SciForschen

Open HUB for Scientific Researc h

( ISSN 2380-548X )

International Journal of Endocrinology and Metabolic Disorders

Research Article Volume: 1.4 Open Access

Functional Characterization of Two Received date: 4 Nov 2015; Accepted date: 19

Nov 2015; Published date: 24 Nov 2015.

Mutations Located in the Ligand Binding Citation: Pérez Garrido N, Saraco N, Marino R,
Ramírez P, Ciaccio M, et al. (2015) Functional

Domain in the SF1 Characterization of Two Mutations Located in the

Ligand Binding Domain in the SF1. Int J Endocrinol
Metab Disord 1(4): doi http://dx.doi.org/10.16966/2380-
Pérez Garrido N1#, Saraco N1#, Marino R1, Ramírez P1, Ciaccio M1, Costanzo M1, 548X.117
Guercio G1, Warman D1, Minini L2, Portillo-Ledesma S2, Rivarola MA1, Coitiño EL2 Copyright: © 2015 Pérez Garrido N, et al. This is
and Belgorosky A1* an open-access article distributed under the terms
1
Endocrinology Service, Hospital de Pediatria Garrahan, Buenos Aires, Argentina of the Creative Commons Attribution License,
2
Laboratorio de Química Teórica y Computacional, Instituto de Química Biológica, Facultad de Ciencias, which permits unrestricted use, distribution, and
Universidad de la República, Montevideo, Uruguay reproduction in any medium, provided the original
#
These two authors contributed equally to this work. author and source are credited.

Corresponding author: Dr. Alicia Belgorosky at Hospital de Pediatría Garrahan, Endocrinology

*

Service, Combate de los Pozos 1881, Buenos Aires, Argentina, E-mail: [email protected]

Abstract
Purpose: Since SF1 gene mutations located in the ligand binding domain are associated with a wide phenotypic spectrum in 46,XY subjects,
the functional and structural characterization of these variations is of great interest. The aim of this study is to evaluate the clinical phenotype,
hormonal pattern and molecular studies (genetic, functional data and protein structural analysis) in two non-related 46,XY disorder of sex
development (DSD) index patients.
Methods: Clinical characteristics, genomic DNA sequencing analysis, protein prediction software study and protein structure analysis, and
functional characterization of the mutations was carried out.
Results: Both index DSD patients showed a similar phenotype, however several affected members of Family 1 showed variable phenotypes.
While in Family 1 a previously reported heterozygous missense point mutation (p.Arg313His) was found, in Family 2 a novel heterozygous
missense point mutation (p.Ser303Arg) was detected. Both mutations were predicted to be as “probably damaging”. The transcriptional activity
of SF1 mutants p.Arg313His and p.Ser303Arg, studied using two different promoters in two cell lines, exhibited significant reductions of
transactivation activity. Structural analysis showed differences between both mutants, such as changes in the flexibility of the receptor backbone
and in the tertiary structure around the ligand and in the AF-2 domain.
Conclusions: One of these ligand binding domain mutations in SF1 showed phenotypic heterogeneity among family members, while both
variations showed similarities in prepubertal phenotype, as well as in damage prediction and experimental decreases in transcriptional activity,
but marked differences in structural consequence predictions. Finally the present study reinforces the concept of the wide variability in the clinical
phenotype in affected 46,XY DSD patients.

Keywords: Steroidogenic factor-1; SF1; NR5A1 gene; LBD mutations; 46,XY DSD

Introduction hypogonadism, and other features such as hyposplenism, abnormalities of

Steroidogenic factor-1 (SF1/AD4BP/FTZF1) plays a key role in the the ventromedial hypothalamus, and late-onset obesity [4,5].
regulation of adrenal and reproductive organs differentiation. The SF1 In humans, mutations in NR5A1 were reported to cause both 46,XY and
gene (NR5A1) is an autosomal gene located on chromosome 9q33 and it is 46,XX gonadal dysgenesis with or without adrenal failure [6-8]. Variable
the member 1 of the nuclear receptor subfamily 5, group A [1]. It expands loss of SF1 function is associated with a wide phenotypic spectrum
over 30 kb of genomic DNA and it is comprised of one non-coding exon indicating that SF1 dosage is critical. In the approximately 81 patients so
(I) followed by six coding exons (II to VII).
far described with impairment to the protein function mutations in the
The protein consists of 461 amino acids that include a DNA-binding NR5A1 gene the clinical phenotype is largely variable including, female
domain (DBD) containing two zinc fingers, a hinge region containing genitalia, mild clitoromegaly, isolated hypospadias, anorchia and even
a first functional activation domain (AF-1), a ligand-binding domain normal male genitalia with infertility [6,9]. In 46,XX affected female
(LBD) of 12 helices (H1-H12) that includes a second functional patients, mutations in NR5A1 are associated with different phenotypes
activation domain (AF-2), and an accessory region [2]. It is expressed including primary and secondary amenorrhea, premature menopause
in undifferentiated gonads even before SRY and it is necessary for testis
and decreased ovarian reserve, but preserved fertility [7,8,10].
determination and differentiation. SF1 protein is highly expressed in
steroidogenic tissues, such as gonads, adrenals, and placenta, and regulates We are reporting the clinical phenotype, hormonal pattern and
almost all the enzymes related to this process. It is also expressed in the molecular studies (genetic, functional data and protein structural
ventromedial hypothalamic nucleus and pituitary gonadotropes with analysis) in two non-related 46,XY, DSD index patients and their affected
relevant physiological roles in the central nervous system [3]. family members. A novel heterozygous NR5A1 gene mutation, c.909G>A
Homozygous null mice (Nr5a1−/−) have adrenal and gonadal agenesis, (p.Ser303Arg), and a previously described [8,10] heterozygous NR5A1
persistent Müllerian structures in XY karyotype, partial hypogonadotropic gene mutation, c.938G>A (p.Arg313His), both located in exon 5, in the

Copyright: © 2015 Pérez Garrido N, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which
permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
 SciForschen
Open HUB for Scientific Researc h

Open Access
highly conserved helix 5 (H5) of the ligand binding domain of the protein Site-directed mutagenesis
(LBD), are presented. Functional studies and protein structure analyses
For promoter activity experiments, an expression vector containing
shed light into the reasons sustaining the pathogenicity of the mutations.
human wild type SF1 cDNA (p-SF1wt) was constructed in the
Subjects and Methods pcDNA3 vector (Invitrogen, Buenos Aires, Argentina). The SF1
cDNA was PCR amplified using specific primers, SF1for_pcDNA3
Clinical material (5′TGGTGTGAGGGGGTTTCTG3′) and SF1rev_pcDNA3
Two families with an index case presenting with a 46,XY DSD were (5′GAGAGGAGGAAGGGATGACC3′) carrying EcoRI and Xho1
evaluated. Four generations of Family 1 and two generations of Family 2 restriction enzyme sites, from RT-PCR of H295R cell line (human
are depicted in the family tree of Figure 1. adrenocortical carcinoma cell line). The 1921-bp PCR product was 2%
The clinical and biochemical findings in the affected members of the agarose gel-purified using the Zymoclean Gel DNA Recovery Kit (ZYMO
first family kindred have been previously reported [10]. Family 2 has not RESEARCH, Buenos Aires, Argentina). The fragment was digested with
been previously reported. EcoRI/Xho1 and cloned into the EcoRI and Xho1 sites of the pcDNA3
vector. The accuracy of the construct was confirmed by sequencing.
This study was approved by the Ethics Committee of the Garrahan NR5A1 expression vectors containing the p.Arg313His and p.Ser303Arg
Pediatric Hospital. Written informed consent for the study was obtained variants were generated by PCR-based site-directed mutagenesis
from all adult patients or patients´ parents or tutors. (QuikChange Site-Directed Mutagenesis Kit, Stratagene, Buenos Aires,
Mutation analysis of the NR5A1 gene Argentina) with specific primers, using p-SF1wt as a template (p-R313H
and p-S303R). The entire sequence of all mutant plasmids was confirmed
Genomic DNA was extracted from peripheral blood leukocytes by by direct sequencing prior to functional studies.
standard procedures. The coding exons (exons 2-7) and flanking intronic
regions of the NR5A1 gene were amplified by PCR using specific primers In vitro functional studies of NR5A1 mutations
gently provided by Dr. J. C. Achermann, University College London, UK. All transient gene expression studies to assess NR5A1/SF1 function
The PCR products were purified (Qia Quick PCR purification kit, Qiagen,
were performed in 24-well plates using Lipofectamine 2000 reagent
Buenos Aires, Argentina) and sequenced using a BigDye Terminator
(Invitrogen. Buenos Aires, Argentina) according to the manufacturer’s
version 3.1 cycle sequencing kit (Applied Biosystems, Buenos Aires,
protocol. Each expression vector (p-SF1wt, p-R313H or p-S303R) was
Argentina) on an ABI PRISM 3130 Genetic Analyzer capillary DNA
co-transfected into SMAT1 cell line (murine immature Sertoli cells)
Sequencer (Applied Biosystems, Buenos Aires, Argentina). The primers
used for sequencing were the same as those used for PCR. The nucleotide or into Y1 cell line (murine adrenocortical tumor cells) with reporter
sequences obtained were compared with the NCBI entry of NR5A1 gene: plasmid (PGL2, Promega, Buenos Aires, Argentina) containing hAMH
NG_008176.1. promoter kindly provided by Dr. Rodolfo Rey (Centro de Investigaciones
Endocrinológicas (CEDIE), Hospital de Niños R. Gutiérrez, Buenos Aires,
In silico protein analysis Argentina), p-PhAMH or with reporter plasmid (PGL3, Promega, Buenos
The sequence homology-based tool SIFT (Sorting Intolerant from Aires, Argentina) containing the h3BHSD2 promoter, p-Ph3BHSD2. Both
Tolerant; http://sift.jcvi.org/), version 2.0.6 and the structure-based promoters have response elements for SF1. The cells were lysed 48 hrs after
tool PolyPhen-2 (Polymorphism Phenotyping v2; http://genetics.bwh. transfection and assayed for luciferase activity (Dual Luciferase Reporter
harvard.edu/pph2/) were used to predict the pathogenicity of the missense Assay System; Promega, Buenos Aires, Argentina). Co-transfection of
variants p.Arg313His and p.Ser303Arg using default settings. The original CMV Renilla luciferase was used as a marker of transfection efficiency.
sequence of the protein was obtained from the Ensembl and Uniprot/ Results are shown as the mean ± SEM of three independent experiments,
Swiss-Prot databases. each performed in triplicate and represents the ratio of luciferase activity

Figure 1: Family trees of both kindreds. Squares represent males and circles represent females. Black squares represent affected 46, XY subjects
who were raised as boys, and black circles represent affected 46, XX subjects. Index case in each family is indicated by an arrow. Family 1 the circle
with a slash through it represents a deceased female who was not studied. Subject I-1 (gray circle) experienced menopause at the age of 30 years
and was inferred to be affected (not available for study).

Citation: Pérez Garrido N, Saraco N, Marino R, Ramírez P, Ciaccio M, et al. (2015) Functional Characterization of Two Mutations Located in the Ligand Binding
Domain in the SF1. Int J Endocrinol Metab Disord 1(4): doi http://dx.doi.org/10.16966/2380-548X.117

2
 SciForschen
Open HUB for Scientific Researc h

Open Access
of each SF1 and mutants compare to the empty vector. All data were FSH and low AMH levels, as well as normal steroidogenic response to hCG
standardized for Renilla activity. Statistical significance was examined stimulation (Table 1). Sex was re-assigned to male. Müllerian structures
using ANOVA test. Values of p<0.05 were considered significant. were present on ultrasound and confirmed by laparoscopy. A right gonad
biopsy at 10 months of age revealed mild testicular dysgenesis, presence of
In silico structural analysis of the wt protein and variants Leydig cells, and few germ cells. His mother reported difficulties getting
Protein complexes in solution were prepared using as scaffold the pregnant and presented low AMH and high basal FSH serum levels.
X-ray crystallographic structure 1ZDT (chain B) of human SF1 wt LBD His father referred normal sexual development and fertility. All affected
bound to a co-regulator peptide (NCoA-2, KENALLRYLLDKD) and individuals studied presented normal adrenal function.
a phospholipid ligand (di-palmitoyl-3-SN-phosphatidylethanolamine,
Mutational analysis
PEF). Ser303Arg and Arg313His point mutations were introduced in
silico with Discovery Studio Visualizer 3.5 [11]. Protonation states of The NR5A1 gene molecular study revealed the mutation c.938G>A
the ionizable residues at pH 7.4 were defined by visual inspection after (p.Arg313His) in heterozygous state in the first family and a novel
addition of H atoms missing in the 2.10 Å resolution crystal structure. mutation, c.909G>A (p.Ser303Arg) in heterozygous state in the second
Each structure was solvated by a truncated octahedral box of TIP3P family. Both mutations are located in exon 5 in the highly conserved H5 of
water extended up to 12 Å around each complex, adding K+ ions to the LBD. In order to determine if these alterations are present with a high
electroneutrality (7, 6, or 8 counterions respectively for wt, p.Ser303Arg frequency in the general population (Single Nucleotide Polymorphism
and p.Arg313His). A standard classical minimization protocol (2500 steps Database), we looked for these variations in the NCBI databases and
relaxing solvent plus ions while maintaining the complex restrained with ensembl genome browser and we did not find them, suggesting that these
500 kcal/mol.Å, followed by 20000 steps of unrestrained optimization of two variations would not be common polymorphisms. In addition, we
the whole system) was applied under periodical boundary conditions with search for the mutations in 100 healthy subjects (200 alleles) by DNA
the sander module of the AMBER12 suite [12], assigning the ff03 force sequencing and no allele carrying this mutation was detected.
field to both SF1 and the co-regulator peptide, and the GAFF parameters
to the phospholipid ligand. RESP atomic charges were also obtained
NR5A1 gene mutation prediction model
with Gaussian09 rev. A.02 [13]. Long-range electrostatics was treated To assess the potential deleterious effect of the amino acid changes,
using the Particle-mesh Ewald (PME) approach [14], and a 10 Å cut-off we used two software programs, SIFT and PolyPhen-2. SIFT prediction
was used for direct space interactions. Molecular dynamics simulations is based on the degree of conservation of amino acid residues in sequence
(MD) were run in explicit water for each complex at 300 K under the alignments derived from closely related sequences. Arginine residue in
same conditions, using a 2 fs integration step and applying restrictions position 313 and serine residue in position 303 are highly conserved
to H atoms with SHAKE algorithm [15]. After 100 ps equilibration in a between species. These mutations were evaluated to the option “affects
NVT ensemble using a Langevin thermostate, 5 ns of NPT simulations protein function” with a highly deleterious tolerance index score of 0.00 and
were produced with pmemd from the AMBER12 suite of programs [12]. 0.02 respectively. The same assessment was performed with PolyPhen-2.
MD trajectory post-processing was conducted with the ptraj module of This software predicts the possible impact of an amino acid substitution
AmberTools 12 [12] and representative structures corresponding to the on the structure and function of a human protein using straightforward
most populated cluster (among five clusters generated with the averaged- physical and comparative considerations. Both mutations were predicted
linkage algorithm) were obtained for each complex. to be as “probably damaging” with a score of 1.000 and 0.999 respectively.
Results Structural analysis
Clinical features The two variants containing point mutations p.Ser303Arg and
p.Arg313His were compared to human SF1 wt. Both amino acid changes
The index case Family 1 [10], patient IV-2 was born with ambiguous are located in the H5 helix of the LBD. In particular, p.Ser303Arg is
genitalia (2 cm length phallus, labioscrotal folds, severe hypospadias, and located in the vicinity of the area of interaction with the co-regulator
small inguinal gonads). Hormonal determinations revealed elevated serum peptide (mainly delimited by H12, H3, and H4) and the p.Arg313His
FSH and low AMH levels, and normal steroidogenic response to hCG mutation is part of a salt bridge H2…H5 compacting the LBD structure of
stimulation (Table 1). Male sex was assigned. Laparoscopic examination the receptor and stabilizing its active form [2,16].
and bilateral orchidopexy was performed at 10 months of age. Müllerian
structures were observed and a biopsy of the right gonad revealed signs of From a comparison of the dynamical behavior of the protein backbone
at the three SF1 complexes in solution emerges that whereas p.Ser303Arg
testicular dysgenesis, absence of Leydig cells and atypical heterochromatic
displays a similar structural evolution than that of SF1 wt, for the
germ cells. No lesions of carcinoma in situ were observed. Three other
p.Arg313His variant it takes longer (near 4 nanoseconds (ns)) to stabilize
46,XY individuals in the family (subjects II-1, III-2 and III-3) presented
the 3D structure, which globally differs from the other two variants due to
with severe hypospadias at birth, all of them developed spontaneous male
the loss of the salt bridge interaction (Figure 2A).
puberty, and one (subject II-1) has fathered 5 children. Among the family
members one 46,XX individual (subject I-1) developed early menopause Since it has been reported that restrictions in the flexibility of NR5A1
(this subject was not available for the biochemical and genetic evaluation) receptors knock down their activation [17,18], we have compared this
and other three 46,XX family members (subjects III-4, III-5 and IV-3) issue between the three variants using the root mean square fluctuations
presented high FSH and low AMH levels. of the protein by residue (RMSF) calculated at the stabilized part of each 5
ns simulation (Figure 2B). As it can be immediately appreciated, whereas
The index case of Family 2 (patient II-1) was the first child of non-
the p.Ser303Arg mutation turns the protein significantly more flexible
consanguineous parents. The baby was born with ambiguous genitalia
throughout all its structure as compared to the wt (particularly in the
and was initially assigned the female sex at birth. The patient was referred
H2-H3 loop and in the H12 helix), the p.Arg313His mutation turns, in
for further evaluation at three months of age. On physical examination,
contrast, the receptor more rigid in several regions.
the baby presented a 2.5 cm length phallus with well developed corporal
tissue, complete labioscrotal fusion and scrotal hypospadias; both inguinal The overall comparison of the tridimensional arrangement of alpha-
gonads were palpable. Hormonal determinations revealed elevated serum helices and loops of the LBD across the three variants (Figures 2C and

Citation: Pérez Garrido N, Saraco N, Marino R, Ramírez P, Ciaccio M, et al. (2015) Functional Characterization of Two Mutations Located in the Ligand Binding
Domain in the SF1. Int J Endocrinol Metab Disord 1(4): doi http://dx.doi.org/10.16966/2380-548X.117

3
 SciForschen
Open HUB for Scientific Researc h

Open Access
CA LH(IU/l) FSH(IU/l) T(ng/ml) E2 AMH Inhibin B Cortisol ACTH
Subject (years) LHRH LHRH (pg/ml) (pmol/l) (pg/ml) (ug/dl) (pg/ml)
basal peak basal peak basal hCG
Family 1 (*)
57 6.0 32.4 (1-14) 2.87 <7.1 (22-38) <30 (30-200) 14.5 38.6
II-1 46,XY
III-2 46,XY 31 2.3 4.6 2.97 <2.9 (22-38) 60.8 (50-450) 12.1 25

III-3 46,XY 29 4.4 13.1 3.09 20 (22-38) 54.7 (75-375) 10.1 38.9

III-4 46,XX 27 12.1 47.5 (1.1-9.6) 0.56 <9 <0.3 (0-75) 8.2 22

III-5 46,XX 25 11.7 25.1(1.1-9.6) 0.31 28.3 5.9 (0-75) 5.6 15.5
9.6 (2.5 13.3 (2.4 ±
IV-2 46,XY 0.03 24.1 24.5 1.04 3.95 <9 58 (76-381) ND 16.6 1 57.3 1
± 1.7) 1.7)
1.8 <0.1 2.6 <0.05 <2.9 (360-638) 31.9 (80-325)

IV-3 46,XX 3.8 <0.1 12.4(2.8±1.9) <0.05 <9 <0.3 (0-74) 14.1 15.7

Family 2
23 12.3 17.8 (1.1-9.6) ND 30.6 <1.3 (0-75) 8.9
I-1 46,XX

13.6
II-1 46,XY 0.3 3.75 0.72 1.36 133 (251-679) 39.9 (80-325) 11.7 20
(2.4±1.7)
Table 1: Serum hormone levels in the affected individuals available for the study.
Boldface numbers indicate values outside the reference range; normal values are shown in parentheses. SI conversion factors: testosterone (nanomoles
per
liter), 3.47; estradiol (picomoles per liter), 3.671; cortisol (nanomoles per liter), 27.59.
CA= Chronological age. ND=Not determined
1
at the age of 0.83 years
(*) Ciaccio et al. [10]

2D) highlights that both point mutations induce changes in the tertiary
Protein Residue:atom pairs Distance (Å) Angle (°)
structure of the receptor around the ligand (H2-H3/H6-H7 loops, beta
hairpin, and H6/H7 helices) and in the AF-2 domain (H4, H11, and H12), WT
resulting the latter in a different positioning of the co-activator peptide. Ser303:OLys434:NH3 3.268 144.7
A closer inspection of the hydrogen-bond network surrounding each Ser303:OHGlu304:O 2.969 146.7
mutation promptly shows that whereas the interaction with Lys434 is the
Ser303:C=OVal307:NH 2.830 175.9
most affected for p.Ser303Arg (in comparison to SF1 wt), Arg313 ability of
S303R
establishing hydrogen bonds with Glu237 and Asp309 in wt is completely
lost when replaced by His313 in p.Arg313His (Table 2). Arg303:NEGlu304:O 4.372 106.4

Finally, a closer look in the comparison of the interactions with the Arg303:NEVal307:NH 3.026 174.3
ligand at the LBD across variants shows that as the p.Ser303Arg mutation WT
affects SF1 interaction with the phospholipid mainly through changes in
Arg313:NEGlu237:OE2 3.153 168.2
Lys440 positioning and the opening of the channel’s entrance defined by
H2-H3 and H6-H7 loops (this resulting in PEF’s polar head more exposed Arg313:NH2Glu237:OE1 2.616 166.8
to the solvent), p.Arg313His mutation does not produce significant
Arg313:NH2Asp309:OD2 3.158 154.4
changes on the ligand-receptor recognition (Figures 2E and 2F).
Arg313:NH1Asp309:OD1 2.689 156.1
Functional studies of NR5A1 mutation activities Arg313:NH2Asp309:OD1 2.864 155.6
To examine the transcriptional activity of the SF1 mutants (p-R313H R313H
and p-S303R) and the wild type SF1 (p-SF1wt), we performed transient co-
Interactions completely lost
transfection assays with different SF1 target gene promoters (p-PhAMH
and p-Ph3BHSD2) in steroidogenic cell lines (SMAT1 and Y1). Table 2: Structural analysis of the hydrogen bond interactions around each
point mutation
In both steroidogenic cell lines, p-SF1wt significantly (p<0.05)
increased reporter gene expression driven by the human AMH or significantly decreased luciferase activity compared to p-SF1wt (1.32
3BHSD2 promoters. Transfection with each of the two missense mutations AU ± 0.05 and 1.09 AU ± 0.01 respectively, mean ± SEM, p<0.05
p-R313H or p-S303R showed impaired transactivation activity compared ANOVA) (Figure 3A). Similar results were obtained in the SMAT1 cell
with p-SF1wt (Figure 3). line with the co-transfection with p-Ph3BHSD2; a significant increased
In details, in the SMAT1 cell line the co-transfection with p-PhAMH luciferase activity in the presence of p-SF1wt (6.92 AU ± 0.25, mean ±
and p-SF1wt significantly increased the luciferase activity (3.00 ± 0.09 AU, SEM, p<0.05 ANOVA) while when assaying the effect of the mutants
mean ± SEM, p <0.05 ANOVA) while mutants p-R313H and p-S303R p-R313H and p-S303R a significant reduction of transactivation

Citation: Pérez Garrido N, Saraco N, Marino R, Ramírez P, Ciaccio M, et al. (2015) Functional Characterization of Two Mutations Located in the Ligand Binding
Domain in the SF1. Int J Endocrinol Metab Disord 1(4): doi http://dx.doi.org/10.16966/2380-548X.117

4
 SciForschen
Open HUB for Scientific Researc h

Open Access

Figure 2: Structural analysis of SF1 mutations. Panel A - Structural evolution of Cα RMSD for each SF1 variant along the simulation taking the
initial structure as reference. Panel B - Flexibility by protein residue calculated as RMS fluctuations from the time-averaged Cα positions along the
stabilized part of each simulation. Panels C and D - Overlay by pairs of protein variants, evidencing the main differences on α-helices, β-hairpin,
and loops 3D disposition in the LBD. In purple the SF1 wt protein, in yellow the R313H mutant, and in green the S303R mutant. AF-2 is the ligand-
dependent activation function and PEF a phospholipid ligand. Circled in red is the coactivator peptide. Panels E and F – Detail of the region around
the ligand, compared by pair of protein variants. In purple the SF1 wt protein, in yellow the R313H mutant, and in green the S303R mutant.

capacity was observed compared to p-SF1wt (1.91 AU ± 0.07 and 2.00 Discussion
AU ± 0.08 respectively, mean ± SEM, p<0.05 ANOVA) (Figure 3B).
We are reporting the molecular characterization of two missense
In the Y1 cell line, similar responses as in the SMAT1 cell line were mutations (p.Arg313His and p.Ser303Arg) in the LBD of the SF1 gene, in
observed with p-Ph3BHSD2 and p-SF1wt (9.27 AU ± 0.54, mean ± SEM, two non-related 46,XY DSD patients, both in heterozygous state.
p<0.05 ANOVA) and mutants p-R313H and p-S303R (4.55 AU ± 0.32 and The clinical and biochemical phenotypes of these two 46,XY index
4.08 AU ± 0.17 respectively, mean ± SEM, p<0.05 vs. SF1wt, ANOVA) (Figure patients were similar. Hormonal determinations showed normal basal and
3C). Transactivating studies of both mutants with the p-PhAMH in the Y1 peak testosterone, high serum FSH and low serum AMH levels for the
cell line were not possible as the p-SF1wt did not increase luciferase activity. child’s age. Evidence of testicular dysgenesis and the presence of Müllerian

Citation: Pérez Garrido N, Saraco N, Marino R, Ramírez P, Ciaccio M, et al. (2015) Functional Characterization of Two Mutations Located in the Ligand Binding
Domain in the SF1. Int J Endocrinol Metab Disord 1(4): doi http://dx.doi.org/10.16966/2380-548X.117

5
 SciForschen
Open HUB for Scientific Researc h

Open Access
sex re-assignation was recommended to, and accepted by the parents, on
the basis of adequate basal T secretion for age, including normal response
to hCG stimulation, and potential for successful intercourse in adulthood.
This decision was also supported by the follow-up of other 46,XY DSD
members of the first family who developed spontaneous male puberty,
one with preserved fertility [10] and lack of reports of development of
testicular tumors in 46,XY NR5A1 dysgenetic testes.
There was a striking variability among the affected relatives in the
first family that range from severe ambiguous genitalia to normal male
external genitalia and preserved fertility, as it was previously reported by
us [10]. A wide phenotypic spectrum has been described in patients with
heterozygous NR5A1 mutations including when the mutation is located
in the LBD (Table 3) [5,6,9,20-32]. Phenotype variability in NR5A1
mutations makes genotype-phenotype correlations very difficult. In 46,XX
individuals carrying heterozygous NR5A1 mutations, variable gonadal
phenotypes have also been described [7,8,10,20,33-36]. In this report,
four 46,XX affected women presented high serum FSH levels with low
levels of AMH. The presence of regular menses in the three young-adult
women studied and successful maternity in two, reflect a compensated
ovarian dysfunction. These women may go through a stage of decreased
ovarian reserve before developing clinical signs or symptoms of ovarian
failure, as it has been reported [20].
Adrenal function was normal in both index patients and their relatives
carrying mutations in NR5A1. To date, adrenal insufficiency was reported
in only three patients harboring NR5A1 mutations [37-39].
The amino acid substitution of both missense mutations (p.Arg313His
and p.Ser303Arg) takes place in a highly conserved site among species
observed by in silico analysis.
The structural analysis showed that, since it turns to be a less rigid
protein, interactions are expected to be more labile for p.Ser303Arg
mutant. On the other hand, the loss of flexibility induced by p.Arg313His
mutation occurs in regions which are involved in several interactions
of relevance for structural packing (H2-E238 and H5-R313) and co-
activator recruiting at the activation function domain AF-2 (H3-R281
and H12-E454). The H11 C-term region where the phospholipid polar
head binds at the entrance of the ligand channel is also highly affected. In
agreement with this, crystallographic studies on the SF1 ligand binding
domain revealed different phospholipids bound in its hormone binding
pocket [2,16-18,40-42].
In vitro assays used to assess the functional impact of these two
mutations, on h3BHSD2 and hAMH promoters and in two different
steroidogenic cell lines (SMAT1 and Y1), showed impaired transactivation
Figure 3: Functional analysis in SMAT1 and Y1 of the R313H
and S303R mutations. The transcriptional activity of wild-type SF1 activity. On this line, besides the known interaction with phospholipids,
(p-SF1wt) and mutants p.Arg313His and p.Ser303Arg (p-R313H and its LBD might interact with some unknown co-activators to trigger
p-S303R respectively) were studied using Ph3BHSD2 and PhAMH adrenal and gonadal development [43]. Even though the in vitro studies
promoters in SMAT1 cell line and Ph3BHSD2 promoter in Y1 cell line. in some reports of NR5A1 gene mutations located in the LBD, confirm
Both mutants in both cell line and with both promoters exhibited a the deleterious effect (Table 3), the clinical phenotype variability observed
reduction of transactivation activity. The results are expressed as fold
among the affected patients reported remains poorly understood.
increase of luciferase activity compared with empty vector (mean ± SD).
All values represent the means ± SEM of three separate transfection Even though, SF1 is known to be engaged in the interaction
experiments, each performed in triplicate. * vs. empty vector; ** vs. SF1, with numerous co-activators acting over the promoter region of
p<0.05, ANOVA. several steroidogenic enzymes and factors involved in reproduction,
steroidogenesis and sexual differentiation [1,6,39], the molecular
structures suggested a failure of embryonic fetal Sertoli cells to secrete mechanisms of heterozygous mutations remain to be elucidated.
AMH during the sensitive prenatal period, which is consistent with the
The majority of the patients previously described, including the
low levels of AMH detected during infancy. The baby of the second family,
present report, carried heterozygous NR5A1 gene mutations in the LBD,
evaluated at the age of minipuberty, also presented low serum inhibin
supporting the concept of dose dependence of SF1 action (Table 3).
B levels along with elevated FSH. As it was proposed in an aromatase
deficient boy, inhibin B might be the major contributor in the regulation In summary, we are reporting, in two non-related 46,XY DSD patients,
of serum FSH secretion in normal infant males [19]. Both patients were the clinical phenotype, hormonal studies, molecular characterization,
initially assigned the female sex at birth, but after a careful evaluation, male and protein structural analysis of one missense mutation of the NR5A1

Citation: Pérez Garrido N, Saraco N, Marino R, Ramírez P, Ciaccio M, et al. (2015) Functional Characterization of Two Mutations Located in the Ligand Binding
Domain in the SF1. Int J Endocrinol Metab Disord 1(4): doi http://dx.doi.org/10.16966/2380-548X.117

6
 SciForschen
Open HUB for Scientific Researc h

Open Access

Sex In silico Functional

Mutation Genital Phenotype Puberty Fertility Reference
Assign. prediction** charaterization
p.Glu237Lys Male Normal Male Spontaneous Azoospermia Damaging Not done [21]
p.Asp238Asn Male Normal Male Spontaneous Severe failure Not done Impaired transcription [22]
Micropenis, Perineal
p.Trp279Arg Male Not reported Not reported Damaging Not done [23]
hypospadias
High sFSH
Micropenis, Perineal
p.Arg281Pro Male Spontaneous Asymptomatic carrier Damaging Impaired transcription [24]
hypospadias
father
Perineal hypospadias,
p.Ser303Arg* Male Prepuberty Prepuberty Damaging Impaired transcription This report
EMS 8/12
Asymptomatic
p.Glu304Lys* Male Perineal hypospadias Prepuberty Not done Impaired transcription [25]
carrier father
p.Arg313Cys Male Glandular hypospadias Not reported Not reported Not done Impaired transcription [23]
Asymptomatic carrier
p.Arg313His Male Perineal hypospadias Not reported Not done Not done [26]
father
[10] and this
p.Arg313His* Male Perineal hypospadias Spontaneous Preserved Damaging Impaired transcription
report
Spontaneous.
p.Gly328Val Male Perineal hypospadias Hypergon. Azoospermia Not done Impaired transcription [27]
hypogonadism
Micropenis, bilateral
p.Val355Met* Male Induced Not reported Not done Impaired transcription [28]
anorquia
DSD
p.Cys370Trp Male Not reported Not reported Damaging Not done [29]
(EMS 3/12)
DSD (female) Spontaneous Pubertal
p.Leu376Phe Female Not done Impaired transcription [27]
Neonatal Clitoromegaly (clitoromegaly) gonadectomy
p.Asp380Tyr Female DSD (female) Not reported Adolescent Damaging Not done [30]
p.Leu437Gln Male Perineal hypospadias Induced Not reported Not done Impaired transcription [31]

Table 3: Missense mutations in the SF-1 ligand binding domain of 46,XY patients
*In silico structural analysis performed;
**Analyzed using SIFT and/or PolyPhen-2 tools.
sFSH: serum FSH.
EMS: External Masculinization Score (minimum: 1, maximum: 12) [32]

gene (p.Arg313His) previously described without any functional study 3. Mello MP, França ES, Fabbri HC, Maciel-Guerra AT, Guerra-Júnior G
performed, and a novel missense mutation (p.Ser303Arg), both in (2011) Multifunctional role of steroidogenic factor 1 and disorders of
heterozygous state, located in the LBD. In vitro and in silico experiments sex development. Arq Bras Endocrinol Metabol 55: 607-612.
argued for their functional impact and also provided insight into the 4. Luo X, Ikeda Y, Parker KL (1994) A cell-specific nuclear receptor
structure-function relationship of the SF1 protein. Finally the present is essential for adrenal and gonadal development and sexual
differentiation. Cell 77: 481-490.
study reinforces the concept of the wide variability in the clinical
phenotype in affected 46,XY DSD patients. 5. Ferraz-de-Souza B, Lin L, Achermann JC (2011) Steroidogenic
factor-1 (SF-1, NR5A1) and human disease. Mol Cell Endocrinol 336:
Acknowledgement 198-205.

Supported by grants from Consejo Nacional de Investigaciones 6. Lin L, Achermann JC (2008) Steroidogenic Factor-1 (SF-1, Ad4BP,
NR5A1) and Disorders of Testis Development. Sex Dev 2: 200-209.
Científicas y Técnicas (CONICET), Fondo para la Investigación Científica
y Tecnologica (FONCYT), Argentina. 7. Lourenço D, Brauner R, Lin L, De Perdigo A, Weryha G, et al. (2009)
Mutations in NR5A1 Associated with Ovarian Insufficiency. N Engl J
References Med 360: 1200-1210.
8. Janse F, de With LM, Duran KJ, Kloosterman WP, Goverde AJ, et al.
1. Parker KL, Rice DA, Lala DS, Ikeda Y, Luo X, et al. (2002) Steroidogenic (2012) Limited contribution of NR5A1 (SF-1) mutations in women with
factor 1: an essential mediator of endocrine development. Recent primary ovarian insufficiency (POI). Fertil Steril 97: 141-146.
Prog Horm Res 57: 19-36.
9. Pedace L, Laino L, Preziosi N, Valentini MS, Scommegna S, et al.
2. Wang W, Zhang C, Marimuthu A, Krupka HI, Tabrizad M, et al. (2005) (2014) Longitudinal hormonal evaluation in a patient with disorder of
The crystal structures of human steroidogenic factor-1 and liver sexual development, 46,XY karyotype and one NR5A1 mutation. Am
receptor homologue-1. Proc Natl Acad Sci U S A 102: 7505-7510. J Med Genet A 164A: 2938-2946.

Citation: Pérez Garrido N, Saraco N, Marino R, Ramírez P, Ciaccio M, et al. (2015) Functional Characterization of Two Mutations Located in the Ligand Binding
Domain in the SF1. Int J Endocrinol Metab Disord 1(4): doi http://dx.doi.org/10.16966/2380-548X.117

7
 SciForschen
Open HUB for Scientific Researc h

Open Access
10. Ciaccio M, Costanzo M, Guercio G, De Dona V, Marino R, et al. disorders of sex development and novel NR5A1 (SF-1) mutations. Eur
(2012) Preserved fertility in a patient with a 46, XY disorder of sex J Endocrinol 167: 125-130.
development due to a new heterozygous mutation in the NR5A1/SF1 28. Philibert P, Zenaty D, Lin L, Soskin S, Audran F, et al. (2007) Mutational
gene: evidence of 46,XY and 46,XX gonadal dysgenesis phenotype analysis of steroidogenic factor 1 (NR5A1) in 24 boys with bilateral
variability in multiple members of an affected kindred. Horm Res anorchia: A French collaborative study. Hum Reprod 22: 3255-3261.
Paediatr 78: 119-126.
29. Baetens D, Mladenov W, Delle Chiaie B, Menten B, Desloovere A,
11. Accelrys Software Inc (2013) Discovery Studio Modeling Environment.
et al. (2014) Extensive clinical, hormonal and genetic screening in a
Release 3.5, San Diego: Accelrys Software Inc.
large consecutive series of 46,XY neonates and infants with atypical
12. Case DA, Darden TA, Cheatham TE, Simmerling CL, Wang J, et al. sexual development. Orphanet J Rare Dis 9: 209.
(2012) AMBER 12 Reference Manual. University of California, San
30. Philibert P, Leprieur E, Zenaty D, Thibaud E, Polak M, et al. (2010)
Francisco.
Steroidogenic factor-1 (SF-1) gene mutation as a frequent cause
13. Frisch MJ, Trucks GW, Schlegel HB, Scuseria GE, Robb MA, et of primary amenorrhea in 46,XY female adolescents with low
al. (2009) Official Gaussian 09 Literature Citation. Gaussian, Inc., testosterone concentration. Reprod Biol Endocrinol 8: 28.
Wallingford CT.
31. Lin L, Philibert P, Ferraz-de-Souza B, Kelberman D, Homfray T, et
14. Darden T, York D, Pedersen L (1993) Particle mesh Ewald: An al. (2007) Heterozygous missense mutations in steroidogenic factor
N•log(N) method for Ewald sums in large systems. The Journal of 1 (SF1/Ad4BP, NR5A1) are associated with 46,XY disorders of sex
Chemical Physics 98: 10089-10092. development with normal adrenal function. J Clin Endocrinol Metab
15. Ryckaert JP, Ciccotti G, Berendsen HJC (1977) Numerical Integration 92: 991-999.
of the Cartesian Equations of Motion of a System with Constraints:
32. Ahmed SF, Cheng A, Dovey L, Hawkins JR, Martin H, et al. (2000)
Molecular Dynamics of n-Alkanes. J Comput Phys 23: 327-341.
Phenotypic features, androgen receptor binding, and mutational
16. Krylova IN, Sablin EP, Moore J, Xu RX, Waitt GM, et al. (2005) analysis in 278 clinical cases reported as androgen insensitivity
Structural analyses reveal phosphatidyl inositols as ligands for the syndrome. J Clin Endocrinol Metab 85: 658-665.
NR5 orphan receptors SF-1 and LRH-1. Cell 120: 343-355.
33. Suwanai AS, Ishii T, Haruna H, Yamataka A, Narumi S, et al. (2013)
17. Musille PM, Pathak MC, Lauer JL, Hudson WH, Griffin PR, et al. A report of two novel NR5A1 mutation families: possible clinical
(2012) Antidiabetic phospholipid-nuclear receptor complex reveals phenotype of psychiatric symptoms of anxiety and/or depression. Clin
the mechanism for phospholipid-driven gene regulation. Nat Struct Endocrinol (Oxf) 78: 957-965.
Mol Biol 19: 532–537.
34. Camats N, Pandey AV, Fernández-Cancio M, Andaluz P, Janner M, et
18. Musille PM, Pathak M, Lauer JL, Griffin PR, Ortlund EA (2013) al. (2012) Ten novel mutations in the NR5A1 gene cause disordered
Divergent sequence tunes ligand sensitivity in phospholipid-regulated
sex development in 46,XY and ovarian insufficiency in 46,XX
hormone receptors. J Biol Chem 288: 20702-20712.
individuals. J Clin Endocrinol Metab 97: E1294-E1306.
19. Deladoëy J, Flück C, Bex M, Yoshimura N, Harada N, et al. (1999)
35. Philibert P, Paris F, Lakhal B, Audran F, Gaspari L, et al. (2013) NR5A1
Aromatase deficiency caused by a novel P450arom gene mutation:
impact of absent estrogen production on serum gonadotropin (SF-1) gene variants in a group of 26 young women with XX primary
concentration in a boy. J Clin Endocrinol Metab 84: 4050-4054. ovarian insufficiency. Fertil Steril 99: 484-489.

20. Warman DM, Costanzo M, Marino R, Berensztein E, Galeano J, et 36. Fabbri HC, de Andrade JG, Soardi FC, de Calais FL, Petroli RJ, et al.
al. (2011) Three new SF-1 (NR5A1) gene mutations in two unrelated (2014) The novel p.Cys65Tyr mutation in NR5A1 gene in three 46,XY
families with multiple affected members: with family variability in 46,XY siblings with normal testosterone levels and their mother with primary
subjects and low ovarian reserve in fertile 46,XX subjects. Horm Res ovarian insufficiency. BMC Med Genet 15: 7.
Paediatr 75: 70-77. 37. Achermann JC, Ito M, Ito M, Hindmarsh PC, Jameson JL (1999) A
21. Safari S, Zare-Abdollahi D, Mirfakhraie R, Ghafouri-Fard S, mutation in the gene encoding steroidogenic factor-1 causes XY sex
Pouresmaeili F, et al. (2014) An Iranian family with azoospermia reversal and adrenal failure in humans. Nat Genet 22: 125-126.
and premature ovarian insufficiency segregating NR5A1 mutation. 38. Biason-Lauber A, Schoenle EJ (2000) Apparently normal ovarian
Climacteric 17: 301-303. differentiation in a prepubertal girl with transcriptionally inactive
22. Bashamboo A, Ferraz-de-Souza B, Lourenço D, Lin L, Sebire NJ, et steroidogenic factor-1 (NR5A1/SF-1) and adrenocortical insufficiency.
al. (2010) Human male infertility associated with mutations in NR5A1 Am J Hum Genet 67: 1563-1568.
encoding steroidogenic factor 1. Am J Hum Genet 87: 505-512. 39. Achermann JC, Ozisik G, Ito M, Orun UA, Harmanci K, et al. (2002)
23. Allali S, Muller JB, Brauner R, Lourenço D, Boudjenah R, et al. (2011) Gonadal determination and adrenal development are regulated by the
Mutation analysis of NR5A1 encoding steroidogenic factor 1 in 77 orphan nuclear receptor steroidogenic factor-1, in a dose-dependent
patients with 46, XY disorders of sex development (DSD) including manner. J Clin Endocrinol Metab 87: 1829-1833.
hypospadias. PLoS One 6: e24117. 40. Sablin E, Blind R, Krylova I, Ingraham J, Cai F, et al. (2009) Structure
24. Philibert P, Polak M, Colmenares A, Lortat-Jacob S, Audran F, et al. of SF-1 bound different phospholipids: evidence for regulatory ligands.
(2011) Predominant Sertoli cell deficiency in a 46,XY disorders of sex Mol Endocrinol 23: 25-34.
development patient with a new NR5A1/SF-1 mutation transmitted by 41. Blind RD, Sabling EP, Kuchenbecker KM, Chiu HJ, Deacon AM, et
his unaffected father. Fertil Steril 95: 1788.e5-e9. al. (2014) The signaling phospholipid PIP3 creates a new interaction
25. Yagi H, Takagi M, Kon M, Igarashi M, Fukami M, et al. (2015) Fertility surface on the nuclear reseptor SF-1. Proc Natl Acad Sci U S A 111:
preservation in a family with a novel NR5A1 mutation. Endocr J 62: 15054-15059.
289-295. 42. Urs AN, Dammer E, Kelly S, Wang E, Merrill AH Jr, et al. (2007)
26. Adamovic T, Chen Y, Thai HT, Zhang X, Markljung E, et al. (2012) The Steroidogenic factor-1 is a sphingolipid binding protein. Mol Cell
p.G146A and p.P125P polymorphisms in the steroidogenic factor-1 Endocrinol 265-266: 174-178.
(SF-1) gene do not affect the risk for hypospadias in Caucasians. Sex
43. Correa RV, Domenice S, Bingham NC, Billerbeck AE, Rainey WE, et
Dev 6: 292-297.
al. (2004) A Microdeletion in the Ligand Binding Domain of Human
27. Tantawy S, Lin L, Akkurt I, Borck G, Klingmüller D, et al. (2012) Sterodogenic Factor 1 causes XY sex reversal without adrenal
Testosterone production during puberty in two 46,XY patients with insufficiency. J Clin Endocrinol Metab 89: 1767-1772.

Citation: Pérez Garrido N, Saraco N, Marino R, Ramírez P, Ciaccio M, et al. (2015) Functional Characterization of Two Mutations Located in the Ligand Binding
Domain in the SF1. Int J Endocrinol Metab Disord 1(4): doi http://dx.doi.org/10.16966/2380-548X.117