EMILY COOK

KYLE WINGFIELD
2/1/2016
GEL ELETROPHORESIS OF RESTRICTION DIGESTS AND
MINISATELLITE ANALYSIS OF HUMAN D1S80 VNTR LOCUS
There will be a short learning catalytics at the beginning of lab.
Goals: 1) Run an agarose gel to determine if the restriction digests from last week worked. 2) Isolate DNA from cheek
cells and 3) PCR amplify the D1S80 VNTR.
Part 1: Gel electrophoresis.
CAUTION! ALWAYS WEAR GLOVES WHEN TOUCHING A GEL OR GEL BOX. GELS USUALLY CONTAIN ETHIDIUM
BROMIDE WHICH IS A MUTAGEN.
Agarose is a gelatinous substance isolated from red algae. An agarose gel is made such that it has wells (or
indentions) that DNA can be placed into. Often agarose gels are also made so that they contain ethidium bromide (we will
discuss this below). The gel is submerged in a buffer which helps maintain pH, and provide ions to support conductivity during
the electrophoresis process. The DNA is loaded into the well of the agarose gel while the gel is submerged in the buffer;
therefore, the DNA must have something to make it sink through the buffer and stay in the well. To make the DNA stay in the
well, before the DNA is loaded it is mixed with loading dye. Loading dyes contain dyes which allow you to check the progress of
gel electrophoresis. In addition, loading dyes contain glycerol (or similar chemicals) which make the DNA sample heavy. The
glycerol causes the DNA to sink through the buffer and stay in the well when the samples are loaded onto the gel. After the
samples are loaded, the gel is placed in an electric field. The DNA migrates through the agarose matrix and is separated based
on its size. DNA has an overall negative charge and will migrate toward the positive electrode. Large pieces of DNA have a
difficult time migrating through the agarose matrix and remain near the top of the gel (near the well). Shorter pieces of DNA
easily migrate through the agarose matrix and migrate further away from the well. When DNA of an unknown size is loaded onto
a gel it must be run through the gel next to a DNA of known size (a molecular marker or standard). Comparing your DNA with the
molecular marker allows you to determine how large your DNA is.
After the DNA is separated, the gel is placed under UV light. Since the gel contains ethidium bromide (EtBr) the DNA
can be observed under UV light. This is because EtBr incorporates into the DNA. When EtBr is exposed to UV light, it fluoresces.
Thus, the DNA can be visualized on a gel because the EtBr in the DNA fluoresces (see figure below).

Figure 1: Sample gel electrophoresis.

The DNA is fluorescent because it
have EtBr incorporated into it and is
being exposed to UV light.

As mentioned above, in order to determine the size of your DNA fragments, you must run a marker (or a standard)
along with your samples. The markers consist of a variety of DNA fragments that are of known size. We will use lambda DNA
digested with the restriction enzyme PstI. The marker is shown in the figure below. The goal of the lab last week was to make
more marker DNA so that we have enough marker to run gels throughout the semester.
Please watch this video https://www.youtube.com/watch?v=Wwgs-FjvWlw. The instructor will expect that you have some idea of
how to load a gel.

Figure 2-DNA
fragments of
lambda PstI marker.

PROCEDURE
A. Prepare your restriction enzyme digests from last week.
Recall that last week you digested lambda DNA with either EcoRI, HindIII or PstI. This week we need to load these
samples on a gel to analyze the results of our digests. In order to run DNA on a gel, it must be mixed with a loading buffer. The
loading buffer contains a dye and glycerol. The dye helps us visualize the electrophoresis process and the glycerol makes the
DNA sink to the bottom of the well during the loading process.
Loading dye comes in a 6X concentration; the final concentration needs to be 1X. You will be adding the 6X loading dye to your
restriction enzyme reaction from last week.
What was the total volume of your restriction enzyme reaction from last week?
20l
How much 6X loading dye do you need to add to your restriction enzyme reaction so that the final concentration of loading buffer
is 1X? (Another way to think about this is that the loading buffer needs to make up 1/6 of your FINAL volume and your FINAL
volume contains both loading buffer and restriction enzyme reaction. Hint: what is the next number above 20 that is divisible by
six? What is the difference between that number and 20? That is how much 6X you add!)
4l

Introduction to DS180 genotyping

Several types of repetitive DNA have found utility in DNA fingerprinting: Variable Number of
Tandem Repeats (VNTRs) or minisatellites, and Short Tandem Repeats (STRs) or
microsatellites. VNTR core sequences can range from 7-100 bps in length, while STR core
sequences are less than 5 bps long. The number of repeats vary considerably.
The D1S80 locus on human Chromosome 1 contains a 16 bp VNTR (consensus:
AGGACCACCAGGAAGG). The smallest allele contains 14 repeats, while the largest alleles
contain up to 72 repeats. In a 1992 analysis of almost 3000 randomly-chosen individuals,

the most common alleles contained 18 and 24 repeats, while the rarest contained 14 and
38.
We will be using a thermocycler to carry out the Polymerase Chain Reaction (PCR) as a way
of specifically amplifying the D1S80 locus from our isolated human genomic DNA.
The primers used in this experiment anneal to sequences flanking the VNTR, and generate a
PCR product that is 145 bp larger than the size of the actual repeat region.
D1S80 Forward primer:

5GAAACTGGCCTCCAAACACTGCCCGCCG

D1S80 Reverse primer:

5GTCTTGTTGGAGATGCACGTGCCCCTTGC
D1S80

References:
http://www.ncbi.nlm.nih.gov:80/books/bv.fcgi?rid=genomes.section.5545
http://www.ncbi.nlm.nih.gov/gquery/gquery.fcgi?term=D1S80
Budowle, B. et al. (1992) J. Forensic Science 40:38
Part 2: DNA isolation Procedure

1.

Pour 10 ml of the saline solution (0.9% NaCl) into mouth and vigorously swish for 30 seconds.

2.

Expel saline solution into a paper cup.

3.

Swirl to mix cells in the cup and transfer 1 ml (1000 l) of the liquid to 1.5 ml tube.

4.

Place your sample tube, together with other student samples, in a balanced configuration in a
microcentrifuge, and spin for 1 minute.

5.

Carefully pour off supernatant into paper cup or sink. Be careful not to disturb the cell pellet at
the bottom of the test tube. A small amount of saline will remain in the tube.

6.

Resuspend cells in remaining saline by pipetting in and out. (If needed, 30 l of saline solution
may be added to facilitate resupension.)

7.

Withdraw 30 l of cell suspension, and add to tube containing 100 l of Chelex. Shake well to
mix.

8.

Boil cell sample for 10 minutes. Use boiling water bath, heat block, or program thermal cycler for
10 minutes at 99C. Then, cool tube briefly on ice (optional).

9.

After boiling, shake tube. Place in a balanced configuration in a microcentrifuge, and spin for 1
minute.

10. Transfer 30 l of supernatant (containing the DNA) to clean 1.5 ml tube. Avoid cell debris and
Chelex beads. This sample will be used for setting up one or more PCR reactions.

11. Store your sample on ice or in the freezer until ready to begin Part II.

Part 3-PCR REACTION SET UP

Introduction to PCR (read pages 331-333 in your textbook)
Watch the following video https://www.youtube.com/watch?
v=2KoLnIwoZKU
PCR (polymerase chain reaction) is a way to amplify small amounts of DNA. This
technique is useful for crime scene investigations, where only a small amount of
DNA may be present. The crime scene investigators can take the small amount of
DNA left behind at a crime scene, make more copies of a particular region of the
DNA and then further analyze the DNA by DNA fingerprinting or sequencing. PCR is
also useful in the lab because a researcher can quickly isolate a small amount of
DNA, make a larger amount of a particular region and clone the target sequence for
further analysis.
In PCR, a small amount (<100 ng) of genomic DNA is put into the reaction to serve
as template DNA. Only a small region of the genome in amplified in each reaction.
The region that is amplified is delineated by primers. PCR works as follows.

Calculate the PCR reaction

a) You need two PCR primers for the reaction.
D1S80 Forward primer:

5GAAACTGGCCTCCAAACACTGCCCGCCG

D1S80 Reverse primer:

5GTCTTGTTGGAGATGCACGTGCCCCTTGC

Each primer will be given to you as a 5uM stock. Your PCR reaction must contain 0.2
uM. The final total volume for the PCR will be 25 uL.
b) You need to add PCR mix. This mix contains the Taq polymerase, Mg++, buffer
and dNTPs needed for PCR. The PCR mix is supplied at a 2X stock concentration.
Your PCR reaction must contain 1X PCR mix.
c) We will use 3 uL of the genomic DNA isolated from cheek cells today as our
template for PCR.

Fill in the table. Have the instructor check your numbers before you set up your
reaction.
Component
2X PCR mix
5 uM primer
1
5 uM primer
2
genomic
template
DNA
water
(total
volume)

amount
in uL
12.5
1
1
3

7.5
25

The PCR reactions will be cycled as follows:

95C 4 min initial denaturation step
30 cycles of
95C 30 sec denaturation
65C 30 sec annealing
72C 2 min elongation
72C 7 min final elongation step

For 35 cycles

Part 4. The instructor will help you take a picture of your gel. Once you
have your picture, look at the gel prediction you made last week during
lab. Analyze your restriction digest by comparing the DNA fragments from
the digest to the computer predictions you made last week and the
molecular weight marker on the gel (shown below). The molecular weight
marker contains DNA fragments of know sizes. The known sizes of the
marker are used to estimate the size of DNA fragments of unknown sizes.
Did your restriction digest from last week work? Briefly explain how you
know.

The sample picture and our results are similar at the top
but our results did not travel as far down at the sample picture results
did. Our restriction did digest and did present good results.

Part 5-Calculate the following solution.

TE is a buffer that is 10mM Tris-CL pH 8.0, 1 mM EDTA
You need to make 100 mL of TE. In the lab you have a 1M stock of 1 M Tris-Cl pH 8.0
and a 0.5 M stock of EDTA.
-

1mL of Tris-Cl
.2 mL of EDTA
98.8mL of water