Experimental Biology Laboratory

Biol 20L Jimmy Shanks

Winter 2023

Lab 5 Protocol: Polymerase Chain Reaction (PCR) and Gel Electrophoresis

of Unknown DNA

Developed by the PDP Team: Tyler Dewitt, Veronica Urabe, and Arina Favilla

Part 1. PCR and bioinformatics analysis

Overview: In this lab, you will conduct a series of PCRs using a given set of primers that
are specific to a particular gene. Your primer set is designed to amplify one of the genes
listed in the table below; you will utilize NCBI BLASTn to identify the gene that your primer
set should amplify and the species in which it is found. Upon proper completion of this
analysis, you will be given the full-length sequence for the gene you amplified and use the
program ApE to then determine the size, in base pairs, of the expected amplicon (PCR
product). By testing your primers on all the samples provided, your goal is to identify which
sample contains DNA from the gene associated with your primer set.

Gene Name Organism Gene Description

DDX39B (Bat 1) is a spliceosome RNA helicase that is

DDX39B Homo Sapien involved in nuclear export of spliced and unspliced mRNA.
(Bat 1) (taxid: 9605)

SNRPB Homo Sapien SNRPB is a small nuclear ribonucleoprotein (snRNP) that plays a
(taxid: 9605) role in pre-mRNA splicing.

Homo Sapien SF3B3 is the splicing factor 3B subunit 3. SF3B3 is involved in

SF3B3 (taxid: 9605) pre-mRNA splicing by assisting in branch-point recognition.

Saccharomyces Whi5 is a transcriptional repressor in budding yeast. Whi5 acts to

Whi5 cerevisiae repress transcription in early G1 phase of the cell cycle by binding
S288C to repressing G1-specific promoters.
(taxid:559292)
Part 1, Protocol 1: PCR set-up

1. Here are the “stock” reagents you will use for your
reactions: 2X PCR Master mix
10 µM forward primer
10 µM reverse primer
5 ng/µL template DNA
Nuclease-free H20

2. Each PCR should have a total volume of 20 µl, a “master mix” has been created
that contains all of the PCR reagents for all your reactions except it does not
contain the template DNAs or the primers. Below, on the left are the final
concentrations, or, where appropriate, the final amounts, of each reagent you’ll
need to have in each reaction. Before you come to class, calculate the
appropriate volumes of each stock reagent and water you must add together
for each reaction (remember this will be provided for you). The first one, for
the master mix, has already been done for you.

Note: It’s generally a good idea to make a bit more “master mix” than you’ll need.
Since you will be setting up five reaction tubes, you will make enough master
mix for six reactions.

Reagent: Final Volume of stock Volume of stock reagent to

Conc/Amount reagent to add for a add to master mix (for 6 rxns)
20µl reaction

PCR Master Mix 10 60

0.5 µM forward primer

0.5 µM reverse primer

10ng template DNA (add separately)

Nuclease-free H20

Total Volume 20µL 20µL x 6 rxns = 120µL

Example calculation #1:

Problem: Assume you have a 10X stock solution but need a final concentration of 1X
in a working solution that is 100 µl (this is different than your reactions
which will be 20 µl). How much 10X stock would you add in making this
100ul working solution?

Answer: C1V1= C2V2; (10)(X) = (1)(100 µl); 10X= (1)(100 µl); add 10 µl of stock
solution.

Example calculation #2:

Problem: Assume you have a stock solution of MgCl2 that is 10 picoM (10 X 10-12
moles/L) and you need a final concentration of 1 picoM in a 20 μL reaction.
How much stock solution do you add in making your working solution?

Answer: C1V1= C2V2 (10pM)(X) = 1 pM (20 µl ); 10X = 1 (20 µl); add 2 µl of stock
solution

3. Once your calculations have been checked, you and your partner will obtain a tube
of master mix that will include buffer, dNTPs, MgCl2, TAQ polymerase and water
already in the correct proportions, and enough for 6 reactions. You will also be
given a tube of forward primer and a tube of reverse primer that make up your
primer set as well as all necessary template DNA.

• Record the letter of the primer-set you were given below:

Primer-set Letter

4. Now add the appropriate amount of each primer to your master mix, according to
your calculations in the table above.

5. Place tubes ON ICE!

IMPORTANT: Mix your master mix well by slowly and carefully pipetting up and
down, KEEP THE PIPETTE TIP SUBMERGED, this will limit bubble
formation.

6. Obtain and label five small, thin-walled PCR tubes of the same color(label the cap only NOT
the tube)
- be sure to wear gloves when removing them from the container!

7. Place tubes ON ICE! Now aliquot (distribute) the appropriate volume of the master
mix in each of the five PCR tubes; there should be an appropriate volume of
master mix so that you can then add template DNA to each tube and get a final
volume of 20 µl in each tube. (You should have some “master mix” left over.)
8. To each of the first 4 tubes, add an appropriate volume of a different DNA
template to each tube. In the 5th tube, instead of adding a DNA template,
add the same volume of water. What is the purpose of this reaction?

Note: Mix contents of each tube thoroughly by pipetting up and down slowly.

Be sure to label each tube (on the lid only) with your initials and the template
for that tube!

9. Place your PCR samples in the microcentrifuge using the adaptors for the small
PCR tubes. Spin tubes briefly (20 seconds) to make sure samples are all at
the bottom of the tubes.

10. Place labeled tubes in the rack designated by your TA. Be sure to put your
samples in the appropriate rack.

11. Once everyone’s tubes are in the racks the instructors will start the
thermocycler to run your PCRs.

PCR thermocycler parameters:

Step. Temp. (ºC) Time (seconds)

1. 95 120

2*. 95 30

3*. 55 30

4*. 72 60

5. 72 5 minutes

6. 4 ∞
*Step 2-4 will repeat 29x for a total of 30 cycles

12. Your samples will run while you proceed to the bioinformatics protocol for
Part 2 (NCBI BLASTn) after clean-up. We will remove your samples from
the thermocyclers when they are done and store your reactions at 4oC
until next week.

13. Clean-up your station and properly dispose of the PCR reagents and other
materials according to the protocol and notes indicated on the board.
• Dump Ice into the sink and place in designated area
• Sticker-labeled tubes go in the designated rack for reuse
 Part 1, Protocol 2. Bioinformatics analysis using NCBI BLAST

1. On a cleaned bench surface that has been disinfected, you may use your
computer for this bioinformatics section.

2. Go to: https://blast.ncbi.nlm.nih.gov/Blast.cgi (or google NCBI BLAST) and

select the link for “Nucleotide BLAST” (Blastn).

3. In the entry box at the very top of the page labeled, “Enter Query Sequence”,
type in your forward primer sequence for the set that you were given (refer
to the table below and fill in the table for your primer-set).

Primer Forward Primer Reverse Primer Product

Set Size
A CCAGATACACATGTAAACAA GTCGTACTTCTTTTGATTTT

B ACACTTTATTTTGGATGAAT GAGATGTCTATCTCATCAGG

C AAAAACAGATTCGGATATAA GTGATCTTAAATCCCTGTAA

D GGTAATTGTATCTGATGTCC ATAGACAAGTGATTCTGAGC

* All primer sequences are listed in the 5’ to 3’ direction

4. Restrict your species search to the relevant species and taxid information listed
on the information table on the first page. Do this by entering the
appropriate info in the "Organism" field. Enter either:
• humans (taxid:9605)
OR
• Saccharomyces cerevisiae S288C (taxid:559292)

Note: Under “Program selection” click on “somewhat similar sequences”

and the results might return faster

5. Click the blue BLAST button. Wait for results page to load (this might take a
minute or two.)

6. The list of “hits” that loads will be displayed as colored bars under the “Graphic Summary”.

• Scroll down to the “Descriptions” field and observe the species and gene
listed for the first few hits

• Omit any sample that differs from the list of potential species that
was provided to you

• Restrict yourself to hits that have a strong E-value (<0.05) and % cover
and % identity scores (ideally 100% for both). (Jimmy described these
numbers to you in the lecture)
 • Fill in the table below

Primer Species Gene E-value %-identity

Forward Primer

Reverse Primer

7. Now, at the top-left of the screen look for the button that says, “Edit and
Resubmit”. Click it and repeat steps 2-4 for the reverse primer.

8. Confirm the information provided in the table above with one of the instructors.
Using the ApE program (free download here:
http://jorgensen.biology.utah.edu/wayned/ape/) on your computer or the
computers provided in Rm 207, you will search for your two primers and
determine the predicted length that you expect the amplicon to be.

9. On your computer or one of the class computers, open the ApE file that has the
name of your target gene (these are located on Canvas under “ApE files”).

10. Search for the primers by using the shortcut “command (or control) F" (Find)

• Then type in your sequences in the search box and click "Find Next". Be
sure to record the position of each primer.

• The sequence of the reverse primer is actually the reverse complement of

the provided gene sequence. In the space below quickly write down the
reverse complement sequence in the standard 5’- 3’ orientation.

• Based on the positions of the two primers, determine the total size of the
DNA from one primer to the next (including the primers themselves) Record
the expected size of the amplicon below:

Expected Amplicon Size (bp)

Next week in lab, in part 2, you will run your PCR products on a gel to determine
which sample carried the gene associated with your primers and to confirm
you generated the expected size amplicon in the corresponding PCR.