Scribd Logo
Upload

Welcome to Scribd!

  • 632 views

    MatK PCR & Sequencing Protocols

    Uploaded by

    Pham Ha Thanh Tung
    This document provides protocols for PCR and sequencing of the matK marker, including reagents, thermocycling programs, and cleanup procedures. It describes two primer choices for PCR and sequencing of matK, and references are provided.

    Copyright:

    Attribution Non-Commercial (BY-NC)
    Download as PDF, TXT or read online from Scribd

    MatK PCR & Sequencing Protocols

    Uploaded by

    Pham Ha Thanh Tung
    632 views3 pages
    This document provides protocols for PCR and sequencing of the matK marker, including reagents, thermocycling programs, and cleanup procedures. It describes two primer choices for PCR and sequencing of matK, and references are provided.

    Original Description:

    MarK PCR sequencing protocols

    Copyright

    © Attribution Non-Commercial (BY-NC)

    Available Formats

    PDF, TXT or read online from Scribd

    Did you find this document useful?

    Is this content inappropriate?

    This document provides protocols for PCR and sequencing of the matK marker, including reagents, thermocycling programs, and cleanup procedures. It describes two primer choices for PCR and sequencing of matK, and references are provided.

    Copyright:

    Attribution Non-Commercial (BY-NC)
    Download as PDF, TXT or read online from Scribd
    Download as pdf or txt
    632 views3 pages

    MatK PCR & Sequencing Protocols

    Uploaded by

    Pham Ha Thanh Tung
    This document provides protocols for PCR and sequencing of the matK marker, including reagents, thermocycling programs, and cleanup procedures. It describes two primer choices for PCR and sequencing of matK, and references are provided.

    Copyright:

    Attribution Non-Commercial (BY-NC)
    Download as PDF, TXT or read online from Scribd
    Download as pdf or txt
    of 3
    At a glance
    Powered by AI
    The document outlines the PCR and sequencing protocols for amplifying and sequencing the matK chloroplast DNA barcode marker from plant specimens.

    The first choice primers are matK-xf and matK-MALP with the following PCR conditions: 98°C for 45 seconds, 35 cycles of 98°C for 10 seconds and 54°C for 30 seconds and 72°C for 40 seconds, and a final extension of 72°C for 10 minutes. The second choice primers are MatK-1RKIM-f and MatK-3FKIM-r with the following PCR conditions: 98°C for 45 seconds, 35 cycles of 98°C for 10 seconds and 52°C for 30 seconds and 72°C for 40 seconds, and a final extension of 72°C for 10 minutes.

    The steps are: diluting the PCR product with water, using specific primers for sequencing depending on which PCR primers were used, setting up the sequencing reaction, thermocycling the sequencing reaction, cleaning up the sequencing product using a Sephadex column, drying and freezing the cleaned up product.

    PCR and Sequencing Protocols - matK

    I. PCR protocol for matK marker Note: Phusion High-Fidelity DNA polymerase was tested on a broad range of plant taxonomic groups and selected as the enzyme with the highest performance for PCR amplification of the chloroplast barcode markers. First choice matK primers Forward: matK-xf TAATTTACGATCAATTCATTC Reverse: matK-MALP ACAAGAAAGTCGAAGTAT Second choice matK primers MatK-1RKIM-f ACCCAGTCCATCTGGAAATCTTGGTTC MatK-3FKIM-r CGTACAGTACTTTTGTGTTTACGAG PCR reagents per 10 L reaction # of reactions 5X HF Buffer (with MgCl2) 100% DMSO 10 mM dNTPs 10 M Primer Forward 10 M Primer Reverse ddH2O Phusion High Fidelity Fisher Scientific #-530 (5U/ L) Total DNA template 1 2 L 0.3 L 0.2 L 0.5 L 0.5 L 5.375 L 0.125 L 100 200 L 30 L 20 L 50 L 50 L 537.5 L 12.5 L Ford et al. 2009 Dunning & Savolainen, 2010 Ki-Joong Kim, pers. comm. Ki-Joong Kim, pers. comm.

    9 L 900 L 1 L per reaction

    Recommendation: taking into account pipette error, aliquot approximately 73 L of the PCR cocktail in each of the upper 12 wells of the plate. Using a 12-channeled pipette, transfer approximately 8.7 L of the PCR cocktail into each well. Add 1 L of DNA. Centrifuge the plate before thermocycling. PCR Thermocycling Program for matK marker First choice matK primers: 98C for 45 seconds; 35 cycles of 98C for 10 seconds, 54C for 30 seconds, 72C for 40 seconds; final extension 72C for 10 minutes.

    November 2013

    Prepared by Masha Kuzmina, PhD.

    Second choice matK primers: 98C for 45 seconds; 35 cycles of 98C for 10 seconds, 52C for 30 seconds, 72C for 40 seconds; final extension 72C for 10 minutes. II. Sequencing protocol for matK marker Dilute PCR product adding 40 L of water in each well. Centrifuge the plate. For the first choice PCR use primers: MatK-1RKIM-f ACCCAGTCCATCTGGAAATCTTGGTTC Reverse: matKACAAGAAAGTCGAAGTAT MALP Ki-Joong Kim, pers. comm. Dunning & Savolainen, 2010

    For the second choice use the same primers those were used for PCR Sequencing reagents per 10 L reaction # of reactions 5X Sequencing Buffer 100% DMSO 10 M primer BigDye ddH2O Total Diluted DNA 1 104 1.875 L 195 L 0.355 L 37 L 1 L 104 L 0.250 L 26 L 5.520 L 574 L 9 L 936 L 2 L per reaction

    Recommendation: taking into account pipette error, aliquot approximately 78 L of the sequencing mix in each of the upper 12 wells of the plate. Using a 12-channeled pipette, transfer approximately 9.5 L of the PCR cocktail in each well. Add 2 L of DNA. Centrifuge the plate before thermocycling. Sequencing Thermocycling Program for matK marker matK Forward (matK-KIM-1R-f) 94C for 10 seconds; 35 cycles of 94C for 20 seconds, 48C for 20 seconds, 60C for 4 minutes; hold at 4C. matK Reverse (matK-MALP-R) 94C for 10 seconds; 35 cycles of 94C for 20 seconds, 50C for 20 seconds, 60C for 4 minutes; hold at 4C.

    November 2013

    Prepared by Masha Kuzmina, PhD.

    Sequencing Cleanup Add Sephadex powder to the Acroprep 96 filter plate. The standard amount of powder is measured by a column loader. Add 300 L of dH2O. Let Sephadex hydrate for 2 hours at room temperature or overnight at 4C. Assemble the Sephadex plate onto collection plate and centrifuge at 2100 rpm for 5 minutes. Immediately proceed to loading sequencing product onto the Sephadex columns to avoid drying. Use a fresh plate as a collecting plate. Centrifuge at 2100 rpm for 5 minutes. Dry the cleanup product at 88C for 20 minutes, then cover the plate with a rubber lid and place in the freezer at -20C until it is placed in ABI capillary sequencer. * The front panel of the plate should be labeled by the standard order number generated by Smithsonian GeneSifter (https://smithsonian.genesifter.net/login).

    References Dunning LT, Savolainen V (2010) Broad-scale amplification of matK for DNA barcoding plants, a technical note. Botanical Journal of the Linnean Society 164: 19. Ford CS, Ayres KL, Haider N, Toomey N, van-Alpen-Stohl J, et al. (2009) Selection of candidate DNA barcoding regions for use on land plants. Botanical Journal of the Linnean Society 159: 111.

    November 2013

    Prepared by Masha Kuzmina, PhD.

    You might also like