The Polymerase Chain Reaction (PCR)

Background
The ​ polymerase chain reaction​ PCR​
, or ​ , is a technique that allows us to isolate a specific
region from a complex DNA sample (such as a whole genome) and ​ amplify (make many copies of) just
that region. The product can be used for cloning, sequencing, genotyping or some other experiment.
Invented by Kary Mullis in 1983, PCR quickly became one of the most important tools in the molecular
biologist’s toolbox and is now used routinely in everything from genetic engineering to ecological
monitoring to forensics.
PCR is an application of DNA replication and in fact uses the replication enzyme ​ DNA
polymerase​ Taq DNA polymerase, isolated from the bacterium ​
. Specifically, ​ Thermus aquaticus
(discovered in hot springs in Yellowstone National Park) is used, because it is heat-resistant. DNA
polymerase requires a ​ primer​, a short
stretch of nucleotides with a free 3′ end, to
tell it where to start replicating. PCR
controls where DNA replication happens by
using two primers, one of which defines
each end of the segment of DNA to be
amplified as shown at right. Primers are
made to order commercially, using an
instrument which chemically joins
nucleotides in a specified order. This means
we have to know the sequence of the DNA in
order to amplify it by PCR.
Amplification occurs because many ​ cycles of replication are carried out, controlled by
precisely controlling the temperature of the reaction in an instrument called a ​ thermal cycler​. The
denaturation step that will
thermal cycler is programmed to initially heat the reaction tubes to 95 °C, a ​
separate the two DNA strands. It then cools
down to the ​annealing ​temperature chosen
for the primers used. During this annealing
step, the primers base-pair with their
matching DNA as shown at right. Notice that
one primer binds to each strand of the DNA.
Now the temperature is raised again to 72
°C, the temperature at which ​ Taq
polymerase works best: the ​ extension step.
Taq polymerase starts at the 3′ end of each
primer and copies the DNA ​ template​.
Now the thermal cycler repeats the
denaturation, annealing and extension steps
over and over as shown in the figure on the
next page—typically for 30 total cycles. With
each cycle, more DNA molecules have their
ends defined by the ends of the primers, so
Taq polymerase can only copy up to that
point. Thus, most of the DNA molecules produced will consist of exactly the region from where the 5′
end of the “forward” primer bound to where the 5′ end of the “reverse” primer bound. The first two of
these are boxed in the figure. The number of amplified segments increases exponentially, so that after
30 cycles, we should have more than one billion amplified molecules, starting with only ​ one single
molecule of template DNA. (You can see how valuable this is for obtaining DNA from a forensic sample
or an ancient dinosaur bone.)
Cold Spring Harbor Laboratory’s DNA Learning Center is a great resource; see PCR animations,
www.dnalc.org/resources/animations/pcr.html​
explanations and interviews at: ​ .
A PCR reaction requires template DNA, primers, the four DNA nucleotides (dATP, dTTP, dCTP
and dGTP; we call a mixture of these “dNTPs”), ​ Taq polymerase, an appropriate buffer solution and
MgCl​2 (which may be included in the buffer). Below, you will find directions for setting up a basic PCR
 PCR |​
2

reaction and information about designing primers. These can be modified for a particular experiment
(indeed, PCR can be used in many different ways) or if an enzyme purchased from a particular
company needs slightly different conditions.

Setting Up a PCR Reaction

volumes you will need for
1. Before you start setting up the reaction, calculate in your notebook the ​
each component:
❏ Template DNA​ : use 10-25 ng for a fairly simple template such as a plasmid or up to 50-125 ng
for a complex template such as human genomic DNA
❏ Primers​ : the final concentration in the PCR reaction should be 0.2 µM each. Usually, primers
are shipped dry and then made up to a concentration of 100 µM (100 pmol/µl). You may need
to dilute a small volume of the primers in order to get a concentration that will allow you to
use a reasonable volume in your reaction.
❏ dNTPs (mixture of the four DNA nucleotides): final concentration should be 0.2 mM of each
nucleotide; typically, the purchased mixture contains 10 mM of each nucleotide, but check to
be sure of your starting concentration.
❏ MgCl​ :​
2​ Taq DNA polymerase requires magnesium ions; usually 1.5-3.5 mM MgCl​ 2 is used. This
Taq supplier. The supplier
may be included in the buffer or added separately, depending on the ​
will usually suggest a starting concentration, often about 3 mM.
❏ Buffer​ Taq supplier, buffer may be provided at 5× concentration (meaning ⅕
: Depending on the ​
of the reaction volume should be buffer) or 10× concentration ( of the volume should be
buffer).
❏ Taq polymerase​ Taq is usually supplied at a concentration of about 5 units/µl (a “unit” is
: ​
defined based on the amount of ​ Taq needed to synthesize a given amount of DNA under
Taq​
standard conditions). Usually 2.5-5 units of ​ are used in most PCR reactions.
❏ Total volume of the reaction should be either 25 or 50 µl. After calculating the volumes of the
other components, determine how much water is needed to reach the desired total volume.
Use filtered, autoclaved “PCR water” to ensure no contaminating DNA is present.
2. Consider controls you might need. It’s a good idea to do a negative control without template DNA:
any bands you see could be due to primer self-annealing or to contaminating DNA molecules. In
some cases, you might also have a positive control, perhaps a template where you know your
primers work.
3. Use 0.2-ml ​thin-walled microcentrifuge tubes for your reactions; these allow rapid heat transfer.
Place your tubes on ice and keep them there until you are ready to start the reaction.
4. Add the components to your chilled tubes in this order: water, buffer, MgCl​
2 (if needed), primers,
Taq​
dNTPs, template DNA, ​ polymerase.
5. If you are setting up many PCR reactions at once, you can prepare a “master mix” and aliquot it
into each tube. Multiply the amount of water, buffer, MgCl​ Taq polymerase
, primers, dNTPs and ​
2​
 PCR |​
3

you need by the number of tubes you want to set up and mix all these components in one tube,
then aliquot the “master mix” to the reaction tubes and add template DNA to each.

Running a PCR Reaction

1. Determine your annealing temperature. The company that supplied the primers should have
melting temperatures (​
included their ​ T​ )—the temperature at which 50% of the primer would be
m​
base-paired with its target. The T​
m of the two primers should be within 5° of each other, and the
annealing temperature is usually set 5° below the lower T​.
m​

2. Determine your extension time. Standard ​Taq polymerase can synthesize DNA at a rate of about 1
kb (1000 bp) per minute, so a 500-bp PCR product would require an extension time of only 30 s,
Taq formulations work faster, so check the
while a 2.5-kb product would require 2.5 min. Some ​
supplier’s instructions to be sure.
3. Program the thermal cycler for the parameters you have decided upon. The following instructions
apply to the Bio-Rad gradient cycler, but other cyclers work similarly.
New ​
❏ Choose ​ from the menu and name your program by using the arrow keys to select letters.
❏ Select a temperature for the heated lid. Heating the lid prevents the liquid from evaporating
and condensing on top of the tube. The default temperature of 100 °C is usually fine.
❏ Select the reaction volume you will use (usually 25 or 50 µl).
❏ You should now see step #1 highlighted and have a choice of ​ TEMP ​ (single temperature) or
GRAD (gradient of temperatures). Choose ​ TEMP and enter ​
95° for an initial step to denature all
5-0-0​
the DNA. Set the time for this first step to 5 minutes by entering ​ . This step will only be
done once. OK the step when you have verified it is entered correctly.
❏ Now, start programming the cycles of denaturing, annealing and elongating. You should see a
choice of ​TEMP​ GRAD​
, ​ GOTO ​
, ​ or ​END ​ for step #2. You want this to be your repeated
TEMP ​
denaturing step; choose ​ 95°​
and set this step to heat to ​ 30 s​
for ​ .
❏ Set the annealing step to ​ 30 s at the annealing
temperature you have chosen.
❏ Set the elongation step to the elongation time you have
chosen and 72°.
GOTO​
❏ At the next step (step #5), choose ​ . This is how you
get the cycles to repeat. You want to go back to your
denaturing step (not the very first 5-minute step, but the 30 s at 95° step, step #2), so you
should go to step #2 29 more times for a standard 30-cycle PCR reaction.
❏ After the 30 cycles, it is common to do one more extension step to allow the polymerase to
finish up any unfinished ends. Set 5 or 10 minutes at 72° to accomplish this.
❏ In case you don’t get to your reaction as soon as it ends, you may want it to refrigerate the
tubes until you come back for them. Set another ​TEMP ​
step for 4°, but set the time to zero; this
will show up as 4° “for ever,” meaning that the temperature will stay at 4 ° until you continue
manually.
END ​
❏ Finally, choose ​ for the last step and save the program.
4. Place your tubes in the cycler (remember that if you’ve chosen a gradient step, the temperature
varies from the low temperature you set at the front of the block to the high temperature at the
back), choose your program from the menu and choose Run. The Screen button on the Bio-Rad
thermal cycler will allow you to choose a display which shows what’s happening currently or one
which shows the time remaining.
5. When the program is complete, remove the tubes. Usually, you will use gel electrophoresis
Handbook​
(discussed elsewhere in this ​ ) to analyze your results.

Troubleshooting a PCR Reaction

If your PCR reaction fails to give you the expected amplified DNA segment, the problem could
be technical (a problem with the PCR reaction itself) or biological (maybe your DNA does not actually
contain a match for your primer sequences). Here are some common problems with PCR that you
might consider:
1. The most likely problem is the annealing temperature. Some primer/template combinations are
very sensitive to temperature and may only work in a narrow range. Set up a few identical PCR
 PCR |​
4

reactions and use the gradient feature of the Bio-Rad thermal cycler to test a range of
temperatures, such as from 4° below your original annealing temperature to 4° above it.
2. Some primer/template combinations are very sensitive to the magnesium concentration. Try
varying the concentration between 1 and 4 mM to see if this affects your results.
3. The quality of your template DNA can certainly affect your reaction; particularly if you are using
fairly impure DNA extracted from tissue or an environmental sample, consider cleaning it up
before using it as template, such as with one of the commercial DNA clean-up kits.
4. Even if you’ve used a computer program (see below) to choose primers that should theoretically
work, they may not work in the real world. If you can’t get a PCR product even after playing with
some of these parameters, consider trying a different primer pair.

Designing PCR Primers

For a typical PCR reaction, primers are 20 nucleotides long and are an exact match to the
template. A 20-nucleotide sequence is plenty long enough to ensure that there will be only one match
in the template (unless, unluckily, your primer matches a repeated sequence!)—we would expect a
given 20-nucleotide sequence to occur randomly only once in every 420 ​= 1.1 × 1012
​bases. But, not just
any 20-nucleotide sequence will work. For example, imagine a primer with the sequence
AAAAAAAGGGGGGTTTTTTT​ . This primer could fold up so that the As paired with the Ts, making it
pretty useless for binding template. We can use bioinformatics to find a primer that will not fold up
and will not base-pair stably with its partner; there are many programs available to test this. Most will
also ensure that the two primers have similar melting temperatures and similar content of Gs and Cs
(which base-pair more tightly than As and Ts).
An easy-to-use primer design program that works well is the implementation of Web Primer at
Saccharomyces​
the ​ Genome Database: ​ www.yeastgenome.org/cgi-bin/web-primer​ .
PCR ​
1. Enter your DNA sequence into the input box and choose ​ as the desired primer type.
exactly the same endpoints
2. On the next page, you will be asked if the PCR product needs to have ​
as the sequence you entered. You will get better primers if you choose ​ NO here: Instead of
entering exactly the DNA segment you want to amplify, include some additional bases (maybe 25
or 50) on each end so that the program can choose primers anywhere in this area. This gives the
program more possible primers to choose from. (Of course, sometimes you need a segment with
very specific endpoints.)
3. You will see boxes in which you can set the minimum and maximum length of the primers, their
minimum and maximum T​ m​, and parameters to describe how much base-pairing within and
between the primers is allowed. Generally you can start with the default settings unless you have
some reason to change them.
4. Submit your choices and the program will attempt to choose possible primers; it will output the
best pair as well as a table of other possibilities. It will let you know if the parameters you chose
were too stringent (too few possibilities) or too relaxed (too many possibilities), and you can
adjust them accordingly.
If you are amplifying a DNA segment so that you can clone it, you may want to add restriction
sites to the ends of your primers that are not present in the template DNA. To do this, you would
design 20-nucleotide primers as usual, but then add the restriction enzyme recognition sequence to
the 5′ end of each primer. Then add four nucleotides, such as AAGG, to each end, because restriction
enzymes don’t like to cut at the very end of the DNA molecule. When your segment is amplified, the
restriction sites will be part of the amplified DNA because they were part of the primer.