A vertebrate homolog of the actin-bundling protein fascin

BB Biochi~ic~a ELSEVIER et Biophysica A~ta Biochimica et Biophysica Acta 1219 (1994) 184-188 Short Sequence-Paper A vertebrate homolog of the actin-bundling protein fascin Joost C.M. Holthuis, Vincent T.G. Schoonderwoert, Gerard J.M. Martens * Department of Animal Physiology, University of Nijmegen, Toernooit,eld, 6525 ED Nijmegen, The Netherlands (Received 21 March 1994) Abstract Sea urchin fascin and the Drosophila singed gene product form a unique class of actin cross-linking proteins involved in the bundling of filamentous actin by an as yet unknown mechanism. From a Xenopus laevis intermediate pituitary cDNA library we have isolated a cDNA encoding a 53-kDa protein that shares approximately 36% amino acid sequence identity with both fascin and the singed gene product, and thus likely represents a vertebrate homolog of these actin-bundling proteins. RNase-protection experiments revealed that in Xenopus the gene is expressed in a wide variety of tissues but with the highest levels of expression in oocytes and testis. This raises the possibility that fascin has a role in microfilament dynamics associated with the formation and/or fertilization of vertebrate germ cells. Key words: Fascin homolog; cDNA sequence; Gene expression; (X. laelqs) Filamentous actin (F-actin) forms a dynamic array of bundles and networks that participates in many cellular activities such as locomotion, cell shape changes, cytokinesis, positioning of intrace[lular organelles, cytoplasmic streaming and attachment to substratum. This highly-ordered arrangement of F-actin is dictated by actin cross-linking proteins which, according to their functions and shapes, can be divided into two groups (see [1] for review). Spectrin, fodrin and filamin belong to the group of gelation proteins that, due to their enormous size and flexibility, can form a loose and open actin network. The second group includes the actin-bundling proteins villin, fimbrin and fascin, small monomeric proteins that cross-link parallel arrays of closely packed actin filaments. Fascin, a 55-kDa protein purified from sea urchin egg extracts, was one of the first proteins shown to bundle F-actin in vitro [2]. In sea urchin, the protein participates in the organization of F-actin into small bundles or rods that eventually form the cores of transient cellular projections. Fascin is involved in the formation of filopodia * Corresponding author. Fax: +31 80 652714. The sequence data reported in this paper have been submitted to the E M B L / G e n B a n k Data Libraries under the accession number X75938. 0167-4781/94/$07.00 © 1994 Elsevier Science B.V. All rights reserved SSDI 01 6 7 - 4 7 8 1 ( 9 4 ) 0 0 0 9 3 - I which emerge from coelomocytes after hypotonic shock [3] and in the development of microvilli on fertilized eggs [4]. In subsequent studies fascin was localized to the actin bundles of starfish oocyte spikes [5] and sperm acrosomal processes [6]. The recent cloning and sequence analysis of a sea urchin fascin c D N A revealed that the protein lacks the actin-binding domain characteristic of other actin cross-linking proteins [7]. Moreover, it was found that fascin is a homolog of the Drosophila singed gene product. The singed gene has a role both in somatic cells during the formation of adult bristles and hairs, and in the female germline during oogenesis [8]. Here we report the molecular cloning and expression of Xenopus fascin, a vertebrate member of this separate class of actin cross-linking proteins. Our research is aimed at the identification of genes required for the proper functioning of neuroendocrine cells, and involves differential hybridization of a Xenopus intermediate pituitary c D N A library with probes derived from m R N A of biosynthetically active and inactive intermediate pituitary cells. One of the nondifferentially hybridizing c D N A clones, X1207, was further analysed as it served as a control in additional expression studies. This clone contained a c D N A insert of 2.5 kb comprising a 1473-bp open-reading frame and a 1053-bp 3'-untranslated region with a putative polyadenylation signal 15-bp upstream of the poly(A) 185 J.CM. Holthuis et al. / Biochimica et Biophysica Acta 1219 (1994) 184-188 tract (Fig. 1). A potential translation initiation site (5'-GGCACCATGA-Y; see [9]) was found at nucleotide positions 20-29. Translation from this site results in a polypeptide of 483 amino acids with a predicted molecular mass of 53 022 Da. A database search at the nucleotide sequence level revealed that 5 '- G C T C G A G C A T C T T T A C T G C G G C A C C 25 ATGAGTTCTGGACCCCTTCAACTCGGGCTCGTTAACTGCAACAACAAGTACCTCACCGCGGAGGCGTTTGGCTTC M S S G P L Q L G L V N C N N K Y L T A E A F G F i00 25 AAGATCAATGCTTCGGCCTCCAGTTTAAAGAAGAAGCAAGTGTGGAGCCTGGAGCCGGCGGGGGACGATACCAGC K I N A S A S S L K K K Q V W S L E P A G D D T S 175 50 GCCGTTTTACTTCGGAGCCACCTTGGCCGGTTCCTTTCTGCGGATAAAGATGGGAAGGTGTCCGGGGAGAGCGAT A V L L R S H L G R F L S A D K D G K V S G E S D 250 75 ACGGCGGGACCCGAGTGCCGCTTCTTGGTCAGTGCGCAGGGAGACGGGCGTTGGGCGCTGCAGTCCGAGTTGTTC L F 325 i00 GGCCGCTACTTTGGAGGCTCCGAGGACCGAATTAGCTGCTTCTCTCCTTCGGTATCTCCTGCCGAGAAATGGGGA G R Y F G G S E D R I S C F S P S V S P A E K W G 400 125 GTCCACCTGGCCATGCACCCCCAGTTCACCCTGTACAGCGTCACCCGCAAGCGCTACCGCCGCCTGAGTGCGAGT V H L A M H P Q F T L Y S V T R K R Y R R L S A S 475 150 GGGGACGAGTTGTCGGTGGAACGCGACGTGCCGTGGGGGGTGGACTCGCTCATCACTCTCCTCTTCCAGGAGAAC G D E L S V E R D V P W G V D S L I T L L F Q E N 550 175 CGCTACAGCATCCAGACCCCCGACCACCGCCTCCTCGCCTCCGACGGCAGCTTGAGAGAGAAGCCCGGCCCCGAC R Y S I Q T P D H R L L A S D G S L R E K P G P D 625 200 ACCGCTTACACGCTCGACATCTCCGCCGGCAAAGTGGCGTTTAGAGGCAGCGACGGGCGCTATTTAACCTCGTCC T A Y T L D I S A G K V A F R G S D G R Y L T S S 700 225 GGCCCGAGTGGCACCTTGAAGTCCGGGCAAGAACAGCAAAGCCGGGAGGACGAGTTATTCGTGCTGGAGAGAAGC G P S G T L K S G Q E Q Q S R E D E L F V L E R S 775 250 TGCCCGCAAGTGGTTCTGACTGCCGGCAACGGAGGAACGTGTCTACAAGGCAAGGTATTGATCTTTTCAGCAAAT C P Q V V L T A G N G G T C L Q G K V L I F S A N 850 275 CAGGATGAGGAGAGTGACCAGGAAACCTTTCAACTGGAAATCAACAAAGATACAAAGATGTGTGCTTTCCGGACT Q D E E S D Q E T F Q L E I N K D T K M C A F R T 925 300 CACACTGGAAAGTATTGGACCCTTTCCAGCAATGGAGGGATTCAGGCATCTGCTTCTACACTGAATAGCAGCTGT H T G K Y W T L S S N G G I Q A S A S T L N S S C i000 325 TATTTTGAAATCGACTGGTGTGACCGTAGAATCACCCTTAAAGGAGTCAATGGAAAATATGTCACAGCCAAGAAG Y F E I D W C D R R I T L K G V N G K Y V T A K K 1075 350 AATGGGCAACTGTCTGCTTCTGTAGATACACCAGGAGAGACGGAGCTCTTTTTAATGAAGCTTATTAACCGTCCC N G Q L S A S V D T P G E T E L F L M K L I N R P 1150 375 CTGATCGTTTTGAGGGGTGAACATGGTTTCATTGGCTGCCGTAAAATGACTGGGACCCTTGATAGCAACCGCTCC L I V L R G E H G F I G C R K M T G T L D S N R S 1225 400 ATTTATGATGTTTTTGAACTGGAATTCAATGATGGTGCTTACAGCCTCAAAGATGCCACTGGGAAATACTGGACT I Y D V F E L E F N D G A Y S L K D A T G K Y W T 1300 425 GTGGGAAGTGATATGTCCGTTACCAGCAGATGTCACCCTGGATGGTCTCTTGAATTCTGCGACTACAACAAAGTG V G S D M S V T S R C H P G W S L E F C D Y N K V 1375 450 GCAATTCAAAAGGTCAATGGCCTTTATCTCAAAGGTGACCACGCTGGTGTTCTGAAAGCAAATGCCGAGAACATC A I Q K V N G L Y L K G D H A G V L K A N A E N I 1450 475 T A G P E C R F L V S A Q G D G R W A L Q S E GACTsCTACCACACTCTGGGEAATACT.AAGCATAATCTGAGGeTGAATCACTAGCeATGTeTGACCTTGTATTCAAA 1525483 TGTGTCCCTTGTGCCTGTTTGCTCTTACCAGGGCAATATAATACAAATCTTGTCTTGCTTGGAGTAACCGTTCTT TGTTGCCACAATCTTAGTACCCTCTAATGTTCTATAGTAAGTTTTTAAAAACCGATCTACAAAGACATGCAGATG CGGCTAAATTGGCCCATGTCGTTTTTAATATTTGTTTACATCCATAAATAGAACTGCTTATTAACAAGGTATTTT TTAACTATGGTAGGATTCCTGAGATGACCCCCCCCCCTTGCTAGCTTTAAGAACTATATTAGTCTTTAACAGTCT TGGTGAGGAGAAAAAGAAAGAAAATGGCATCTCTTAGGAGGCACTTTAAGTGACGGCGATCATATTTTGGCAAGT ACTAGTACTAGCTACTTTGAAAAAAAAGTTTGCTTTTTTAAAAAAAAATGCAAAACTTGCACATTTAACCATTTA TGCCTAGTGGTTTTATAGGGCCGTATTCCTTCCTGTAGAAAGGTTTATGTAATTGGAAAGGTAGAATCTTAATAG TAATCCAAACAGTATTAACGTCTTTATTTACTTTCTGTCTACCAATGAACCTCATCTCAGCCTCTCTATCTCAGC AGTAAATGTAATATACTTTGTGGTGCTAAATGACAATGCTCTACATTTAAAATAACTTTCAAATGTTCATAAAAT GTACCACCTACAGATAAGTACCAAGTATTTAAAGTTTAATAACATTTGTATGTCAGTCTGGGCTATTTAAATCTC 1600 1675 1750 1825 1900 1975 2050 2125 2200 2275 2350 TCTGCCATGCGACTGACCTGAACTTCAGTTGTGACTAAAGCCTTACTTGCTGCTTCCACACTCCTGTGATTTGAT 2425 TTGTCAAGCTGCCACATGCTGATTCTATTGTCTTAAGTGCCATTTTGAGAACATAGCAGTGTAGAGAAATAAACC CATTTGTTCCAGT~, ~ 3' 2500 2542 TCTTTCTTTTAGTCACTATCTGCAGTTTATGACCAAATATACACCTATAGCACTTCTGTGGTGCAGGGCATTGTT Fig. 1. Nucleotide sequence and deduced amino acid sequence of Xenopus intermediate pituitary c D N A clone X1207. The translation termination codon is marked by an asterisk and a putative polyadenylation signal is underlined. The c D N A sequence is available from the E M B L nucleotide sequence database under accession n u m b e r X75938. 186 J.C.M. Holthuis et al. / Biochimica et BiophysicaActa 1219 (1994) 184-188 clone X1207 shares 58% identity with a cDNA encoding the 57-kDa product of the Drosophila singed gene [8] and 57% identity with a sea urchin cDNA coding for the 55-kDa actin-bundling protein fascin [7]. At the amino acid sequence level the X1207 protein displays an overal identity of 38% with the Drosophila singed gene product and 34% with sea urchin fascin (Fig. 2). Bryan et al. [7] found that sea urchin fascin lacks a clear structural relationship with known actin-binding proteins but shares 35% sequence identity with the Drosophila singed gene product. Their findings suggest that fascin is the echinoid homolog of the Drosophila singed gene product and that these proteins form a separate class of actin cross-linking proteins which they named 'the fascin family'. We conclude that clone X1207 encodes Xenopus fascin and thus represents a vertebrate member of this novel class of actin cross-linking proteins. Peptide sequence information from a 55-kDa actin-bundling protein isolated from HeLa cell extracts revealed that fascin also exists in human [7,10]. This protein has been previously co-localized with the actin bundles in stress fibers and microspikes of cultured mammalian cells [11]. As shown in Fig. 2, the polypeptide sequence of the 55-kDa HeLa cell protein S X1207 : singed: fascin: p X1207 : singed: ~ l m < Q © ~ ~1' ~Y s N • ~ fascin: A RIQ V W I L ~ _ ~ Q E E S S X1207 : m ~ sinaed: S E fascin: ~ P ~ X1207 : singed: fascin: ~ ] T ~ I G H~R~A ~Q singed: fascin: 55 kDa : - H ~I- T K A ~ PLOL iiN N L K Y K F C -L S s ~ i T PlDIK[E] v N G E E~JI ~~__~F-qN QIA S A ~ I ~ G I H IK~N~JFIIlL E D S CrQ__~PQ[G E F~JIK DIG E[b_EJAIL EIQISlS AIQI X1207 : singed: fascin: KD~KMC~F~ W S A H R W V E[~D K Y X1207 -T L K G VING G~T C LN L R~V~ -~K~AISIL Q E I~JE L v ~ v K ~ I ~ -ili ~ O GIEID IK D ~ Vl- S~K 138 159 142 186 210 195 263 247 iii . . . . . . -~HT i G K~Y--W~T~S NIG G I Q A S A S T L N - S S ~ Y ~ I D~C D R R I D R~WIC L~A G GL~G I Q A T ~ R R C AID~LIF E~L I W ~ J H ~ D G S V C D P K K N $ R A K~JF W ~ K - T V h AIG I Q A N ~ S K D Q TID CIQIF~S V E Y N ~ J N D M 336 360 351 ~ K ~ S V D T P G~T E L~L - - K D D E ~o~ 90 314 298 K Y__~T A N V 37 G E N E T F Q L E Y D E~T E T F Q L E F - H V R L R ~ P GIG K Y VIS V R DIN G H L FIL Q D S P - C ~i R H 35 K - R S S[~S T RIV h K S l S ~ P G - M~T~L I N R PL~i~V L R G E H G FII~C~ I N [~]V ~ f ] ~ K V - Q~i T R I Cc~l R[S Q s S~FIA I RIA 389 ~ ~ ~I~'v~~~-~I~U ~i~ L~N R P~I~v LIK CIPIH G F V GIM L I N R P I I V R~q~H G; X1207 : ~ M T G - T ~ V D ~ I ~ E L_~F N i -~A~S~K--~A T ~ T V G S D~i singed: T P ~ N L K EIC N K ~ T ~ L I V E~R A KIGIL V HIL KIA H S R I E G E fascin: ~ E G~JK A E AIC N R SIN FID V FiT V~JT Y K -G ~ G ~ T ~ S CIG K Y WlS C D D S X1207 : ~ singed: fasein: I E -N ~ S I Q~P D H R L A E E G G~yY A~H T~JC~N~Y G K E A F[~Gt~F S P I G V D sin~ed: ~ s ~ L ~ K ~ _ < ~ y ~ m ~ s ~ I ~ u ~ ~ ~ fescin: 55 kDa: E,A ~ E L < m ~ K ~ M E ~ - ~ < ~ S[~R D ~ V ~ I ~ - - ~ L ~ Q 1 H V ~ _ ~ E N,~z~ ,, ~1 ~ i ] ~ v VF 1~L E V V LIV P W GIA D~_SJT L fascin: 55 kDa: L I i A E K ~kC~3c KkKJVIN A S C h I T uk%~3 A~T[2 GLA S E JFIW T V H L A I A RJ P Q VIN S E SIS T SIN P S~JA NIW T VIQIL AIIIH P Q VlC A K Q V V CIN E DrP~hlF S L ~ E Y H G G H L A L R DIR Q T D~__qJQ~JA G T A N~__~Q T~JQIF T LII F T S H h~h R DIN N x1=o~ : ,~ D ~,. ~ i v ~ v singed: DR~ _ ~ _ E ~ F I S I L E D S ~ J P Y Y ~ ~ K A P S GL~NIF L S A D KINIG N VIY CLCJS v E D R~_TJE D A D T S - - G ~ w ~ ~IQ s ~ ~ ~mmm~-] G SlG R W A L K N C Y - - F - G~_~W A L K NIVS H Q [ appears to be closely related to that of Xenopus fascin, sharing 69% sequence identity over a total of 36 amino acids. To get insight into the physiological relevance of fascin in a vertebrate organism, we studied the expression characteristics of its gene in Xenopus. We found three distinct transcripts of 3.0, 2.9 and 2.6 kb in Xenopus kidney (Fig. 3). Multiple fascin transcripts (of 3.6, 3.3 and 3.0 kb) have also been described in Drosophila where they are differentially expressed during metamorphosis and oogenesis [8]. These transcripts differ only in the lengths of their 3'-untranslated regions, probably due to alternative polyadenylation, and thus they encode the same protein. Using an RNaseprotection assay we were able to demonstrate the presence of fascin mRNA in all Xenopus tissues examined (Fig. 4). Highest levels of expression were detected in oocytes and testis. The order of the expression levels relative to that in oocytes (100%) was: testis (30%), brain (10%), ovaria (8%), lung (7%), anterior pituitary (pars distalis, 6%), kidney (3%), spleen (3%), muscle (2%), liver (1%), heart (1%), adipose tissue (1%) and pancreas (0.5%). Collectively, these data indicate that transcription of the gene is ubiquitous and is not con- V~i S I y[~--~r~_qJD H A [G]V L~-K-A-~A E N I ~ ] T ~ LY~ _ ~ i ~ T K NIGIAIF~D D G T DkD_SjAITQtg]W E F I L I K~_GJE Q S G~JL F ~ T I A NJG S E V S K DIT L w E F I R C H ~ W A D ~ _ D G S G T 399 441 468 451 483 512 496 Fig. 2. Amino acid sequence alignment of Xenopus protein X1207, the Drosophila singed gene product [8], sea urchin fascin [7] and three peptide fragments derived from a 55-kDa actin-bundling protein isolated from HeLa cells [7,10]. Gaps (-) have been introduced to achieve maximum identity. Identical amino acid residues are boxed. J.C.M. Holthuis et al. /Biochimica et Biophysica Acta 1219 (1994) 184-188 fined to specific organs. Therefore, regulation of microfilament assembly by fascin probably takes place in a large variety of cell types. On the other hand, the high levels of fascin transcripts detected in oocytes and testis suggest that the protein has a prominent role in the reorganisation of microfilaments during the formation, maturation a n d / o r fertilization of vertebrate germ cells. This notion is consistent with functional data on fascin in echinoderms and insects. For instance, it has been known for decades that mutations within the Drosophila singed gene locus interfere with oogenesis and frequently result into female sterility [12,13]• Female mutants produce only a small number of late-stage egg chambers. The few eggs laid are flaccid with shortened filaments and they do not develop. This means that, at least in the fruit fly, fascin has a critical function during oocyte development• In germ cells of echinoderms, fascin participates in the abrupt redistribution of actin filaments during transient cell shape changes. These include the appearence of microspikes 28S m 3.0 2.9 2.6 ,, " " 187 ~;...~, 18S -i ilii ¸¸ Fig. 3. Northern blot analysis of Xenopus fascin m R N A . Twenty-five /xg of total R N A from pars distalis and 7.5/zg poly(A) + R N A from kidney, heart and liver were probed with a random primed-labeled 2.5 kb c D N A insert from clone X1207 and autoradiographed at - 7 0 ° C for 7 days using two intensifying screens. Positions of 18S and 28S r R N A as well as the sizes (in kb) of three hybridizing transcripts are indicated. • ~ .~ aa O .~ t:k W o ,,, .,---fascin Fig. 4. Analysis of fascin m R N A expression in various Xenopus tissues by RNase-protection assay. A PstI fragment of clone X1207, comprising nucleotides 1 to 311 of the cDNA, was subcloned into pBluescript KS + (Stratagene). Following HindlII-linearization of the construct and in vitro transcription, radiolabeled anti-sense R N A was hybridized overnight with 2 0 / z g yeast t R N A or 10/xg total R N A from each tissue (except for muscle and pars distalis: 5 /xg total RNA). Following digestion with R N a s e - A and -T1, the R N A was loaded onto a denaturing polyacrylamide gel and autoradiographed at - 70°C for 3 days using two intensifying screens. Position of the protection signals is indicated. 188 J.C.M. Holthuis et al. / Biochimica et Biophysica Acta 1219 (1994) 184-188 o n d e v e l o p i n g o o c y t e s [5], t h e f o r m a t i o n o f t h e a c r o s o m a l p r o c e s s o n s p e r m h e a d s [6] a n d t h e e l o n g a t i o n o f egg microvilli u p o n f e r t i l i z a t i o n [4]. W h e t h e r fascin serves s i m i l a r roles in t h e v e r t e b r a t e r e p r o d u c t i v e syst e m r e m a i n s to b e e s t a b l i s h e d . T h i s w o r k was s u p p o r t e d by a P I O N I E R g r a n t f r o m t h e N e t h e r l a n d s O r g a n i z a t i o n of Scientific R e s e a r c h (NWO) and European Community grant BIOT-CT910302. [3] [4] [5] [6] [7] [8] [9] [10] [11] References [1] Matsudaira, P. (1991) Trends Biochem. Sci. 16, 87-92. [2] Kane, R.E. (1976) J. Cell Biol. 71, 704-714. [12] [13] Otto, J.J., Kane, R.E. and Bryan, J. (1979) Cell 17, 285-293. Otto, J.J., Kane, R.E. and Bryan, J. (1980) Cell Motil. 1, 31-40. Otto, J.J. and Schroeder, T.E. (1984) Dev. Biol. 101,263-273. Maekawa, S., Endo, S. and Sakai, H. (1982) J. Biochem. 92, 1959-1972. Bryan, J., Edwards, R., Matsudaira, P., Otto, J. and Wulfkuhle, J. (1993) Proc. Natl. Acad. Sci. USA 90, 9115-9119. Paterson, J. and O'Hare, K. (199l) Genetics 129, 1073-1084. Kozak, M. (1987) Nucleic Acids Res. 15, 8125-8132. Yamashiro-Matsumura, S. and Matsumura, F. (1985) J. Biol. Chem. 280, 5087-5097. Yamashiro-Matsumura, S. and Matsumura, F. (1986) J. Cell Biol. 103, 631-640. Bender, H.A. (1960) Genetics 45, 867-883. Perrimon, N. and Gans, M. (1983) Dev. Biol. 100, 365-373.