Immune-Regulatory Molecule CD69 Controls Peritoneal Fibrosis

BASIC RESEARCH www.jasn.org Immune-Regulatory Molecule CD69 Controls Peritoneal Fibrosis Georgios Liappas,* Guadalupe Tirma González-Mateo,* Raquel Sánchez-Díaz,† Juan José Lazcano,† Sandra Lasarte,† Adela Matesanz-Marín,† Rafal Zur,‡ Evelina Ferrantelli,§ Laura García Ramírez,| Abelardo Aguilera,| Elena Fernández-Ruiz,| Robert H.J. Beelen,§ Rafael Selgas,¶ Francisco Sánchez-Madrid,†** Pilar Martín,† and Manuel López-Cabrera* BASIC RESEARCH *Centro de Biología Molecular Severo Ochoa, Consejo Superior de Investigaciones Científicas Universidad Autónoma de Madrid, Madrid, Spain; †Signaling and Inflammation Program, Centro Nacional de Investigaciones Cardiovasculares, Madrid, Spain; ‡Department of Immunology and Oncology, Centro Nacional de Biotecnología Consejo Superior de Investigaciones Científicas, Madrid, Spain; §Department of Molecular Cell Biology and Immunology, Vrije Universiteit University Medical Center Vrije Universiteit Medisch Centrum, Amsterdam, The Netherlands; |Molecular Biology Unit and **Immunology Department, Hospital Universitario de la Princesa, Instituto de Investigación Sanitaria La Princesa, Madrid, Spain; and ¶Nephrology Department, Hospital Universitario La Paz, Instituto de Investigación Sanitaria La Paz, Madrid, Spain ABSTRACT Patients with ESRD undergoing peritoneal dialysis develop progressive peritoneal fibrosis, which may lead to technique failure. Recent data point to Th17-mediated inflammation as a key contributor in peritoneal damage. The leukocyte antigen CD69 modulates the setting and progression of autoimmune and inflammatory diseases by controlling the balance between Th17 and regulatory T cells (Tregs). However, the relevance of CD69 in tissue fibrosis remains largely unknown. Thus, we explored the role of CD69 in fibroproliferative responses using a mouse model of peritoneal fibrosis induced by dialysis fluid exposure under either normal or uremic status. We found that cd692/2 mice compared with wild-type (WT) mice showed enhanced fibrosis, mesothelial to mesenchymal transition, IL-17 production, and Th17 cell infiltration in response to dialysis fluid treatment. Uremia contributed partially to peritoneal inflammatory and fibrotic responses. Additionally, antibody–mediated CD69 blockade in WT mice mimicked the fibrotic response of cd692/2 mice. Finally, IL-17 blockade in cd692/2 mice decreased peritoneal fibrosis to the WT levels, and mixed bone marrow from cd692/2 and Rag22/2gc2/2 mice transplanted into WT mice reproduced the severity of the response to dialysis fluid observed in cd692/2 mice, showing that CD69 exerts its regulatory function within the lymphocyte compartment. Overall, our results indicate that CD69 controls tissue fibrosis by regulating Th17-mediated inflammation. J Am Soc Nephrol 27: 3561–3576, 2016. doi: 10.1681/ASN.2015080909 Received August 18, 2015. Accepted March 7, 2016. The peritoneum is a continuous membrane that lines the abdominal cavity and the organs located within this cavity. 1 Peritoneal membrane (PM) damage inflicted by mechanical trauma or other insults promotes an inflammatory response, which may lead to the development of fibrosis.2,3 Extensive peritoneal fibrosis, such as that taking place in patients with encapsulating peritoneal sclerosis or postsurgical peritoneal adhesions, is a significant source for patient morbidity and mortality. 4,5 J Am Soc Nephrol 27: 3561–3576, 2016 G.L., G.T.G.-M., and R.S.-D. contributed equally to this work. Published online ahead of print. Publication date available at www.jasn.org. Correspondence: Dr. Pilar Martín, Centro Nacional de Investigaciones Cardiovasculares (CNIC), Melchor Fernández Almagro 3, 28029 Madrid, Spain, or Dr. Manuel López-Cabrera, Centro de Biología Molecular Severo Ochoa, CSIC-UAM, C/Nicolás Cabrera number 1, Campus Cantoblanco, 28049 Madrid, Spain. Email: [email protected] or [email protected] Copyright © 2016 by the American Society of Nephrology ISSN : 1046-6673/2712-3561 3561 BASIC RESEARCH www.jasn.org Figure 1. CD69 regulates fibrosis and MMT. (A) Representative images of fibrosis assessment by Masson Trichrome staining of PM sections from WT and cd692/2 mice treated for 40 days with PDF or saline as control. Thickness of PM, indicated with black arrows, was measured. Results are means6SDs (n$9). Blue in the staining represents collagen depositions. Scale bars, 100 mm. (B) Quantification of total cells in peritoneal effluents from WT and cd692/2 mice treated as in A and correlation between total cell number and PM thickening (Spearman regression; n$9). (C) Relative expression of collagen 1 and fibronectin mRNA in PM from WT and cd692/2 mice 3562 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 3561–3576, 2016 www.jasn.org Unfortunately, the precise mechanisms that contribute to the development of peritoneal fibroproliferative diseases are still poorly understood, hindering the development of efficient therapies.2,6,7 The study of peritoneal damage induced by the exposure to dialysis fluids has determined that mesothelial to mesenchymal transition (MMT) and inflammation establish a feedback loop. As a result of this feedback, the PM undergoes a remodeling with the accumulation of extracellular matrix.3,8 Peritoneal dialysis (PD) is an RRT on the basis of the use of the PM as a semipermeable barrier across which ultrafiltration and diffusion take place.3,9 Membrane failure is associated with structural alterations of the peritoneum, with fibrosis as the most constant feature of peritoneal deterioration. Myofibroblasts are the main responsible cells for peritoneal fibrosis, and they might have at least a dual origin from resident fibroblasts and mesothelial cells via MMT.3,10,11 Peritoneal infections and the nonphysiologic nature of dialysis fluids induce chronic inflammation, which eventually leads to the development of fibrosis.3,12,13 It has been suggested by some authors but not by others14–16 that the uremic status of patients on PD may also affect the anatomy of the PM. The immunologic mechanisms underlying PD–induced peritoneal fibrosis remain largely unknown. It has been recently shown that Th17– and more specifically, IL-17–mediated inflammatory response might play a central role in peritoneal damage.17 In addition, it has been shown that pharmacologic treatments modulating Th17 response and/or enhancing regulatory T cell (Treg) response ameliorated peritoneal fibrosis and preserved membrane function.18,19 The antigen CD69 is a C–type lectin disulfide–linked homodimer that is rapidly expressed by most leukocytes in vitro on activation,20,21 whereas in vivo, its expression is restricted to positively selected thymocytes, specific subsets of memory and Treg cells,22,23 and leukocytes of chronic inflammatory infiltrates.24,25 Studies using CD69-deficient models have shown that the absence of CD69 results in enhanced susceptibility to several inflammatory or autoimmune diseases.26–30 These studies also indicate that CD69 contributes to the resolution of inflammation by regulating the balance between Th17 and Tregs.31,32 The cytoplasmic tail of CD69 interacts with and activates the Jak3-Stat5 pathway, inhibiting the Stat3–dependent ROR(g)t activation and therefore, modulating Th17 development and function.30 Recently, a novel FoxP3+CD69+Treg subset, capable of maintaining immune homeostasis and providing protection from developing BASIC RESEARCH inflammation, has been identified.33 Thus, CD69 might determine the outcome of immune responses by both limiting Th17 responses and regulating the function of Treg subset. Given that CD69 controls the inflammatory response, we assessed whether CD69 acts as a regulator of fibrotic processes during peritoneal damage. In this study, we used an established animal model of peritoneal fibrosis in CD69-deficient mice. Our findings show that the expression of CD69 in the lymphoid compartment limits peritoneal fibrosis through modulation of the Th17-mediated inflammation. RESULTS CD69-Deficient Mice Develop an Exacerbated PD Fluid–Induced Fibroproliferative Response To assess the role of CD69 in fibrosis, we have studied the peritoneal fibroproliferative response of C57BL/6 wild–type (WT) and cd692/2 mice in a model of peritoneal dialysis fluid (PDF) exposure at various time intervals (10, 20, and 40 days). This model elicits a moderate fibrotic response in C57BL/6 mice.34,35 Analysis at day 10 showed no significant difference between the groups in terms of fibrosis and leukocyte infiltration (data not shown). After 20 days, there was a significant increase in PM thickness, and infiltrating cells were only in cd692/2 mice exposed to PDF compared with mice exposed to saline (Supplemental Figure 1). PM fibrosis and inflammatory infiltrate further increased in cd692/2 mice treated with PDF for 40 days, whereas in WT mice, thickness and infiltrate augmented only slightly but reached significant values at this time point (Figure 1, A and B). There was a strong correlation between peritoneal thickness and the number of infiltrating cells (Figure 1B). These data were verified by the detection of high levels of the major extracellular matrix components collagen 1 and fibronectin measured by quantitative PCR (qPCR) in peritoneal tissues from cd692/2 compared with WT mice exposed to PDF (Figure 1C). In the control groups, we did not detect a–smooth muscle actin (a-SMA) in the PM, and cytokeratin staining was confined to the preserved mesothelial cell monolayer (Figure 1D). In contrast, a greater accumulation of a-SMA fibroblasts was observed in the submesothelial compact region of cd692/2 compared with WT mice treated with PDF. A significant proportion of the myofibroblasts coexpressed cytokeratin, indicating that they were derived from local conversion of mesothelial cells (MMT) (Figure 1D). There was a strong correlation between peritoneal thickness treated as in A. Data are means6SDs (n=3). (D) Representative images of immunofluorescence analysis of PM sections from WT and cd692/2 mice treated as in A, stained with antibodies to cytokeratin (green) or a-SMA (red), and counterstained with 4,6-diamidino-2-phenylindole (blue). Quantification of double-positive (a-SMA+ Cyt+) cells (yellow; indicated with arrows) was performed; 10 fields per mouse were usually scored. Data show means6SDs (n=9). Correlation between a-SMA+ Cyt+ cell counts and PM thickness was evaluated (Spearman regression; n=9). Magnification, 3200. (A–D) Differences were considered statistically significant for P,0.05 using one-way ANOVA. *P,0.05; **P,0.01; ***P,0.001. (E) Total protein extracts of PM from WT or cd692/2 mice (n$3) treated as in A were immunoblotted with antibodies to a-SMA and b-actin as loading control. J Am Soc Nephrol 27: 3561–3576, 2016 CD69-Driven Regulation of Peritoneal Fibrosis 3563 BASIC RESEARCH www.jasn.org Figure 2. CD69 deficiency induces proinflammatory and profibrotic cytokine production in the peritoneum. (A) Concentration of the main cytokines released by Th17, Th1, and Th2 cells (IL-17, IFN-g, and IL-4, respectively) was measured in the peritoneal effluents from WT and cd692/2 mice treated for 40 days with PDF or saline as control (n$8). (B) Concentration of proinflammatory cytokines TGF-b, IL-6, IL-1b, and MCP3 as in A. (C) Relative mRNA expression of TGF-b, IL-6, and IL-1b was assessed by qPCR (n$3) in PM tissue from WT and cd692/2 mice treated as in A. In A–C, data are means6SDs. P values ,0.05 were considered statistically significant using one- 3564 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 3561–3576, 2016 www.jasn.org and the number of double-positive fibroblasts (Figure 1D). These data were confirmed by the analysis of a–SMA protein levels from peritoneal samples (Figure 1E). These results indicate that the inflammation/MMT axis drives the fibrotic process of the PM after PDF exposure and that this process is deregulated in cd692/2 mice. CD69-Deficient Mice Show Enhanced Proinflammatory Milieu on PDF Exposure At 40 days after PD treatment, the levels of IL-17 were greatly enhanced in the effluent of cd692/2 mice, whereas IFN-g and IL-4 levels did not show any significant differences between groups (Figure 2A). Analysis of cytokines controlling Th17 differentiation revealed that TGF-b increased significantly in PDF–treated cd692/2 mice, whereas IL-6 did not show differences among groups, and IL-1b was increased in the effluent of both saline– and PDF–treated cd692/2 mice. MCP-3 expression was also increased in the effluents of PDF–exposed cd692/2 mice (Figure 2B). Interestingly, TGF-b, IL-6, and IL-1b cytokine–encoding transcripts from peritoneal tissue were significantly increased in PDF–treated cd692/2 mice compared with the WT (Figure 2C). These data indicated that TGF-b, but not IL-6 and IL-1b, was mostly locally produced. Analysis of the effluents 20 days after PDF exposure showed a strong increase of the proinflammatory cytokines IL-17 and IL-6 in cd692/2 mice compared with WT mice (Supplemental Figure 2A). There was also increased expression of the chemokines GM-CSF; MIP1a; MIP1b; regulated upon activation, normal T cell expressed and secreted; and MCP-3 in PDF–treated cd692/2 mice (Supplemental Figure 2B). Comparison of the expression levels of these molecules at different time intervals showed that the inflammatory mediators (e.g., IL-17, IL-6, and MCP-3) tended to peak at 20 days, whereas the profibrotic cytokine TGF-b was upregulated at 40 days (Figure 2D). Analysis of the infiltrating cells in effluent and peritoneal tissue at 40 days showed that PDF exposure induced recruitment of CD4+ and CD8+ T lymphocytes in WT mice and to a greater extent, cd692/2 mice (Figure 3A, Supplemental Table 1). Quantification of the T helper subsets in the effluents revealed an increase in Th17 in PDF–treated WTmice that was exacerbated in cd692/2 mice (Figure 3B). Consistent with our previous results,30 the Stat3 signaling pathway, involved in Th17 differentiation,36 was enhanced in cd692/2 mice exposed to PDF, because protein levels were increased compared with the WT (Figure 3C). Moreover, 40 days after PD treatment, there was a small but significant increase in the number of CD4+/FoxP3+ (Treg) cells in cd692/2, and this increase was much lower compared with the total number of Th17 cells BASIC RESEARCH (Figure 3D). This resulted in an increased Th17-to-Treg ratio in WTand cd692/2 mice exposed to PDF. This ratio was higher in the cd692/2 mice (Figure 3D). The presence of an inflammatory response in PDF–treated cd692/2 mice was further substantiated by the strong recruitment of neutrophils and monocytes into the abdominal cavity and the peritoneal tissue (Figure 3E, Supplemental Table 1). Similar results were obtained in cd69 2 /2 mice after 20 days of PD treatment (Supplemental Figure 3). CD69 Controls Fibrosis under Uremic Conditions We generated WT and cd692/2 uremic Foxp3-mRFP/IL-17AeGFP mice (Figure 4A), which were treated with saline or PDF for 40 days. At the end of the study, a significant increase in PM thickness was observed in both WTand cd692/2 mice exposed to PDF compared with mice exposed to saline, and again, the fibrosis was exacerbated in cd692/2 mice (Figure 4B). The infiltrate increased in WT and cd69 2/2 mice exposed to PDF, but it reached statistical significance only in the cd692/2 group (Figure 4C). These data were confirmed by the detection of high levels of collagen 1 and fibronectin mRNAs as well as TGF-b–, IL-6–, and IL-1b–encoding transcripts in peritoneal tissues from cd692/2 compared with WT mice exposed to PDF (Figure 4, D and E). The level of IL-17 in the effluent was significantly increased in cd692/2 mice exposed to PDF, but in these uremic mice, the concentration of IL-17 was much lower than that in nonuremic mice at the same time point of treatment. IFN-g and IL-4 levels did not show any significant differences between groups (Supplemental Figure 4). PDF induced recruitment of CD4+ and CD8+ T lymphocytes to similar extents in WT and cd692/2 mice (Supplemental Figure 5A). Th17 showed an increase in both PDF–treated WT and cd692/2 mice, but the number of Th17 was significantly higher in cd692/2 mice (Supplemental Figure 5B). The number of Tregs also increased in WT and cd692/2 mice treated with PDF, reaching statistical significance only in the cd692/2 group (Supplemental Figure 5B). Similarly, the increase of the Th17-to-Treg ratio reached statistical significance only in cd692/2 mice (Supplemental Figure 5B). The recruitment of monocytes and neutrophils was induced by PDF exposure to a similar extent in WT and cd692/2 mice (Supplemental Figure 5C). It was noteworthy that the number of cells in the infiltrates was generally smaller in nephrectomized than in nonuremic cd692/2 mice exposed to PDF, whereas the thickness was similar in both uremic and nonuremic cd692/2 mice. In contrast, uremic WT mice exposed to PDF showed increased fibrosis and infiltrate cell number compared with nonuremic WT mice. These data suggested that uremia accelerated the inflammator y process and that the way ANOVA. *P,0.05; **P,0.01; ***P,0.001. (D) Time course analysis of the production of IL-17, IL-6, MCP3, and TGF-b in the peritoneal effluents from WT and cd692/2 mice (KO) treated for 10, 20, and 40 days with PDF or saline as control. Colored columns highlight whether a cytokine is important for either the initiation of inflammation or fibrosis. J Am Soc Nephrol 27: 3561–3576, 2016 CD69-Driven Regulation of Peritoneal Fibrosis 3565 BASIC RESEARCH www.jasn.org Figure 3. CD69 deficiency enhances the peritoneal recruitment of Th17 cells. (A) Quantitative analysis of CD8+ and CD4+ cells recruited to the peritoneal cavity of WT and cd692/2 mice in response to a 40-day treatment with PDF by flow cytometry. Representative density plot is shown with highlighted percentages of the corresponding lymphocytes. Total numbers of CD8+ and CD4+ cells in the peritoneal effluents, shown in the graphs, were calculated according to the flow cytometry results and total cell count in the same mouse. Data are means6SDs (n$6). (B) Density plot of flow cytometry analysis of CD4+IL-17+ (Th17) and CD4+IFN-g + (Th1) cells. Numbers in quadrants 3566 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 3561–3576, 2016 www.jasn.org inflammation curve was in its decline phase in cd692/2 but not in WT mice exposed to PDF. Taken together, our results indicated that uremia contributed slightly to the final outcome of peritoneal alteration, confirming the regulatory role of CD69 in those processes. Blockade of CD69 Mimics the Exacerbated Response of cd692/2 Mice to PD Fluid To further show the relevance of CD69 in limiting peritoneal fibrosis, PDF–exposed WT mice were intraperitoneally injected with a neutralizing anti–CD69 antibody (mAb-2.2) or a mouse IgG1 isotype–matched control (mAb-2.8). PDF– exposed cd692/2 mice treated with mAb-2.2 served as positive control. WT mice treated with anti-CD69 exhibited increased peritoneal fibrosis in response to PDF exposure compared with WT mice treated with the control antibody and similar to cd692/2 treated with anti-CD69 mAb (Figure 5A). Quantification of the CD4+ lymphocytes showed a clear increase, although it did not reach statistical significance (P=0.06), in Th17 but not in Th1 or Th2 in anti–CD69-treated WT and cd692/2 mice exposed to PDF (Figure 5B). Again, after PDF exposure, there was a significant increase in the number of Tregs in cd692/2 mice treated with anti-CD69 antibody (Figure 5C), but this increase was not observed in WTmice (Figure 5C). The enhanced inflammatory response in PDF-exposed mice treated with anti-CD69 was supported by a stronger recruitment of neutrophils and monocytes (Figure 5D). There was a strong correlation between thickness and the number of infiltrating Th17 cells (r=0.64; P=0.03), reinforcing the concept that Th17-mediated inflammation drives peritoneal fibrosis. IL-17 Mediates the Exacerbated Response of cd692/2 Mice to PD Fluid To show that IL-17 mediated the exacerbated inflammatory and fibrotic responses to PDF in cd692/2 mice, they were intraperitoneally injected with anti–IL-17 neutralizing mAb or a rat IgG2A isotype–matched control; cd692/2 mice treated with anti–IL-17 presented less peritoneal fibrosis in response to PDF compared with cd692/2 mice treated with the control antibody (Figure 6A). An analysis of CD4+ lymphocytes subpopulations showed a significant reduction in Th17 but not in Th1 or Th2 in anti– IL-17–treated cd692/2 mice exposed to PDF (Figure 6B). PDF–exposed cd692/2 mice treated with blocking anti–IL-17 antibody did not show a significant decrease of CD4+/FoxP3+ BASIC RESEARCH (Treg) cells (Figure 6C). However, the Th17-to-Treg ratio was reduced in cd692/2 mice treated with anti–IL-17 compared with mice treated with the control antibody (Figure 6D). Treatment with anti–IL-17 abrogated the expression of IL-17 in PDF–exposed cd692/2 mice (Figure 6E). The decreased inflammatory response in PDF–exposed cd692/2 mice treated with anti–IL-17 was shown by a reduction in neutrophil and monocyte recruitment (Figure 6F). These results strongly suggested that CD69 modulated the Th17– mediated inflammatory response in the peritoneal cavity and negatively regulated peritoneal fibrosis induced by PDF exposure. CD69 within the Lymphocyte Compartment Regulates Fibrosis WT and cd692/2 mice were reconstituted with mixed bone marrow (BM) cells from Rag22/2 gc2/2 and CD692/2 or Rag22/2gc2/2 and WT cells in a proportion of 3:1, respectively. The myeloid cell subset of the chimeric mice belongs to the Rag22/2gc2/2 double mutants, whereas the lymphocytic compartment belongs to WT or cd692/2 donors as shown by CD69 expression on the CD4+ T cell subset (Figure 7A). WT or cd692/2 mice reconstituted with Rag22/2gc2/2 and WTor CD69 KO BM cells had similar proportions of lymphocyte subpopulations (Supplemental Figure 6). Mice reconstituted with a mixture of BM cells from Rag22/2gc2/2 and cd692/2 had greater PDF–induced peritoneal fibrosis than mice reconstituted with Rag22/2gc2/2 and WT BM cells (Figure 7B), indicating that the expression of CD69 within the lymphocytes was critical to controlling the fibroproliferative response after PD treatment. An analysis of the T helper subpopulations revealed a significant increase in Th17 but not in Th1 or Th2 cells in mice reconstituted with Rag22/2gc2/2 and cd692/2 BM cells compared with mice reconstituted with Rag22/2gc2/2 and WT BM cells on exposure to PDF (Figure 7C). Therefore, these data unequivocally show that CD69 expression within the lymphocyte compartment controls the Th17 response and the development of fibrosis in the peritoneum after PD treatment. DISCUSSION The pathophysiologic role of CD69 in fibroproliferative diseases had not been explored so far. By using complementary indicate percentages of the corresponding cells. Total numbers of CD4+IL-17+ (Th17), CD4+IFN-g + (Th1), and CD4+IL-4+ (Th2) cells collected from the peritoneal cavity were quantified. Data are means6SDs (n$6). (C) Immunoblotting analysis of total and phosphorylated Stat3 in total protein lysates of PM from WT and cd692/2 treated or not with PDF for 40 days (n$3). b-Actin was used as loading control. (D) Density plot of flow cytometry analysis of CD4+FoxP3+ (Tregs) and their total quantification are shown. Th17-to-Treg ratio is shown. Data are means6SDs (n$6). (E) Density plot of flow cytometry analysis of CD11b+Ly6Glow (monocytes) and CD11b+Ly6Ghigh (neutrophils) and their quantification are shown (n$6). P values ,0.05 were considered statistically significant using one-way ANOVA. *P,0.05; **P,0.01; ***P,0.001. J Am Soc Nephrol 27: 3561–3576, 2016 CD69-Driven Regulation of Peritoneal Fibrosis 3567 BASIC RESEARCH www.jasn.org Figure 4. CD69 regulates fibrosis in mice with abnormal renal function. WT and cd692/2 mice undergo 5/6 nephrectomy before treatment with saline or PDF for a period of 40 days. (A) Serum levels of urea and creatinine were measured before and 10 and 54 days after 5/6 nephrectomy in groups throughout the treatment with saline or PDF. (B) Fibrosis assessment by Masson Trichrome staining in CD692/2 and WT mice 54 days postnephrectomy. Arrows indicate thickness of the PM. Right panel shows quantification of peritoneal fibrosis in uremic mice (n$10). (C) Total cell counts of the peritoneal effluent in each group of mice. Fibrosis and inflammation in 3568 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 3561–3576, 2016 www.jasn.org experimental approaches in WT and cd692/2 mice as well as BM transplantation and in vivo blocking experiments, our results strongly indicate that CD69 modulates peritoneal fibrosis, at least in part, through regulation of the Th17/Treg balance. We also show that uremia contributes modestly to fibroproliferative response of the peritoneum and that CD69 also modulates the inflammation under the uremic status. Despite the findings in animal models,37,38 the effect of uremia itself on the peritoneum in humans is controversial.14–16 The possible contribution of uremia to the alteration of the PM anatomy and its transport characteristics is still a matter of debate. The Th17 lineage has gained broad acceptance as a key mediator of various inflammatory and autoimmune pathologies.39–44 Tregs are suppressors of activated T cell expansion and considered key regulators of adaptive immunity that mediates self-tolerance.45 Recent evidence indicates that Th17 lineage and Tregs are developmentally related.46 In addition, it was shown that plasticity between these two lineages as well as the pathogenic conversion of Tregs into Th17 cells occurred in autoimmune arthritis.47 Our data show that CD69 deficiency or CD69 blockade results in exacerbated peritoneal fibrosis in response to PDF. This result correlates with enhanced inflammatory infiltrate and local hyperactivation of the Th17 cells. In contrast, Th1- or Th2-mediated responses seem to have little, if any, relevance in PD-induced fibrosis. The enhanced peritoneal fibrosis in cd692/2 mice is associated with an increase in the Th17-to-Tregs ratio, which is caused by augmented Th17 cells rather than a decrease of Tregs. Even more important than the relative proportion of Tregs is their functional stage. It has been described that the expression of CD69 on Tregs is required for the correct function of these cells in immune homeostasis and the modulation of inflammation.33 Thus, it can be speculated that CD69 controls peritoneal fibrosis by limiting Th17 responses and regulating the function of Tregs. Our results show that the peritoneal changes induced by PDF exposure are not only exacerbated in magnitude but also, accelerated over time intervals in cd692/2 mice and that inflammation precedes the fibrotic process. One of the most remarkable characteristics during peritoneal fibrosis is the progressive accumulation of myofibroblasts. Here, we show that the accumulation of myofibroblasts is greater in cd692/2 than in WT mice on PDF treatment. A significant proportion of these myofibroblasts derive from mesothelial cells via MMT. Recently, the concept of MMT as a key process in peritoneal fibrosis has been challenged by a lineage-tracing study. 11 However, another lineage tracing–based study BASIC RESEARCH confirmed the mesothelial origin of a subpopulation of peritoneal fibroblasts.48 Thus, the role of MMT in peritoneal fibrosis is still a matter of debate and will require additional studies.49 Independent of the precise origin of the myofibroblasts, our results clearly indicate that inflammation drives the fibrotic process of the PM after PDF exposure and that this process is deregulated in cd692/2 mice. We have observed that TGF-b is strongly upregulated in the peritoneal cavity of cd692/2 mice exposed to PDF. This cytokine plays a central role in the differentiation of Th17 and Treg lineages, because it causes uncommitted progenitors to pass through an intermediate stage.50 Exposure to TGF-b alone skews precursors toward the Treg lineage, whereas the combination of TGF-b and IL-6 causes progenitors to adopt a Th17 signature.46 We have observed that IL-6 was rapidly induced at 20 days in the peritoneal cavity of cd692/2 mice exposed to PDF, and it remained high at 40 days. These data might explain the strong local polarization toward Th17 differentiation in response to PDF exposure. In conclusion, our findings show that CD69 modulates Th17–mediated inflammatory responses and negatively regulates peritoneal fibrosis. These data improve our understanding of fibrotic processes and might help in the design of new therapeutic approaches in preventing fibroproliferativeassociated diseases. CONCISE METHODS Mice The cd692/2 mice were generated in the 129/Sv background as described51 and backcrossed onto C57BL/6 for at least 12 generations. cd692/2 and wild type mice used for experiments were 8-12-week old females, and were either littermates or age-matched offspring of littermates in the C57BL/6 background. Double reporter mice (BL6 background) expressing Foxp3-mRFP (monomeric red fluorescence protein inserted in the foxp3 locus) and IL-17A-eGFP (enhanced green fluorescent protein (eGFP) inserted in the Il17a locus), were kindly provided by Dr. R. Flavell. We generated cd692/2/Foxp3-mRFP/IL-17A-eGFP mice after backcrossing double reporter with C57/BL6 cd692/2 mice. Rag22/2gc2/2 double–KO mice were provided by Dr. M.L. Toribio. Animals were housed and used in specific pathogen–free conditions at the CNIC animal facility. All animal procedures were approved by the ethics committee of the Comunidad Autónoma de Madrid and conducted in accordance with the institutional guidelines that comply with the Directive of the European Parliament and of the Council on the Protection of Animals Used for Scientific Purposes.52 peritoneal tissue from uremic WT and CD692/2 mice were assessed by qPCR analysis of (D) collagen 1 and fibronectin and (E) proinflammatory cytokines, respectively. Bars are means6SDs (n$6). P values ,0.05 were considered statistically significant using one–way ANOVA test, and Bonferroni post-tests were used to compare selected pairs of means and all pairs of means, respectively. NX, nephrectomy. *P,0.05; **P,0.01; ***P,0.001. J Am Soc Nephrol 27: 3561–3576, 2016 CD69-Driven Regulation of Peritoneal Fibrosis 3569 BASIC RESEARCH www.jasn.org Figure 5. CD69 blockade in WT mice reproduces the CD692/2 phenotype. WT and cd692/2 mice were subject to a 40-day PDF treatment combined with either anti-CD69 antibody (Ab-2.2 or +2.2) treatment (in the case of both genotypes) or isotype control antibody (Ab-2.8 or +2.8) treatment as control (in the case of WT alone). The antibody was applied every 5 days (100 mg per mouse). (A) Representative pictures of Masson Trichrome staining of PM sections from the three groups. The PM thickness, indicated with arrows, was quantified. Data are means6SDs (n$5). Scale bars, 100 mm. (B and C) Representative density plots of flow cytometry analysis and 3570 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 3561–3576, 2016 www.jasn.org BASIC RESEARCH Animal Surgeries and PDF Treatment Anti–IL-17 Administration and Neutralization Catheter implantation was performed as described elsewhere.53 We used four groups of mice throughout the project. The control WTand cd692/2 groups received 2 ml physiologic saline (n=10 per group) via a catheter. In addition, the treated WT and cd692/2 groups received 2 ml standard PDF (PDF-4; 25% glucose; pH 5.5; Stay Safe; Fresenius Medical Care) daily through the catheter (n=10 per group). The mice were treated for various time intervals (10, 20, and 40 days). To study the mechanism of the CD69 receptor in tissue fibrosis, we performed a comparison between the WT and cd692/2 PDF groups. The experiment was repeated a minimum of two times. To make mice uremic, 5/6 nephrectomy was performed under isoflurane anesthesia (4% for induction and 2%–3% for maintenance); 0.05–0.1 mg/kg buprenorphine (Temgesic) was injected intramuscularly 15–30 minutes preoperatively, and eye drops were given. The animal was shaved in the abdomen, and it was placed on a heating pad. A ventral midline incision was made through the skin followed by an incision along the linea alba. Through the laparotomy, the left kidney was released from its capsule by using surgical forceps and wet cotton swabs. At this point, the kidney could be easily positioned on top of the peritoneum and was placed on a wound pad. The anterior one third and posterior one third parts of the kidney were impaired by using a monopolar electric blade. The remaining functional one third of the left kidney is placed back into its original position in the abdominal cavity. Following the same procedure, the right kidney was also removed from the abdominal cavity and released from the capsule. A total ligation with insoluble suture was applied that included the kidney vein, artery, and urethra. After the ligation, the right kidney was totally removed from the body. A volume of 200 ml blood was drawn via facial vein puncture at day 21 and at days 10 and 54 postnephrectomy (end point). At all of the time points, serum samples were analyzed for urea and creatinine levels. Measurements were performed by using the Dimension RxL Max Integrated Chemistry System. PD–instilled cd692/2 mice were treated with a neutralizing antibody against IL-17A or its corresponding control (mouse IgG1-K Isotype). Anti–IL-17A antibody (100 mg per mouse; eBioscience, San Diego, CA) was instilled in the peritoneal cavity via a catheter every 5 days for a total period of 40 days. A control group was created by treating PDF–instilled cd692/2 mice with mouse IgG1-K Isotype (eBioscience) at the same concentration. Anti-CD69 Administration and Neutralization Murine mAb-2.2 antibody (IgG1-K), specific for mouse CD69, was generated as previously described.54,55 It was purified from concentrated supernatants obtained in an INTEGRA CL 350 Flask (Integra Biosciences AG) using a protein G column (Pharmacia Biotech). Purified antibody was dialyzed extensively against PBS, tested for endotoxin (levels were ,0.1 ng/ml), and stored at 220°C. PDF–treated WT mice were treated with a neutralizing antibody mAb-2.2 against CD69. mAb-2.2 can completely block CD69 receptors in all mouse compartments. mAb-2.2 (100 mg per mouse) was instilled in the peritoneal cavity through a catheter every 5 days for a total of 40 days. As control groups, WT PDF–instilled mice were treated with a mouse mAb-2.8 isotype, and cd692/2 PDF mice were treated with neutralizing antibody mAb-2.2. FACS Analyses Cell suspensions obtained from peritoneal lavage and membranes were stained with fluorochrome–conjugated mouse–specific antibodies against CD3, CD45, CD4, CD8a, B220, CD11c, CD11b, Ly6C, CD69, Ly6G, IFN-g, IL-4, and IL-17 (BD Biosciences Pharmingen, San Diego, CA) and FoxP3 (eBiosciences). Before intracellular staining, cells were restimulated for 4 hours with 50 ng/ml PMA and 500 ng/ml ionomycin in the presence of 1 mg/ml Brefeldin A. Samples were analyzed in a BD FACS Canto II (BD Biosciences, San Jose, CA) flow cytometer, and additional analyses were performed using FlowJo software. BM Chimera Mice WT and cd692/2 females, which were 10–12 weeks old, were lethally g-irradiated with two doses of 6.5 Gy and intravenously administered a mixture of 43106 BM cells from Rag22/2gc2/2 and cd692/2 or Rag22/2gc2/2 and WT cells in a proportion of 3:1, respectively. The Rag22/2gc2/2 double–mutant mice are completely alymphoid (they lack T, B, and NK subsets), which gives specificity to our assay: the myeloid cell subset will belong to the Rag22/2gc2/2 double mutants, whereas the lymphocyte compartment will belong only to WTor cd692/2 donors. Reconstitution of the immune system by the donors was analyzed 6 weeks after the BM transplant, and reconstituted mice were subsequently analyzed 40 days after PD treatment. Real-Time qPCR cDNA for real-time qPCR was generated from 0.5 mg total RNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA) in a final reaction volume of 10 ml. The qPCR reactions were performed in triplicate using 10 ml each cDNA at 1:40 dilution, 10 mM each oligonucleotide, and HOT FIREPol qPCR Mix (Solis BioDyne) or Power SYBR Green PCR Master Mix in a total volume of 8 ml in MicroAmp Optical 384-Well Plates (Applied Biosystems). PCR reactions were performed using the ABI PRISM 7900HT (Applied Biosystems). The amount of amplified DNA was measured through the emission of light by SYBR Green Dye, intercalating in synthesized double–stranded DNA. All samples were quantification of T cell subsets in the peritoneal effluents (n$5): (B) Th17 (CD4+IL-17+), Th1 (CD4+IFN-g +), and Th2 (CD4+IL-4+) and (C) Tregs (CD4+Foxp3+). Percentages of the subpopulations are shown above the corresponding quadrant in the graph. (D) Representative density plots of flow cytometry analysis and quantification of CD11b+Ly6Glow (monocytes) and CD11b+Ly6Ghigh (neutrophils) cells in the peritoneal effluents (n$5). Percentages of the subpopulations are shown above the corresponding quadrant in the graph. Data are means6SDs (n$5). P values ,0.05 are considered statistically significant using one-way ANOVA. *P,0.05; **P,0.01; ***P,0.001. J Am Soc Nephrol 27: 3561–3576, 2016 CD69-Driven Regulation of Peritoneal Fibrosis 3571 BASIC RESEARCH www.jasn.org Figure 6. Neutralization of IL-17 in PDF–treated cd692/2 mice attenuates peritoneal fibrosis. The cd692/2 mice were subject to a 40-day exposure to PDF and simultaneously treated with either a neutralizing antibody against IL-17 (anti–IL-17) or its corresponding control antibody. The antibody was applied every 5 days (100 mg per mouse). (A) Representative pictures of Masson Trichrome–stained sections of PM from both cd692/2 groups. PM is indicated with arrows. PM thickness was measured, and quantification is represented on the graph. Data are means6SDs (n$5). (B) Flow cytometry analysis of Th17 (CD4+IL-17+), Th1 (CD4+IFN-g +), and Th2 (CD4+IL-4+) 3572 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 3561–3576, 2016 www.jasn.org measured in triplicate. SDS v2.2 software was used to analyze the results. Specific amplification was controlled by melting curve analysis. The data were analyzed by using the comparative Ct Method (DDCt). The x-fold change in mRNA expression was quantified relative to control WT samples from the same experiment. b-Actin and GAPDH mRNAs was used as housekeeping genes. The primers that were used in this study were as follows: collagen, forward: CCAGAGTGGAACAGCGATTAC and reverse: GCAGGCGAGATGGCTTATTT; fibronectin, forward: GCAAACCTATAGCTGAGAAGTC and reverse: CAAGTACAGTCCACCATCATC; TGF-b, forward: GGAACTCTACCAGAAATATAGCAACAAT TC and reverse: TGTAATCCGTCTCCTTGGTTCAG; IL-6, forward: GAGGATACCACTCCCAACAGACC and reverse: AAGTGCATCATCGTTGTTCATACA; IL-1b, forward: TGGTGTGTGACGTTCCATT and reverse: CAGCACGAGGCTTTTTTGTTG; b-actin, forward: AAGGAGATTACTTGCTCTGGCTCCTA and reverse: ACTCATCGTACTTCCTGCTTGCTGAT; and GAPDH, forward: AGCTTGTCATCAACGGGAAG and reverse: TT TGATGTTAGTGGGGTCTCG. BASIC RESEARCH using an Olympus BX41 Clinical Microscope (Olympus, Tokyo, Japan) and an Olympus DP20 Digital Camera (Olympus) using cell acquisition software. The peritoneal thickness in each mouse was calculated by the median of measurement taken every 50 mm from one extreme to the other of the biopsy. The result was used to calculate the group thickness. Immunofluorescence Biopsies of mice were frozen in optimal cutting temperature compound and cut into 5-mm sections. To identify the mesothelial cells, we used a mouse anticytokeratin 8/18 (clone 5D3; Novocastra, Newcastle, United Kingdom), which was stained with anti-IgG1–specific Zenon Fab Fragments (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. Mesenchymal cells were stained with a-SMA (ab5694–100; Abcam, Inc., Cambridge, MA) and Zenon Fab Fragments. Nuclei were stained with 4,6-diamidino-2-phenylindole. The microscopy was performed with a fluorescence microscope (Leica CTR6000 with LAS-AF6000 software; Leica Microsystems) or a confocal microscope (Leica TCS SPE with LAS-AF software, version 2.0.1, build 2043; Leica Microsystems). Immunoblotting Lysates of PM were prepared in PD buffer (40 mM Tris HCl [20 mM, pH 8.0], 0.5 M NaCl, 6 mM EDTA, 6 mM de EGTA, and 0.1% NP40) containing the protease inhibitor cocktail (Complete; Roche, Basel, Switzerland). Proteins (30 mg) were size separated on 10% SDS polyacrylamide gels and transferred onto Trans-Blot Nitrocellulose Membranes (Bio-Rad, Hercules, CA). Primary antibodies for immunoblotting were as follows: anti–b-actin (Santa Cruz Biotechnology, Santa Cruz, CA), anti-Stat3 (Santa Cruz Biotechnology), antiphospho-Stat3 (Cell Signaling Technology, Danvers, MA), and a-SMA (Sigma-Aldrich, St. Louis, MO). Statistical Analyses P values were calculated with the t test, and values ,0.05 were considered significant. Means of the experimental groups were compared by using one-way ANOVA. To account for multiple comparisons, the Tukey or Bonferroni post-tests were used to compare selected pairs of means and all pairs of means, respectively. All statistical analyses were carried out with GraphPad Prism 5.03 (GraphPad Software, La Jolla, CA). Correlations were assessed using Spearman correlation tests (GraphPad Prism 5.03). FlowCytomix To determine the quantity of cytokines and chemokines, the peritoneal cavity was washed with 2 ml saline immediately after the mice were euthanized. The solution was centrifuged, and the supernatant was analyzed for cytokine and chemokine production using the FlowCytomix technique (Bender MedSystems GmbH). Data were analyzed using the FlowCytomix Pro 2.2 software (Bender MedSystems GmbH). Masson Trichrome Staining Parietal peritoneal biopsies were collected from the opposite side of the catheter installation. The biopsies were fixed in Bouin solution, embedded in paraffin, cut into 5-mm sections, and stained with Masson Trichrome. The PM thickness was determined using a microscope (Leica CTR6000 with a Leica Microsystems LAS-AF6000; Leica Microsystems, Buffalo Grove, IL). Microphotographs were obtained ACKNOWLEDGMENTS The authors thank Juliette Siegfried and her team at ServingMed.com for editing the manuscript and Dr. Richard Flavell for kindly providing the foxp3-mRFP/Il17a-eGFP double reporter mice. G.L. and E.F. were supported by the European Union Seventh Framework Program EuTRiPD under grant PITN-GA-2011-287813. G.T.G.-M. is funded by Consejo Superior de Investigaciones Científicas. R.S.-D. is funded with a predoctoral fellowship from Comunidad de Madrid, and S.L. is funded with a fellowship from Redes Temáticas de Investigación Cooperativa en Salud (RETICS) Enfermedades Cardiovasculares from Instituto de Salud Carlos III. R.Z. received the laCaixa Foundation International Fellowship (laCaixa/Centro Nacional de Biotecnología). A.A. was supported by grant FIS 12/01175 from the cells in the peritoneal effluents from indicated groups and representative density plots. Percentages of the analyzed cells are shown above the corresponding quadrants. (C) Percentage of Tregs in the peritoneal effluents was measured by flow cytometry, and (D) Th17-to-Treg ratio is shown. (E) Quantification of IL-17 concentration in the peritoneal effluents by ELISA. (F) Percentages of CD11b+Ly6Glow (monocytes; left panel) and CD11b+Ly6Ghigh (neutrophils; right panel) in the peritoneal effluents from the indicated groups quantified by flow cytometry. Data are means6SDs (n$8). P values ,0.05 were considered statistically significant using the t test. n.d., not detectable. *P,0.05; **P,0.01; ***P,0.001. J Am Soc Nephrol 27: 3561–3576, 2016 CD69-Driven Regulation of Peritoneal Fibrosis 3573 BASIC RESEARCH www.jasn.org Figure 7. CD69 expression within the lymphocyte compartment drives peritoneal fibrosis. WT and cd692/2 (KO) mice were transplanted with a mixture of BM cells from either Rag22/2gc2/2 and CD692/2 (KO) or Rag22/2gc2/2 and CD69+/+ (WT) cells as described in Concise Methods. (A) Representative histogram plot of flow cytometry analysis of CD4+ CD69+ cells in peripheral blood from four chimeric groups and the corresponding quantification. Data are means6SDs (n$8). (B) Representative pictures of Masson Trichrome staining of peritoneal tissue sections from reconstituted mice subjected to a 40-day exposure to PDF. PM is indicated with arrows. PM thickness was measured. Data are means6SDs (n$4). (C) Flow cytometry analysis of Th17 (CD4+IL-17+), Th1 (CD4+IFN-g +), and Th2 (CD4+IL-4+) cells from the peritoneal cavity. Data are means6SDs (n$7). P values ,0.05 were considered statistically significant using one-way ANOVA. *P,0.05; **P,0.01; ***P,0.001. Fondo de Investigaciones Santitarias. R.S. was supported by grants RETICS 06/0016 and PI 09/0064 from the Fondo de Investigaciones Santitarias. Grants SAF2011-25834 (to F.S.-M.), SAF2011-27330 (to P.M.), 3574 Journal of the American Society of Nephrology and INDISNET 01592006 (to F.S.-M. and P.M.) were from the Comunidad de Madrid and RETICS Enfermedades Cardiovasculares from the Instituto de Salud Carlos III, and grant ERC-2011-AdG294340-GENTRIS J Am Soc Nephrol 27: 3561–3576, 2016 www.jasn.org from the European Research Council (European Commission) was to F.S.-M. M.L.-C. was supported, in part, by Ministerio de Economia y Competitividad grant SAF2013-47611-R and funding from Comunidad Autónoma de Madrid 2010-BMD2321 (FIBROTEAM). The Centro Nacional de Investigaciones Cardiovasculares (CNIC) is supported by the Spanish Ministry of Economy and Competitiveness (MINECO) and the Pro-CNIC Foundation, and a Severo Ochoa Center of Excellence (MINECO award SEV-2015-0505). DISCLOSURES None. REFERENCES 1. Di Paolo N, Sacchi G: Atlas of peritoneal histology. Perit Dial Int 20 [Suppl 3]: S5–S96, 2000 2. Maciver AH, McCall M, James Shapiro AM: Intra-abdominal adhesions: Cellular mechanisms and strategies for prevention. Int J Surg 9: 589– 594, 2011 3. Devuyst O, Margetts PJ, Topley N: The pathophysiology of the peritoneal membrane. J Am Soc Nephrol 21: 1077–1085, 2010 4. Moinuddin Z, Summers A, Van Dellen D, Augustine T, Herrick SE: Encapsulating peritoneal sclerosis-a rare but devastating peritoneal disease. Front Physiol 5: 470, 2014 5. Hellebrekers BW, Kooistra T: Pathogenesis of postoperative adhesion formation. Br J Surg 98: 1503–1516, 2011 6. Kawanishi H, Moriishi M: Encapsulating peritoneal sclerosis: Prevention and treatment. Perit Dial Int 27[Suppl 2]: S289–S292, 2007 7. González-Mateo GT, Aroeira LS, López-Cabrera M, Ruiz-Ortega M, Ortiz A, Selgas R: Pharmacological modulation of peritoneal injury induced by dialysis fluids: Is it an option? Nephrol Dial Transplant 27: 478–481, 2012 8. Aroeira LS, Aguilera A, Sánchez-Tomero JA, Bajo MA, del Peso G, Jiménez-Heffernan JA, Selgas R, López-Cabrera M: Epithelial to mesenchymal transition and peritoneal membrane failure in peritoneal dialysis patients: Pathologic significance and potential therapeutic interventions. J Am Soc Nephrol 18: 2004–2013, 2007 9. Chaimovitz C: Peritoneal dialysis. Kidney Int 45: 1226–1240, 1994 10. Yáñez-Mó M, Lara-Pezzi E, Selgas R, Ramírez-Huesca M, DomínguezJiménez C, Jiménez-Heffernan JA, Aguilera A, Sánchez-Tomero JA, Bajo MA, Alvarez V, Castro MA, del Peso G, Cirujeda A, Gamallo C, Sánchez-Madrid F, López-Cabrera M: Peritoneal dialysis and epithelialto-mesenchymal transition of mesothelial cells. N Engl J Med 348: 403– 413, 2003 11. Chen YT, Chang YT, Pan SY, Chou YH, Chang FC, Yeh PY, Liu YH, Chiang WC, Chen YM, Wu KD, Tsai TJ, Duffield JS, Lin SL: Lineage tracing reveals distinctive fates for mesothelial cells and submesothelial fibroblasts during peritoneal injury. J Am Soc Nephrol 25: 2847–2858, 2014 12. García-López E, Lindholm B, Davies S: An update on peritoneal dialysis solutions. Nat Rev Nephrol 8: 224–233, 2012 13. Morgan LW, Wieslander A, Davies M, Horiuchi T, Ohta Y, Beavis MJ, Craig KJ, Williams JD, Topley N: Glucose degradation products (GDP) retard remesothelialization independently of D-glucose concentration. Kidney Int 64: 1854–1866, 2003 14. Williams JD, Craig KJ, Topley N, Von Ruhland C, Fallon M, Newman GR, Mackenzie RK, Williams GT; Peritoneal Biopsy Study Group: Morphologic changes in the peritoneal membrane of patients with renal disease. J Am Soc Nephrol 13: 470–479, 2002 J Am Soc Nephrol 27: 3561–3576, 2016 BASIC RESEARCH 15. Plum J, Hermann S, Fusshöller A, Schoenicke G, Donner A, Röhrborn A, Grabensee B: Peritoneal sclerosis in peritoneal dialysis patients related to dialysis settings and peritoneal transport properties. Kidney Int Suppl 78: S42–S47, 2001 16. Jiménez-Heffernan JA, Aguilera A, Aroeira LS, Lara-Pezzi E, Bajo MA, del Peso G, Ramírez M, Gamallo C, Sánchez-Tomero JA, Alvarez V, López-Cabrera M, Selgas R: Immunohistochemical characterization of fibroblast subpopulations in normal peritoneal tissue and in peritoneal dialysis-induced fibrosis. Virchows Arch 444: 247–256, 2004 17. Rodrigues-Díez R, Aroeira LS, Orejudo M, Bajo MA, Heffernan JJ, Rodrigues-Díez RR, Rayego-Mateos S, Ortiz A, Gonzalez-Mateo G, LópezCabrera M, Selgas R, Egido J, Ruiz-Ortega M: IL-17A is a novel player in dialysis-induced peritoneal damage. Kidney Int 86: 303–315, 2014 18. Sandoval P, Loureiro J, González-Mateo G, Pérez-Lozano ML, Maldonado-Rodríguez A, Sánchez-Tomero JA, Mendoza L, Santamaría B, Ortiz A, Ruíz-Ortega M, Selgas R, Martín P, Sánchez-Madrid F, Aguilera A, López-Cabrera M: PPAR-g agonist rosiglitazone protects peritoneal membrane from dialysis fluid-induced damage. Lab Invest 90: 1517–1532, 2010 19. González-Mateo GT, Fernández-Míllara V, Bellón T, Liappas G, RuizOrtega M, López-Cabrera M, Selgas R, Aroeira LS: Paricalcitol reduces peritoneal fibrosis in mice through the activation of regulatory T cells and reduction in IL-17 production. PLoS One 9: e108477, 2014 20. Testi R, Phillips JH, Lanier LL: T cell activation via Leu-23 (CD69). J Immunol 143: 1123–1128, 1989 21. Cebrián M, Yagüe E, Rincón M, López-Botet M, de Landázuri MO, Sánchez-Madrid F: Triggering of T cell proliferation through AIM, an activation inducer molecule expressed on activated human lymphocytes. J Exp Med 168: 1621–1637, 1988 22. Okhrimenko A, Grün JR, Westendorf K, Fang Z, Reinke S, von Roth P, Wassilew G, Kühl AA, Kudernatsch R, Demski S, Scheibenbogen C, Tokoyoda K, McGrath MA, Raftery MJ, Schönrich G, Serra A, Chang HD, Radbruch A, Dong J: Human memory T cells from the bone marrow are resting and maintain long-lasting systemic memory. Proc Natl Acad Sci U S A 111: 9229–9234, 2014 23. Shinoda K, Tokoyoda K, Hanazawa A, Hayashizaki K, Zehentmeier S, Hosokawa H, Iwamura C, Koseki H, Tumes DJ, Radbruch A, Nakayama T: Type II membrane protein CD69 regulates the formation of resting T-helper memory. Proc Natl Acad Sci U S A 109: 7409–7414, 2012 24. Laffón A, García-Vicuña R, Humbría A, Postigo AA, Corbí AL, de Landázuri MO, Sánchez-Madrid F: Upregulated expression and function of VLA-4 fibronectin receptors on human activated T cells in rheumatoid arthritis. J Clin Invest 88: 546–552, 1991 25. García-Monzón C, Moreno-Otero R, Pajares JM, García-Sánchez A, López-Botet M, de Landázuri MO, Sánchez-Madrid F: Expression of a novel activation antigen on intrahepatic CD8+ T lymphocytes in viral chronic active hepatitis. Gastroenterology 98: 1029–1035, 1990 26. Sancho D, Gómez M, Viedma F, Esplugues E, Gordón-Alonso M, García-López MA, de la Fuente H, Martínez-A C, Lauzurica P, SánchezMadrid F: CD69 downregulates autoimmune reactivity through active transforming growth factor-beta production in collagen-induced arthritis. J Clin Invest 112: 872–882, 2003 27. Martin P, Gómez M, Lamana A, Matesanz Marín A, Cortés JR, RamírezHuesca M, Barreiro O, López-Romero P, Gutiérrez-Vázquez C, de la Fuente H, Cruz-Adalia A, Sánchez-Madrid F: The leukocyte activation antigen CD69 limits allergic asthma and skin contact hypersensitivity. J Allergy Clin Immunol 126: 355–365, 2010 28. Cruz-Adalia A, Jiménez-Borreguero LJ, Ramírez-Huesca M, ChicoCalero I, Barreiro O, López-Conesa E, Fresno M, Sánchez-Madrid F, Martín P: CD69 limits the severity of cardiomyopathy after autoimmune myocarditis. Circulation 122: 1396–1404, 2010 29. Radulovic K, Manta C, Rossini V, Holzmann K, Kestler HA, Wegenka UM, Nakayama T, Niess JH: CD69 regulates type I IFN-induced tolerogenic signals to mucosal CD4 T cells that attenuate their colitogenic potential. J Immunol 188: 2001–2013, 2012 CD69-Driven Regulation of Peritoneal Fibrosis 3575 BASIC RESEARCH www.jasn.org 30. Martín P, Gómez M, Lamana A, Cruz-Adalia A, Ramírez-Huesca M, Ursa MA, Yáñez-Mo M, Sánchez-Madrid F: CD69 association with Jak3/Stat5 proteins regulates Th17 cell differentiation. Mol Cell Biol 30: 4877– 4889, 2010 31. Martín P, Sánchez-Madrid F: CD69: An unexpected regulator of TH17 cell-driven inflammatory responses. Sci Signal 4: pe14, 2011 32. González-Amaro R, Cortés JR, Sánchez-Madrid F, Martín P: Is CD69 an effective brake to control inflammatory diseases? Trends Mol Med 19: 625–632, 2013 33. Cortés JR, Sánchez-Díaz R, Bovolenta ER, Barreiro O, Lasarte S, Matesanz-Marín A, Toribio ML, Sánchez-Madrid F, Martín P: Maintenance of immune tolerance by Foxp3+ regulatory T cells requires CD69 expression. J Autoimmun 55: 51–62, 2014 34. Walkin L, Herrick SE, Summers A, Brenchley PE, Hoff CM, Korstanje R, Margetts PJ: The role of mouse strain differences in the susceptibility to fibrosis: A systematic review. Fibrogenesis Tissue Repair 6: 18, 2013 35. Busnadiego O, Loureiro-Álvarez J, Sandoval P, Lagares D, Dotor J, Pérez-Lozano ML, López-Armada MJ, Lamas S, López-Cabrera M, Rodríguez-Pascual F: A pathogenetic role for endothelin-1 in peritoneal dialysis-associated fibrosis. J Am Soc Nephrol 26: 173–182, 2015 36. Stockinger B: Good for Goose, but not for Gander: IL-2 interferes with Th17 differentiation. Immunity 26: 278–279, 2007 37. Combet S, Ferrier ML, Van Landschoot M, Stoenoiu M, Moulin P, Miyata T, Lameire N, Devuyst O: Chronic uremia induces permeability changes, increased nitric oxide synthase expression, and structural modifications in the peritoneum. J Am Soc Nephrol 12: 2146–2157, 2001 38. Ferrantelli E, Liappas G, Keuning ED, Vila Cuenca M, González-Mateo G, Verkaik M, López-Cabrera M, Beelen RH: A novel mouse model of peritoneal dialysis: Combination of uraemia and long-term exposure to PD fluid. BioMed Res Int 2015: 106902, 2015 39. Peck A, Mellins ED: Plasticity of T-cell phenotype and function: The T helper type 17 example. Immunology 129: 147–153, 2010 40. Liang SC, Long AJ, Bennett F, Whitters MJ, Karim R, Collins M, Goldman SJ, Dunussi-Joannopoulos K, Williams CM, Wright JF, Fouser LA: An IL17F/A heterodimer protein is produced by mouse Th17 cells and induces airway neutrophil recruitment. J Immunol 179: 7791–7799, 2007 41. Rangachari M, Mauermann N, Marty RR, Dirnhofer S, Kurrer MO, Komnenovic V, Penninger JM, Eriksson U: T-bet negatively regulates autoimmune myocarditis by suppressing local production of interleukin 17. J Exp Med 203: 2009–2019, 2006 42. He D, Wu L, Kim HK, Li H, Elmets CA, Xu H: CD8+ IL-17-producing T cells are important in effector functions for the elicitation of contact hypersensitivity responses. J Immunol 177: 6852–6858, 2006 43. Nakae S, Nambu A, Sudo K, Iwakura Y: Suppression of immune induction of collagen-induced arthritis in IL-17-deficient mice. J Immunol 171: 6173–6177, 2003 44. Komiyama Y, Nakae S, Matsuki T, Nambu A, Ishigame H, Kakuta S, Sudo K, Iwakura Y: IL-17 plays an important role in the development of 3576 Journal of the American Society of Nephrology 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. experimental autoimmune encephalomyelitis. J Immunol 177: 566– 573, 2006 Sakaguchi S: Naturally arising CD4+ regulatory t cells for immunologic self-tolerance and negative control of immune responses. Annu Rev Immunol 22: 531–562, 2004 Bettelli E, Carrier Y, Gao W, Korn T, Strom TB, Oukka M, Weiner HL, Kuchroo VK: Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature 441: 235–238, 2006 Komatsu N, Okamoto K, Sawa S, Nakashima T, Oh-hora M, Kodama T, Tanaka S, Bluestone JA, Takayanagi H: Pathogenic conversion of Foxp3+ T cells into TH17 cells in autoimmune arthritis. Nat Med 20: 62– 68, 2014 Lua I, Li Y, Pappoe LS, Asahina K: Myofibroblastic conversion and regeneration of mesothelial cells in peritoneal and liver fibrosis. Am J Pathol 185: 3258–3273, 2015 Liu Y, Dong Z, Liu H, Zhu J, Liu F, Chen G: Transition of mesothelial cell to fibroblast in peritoneal dialysis: EMT, stem cell or bystander? Perit Dial Int 35: 14–25, 2015 Zhou L, Lopes JE, Chong MM, Ivanov II, Min R, Victora GD, Shen Y, Du J, Rubtsov YP, Rudensky AY, Ziegler SF, Littman DR: TGF-beta-induced Foxp3 inhibits T(H)17 cell differentiation by antagonizing RORgammat function. Nature 453: 236–240, 2008 Lauzurica P, Sancho D, Torres M, Albella B, Marazuela M, Merino T, Bueren JA, Martínez-A C, Sánchez-Madrid F: Phenotypic and functional characteristics of hematopoietic cell lineages in CD69-deficient mice. Blood 95: 2312–2320, 2000 Directive 2010/63/EU of the European Parliament and of the Council of 22 September 2010 on the Protection of Animals Used for Scientific Purposes. Official Journal of the European Union 53: 33–79, 2010 González-Mateo GT, Loureiro J, Jiménez-Hefferman JA, Bajo MA, Selgas R, López-Cabrera M, Aroeira LS: Chronic exposure of mouse peritoneum to peritoneal dialysis fluid: Structural and functional alterations of the peritoneal membrane. Perit Dial Int 29: 227–230, 2009 Esplugues E, Sancho D, Vega-Ramos J, Martínez C, Syrbe U, Hamann A, Engel P, Sánchez-Madrid F, Lauzurica P: Enhanced antitumor immunity in mice deficient in CD69. J Exp Med 197: 1093–1106, 2003 Sancho D, Gómez M, Martinez Del Hoyo G, Lamana A, Esplugues E, Lauzurica P, Martinez-A C, Sánchez-Madrid F: CD69 targeting differentially affects the course of collagen-induced arthritis. J Leukoc Biol 80: 1233–1241, 2006 This article contains supplemental material online at http://jasn.asnjournals. org/lookup/suppl/doi:10.1681/ASN.2015080909/-/DCSupplemental. J Am Soc Nephrol 27: 3561–3576, 2016