Ichtyology

HAL is a multidisciplinary open access archive for the deposit and dissemination of scientific research documents, whether they are published or not. The documents may come from teaching and research institutions in France or abroad, or from public or private research centers. L'archive ouverte pluridisciplinaire HAL, est destinée au dépôt et à la diffusion de documents scientifiques de niveau recherche, publiés ou non, émanant des établissements d'enseignement et de recherche français ou étrangers, des laboratoires Introduction : Pour une histoire des animaux aquatiques des mers septentrionales Thierry BUQUET, Brigitte GAUVIN, Catherine JACQUEMARD & Marie-Agnès LUCAS-AVENEL 2018  53  2 anthropozoologica art. 53 (2)-Publié le 30 janvier 2018 www.anthropozoologica.com Anthropozoologica est une revue en flux continu publiée par les Publications scientifiques du Muséum, Paris, avec le soutien de l'Institut des Sciences Humaines et Sociales du CNRS.

Le rouget barbet de vase : Mullus barbatus barbatus (Linné, 1758) est une espèce démersale, cible de la pêcherie chalutière et d'intérêt commercial important. Sur un total de 1679 spécimens, 1150 femelles et 529 mâles, ont été capturés au cours de l'année 2009, de taille comprise entre 83 et 275mm. La reproduction a été suivi et analysée à partir de l'observation macroscopique des gonades et au suivi des variations mensuelles des rapports gonadosomatique et hépatosomatique, et de l'indice pondéral. La période de ponte ainsi observée se situe d'avril à juillet avec de fortes maturations des ovaires durant le mois de mai. La taille à la première maturité sexuelle est estimée à 142mm pour les femelles et de 139mm pour les mâles. Mots clefs: Rouget barbet de vase; rapport gonado-somatique; rapport hépatosomatique; maturité sexuelle; période de ponte; baie d'Oran. Abstract The red Mullet Mullus barbatus barbatus, benthic fish, targeted by the trawl fishery, with a high commercial interest; it is an economic resource of the Mediterranean coast where it is strongly exploited. Of a total of 1679 specimens, 1150 females and 529 males were captured during monthly samples from January to December 2009, of a size between 83 and 275mm. The reproduction was described and analyzed from macroscopic observation of gonads and the tracking monthly changes of Gonadosomatic index (GSI) and Hepatosomatic index (HSI). The period of reproduction of the red mullet extends from April to July with strong maturation of the ovaries during the month of May. The size at the first sexual maturity is estimated at 142mm for females and 150mm for the males.

Ikan Kembung (Rastrelliger brachysoma) termasuk ikan pelagis kecil yang memiliki nilai ekonomis menengah, sehingga terhitung sebagai komoditas yang cukup penting bagi nelayan lokal. Ikan Kembung biasanya dijual segar atau diproses menjadi ikan pindang dan ikan asin yang lebih tahan lama. Ikan kembung yang masih kecil juga sering digunakan sebagai umpan hidup untuk memancing cakalang. Tubuh ramping memanjang, memipih dan agak tinggi, 1 : 3,7±6 dibandingkan dengan panjang tubuh FL (fork length). Sisi dorsal gelap, biru kehijauan hingga kecoklatan, dengan1±2 deret bintik gelap membujur di dekat pangkal sirip punggung; sisik ventral keperakan. Sisik-sisik yang menutupi tubuh kembung berukuran kecil dan seragam. Sirip punggung dalam dua berkas, diikuti oleh 5 sirip kecil tambahan (finlet). Jumlah finlet yangsama juga terdapat di belakang sirip anal, duri pertama sirip anal tipis dan kecil (rudimenter). Sepasang lunas ekor berukuran kecil terdapat di masing-masing sisi batang ekor. Di depan dan belakang mata terdapat pelupuk mata berlemak (adip ose).

This short essay discusses sixteenth- and early seventeenth-century representations of aquatic creatures made in two of the most important port cities of Europe at the time: Venice and Antwerp. We look at the diversity of visual material and representative genres (drawings, illuminations, frescoes, prints, oil paintings), at their connections with aquatilia as objects, and at the links of both objects and images to collections in these two cities. In comparing the material from these two port cities and cultural centres we are especially interested in three questions: periodisation; materiality; and innovation in visual formats, including its possible connection with the role of both Venice and Antwerp as European centres of printing.

English abstract: The study of figurative fish names shows that our vision of the marine universe is built  "through" our experience of the terrestrial environment, since it is essentially based on metaphors whose source domains include terrestrial and flying animals, plants or fruits, human features (as professions or artifacts produced by man), the sun, the moon, the stars, etc. On the other hand, phraseology and paremiology demonstrate the reversibility of these associations of ideas, contrary to the unidirectional cross-conceptual path stated by Lakoff & Johnson from emerging source domains towards not directly accessible target domains (Gibbs). The Spanish phrasemes turn upside down this path in many expressions where marine fauna is the source domain mapped on the terrestrial target domain. A brief overview to other languages confirms that this phenomenon is not specific for Spanish.
Russian longer abstract : Изучение переносных наименований рыб показывает, что наши представления о водном мире  связаны  с  нашим опытом  жизни на суше, поскольку речь идет о метафорах со сферами –источниками, относящимися к животным, обитающим на суше, к птицам, растениям или их плодам, к человеку,  местам его проживания,  профессиям,  предметному миру, созданному человеком, а также к физическому миру (солнце, луна, звезды)  и т.д. (Pamies, 2010).С другой стороны, фразеология и паремиология  доказывают обратимость подобного рода ассоциаций,  вопреки выдвинутому Дж.Лакоффом и М.Джонсоном (1980) тезису об однонаправленной метафорической проекции между конкретными и прозрачными сферами – источниками и менее определенными концептуальными доменами – целями (Gibbs,1999,45). Испанские фраземы часто нарушают  данную проекцию, поскольку во многих случаях ихтиологическая фауна служит сферой- источником и проецируется на наземный мир, концептуализируя самые разнообразные явления.
Обращение к другим языкам доказывает справедливость данного утверждения  не только применительно к испанскому языку. Так, например, рыбе «средиземноморский долгопер»  биологи дали название Dactylopterus volitans посредством орнитологической метафоры.  Схожие народные названия эта рыба получила  во многих языках, меняется только наименование птицы: исп. pez golondrina (рыба-ласточка), катал. peix xoriguer (рыба-пустельга), франц. poule de mer (букв. морская курица), итал. pesce civetta (букв. сова), нем. Flughahn (букв. летающий петух). Основной семой здесь является размер ее плавательных придатков, которые в испанском языке именуются как aletas (букв. крылья; перен. плавники), то есть речь идет о той же орнитологической метафоре, но применяемой к любому виду рыб.
В других случаях переносные наименования, связанные с водной фауной, во многих языках совпадают при их применении к другим концептуальным доменам. Это, например,  ассоциации между образом рыбы, попавшейся на крючок, и неосторожностью болтливых людей: исп.por la boca muere el pez, порт. peixe morre pela boca ( букв. рыба умирает ртом; перен. язык мой - враг мой); англ.a fish is caught by its mouth; и т.д. (букв. букв. рыба ловится ртом; перен. язык мой - враг мой).
Сравнительно-сопоставительный подход к данному явлению  также показывает, что наряду с частыми межъязыковыми метафорическими совпадениями родового понятия «Рыба» наблюдается большое число  фразеологических несоответствий между видовыми  названиями (осьминог, треска, сардина, лещ, рак…). Можно отметить даже замены  во фразеологических моделях, связанных  с малой значимостью  наиболее дешевых пород рыб. Например,  в Западной Европе наименование сардины используется для обозначения скопления людей в общественном транспорте (исп.como sardinas en lata; франц.serrés comme des sardines; англ.packed like sardines), а в русском языке в качестве культурного эквивалента используется  селедка (как сельди в бочке).

Laimosemion ubim, new species, is described from a small stream tributary of Lago Amanã system, Central Amazon, northern Brazil, based on external and internal anatomical morphological characters. It is considered closely related to other species of Laimosemion, subgenus Owiyeye, from the same region. It is distinguished from all other rivulids by having double-branched epipleural ribs, a condition never found among cyprinodontiforms, and from all its congeners by having hypertrophied teeth on the anterior portion of the outer row of the premaxilla and dentary in males. It reaches a maximum adult size of about 18 mm SL and exhibits several reductive characters, as expected for a miniature species, including a notable reductive character state – four branchiostegal rays.

In the present study, an effort has been made to investigate the fish resources quantitatively by studying the ichthyofaunal biodiversity of Varada River stretch from Karehonda fishing village to Bankasana of Soraba. Monthly sampling was conducted at three fish landing centres over a period of two years (November 2009 to June 2011) by using gill nets. A total of 10,569 kg of fishes from three landing centers were collected and Bankasana landing center recorded maximum followed by Karehonda and Holejoladagudde. During the present study a total of 78 species belonging to 18 families and 6 orders were recorded. The order Cypriniformes was found to be dominant with 40 fish species (51.28%) followed by Siluriformes 24 species (30.76%) and Perciformes 10 species (12.82%). Although, 78 species were recorded, the family Cyprinidae recorded 35 fish species (44.87%) followed by Bagridae 10 (12.82%), Schilbeidae and Ambassidae with 5 fish species (6.41%) each to total fish landing. The Simpson's index of diversity (1-Lambda') was highest in Karehonda (0.9063) followed by Holejoladagudde (0.9012) and Bankasana (0.8640). This indicated the greater fish biodiversity in Karehonda when compared to other two centers. The biomass of fish species was more in Bankasana (S=70, N=4948) followed by Karehonda (S=66, N=2825), and Holejoladagudde (S=65, N=2796). Further, the other indices such as Pielou's evenness (J'), Shannon H' (loge) and Simpson 1-Lambda' were also used to assess the richness of biodiversity of all the three fish landing centers. The paper attempts to evaluate ichthyofaunal diversity in the region and suggests mitigating measures.

Se estudió la ecología reproductiva de nueve especies dominantes de la comunidad de peces del río Kaka'da. Para ello se determinaron los parámetros: fecundidad, diámetro de ovocitos, índice gonadosomático, factor de condición, estructura de tallas, variaciones temporales de los estados de madurez, tallas, acumulación de grasa, talla media de madurez sexual e índice de actividad reproductiva. Se observó una correlación positiva entre la longitud y la fecundidad sólo en los Siluriformes y en el Perciforme P. squamosissimus. En general, para las especies analizadas, hubo una dominancia de hembras, asimismo, estas mostraron mayores longitudes y pesos que los machos. Los mayores índices gonadosomáticos se registraron en subida de aguas y aguas bajas, mientras que el factor de condición fue mayor en aguas altas. Finalmente, la comunidad íctica mostró una actividad reproductiva intensa durante subida de aguas y moderada durante aguas bajas.

Kajian perikanan pada tembakang (Helostoma temminckii) di Rawa Bawang Juyeuw Kabupaten Tulang Bawang Barat dilakukan untuk mempelajari potensi biologinya. Kajian ini diperlukan sebagai data dasar domestikasi tembakang sebagai ikan budidaya dan konservasi. Hasil penelitian menunjukkan bahwa waktu terbaik untuk penangkapan tembakang ukuran benih sampai dewasa adalah pada Maret sampai April dengan menggunakan jaring tancap yang tidak mematikan tembakang. Morfologi tembakang pada ukuran yang berbeda menunjukkan stok yang belum tereksploitasi dan layak dijadikan plasma nutfah perikanan tangkap dan budidaya yang berkelanjutan. Pada ukuran benih sampai dewasa isi pencernaan tembakang didominasi oleh plankton sebagai makanan utamanya. Masyarakat lokal disarankan untuk menjadikan tembakang sebagai alternatif sumber protein hewani selain ikan eksotis yang mulai banyak berkembang di Rawa Juyeuw.

In this study, condition factor values, length-weight and length-length relationships of totally 155
Prussian carp, Carassius gibelio (Bloch, 1782) specimens, captured from Lake Ladik between November
2009 and October 2010, were examined. Sex composition was 93.5 % female and 6.5 % male. Fork
lengths of samples ranged from 13.4 cm to 26.5 cm and weights ranged from 58 g to 550 g. Condition
factor values varied between 2.201 and 3.238. Mean condition factor of all individuals was calculated as
2.676. Length-weight relationship was found as W=0.0168L3.149 (r2
=0.988) for all specimens. According
to b value of length-weight relationship, the growth of species was positive allometric (b>3, P<0.001). All
correlations among total length, fork length and standard length were highly significant (P<0.001).

In 1986, a new species of the genus Lipophrys, L. heuvelmansi, was described by the ichthyologist
François Charousset. On the basis of two sampled specimens from the Adriatic Sea (Croatia),
the author made a detailed description of the new species. From the author’s description, we noticed
a striking resemblance between this species and Microlipophrys canevae (Vinciguerra, 1880). In order
to eliminate any doubt about the identity of this fish, we analyzed the paratype preserved at the Zoological
Museum of Lausanne (Switzerland) and compared it with a male specimen of Microlipophrys
canevae sampled in the Tyrrhenian Sea (Italy). From this comparison, we can establish that Lipophrys
heuvelmansi Charousset, 1986 should be considered junior synonym of Microlipophrys canevae (Vinciguerra,
1880).

Recent pelagic and benthic trawling activities over the Brazilian continental slope between 11° and 23°S captured nine species representing five genera of the stomiiform family Sternoptychidae. Among these, three species are new records for Brazilian waters: Sternoptyx pseudodiaphana, Argyripnus atlanticus, and Polyipnus sp. The known distributions of Argyropelecus aculeatus and Maurolicus stehmanni along the Brazilian coast are extended northward to 13°S and 16°S, respectively, while that of Sternoptyx diaphana is extended southward to 13°S. Argyropelecus hemigymnus, Argyropelecus sladeni, and Sternoptyx pseudobscura were rarely caught (n=2-16). A key to the western South Atlantic species of Sternoptychidae is provided.

EnglishDue to the delay in publication of the journal &quot;Eurasia Antiqua&quot;, reports of the ongoing excavation have appeared elsewhere in recent years. The present report includes the excavations from the years 2012 through 2016. The discovery of a large lake fed by the Danube can be seen as the most noteworthy result within this report. Along the bank of this lake lay the neolithic anc Copper Age settlement, and the origin of the lake can be placed sometime in the 8th millennium BCE and persisted inteo the first millennium CE. The main focus of the excavations in recent years was the investigation of the outer settlement, in which not only Copper Age but also Neolithic settlement remains have come to light. The quality of perservation in the outer settlement differs: the settlement layers lie partially under a colluvium layer, which ranges in places from 0,5-1,7 m in thickness. The flat settlement and the settlement upon the tell mount persisted simultaneously throughout the (calculated) duration of the settlement; fuerthermore, teh flat settlement seems to have existed for some time before the erection of the settlement mound. According to 14C dates, the oldest settlement remains can be placed in the late 6th millennium BCE. A necropolis has not yet been identified, but burials have instead been discoveren in nearly every surface of the outer settlement, including a mass grave. Burials mostlyexhibit individuals in a crouched position, The Neolithic settlement remains allow us to update our knowledge on the Boian Culture. The excavation results in Pietrele provide us with an opportunity to describe the beginning of a Copper Age settlement mound from the Neolithic settlementactivities, allowing for a better understanding and description of the change from the Neolithic to the Copper Age economic system, whose drastic changes in tchnology and economy are already making themselves known. for instance, a transition from organic to mineral temper took place within the ceramic industry, and even the silex sindustry during the Gumelnita period differs from the late Neolithic flint tools. The technical and economic differences even include cattle breeding and hunting activities: the former played a larger role during the Gumelnita period. Harpoons made of antler can be counted among the fishing tools as a Copper Age innovation, which likely were used in order to hunt very large fish. In 2013, the circular earthwirk complex was investigated, which lies about 680 air-line meters away. A ca. 10 m wide (still 3 m at the base) and 3.7 m deep trench was recorded here, whose filling material can be attributed to a Bronze Age complex belonging to the Tei Culture. This indicates possibly more intense settlement activityon the Lower Danube during the Bronze Age of the second millennium BCE. The 14C dates indicate a relatively short settlement duration spanning from 1400-1300 BCE. DeutschBedingt durch das verspatete Erscheinen der Zeitschrift Eurasia Antiqua wurde in den vergangenen Jahren an anderer Stelle uber der Fortgang der Grabungen berichtet. Im vorliegenden Bericht werden die Jahre 2012-2016 dargestellt. Als Hauptergebnis der Untersuchungen dieser Zeit darf die Identifizierung eines grossen Sees gelten, der durch die Donau gespeist wurde. Die neolithische und kupferzeitliche Siedlung lag direkt am Seeufer. Die Entstehung des Palaosees &quot;Locul Gorgana&quot; durfte bereits im 8.Jt. v. Chr. anzusetzen sein. Er existierte bis in das 1. Jt. n. Chr. Im Mittelpunkt der archaologischen Arbeiten stand insbesondere die Erforschung der Aussensiedlung. Hier haben sich sowohl kupferzeitliche als auch neolithische Siedlungshinterlassenschaften eingstellt. Die Erhaltungsbedingungen der Aussensiedlung sind sehr unterschiedlich. Die Fundschichten der Aussensiedlung liegen teilweise unter einrm bis zu 1,7 m machtigen Kolluvium, teilweise auch nur etwa 0,5 m tief. Die Flachsiedlung bestand wahrend der gesamten bisher nachgewiesenen Dauer der Desiedlung auf dem Siedlungshugel. Die Flachsiedlung existierte daruber hinaus bereits geraume Zeit bevor der Siedlungshugel errichtet wurde. Die altesten Besiedlungsreste gehoren nach 14C-Daten in das spate 6. Jt. v. Chr. Eine Nekropole konnte noch nicht identifiziert werden. Stattdessen wurden mittlerweille in fast allen Flachen der Aussensiedlung Bestattungen entdeckt, darunter auch ein Massengrab. Inzwischen liegen zahlreiche Bestattugen meist in Hockerlage vor. Die neolithischen Siedlungsreste werden eine Aktualisierung der bisherigen Arbeiten zur Boian Kultur gestatten. In Pietrele besteht zudem die Moglichkeit, den Beginn eines kupferzeitlichen Siedlungshugels aus den neolithischen Siedlungsgeschehen heraus zu beschreiben. Damit kann der Weschsel vom neolithischen zum chalkolithischen Wirtschaftsystem besserbeschrieben werden. Bereits jetzt lassen sich tiefgreidende Veranderungen von der neolithischen zur kupferzeitlichen okonomie und Technik erkennen. In der Keramik ist mit dem Ubergang von…

Au terme de cette étude, neuf espèces de Nématodes ont été inventoriées:-Cet inventaire, non exhaustif, ouvre des perspectives sur une connaissance plus approfondie de l'ichtyofaune de haute mer , car les connaissances concernant les grandes bathymétries demeurent encore insuffisantes. Introduction Les parasites de poissons de haute mer représentent le moyen le plus fiable de récolte d'informations sur la biodiversité des écosystèmes profonds souvent inaccessibles par d'autres moyens-Ce travail, est un inventaire des Nématodes parasites de poissons gadidés de la côte oranaise, Phycis blennoides, Phycis phycis Mora moro et Micromesistius poutassou suivi d'une étude écologique du parasitisme afin d'établir autant que possible des liens entre la cinétique des infra populations de Nématodes, les milieux hôtes, géographiques ainsi que les fluctuations saisonnières.

External skin brooding evolved independently in several groups of fishes. Cotylephores, sites for the attachment of developing embryos, occur within the fused pelvic fins of the ghost pipefishes, Solenostomus, on the ventral surface of the South American catfish, Platystacus, and on other aspredinid cattfishes of the tribe Aspredini. Cotylephores are transient outgrowths of tissue that occur only on brooding fish. They consist of a pedicle that extends from the abdomen or fin and terminates in an apical calyx. The calyx supports and adheres to the egg envelope that encloses the developing embryo. The pedicle of the catfish cotylephore is a single, large structure (1615 ± 23.25 µm), while those of ghost pipefishes are small and branched (687 ± 3.89 µm; number of branches: 26 ± 0.63). In both instances, a simple cuboidal epithelium, whose cells bear microplicae, encloses an extensive connective tissue core that contains large blood vessels that ramify into a capillary plexus in the calyx. Cotylephores of Platystacus are more heavily vascularized than those of Solenostomus and contain 34.77% more blood vessel surface area at the calyx, to which the egg envelope adheres. In addition to their role in attachment, cotylephores may function in embryonic maintenance through the exchange of gas across the egg envelope, mediated by female circulatory vessels within the cotylephore calyx. Comparisons of morphology and development suggest that cotylephores are the result of convergent evolution of a reproductive adaptation.

In hatcheries, fish are normally reared in barren environments, which have been reported to affect their phenotypic development compared with wild conspecifics. In this study, Atlantic salmon (Salmo salar) alevins were reared in conventional barren hatchery trays or in either of two types of structurally enriched trays. We show that increased structural complexity during early rearing increased brain size in all investigated brain substructures. However, these effects disappeared over time after transfer to barren tanks for external feeding. Parallel to the hatchery study, a group of salmon parr was released into nature and recaptured at smoltification. These stream-reared smolts developed smaller brains than the hatchery reared smolts, irrespective of initial enrichment treatment. These novel findings do not support the hypothesis that there is a critical early period determining the brain growth trajectory. In contrast, our results indicate that brain growth is
plastic in relation to environment. In addition, we show allometric growth in brain substructures over juvenile development, which suggests that comparisons between groups of different body size should be made with caution. These results can aid the development of ecologically sound rearing methods for conservational fish-stocking programs.

HAL is a multidisciplinary open access archive for the deposit and dissemination of scientific research documents, whether they are published or not. The documents may come from teaching and research institutions in France or abroad, or from public or private research centers. L'archive ouverte pluridisciplinaire HAL, est destinée au dépôt et à la diffusion de documents scientifiques de niveau recherche, publiés ou non, émanant des établissements d'enseignement et de recherche français ou étrangers, des laboratoires Introduction : Pour une histoire des animaux aquatiques des mers septentrionales Thierry BUQUET, Brigitte GAUVIN, Catherine JACQUEMARD & Marie-Agnès LUCAS-AVENEL 2018  53  2 anthropozoologica art. 53 (2)-Publié le 30 janvier 2018 www.anthropozoologica.com Anthropozoologica est une revue en flux continu publiée par les Publications scientifiques du Muséum, Paris, avec le soutien de l'Institut des Sciences Humaines et Sociales du CNRS.

During an ichthyological survey in September 2015 at the Ceará-Mirim River estuary, Rio Grande do Norte State, northeastern Brazil, we collected a male of Kryptolebias hermaphroditus, a cynolebiid species that had been previously described as containing exclusively self-fertilizing hermaphrodites. This is the first record of a male in this species, over 140 years after the discovery of the mangrove rivulid species from Brazil. Our discovery reinforces the need for more studies in K. hermaphroditus, as well as the potential of this species as a model for evolutionary studies due to its unique mating system. Durante uma amostragem ictiológica em setembro de 2015 no estuário do rio Ceará-Mirim, Estado do Rio Grande do Norte, Nordeste do Brasil, nós coletamos um macho de Kryptolebias hermaphroditus, uma espécie de rivulídeo que foi descrita como contendo apenas hermafroditas auto-fertilizantes. Este é o primeiro registro de um macho dessa espécie, mais de 140 anos depois da descoberta das espécies de rivulídeos de manguezais do Brasil. Nossa descoberta reforça a necessidade de mais estudos em K. hermaphroditus, assim como, o potencial desta espécie como um modelo para estudos evolutivos devido ao seu sistema reprodutivo único.

... 1–6. © Allerton Press, Inc., 2011 ... of amplification of a 734 bp fragment of the hLF gene using pair of primers GL F (5&amp;#x27; TGTCTTC CTCGTCCTGCTGTTCC 3&amp;#x27;) and GL R (5&amp;#x27; CAT ACTCGTCCCTTTCAGCCTCG 3&amp;#x27;). Amplification was carried out in the Perkin Elmer thermocycler ( ...

Knowledge of taxonomy, systematics and life histories of the skates that inhabit the Gulf of California is scarce. Five species have been documented in the Sea of Cortez: R. cortezensis, R. equatorialis, Raja inornata, R. rhina and R. velezi. The California skate (R. inornata) is the most abundant species caught as by-catch during the hake trawl fishery in the Gulf. Intraspecific variation in the external morphology of R. inornata from the northern Gulf of California, México is described on the basis of 24 proportional morphometric variables from 45 males (227-525 mm total length TL) and 52 females (226-690 mm TL). Males and females had 9 and 14 proportional dimensions respectively that were isometric with total length (TL). Regression slope and elevation analysis revealed that 9 relationships between TL and morphometric variables were sexually dimorphic. A stepwise discriminant function separated three groups of skates (females and males of R. inornata and males of Raja cortezensis) and was able to correctly classify 97%, 100% and 100% of the original grouped cases, respectively. The variables that best discriminated between species and sexes were preorbital length, preoral length, distance between fifth gill openings, maximum distance between pelvic fins, and distance from cloaca to anterior caudal fin. The study also revealed that several of the meristic characters examined showed considerable variation and, therefore, should be used with caution in taxonomic studies.

Geijsteren; Water en cultuurhistorie ordende principes voor het beekdal Oostrumse beek. Een excursie van de KNNV, Koninklijke Nederlandse Natuurhistorische Vereniging in het beekdal Oostrumse beek in Geijsteren.
Een landschapsbiografische en Cultuur historische studie van landgoed Geijsteren.

La grotte du Bourrouilla a Arancou, Pyrenees-Atlantiques, decouverte en 1986, avait ete affectee par une fouille clandestine dont les deblais ont ete tamises sous l&#39;eau, livrant des restes lithiques et fauniques abondants ainsi que des oeuvres d&#39;art mobilier en os et bois de Cervide, attribuables au Magdalenien. Un sondage important effectue a l&#39;exterieur mit en evidence trois ensembles de couches contenant un possible Azilien, du Magdalenien superieur et un possible Magdalenien moyen. Les datations carbone 14 des ossements provenant du sondage confirment l&#39;appartenance des niveaux dates au Magdalenien superieur et moyen. Les resultats de ces datations sont compares a ceux obtenus anterieurement pour d&#39;autres sites de la region pyreneenne. Les deux series d&#39;outillage lithique du sondage et des deblais de la fouille clandestine sont attribuees au Magdalenien moyen et superieur a final. Les vestiges decouverts dans le sondage ont beneficie de nombreux remontages, d&#39;un classement sommaire par categorie de matieres premieres et d&#39;une etude typo-technologique. L&#39;outillage recueilli dans les deblais de la fouille clandestine complete les donnees typologiques de la fouille. L&#39;outillage en matieres dures animales, os et bois de Cervide, est varie et comporte des aiguilles a chas, des harpons a double rang de barbelures, des sagaies a biseau simple ou double, ainsi qu&#39;une piece en os portant une douille et qui a du servir a l&#39;emmanchement. Les sagaies fourchues caracteristiques du Magdalenien pyreneen ont ete trouvees dans le sondage au dessous des couches a harpons. L&#39;un des objets les plus caracteristiques du site est une lame d&#39;os sur cote refendue et polie, faconnee en forme de canif et souvent decoree. Les parures sont principalement des incisives sciees et des craches de Cerf percees. Des dechets de debitage sur os et bois de Cervide indiquent les techniques de debitage par rainures doubles et

EnglishDue to the delay in publication of the journal &quot;Eurasia Antiqua&quot;, reports of the ongoing excavation have appeared elsewhere in recent years. The present report includes the excavations from the years 2012 through 2016. The discovery of a large lake fed by the Danube can be seen as the most noteworthy result within this report. Along the bank of this lake lay the neolithic anc Copper Age settlement, and the origin of the lake can be placed sometime in the 8th millennium BCE and persisted inteo the first millennium CE. The main focus of the excavations in recent years was the investigation of the outer settlement, in which not only Copper Age but also Neolithic settlement remains have come to light. The quality of perservation in the outer settlement differs: the settlement layers lie partially under a colluvium layer, which ranges in places from 0,5-1,7 m in thickness. The flat settlement and the settlement upon the tell mount persisted simultaneously throughout the ...

Stomach contents were analyzed from 109 individuals. A total of 4 Genera and 14 Species were identified. Crustaceans accounted for %N=67.39% , %IRI= 86.37% of the total identified taxa and Teleosts %N=32.61% (%IRI = 13.63%). An ontogenetic change was observed in P. volitans diet.

Stomach contents were analyzed from 109 individuals. A total of 4 Genera and 14 Species were identified. Crustaceans accounted for %N=67.39% , %IRI= 86.37% of the total identified taxa and Teleosts %N=32.61% (%IRI = 13.63%). An ontogenetic change was observed in P. volitans diet.

A study on the sexual cycle of the European anchovy, the pelagic fish Engraulis encrasicolus (Linnaeus, 1758) (Clupeiformes Engraulidae), was carried out in Algerian East coasts over a year (July 2008-June 2009). Annual sex-ratio (SR) showed that females dominate with an average male sex-ratio of 39.35%. The European anchovy spawning period ranges from April to October with peaks in the warmest months, strictly dependent on temperature. The go nado-somatic index was updated monthly which allowed us to divide the entire cycle into four successive phases: (i) a phase of slow maturation which occurs between the end of winter and the beginning of spring; (ii) a phase of significant sexual activity; (iii) a phase of emission of the sexual products which corresponds to the warmest months; and, finally, (iv) a phase of sexual rest occurring in the coldest months. Monthly variation of either hepato-somatic index or mesenteric fat reserves informed us about the origin of the energetic deposi...

Stomach contents were analyzed from 109 individuals. A total of 4 Genera and 14 Species were identified. Crustaceans accounted for %N=67.39% , %IRI= 86.37% of the total identified taxa and Teleosts %N=32.61% (%IRI = 13.63%). An ontogenetic change was observed in P. volitans diet.

HAL is a multidisciplinary open access archive for the deposit and dissemination of scientific research documents, whether they are published or not. The documents may come from teaching and research institutions in France or abroad, or from public or private research centers. L'archive ouverte pluridisciplinaire HAL, est destinée au dépôt et à la diffusion de documents scientifiques de niveau recherche, publiés ou non, émanant des établissements d'enseignement et de recherche français ou étrangers, des laboratoires Introduction : Pour une histoire des animaux aquatiques des mers septentrionales Thierry BUQUET, Brigitte GAUVIN, Catherine JACQUEMARD & Marie-Agnès LUCAS-AVENEL 2018  53  2 anthropozoologica art. 53 (2)-Publié le 30 janvier 2018 www.anthropozoologica.com Anthropozoologica est une revue en flux continu publiée par les Publications scientifiques du Muséum, Paris, avec le soutien de l'Institut des Sciences Humaines et Sociales du CNRS.