G C A T

T A C G
G C A T
genes
Brief Report
Phenotypic Assessment of Pathogenic Variants in GNAO1 and
Response to Caffeine in C. elegans Models of the Disease
Martina Di Rocco 1,2 , Serena Galosi 2 , Francesca C. Follo 1 , Enrico Lanza 3 , Viola Folli 3,4 , Alberto Martire 5 ,
Vincenzo Leuzzi 2 and Simone Martinelli 1, *

1 Department of Oncology and Molecular Medicine, Istituto Superiore di Sanità, 00161 Rome, Italy
2 Department of Human Neuroscience, ‘Sapienza’ University of Rome, 00185 Rome, Italy
3 Center for Life Nano Science, Istituto Italiano di Tecnologia, 00161 Rome, Italy
4 D-tails s.r.l., 00165 Rome, Italy
5 National Center for Drug Research and Evaluation, Istituto Superiore di Sanità, 00161 Rome, Italy
* Correspondence: [email protected]; Tel.: +39-06-49902569

Abstract: De novo mutations affecting the G protein α o subunit (Gαo)-encoding gene (GNAO1) cause
childhood-onset developmental delay, hyperkinetic movement disorders, and epilepsy. Recently, we
established Caenorhabditis elegans as an informative experimental model for deciphering pathogenic
mechanisms associated with GNAO1 defects and identifying new therapies. In this study, we
generated two additional gene-edited strains that harbor pathogenic variants which affect residues
Glu246 and Arg209 —two mutational hotspots in Gαo. In line with previous findings, biallelic changes
displayed a variable hypomorphic effect on Gαo-mediated signaling that led to the excessive release
of neurotransmitters by different classes of neurons, which, in turn, caused hyperactive egg laying and
locomotion. Of note, heterozygous variants showed a cell-specific dominant-negative behavior, which
was strictly dependent on the affected residue. As with previously generated mutants (S47G and
A221D), caffeine was effective in attenuating the hyperkinetic behavior of R209H and E246K animals,
indicating that its efficacy is mutation-independent. Conversely, istradefylline, a selective adenosine
A2A receptor antagonist, was effective in R209H animals but not in E246K worms, suggesting that
Citation: Di Rocco, M.; Galosi, S.; caffeine acts through both adenosine receptor-dependent and receptor-independent mechanisms.
Follo, F.C.; Lanza, E.; Folli, V.; Overall, our findings provide new insights into disease mechanisms and further support the potential
Martire, A.; Leuzzi, V.; Martinelli, S. efficacy of caffeine in controlling dyskinesia associated with pathogenic GNAO1 mutations.
Phenotypic Assessment of
Pathogenic Variants in GNAO1 and Keywords: GNAO1; Gαo; movement disorders; epilepsy; caffeine; Caenorhabditis elegans
Response to Caffeine in C. elegans
Models of the Disease. Genes 2023, 14,
319. https://doi.org/10.3390/
genes14020319 1. Introduction
Academic Editor: Erik C. Andersen GNAO1 encodes the G protein α o subunit (Gαo), which is one of the most abundant
proteins in the mammalian brain whose function is highly conserved throughout evolu-
Received: 20 December 2022
tion [1–3]. Gαo controls inhibitory signaling from several G-protein-coupled receptors
Revised: 13 January 2023
Accepted: 22 January 2023
(GPCRs), which modulates neuronal excitability [4] and controls neurodevelopment [5,6].
Published: 26 January 2023
In striatal medium spiny neurons, Gαo modulates signal flow through dopamine D2 and
adenosine A2A GPCRs and the second messenger cyclic adenosine monophosphate (cAMP)
cascade and has major effects on motor control [7].
GNAO1 pathogenic variants occur de novo in infantile- and childhood-onset neu-
Copyright: © 2023 by the authors. rological disorders. The phenotypic spectrum is highly heterogeneous and ranges from
Licensee MDPI, Basel, Switzerland. early infantile epileptic encephalopathy (EIEE17, MIM #615473) to neurodevelopmental
This article is an open access article disorder with involuntary movements, with or without epileptic seizures (NEDIM, MIM
distributed under the terms and #617493) [8–12]. Susceptibility to a broad range of triggers, including emotions, fever,
conditions of the Creative Commons high external temperature, infections, and intentional movements causes life-threatening
Attribution (CC BY) license (https:// paroxysmal exacerbations and is pathognomonic for GNAO1 encephalopathy and other
creativecommons.org/licenses/by/ postsynaptic disorders caused by mutations in genes with a role in this pathway (i.e.,
4.0/).

Genes 2023, 14, 319. https://doi.org/10.3390/genes14020319 https://www.mdpi.com/journal/genes

Genes 2023, 14, 319 2 of 14

ADCY5, GNB1, HPCA, PDE2A, and PDE10A) [13,14]. Atypical presentations associated
with milder and delayed-onset dystonia have recently been reported [15,16].
Recent data from our study and others suggest that GNAO1 mutations act through a
combination of loss-of-function (LOF) and dominant-negative (DN) mechanisms, depend-
ing on the particular residue involved and the specific amino acid substitution [7,17–19].
However, a comprehensive understanding of the genotype/phenotype correlations and
the underlying pathogenic mechanisms is still lacking, which hinders the discovery of
effective therapies. In the winding path toward the identification of new potential drugs,
simple model organisms can help. Recently, we have shown that caffeine dramatically
improves the aberrant motor function of engineered nematodes that carry mutations in
goa-1, the C. elegans orthologues of GNAO1, by blocking a putative adenosine receptor
(AR) in the worm [18]. In the same year, Larasati and colleagues showed that dietary zinc
supplementation restores both the motor function and the longevity of humanized flies
harboring disease-causing GNAO1 variants [19].
Here, we extended C. elegans studies to two of the most common GNAO1 mutations
associated with hyperkinetic movement disorder (MD), i.e., R209H and E246K. Functional
assessment of monoallelic and biallelic variations revealed a variable LOF behavior of
changes in Gαo-mediated signaling and a cell-specific DN effect, which was limited to
the heterozygous R209H allele. Of note, caffeine was found to ameliorate hyperactive
locomotion of gene-edited animals both in an AR-dependent and AR-independent manner.

2. Materials and Methods

2.1. Generation of Gene-Edited C. elegans Strains
Culture, maintenance, microinjections, and crosses were performed using standard
techniques [20,21]. The Bristol N2 strain (control animals) was provided by the Caenorhabdi-
tis Genetics Center (CGC; University of Minnesota, Minneapolis, MN, USA).
Nucleotide changes to the endogenous goa-1 locus were carried out by CRISPR/Cas9
genome editing as previously described [18] but with minor modifications. Two single
guides (sgRNAs) were assembled with the Cas9 protein to generate multiple ribonucleo-
protein (RNP) complexes targeting codon 209. This strategy has recently been described
to target multiple C. elegans loci [22]. Briefly, twenty N2 animals were injected with a mix
that contained 750 ng/µL Cas9 (IDT, Coralville, Iowa, USA), 700 ng/µL ALT-R CRISPR
tracrRNA, 115 ng/µL dpy-10 crRNA, 37.5 ng/µL ssODN dpy-10, 350 ng/µL goa-1 crRNA
(50 -TACAGATTGTTCGATGTGGG-30 ), 175 ng/µL ssODN goa-1[R209C] (50 -TCTTGATAAAA
AAATAATATTTAATAATGAATATTTACAGATTATTTGACGTTGGTGGACAGAGATCTG
AGTGTAAAAAATGGATTCATTGTTTCGAAGATGTTACTGCTATTAT-30 ), and 175 ng/µL
ssODN goa-1[R209H] (50 -TCTTGATAAAAAAATAATATTTAATAATGAATATTTACAGATTA
TTTGACGTTGGTGGACAGAGATCTGAGCATAAAAAATGGATTCATTGTTTCGAAGATG
TTACTGCTATTAT-30 ). Worms were then recovered on NGM medium at 20 ◦ C. PCR amplifica-
tion was carried out using a single forward primer (50 -TGACGACCTGGAAAGGTTAGG-30 )
and two reverse primers annealing with wild-type (50 -CCACGAGGCATCTGCGTATAT-30 )
or modified (50 -CGTTGGTGGACAGAGATCTG-30 ) sequences to isolate animals harboring
goa-1 c.625_627AGG > TGT (R209C) or c.625_627AGG > CAT (R209H) nucleotide sub-
stitution. Animals were isolated from jackpot plates that corresponded to plates with a
higher percentage of roller and dumpy worms, which was used as a co-injection pheno-
typic marker [23]. Genotype was confirmed by Sanger sequencing. Multiple independent
lines were generated which carried the R209H substation but not the R209C substitution.
Gene-edited lines were out-crossed three times to the N2 strain to remove any potential
off-target mutation and were then used for phenotypic analysis. These lines displayed an
equivalent phenotype and were referred to as goa-1(pan23[R209H]). We failed to identify
gene-edited strains carrying the c.736G > A (E246K) variant (details on this microinjec-
tion are available upon request). The generation of the hT2-balanced strain PHX6121
goa-1(syb5893)/hT2[bli-4(e937)let-?(q782)qIs48] which carried this substitution in a heterozy-
Genes 2023, 14, 319 3 of 14

gous state was outsourced (Fujian SunyBiotech Co., Ltd., Fuzhou, China). From this strain,
we then isolated animals homozygous for index mutation.

2.2. Sensitivity to Aldicarb, Levamisole and PTZ

Sensitivities to aldicarb, levamisole, and PTZ (Sigma-Aldrich, Saint Louis, MO, USA)
were assessed as previously described [24–26]. Young adult hermaphrodites obtained from
synchronized cultures were assayed. Paralysis was confirmed by evaluating the lack of
response to prodding with a platinum wire. Convulsions were measured on agar plates.
Phenotypic analyses were conducted using Leica MZ10F (Leica Microsystems, Wetzlar,
Germany) and Nikon SMZ18 (Nikon Europe, Amstelveen, the Netherlands) stereomicro-
scopes. Data were analyzed as the percentage of animals that were still able to move at
each time point.

2.3. Behavioral Assays

Locomotion parameters were analyzed quantitatively using a recently developed
automated tracking system, which has been previously detailed [18]. Body bends are
defined as a change in the direction of the posterior bulb part of the pharynx along the y
axis when the worm is traveling along the x axis [27]. Reversals are defined as backward
movements equal to at least one-fifth of the animal’s length that correspond to the length of
the pharynx. Short reversals were defined as backward movements equal to at least 1/2 of
the length of the pharynx. Synaptic vesicles release by HSN motor neurons was evaluated
by counting the number of eggs retained in the uterus of adult hermaphrodites in the
exponential phase of laying using an Eclipse Ti2-E microscope (Nikon Europe) which was
equipped with DIC optics on live animals and mounted on 2% agarose pads that contained
10 mM sodium azide as anesthetic. Embryonic and larval lethality, Pvl phenotype, and
brood size were investigated as previously reported [18].

2.4. Response to Caffeine and Istradefylline

Caffeine (Sigma-Aldrich) was freshly dissolved in water and added to agar plates
(5 mM potassium phosphate buffer, pH 6.0, 1 mM CaCl2 , 1 mM MgSO4 ) to a final concen-
tration in the range from 1–10 mM. Plates were freshly prepared and seeded with 12.5 µL
of Escherichia coli OP50 bacteria to get a thin and homogeneous lawn of food. The number
of reversals per minute was counted in L3 animals that moved on the assay plate after
2 h of exposure. Sensitivity to istradefylline (Tocris, Bristol, UK) was assessed after 2 h of
exposition at multiple doses. Istradefylline was freshly dissolved in DMSO. Given that
DMSO alone affects reversal rates in gene-edited animals (0.3% and 0.6% DMSO decrease
the reversal rates of 12% and 30%, respectively) and in control worms (0.3% and 0.6%
DMSO decrease the reversal rates of 35 and 40%, respectively), nematodes were treated in
parallel with the drug or the solvent alone at the corresponding dose. The percentage of
rescue is defined as [1 − (∆1/∆2)*100], where ∆1 and ∆2 are the difference between the
reversals measured in the presence and absence of the drug and the reversals of control
worms exposed to the solvent, respectively. Therefore, the percentage of rescue was 0%
when the reversal rate remained the same before and after drug exposition and 100% when
the reversal rate resembled that of control animals after exposure to the drug.

2.5. Statistics
Statistical differences were calculated using GraphPad Prism 8.4.2 software. Speed dis-
tributions were evaluated by a two-sample t-test using MATLAB software version R2022a
(Mathworks, Natick, Massachusetts). Genotype blinding was used for all experiments,
except for the data reported in Figure 1.
Genes 2023, 14, 319 4 of 14

3. Results
3.1. Generation of Gene-Edited C. elegans Strains
Human Gαo and C. elegans GOA-1 display 90% homology in their amino acid se-
quence, and the vast majority of affected residues, including the mutational hotspots Arg209
and Glu246 , were conserved between the two species [17,18]. Initially, we aimed to intro-
duce c.625_627AGG > TGT (p.R209C), c.625_627AGG > CAT (p.R209H), and c.736G > A
(p.E246K) nucleotide substitutions at the orthologous location of the C. elegans gene by
CRISPR/Cas9 genome editing. Due to the high efficiency of this technology in the worm,
we used a multiplexed strategy by simultaneously expressing two sgRNAs to generate
animals that carried both mutations at codon 209 in a single microinjection (Figure S1).
However, while we obtained several independently edited animals, which harbored the
R209H substitution, during multiple rounds of injections, we were unable to identify worms
that carried the R209C change in either a homozygous or heterozygous state. Similarly,
in independent sets of injections, we failed to identify modified animals that carried the
glutamic acid-to-lysine amino acid substitution at codon 246. Given Gαo’s role in control-
ling mitotic spindle alignment during early embryogenesis [28,29] and regulating meiotic
maturation of the germline [30], these results suggest a detrimental effect of specific goa-1
mutations on embryonic survival and/or gametogenesis. Recent data by Wang and col-
leagues seem to confirm this hypothesis. In fact, although they succeeded in generating and
characterizing R209C-edited animals [17], it was not possible to keep this strain in culture
for a long time or freeze it due to the extremely low number of laid eggs [31]. A similar
progeny issue was observed in worms homozygous for the G203R substitution. Based on
these findings, we decided to focus our work on the arginine-to-histidine change at codon
209 and outsource the generation of an hT2-balanced strain that carried the c.736G > A
(p.E246K) variant in heterozygosity (Fujian SunyBiotech Co., Ltd., Fuzhou, China). From
this strain, we then isolated animals homozygous for the aforementioned mutation.
In sum, we generated goa-1(pan23[R209H]) animals (hereafter goa-1[R209H]) and
derived homozygous E246K-edited worms from the balanced PHX6121 goa-1(syb5893)/hT2[bli-
4(e937)let-?(q782)qIs48] strain (hereafter goa-1[E246K]). Like goa-1(sa734) null mutants [18,30,32]
and previously generated knock-in animals [18], the nematodes, homozygous for the antici-
pated changes, displayed slow growth and variable percentages of nonspecific phenotypes,
including protruding vulva (Pvl), larval and embryonic lethality, and reduced offspring
(Table 1).

Table 1. Biallelic goa-1 mutations exhibit a variable degree of developmental phenotypes.

Embryonic Lethality Larval Arrest Brood Size Pvl Phenotype

Genotype
(%) (%) (% of Controls) (%)
goa-1[WT] 0.5 1 0 - 1
goa-1[R209H] 5 (p < 0.01) 2 5 (p < 0.01) 80 (p < 0.01) 10 (p < 0.01)
goa-1[E246K] 21 (p < 0.001) 40 (p < 0.001) 18 (p < 0.001) 50 (p < 0.001)
1 Twenty hermaphrodites per genotype were assayed to evaluate the brood size. More than 200 animals per geno-
type were tested in all other assays. 2 p-values are calculated using two-way ANOVA with Bonferroni correction.

3.2. Biallelic GNAO1 Mutations Result in Loss of Gαo Function in C. elegans

A well-conserved function of Gαo and well-established behavioral phenotypes justi-
fied assessing the impact of GNAO1 mutations in the worm. In C. elegans, Gαo signaling
inhibits the synaptic vesicles release machinery in HSN and ventral cord motor neurons and
controls egg laying and locomotion, respectively [33]. Consistently, Gαo null mutants dis-
play hyperactive egg laying and locomotion and show hypersensitivity to aldicarb, which
is an acetylcholinesterase inhibitor that causes accumulation of acetylcholine (ACh) in the
synaptic cleft of the neuromuscular junction (NMJ); in turn, this results in sustained muscle
contraction and paralysis [33–35]. Previous studies established that gene-edited worms
that harbor biallelic goa-1 variants phenocopy the behavior of goa-1(n363) or goa-1(sa734)
null mutants, which displays increased egg laying and locomotion and hypersensitivity to
 and controls egg laying and locomotion, respectively [33]. Consistently, Gαo null mutants
display hyperactive egg laying and locomotion and show hypersensitivity to aldicarb,
which is an acetylcholinesterase inhibitor that causes accumulation of acetylcholine (ACh)
in the synaptic cleft of the neuromuscular junction (NMJ); in turn, this results in sustained
muscle contraction and paralysis [33–35]. Previous studies established that gene-edited
Genes 2023, 14, 319 5 of 14
worms that harbor biallelic goa-1 variants phenocopy the behavior of goa-1(n363) or goa-
1(sa734) null mutants, which displays increased egg laying and locomotion and hypersen-
sitivity to aldicarb-induced paralysis, suggesting augmented releases of neurotransmit-
aldicarb-induced
ters by paralysis,
both HSN and ventral cordsuggesting augmented
motor neurons releases of neurotransmitters by both
[17,18].
HSN and ventral cord motor neurons [17,18].
In this study, we show that homozygous R209H and E246K mutations affected the
number ofIneggsthis study, weinshow
retained that homozygous
the uterus R209H and E246K
of adult hermaphrodites during mutations affected the
the exponential
number of eggs retained in the uterus of adult hermaphrodites during
phase of laying, with an average of 15 in the control worms to an average of 4 and 2.5 in the exponential
phase of laying,
goa-1[R209H] with an average
and goa-1[E246K] animals,of 15 in the control
respectively worms
(Figure 1). to an average
These of 4 and
data suggest an2.5 in
goa-1[R209H] goa-1[E246K]
excessive release of serotonin and other neurotransmitters by HSNs, which is likely due an
and animals, respectively (Figure 1). These data suggest
excessive
to a lack release of serotonin
of Gαo-mediated inhibitionandinother neurotransmitters
this pair by HSNs, which is likely due to
of motor neurons.
a lack of Gαo-mediated inhibition in this pair of motor neurons.

Figure
Figure 1. goa-1[R209H]
1. goa-1[R209H] and and goa-1[E246K]
goa-1[E246K] animals
animals show
show increased
increased egg
egg layingactivity.
laying activity.(A)
(A)Repre-
Representa-
tive images of mid-body
sentative mid-body regions
regionsofofcontrol
controlanimals
animals(upper
(upperpanel) and
panel) andgoa-1 mutants
goa-1 mutants (lower panels).
(lower
Retained eggs are visible as oval objects inside the body of adult hermaphrodites. Wild-type worms
displayed 15 unlaid eggs on average, while Gαo mutants retained only a few eggs in their uterus.
Magnification is constant in all images. (B) The egg laying activity is quantified as the number of
eggs present in the uterus (* p < 0.05 and *** p < 0.0001; one-way ANOVA with Bonferroni correction).
Twenty animals for each genotype were tested. Data represent means ± SEM of multiple observations.
Data collected in our previous study [18] are included in panel B for comparison (gray bars). sa734 is
a null allele of goa-1 [30,32].
 type worms displayed 15 unlaid eggs on average, while Gαo mutants retained only a few eggs in
their uterus. Magnification is constant in all images. (B) The egg laying activity is quantified as the
number of eggs present in the uterus (* p < 0.05 and *** p < 0.0001; one-way ANOVA with Bonferroni
correction). Twenty animals for each genotype were tested. Data represent means ± SEM of multiple
observations. Data collected in our previous study [18] are included in panel B for comparison (gray
Genes 2023, 14, 319 6 of 14
bars). sa734 is a null allele of goa-1 [30,32].

Similarly, goa-1[R209H] and goa-1[E246K] mutants phenocopied the hyperkinetic

Similarly,
motor behavior goa-1[R209H]
of previouslyand goa-1[E246K]
generated mutants
knock-in animals phenocopied the hyperkinetic
[17,18] and goa-1 LOF mutants
motor behaviorInofparticular,
[17,18,33–35]. previouslybygenerated knock-in animals
using an automated tracking[17,18]
platform andtogoa-1
recordLOF mu-
multiple
tants [17,18,33–35].
locomotor parameters,In particular,
we were ableby to
using an automated
demonstrate tracking platform
that goa-1[R209H] to record
and goa-1[E246K]
multiple
animalslocomotor parameters,spontaneous
showed hyperactive we were able to demonstrate
crawling goa-1[R209H]
that moved
(Figure 2A), and goa-
faster than con-
1[E246K]
trol animals (Figure 2B) with more frequent body bends (Figure 2C), and displayedfaster
animals showed hyperactive spontaneous crawling (Figure 2A), moved unco-
than controllocomotion,
ordinated animals (Figure 2B) with
assuming more shape
a coil-like frequent
when body
theybends (Figureto2C),
attempted move and dis-
(Figure
played uncoordinated
2D). Moreover, locomotion,
goa-1-edited worms assuming
exhibiteda coil-like shapefrequency
an increased when they of attempted to
reversals (i.e.,
move (Figure 2D).
spontaneous Moreover,
backward goa-1-edited
locomotion) worms
(Figure exhibited
2E), likely due toanthe increased
augmentedfrequency
releaseofof
reversals
glutamate (i.e.,onto
spontaneous
AVA, whichbackward locomotion)
is the main (Figure
interneuron that2E), likely this
controls due repetitive
to the augmented
behavior
release
[36]. of glutamate onto AVA, which is the main interneuron that controls this repetitive
behavior [36].

Figure2.2.goa-1[R209H]
Figure goa-1[R209H] and goa-1[E246K]
and goa-1[E246K]animals
animalsexhibit aberrant
exhibit motor
aberrant behavior.
motor (A) Trajectories
behavior. (A) Trajecto-
ofries
15 of 15 worms
worms on agar
on agar plates
plates recorded
recorded for 2forminutes.
2 minutes. Different
Different colors
colors refer
refer totodifferent
differentanimals.
animals.
The gene-edited mutants showed abnormal crawling and longer (goa-1[R209H])
The gene-edited mutants showed abnormal crawling and longer (goa-1[R209H]) or irregular (goa- or irregular (goa-
1[E246K]) tracks compared with the controls. (B) goa-1[R209H] crawled faster than wild-type
1[E246K]) tracks compared with the controls. (B) goa-1[R209H] crawled faster than wild-type animals ani-
(*** p < 0.0001; one-way ANOVA with Bonferroni correction). The aberrant motor behavior of bothof
mals (*** p < 0.0001; one-way ANOVA with Bonferroni correction). The aberrant motor behavior
mutants was also revealed by the number of body bends per minute (C), the time spent in a coiled
position (D), and the reversal rate (E) (* p < 0.05 and *** p < 0.0001). Twenty animals were tested for
each genotype. Data represent means ± SEM of multiple observations. Data collected in our previous
study [18] are included in panels B–E for comparison (gray bars). sa734 is a null allele of goa-1 [30,32].

C. elegans locomotion is regulated by GPCR-GOA-1-mediated signaling, which nega-

tively controls presynaptic ACh release by ventral cord motor neurons [37,38]. Pharmaco-
logical treatment with aldicarb represents a fast and reliable strategy to determine whether
 our previous study [18] are included in panels B–E for comparison (gray bars). sa734 is a null allele
of goa-1 [30,32].

C. elegans locomotion is regulated by GPCR-GOA-1-mediated signaling, which neg-

Genes 2023, 14, 319 atively controls presynaptic ACh release by ventral cord motor neurons [37,38]. 7Pharma- of 14
cological treatment with aldicarb represents a fast and reliable strategy to determine
whether synaptic transmission at the NMJ is altered [24]. As anticipated, goa-1 null mu-
tants and previously generated CRISPR-edited worms which harbored GNAO1 mutations
synaptic transmission at the NMJ is altered [24]. As anticipated, goa-1 null mutants and
showed
previously hypersensitivity to aldicarb-induced
generated CRISPR-edited worms which paralysis because
harbored GNAO1of augmented
mutations ACh
showedrelease
and
hypersensitivity to aldicarb-induced paralysis because of augmented ACh release and and
its faster accumulation in the synaptic cleft [17,18]. Consistently, goa-1[R209H]
goa-1[E246K] animals exhibited
its faster accumulation variable
in the synaptic hypersensitivity
cleft to this drug
[17,18]. Consistently, (Figure 3A),
goa-1[R209H] andbutgoa-nor-
mal sensitivity
1[E246K] animalstoexhibited
levamisole (Figure
variable S2), which is atonicotinic
hypersensitivity this drugreceptor
(Figure agonist
3A), butthat acts on
normal
postsynaptic
sensitivity to muscles,
levamisolehighlighting
(Figure S2), the presynaptic
which origin
is a nicotinic of the agonist
receptor cholinergic defect.
that acts on We
then assessedmuscles,
postsynaptic GABAergic signalingthe
highlighting at inhibitory
presynapticmotororiginneurons by evaluating
of the cholinergic sensitivity
defect. We
then
to assessed GABAergic
pentylenetetrazole signaling
(PTZ), which at is
inhibitory motor neurons
a competitive inhibitorbyofevaluating
GABA-Asensitivity
receptors on
to pentylenetetrazole
body-wall (PTZ), which
muscles. Exposure is adrug
to this competitive
resultedinhibitor of GABA-A
in a convulsive receptors[25].
phenotype on Of
note, knock-in animals showed PTZ hypersensitivity (Figure 3B), indicating a shiftOf
body-wall muscles. Exposure to this drug resulted in a convulsive phenotype [25]. in the
note, knock-in
equilibrium animalsexcitatory
between showed PTZ andhypersensitivity
inhibitory inputs (Figure 3B), the
towards indicating
former aatshift
the in
C. the
elegans
equilibrium
NMJ. between severe
A particularly excitatory and inhibitory
phenotype inputs towards
was observed at the C. elegans
the formermutants.
in goa-1[E246K]
NMJ. A particularly severe phenotype was observed in goa-1[E246K] mutants.

3. goa-1[R209H]
Figure 3.
Figure goa-1[R209H] and goa-1[E246K]
and goa-1[E246K] animals display
animals increased
display ACh release
increased ACh at the NMJ.
release (A)NMJ.
at the Gαo (A)
mutants
Gαo showed
mutants hypersensitivity
showed to aldicarb
hypersensitivity (1 mM)
to aldicarb compared
(1 mM) comparedwith with
control animals
control (p < 0.005
animals (p < 0.005
for goa-1[R209H]
goa-1[R209H]andandpp<<0.0001 forgoa-1[E246K];
0.0001for goa-1[E246K]; log-rank
log-ranktest), suggesting
test), suggestingincreased AChACh
increased release
release
at the C.
C. elegans
elegansNMJ.
NMJ.Twenty
Twentyanimals
animals forfor each
each genotype
genotype were
were tested.
tested. (B) (B)
GαoGαo mutants
mutants showed
showed
hypersensitivity to PTZ (5 mg/mL on agar plates; 15 min of exposition), likely indicating an excess of
stimulatory signal over inhibitory signal at the NMJ (*** p < 0.0001; Fisher’s exact test with Bonferroni
correction). In both assays, goa-1[E246K] animals displayed a much more severe phenotype than
goa-1[R209H] worms (p < 0.0001). Twenty animals for each genotype were tested. Data represent
means ± SEM of three independent experiments. Data collected in our previous study [18] are
included for comparison (gray bars). Sa734 is a null allele of goa-1 [30,32].
Genes 2023, 14, x FOR PEER REVIEW 8 of 14

hypersensitivity to PTZ (5 mg/mL on agar plates; 15 min of exposition), likely indicating an excess
Genes 2023, 14, 319 of stimulatory signal over inhibitory signal at the NMJ (*** p < 0.0001; Fisher’s exact test with8Bon-
of 14
ferroni correction). In both assays, goa-1[E246K] animals displayed a much more severe phenotype
than goa-1[R209H] worms (p < 0.0001). Twenty animals for each genotype were tested. Data repre-
sent means ± SEM
Overall, of findings
these three independent experiments.
further support Data collected
the notion in our previous
that pathogenic GNAO1 study [18] are
mutations
included for comparison (gray bars). Sa734 is a null allele of goa-1 [30,32].
result in the loss of Gαo function when tested in C. elegans as homozygous alleles.
Overall, these
3.3. Heterozygous findings
GNAO1 further support
Mutations Display athe notion that
Cell-Specific DNpathogenic
Behavior inGNAO1 mutations
C. elegans Neurons
result in the loss of Gαo function when tested in C. elegans as homozygous alleles.
Recent data indicate that GNAO1 haploinsufficiency causes mild dystonic features
associated with an age of onset in adulthood/adolescence and only minor neurological
3.3. Heterozygous GNAO1 Mutations Display a Cell-Specific DN Behavior in C. elegans
comorbidities [15,16]. This finding indicates that haploinsufficiency is not sufficient to
Neurons
cause the archetypal EIEE17 or NEDIM phenotypes, suggesting a more complex behavior
Recent
for the mutantdata indicate
alleles that GNAO1
underlying haploinsufficiency
these conditions. causes
Consistently, mild dystonic
multiple features
lines of evidence
associated with an age of onset in adulthood/adolescence and
indicated that pathogenic GNAO1 mutations variably act dominantly by interfering with only minor neurological
comorbidities
the function of[15,16].
wild-type ThisGαo finding indicates that haploinsufficiency is not sufficient to
[7,17,18].
causeInthe archetypal
this study, weEIEE17
analyzed or NEDIM phenotypes,
the functional suggesting
consequences a more complex
of heterozygous goa-1behavior
variants
for the F1
in the mutant alleles
progeny underlying
generated by these
genetic conditions. Consistently,
crosses between multiple lines
hermaphrodites of harbored
that evidence
indicated that pathogenic
biallelic mutations and males GNAO1 mutations
that carried the variably
wild-type act dominantly
goa-1 by interfering
allele. Wang with
and colleagues
the function of wild-type Gαo [7,17,18].
have recently demonstrated that goa-1(+/−) animals behave as control worms in the
In this
aldicarb study,
assay and weshow analyzed
normalthe functional
sensitivity consequences
to this of heterozygous
drug [17]. Conversely, goa-1 vari-
goa-1(+/R209H)
ants in thea F1
displayed progeny generated
hypersensitive responseby genetic crosses between
to aldicarb-induced paralysis,hermaphrodites
which was similar thattohar-
that
bored
observed biallelic
in themutations
homozygous and goa-1[R209H]
males that carriedanimals the(Figure
wild-type
4A).goa-1 allele.goa-1(+/R209H)
Similarly, Wang and col-
leagues
nematodes have recentlyan
exhibited demonstrated
increased reversal that goa-1(+/-)
rate, which animals behave
resembled the as control worms
phenotype observed in
the
in thealdicarb assay strain
homozygous and show (Figurenormal
4B). Insensitivity
contrast, the to hyperactive
this drug [17]. Conversely,
egg laying goa-
phenotype
of goa-1[R209H]
1(+/R209H) nematodes
displayed was partially
a hypersensitive restored
response by the presence of
to aldicarb-induced a singlewhich
paralysis, wild-type
was
goa-1 allele
similar (Figure
to that observed4C).inFinally, no relevant
the homozygous defects were
goa-1[R209H] observed
animals in goa-1(+/E246K)
(Figure 4A). Similarly,
heterozygous animals,
goa-1(+/R209H) nematodes at least for thean
exhibited analyzed
increased phenotypes.
reversal rate, which resembled the phe-
notype Taken together,
observed these
in the findings suggest
homozygous strain that R209H
(Figure 4B). acts as a DNthe
In contrast, allele in cholinergic
hyperactive egg
ventralphenotype
laying cord motorofneurons
goa-1[R209H]mediating aldicarb
nematodes was sensitivity
partially and locomotion
restored and likely
by the presence ofin
a
glutamatergic AVA interneurons controlling the reversal rate, but not in
single wild-type goa-1 allele (Figure 4C). Finally, no relevant defects were observed in goa- serotoninergic HSN
motor neurons,
1(+/E246K) which regulate
heterozygous animals, eggat laying.
least forOur data further
the analyzed demonstrate a cell-specific
phenotypes.
effect of individual GNAO1 pathological changes in C. elegans.

Figure 4. Cont.
Genes 2023, 14, x FOR PEER REVIEW 9 of 14
Genes 2023, 14, 319 9 of 14

Figure 4. The monoallelic goa-1(+/R209H) allele displays a cell-specific dominant-negative behavior

Figure 4. The monoallelic goa-1(+/R209H) allele displays a cell-specific dominant-negative be-
in C. elegans
havior in C. neurons. The sensitivity
elegans neurons. to aldicarbto(A),
The sensitivity the reversal
aldicarb (A), therate (B), and
reversal the(B),
rate number
and the of retained
number
eggs (C) were assessed in worms carrying the goa-1 mutations in a heterozygous state.
of retained eggs (C) were assessed in worms carrying the goa-1 mutations in a heterozygous state. goa-1(+/R209H)
animals displayed
goa-1(+/R209H) hypersensitivity
animals to aldicarb-induced
displayed hypersensitivity paralysis (p < paralysis
to aldicarb-induced 0.005; log-rank test)log-rank
(p < 0.005; and an
increased
test) and anreversal
increased (* p < 0.05
ratereversal and
rate <p
(* p*** < 0.0001;
0.05 and ***pone-way ANOVA
< 0.0001; one-way with Bonferroni
ANOVA with correction),
Bonferroni
correction),
whose severitywhosewasseverity was undistinguishable
undistinguishable compared compared
with that of with that ofcarrying
animals animalsthe carrying
mutation the mu-
in a
tation in a homozygous state. These data suggest a DN behavior of the R209H
homozygous state. These data suggest a DN behavior of the R209H variant in ventral cord motor variant in ventral
cord motor
neurons andneurons
possiblyandin possibly in AVAbut
AVA neurons, neurons,
not in but
HSNnot in HSN
motor motor(egg
neurons neurons
laying(egg layingwas
activity ac-
tivity was not significantly affected in heterozygous worms) (C). No relevant phenotypes were ob-
not significantly affected in heterozygous worms) (C). No relevant phenotypes were observed in
served in the hT2-balanced goa-1(+/E246K) mutants (PHX6121 strain). Twenty animals for each gen-
the hT2-balanced goa-1(+/E246K) mutants (PHX6121 strain). Twenty animals for each genotype
otype were tested. Data represent means ± SEM of multiple experiments that were carried out using
were unrelated
three tested. Data represent
clones means
generated ± SEMgenetic
following of multiple
crossesexperiments that were
to control animals. Datacarried out in
collected using
our
three unrelated
previous clones
study [18] aregenerated
included infollowing
panels Bgenetic
and C crosses to control
for comparison animals.
(gray bars).Data
sa734collected
is a nullin our
allele
previous
of study [18]
goa-1 [30,32]. are included
The behavior in panels B and
of goa-1(+/sa734), C for comparison
goa-1(+/S47G), (gray bars). sa734
and goa-1(+/A221D) is a null allele
heterozygous an-
of goa-1
imals [30,32].
is also shownThe(panels
behavior of goa-1(+/sa734), goa-1(+/S47G), and goa-1(+/A221D) heterozygous
B,C).
animals is also shown (panels B,C).
Taken together, these findings suggest that R209H acts as a DN allele in cholinergic
3.4. Response to Caffeine
ventral cord motor and Istradefylline
neurons mediating aldicarb sensitivity and locomotion and likely in
Recently, AVA
glutamatergic we have shown that
interneurons caffeine significantly
controlling improves
the reversal rate, theinaberrant
but not motor
serotoninergic
function of gene-edited worms harboring two pathogenic GNAO1 mutations—S47G
HSN motor neurons, which regulate egg laying. Our data further demonstrate a cell-spe- and
A221D
cific [18].
effect Such a benefic
of individual GNAO1effect was mimicked
pathological by istradefylline,
changes in C. elegans. which is a selective
adenosine A2A receptor (A2A R) antagonist that is currently used in the treatment of Parkin-
son’s
3.4. diseaseto(PD)
Response [39], and
Caffeine andIstradefylline
by other AR antagonists, indicating that caffeine acts, at least
in part, by blocking a putative AR in the nematode [18].
Recently, we have shown that caffeine significantly improves the aberrant motor
In this study, two hours of exposure of goa-1[R209H] and goa-1[E246K] animals to caf-
function of gene-edited worms harboring two pathogenic GNAO1 mutations—S47G and
feine restored hyperactive locomotion in terms of the number of short reversals per minute
A221D [18]. Such a benefic effect was mimicked by istradefylline, which is a selective
in a dose-dependent manner (Figure 5A). Interestingly, istradefylline was able to rescue
 adenosine A2A receptor (A2AR) antagonist that is currently used in the treatment of Par-
kinson’s disease (PD) [39], and by other AR antagonists, indicating that caffeine acts, at
least in part, by blocking a putative AR in the nematode [18].
In this study, two hours of exposure of goa-1[R209H] and goa-1[E246K] animals to
Genes 2023, 14, 319 10 of 14
caffeine restored hyperactive locomotion in terms of the number of short reversals per
minute in a dose-dependent manner (Figure 5A). Interestingly, istradefylline was able to
rescue the reversal rate of goa-1[R209H] worms but not goa-1[E246K] worms (Figure 5B
the Figure
and reversalS3),
rate of goa-1[R209H]
suggesting worms
that caffeine acts not goa-1[E246K]
butthrough worms
AR-dependent and(Figures 5B and S3),
AR-independent
suggesting that
mechanisms. Thecaffeine
reversalacts
ratethrough
was not AR-dependent and AR-independent
significantly affected mechanisms.
in control animals that were
The reversal rate was not
exposed to these molecules. significantly affected in control animals that were exposed to
these molecules.

Caffeineand
Figure5.5.Caffeine
Figure andistradefylline
istradefyllinevariably
variablyimprove
improvethe theaberrant
aberrantlocomotor
locomotorbehavior goa-1
behaviorofofgoa-1
mutants.
mutants.(A) (A)Two
Twohours
hoursof ofexposure
exposuretotocaffeine
caffeineameliorated
amelioratedthe thehyperactive
hyperactivelocomotion
locomotionofofknock-
knock-
in
inanimals
animalsininterms
termsof of
thethe
number of short
number reversals
of short per minute
reversals in a dose-dependent
per minute manner
in a dose-dependent (*** p
manner
<(***
0.0001; one-way ANOVA with Bonferroni correction). (B) Exposure to istradefylline
p < 0.0001; one-way ANOVA with Bonferroni correction). (B) Exposure to istradefylline (2 (2 h) de-h)
creased the reversal rate of goa-1[R209H] worms (* p < 0.05 and *** p < 0.0001) but not goa-1[E246K]
decreased the reversal rate of goa-1[R209H] worms (* p < 0.05 and *** p < 0.0001) but not goa-1[E246K]
animals, suggesting that caffeine also acts through an AR-independent mechanism. Results are also
animals, suggesting that caffeine also acts through an AR-independent mechanism. Results are also
provided as the percentage of rescue (see Materials and Methods for details). Twenty animals for
provided as the percentage of rescue (see Materials and Methods for details). Twenty animals for
each genotype were tested. Data represent the means ± SEM of multiple observations.
each genotype were tested. Data represent the means ± SEM of multiple observations.
4.4.Discussion
Discussion
We
We report
report on
on the
the functional
functionalimpact
impactof oftwo
twoofofthe
themost
mostrecurrent
recurrent GNAO1
GNAO1mutations
mutations
associated
associatedwith
withhyperkinetic
hyperkineticMD.MD.Like
Likepreviously
previouslytested
testedvariants,
variants,when
whenintroduced
introducedin inthe
the
C. elegans genome as homozygous alleles, these changes result in a loss of Gαo
C. elegans genome as homozygous alleles, these changes result in a loss of Gαo function function in
multiple types of neurons, causing hyperactive locomotion and egg laying.
in multiple types of neurons, causing hyperactive locomotion and egg laying. Phenotypic Phenotypic
profiling
profiling ofof heterozygous
heterozygousvariants
variantssuggests
suggestscellcell context-specific
context-specific DN behavior
DN behavior of the of the
R209H
but not the E246K allele. Finally, we further confirm the beneficial effect of caffeine in
restoring normal locomotion in gene-edited worms and establish that this molecule may
act through AR-dependent and AR-independent mechanisms.
GNAO1 encephalopathy is characterized by a clinical phenotype combining distinctive
motor, epileptic, and neurodevelopmental features [8–12]. While two different nosological
entities are reported in OMIM (EIEE17 and NEDIM), a significant overlap in disease
Genes 2023, 14, 319 11 of 14

manifestations across patients carrying different variants best captures what is observed
in clinical practice, with a small number of affected individuals presenting with isolated
MD or epilepsy [12,13]. However, genotype-phenotype correlations have been reported
as some variants have been consistently associated with MD, others with early onset
epilepsy, and still others with severe MD with life-threatening exacerbations [12–14]. In
addition, a subset of missense changes and LOF mutations that are predicted to result
in GNAO1 haploinsufficiency have recently been associated with milder and delayed-
onset dystonia [15,16]. Based on this evidence, understanding the mechanisms by which
individual mutations affect downstream signaling pathways is crucial for developing
targeted therapies to treat this disorder effectively.
In this scenario, simple model organisms represent a powerful tool of investigation.
In a humanized Drosophila model of GNAO1 encephalopathy, heterozygous flies carrying
the G203R variant recapitulated some of the clinical features of the disease, manifesting
motor dysfunction, reduced life span, and brain abnormalities [19,40]. Remarkably, these
phenotypes were improved by dietary zinc supplementation [19]. In C. elegans, the genera-
tion of genetically modified strains established that biallelic goa-1 variants (G42R, S47G,
G203R, R209C, R209H, A221D, and E246K) show a clear LOF effect on Gαo-mediated
signaling [17,18], but they affect diverse biological processes differently. For instance, only
G203R, R209C, and E246K strongly affected developmental programs and the meiotic
maturation of germ cells. Moreover, although E246K had no DN activity in our assays,
goa-1[E246K] animals showed extreme severity of certain phenotypes (uncoordinated loco-
motion and PTZ-hypersensitivity), which were more severe than those of worms which
lacked goa-1. Finally, goa-1[R209H] animals were very fast but less sensitive to aldicarb than
other mutants, with only a slightly increased reversal rate. These differences likely reflect
the unique impact of individual mutations on cellular and clinical phenotypes.
When assessed as monoallelic variants, some GNAO1 mutations (G42R, R209C, R209H,
A221D) functioned as DN alleles in nematodes, while others did not, at least in the exper-
iments performed. Intriguingly, the A221D substitution had DN activity in HSN motor
neurons, but not in ventral cord motor neurons. Similarly, the R209H allele acted domi-
nantly in cholinergic neurons controlling locomotion and possibly in AVA interneurons
but not in HSNs. These results suggest a neuron type-specific DN behavior of individual
GNAO1 alleles in C. elegans, which is in line with recent data obtained in neuronal cul-
tures [7]. Specifically, these studies revealed that R209C and G203R mutations affected
dopamine signaling in medium spiny neurons expressing D2 receptors (iMSNs), but only
G203R increased dopamine response in MSNs expressing D1 receptors (dMSNs). Similarly,
both changes impaired adenosine signaling in dMSNs, but only G203R improved the
strength of adenosine responses in iMSNs. Overall, these findings suggest that GNAO1
may affect motor control in a mutation-dependent manner.
Caffeine was shown to ameliorate the hyperactive MD of genetically modified worms
carrying the p.S47G and p.A221D goa-1 variants by antagonizing a putative AR [18]. In this
study, we confirmed the beneficial effect of this molecule in goa-1[R209H] and goa-1[E246K]
animals. Of note, the selective A2A R antagonist istradefylline effectively improved the
reversal rate of goa-1[R209H] but not goa-1[E246K] worms. Such a discrepancy could be
explained by the well-known propensity of caffeine to act through both AR-dependent
and AR-independent mechanisms. In this regard, caffeine is also a nonspecific phosphodi-
esterase (PDE) blocker [41,42], while istradefylline does not induce the inhibition of canine
PDE I-V enzymes [43]. In line with this finding, caffeine could be effective on phenotypes
resulting from mutations that involve both increased and decreased cAMP levels, which
block ARs or PDE, respectively; in contrast, istradefylline should reasonably act only when
cAMP abnormally increases. The effect of Gαo mutations on intracellular cAMP levels
has not yet been systematically characterized. Recent data from Larasati et al. revealed an
increased association between Gαo-E246K and Gβγ subunits [19]. Since the release of Gβγ
from the heterotrimeric complex is required to positively modulate the responsiveness of
the cAMP-producing enzyme adenylyl cyclase 5 (AC5) [7], which is the main AC isoform
Genes 2023, 14, 319 12 of 14

in the striatum [44], we might expect decreased cAMP levels in goa-1[E246K] animals,
which could explain the lack of response to istradefylline. The amplified inhibition of
cAMP synthesis observed in HEK 293T cells overexpressing the E246K but not the R209H
variant [45] appears to support this model. However, further studies are needed to assess
the consequences of individual GNAO1 variants on Gβγ signaling.
The therapeutic potential of caffeine has already been established in PD and other
MDs. It is worth noting that an ongoing clinical trial (ClinicalTrials.gov; id.: NCT04469283)
is evaluating the effects of caffeine in subjects with mutations in ADCY5, which is the
gene coding for AC5 [46], and a retrospective study regarding the efficacy of caffeine in
ADCY5-related dyskinesia has recently been published [47]. Despite limitations related
to the rarity of the condition and the nonrandomized design, this study, which included
30 patients with ADCY5-related dyskinesia, showed that caffeine is well tolerated in
children, and 27 patients reported a clear reduction in motor symptoms and a consistent
improvement in their quality of life. As for the three patients who reported a worsening
quality of life, the impact of the identified variants on the modulation of cAMP levels has
not been investigated. We can only speculate that ADCY5 mutations with a LOF effect
may be responsible for a cAMP reduction in nonresponding cases, while, conversely, GOF
mutations could result in increased cAMP levels in responding patients. On this basis, a
clear assessment of the direction of the alteration of cAMP (increase vs. decrease) resulting
from different GNAO1 mutations is crucial for establishing inclusion and exclusion criteria
in clinical trials with caffeine in GNAO1-related dyskinesia.
In sum, our findings further confirm that C. elegans is a valid in vivo model for un-
derstanding the molecular and cellular mechanisms underlying GNAO1 encephalopathy.
The generated strains represent an efficient platform to functionally classify the increasing
number of GNAO1 variants and perform broader pharmacological screens.

Supplementary Materials: The following supporting information can be downloaded at: https://
www.mdpi.com/article/10.3390/genes14020319/s1, Figure S1: Gene editing strategy at codon 209
and Sanger sequencing validation; Figure S2: Mutant animals show normal sensitivity to levamisole;
Figure S3: Istradefylline is not effective in goa-1 [E246K] animals.
Author Contributions: Conceptualization, S.M. and V.L.; methodology, M.D.R. and E.L.; software,
V.F. and E.L.; validation, M.D.R., S.G., and E.L.; formal analysis, M.D.R. and S.M.; investigation,
M.D.R. and F.C.F.; writing—original draft preparation, S.M.; writing—review and editing, A.M., S.G.,
and V.L.; funding acquisition, S.M. All authors have read and agreed to the published version of
the manuscript.
Funding: This research was funded by Istituto Superiore Di Sanità, Ricerca Indipendente 2020-
2022_ISS20-0ab01a06bd2a and secured by S.M. M.D.R. is a recipient of a research fellowship from the
Associazione Famiglie GNAO1 APS.
Institutional Review Board Statement: Not applicable.
Informed Consent Statement: Not applicable.
Data Availability Statement: Not applicable.
Acknowledgments: We are grateful to S. Venanzi (Istituto Superiore di Sanità, Rome) for technical
assistance. We thank SunyBiotech for the generation of the PHX6121 strain. The N2 strain was
provided by the Caenorhabditis Genetics Center (CGC), which is funded by NIH Office of Research
Infrastructure Programs (P40 OD010440). We also thank WormBase.
Conflicts of Interest: The authors declare no conflict of interest. The funders had no role in the design
of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or
in the decision to publish the results.
Genes 2023, 14, 319 13 of 14

References
1. Sternweis, P.C.; Robishaw, J.D. Isolation of two proteins with high affinity for guanine nucleotides from membranes of bovine
brain. J. Biol. Chem. 1984, 259, 13806–13813. [CrossRef] [PubMed]
2. Wolfgang, W.J.; Quan, F.; Goldsmith, P.; Unson, C.; Spiegel, A.; Forte, M. Immunolocalization of G protein alpha-subunits in the
Drosophila CNS. J. Neurosci. 1990, 10, 1014–1024. [CrossRef] [PubMed]
3. Strittmatter, S.M.; Valenzuela, D.; Kennedy, T.E.; Neer, E.J.; Fishman, M.C. G0 is a major growth cone protein subject to regulation
by GAP-43. Nature 1990, 344, 836–841. [CrossRef] [PubMed]
4. Wettschureck, N.; Offermanns, S. Mammalian G proteins and their cell type specific functions. Physiol. Rev. 2005, 85, 1159–1204.
[CrossRef] [PubMed]
5. Jiang, M.; Gold, M.S.; Boulay, G.; Spicher, K.; Peyton, M.; Brabet, P.; Srinivasan, Y.; Rudolph, U.; Ellison, G.; Birnbaumer, L.
Multiple neurological abnormalities in mice deficient in the G protein Go. Proc. Natl. Acad. Sci. USA 1998, 95, 3269–3274.
[CrossRef]
6. Silachev, D.; Koval, A.; Savitsky, M.; Padmasola, G.; Quairiaux, C.; Thorel, F.; Katanaev, V.L. Mouse models characterize GNAO1
encephalopathy as a neurodevelopmental disorder leading to motor anomalies: From a severe G203R to a milder C215Y mutation.
Acta Neuropathol. Commun. 2022, 10, 9. [CrossRef]
7. Muntean, B.S.; Masuho, I.; Dao, M.; Sutton, L.P.; Zucca, S.; Iwamoto, H.; Patil, D.N.; Wang, D.; Birnbaumer, L.; Blakely, R.D.;
et al. Gαo is a major determinant of cAMP signaling in the pathophysiology of movement disorders. Cell Rep. 2021, 34, 108718.
[CrossRef]
8. Nakamura, K.; Kodera, H.; Akita, T.; Shiina, M.; Kato, M.; Hoshino, H.; Terashima, H.; Osaka, H.; Nakamura, S.; Tohyama, J.; et al.
De Novo mutations in GNAO1, encoding a Gαo subunit of heterotrimeric G proteins, cause epileptic encephalopathy. Am. J.
Hum. Genet. 2013, 93, 496–505. [CrossRef]
9. Saitsu, H.; Fukai, R.; Ben-Zeev, B.; Sakai, Y.; Mimaki, M.; Okamoto, N.; Suzuki, Y.; Monden, Y.; Saito, H.; Tziperman, B.; et al.
Phenotypic spectrum of GNAO1 variants: Epileptic encephalopathy to involuntary movements with severe developmental delay.
Eur. J. Hum. Genet. 2016, 24, 129–134. [CrossRef]
10. Danti, F.R.; Galosi, S.; Romani, M.; Montomoli, M.; Carss, K.J.; Raymond, F.L.; Parrini, E.; Bianchini, C.; McShane, T.; Dale, R.C.;
et al. GNAO1 encephalopathy: Broadening the phenotype and evaluating treatment and outcome. Neurol. Genet. 2017, 3, e143.
[CrossRef]
11. Feng, H.; Khalil, S.; Neubig, R.R.; Sidiropoulos, C. A mechanistic review on GNAO1-associated movement disorder. Neurobiol.
Dis. 2018, 116, 131–141. [CrossRef]
12. Schirinzi, T.; Garone, G.; Travaglini, L.; Vasco, G.; Galosi, S.; Rios, L.; Castiglioni, C.; Barassi, C.; Battaglia, D.; Gambardella,
M.L.; et al. Phenomenology and clinical course of movement disorder in GNAO1 variants: Results from an analytical review.
Parkinsonism Relat. Disord. 2019, 61, 19–25. [CrossRef] [PubMed]
13. Galosi, S.; Pollini, L.; Novelli, M.; Bernardi, K.; Di Rocco, M.; Martinelli, S.; Leuzzi, V. Motor, epileptic, and developmental
phenotypes in genetic disorders affecting G protein coupled receptors-cAMP signaling. Front. Neurol. 2022, 13, 886751. [CrossRef]
14. Abela, L.; Kurian, M.A. Postsynaptic movement disorders: Clinical phenotypes, genotypes, and disease mechanisms. J. Inherit.
Metab. Dis. 2018, 41, 1077–1091. [CrossRef]
15. Wirth, T.; Garone, G.; Kurian, M.A.; Piton, A.; Millan, F.; Telegrafi, A.; Drouot, N.; Rudolf, G.; Chelly, J.; Marks, W.; et al.
Highlighting the Dystonic Phenotype Related to GNAO1. Mov. Disord. 2022, 37, 1547–1554. [CrossRef] [PubMed]
16. Krenn, M.; Sommer, R.; Sycha, T.; Zech, M. GNAO1 Haploinsufficiency Associated with a Mild Delayed-Onset Dystonia
Phenotype. Mov. Disord. 2022, 37, 2464–2466. [CrossRef] [PubMed]
17. Wang, D.; Dao, M.; Muntean, B.S.; Giles, A.C.; Martemyanov, K.A.; Grill, B. Genetic modeling of GNAO1 disorder delineates
mechanisms of Gαo dysfunction. Hum. Mol. Genet. 2022, 31, 510–522. [CrossRef]
18. Di Rocco, M.; Galosi, S.; Lanza, E.; Tosato, F.; Caprini, D.; Folli, V.; Friedman, J.; Bocchinfuso, G.; Martire, A.; Di Schiavi, E.; et al.
Caenorhabditis elegans provides an efficient drug screening platform for GNAO1-related disorders and highlights the potential
role of caffeine in controlling dyskinesia. Hum. Mol. Genet. 2022, 31, 929–941. [CrossRef]
19. Larasati, Y.A.; Savitsky, M.; Koval, A.; Solis, G.P.; Valnohova, J.; Katanaev, V.L. Restoration of the GTPase activity and cellular
interactions of Gαo mutants by Zn2+ in GNAO1 encephalopathy models. Sci. Adv. 2022, 8, eabn9350. [CrossRef]
20. Sulston, J.E.; Hodgkin, J. Methods. In The Nematode Caenorhabditis Elegans; The Community of C. elegans Researchers, Wood, W.B.,
Eds.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 1988; pp. 587–606.
21. Mello, C.C.; Kramer, J.M.; Stinchcomb, D.; Ambros, V. Efficient gene transfer in C. elegans: Extrachromosomal maintenance and
integration of transforming sequences. EMBO J. 1991, 10, 3959–3970. [CrossRef]
22. Yang, B.; Schwartz, M.; McJunkin, K. In vivo CRISPR screening for phenotypic targets of the mir-35-42 family in C. elegans. Genes.
Dev. 2020, 34, 1227–1238. [CrossRef] [PubMed]
23. Paix, A.; Folkmann, A.; Rasoloson, D.; Seydoux, G. High Efficiency, Homology-Directed Genome Editing in Caenorhabditis elegans
Using CRISPR-Cas9 Ribonucleoprotein Complexes. Genetics 2015, 201, 47–54. [CrossRef] [PubMed]
24. Mahoney, T.R.; Luo, S.; Nonet, M.L. Analysis of Synaptic Transmission in Caenorhabditis elegans Using an Aldicarb-Sensitivity
Assay. Nat. Protoc. 2006, 1, 1772–1777. [CrossRef] [PubMed]
25. Thapliyal, S.; Babu, K. Pentylenetetrazole (PTZ)-induced Convulsion Assay to Determine GABAergic Defects in Caenorhabditis
elegans. Bio. Protoc. 2018, 8, e2989. [CrossRef]
Genes 2023, 14, 319 14 of 14

26. Davis, A.N.; Tanis, J.E. Measuring Caenorhabditis elegans Sensitivity to the Acetylcholine Receptor Agonist Levamisole. J Vis. Exp.
2022, 184. [CrossRef]
27. Hart, A.C. Behavior. In WormBook: The Online Review of C. elegans Biology. 2006. Available online: http://www.wormbook.
org/(accessed on 10 December 2022).
28. Miller, K.G.; Rand, J.B. A role for RIC-8 (Synembryn) and GOA-1 (G(o)alpha) in regulating a subset of centrosome movements
during early embryogenesis in Caenorhabditis elegans. Genetics 2000, 156, 1649–1660. [CrossRef]
29. Gotta, M.; Ahringer, J. Distinct roles for Galpha and Gbetagamma in regulating spindle position and orientation in Caenorhabditis
elegans embryos. Nat. Cell Biol. 2001, 3, 297–300. [CrossRef]
30. Govindan, J.A.; Cheng, H.; Harris, J.E.; Greenstein, D. Gαo/i andGαs signaling function in parallel with the MSP/Eph receptor
to control meiotic diapause in C.elegans. Curr. Biol. 2006, 16, 1257–1268. [CrossRef] [PubMed]
31. Grill, B.; (University of Washington School of Medicine, Seattle, WA, USA). Personal communication, 2022.
32. Robatzek, M.; Thomas, J.H. Calcium/calmodulin-dependent protein kinase II regulates Caenorhabditis elegans locomotion in
concert with a Go/Gq signaling network. Genetics 2000, 156, 1069–1082. [CrossRef]
33. Koelle, M.R. Neurotransmitter signaling through heterotrimeric G proteins: Insights from studies in C. elegans. In The C. elegans
Research Community; Worm Book: Tel Aviv, Israel, 2018; pp. 1–52.
34. Mendel, J.E.; Korswagen, H.C.; Liu, K.S.; Hajdu-Cronin, Y.M.; Simon, M.I.; Plasterk, R.H.; Sternberg, P.W. Participation of the
protein Go in multiple aspects of behavior in C. elegans. Science 1995, 267, 1652–1655. [CrossRef]
35. Ségalat, L.; Elkes, D.A.; Kaplan, J.M. Modulation of serotonin-controlled behaviors by Go in Caenorhabditis elegans. Science 1995,
267, 1648–1651. [CrossRef] [PubMed]
36. Katz, M.; Corson, F.; Keil, W.; Singhal, A.; Bae, A.; Lu, Y.; Liang, Y.; Shaham, S. Glutamate spillover in C. elegans triggers repetitive
behavior through presynaptic activation of MGL-2/mGluR5. Nat. Commun. 2019, 10, 1882. [CrossRef] [PubMed]
37. Miller, K.G.; Emerson, M.D.; Rand, J.B. Goalpha and diacylglycerol kinase negatively regulate the Gqalpha pathway in C. elegans.
Neuron 1999, 24, 323–333. [CrossRef] [PubMed]
38. Zhen, M.; Samuel, A.D. C. elegans locomotion: Small circuits, complex functions. Curr. Opin. Neurobiol. 2015, 33, 117–126.
[CrossRef]
39. Chen, J.F.; Cunha, R.A. The belated US FDA approval of the adenosine A2A receptor antagonist istradefylline for treatment of
Parkinson’s disease. Purinergic Signal 2020, 16, 167–174. [CrossRef] [PubMed]
40. Savitsky, M.; Solis, G.P.; Kryuchkov, M.; Katanaev, V.L. Humanization of Drosophila Gαo to Model GNAO1 Paediatric En-
cephalopathies. Biomedicines 2020, 8, 395. [CrossRef] [PubMed]
41. Shi, D.; Padgett, W.L.; Daly, J.W. Caffeine analogs: Effects on ryanodine-sensitive calcium-release channels and GABAA receptors.
Cell. Mole. Neurobiol. 2003, 23, 331–347. [CrossRef]
42. Boswell-Smith, V.; Spina, D.; Page, C.P. Phosphodiesterase inhibitors. Brit. J. Pharmacol. 2006, 147, S252–S257. [CrossRef]
43. Saki, M.; Yamada, K.; Koshimura, E.; Sasaki, K.; Kanda, T. In vitro pharmacological profile of the A2A receptor antagonist
istradefylline. Naunyn Schmiedebergs Arch. Pharmacol. 2013, 386, 963–972. [CrossRef] [PubMed]
44. Lee, K.W.; Hong, J.H.; Choi, I.Y.; Che, Y.; Lee, J.K.; Yang, S.D.; Song, C.W.; Kang, H.S.; Lee, J.H.; Noh, J.S.; et al. Impaired D2
dopamine receptor function in mice lacking type 5 adenylyl cyclase. J. Neurosci. 2002, 22, 7931–7940. [CrossRef]
45. Feng, H.; Sjögren, B.; Karaj, B.; Shaw, V.; Gezer, A.; Neubig, R.R. Movement disorder in GNAO1 encephalopathy associated with
gain-of-function mutations. Neurology. 2017, 89, 762–770. [CrossRef] [PubMed]
46. Méneret, A.; Gras, D.; McGovern, E.; Roze, E. Caffeine and the Dyskinesia Related to Mutations in the ADCY5 Gene. Ann. Intern.
Med. 2019, 171, 439. [CrossRef] [PubMed]
47. Méneret, A.; Mohammad, S.S.; Cif, L.; Doummar, D.; DeGusmao, C.; Anheim, M.; Barth, M.; Damier, P.; Demonceau, N.; Friedman,
J.; et al. Efficacy of Caffeine in ADCY5-Related Dyskinesia: A Retrospective Study. Mov. Disord. 2022, 37, 1294–1298. [CrossRef]
[PubMed]

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.