TESE Crislaine Xavier Da Silva

UNIVERSIDADE FEDERAL DE PERNAMBUCO
CENTRO DE BIOCIÊNCIAS
PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA
CRISLAINE XAVIER DA SILVA
Estudo da diversidade genética de Euchroma gigantea (Coleoptera:

Buprestidae): contribuições à elucidação dos mecanismos evolutivos e status
taxonômico
Recife
2018

taxonômico
Tese apresentada ao Programa de Pós-Graduação

em Genética da Universidade Federal de
Pernambuco como parte dos requisitos exigidos para
obtenção do título de Doutora em Genética.
Orientadora: Rita de Cássia de Moura

Coorientador: Diogo Cavalcanti Cabral de Mello
Recife
2018
Dados Internacionais de Catalogação na Publicação (CIP) de acordo com ISBD
Silva, Crislaine Xavier da

Estudo da diversidade genética de Euchroma gigantea
(Coleoptera: Buprestidae): contribuições à elucidação dos mecanismos
evolutivos e status taxonômico / Crislaine Xavier da Silva - 2018.
187 folhas: il., fig., tab.
Orientador: Rita de Cássia de Moura

Coorientador: Diogo Cavalcanti de Mello
Tese (Doutorado) – Universidade Federal de Pernambuco.
Centro de Biociências. Programa de Pós-Graduação em Genética.
Recife,
2018.
Inclui referências e anexos
1. Evolução cromossômica 2. Citogenética molecular 3. Euchroma

gigantea I. Moura, Rita de Cássia de (orient.) II. Mello, Diogo
Cavalcanti (coorient.) III.Título
576.5 CDD (22.ed.) UFPE/CB-2018-406
Elaborado por Claudina Karla Queiroz Ribeiro CRB4/1752


taxonômico
Tese apresentada ao Programa de

Pós-Graduação em Genética, Área
de Concentração Evolução, da
Universidade Federal de
Pernambuco, como requisito
parcial para obtenção do título de
doutora em Genética.
Aprovada em 26/04/2018.
BANCA EXAMINADORA
_______________________________________________________________
Profª Dra Rita de Cássia de Moura
Universidade de Pernambuco
_______________________________________________________________
Profª Drª Ana Maria Benko Iseppon
Universidade Federal de Pernambuco
_______________________________________________________________
Profº Dr. Luiz Gustavo Rodrigues Souza
_______________________________________________________________
Profª Drª Ana Christina Brasileiro Vidal
_______________________________________________________________
Profª Drª Neide Santos
Àquelas cujos nomes carregam Alexandrina, Souza
da Silva e Xavier. Minhas heroínas, que sempre
foram exemplos de força e perseverança. Com muito
amor, dedico.
AGRADECIMENTOS
Em 2008 fui apresentada a Euchroma gigantea. Na ocasião minha

orientadora, Rita Moura, falou-me sobre a citogenética da espécie com muito
entusiasmo. Fui convidada para estudar a espécie, mas desconversei. Alto
polimorfismo cromossômico, cromossomos B, mecanismo de determinação sexual
múltiplo... me assustei. Por muito tempo julguei que meus olhos ainda não estavam
preparados para lidar com essa citogenética complexa. Até que chegou um tempo
em que eu senti que era justamente desse desafio que eu precisava para crescer.
Trabalhar com Euchroma exigiu de mim atributos que precisei aprender e exercitar.
E nesse caminho eu sempre me inspirei e encontrei apoio em muitas pessoas.
Jamais conseguiria trilhá-lo sozinha! Por isso tenho muito a agradecer a cada um
que Deus colocou em meu caminho ao longo desses anos.
Agradeço a minha mãe, Lúcia, e ao meu pai, Joaquim, que sempre me
incentivaram, deram todo o amor e suporte necessários para que eu chegasse até
aqui. Aos meus irmãos, Carlos André e Cleriston pela parceria de sempre. A minha
vozinha Maria, aos meus tios, tias, primos e primas pela compreensão das minhas
ausências, por vibrarem comigo a cada conquista e pelo apoio sempre. Gratidão
sem medidas. Amo muito vocês.
À minha orientadora-desde-sempre, Rita Moura. Juntas passamos por muitas
fases e eu agradeço pela nossa parceria firme e forte em cada uma delas. Por todos
os desafios propostos desde o início da minha jornada acadêmica. Por me permitir
assumir responsabilidades para as quais eu não sabia que tinha competência. Pelo
incentivo de enfrentar o novo, de buscar voar mais alto e de não ter medo das
dificuldades. Durante todo esse tempo eu cresci bastante e devo muito disso à sua
orientação, que foi sempre muito exigente e às vezes dura, mas também foi maternal
às vezes, reconheço. Agradeço pela confiança e ainda pela compreensão em
diversos momentos.
Ao meu coorientador, Diogo Cabral de Mello pela orientação, incentivos e por
ter me permitido espaço para conduzir os experimentos com autonomia em seu
laboratório. Agradeço também pelas suas críticas tão peculiares. Jamais as
esquecerei porque sei que aprendi com todas elas. #semrancores
Encontrar Diogo e Rita nesta jornada foi um prazer. Profissionais exemplares,
pelos quais tenho respeito, amizade, carinho e admiração. Serei sempre grata a
vocês.
A Cláudio Vasconcelos por todo apoio e pela ajuda nas coletas em Recife,
Brasília e Goiânia. Ao Dr. Gabriel da Luz Wallau pela colaboração na montagem e
análises do genoma mitocondrial. Às professoras que compuseram a minha banca
de qualificação Andrea Harand, Ana Christina Vidal e Neide Santos pelas críticas a
este trabalho. Ao professor Dr. Fernando Silva e a MsC Amanda Arcanjo pelas
amostras de Belém do Pará. Ao professor Dr. Edgar Bione pelo auxílio no início das
coletas em Brasília. À Dra. Sônia Casari e ao Dr. Carlos Campaner pelas amostras
cedidas pelo Museu de Zoologia da USP.
À velha guarda do LBGI: Adriana, Celso, Cristiane, Jéssica, Julliana, Igor e
Sárah que estiveram comigo ao longo dessa jornada me dando suporte científico,
metodológico e emocional também. A Karol e Rógean, que desde o começo
embarcaram comigo no desafio de estudar Euchroma. A Aline, Geyner, Josival,
Júlio, Liliane, Moara, Rafaelle e Thyago pelos conhecimentos, momentos de
descontração e tudo o mais que partilhamos.
Ao pessoal do Laboratório de Citogenética Animal da UNESP de Rio Claro:
Allison, Ana Beatriz, Diogo Milani, Mariani, Octávio, Rafael e Vanessa por todo o
suporte metodológico e convívio durante a minha estada em Rio Claro. A Mariani e
Vanessa, agradeço especialmente por terem me recebido em Rio Claro e por me
permitirem a honra do convívio com suas famílias. Foi maravilhoso me sentir tão
bem acolhida em suas casas e corações.
Às minhas amigas Cristina Heleodoro, Viviane Mattos e Amanda
Albuquerque, que muitas vezes a distância foram sempre apoio para enfrentar essa
jornada que todas nós amamos, mas que por vezes nos sequestra a subjetividade.
Vocês me inspiram.
Ao Programa de Pós-Graduação em Genética pelas oportunidades e aos
mestres que tanto contribuíram na minha formação. À CAPES, FACEPE, FAPESP,
ao PFAUPE e ao CNPq pelo financiamento desta pesquisa.
“Diego não conhecia o mar. O pai, Santiago
Kovadloff, levou-o para que descobrisse o mar. [...]
Ele, o mar, estava do outro lado das dunas altas,
esperando.
Quando o menino e o pai enfim alcançaram aquelas
alturas de areia, depois de muito caminhar, o mar
estava na frente de seus olhos. E foi tanta a
imensidão do mar, e tanto seu fulgor, que o menino
ficou mudo de beleza.
E quando finalmente conseguiu falar, tremendo,
gaguejando pediu ao pai: — Me ensina a olhar!”
(Eduardo Galeano)
RESUMO
O gênero Euchroma Solier, 1833 (Buprestidae, Coleoptera) considerado

monoespecífico para E. gigantea, apresenta polimorfismo morfológico e
cromossômico. O objetivo deste trabalho foi correlacionar os polimorfismos
genéticos de E. gigantea com o processo de diversificação cariotípica e status
taxonômico da espécie. Espécimes de Recife-PE, Maceió-AL, Belém-PA, Ribeirão
Preto-SP e Brasília-DF foram cariotipados e analisados através de FISH com sondas
de DNAr 18S, histonas (H3/H4) e DNAsat (Egig1, Egig2, Egig3). Além disso, foram
realizadas análises filogenéticas de um fragmento do COI, análise de variabilidade
de dois DNAsat, montagem e análise do mitogenoma da espécie. Os cariótipos
variaram entre 2n = 22 e 2n = 36, todos com mecanismo de determinação sexual
múltiplo com cinco, seis ou oito cromossomos. Todos os cariótipos apresentaram
cromossomos B, exceto os de Brasília. Rearranjos cromossômicos do tipo fissões,
translocações e inversões pericêntricas foram os principais rearranjos responsáveis
pela diversificação cromossômica em E. gigantea, que se originou a partir do
cariótipo ancestral de Coleoptera. Análises filogenéticas do COI indicaram a
ocorrência de três linhagens de Euchroma no Brasil, todas com polimorfismo
cromossômico. Os sítios de histonas e Egig1 foram observados nas regiões
pericentroméricas de todos os cromossomos em diferentes cariótipos. Sítios de
DNAr e duas sequências de DNAsat foram variáveis entre diferentes cariótipos e
indivíduos com mesmo cariótipo. Sequências repetitivas podem estar influenciando a
alta taxa de rearranjos cromossômicos. Por outro lado, a variabilidade na distribuição
de sítios de DNAr e DNAsat foi provavelmente ocasionada por rearranjos e eventos
de recombinação ectópica. O mitogenoma da espécie possui características únicas,
que podem ser consideradas linhagem-específicas e sinapomorfias no gênero.
Palavras-chave: Evolução cromossômica. Citogenética molecular. Filogenia.

Especiação. Mitogenoma.
ABSTRACT
Euchroma Solier, 1833 (Buprestidae, Coleoptera) is a monospecific genus for

E. gigantea, which presents morphological and chromosomal polymorphism. The aim
of this work was to correlate the genetic polymorphisms of E. gigantea with the
process of karyotype diversification and taxonomic status of the species. Specimens
from Recife-PE, Maceió-AL, Belém-PA, Ribeirão Preto-SP and Brasília-DF were
karyotyped and analyzed by FISH with 18S rDNA probes, histones (H3 / H4) and
satDNA (Egig1, Egig2 , Egig3). In addition, phylogenetic analysis of a fragment of
COI was performed, as well as variability analysis of two satDNAs, assembly and
analysis of the mitogenome of the species. Karyotypes ranged from 2n = 22 to 2n =
36, all with multiple sexual mechanism with five, six or eight chromosomes. In
addition, all karyotypes had B chromosomes, except those from Brasília.
Chromosome rearrangements such as fission, translocations and pericentric
inversions were the main rearrangements responsible for chromosome diversification
in E. gigantea from the ancestral karyotype in Coleoptera. Phylogenetic analysis of
COI indicated the occurrence of three lineages of Euchroma in Brazil, all with
chromosomal polymorphism. Histone and Egig1 sites were observed in the
pericentromeric regions of all chromosomes in different karyotypes. DNAr sites and
two satDNA sequences were variable between different karyotypes and individuals
with the same karyotype. Repetitive sequences may be influencing the high rate of
chromosomal rearrangements. On the other hand, the variability in the distribution of
rDNA and satDNA sites was probably caused by rearrangements and ectopic
recombination events. The mitogenoma of the species has unique characteristics,
which may be considered lineage-specific and synapomorphies in the genus.
Key words: Chromosomal evolution. Molecular cytogenetics. Phylogeny. Speciation.

Mitogenome.
LISTA DE ILUSTRAÇÕES
Revisão da literatura
Figura 1- Síntipo de Euchroma gigantea descrito por Linnaeus em 1758, depositado
no museu The Linnaean Society of London (a-c). Vista dorsal (a), ventral
(b) e lateral (c) do adulto e vista dorsal da larva (d). Fonte: a-c) The
Linnean Society of London, d) Autora..……..……………………………….26
Figura 2- Células em metáfase I de três espécimes de Euchroma gigantea oriundos
do município de Colômbia-SP. Barra: 5 µm..…………………….....….......33
Figura 3- Células em metáfase espermatogonial (A-D) e metáfase I (E) de
espécimes de Euchroma gigantea oriundos de Recife e Igarassu-PE.
Barra: 10 µm. ………………………………………...………………………..34
Figura 4- Padrão de bandeamento C, coloração com AgNO3 e hibridização in situ
fluorescente com sonda de DNAr em células meióticas e mitóticas de
Euchroma gigantea. Metáfase mitótica de um macho (A). Representação
esquemática do bandeamento C dos cromossomos sexuais (B).
Impregnação com AgNO3 em zigóteno indicando a RON (C). Metáfase
espermatogonial exibindo os dois sítios de DNAr (D). Metáfase I indicando
a localização dos sítios nos cromossomos X1 e X2 (cabeças de setas) (E).
Barra: 10 µm. …………………………………….............................……….36
Figura 5- Diagrama do mitogenoma ancestral de insetos. Genes de RNAt estão
indicados pelas abreviações de uma letra para seus aminiácidos
correspondentes segundo a IUPAC. A direção da transcrição dos genes é
indicada pelas setas. O tamanho dos genes é grosseiramente
proporcional ao seu compimento. Abreviações dos genes codificates de
proteínas: atp6, atp8: Subunidades 6 e 8 da ATP sintase; cob: Citocromo
oxidase b; cox1–cox3:Subunidades 1-3 da Citocromo oxidase c; nad1–6,
nad4L, Subunidades 1-6 e 4L da NADH desidrogenase; rrnS, rrnL,
subunidades maior e menor de RNA ribossomal; CR, região
controle......................................................................................................42
Insights into the karyotype evolution and speciation of the beetle Euchroma
gigantea (Coleoptera: Buprestidae)
Figure 1- Sampling sites of Euchroma gigantea used for cytogenetic and COI
analyses: Pará (PA), Pernambuco (PE), Alagoas (AL), São Paulo (SP),
and Federal District (DF). Coordinates: Belém—01° 28′ 13.55″ S, 48° 26′
49.98″ W; Recife—08° 03′ 060″ S, 34° 57′ 200″ W; Maceió—09° 33′ 4.11″
S, 35° 46′ 6.74″ W; Ribeirão Preto—21° 10′ 16.22″ S, 47° 51′ 19.67″ W;
Brasília—15° 46′ 44.7″ S, 47° 55′ 20.4″ W..............................................69
Figure 2- Chromosomal variation in metaphase I of Euchroma gigantea from (a–d)
Brasília, DF; (e, f) Ribeirão Preto, SP; (g) Belém, PA; (h, j) Recife, PE;
and (i, k) Maceió, AL. Black arrowheads indicate the ends of the sex
chromosome chains with (a, i) five, (b, d–h, k) six, or (c) eight
chromosomes. Note the presence of an autosomal trivalent (T) in a.
Hollow arrowheads indicate examples of punctiform B chromosomes (e,
f, g, k). Note two large B chromosomes (*) in g. Insets in i–k represent
the alternative conditions of pair 1 in these karyotypes. Bar = 10
μm...........................................................................................................70
Figure 3- Variability of multiple sex chromosome mechanism in Euchroma gigantea.
Conventional (a, p) and inverted DAPI staining (d, g, j, m). The same
chain is shown in the second column, after FISH with histone H4 (green)
or H3 (red) as probe, and respective drawing schemes are shown in the
third column. Bar = 10 μm…...................................................................71
Figure 4- (a) Bayesian phylogenetic tree and (b) median-joining haplotype network
topology for COI fragment from Euchroma gigantea. Abbreviations of
sampling sites are shown in the tree and correspond to those in Table 1.
The posterior probabilities/maximum likelihood bootstrap values are
given near the branches. The scale bar indicates 0.04 change per site. In
the network topology, small black circles represent extinct or unsampled
haplotypes; numbers next to the network correspond to the number of
steps among the lineages; and circle areas are proportional to the
haplotype frequencies. Emb. pat.: Embrikillium patricium, Bup. lae.
Buprestis laeviventris, Sphe. sp. Sphenoptera sp., and Sel. cal.: Selagis
caloptera. Asterisks (*) next to the specimen abbreviation in DF samples
correspond to the sexual chain with five (*), six (**), or eight (***)
chromosomes……………………………………………….……………......72
Figure 5- FISH mapping of histones H3 and H4 in (a–e, g) meiotic and (f, h) mitotic
cells of Euchroma gigantea. White arrowheads indicate the ends of the
sex chromosome chains with (a, g) five, (c, d, e) six, or (b) eight
chromosomes. Insets in (g) represent the alternative conditions to pair 1
in this karyotype. Bar = 10 μm……………………………………………...73
Figure 6- Hypotheses of chromosomal evolution in Euchroma gigantea (a, b).
Idiograms A and B (a) correspond to Coleoptera and Buprestidae modal
karyotypes, respectively. Underlined letters are karyotypes described in
this work; remaining karyotypes were described in Mesa and Fontanetti
(1984) and Moura et al. (2008). *Pericentric inversions were observed in
one or two pairs of these karyotypes…………………………………..…..74
Figure S1- Karyotype analysis of Euchroma gigantea with 2n = 22, X1Y1X2Y2X3 from
Brasília-DF. The cells are stained with Giemsa. Autosomal and sexual
chromosomes are indicated and chromosomes of compound trivalent are
indicated as TA (acrocentric) and TM (metacentric). The insert is a sexual
chain from a different metaphase belonging to the same individual. Bar =
5µm……………..………………………………………………………..…....75
Figure S2- Karyotype analysis of Euchroma gigantea with 2n = 22, X1Y1X2Y2X3Y3
from Brasília-DF. The cells are stained with Giemsa. Autosomal and
sexual chromosomes are indicated. All cells belong to same individual.
Bar = 5µm……………………………………………………...……………..76
Figure S3- Karyotype analysis of Euchroma gigantea with 2n = 22,
X1Y1X2Y2X3Y3X4Y4 from Brasília-DF. The cells are stained with Giemsa.
Autosomal and sexual chromosomes are indicated. All cells belong to
same individual. Bar = 5µm…………………………………………………77
from Brasília-DF. The cell is stained with DAPI and the color was inverted
using Photoshop CC 2014. Autosomal and sexual chromosomes are
indicated. Bar = 5µm…..……………………………………………………..78
from Ribeirão Preto-SP. The cell is stained with Giemsa. Autosomal and
sexual chromosomes are indicated. Bar = 5µm………..………......….…78
from Ribeirão Preto-SP. The cell is stained with Giemsa. Autosomal and
sexual chromosomes are indicated. Bar = 5µm……………………….….79
from Belém-PA. The cell is stained with Giemsa. Autosomal and sexual
chromosomes are indicated. Bar = 5µm…………………………..…….…80
Figure S8- Karyotype analysis of Euchroma gigantea with 2n = 32, X1Y1X2Y2X3Y3 + 2
B, from Belém-PA. The cell is stained with Giemsa. Autosomal and
sexual chromosomes are indicated. Note the presence of two large B
chromosomes. Bar = 5µm.………………………………………………..…81
from Recife-PE. The cell is stained with DAPI and the color was inverted
in Photoshop CC 2014. Autosomal and sexual chromosomes are
indicated. Bar = 5µm…………....……………………………………………82
Figure S10- Karyotype analysis of Euchroma gigantea with 2n = 35, X1Y1X2Y2X3
from Maceió-AL. The cell is stained with Giemsa. Autosomal and sexual
chromosomes are indicated. Bar = 5µm……..…………………………....83
from Recife-PE. The cell is stained with Giemsa. Autosomal and sexual
chromosomes are indicated. Bar = 5µm…………………………………...84
Figure S12- C-banding in meiotic cell of E. gigantea. The black arrowheads indicate
the ends of sex chain and hollow arrowheads point to punctiform B
chromosomes. In detail, comparison of pair 1 heteromorphic
(submeta/acrocentric) and homomorphic with two homologs acrocentric.
Bar = 10µm……………………………………...…..………………………..85
Figure S13- Co-localization of histone genes in meiotic cell. The white arrowheads
indicate the ends of sexual chain and hollow arrowheads point to
punctiform B chromosomes. Bar = 10µm…………………………...…..…85
18s rDNA and satDNAs mapping in the chromosomes of Euchroma gigantea
(Coleoptera: Buprestidae) highlights the complex evolutionary history of
divergent karyotypes
Figure 1- Egig2 and Egig3 sequence logos (upper) and haplotype networks (bottom).
In the logos each line represents sequence variation in lineages Northeast,
North and Southeast/Midwest. In nodes with more than one mutation
between haplotypes, the number of steps are indicated. Small black circles
correspond to unsampled haplotypes and circles are proportional to the
haplotypes frequencies…………………….…………………………….…..103
Figure 2- Fluorescence in situ hybridization with 18S rDNA probe on meiotic (a-f, h-j)
and mitotic (g,k) cells of Euchroma gigantea. The arrows indicate 18S
rDNA sites and arrowheads indicate the ends of sex chromosome chain
with five (a, h-j), six (b, d-f) or eight chromosomes (c). Note in (a) the
presence of an autosomal trivalent – T. See the dot B chromosomes in (d,
g-k). The diploid numbers and location of sampling are indicated in each
image. Bar = 10µm………………………………………..…......................104
Figure 3- FISH mapping of Egig1 in spermatogonial metaphases (a, c), metaphases
I (b, d) and metaphases II (e, f) of Euchroma gigantea. Note the location of
signals in pericentromeric regions of all chromosomes independent of
diploid number. The diploid numbers and location of sampling are
indicated directly in each cell. Bar:
5µm.…………………………………………………………………………....105
Figure 4- Meiotic cells in metaphases II (a, b) and metaphases I (c-f) of Euchroma
gigantea probed for Egig2 (green) and Egig3 (red) through FISH. Inserts
show separated signals. The diploid numbers and location of sampling are
indicated directly in each image. Bar = 10µm……………………………..106
Figure 5- Chromosomal mapping through FISH of Egig3 and 18S rDNA in Euchroma
gigantea metaphases I showing the co-location of both sequences. Inserts
show the signals separately. Bar 10 µm…………………………………...106
Figure S1- Idiograms showing results of FISH with rDNA probe. The asterisks (*)
identify heteromorphic pairs…………………...…………………………….107
Mitogenoma de Euchroma gigantea (Coleoptera: Buprestidae) revela redução
do gene COII, sequência não codificante e duplicação de genes de RNAt
Figura 1- Mapa circular do mitogenoma de Euchroma gigantea. Os genes de RNAt
estão indicados de acordo com o código de três letras para o aminoácido
segundo a IUPAC. Abreviações: ATP6, ATP8, genes das subunidades 6 e
8 da ATP sintase; Cob, gene da citocromo oxidase b; COI, COII, COIII,
genes das subunidades 1-3 da citocromo C oxidase; ND1-6, ND4L, genes
das subunidades 1-6 e 4L da NADH desidrogenase; rRNAL, rRNAS,
subunidades do RNA ribossomal. O círculo interno em azul representa a
cobertura de reads para cada nucleotídeo. Azul mais escuro marca
regiões onde a profundidade de sequenciamento foi maior que 1000x. O
círculo externo indica as regiões anotadas pelo MITOS com RNAt em
amarelo, genes codificantes de proteínas em azul com exceção do COII
em verde. Os genes de RNAr estão marcados em vermelho e a região
controladora em cinza..................................................... .......................124
Figura 2- Esquema do fragmento entre o gene RNAtL2 e ATP8. Os genes de RNAt
estão indicados de acordo com o código de três letras para o aminoácido
segundo a IUPAC. Note o tamanho do gene COII conservado (618 pb) e
três tipos de organização na região após o gene RNAtAsp. No tipo I, uma
duplicação do gene RNAtAsp, está separada da sua cópia por uma região
não codificante de 370 pb; no tipo II, presença de um gene RNAtAsn2 e
uma região não codificante de 171 pb; no tipo III, presença do gene
RNAtTyr, no sentido inverso, que se sobrepõem em 1 pb ao gene de
RNAtAsp....................................................................................................125
Figura 3- Predição de estruturas secundárias dos genes de RNAt Asp, RNAtTyr2 e
RNAtAsn2 identificadas no mitogenoma de Euchroma. gigantea. Variações
em cada sítio do RNAtAsp1 foram indicadas próximo ao nucleotídeo
correspondente. Cada amostra com mutações foi identificada com uma
cor e as que foram idênticas à sequência identificada na montagem do
mitogenoma foram mantidas em preto. Note em RNAtAsp1 e RNAtAsp1’ que
a diferença em 1pb alterou o tamanho do loop TψU...............................125
Figura 4- Alinhamento entre as sequências variantes do gene RNAtAsp e do gene
putativo RNAtAsn2.....................................................................................126
Figura 5- Árvore filogenéticas bayesiana para as sequências de nucleotídeos dos
genes codificantes de proteínas de Euchroma gigantea e outras espécies
da ordem Coleoptera. Os valores de probabilidade posterior/aLTR estão
indicados próximos aos nós. A barra de escala indica o número de
mutações por sítio...................................................................................127
Figura 6- Árvore filogenética bayesiana para as sequências de aminoácidos dos
genes codificantes de proteínas de Euchroma gigantea e outras espécies
da ordem Coleoptera. Os valores de probabilidade posterior/aLTR estão
indicados próximos aos nós. A barra de escala indica o número de
mutações por sítio...................................................................................128
Figura S1- Estruturas secundárias preditas para os 23 genes de tRNA do
mitogenoma de Euchroma gigantea........................................................130
Figura S2- Comparação da sequência de nucleotídeos do gene COII entre espécies
de Buprestoidea......................................................................................131
Figura S3- Comparação da sequência de aminoácidos do gene COII entre espécies
de Buprestoidea. Note as regiões I e II, e os sítios evolutivamente
conservados entre vertebrados, levedura, milho e insetos: histidina (24,
161) em verde, ácido glutâmico (62 e 202) em rosa e ácido aspártico (88,
139,158 e 173) em azul..........................................................................133
LISTA DE TABELAS
Revisão da literatura
Tabela 1- Números diploides das espécies de Buprestidae analisadas
citogeneticamente.....................................................................................29
gigantea (Coleoptera: Buprestidae)
Table 1- Euchroma gigantea sampling locations, chromosomal variability, and COI
Genbank accession numbers…………………………………………………..68
Table 2. Pairwise distance of cytochrome oxidase c I subunit within and between
populations of Euchroma gigantea. The means (minimum–maximum) of
pairwise distances are indicated..................................................................69
18s rDNA and satDNAs mapping in the chromosomes of Euchroma gigantea
(Coleoptera: Buprestidae) highlights the complex evolutionary history of
divergent karyotypes
Table 1- Chromosomal data of Euchroma gigantea analyzed individuals per sampling
site……...………………………………………………………………………..104
Mitogenoma de Euchroma gigantea (Coleoptera: Buprestidae) revela redução
do gene COII, sequência não codificante e duplicação de genes de RNAt
Tabela 1- Localidades de coleta dos espécimes analisados e cariótipos................126
Tabela 2- Distância par a par entre as sequências variantes do gene RNAtAsp e o
gene RNAtAsn2.........................................................................................129
Tabela S1- Resumo do mitogenoma de Euchroma gigantea..................................130
LISTA DE ABREVIATURAS E SIGLAS
2n Número diploide
AgNO3 Nitrato de prata
AL Estado de Alagoas
CAD Domínio carbamoilfosfato-sintase
CAPES Coordenação de Aperfeiçoamento de Pessoal de Nível Superior
CMA3 Cromomicina A3
CNPq Conselho Nacional de Desenvolvimento Científico e Tecnológico
COI Citocromo c oxidase subunidade I
DAPI 4’-6-diamidino-2-fenil-indol
dATP Desoxiadenosina trifosfato
DF Distrito Federal
DNA Ácido desoxirribonucleico
DNA C0t-1 DNA altamente e moderadamente repetido
DNAr DNA ribossomal
DNAsat DNA Satélite
dUTP Desoxiuridina trifosfato
eccDNA Extrachromosomal circular DNA
FACEPE Fundação de Amparo à Ciência e Tecnologia do Estado de
Pernambuco
FAPESP Fundação de Amparo à Pesquisa do Estado de São Paulo
FISH Hibridização in situ fluorescente
FITC Isocianato de fluoresceína
GO Estado de Goiás
HC Heterocromatina constitutiva
IBAMA Instituto do Meio Ambiente e Recursos Naturais Renováveis
ICB Instituto de Ciências Biológicas
IUPAC International Union of Pure and Applied Chemistry
LBGI Laboratório de Biodiversidade e Genética de Insetos
MEGA Molecular Evolutionary Genetics Analysis
mL Mililitros
mm Milímetros
PA Estado do Pará
pb Pares de bases
PE Estado de Pernambuco
PFAUPE Programa de Fortalecimento Acadêmico da UPE
PCR Reação em cadeia da polimerase
RNA Ácido ribonucleico
RNAr RNA ribossomal
RON Região organizadora do nucléolo
RNAt RNA transportador
UFPE Universidade Federal de Pernambuco
UNESP Universidade Estadual Paulista “Júlio de Mesquita Filho”
UPE Universidade de Pernambuco
Xyp Sistema sexual Xy com configuração em para-quedas
Xyr Sistema sexual Xy com configuração em bastão
SUMÁRIO
1 INTRODUÇÃO ....................................................................................................... 22
1.1 OBJETIVOS ........................................................................................................ 23
1.1.1 Objetivo geral ................................................................................................. 23
1.1.2 Objetivos específicos..................................................................................... 23
2 REVISÃO DA LITERATURA ................................................................................. 25
2.1 CONSIDERAÇÕES GERAIS SOBRE A FAMÍLIA BUPRESTIDAE

(COLEOPTERA) ....................................................................................................... 25
2.1.1 Euchroma gigantea ........................................................................................ 26
2.2 CITOGENÉTICA DE BUPRESTIDAE ................................................................. 28
2.2.1 Citogenética de Euchroma gigantea............................................................. 32
2.3 REARRANJOS CROMOSSÔMICOS E ESPECIAÇÃO ...................................... 36
2.4 USO DE DNA REPETITIVO NO ENTENDIMENTO DA EVOLUÇÃO

CROMOSSÔMICA EM COLEOPTERA .................................................................... 39
2.5 O DNA MITOCONDRIAL E APLICAÇÃO EM INCERTEZAS TAXONÔMICAS .. 42
3 INSIGHTS INTO THE KARYOTYPE EVOLUTION AND SPECIATION OF THE

BEETLE EUCHROMA GIGANTEA (COLEOPTERA: BUPRESTIDAE) .................. 45
4 18S RDNA AND SATDNAS MAPPING IN THE CHROMOSOMES OF

EUCHROMA GIGANTEA (COLEOPTERA: BUPRESTIDAE) HIGHLIGHTS THE
COMPLEX EVOLUTIONARY HISTORY OF DIVERGENT KARYOTYPES ............. 86
5 MITOGENOMA DE EUCHROMA GIGANTEA (COLEOPTERA: BUPRESTIDAE)

REVELA REDUÇÃO DO GENE COII, SEQUÊNCIA NÃO CODIFICANTE E
DUPLICAÇÃO DE GENES DE RNAT .................................................................... 108
6 DISCUSSÃO GERAL .......................................................................................... 134
7 CONCLUSÕES .................................................................................................... 146

REFERÊNCIAS ....................................................................................................... 147
ANEXO A – NORMAS PARA PUBLICAÇÃO ........................................................ 159
ANEXO B - CURRICULUM VITAE (LATTES) ........................................................ 181

22
1 INTRODUÇÃO
Euchroma gigantea Linneus 1735 é um besouro pertencente à família

Buprestidae, subfamília Chrysochroinae e tribo Chalcophorini. Para esta espécie
atualmente são consideradas quatro subespécies (E. gigantea goliath, E. gigantea
harperi, E. gigantea inca e E. gigantea peruanum) e algumas variedades, todas
com distribuição neotropical. Citogeneticamente a espécie apresentou um alto
polimorfirsmo, com espécimes apresentando cariótipos com 2n = 24, 26, 32, 33,
34 e 36. Todos os cariótipos possuem mecanismo de determinação sexual
múltiplo em cadeia com cinco ou seis cromossomos e cromossomos B que
variaram de cinco a 32.
Com base nos cariótipos descritos e em cariótipos hipotéticos foi sugerida
a ocorrência de sucessivos rearranjos do tipo fusão (reduzindo o número
cromossômico de 2n = 36 a 24) ou fissão (aumentando o número cromossômico
de 2n = 24 a 36), além de inversões pericêntricas como sendo responsáveis pela
variação cromossômica observada em E. gigantea. O alto polimorfismo
cromossômico observado na espécie, aliado à descrição de subespécies e
variedades, sugerem a ocorrência de diferentes espécies no gênero Euchroma,
que é considerado monoespecífico.
Rearranjos cromossômicos quando fixados entre subpopulações de uma
espécie e em espécies proximamente relacionadas podem facilitar o isolamento
reprodutivo. O cruzamento entre progenitores cromossomicamente divergentes
pode comprometer a viabilidade ou a fertilidade dos híbridos em decorrência de
problemas de segregação durante a meiose, da formação de gametas não
balanceados ou de possíveis incompatibilidades gênicas entre os parentais. Para
o entendimento do papel dos rearranjos cromossômicos no processo de
especiação, análises filogenéticas, principalmente com o uso de genes
mitocondriais, têm sido realizadas possibilitando a identificação de barreiras
reprodutivas entre espécies ou subpopulações cromossomicamente divergentes.
Até o presente não foram realizados estudos correlacionando o
polimorfismo cromossômico de E. gigantea com marcadores genéticos, que
possam ajudar a elucidar se a variação cromossômica descrita corresponde a
cariótipos espécie-específicos ou constitui um alto polimorfismo como sugerido
23
anteriormente. Assim, a ampliação da análise cariotípica em espécimes de

diferentes localidades brasileiras, bem como o mapeamento de sequências de
DNA repetitivo (DNAr 18S, histonas e DNAs satélites) nos diversos cariótipos
poderão contribuir para a melhor identificação dos rearranjos cromossômicos
envolvidos da diversificação cromossômica em E. gigantea. Além disso, análises
comparativas e filogenéticas do mitogenoma e de fragmentos do gene COI em
espécimes cariotipados fornecerão subsídios para testar a suposta condição
polimórfica da espécie ou a ocorrência de um complexo de espécies crípticas. Isto
permitirá verificar se (I) Euchroma gigantea é uma espécie cromossomicamente
polimórfica ou se (II) diferentes cariótipos constituem grupos filogeneticamente
distintos, gerando evidências da ocorrência de espécies crípticas.
1.1 OBJETIVOS
1.1.1 Objetivo geral
Realizar análises cromossômicas e moleculares em espécimes de Euchroma

gigantea, visando correlacionar os polimorfismos genéticos com o processo de
diversificação cariotípica e status taxonômico da espécie.
1.1.2 Objetivos específicos
1. Descrever a macroestrutura cromossômica de espécimes de Euchroma

gigantea de diferentes localidades para verificar a ocorrência de
polimorfismo cromossômico e novos cariótipos.
2. Verificar o status taxonômico da espécie através de análise filogenética
visando correlacioná-lo com a variação cromossômica.
3. Propor um modelo evolutivo com base na diversificação cromossômica de
E. gigantea visando identificar os principais rearranjos envolvidos no
processo.
4. Verificar se sequências repetitivas de DNA estão envolvidas no processo
de diversificação cromossômica da espécie.
24
5. Determinar a estrutura do mitogenoma e verificar se existe variação

significativa de alguma região entre indivíduos de diferentes cariótipos e
localidades.
25
2 REVISÃO DA LITERATURA
2.1 CONSIDERAÇÕES GERAIS SOBRE A FAMÍLIA BUPRESTIDAE

(COLEOPTERA)
Buprestidae (Subordem: Polyphaga) constitui uma das famílias de
besouros mais representativas, com cerca de 15.000 espécies distribuídas em
todas as regiões biogeográficas, desde as florestas boreais do Hemisfério Sul até
as mais distantes ilhas do oceano pacífico (BELLAMY, 2008; BELLAMY;
VOLKOVITSH, 2005). No Brasil, há registros de 1.459 espécies, pertencentes a
68 gêneros (CASARI; IDE, 2012). Bellamy (2003), baseando-se na análise
morfológica da antena realizada por Volkovitsh (2001), propôs para Buprestidae a
ocorrência de seis subfamílias (Julodinae, Polycestinae, Galbelinae,
Chrysochroinae, Buprestinae e Agrilinae).
Recentemente, Evans et al. (2015) construíram uma filogenia molecular
utilizando uma sequência concatenada de genes nucleares (CAD, DNAr 18S,
28S) e mitocondrial (COI), e observaram que várias das 141 espécies estudadas
apresentaram agrupamento inesperado quando comparado com a classificação
de Bellamy (2003). Neste trabalho, foram observados três clados principais, um
correspondente a subfamília Agrilinae, outro aos representantes das subfamílias
Buprestinae, Chrysochroinae e Galbelinae, e o terceiro formado por espécies de
Polycestinae e Julodinae Evans et al. (2015).
Embora os suportes dos nós não tenham sido suficientes para determinar
de forma conclusiva as inter-relações entre as seis subfamílias, os resultados
foram consistentes com as principais linhagens geralmente aceitas em estudos
baseados em caracteres morfológicos, com exceção da subfamília monogenérica
Galbelinae que, embora tenha formado um grupo monofilético, permaneceu
inserida no clado Buprestinae-Chrysochroinae. Apesar da monofilia da família
Buprestidae ter sido fortemente suportada por Evans et al. (2015), os autores
sugeriram que estudos adicionais são necessários para o melhor entendimento
das inter-relações entre as subfamílias de Buprestidae.
26
2.1.1 Euchroma gigantea
Euchroma Dejean, 1833 é um dos 79 gêneros da família Buprestidae com

ocorrência no Brasil. Este gênero está incluído na subfamília Chrysochroinae,
tribo Chalcophorini (BELLAMY, 2008; BLACKWELDER, 1944) e é considerado
monoespecífico para E. gigantea Linneus 1735. Euchroma gigantea possui
descrições de seis variedades e quatro subespécies (E. gigantea goliath, E.
gigantea harperi, E. gigantea inca e E. gigantea peruanum) as quais apresentam
distribuição neotropical (BELLAMY, 2008; BLACKWELDER, 1944).
Euchroma gigantea é uma espécie vulgarmente conhecida como mãe-de-
sol ou buprestídeo gigante da América do Sul (RODRIGUES-NETTO; CAMPOS;
IDE, 2003), devido a sua coloração iridescente metálica e ao tamanho, que pode
chegar a oito centímetros na fase adulta (Figura 1a-c) (COSTA LIMA, 1953). Na
fase de larva, os espécimes medem em torno de um centímetro no primeiro instar,
podendo chegar até 15 cm no 5º e último instar (FONSECA, 2010; GARCIA,
1998). Assim como outras larvas de espécies de Buprestidae, as larvas de E.
gigantea lembram a forma de uma palmatória (COSTA LIMA, 1953),
apresentando coloração amarelo-creme, cabeça grande em relação ao corpo e
com uma placa esclerosada na região do protorax (GARCIA, 1998) (Figura 1d).
Figura 1. Síntipo de Euchroma gigantea descrito por Linnaeus em 1758,
depositado no museu The Linnaean Society of London (a-c). Vista dorsal
(a), ventral (b) e lateral (c) do adulto e vista dorsal da larva (d).
Fonte: a-c) The Linnean Society of London, d) Autora.

27
Considerando a classificação de E. gigantea em subespécies, existe

registro apenas para E. gigantea inca na Região Sudeste do Brasil (BELLAMY,
2008). Nas demais localidades onde esta espécie ocorre não há informações
sobre a qual subespécie os exemplares pertencem, sendo todos classificados
unicamente como Euchroma gigantea. Assim, no Brasil há registros de E.
gigantea nos estados do Amazonas (INPA, 2013), Ceará (PEREIRA et al., 2013),
Paraíba (CREÃO-DUARTE et al., 2000), Pernambuco (MOURA; MELO; SOUZA,
2008), Alagoas (FONSECA, 2010), Bahia (LIMA; SOUZA; LHANO, 2014), Goiás
(GARCIA, 1998), Minas Gerais (VICHIATO et al., 2014), São Paulo (MESA;
FONTANETTI, 1984; RODRIGUES-NETTO; CAMPOS; IDE, 2003), Rio de
Janeiro (SHARP, 1881), Mato Grosso do Sul (BERTI FILHO; MENDES FILHO;
KRUGNER, 1980) e no Distrito Federal (MORENO, 2010). Euchroma gigantea é
geralmente encontrada hospedada em espécies da família Malvaceae
comumente utilizadas para arborização de áreas urbanas, como Pachira aquatica
(GARCIA, 1998, 1999), P. quinatum (ARGUEDAS, 2006), Ceiba speciosa
(RODRIGUES-NETTO; CAMPOS; IDE, 2003), C. pentandra (GARCÍA; PÉREZ;
IRIARTE, 2014) e Eriotheca crenulaticalyx (CREÃO-DUARTE et al., 2000). No
entanto, existem relatos da ocorrência de E. gigantea também em espécies de
outras famílias, por exemplo, Araucaria angustifolia (Araucariaceae) (MECKE,
2002) e Ficus spp. (Moraceae) (BERTI FILHO; MENDES FILHO; KRUGNER,
1980).
Estudos sobre a biologia da espécie são escassos, no entanto foram
realizadas observações sobre o desenvolvimento de E. gigantea em espécimes
de P. aquatica em Goiânia – GO (GARCIA, 1998) e Maceió-AL (FONSECA,
2010). As fêmeas ovopositam em média seis vezes entre os meses de dezembro
e março, com uma média de 40 ovos por postura em fendas próximas às raízes
da espécie hospedeira (FONSECA, 2010; GARCIA, 1998). A eclosão das larvas
ocorre em média em 19 dias e a partir de então as mesmas constroem uma
galeria no sentido do sistema radicular da planta, onde se alimentam e se
desenvolvem em média por 240 dias, com viabilidade média de 72% (GARCIA,
1998). O período pré-pupal apresenta um tempo médio de 13 dias e a viabilidade
média de 63%, o período pupal tem média de 30 dias e viabilidade de 69%. O
empupamento ocorre entre a serragem deixada pelas larvas, ficando a pupa com
28
a cabeça voltada para a entrada da galeria e após o período pupal, o adulto

constrói uma galeria de forma ovalada no sentido vertical em direção à superfície
do solo. O ciclo biológico médio é de 302 dias (GARCIA, 1998) e segundo
Fonseca (2010), o adulto tem longevidade média de 60 dias.
Este hábito de reprodução de E. gigantea, aliado à voracidade das larvas,
são características que a fazem se destacar como praga, causando prejuízos
diretos na planta hospedeira, que fica sem nenhum sistema de sustentação e cai
devido a ação dos ventos, e indiretos, provocados pela queda das árvores,
colocando em risco a segurança de pessoas e animais (RODRIGUES-NETTO;
CAMPOS; IDE, 2003). No Brasil, em alguns estados e particularmente na cidade
de Brasília, onde a Pachira aquatica foi extensivamente utilizada para a
arborização urbana, mais de 1500 exemplares da espécie foram removidos
devido ao risco iminente de queda das árvores infestadas por E. gigantea
(MORENO, 2010).
2.2 CITOGENÉTICA DE BUPRESTIDAE
Os estudos citogenéticos prévios na família Buprestidae foram realizados

apenas em 93 espécies (0,62%) pertencentes a 23 gêneros (Mesa e Fontanetti,
1984; Karagyan e Kuznetsova, 2000; Karagyan et al., 2004, 2012; Karagyan e
Lachowska, 2007; Moura et al., 2008). Embora este número seja relativamente
baixo, é possível observar uma considerável variabilidade cariotípica nesta
família, onde o número diploide varia de 2n = 12 em Melanophila acuminata
(Buprestinae) a 2n = 46 em Sphenoptera scovitzi (Chrysochroinae) (Tabela 1).
O número cromossômico modal é o 2n = 22, presente em 36 espécies das
subfamílias Agrilinae (4) e Buprestinae (32), seguido por 2n = 20, observado em
19 espécies distribuídas em todas as subfamílias exceto Julodinae (KARAGYAN,
2001; KARAGYAN; KUZNETSOVA, 2000; KARAGYAN; KUZNETSOVA;
LACHOWSKA, 2004; KARAGYAN; LACHOWSKA, 2007; KARAGYAN;
LACHOWSKA; KALASHIAN, 2012).
Quanto ao sistema de determinação sexual, o mais frequente é o XY,
encontrado em diferentes conformações (XYp, XYr, "XY"), no entanto, sistemas
sexuais derivados do tipo neo-XY e múltiplos X-Y também são observados. O tipo
29
"pára-quedas" Xyp é o mais comum e foi registrado em 66 espécies (Tabela 1)

(KARAGYAN, 2001; KARAGYAN; KUZNETSOVA, 2000; KARAGYAN;
KUZNETSOVA; LACHOWSKA, 2004; KARAGYAN; LACHOWSKA, 2007;
KARAGYAN; LACHOWSKA; KALASHIAN, 2012; MESA; FONTANETTI, 1984;
MOURA; MELO; SOUZA, 2008).
Tabela 1. Números diploides das espécies de Buprestidae analisadas citogeneticamente.

Subfamília
Cariótipo Referências
Espécies
Agrilinae
Agrilus sp. 20, neo-XY Karagyan e Kuznetsova, 2000
A. angustulus 22, Xyp Karagyan et al., 2004
A. anxius 22, Xyp
Karagyan et al., 2004
A. araxenus 20, Xyp Karagyan et al., 2004
A. liragus 20, neo XY Karagyan e Kuznetsova, 2000
A. obscuricollis 20, Xyp Karagyan et al., 2004
A. politus 20, XY Karagyan e Kuznetsova, 2000
Coraebus rubi 22, Xyp Karagyan et al., 2004
C. sinuatus 24, XY Karagyan et al., 2004
Meliboeus caucasicus 22, Xyp Karagyan et al., 2004
Buprestinae
Anthaxia amasina 16, Xyp Karagyan e Lachowska, 2007
A. bicolor 16, Xyp Karagyan e Kuznetsova, 2000
A. deaurata 16, Xyp Karagyan e Kuznetsova, 2000
A. hungarica 16, Xyp Karagyan e Kuznetsova, 2000
A. lgockii 16, Xyp Karagyan e Kuznetsova, 2000
A. mirabilis 16, Xyp Karagyan e Kuznetsova, 2000
A. olympica 16, Xyp Karagyan e Lachowska, 2007
A. podolica 16, Xyp Karagyan e Kuznetsova, 2000
A. sponsa 16, Xyp Karagyan e Kuznetsova, 2000
A. viridifrons 16, Xyp Karagyan e Kuznetsova, 2000
Buprestis fasciata 20 Karagyan e Kuznetsova, 2000
Castiarina adelaidae 22, Xyp Karagyan e Kuznetsova, 2000
C. argillacea 22, Xyp Karagyan e Kuznetsova, 2000
C. cupreoflava 22, Xyp Karagyan e Kuznetsova, 2000
C. decemmaculata 22, Xyp Karagyan e Kuznetsova, 2000
C. flavopicta 22, Xyp Karagyan e Kuznetsova, 2000
C. grata 22, Xyp Karagyan e Kuznetsova, 2000
C. rufipennis 22, Xyp Karagyan e Kuznetsova, 2000
C. sexplagiata 22, Xyp Karagyan e Kuznetsova, 2000
C. simulata 22, Xyp Karagyan e Kuznetsova, 2000
C. subnotata 22, Xyp Karagyan e Kuznetsova, 2000
C. subtincta 22, Xyp Karagyan e Kuznetsova, 2000
C. triramosa 22, Xyp Karagyan e Kuznetsova, 2000
Chrysobothris affinis 16, Xyp Karagyan e Lachowska, 2007
C. dentipes 16, Xyp Karagyan e Kuznetsova, 2000
30
Subfamília
Espécies
C. floricola 16, Xyp Karagyan e Kuznetsova, 2000
Melanophila acuminata 12, Xyp Karagyan e Kuznetsova, 2000
M. drummondi 16, XY Karagyan e Kuznetsova, 2000
M. intrusa 16, XY Karagyan e Kuznetsova, 2000
Sphaerobothris aghababiani 16, Xyp Karagyan et al., 2012
Stigmodera cancellata 22, Xyp Karagyan e Kuznetsova, 2000
S. goryi 22, Xyp Karagyan e Kuznetsova, 2000
S. gratiosa 22, Xyp Karagyan e Kuznetsova, 2000
S. macularia 22, Xyp Karagyan e Kuznetsova, 2000
S. porosa 22, Xyp Karagyan e Kuznetsova, 2000
S. roei 22, Xyp Karagyan e Kuznetsova, 2000
Themognatha alternata 20, Xyp Karagyan e Kuznetsova, 2000
T. barbiventris 22, Xyp Karagyan e Kuznetsova, 2000
T. bonvouloiri 22, Xyp Karagyan e Kuznetsova, 2000
T. chalcodera 22, Xyp Karagyan e Kuznetsova, 2000
T. chevrolati 22, Xyp Karagyan e Kuznetsova, 2000
T. donovani 22, Xyp Karagyan e Kuznetsova, 2000
T. heros 22, Xyp Karagyan e Kuznetsova, 2000
T. mitchelli 22, Xyp Karagyan e Kuznetsova, 2000
T. mniszechi 22, Xyp Karagyan e Kuznetsova, 2000
T. nickerli 20, Xyp Karagyan e Kuznetsova, 2000
T. parvicollis 22, Xyp Karagyan e Kuznetsova, 2000
T. pubicollis 22, Xyp Karagyan e Kuznetsova, 2000
T. regia 22, Xyp Karagyan e Kuznetsova, 2000
T. tricolorata 22, Xyp Karagyan e Kuznetsova, 2000
T. variabilis 22, Xyp Karagyan e Kuznetsova, 2000
T. viridicincta 22, Xyp Karagyan e Kuznetsova, 2000
Chrysochroinae
Acmaeodera flavolineata 20, neo-XY Karagyan e Lachowska, 2007
Capnodis miliares 20, Xyp Karagyan e Kuznetsova, 2000
C. tenebrionis 14, neo-XY Karagyan e Kuznetsova, 2000
Chalcophora lacustris 21, X0 Karagyan e Kuznetsova, 2000
Dicerca aenea validiuscula 20, Xyp Karagyan et al., 2012
D. divaricata 20, Xyp Karagyan e Kuznetsova, 2000
D. prolongata 20, Xyp Karagyan e Kuznetsova, 2000
D. tenebrosa 20, Xyp Karagyan e Kuznetsova, 2000
Euchroma gigantea 24, X1Y1X2Y2X3Y3 Mesa e Fontanetii, 1984
E. gigantea 26, X1Y1X2Y2X3 Mesa e Fontanetii, 1984
E. gigantea 32, X1Y1X2Y2X3Y3 Moura et al., 2008
E. gigantea 33 Moura et al., 2008
Ovalisiana nasdezhdae 20, Xyp Karagyan et al., 2004
Perotis cuprata 20, Xyp Karagyan e Kuznetsova, 2000
P. lugubris 20, Xyp Karagyan e Kuznetsova, 2000
Sphenoptera artemisiae 24, XY Karagyan et al., 2004
31
Subfamília
Espécies
S. glabrata 40, XY Karagyan et al., 2004
S. mesopotâmica 24, XY Karagyan e Kuznetsova, 2000
S. scovitzi 24 Karagyan e Kuznetsova, 2000
S. scovitzii 38-46 Karagyan et al., 2012
S. tamarisci 30, neo-XY Karagyan e Lachowska, 2007
Julodinae Karagyan e Kuznetsova, 2000
Julodis andreae 26, neo-XY Karagyan e Kuznetsova, 2000
J. faldermanni 26, XY Karagyan e Kuznetsova, 2000
J. whithilli 24, neo-XY Karagyan e Kuznetsova, 2000
Julodella globithorax 26, XYp Karagyan e Kuznetsova, 2000
Stenocera sp. 26, neo-XY Karagyan e Kuznetsova, 2000
S. laevigata 26, neo-XY Karagyan e Kuznetsova, 2000
S. nitidicolis 26, neo-XY Karagyan e Kuznetsova, 2000
Polycestinae
Acmaeodera boryi 18, Xyr Karagyan e Kuznetsova, 2000
A. flavofasciata 18, Xyr Karagyan e Kuznetsova, 2000
A. gibbulosa 18, Xyr Karagyan e Kuznetsova, 2000
A. hepburni 18, neo-XY Karagyan e Kuznetsova, 2000
A. pilosellae persica 20, neo-XY Karagyan et al., 2012
A. vetusta 18, Xyr Karagyan e Kuznetsova, 2000
Poucos cariótipos de espécies da família Buprestidae foram analisados

através da citogenética convencional e molecular. Karagyan (2001) estudou seis
espécies através de coloração com AgNO3 e observou blocos argirofílicos em um
ou dois pares autossômicos em duas espécies de Acmaeoderella, enquanto
quatro espécies do gênero Sphenoptera exibiram blocos argirofílicos no bivalente
sexual (Xyp). Segundo a autora esses blocos podem representar regiões
organizadoras de nucléolos (RONs).
Karagyan et al. (2012) estudaram os cariótipos das espécies Acmaeodera
pilosellae persica, Sphenoptera scovitzii, Dicerca aenea validiuscula e
Sphaerobothris aghababiani através de bandeamento C, impregnação com
AgNO3 e coloração com fluorocromos DAPI e CMA3. Pequenos blocos de HC
foram observados na região pericentromérica dos cromossomos das quatro
espécies. Alguns blocos da HC foram CMA3+, indicando riqueza em pares de
bases GC, os quais foram também AgNO3+. Adicionalmente, as espécies S.
aghababiani e D. aenea validiuscula apresentaram marcação CMA3+ e AgNO3+
nos cromossomos sexuais Xyp (para-quedas). Os autores discutem a possível
relação das marcações AgNO3+ com a presença de RONs. No entanto, visto que
32
as células não foram analisadas em prófase, fase na qual as RONs são

identificadas em cromossomos de besouros, os autores admitem a necessidade
do uso de técnicas mais específicas para elucidar esta questão.
Frydrychová e Marec (2002), em um estudo com várias espécies de
Coleoptera, detectaram a presença da sequência telomérica (TTAGG)n nas
regiões terminais dos cromossomos da espécie Agrilus viridis (Buprestidae).
Infelizmente, como observado, os resultados destes estudos em Buprestidae
geraram dados fragmentados que impossibilitam análises comparativas e
evolutivas mais abrangentes.
2.2.1 Citogenética de Euchroma gigantea
Na família Buprestidae, um alto polimorfismo cromossômico foi observado

no gênero Euchroma, que é monoespecífico para E. gigantea. Nesta espécie os
cariótipos apresentaram variação de 2n = 24 até 2n = 36 (MOURA; MELO;
SOUZA, 2008), todos com mecanismo de determinação sexual múltiplo, além da
presença de cromossomos B (Mesa e Fontanetti, 1984; Moura et al., 2008)
(Tabela 1). O polimorfismo cromossômico intraespecífico em E. gigantea, aliado à
ocorrência de subespécies e variedades, sugere a ocorrência de mais de uma
espécie no gênero, provavelmente um complexo de espécies crípticas.
Mesa e Fontanetti (1984), analisando três espécimes de E. gigantea
oriundos do município de Colômbia – SP, encontraram os cariótipos com 2n = 24
e 2n = 26 com a presença de um mecanismo de determinação sexual múltiplo e
cromossomos B puntiformes variando de 16 a 32 (Figura 2). Neste estudo, um dos
três espécimes apresentou o cariótipo 2n = 24, X1Y1X2Y2X3Y3, com cinco pares de
autossomos metacêntricos, três pares acrocêntricos, um par de cromossomos
heteromórficos, sendo um acrocêntrico e outro metacêntrico (Figura 2A); o
segundo espécime apresentou o 2n = 24, X1Y1X2Y2X3Y3, com cinco pares de
autossomos metacêntricos, dois pares acrocêntricos, um tetravalente formando
uma cadeia de zig-zag com dois cromossomos metacêntricos e dois acrocêntricos
(Figura 2B, D). O terceiro indivíduo apresentou 2n = 26, com uma cadeia de
cromossomos sexuais com cinco cromossomos (X1Y1X2Y2X3), cinco pares de
autossomos metacêntricos, quatro pares de acrocêntricos, um trivalente formado
33
por um cromossomo metacêntrico no centro e dois acrocêntricos nas

extremidades. Na cadeia de cromossomos sexuais, com exceção do Y3, que
exibiu morfologia acrocêntrica, os demais cromossomos foram metacêntricos ou
submetacêntricos (Figura 2C).
Mesa e Fontanetti (1984) sugeriram que sucessivas translocações
envolvendo autossomos e cromossomos sexuais foram responsáveis pela
formação deste complexo mecanismo encontrado em E. gigantea, e que
provavelmente é derivado de um sistema Xy.
Figura 2. Células em metáfase I de três espécimes de

Euchroma gigantea oriundos do município de
Colômbia-SP. Barra: 5 µm.
Fonte: Mesa e Fontanetti, 1984
Moura et al. (2008), analisando espécimes de E. gigantea oriundos de

Recife e Igarassu-PE, observaram os cariótipos com 2n = 32, 2n = 34 e 2n = 36,
todos apresentando o mecanismo sexual X1Y1X2Y2X3Y3. A morfologia dos
cromossomos autossomos foi predominantemente acrocêntrica, sendo observado
apenas um par submetacêntrico no cariótipo com 2n = 34 e dois pares
submetacêntricos no cariótipo com 2n = 32. Além disso, um cariótipo
heteromórfico com 2n = 33 foi observado em um espécime. No sistema sexual
múltiplo, todos os cromossomos X foram submetacêntricos, os cromossomos Y1 e
Y2 metacêntricos e o cromossomo Y3 acrocêntrico. A presença do mecanismo
34
X1Y1X2Y2X3Y3 em todas as composições dos cariótipos encontrados

em E. gigantea sugere que este é antigo e bem estabelecido. Durante a metáfase
I, os cromossomos sexuais apresentaram-se ligados por quiasma distal formando
uma cadeia alternada com a seguinte sequência X1-Y1-X2-Y2-X3-Y3 (Figura 3).
Figura 3. Células em metáfase espermatogonial (A-D) e

metáfase I (E) de espécimes de Euchroma gigantea
oriundos de Recife e Igarassu-PE. Barra: 10 µm.
Fonte: Adaptado de MOURA et al. 2008
Comparando os cariótipos encontrados nas amostras de E. gigantea de

Pernambuco e de São Paulo, Moura et al. (2008) sugeriram dois possíveis
caminhos evolutivos para a formação dos distintos cariótipos. Considerando que o
cariótipo plesiomórfico seja o 2n = 36, sucessivas fusões cêntricas teriam
resultado nos cariótipos derivados, iniciando com uma única fusão homozigótica,
35
produzindo 2n = 34, seguido por duas fusões produzindo 2n = 32, cinco fusões
produzindo 2n = 26 e seis dando origem ao 2n = 24. A outra alternativa sugerida
foi que os rearranjos ocorreram a partir do cariótipo 2n = 24, no qual uma fissão
daria origem ao 2n = 26, quatro fissões produziriam o 2n = 32, cinco fissões
dariam origem ao 2n = 34 e seis fissões ao 2n = 36. Além dos rearranjos
descritos, os autores sugeriram a ocorrência de inversões pericêntricas
responsáveis pela alteração da morfologia dos cromossomos nos diferentes
cariótipos observados em E. gigantea.
Ainda no estudo de Moura et al. (2008) as técnicas de bandeamento C,
impregnação com AgNO3 e hibridização in situ fluorescente (FISH) com sonda de
DNAr 45S foram aplicadas nos cariótipos com 2n = 32 de E. gigantea. Pequenos
blocos de heterocromatina constitutiva (HC) foram observados na região
pericentromérica dos cromossomos autossômicos e uma grande quantidade de
HC nos cromossomos sexuais. Os cromossomos X1 e X3 apresentaram-se quase
completamente heterocromáticos e no X2 a HC foi observada apenas na região
terminal do braço curto. O Y1 apresentou o braço curto quase completamente
heterocromático e uma banda de HC intersticial no braço longo. O Y 2 apresentou
um bloco de HC se estendendo ao longo dos dois braços cromossômicos e o Y 3
exibiu um bloco de HC pericentromérico no braço curto. Uma RON foi observada
na cadeia de cromossomos sexuais e a hibridização in situ florescente evidenciou
sinais de DNAr 45S nos cromossomos X1 e X2, confirmando o resultado da
impregnação com AgNO3.
36
Figura 4. Padrão de bandeamento C, coloração com

AgNO3 e hibridização in situ fluorescente com sonda de
DNAr em células meióticas e mitóticas de Euchroma
gigantea. Metáfase mitótica de um macho (A).
Representação esquemática do bandeamento C dos
cromossomos sexuais (B). Impregnação com AgNO3 em
zigóteno indicando a RON (C). Metáfase espermatogonial
exibindo os dois sítios de DNAr (D). Metáfase I indicando a
localização dos sítios nos cromossomos X1 e X2 (cabeças
de setas) (E). Barra: 10 µm.
Fonte: Adaptada de MOURA et al. 2008
2.3 REARRANJOS CROMOSSÔMICOS E ESPECIAÇÃO
White (1968) propôs um modelo no qual rearranjos cromossômicos podem

desempenhar um papel direto na promoção da especiação. Isto com base na
observação de que os rearranjos cromossômicos podem alterar as taxas e
padrões de fluxo gênico dentro e entre espécies, através da redução no fitness de
indivíduos híbridos cromossômicos.
Muitos modelos de especiação cromossômica têm sido propostos e
divergem quanto à necessidade de isolamento geográfico para a especiação aos
processos que originam os rearranjos e como eles se tornam fixos nas
37
populações, quanto à intensidade dos efeitos dos rearranjos no fitness de

indivíduos heterozigotos cromossômicos e ainda se as modificações
cromossômicas estão associadas com diferenças adaptativas que permitem a
colonização de novos habitats. No entanto, esses modelos compartilham uma
característica fundamental, a qual postula que as diferenças cromossômicas
acumuladas entre as novas espécies e os seus progenitores comprometem a
fertilidade ou a viabilidade dos híbridos interespecíficos (sub-dominância)
(BROWN; O’NEILL, 2010; CRESPI; NOSIL, 2013; LIVINGSTONE; RIESEBERG,
2004; RIESEBERG, 2001).
Rearranjos cromossômicos permitem a diferenciação de genes,
consequentemente o acúmulo de incompatibilidades, além de alterar a expressão
gênica perto de breakpoints (Faria e Navarro, 2010). Além disso, em
heterozigotos para translocações e inversões, o crossing over em certas áreas de
cromossomos rearranjados gera cromátides com duplicações e deficiências no
conteúdo gênico (LIVINGSTONE; RIESEBERG, 2004). Sendo assim, o efeito
negativo no fitness do heterozigoto cromossômico pode ser decorrente tanto de
problemas de segregação durante a meiose e a formação de gametas não
balanceados, bem como de possíveis incompatibilidades gênicas entre os
parentais (BROWN; O’NEILL, 2010; CRESPI; NOSIL, 2013; FARIA; NAVARRO,
2010).
Uma crítica às teorias de evolução cromossômica é que uma forte sub-
dominância implica que os rearranjos seriam rapidamente eliminados da
população, por outro lado, uma fraca sub-dominância sugere que os rearranjos
podem permanecer na população, mas não têm forte efeito na esterilidade do
híbrido para facilitar o isolamento das espécies incipientes (LANDE, 1985;
RIESEBERG, 2001). Uma ressalva a esta crítica é que tanto a deriva genética
como drive meiótico podem oferecer meios para que um rearranjo subdominante
persista em uma população (BROWN; O’NEILL, 2010). Assim, a hibridização
entre indivíduos cromossomicamente distintos pode contribuir para a divergência
de populações, gerando uma população híbrida que permanece distinta de ambas
populações parentais (ABBOTT et al., 2013). Além disso, uma barreira genética
bem como a especiação não resultam de uma única variação, mas do acúmulo de
variações (BROWN; O’NEILL, 2010).
38
Em alguns gêneros de diferentes ordens de insetos foi observado que

rearranjos cromossômicos podem desempenhar um papel importante na origem
de barreiras reprodutivas que isolam espécies ou populações em processo de
especiação (COLUZZI et al., 2002; KAWAKAMI; BUTLIN; COOPER, 2011;
KOBAYASHI et al., 2000; MILLS; COOK, 2014; NOOR et al., 2001).
No gênero Drosophila (Diptera), inversões que distinguem as espécies D.
pseudoobscura e D. persimilis carregam alelos que causam esterilidade do
híbrido quando introgredidos. Para estas espécies, Noor et al. (2001) propuseram
um modelo no qual a supressão da recombinação entre as regiões invertidas
acarreta um isolamento pós-zigótico entre essas espécies. Neste modelo,
rearranjos cromossômicos podem facilitar a diversificação após um contato
secundário, por reduzir a recombinação na região rearranjada e então manter o
desequilíbrio de ligação entre genes envolvidos nesta parte do genoma.
Um modelo similar foi proposto para o complexo de espécies Anopheles
gambiae (Diptera), que apresenta diferentes padrões de fixação de inversões
paracêntricas em sete espécies crípticas citogeneticamente distinguíveis
(COLUZZI et al., 2002). No gênero Vandiemenella (Orthoptera), hibridizações
subsequentes entre indivíduos de populações adjacentes, que possuem inversões
ou fusões cêntricas fixadas diferencialmente, resultam em híbridos inférteis
(KAWAKAMI; BUTLIN; COOPER, 2011). Neste gênero, os estudos citogenéticos,
aliados a análises filogenéticas utilizando genes mitocondriais e nucleares
permitiu o melhor entendimento do papel dos rearranjos cromossômicos na
especiação (KAWAKAMI; BUTLIN; COOPER, 2011).
Na ordem Coleoptera, estudos sobre a relação de rearranjos
cromossômicos e especiação são escassos. Nesta ordem, os estudos
citogenéticos, em geral, relacionam cariótipos de diferentes gêneros em uma
família ou subfamília e os rearranjos cromossômicos são discutidos nesse
contexto, focando principalmente na variação do número diploide e mecanismos
sexuais (CABRAL-DE-MELLO et al., 2008; PETITPIERRE, 2011; ROZEK et al.,
2004) com pouca ênfase nos processos de especiação (GALIÁN; PROENÇA;
VOGLER, 2007; KOBAYASHI et al., 2000). Em geral, o que tem sido observado
nos gêneros, como por exemplo Bembidion (Carabidae) e Onthophagus
(Scarabaeidae), é a predominância de um número diploide na maioria das
39
espécies cariotipadas e no caso de cariótipos derivados, o aumento ou redução

de dois cromossomos (BLACKMON; DEMUTH, 2015). Aparentemente, o
processo de especiação para a maioria das espécies nesses gêneros não envolve
muitos rearranjos cromossômicos.
Em Coleoptera, um exemplo no qual a diferenciação cromossômica foi
considerada no processo de especiação foi na espécie Epilachna
vigintioctopunctata (Coccinellidae) (KOBAYASHI et al., 2000). Neste trabalho, os
autores analisaram oito populações asiáticas de E. vigintioctopunctata através de
citogenética convencional, análise filogenética de um fragmento do gene
codificador da enzima citocromo oxidase I (COI) e cruzamentos. Apesar dos
espécimes apresentarem o mesmo número diploide (2n = 18, Xyp/XYp), diferenças
na morfologia dos seis menores pares de autossomos relacionadas com o
aumento de heterocromatina, além do tamanho diferencial do cromossomo Y,
permitiram distinguir as populações do Norte e do Sul asiático. Esta separação foi
bem suportada pela análise filogenética. Além disso, o cruzamento intergrupo não
originou prole viável, indicando que possivelmente as diferenças cromossômicas
estão atuando como barreira, promovendo o isolamento reprodutivo das
populações. Estes resultados indicaram que os espécimes analisados pertencem
a pelo menos duas espécies crípticas.
2.4 USO DE DNA REPETITIVO NO ENTENDIMENTO DA EVOLUÇÃO

CROMOSSÔMICA EM COLEOPTERA
A técnica de hibridização in situ fluorescente com o uso de diferentes

sondas de DNA repetitivo tem contribuído para o entendimento da estrutura e
organização cromossômica em Coleoptera. As sequências mais utilizadas são as
de famílias multigênicas, seguida por DNA satélite, elementos de transposição e
sequências teloméricas (CABRAL-DE-MELLO et al., 2011a; LORITE et al., 2002;
MRAVINAC et al., 2011; SÁNCHEZ-GEA; SERRANO; GALIÁN, 2000;
UGARKOVIĆ; PODNAR; PLOHL, 1996). O número de espécies de Coleoptera
analisadas ainda é pequeno (<0,05%) e restrito a poucas famílias das subordens
Adephaga (FRYDRYCHOVÁ; MAREC, 2002; GALIAN; HUDSON, 1999;
SÁNCHEZ-GEA; SERRANO; GALIÁN, 2000) e Polyphaga (AMORIM et al., 2016;
40
CABRAL-DE-MELLO et al., 2011a; COLOMBA et al., 2004; COLOMBA; VITTURI;

ZUNINO, 2000; FRYDRYCHOVÁ; MAREC, 2002; GOLL et al., 2015; MENDES-
NETO et al., 2010; MOURA; MELO; SOUZA, 2008; MRAVINAC et al., 2011;
SAHARA; MAREC; TRAUT, 1999; XAVIER; CABRAL-DE-MELLO; MOURA,
2014).
O DNAr 45S é a sequência mais mapeada considerando o número de
espécies analisadas nas diferentes famílias de Coleoptera, sendo possível
observar de dois a 16 sítios distribuídos exclusivamente em autossomos, apenas
em cromossomos sexuais ou em ambos (ALMEIDA et al., 2010; ARCANJO et al.,
2009; CABRAL-DE-MELLO et al., 2011a; COLOMBA et al., 2004; OLIVEIRA et
al., 2010; SÁNCHEZ-GEA; SERRANO; GALIÁN, 2000). A família Scarabaeidae
(Polyphaga) é a que apresenta o maior número de espécies estudadas através da
FISH. É também nesta família onde se encontram as espécies de Coleoptera com
sequências de DNAr 5S, histona H3, fração de DNA C0t-1 e elementos de
transposição (TEs) mapeadas (AMORIM et al., 2016; CABRAL-DE-MELLO et al.,
2011a, 2011b; CABRAL-DE-MELLO; MOURA; MARTINS, 2011; OLIVEIRA et al.,
2012; OLIVEIRA; MOURA; MARTINS, 2012; XAVIER; CABRAL-DE-MELLO;
MOURA, 2014). Estes estudos, em geral, revelaram de dois a cinco sítios
referentes aos genes de DNAr 5S e histona H3, que apresentaram co-localização
dos sinais em todos os cariótipos nos quais as duas sequências foram mapeadas
(CABRAL-DE-MELLO et al., 2011a).
O mapeamento da fração de DNA C0t-1 e de elementos de transposição foi
restrito a espécies dos gêneros Coprophanaeus e Dichotomius (Scarabaeidae) e
contribuiu para o entendimento da origem do cromossomo B em C. cyanescens
(OLIVEIRA; MOURA; MARTINS, 2012) e da possível relação dos TEs com a
dinâmica da HC em espécies do gênero Dichotomius (AMORIM et al., 2016;
CABRAL-DE-MELLO et al., 2011b; XAVIER; CABRAL-DE-MELLO; MOURA,
2014).
O mapeamento de sequências teloméricas revelou a presença da repetição
(TTAGG)n, comumente encontrada em invertebrados, nas extremidades dos
cromossomos de nove espécies pertencentes as famílias Anobiidae, Buprestidae,
Chrysomelidae, Coccinellidae, Cucujidae, Curculionidae e Elateriade
(FRYDRYCHOVÁ; MAREC, 2002; MORA et al., 2015). Em espécies da família
41
Tenebrionidae, a sequência (TCAGG)n, caracterizada no genoma de Tribolium

castaneum, foi mapeada nas extremidades dos cromossomos de Tenebrio molitor
e T. castaneum. Esta repetição (TCAGG) pode representar uma variante funcional
da sequência (TTAGG)n, visto que, ao menos em T. molitor, esta sequência não
foi encontrada (MRAVINAC et al., 2011; SAHARA; MAREC; TRAUT, 1999).
Diferentes famílias de DNA satélite espécies-específicas, obtidas através
do método clássico com enzimas de restrição, foram mapeadas em espécies das
famílias Tenebrionidae e Chrysomelidae, ambas da subordem Polyphaga. Em
comum, os estudos revelaram que estas sequências possuem monômeros de 110
a 711pb, são ricas em A-T e estão presentes nas regiões pericentroméricas de
todos ou quase todos os cromossomos. Algumas vezes, as
sequências exibiram subrepetições diretas ou invertidas que podem fornecer
indícios de como elas evoluíram ou que podem ter algum papel funcional no
genoma devido à possibilidade de gerar estruturas secundárias (JUAN; PONS;
PETITPIERRE, 1993; LORITE et al., 2001, 2002; LORITE; TORRES;
PALOMEQUE, 2013; MRAVINAC; PLOHL, 2010; UGARKOVIĆ; DURAJLIJA;
PLOHL, 1996; UGARKOVIĆ; PODNAR; PLOHL, 1996).
Recentemente, Pavlek et al. (2015) realizaram um estudo mais detalhado
do DNA satélite TCAST, anteriormente descrito para Tribolium castaneum e,
através de análises bioinformáticas do genoma de T. castaneum, descobriram
várias outras famílias e subfamílias de DNAs repetitivos. Neste estudo, nove
famílias de DNAsat mais abundantes, além do TCAST, foram mapeadas através
de FISH no cariótipo de T. castaneum. Embora a localização do TCAST na HC de
todos os cromossomos tenha sido confirmada, as demais famílias de DNAsat
estiveram presentes principalmente em regiões eucromáticas. Estes resultados,
aliados às análises bioinformáticas da distribuição genômica das sequências,
permitiram aos autores sugerir que trocas inter-cromossômicas seguidas pela
amplificação foram responsáveis pelos padrões distribuição observados. Além
disso, que elementos de transposição podem estar atuando na dispersão das
sequências.
42
2.5 O DNA MITOCONDRIAL E APLICAÇÃO EM INCERTEZAS TAXONÔMICAS
O genoma mitocondrial (mt) em animais geralmente é constituído de uma

molécula circular composta por 37 genes, sendo 13 genes codificantes de
proteínas, 22 de RNAt e dois de RNAr (BOORE, 1999). Este genoma possui
características únicas quando comparado ao genoma nuclear, como a herança
materna, a alta taxa de mutações, a baixa frequência de recombinação e o alto
número de cópias (BOORE, 1999; LADOUKAKIS; ZOUROS, 2017).
Figura 5. Diagrama do mitogenoma ancestral de insetos. Genes de RNAt estão

indicados pelas abreviações de uma letra para seus aminoácidos correspondentes
segundo a IUPAC. A direção da transcrição dos genes é indicada pelas setas. O
tamanho dos genes é grosseiramente proporcional ao seu comprimento.
Abreviações dos genes codificates de proteínas: atp6, atp8: Subunidades 6 e 8 da
ATP sintase; cob: Citocromo oxidase b; cox1–cox3:Subunidades 1-3 da Citocromo
oxidase c; nad1–6, nad4L, Subunidades 1-6 e 4L da NADH desidrogenase; rrnS,
rrnL, subunidades maior e menor de RNA ribossomal; CR, região controle.
Fonte: CAMERON, 2014

43
Outras características do mitogenoma refletem em facilidades de ordem

metodológica que fazem do DNAmt uma informação acessível e útil, por exemplo,
em estudos de genética de populações (KAJTOCH et al., 2014; LOPES et al.,
2013; LOPEZ et al., 2014) e de identificação molecular de espécies (HAN et al.,
2012; KEKKONEN; HEBERT, 2014; WU et al., 2017).
Embora as sequências do mitogenoma sejam conhecidas por evoluir
rapidamente, seus arranjos gênicos frequentemente são mantidos por longos
períodos na escala evolutiva (BOORE, 1999). Em insetos a maioria mitogenomas
descritos possuem o arranjo considerado ancestral para artrópodes (BOORE,
1999; CAMERON, 2014). Porém, rearranjos têm sido encontrados em muitas
ordens, os quais não são compartilhados entre elas. Em vez disso, os rearranjos
ocorreram independentemente e são considerados como sinapomórficos em
categorias taxonômicas abaixo de ordem, como infraordem, família, subfamília e
gênero (CAMERON, 2014).
Rearranjos também têm sido observados em nível de espécies, mas a
extensão taxonômica desses rearranjos não foi determinada nestes casos. Tais
rearranjos variam entre eventos de inversões, como observado em Hymenoptera
(CAMERON, 2014), deleções de RNAt em Coleoptera (NAN; WEI; HE, 2016;
TANG et al., 2017) ou duplicações de genes de RNAt como identificado em
Lepidoptera (LIU et al., 2017), até rearranjos de maiores extensões envolvendo
múltiplos genes, incluindo os codificantes de proteínas em espécies da ordem
Mecoptera (BECKENBACH, 2011).
Embora essas variações representem um estado derivado que não é
filogeneticamente informativo, elas podem representar sinapomorfias particulares
de alguns táxons (TIMMERMANS; VOGLER, 2012). Estas sinapomorfias são
consideradas com grande potencial para resolver alguns ramos da filogenia de
metazoários, pois comparações do mitogenoma completo podem resultar em
insights significantes sobre a evolução tanto dos organismos, quanto dos
genomas (BOORE, 1999).
Em Buprestidae, apenas oito espécies tiveram descrição completa ou
parcial do mitogenoma (DUAN et al., 2017; HONG et al., 2009; TIMMERMANS et
al., 2015). Dentre estes, o único que apresentou variações ao padrão considerado
ancestral para insetos foi o da espécie Chrysochroa fulgidíssima (Chrysochroinae)
44
(BOORE, 1999; DUAN et al., 2017; HONG et al., 2009). Neste mitogenoma
sequências similares aos genes de tRNALeu e tRNAAsn foram encontradas na
região controle (HONG et al., 2009). Estas sequências possuem o anticódon e o
potencial de gerar estruturas secundárias, porém, apresentam distâncias de 50-
58% dos genes regulares e a presença de muitos mismatches nas regiões do
anticódon e aminoacil, o que põe em questão a sua funcionalidade (HONG et al.,
2009). Além disso, neste mitogenoma foi identificado um espaçador de 37 pares
de bases (pb) entre os genes tRNAAsp e AP8, o qual é incomum em Coleoptera e
sua origem não foi discutida (HONG et al., 2009).
Sequências isoladas de DNAmt também têm sido úteis para resolução de
problemas taxonômicos. Em Coleoptera, análises filogenéticas para distintos
grupos utilizando genes mitocondriais em conjunto com genes nucleares têm sido
realizadas, algumas abrangendo famílias inteiras e outras restritas a unidades
taxonômicas mais terminais, como subfamílias, tribos e gêneros (BERGSTEN et
al., 2012; MAGRO et al., 2010; PFEILER et al., 2010; RAUPACH; HANNIG;
WÄGELE, 2011).
A utilização de genes mitocondriais em análises filogenéticas ou de distância
genética (DNA barcode) tem sido especialmente útil no estudo de espécies
crípticas, ou seja, aquelas que pertencem a linhagens geneticamente divergentes,
mas são morfologicamente indistinguíveis ou de difícil distinção. Essas espécies
são encontradas em vários grupos animais (BICKFORD et al., 2007;
PFENNINGER; SCHWENK, 2007) incluindo besouros da família Buprestidae
(KIM; HWANG; KWON, 2014; PENTINSAARI; MUTANEN; KAILA, 2014). Em
geral estas espécies carecem de análise taxonômica (KEKKONEN; HEBERT,
2014; KIM; HWANG; KWON, 2014; MILLS; COOK, 2014) e estas metodologias
podem pode ser utilizadas como o primeiro passo para a organização de grupos
geneticamente divergentes, que podem então ser mais facilmente analisados por
taxonomia convencional (HAJIBABAEI et al., 2007; MILLS; COOK, 2014).
45
3 INSIGHTS INTO THE KARYOTYPE EVOLUTION AND SPECIATION OF THE

BEETLE EUCHROMA GIGANTEA (COLEOPTERA: BUPRESTIDAE)
Crislaine Xavier1; Rógean Vinícius Santos Soares1; Igor Costa Amorim1; Diogo
Cavalcanti Cabral-de-Mello2; Rita de Cássia de Moura1*
1Universidade de Pernambuco (UPE), Instituto de Ciências Biológicas, Laboratório

de Biodiversidade e Genética de Insetos, Recife, Pernambuco, Brazil
2Universidade Estadual Paulista (UNESP), Instituto de Biociências, Departamento
de Biologia, Rio Claro, São Paulo, Brazil
*Universidade de Pernambuco (UPE) - Instituto de Ciências Biológicas/ICB,

Laboratório de Biodiversidade e Genética de Insetos. Rua Arnóbio Marques 310,
Santo Amaro, CEP 50100-130 Recife - PE, Brazil.
e-mail: [email protected]
Este manuscrito foi publicado na Revista Chromosome Research

Fator de impacto: 2.385
Qualis B1 (CBI)
46
Abstract
Euchroma Dejean, 1833 (Buprestidae: Coleoptera) is a monotypic genus

comprising the species Euchroma gigantea, with populations presenting a degree
of karyotypic variation/polymorphism rarely found within a single taxonomic
(specific) unit, as well as drastically incompatible meiotic configurations in
populations from extremes of the species range. To better understand the complex
karyotypic evolution of E. gigantea, the karyotypes of specimens from five
populations in Brazil were investigated using molecular cytogenetics and
phylogenetic approaches. Herein, we used FISH with histone genes as well as
sequencing of the COI to determine differential distribution of markers and
relationships among populations. The analyses revealed new karyotypes, with
variability for chromosome number and morphology of multiple sex-chromosome
mechanisms, occurrence of B chromosome variants (punctiform and large ones),
and high dispersion of histone genes in different karyotypes. These data indicate
that chromosomal polymorphism in E. gigantea is greater than previously reported,
and that the species can be a valuable model for cytogenetic studies. The COI
phylogenetic and haplotype analyses highlighted the formation of three groups
with chromosomally polymorphic individuals. Finally, we compared the different
karyotypes and proposed a model for the chromosomal evolution of this species.
The species E. gigantea includes at least three cytogenetically polymorphic
lineages. Moreover, in each of these lineages different chromosomal
rearrangements have been fixed. Dispersion of repetitive sequences may have
favored the high frequency of these rearrangements, which could be related to
both adaptation of the species to different habitats and the speciation process.
Keywords: Chromosomal evolution; chromosomal rearrangement; multiple sex-

chromosome mechanism; molecular cytogenetics; histone dispersion
47
Introduction
Chromosomal rearrangements can promote reproductive isolation by either

hybrid sterility or suppression of recombination, which are processes directly
involved in speciation events (Faria and Navarro 2010). The traditional theory of
chromosomal speciation, for instance, predicts that this process may occur when
structural rearrangements become fixed in a population. Then, recombination
among rearranged chromosomes in heterokaryotypic hybrids generates
unbalanced gametes, resulting in underdominance, i.e. reduced fertility or
complete sterility (Brown and O’Neill 2010). Furthermore, incompatibility between
rearranged chromosomes could lead to reproductive isolation and speciation,
especially when such changes are linked to the sex chromosomes (Rieseberg
2001). The role of chromosomal rearrangements in originating reproductive
barriers, has been investigated and reported to play an important role in isolating
species or populations in some genera of Hemiptera (Mills and Cook 2014),
Diptera (Noor et al. 2001; Coluzzi et al. 2002), Orthoptera (Kawakami et al. 2011)
and Coleoptera (Kobayashi et al. 2000) insects.
In Coleoptera, studies on the relationship between chromosomal
rearrangements and speciation are scarce. In this order, general karyotypic
descriptions have been made and chromosomal rearrangements have been
discussed with focus on understanding the variation in diploid number (2n) as well
as the origin and evolution of sex chromosomes (Karagyan and Kuznetsova 2000;
Rozek et al. 2004; Schneider et al. 2007; Cabral-de-Mello et al. 2008; Petitpierre
2011). However, there are few examples in which speciation processes related to
chromosomal rearrangements in some genera are well documented. Among
these, two general scenarios are observed in phylogenetically related or cryptic
species: (i) increase or decrease in diploid number; or (ii) maintenance of diploid
number with change of chromosome morphology due to rearrangements or
differential constitutive heterochromatin content (Kobayashi et al. 2000; Galián et
al. 2007; Dutrillaux and Dutrillaux 2016).
Euchroma Dejean, 1833 (Coleoptera, Buprestidae) is a monotypic genus to
E. gigantea (Linnaeus) 1758, accounting for four subspecies with Neotropical
distribution: E. g. goliath, E. g. harperi, E. g. inca and E. g. peruanum (Blackwelder
48
1944). Morphological variability has been observed along the species

geographical distribution, whereby only the subspecies E. g. inca is recorded in
Brazil (Blackwelder 1944; Bellamy 2003). From a chromosomal point of view, E.
gigantea is also polymorphic among Brazilian populations from Colômbia (state of
São Paulo – SP), Recife and Igarassu (state of Pernambuco – PE). The diploid
numbers 2n=24 or 26 have been reported in individuals from São Paulo (Mesa
and Fontanetti 1984), and 2n=32, 33, 34 or 36 in individuals from Pernambuco
(Moura et al. 2008). The occurrence of a multiple sex chromosome chain
(X1Y1X2Y2X3Y3) originated from sex chromosome-autosome translocations (Mesa
and Fontanetti 1984; Moura et al. 2008) is noteworthy, as well as the punctiform B
chromosomes varying in number from five (Moura et al. 2008) to 32 (Mesa and
Fontanetti 1984). Moura et al. (2008) proposed two most likely mechanisms to
explain the chromosomal variation in E. gigantea. In both cases, the sex
chromosome chain was hypothesized to have emerged before the diversification
of autosomal chromosomes. The first mechanism suggests that the ancestral
karyotype was 2n=36, from which successive centric fusions resulted in reduction
of the diploid number to 2n=24. The second hypothesis proposes that, starting
from a 2n=24 ancestral karyotype, successive centric fissions occurred, increasing
the diploid number to 2n=36. In addition, pericentric inversions are suggested to
be responsible for changes in the proportions of chromosome arms in different
karyotypes described in E. gigantea.
The chromosome features, i.e. diploid number, sex chromosomes and
presence of B chromosomes, in E. gigantea are remarkably different from those
reported for other species in the family Buprestidae, indicating the need for further
investigations. In this family, the diploid number varies from 2n=12 in Melanophila
acuminata (Buprestinae) to 2n=46 for Sphenoptera scovitzi (Chrysochroinae), but
most species show 2n=22 or 20, simple sexual mechanism, and no B
chromosomes (Karagyan and Kuznetsova 2000; Karagyan et al. 2004; Karagyan
and Lachowska 2007; Karagyan et al. 2012).
In this work, conventional and molecular cytogenetic analyses and
phylogeny of cytochrome c oxidase subunit I (COI) were combined to unravel the
complex chromosomal evolution of E. gigantea. The present data support the
49
hypothesis of diverse chromosome rearrangements generating the high

chromosomal polymorphism, as well as lineage diversification in E. gigantea.
Material and methods

Sample collection
E. gigantea (Linnaeus, 1758) specimens were collected manually from trees
of the family Malvaceae used in afforestation of urban areas in Recife (state of
Pernambuco – PE), Maceió (state of Alagoas – AL), Ribeirão Preto (state of São
Paulo – SP), Belém (state of Pará – PA) and Brasília (Federal District – DF),
Brazil. Male individuals were predominant in all populations, and females could not
be sampled in SP and PA. Sixty-two male individuals were karyotyped, 55 of
which were used for molecular investigation. For COI analysis, two specimens
from Colômbia (SP) were also included which were previously analyzed
cytogenetically by Mesa and Fontanetti (1984) and deposited at the Zoology
Museum of the University of São Paulo (MZUSP), Brazil (Fig. 1, Table 1).
Sampling was performed in accordance with Brazilian laws of environmental
protection, permitted by license from IBAMA/SISBIO (No. 16278-1).
Cytogenetic analyses
Chromosomal preparations were obtained from 62 individuals by the
classical method of testicular squashing, followed by conventional staining with 5%
Giemsa solution. Ovaries were treated for 30 min with 0.05% colchicine solution;
however, only low-quality preparations could be obtained, frequently with no
metaphases. Whenever possible, the morphology of all chromosomes was also
compared among individuals with the same diploid number. C-banding was
performed as described by Sumner (1972), with exposure to BaOH (barium
hydroxide) for 50 seconds.
Fluorescence in situ hybridization (FISH) was performed as described by

Pinkel et al. (1986) with modifications (Cabral-de-Mello et al. 2010). Genomic DNA
was extracted from leg muscle tissue using the phenol-chloroform procedure
described by Sambrook and Russel (2001). H3 and H4 histone gene sequences
were obtained from the genome of E. gigantea using specific primers described by
50
Cabral-de-Mello et al. (2010) and Pineau et al. (2005), respectively. PCR products
were sequenced by Macrogen Inc. (Korea), and the sequences were deposited in
GenBank (accession numbers: KX885406, KX885407). The reactions were
performed in a volume of 50 µL containing 1X Taq DNA polymerase recombinant
buffer (Invitrogen), 1.5 mM of MgCl2, 0.02 mM of dNTP, 0.4 μM of each primer and
0.02 units of Taq DNA polymerase. The PCR program consisted of initial
denaturation for 5 min at 94ºC; 30 cycles of 1 min at 94 ºC; 30 s at 55ºC; 60 s at
72ºC; and final extension for 5 min at 72ºC. The H3 and H4 histone probes were
labeled by nick translation using digoxigenin-dUTP (Roche) and biotin-14-dATP
(Invitrogen, San Diego, CA, USA), following the guidelines of the suppliers. The
H3 histone probe was detected with anti-digoxigenin-rhodamine (Roche), and the
H4 histone probe was detected with avidin-FITC (fluorescein isothiocyanate)
(Invitrogen, San Diego, CA, USA). Whenever possible, two probes were combined
in the same slide.
The cells were analyzed in an Olympus microscope BX61 equipped with a

fluorescent lamp. The images were captured using a DP70 cooled digital camera,
and the brightness and contrast of photographs were optimized using the software
Photoshop CC 2014.
Phylogenetic analysis
A fragment of cytochrome c oxidase subunit I (COI) gene from 53

karyotyped individuals plus the two specimens provided by MZUSP was amplified
using the primers C1-J-2183 (Jerry) – 5’ CAA CAT TTA TTT TGA TTT TTT GG –
and TL2-N-3014 (Pat) – 5’ TCC AAT GCA CTA ATC TGC CAT ATT A (Simon et
al. 1994). The reactions were performed in a volume of 50 µL containing 1X Taq
DNA polymerase recombinant buffer (Invitrogen), 1.5 mM of MgCl 2, 0.02 mM of
dNTP, 0.4 μM of each primer, and 0.02 U of Taq DNA polymerase. The PCR
program was conducted as follows: initial denaturation for 5 min at 94ºC; 40 cycles
of 30 sec at 94ºC; 30 s at 55ºC; 1 min at 72ºC; and final extension for 5 min at
72ºC. The PCR products were purified using the ExoSAP-IT (Affymetrix) reagent,
51
following the guidelines of the suppliers, and sequenced with the Jerry primer by
Macrogen Inc. (Korea).
Chromatograms were analyzed using the Pregap4 software, Staden

package (Bonfield et al. 1995). The sequences were aligned with the program
Clustal W (Thompson et al. 1994) and genetic distances were calculated using
Kimura’s two-parameter model (Kimura 1980), both implemented in the MEGA 6
software (Tamura et al. 2013). A phylogenetic analysis using Bayesian inference
was performed with the program MrBayes 3.2.2 (Ronquist et al. 2012), and the
appropriate model of nucleotide sequence evolution determined using jModelTest
(http://jmodeltest.org) was applied (HKY+G). Two independent replicates of the
Markov chain Monte Carlo search were performed with 10,000,000 simulations,
each with eight chains. Trees were sampled every 100 generations, and the first
25% were discarded as “burn-in”. The analysis was ran in the CIPRES Science
Gateway (Miller et al. 2010). Maximum likelihood analysis was performed using
raxmlGUI 1.2 (Silvestro and Michalak 2011) with 1,000 bootstrap replications.
Homologous sequences of Embrikillium patricium (KM364387), Buprestis
laeviventris (KM364353), Sphenoptera sp. (KM364392) and Selagis caloptera
(KM364373) (Buprestidae) were used as out-group. The topological relationship
between the haplotypes was estimated using the program Network 5.0
(http://www.fluxux-engineering.com) with the median-joining approach.
Results
Karyotypes
Extensive intra- and interpopulation chromosomal variability was observed
in meiotic and mitotic cells of the 62 studied individuals (Fig. 2, Fig. S1-S11).
Diploid numbers ranged from 2n=22 to 2n=36. Variation in chromosome number
was found in Brasília – DF (2n=22 and 24), Maceió – AL (2n=35 and 36), Recife –
PE (2n=34 and 36) and Ribeirão Preto – SP (2n=26 and 28), whereas a single
karyotype with 2n=32 was found in Belém – PA (Table 1, Fig. 2, Fig. S1-S11). All
these karyotypes harbor multiple sex chromosome chains consisting of five
(X1Y1X2Y2X3), six (X1Y1X2Y2X3Y3) or eight (X1Y1X2Y2X3Y3X4Y4) chromosomes,
52
which were observed in five, 52 and five individuals, respectively. Individuals

bearing the chain with six chromosomes were observed in all populations, and that
from Maceió – AL further presented specimens with five chromosomes in sex
chromosome chain. Brasília – DF was the most diverse population, exhibiting the
three aforementioned multivalent sex chain compositions. Moreover, we found
punctiform B chromosomes in 51 individuals, except in those from Brasília – DF
(Table 1, Fig. 2), and a large type of B chromosome in two individuals from Belém
– PA (Table 1, Fig. 2).
Karyotypes with 2n=22 were polymorphic for autosomal morphology and
number of chromosomes in sex chain, which comprised five, six or eight
chromosomes (Fig. 2a-c). One individual presented five sex chromosomes, as well
as four meta-submetacentric and two acrocentric pairs, one heteromorphic pair
composed of one submetacentric and one acrocentric chromosome, and a
trivalent formed by one metacentric and two acrocentric chromosomes (Fig. 2a,
Fig. S1), resulting in gametes with ten or twelve chromosomes (Fig. S1).
Individuals with six sex chromosomes presented seven biarmed autosomal and
one acrocentric pair (Fig. 2b, Fig. S2). Finally, in individuals showing 2n=22 with
eight sex chromosomes, we observed five biarmed and two acrocentric bivalents
(Fig. 2c, Fig. S3). Only one specimen presented 2n=24, showing six sex
chromosomes and one submetacentric, five metacentric and three acrocentric
autosomal pairs (Fig. 2d, Fig. S4). The karyotype with 2n=26 showed five
metacentric and five acrocentric autosomal pairs, and 2n=28 displayed four
metacentric and seven acrocentric autosomal pairs; both karyotypes harbored sex
chains composed of six chromosomes (Fig. 2e, f Fig. S5, S6). B chromosomes
with number ranging from eight to 16 in 2n=26 and 2n=28 individuals were noticed
(Table 1).
Individuals with 2n=32 were found in Belém – PA. They presented one or
two submetacentric pairs and the remaining autosomal pairs with acrocentric
morphology, and sex chromosome chain with six chromosomes (Fig. 2g, Fig. S7,
S8). These specimens exhibited two to five punctiform B chromosomes, and two
individuals showed large meta-submetacentric B chromosomes (Table 1, Fig. 2g,
Fig. S8).
53
Specimens with 2n=34 were found in Recife – PE, showing one metacentric
and 13 acrocentric autosomal pairs (Fig. 2h, S9), in addition to B chromosomes
ranging in number from two to 14 (Table 1). In individuals with 2n=35,
polymorphisms in autosomal morphology were observed: either all autosome pairs
were acrocentric or only the major autosome pair was submetacentric, which was
also observed in heteromorphic condition. All these individuals presented a sex
chromosome chain formed by five chromosomes (Fig. 2i, S10) and B
chromosomes with number varying from four to 14 (Table 1). Individuals with
2n=36 were found in Maceió – AL and Recife – PE. However, despite
maintenance of diploid number, sex chromosome chain with six chromosomes and
most autosomes being acrocentric, polymorphisms in the major autosome pair
were detected in both localities, showing acrocentric or submetacentric
morphology, or heteromorphic condition (Fig. 2j, k, S11). Punctiform B
chromosomes varied in number from one to 14 (Table 1).
Regarding the sex chromosome chain, differences in chromosomal
morphology were observed even when the number of chromosomes is the same
(Fig. 3, 6, S1-11). It was not possible to determine the proto X or proto Y
chromosome, nor the homologies among all chromosomes in different chain
configurations. However, the X1, identified through morphology by Mesa and
Fontanetti (1984) and Moura et al. (2008) is similar in all karyotypes. Hence,
starting the sex chromosome chain from X1, the other chromosomes could be
denominated. In specimens from Brasília – DF, the chain with X1Y1X2Y2X3 was
composed only of biarmed chromosomes (Fig. 3a-c). In the sex chromosome
chain with X1Y1X2Y2X3Y3, X2 had acrocentric morphology while the other
chromosomes were biarmed (Fig. 3d-f). Finally, in the specimens from Brasília –
DF with X1Y1X2Y2X3Y3X4Y4, X2 and X4 were acrocentric and the other
chromosomes were biarmed (Fig. 3g-i).
In all analyzed specimens from Ribeirão Preto – SP, Belém – PA and
Recife – PE, and four individuals from Maceió – AL, the sex chromosome chain
contained six chromosomes and showed similar chromosome morphology. While
all X chromosomes in addition to Y1 and Y2 showed meta-submetacentric
morphology, Y3 was acrocentric (Fig. 3 j-l). Further, Y3 was absent in four
specimens from Maceió – AL (Fig. 2i, 3 p-r).
54
Very weak C bands were observed in the pericentromeric region of

autosomal chromosomes in individuals with 2n=35, X1Y1X2Y2X3 from Maceió – AL,
with the exception of the heteromorphic pair 1, where the short arm of the
submetacentric chromosome was entirely heterochromatic. In addition, intense
bands were present in the pericentromeric region of sex chromosomes (Fig. S12).
Phylogeny of COI and haplotype network

The COI sequences had an average length of 751 bp, 50 of which were
variable sites, resulting in 22 haplotypes. The Bayesian and maximum-likelihood
phylogenetic analysis showed a similar topology. They revealed a monophyletic
group, and three main clades were highlighted (Fig. 4a). Three haplogroups were
retrieved by the median-joining haplotype network (Fig. 4b). Samples from the
same locality were grouped regardless of diploid or sex chromosome number.
Groupings coincided with the Brazilian geographical regions Northeast and North,
and individuals from the Southeast and Midwest were clustered into the same
clade/group. The pairwise distance of COI within each of these groups ranged
from 0 to 4%, and from 2 to 7% between groups (Table 2).
Chromosomal location of histone genes

The FISH technique using H3 and H4 histone genes as probes was
performed in at least one representative of each collection site, and multiple sites
were noticed. All signals were co-located in pericentromeric regions of all
autosome and sex chromosomes (Fig. 3, 5, S13). As these sequences were
located in pericentromeric regions of all chromosomes, they helped define
autosomal polymorphisms with regards to morphology.
Discussion
The high incidence of chromosomal polymorphism in Euchroma gigantea
The description of new karyotypes with 2n=22, 2n=28 and 2n=35 and the
uncovering of morphological variation in karyotypes with the same diploid number
and in sex chromosomes provided in this work, expand the current view on
chromosomal variability in E. gigantea. Our results depict a wider karyotypic
variation than previously described by Mesa and Fontanetti (1984) and Moura et
55
al. (2008), and suggest that intense chromosomal evolution in the species might
have resulted diversification of cryptic species in the genus. Considerable level of
karyotypic diversity has been described in other Coleoptera genera. For instance,
in the genus Blaps (Tenebrionidae) species are found displaying 2n=19, 21, 34,
35, 36, 37 or 38, and may have multiple sex chromosome systems varying from
XXY to X1-12Y1-6 (Juan and Petitpierre 1991; Vitturi et al. 1996). In the suborder
Polyphaga, centric fissions and fusions, in addition to translocations and loss of Y,
have generated polymorphisms in some species. For instance, Botanochara
bonariensis (Chrysomelidae) presents 2n=27, Xyy; 41, Xyy; 44, XXXY; and 47,
XXY (De Julio et al. 2010); whereas Anthonomus bisignifer (Curculionidae) shows
2n=19, XO; 30, Xyp; 32, Xyp; 34, Xyp; and 36, Xyp (Blackmon and Demuth 2015).
However, polymorphisms at species level observed in other Coleoptera or even
Buprestidae (Karagyan and Kuznetsova 2000; Karagyan et al. 2004; Karagyan
and Lachowska 2007; Karagyan et al. 2012) are smaller than the karyotypic
polymorphism observed in E. gigantea.
Comparison among the E. gigantea karyotypes evidenced the occurrence
of autosome-autosome and autosome–sex chromosome translocations, fissions,
fusions, pericentric inversions and Y3 loss in the chromosomal evolution of this
species. These rearrangements are also observed in the karyotype evolution of
other Coleoptera (Cabral-de-Mello et al. 2008; De Julio et al. 2010). Besides these
rearrangements, comparison of the pair 1 in 2n=35 individuals suggests
amplification or loss of heterochromatin, as the short arm of the submetacentric
chromosome was entirely heterochromatic whereas the size of the acrocentric
counterpart corresponded to the long arm of the submetacentric one (Fig. 2i, S12).
This suggests that heterochromatin amplification or loss could be responsible for
morphology variation among individuals for pair 1. Based on the distribution of E.
gigantea karyotypes in Brazilian populations and the COI phylogeny that showed
an evident separation of individuals below and above 2n=30, we proposed an
evolutionary scenario for the chromosomal diversification of this species (Fig. 6),
described in detail below.
From the putative karyotype with 2n=20, Xy, which is ancestral for
Coleoptera and also described for Buprestidae (Karagyan and Kuznetsova 2000;
Karagyan et al. 2004; Karagyan et al. 2012), one autosome fission originated
56
2n=22, which is the modal karyotype in this family (Karagyan and Kuznetsova
2000). The occurrence of a multiple sexual chain with six chromosomes in all
analyzed populations and in a large number of individuals (55 out of 62), suggests
that it was likely present in the ancestor of E. gigantea, as previously proposed by
Mesa and Fontanetti (1984), and originated before other chromosomal
reorganizations, such as increasing diploid numbers. Therefore, we propose that
sex chromosome-autosome translocations originated a chromosome chain with six
sex chromosomes (X1Y1X2Y2X3Y3) from the karyotype with 2n=22, Xy.
Subsequently, the occurrence of additional autosome–sex chromosome
translocation increased the number of chromosomes in the chain. Starting from a
2n=22, X1Y1X2Y2X3Y3 state, one autosome fission originated a karyotype with
2n=24 (Fig 6a) and, from it, pericentric inversions, a Robertsonian translocation
and Y3-autosome fusion originated the karyotype with 2n=22, X1Y1X2Y2X3, which
has an autosomal trivalent and one heteromorphic pair. From the karyotype with
2n=24, fission events, pericentric inversions and autosome-autosome (A-A)
translocations caused an increase of diploid number to 2n=32, change of
chromosomal morphology, and originated tri- or tetravalents in individuals from the
Southeast/Midwest and North clades (Fig. 6a).
Karyotypes found in the Northeastern population may have arisen from that
with 2n=32 found in the Northern group through autosome fission and pericentric
inversions (Fig. 6a). Nevertheless, the karyotype with 2n=32 from Pernambuco
described by Moura et al. (2008) may have originated independently, through
centric fissions and pericentric inversions, from 2n=22 with six sex chromosomes
(Fig 6b). From this 2n=32 set, karyotypes with 2n=34 and 36 probably originated
through centric fissions (Fig 6b). As suggested for other organisms, the high
number of chromosomal rearrangements throughout the karyotype evolution of E.
gigantea may have favored the emergence of punctiform B chromosomes
(Colombo and Remis 1997; Rosetti et al. 2007; Martis et al. 2012; Zhou et al.
2012; Houben et al. 2014). The occurrence of B chromosome variants (punctiform
and large ones) in distinct populations suggests multiple B chromosome origins or
different evolution, further supporting the extensive chromosomal variability of the
species. Absence of B chromosomes in the population from Brasília – DF and
presence of large B chromosomes exclusively in individuals from Belém – PA
57
indicate that different factors may be acting on the maintenance and dynamics of
these chromosomes in E. gigantea. Such factors may be mechanisms of origin,
composition of these chromosomes, and the possible selective pressure which
individuals are subject to in accordance with different environmental conditions
(Camacho 2005).
Meiotic chains as observed in E. gigantea are also found in other animals,
such as the huntsman spider Delena cancerides (Rowell 1990; Sharp and Rowell
2007), the centipede Otocryptops sexspinosus (White 1973), the termite
Incisitermes schwarzi (Syren and Luykx 1977), the platypus Ornithorhynchus
anatinus (Rens et al. 2004), and many tiger beetles (Cicindelidae) (Galián et al.
2007). In some species, the number of chromosomes involved in the chain is
conserved between individuals (Rens et al. 2004). However, polymorphisms can
be found, and might indicate either recent or rapid evolution of the chain,
especially when there is no genetic differentiation among individuals with distinct
karyotypic features (Luykx and Syren 1981; Rowell 1990). Meiotic chain
polymorphisms are not often tolerated in many species, as they can disrupt the
correct segregation of chromosomes and thus, the essential formation of balanced
gametes. The segregation of contiguous elements can lead to migration of two
chromosomes with partial homology to the same pole, resulting in aneuploid
gametes (Gruetzner et al. 2006; Sharp and Rowell 2007). The alternate orientation
of chromosomes X and Y at the first meiosis in the chains, seen in E. gigantea (Fig
2, S1-11), may have favored correct segregation and consequent production of
balanced gametes.
The sex chromosome chains composed of five elements found in Brasília –
DF and Maceió – AL probably have independent origins. While the individual with
2n=22 presents a heteromorphic pair that probably contains Y3 chromosomes,
individuals with 2n=35 seem to have lost the Y3 chromosome. Loss of the Y
chromosome has been reported in many groups of Coleoptera, including the
suborders Adephaga and Polyphaga (Schneider et al. 2007; Cabral-de-Mello et al.
2008; De Julio et al. 2010). One hypothesis for this evolutionary event is that the Y
chromosome could accumulate transposable elements, especially
retrotransposons, which can change the chromatin structure from a euchromatic
nature into a heterochromatic one, and thus contribute to Y degeneration with
58
consequent loss (Steinemann and Steinemann 1998). On the other hand, in

multiple sex systems the loss of Y was reported in the monotreme echidna
Tachyglossus aculeatus. In this species, inversion in the Y chromosome might
suppress the meiotic synapsis and chromosome recombination, contributing to its
differentiation, degradation, and ultimately entire loss (Gruetzner et al. 2006).
The presence of individuals with heteromorphic pairs in the Northeast clade
and of polymorphic karyotypes 2n=22 in the Southeast/Midwest clade indicate the
possibility of crossing between parental specimens with the same diploid number,
but cytogenetically distinct. However, the only available study regarding E.
gigantea viability, performed in natural population of the city of Goiânia (state of
Goiás – GO), has revealed that part of the offspring was inviable. Namely, the
survival of larvae, pre-pupal and pupal stages declined by 72%, 63% and 69%,
respectively (Garcia 1998). Karyotypes of individuals from Goiânia were not
known, but possibly presented polymorphisms as seen in other populations of the
Southeast/Midwest clade in which they were included (data not shown). Thus, the
observed viability decline (Garcia 1998) could be related to fertilization of
unbalanced gametes.
Our genetic variation data for in E. gigantea support the existence of at
least three lineages, and suggest that chromosomal divergence could be involved
in the speciation process, as seen in other insect species (Coluzzi et al. 2002;
Mills and Cook 2014). In addition, the three lineages of E. gigantea were formed
by individuals belonging to distinct biomes that possess different physical, climatic,
geographic and lithological conditions, with specific fauna and flora (Coutinho
2006). Hence, differential fixation of rearrangements, such as translocations,
fissions or inversions, among E. gigantea populations may involve adaptive
processes, as reported for several eukaryotes (Coghlan et al. 2005; Crombach
and Hogeweg 2007; Taffarel et al. 2015), whereby rearrangements can be
correlated with phenotypic differences that confer varying fitness in different
habitats (Coghlan et al. 2005).
Histone genes were amplified in centromeres of Euchroma gigantea

The co-localization of H3 and H4 histone genes observed in E. gigantea
chromosomes was expected. In Coleoptera, as well as in other insects, these
59
genes are usually found near H1, H2A and H2B genes, in a quintet array repeated
in tandem (Nagoda et al. 2005; Roehrdanz et al. 2010). However, the dispersion of
histone sequences in all chromosomes was surprising. Most of the 15 Coleoptera
species mapped for histone genes presented two FISH signals exclusively in
autosome pairs (Cabral-de-Mello et al. 2011; Goll et al. 2015). Three exceptions
were Scarabaeidae species that showed one or two sites located in sex
chromosomes, or six sites in autosomes and the X chromosome (Cabral-de-Mello
et al. 2011). Dispersion of histone sequences was also observed in grasshoppers
(Oliveira et al. 2011; Bueno et al. 2013). However, dispersion in E. gigantea was
found in all different karyotypes, unlike orthopterans, which present variation in
number of sites among individuals within a species with a single karyotype
(Oliveira et al. 2011; Bueno et al. 2013; Pine et al. 2017). Dispersion of histone
genes is generally attributed to mechanisms that maintain highly repetitive
sequences in centromeric regions, such as mobility of transposable elements,
ectopic recombination or extrachromosomal circular DNA (eccDNA), which are
also proposed to explain the dispersion of other classes of repetitive DNA (Fitch et
al. 1990; Raskina et al. 2004; Bione et al. 2005; Cohen et al. 2010; Nguyen et al.
2010).
The dispersion of histone genes in E. gigantea must have occurred before
chromosomal diversification, considering that it is observed in all populations. No
positive correlation exists between chromosome number and histone gene
dispersion, since all tested karyotypes show dispersion in all chromosomes.
However, as previously documented, repetitive elements can trigger chromosomal
rearrangements in invertebrates (Coghlan and Wolfe 2002; Coghlan et al. 2005):
they constitute hotspots for breakpoints leading to chromosomal rearrangements
such as translocations (Coghlan and Wolfe 2002) and fissions (Rousselet et al.
2000), which are frequent in the chromosome evolution history of E. gigantea.
Hence, the presence of a large number of histone genes in E. gigantea, as well as
other repetitive sequences commonly present in the centromeric region, e.g.
satellite DNA (Slamovits et al. 2001; Evans et al. 2017) and transposable elements
(Raskina et al. 2008), may promote the very high frequency of rearrangements
occurring throughout the chromosomal evolution of this species.
60
Conclusions
Several rearrangements were responsible for the formation of distinct
karyotypes within and among Euchroma gigantea populations. The chromosomal
variation in E. gigantea possibly started from a set with 2n=20, Xy, which
underwent centric fissions and fusions, translocations, pericentric inversions and
Y-chromosome loss. Some of these rearrangements may have been differently
fixed in the three lineages exhibiting distinct geographical distribution, and thus
possibly contributed to the adaptation to different habitats and to the speciation
process. The dispersion of histone genes that occurred before karyotypic
diversification, as well as of other repetitive sequences might have favored the
high frequency of chromosomal rearrangements seen in the species.
Acknowledgements
We are grateful to Dr. Fernando A. B. Silva and M.Sc. Amanda Arcanjo for
providing samples from Belém – PA; to Dr. Edgar Bione for help with specimen
collection in Brasília – DF; to Dr. Sônia Casari and Dr. Carlos Campaner for
providing the specimens analyzed here from the Zoology Museum at the
University of São Paulo; and Dra. Cibele Sotero-Caio for the critical reading of the
manuscript. This study was supported by Coordenação de Aperfeiçoamento de
Pessoal de Nível Superior (Capes) (doctorate scholarships to CX and ICA),
Fundação de Amparo à Ciência e Tecnologia de Pernambuco – FACEPE (APQ
process number 0777-2.02/15 and Masters scholarship to RVSS), Fundação de
Amparo à Ciência do Estado de São Paulo – FAPESP (2014/11763-8) and
Conselho Nacional de Desenvolvimento Científico e Tecnológico – CNPq, Brazil
(PQ-2 of RCM process number 305298/2014-3).
Conflict of interest
The authors declare that they have no conflict of interest.
References
61
Bellamy C (2003) An illustrated summary of the higher classification of the

superfamily Buprestoidea (Coleoptera). Folia Heyrovskiana 10:44
Bione EG, Camparoto M, Simões Z (2005) A study of the constitutive
heterochromatin and nucleolus organizer regions of Isocopris inhiata and
Diabroctis mimas (Coleoptera: Scarabaeidae, Scarabaeinae) using C-
banding, AgNO3 staining and FISH techniques. Genet Mol Biol 28:376–381
Blackmon H, Demuth JP (2015) Coleoptera Karyotype Database. Coleopt Bull
69:174–175. doi: 10.1649/0010-065X-69.1.174
Blackwelder RE (1944) Checklist of the coleopterous insects of Mexico, Central
America, The West Indies, and South America. Bull United States Natl
Museum 185:189–341
Bonfield JK, Smith KF, Staden R (1995) A new DNA sequence assembly program.
Nucleic Acids Res 24:4992–4999
Brown JD, O’Neill RJ (2010) Chromosomes, conflict, and epigenetics:
chromosomal speciation revisited. Annu Rev Genomics Hum Genet 11:291–
316
Bueno D, Palacios-Gimenez OM, Cabral-de-Mello DC (2013) Chromosomal
mapping of repetitive DNAs in the grasshopper Abracris flavolineata reveal
possible ancestry of the B chromosome and H3 histone spreading. PLoS
One. doi: 10.1371/journal.pone.0066532
Cabral-de-Mello DC, Moura RC, Martins C (2010) Chromosomal mapping of
repetitive DNAs in the beetle Dichotomius geminatus provides the first
evidence for an association of 5S rRNA and histone H3 genes in insects, and
repetitive DNA similarity between the B chromosome and A complement.
Heredity (Edinb) 104:393–400
Cabral-de-Mello DC, Oliveira SG, de Moura RC, Martins C (2011) Chromosomal
organization of the 18S and 5S rRNAs and histone H3 genes in Scarabaeinae
coleopterans: insights into the evolutionary dynamics of multigene families
and heterochromatin. BMC Genet 12:88
Cabral-de-Mello DC, Oliveira SG, Ramos IC, Moura RDC (2008) Karyotype
differentiation patterns in species of the subfamily Scarabaeinae
(Scarabaeidae, Coleoptera). Micron 39:1243–1250
Camacho J (2005) B chromosomes. In: TR G (ed) The evolution of the genome.
62
Elsevier, San Diego, pp 223–286

Coghlan A, Eichler EE, Oliver SG, et al (2005) Chromosome evolution in
eukaryotes: A multi-kingdom perspective. Trends Genet 21:673–682
Coghlan A, Wolfe KH (2002) Fourfold faster rate of genome rearrangement in
nematodes than in Drosophila. Genome Res 12:857–867
Cohen S, Agmon N, Sobol O, Segal D (2010) Extrachromosomal circles of satellite
repeats and 5S ribosomal DNA in human cells. Mob DNA 1:1-11
Colombo PC, Remis MI (1997) On the origin of B-chromosomes: neo XY systems
and X-like supernumeraries in Orthoptera. Caryologia 50:151–162
Coluzzi M, Sabatini A, Torre A, et al (2002) A polytene chromosome analysis of
the Anopheles gambiae species complex. Science 298:1415–1418
Coutinho LM (2006) O conceito de bioma. Acta Bot Brasilica 20:13–23
Crombach A, Hogeweg P (2007) Chromosome rearrangements and the evolution
of genome structuring and adaptability. Mol Biol Evol 24:1130–1139
De Julio M, Fernander FR, Costa C, et al (2010) Mechanisms of karyotype
differentiation in Cassidinae sensu lato (Coleoptera , Polyphaga ,
Chrysomelidae) based on seven species of the Brazilian fauna and an
overview of the cytogenetic data. Micron 41:26–38
Dutrillaux A, Dutrillaux B (2016) Chromosome comparison of 17 species/ sub-
species of African Goliathini (Coleoptera, Cetoniinae). Comp Cytogenet
10:269–282
Evans BJ, Upham NS, Golding GB, et al (2017) Evolution of the largest
mammalian genome. Genome Biol Evol 9:1711–1724
Faria R, Navarro A (2010) Chromosomal speciation revisited: Rearranging theory
with pieces of evidence. Trends Ecol Evol 25:660–669
Fitch DH a., Strausbaugh LD, Barrett V (1990) On the origins of tandemly
repeated genes: Does histone gene copy number in Drosophila reflect
chromosomal location? Chromosoma 99:118–124
Galián J, Proença SJR, Vogler AP (2007) Evolutionary dynamics of autosomal-
heterosomal rearrangements in a multiple-X chromosome system of tiger
beetles (Cicindelidae). BMC Evol Biol 7:158
Garcia AH (1998) Aspectos sobre a biologia de Euchroma gigantea (L., 1758)
(Coleoptera - Buprestidae) em Pachira aquatica AUBLET (Bombaceae). An
63
da Esc Agron e Veterinária 28:69–73

Goll LG, Matiello RR, Artoni RF, et al (2015) High-resolution physical chromosome
mapping of multigene families in Lagria villosa (Tenebrionidae): occurrence of
interspersed ribosomal genes in Coleoptera. Cytogenet Genome Res 146:64–
70
Gruetzner F, Ashley T, Rowell DM, Marshall Graves JA (2006) How did the
platypus get its sex chromosome chain? A comparison of meiotic multiples
and sex chromosomes in plants and animals. Chromosoma 115:75–88
Houben A, Banaei-Moghaddam AM, Klemme S, Timmis JN (2014) Evolution and
biology of supernumerary B chromosomes. Cell Mol Life Sci 71:467–478
Juan C, Petitpierre E (1991) Chromosome numbers and sex-determining systems
in Tenebrionidae (Coleoptera). In: Zunino M, Bellés X, Blas M (eds) Advances
in Coleopterology. AEC, Barcelona, pp 167–176
Karagyan G, Kuznetsova KG (2000) Chromosome numbers and sex chromosome
systems in buprestid beetles (Coleoptera, Buprestidae). Entomol Rev 80:38–
49
Karagyan G, Kuznetsova VG, Lachowska D (2004) New cytogenetic data on
Armenian buprestids (Coleoptera, Buprestidae) with a discussion of karyotype
variation within the family. Folia Biol (Kraków)52:151–158
Karagyan G, Lachowska D (2007) Karyotypes of five species of jewel-beetles and
presumptive ancestral state of karyotypes of the subfamilies Polycestinae,
Chrysochroinae and Buprestinae (Insecta: Coleoptera: Buprestidae). Comp
Cytogenet 1:121–127
Karagyan G, Lachowska D, Kalashian M (2012) Karyotype analysis of four jewel-
beetle species (Coleoptera, Buprestidae) detected by standard staining, C-
banding, AgNOR-banding and CMA3/DAPI staining. Comp Cytogenet 6:183–
197
Kawakami T, Butlin RK, Cooper SJB (2011) Chromosomal speciation revisited:
Modes of diversification in Australian morabine grasshoppers (Vandiemenella,
viatica species group). Insects 2:49–61
Kimura M (1980) A simple method for estimating evolutionary rate of base
substitutions through comparative studies of nucleotide sequences. J Mol
Evol 16:111–120
64
Kobayashi N, Shirai Y, Tsurusaki N, et al (2000) Two cryptic species of the

phytophagous ladybird beetle Epilachna vigintioctopunctata (Coleoptera:
Coccinellidae) detected by analyses of mitochondrial DNA and karyotypes,
and crossing experiments. Zoolog Sci 17:1159–1166
Luykx P, Syren RM (1981) Multiple sex-linked reciprocal translocations in a termite
from Jamaica. Experientia 37:819–820
Martis MM, Klemme S, Banaei-Moghaddam AM, et al (2012) Selfish
supernumerary chromosome reveals its origin as a mosaic of host genome
and organellar sequences. Proc Natl Acad Sci 109:13343–13346
Mesa A, Fontanetti CS (1984) Multiple sex-chromosomes, autosomal
polymorphism and a high number of S chromosomes in Euchroma gigantea L
1735 (Coleoptera, Buprestidae). Rev. Bras. Genet. 7:629–637
Miller MA, Pfeiffer W, Schwartz T (2010) Creating the CIPRES Science Gateway
for Inference of Large Phylogenetic Trees. In: Gateway Computing
Environments Workshop (GCE). pp 1–8
Mills PJ, Cook LG (2014) Rapid chromosomal evolution in a morphologically
cryptic radiation. Mol Phylogenet Evol 77:126–135
Moura R de C, Melo NF, Souza MJ (2008) High levels of chromosomal
differentiation in Euchroma gigantea L. 1735 (Coleoptera, Buprestidae).
Genet Mol Biol 31:431–437
Nagoda N, Fukuda A, Nakashima Y, Matsuo Y (2005) Molecular characterization
and evolution of the repeating units of histone genes in Drosophila americana:
Coexistence of quartet and quintet units in a genome. Insect Mol Biol 14:713–
717
Nguyen P, Sahara K, Yoshido A, Marec F (2010) Evolutionary dynamics of rDNA
clusters on chromosomes of moths and butterflies (Lepidoptera). Genetica
138:343–354
Noor MA, Grams KL, Bertucci LA, Reiland J (2001) Chromosomal inversions and
the reproductive isolation of species. Proc Natl Acad Sci U S A 98:12084–
12088
Oliveira NL, Cabral-de-Mello DC, Rocha MF, et al (2011) Chromosomal mapping
of rDNAs and H3 histone sequences in the grasshopper Rhammatocerus
brasiliensis (Acrididae, Gomphocerinae): extensive chromosomal dispersion
65
and co-localization of 5S rDNA/H3 histone clusters in the A complement and

B chromosome. Mol Cytogenet 4:24
Petitpierre E (2011) Cytogenetics, cytotaxonomy and chromosomal evolution of
Chrysomelinae revisited (Coleoptera, Chrysomelidae). Zookeys 79:67–79
Pine MB, Gallo RB, da Silva CRM, et al (2017) Chromosome mapping in Abracris
flavolineata (De geer, 1773) (Orthoptera) from the Iguaçu National Park - Foz
do Iguaçu, Paraná, Brazil. Comp Cytogenet 11:203–212
Pineau P, Henry M, Suspène R, et al (2005) A universal primer set for PCR
amplification of nuclear histone H4 genes from all animal species. Mol Biol
Evol 22:582–588
Pinkel D, Straume T, Gray JW (1986) Cytogenetic analysis using quantitative,
high-sensitivity, fluorescence hybridization. Proc Natl Acad Sci 83:2934–2938
Raskina O, Belyayev A, Nevo E (2004) Activity of the En/Spm-like transposons in
meiosis as a base for chromosome repatterning in a small, isolated,
peripheral population of Aegilops speltoides Tausch. Chromosome Res
12:153–161
Raskina O, Barber JC, Nevo E, Belyayev A (2008) Repetitive DNA and
chromosomal rearrangements: speciation- related events in plant genomes.
Cytogenet Genome Res 120:351–357
Rens W, Grützner F, O’Brien PCM, et al (2004) Resolution and evolution of the
duck-billed platypus karyotype with an X1Y1X2Y2X3Y3X4Y4X5Y5 male sex
chromosome constitution. Proc Natl Acad Sci U S A 101:16257–16261
Rieseberg LH (2001) Chromosomal rearrangements and speciation in animals.
Trends Ecol Evol 16:351–358
Roehrdanz R, Heilmann L, Senechal P, et al (2010) Histone and ribosomal RNA
repetitive gene clusters of the boll weevil are linked in a tandem array. Insect
Mol Biol 19:463–471
Ronquist F, Teslenko M, van der Mark P, et al (2012) MrBayes 3.2: Efficient
Bayesian phylogenetic inference and model choice across a large model
space. Syst Biol 61:539–542
Rosetti N, Vilardi JC, Remis MI (2007) Effects of B chromosomes and
supernumerary segments on morphometric traits and adult fitness
components in the grasshopper, Dichroplus elongatus (Acrididae). J Evol Biol
66
20:249–59
Rousselet J, Monti L, Auger-Rozenberg M a, et al (2000) Chromosome fission
associated with growth of ribosomal DNA in Neodiprion abietis (Hymenoptera:
Diprionidae). Proc Biol Sci 267:1819–23
Rowell DM (1990) Fixed fusion heterozygosity in Delena cancerides Walck.
(Araneae: Sparassidae): an alternative to speciation by monobrachial fusion.
Genetica 80:139–157
Rozek M, Lachowska D, Petitpierre E, Holecová M (2004) C-bands on
chromosomes of 32 beetle species (Coleoptera: Elateridae, Cantharidae,
Oedemeridae, Cerambycidae, Anthicidae, Chrysomelidae, Attelabidae and
Curculionidae). Hereditas 140:161–170
Sambrook J, Russel DW (2001) Molecular Cloning. A Laboratory Manual, Third
Edit. Cold Spring Harbor, New York
Schneider MC, Rosa SP, Almeida MC, et al (2007) Strategies of karyotype
differentiation in Elateridae (Coleoptera, Polyphaga). Micron 38:590–598
Sharp HE, Rowell DM (2007) Unprecedented chromosomal diversity and
behaviour modify linkage patterns and speciation potential: Structural
heterozygosity in an Australian spider. J Evol Biol 20:2427–2439
Silvestro D, Michalak I (2011) raxmlGUI: a graphical front-end for RAxML. Org
Divers Evol 12:335–337
Simon C, Frati F, Beckenbach A, et al (1994) Evolution, weighting, and
phylogenetic utility of mitochondrial gene sequence and a compilation of
conserved polymerase chain reaction primers. Ann Entomol Soc Am 87:651–
701
Slamovits CH, Cook J a, Lessa EP, Rossi MS (2001) Recurrent amplifications and
deletions of satellite DNA accompanied chromosomal diversification in South
American tuco-tucos (Genus Ctenomys, Rodentia: Octodontidae): a
phylogenetic approach. Mol Biol Evol 18:1708–1719
Steinemann M, Steinemann S (1998) Enigma of Y chromosome degeneration:
neo-Y and neo-X chromosomes of Drosophila miranda a model for sex
chromosome evolution. Genetica 102/103:409–420
Sumner AT (1972) A simple technique for demonstrating centromeric
heterochromatin. Exp Cell Res 75:304–306
67
Syren RM, Luykx P (1977) Permanent segmental interchange complex in the

termite Incisitermes schwarzi. Nature 266:167–168
Taffarel A, Bidau CJ, Martí DA (2015) Chromosome fusion polymorphisms in the
grasshopper , Dichroplus fuscus (Orthoptera: Acrididae: Melanoplinae):
Insights on meiotic effects. Eur J Entomol 112:11–19
Tamura K, Stecher G, Peterson D, et al (2013) MEGA6 : Molecular Evolutionary
Genetics Analysis Version 6 . 0. Mol Biol Evol 30:2725–2729
Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the
sensitivity of progressive multiple sequence alignment through sequence
weighting, position-specific gap penalties and weight matrix choice. Nucleic
Acids Res 22:4673–80
Vitturi R, Catalano E, Sparacio I, et al (1996) Multiple-chromosome sex systems in
the darkling beetles Blaps gigas and Blaps gibba (Coleoptera,
Tenebrionidae). Genetica 97:225–233
White MJD (1973) Animal cytology and evolution. Cambridge University Press,
London
Zhou Q, Zhu H, Huang Q, et al (2012) Deciphering neo-sex and B chromosome
evolution by the draft genome of Drosophila albomicans. BMC Genomics
13:109
68
Tables and figures
Table 1 Euchroma gigantea sampling locations, chromosomal variability and COI Genbank
accession numbers
Localities Id. Sequence GenBank accession 2n Sex B/ B* chromosomes
number chain
Maceió – AL AL1 KY081928 35 5 4
AL2 KY081929 36 6 6
AL3 KY081930 36 6 4
AL4 KY081931 36 6 9
AL5 KY081932 36 6 11
AL6 KY081933 35 5 4
AL7 KY081934 35 5 14
AL8 KY081935 35 5 7
AL9 - 36 6 8
Recife - PE PE1 KY081909 34 6 4
PE2 KY081910 36 6 4
PE3 KY081911 34 6 7
PE4 KY081912 36 6 5
PE5 KY081913 34 6 6
PE6 KY081914 34 6 10
PE7 KY081915 34 6 4
PE8 KY081916 34 6 8
PE9 KY081917 36 6 1
PE10 KY081918 36 6 4
PE11 KY081919 34 6 8
PE12 KY081920 34 6 14
PE13 KY081921 34 6 5
PE14 KY081922 34 6 2
PE15 KY081923 34 6 5
PE16 KY081924 34 6 5
PE17 KY081925 36 6 3
PE18 KY081926 34 6 2
PE19 KY081927 34 6 6
PE20 - 34 6 2
Belém – PA PA1 KY081936 32 6 3
PA2 KY081937 32 6 4/2*
PA3 KY081938 32 6 3
PA4 KY081939 32 6 4
PA5 KY081940 32 6 4
PA6 KY081941 32 6 4
PA7 KY081942 32 6 2
PA8 KY081943 32 6 2
PA9 KY081944 32 6 5/1*
PA10 KY081945 32 6 4
Riberão Preto – SP SP1 KY081899 26 6 8
SP2 KY081900 26 6 16
SP3 KY081901 26 6 8
SP4 KY081902 26 6 12
SP5 KY081903 26 6 16
SP6 KY081904 26 6 10
SP7 KY081905 26 6 10
SP8 KY081906 26 6 16
SP9 - 28 6 15
SP10 - 26 6 14
SP11 - 26 6 10
SP12 - 26 6 10
Colômbia - SP SP13a KY081907 24 or 26 5 or 6 16, 20 or 32
SP14 a KY081908 24 or 26 5 or 6 16, 20 or 32
Brasília - DF DF1 KY081946 22 8 0
DF2 KY081947 22 8 0
DF3 KY081948 22 6 0
DF4 KY081949 22 8 0
DF5 KY081950 22 8 0
DF6 KY081951 24 6 0
DF7 KY081952 22 8 0
DF8 KY081953 22 5 0
DF9 KY081954 22 6 0
DF10 KY081955 22 6 0
DF11 - 22 6 0
a Indicates two individuals analyzed by Mesa and Fontanetti (1984); B: Punctiform B chromosomes;
B*: Large B chromosomes
69
Table 2 Pairwise distance of cytochrome oxidase c I subunit within and between populations of
Euchroma gigantea. The means (minimum - maximum) of pairwise distances are indicated
Between Populations
Within populations Northeast North
Northeast 0.01 (0-0.01)
North 0.00 (0-0.01) 0.03 (0.03-0.04)
Southeast/West Center 0.01 (0-0.04) 0.03 (0.02-0.07) 0.03 (0.02-0.06)
Fig. 1 Sampling sites of Euchroma gigantea used for cytogenetic and COI analyses: Pará (PA),
Pernambuco (PE), Alagoas (AL), São Paulo (SP), and Federal District (DF). Coordinates: Belém –
01º28’13.55’’ S 48º26’49.98’’ W; Recife – 08º03’060” S 34º57’200’’ W; Maceió – 09º33’4.11’’ S
35º46’6.74’’ W; Ribeirão Preto – 21º10’16.22’’ S 47º51’19.67’’ W; Brasília – 15°46'44.7" S
47°55'20.4" W
70
Fig. 2 Chromosomal variation in metaphase I of Euchroma gigantea from (a-d) Brasília – DF, (e, f)
Ribeirão Preto – SP, (g) Belém – PA, (h, j) Recife – PE and (i, k) Maceió – AL. Black arrowheads
indicate the ends of the sex chromosome chains with (a, i) five, (b, d-h, k) six or (c) eight
chromosomes. Note the presence of an autosomal trivalent (T) in (a). Hollow arrowheads indicate
examples of punctiform B chromosomes (e, f, g, k). Note two large B chromosomes (*) in (g).
Insets in i-k represent the alternative conditions of pair 1 in these karyotypes. Bar = 10 µm
71
Fig. 3 Variability of multiple sex-chromosome mechanism in Euchroma gigantea. (a, p)

Conventional and (d, g, j, m) inverted DAPI staining. The same chain is shown in the second
column, after FISH with histone H4 (green) or H3 (red) as probe, and respective drawing schemes
are shown in the third column. Bar = 10 µm
72
Fig. 4 (a) Bayesian phylogenetic tree and (b) median-joining haplotype network topology for COI
fragment from Euchroma gigantea. Abbreviations of sampling sites are shown in the tree and
correspond to those in Table 1. The posterior probabilities / maximum likelihood bootstrap values
are given near the branches. The scale bar indicates 0.04 change per site. In the network topology,
small black circles represent extinct or unsampled haplotypes; numbers next to the network
correspond to the number of steps among the lineages; and circle areas are proportional to the
haplotype frequencies. Emb. pat.: Embrikillium patricium, Bup. lae. Buprestis laeviventris, Sphe. sp.
Sphenoptera sp. and Sel. cal.: Selagis caloptera. Asterisks (*) next to the specimen abbreviation in
DF samples correspond to the sexual chain with five (*), six (**) or eight (***) chromosomes
73
Fig. 5 FISH mapping of histones H3 and H4 in (a-e, g) meiotic and (f, h) mitotic cells of Euchroma
gigantea. White arrowheads indicate the ends of the sex chromosome chains with (a, g) five, (c, d,
e) six or (b) eight chromosomes. Insets in (g) represent the alternative conditions to pair 1 in this
karyotype. Bar = 10 µm
74
Fig. 6 Hypotheses of chromosomal evolution in Euchroma gigantea (a, b). Idiograms A and B (a)
correspond to Coleoptera and Buprestidae modal karyotypes, respectively. Underlined letters are
karyotypes described in this work; remaining karyotypes were described in Mesa and Fontanetti
(1984) and Moura et al. (2008). *Pericentric inversions were observed in one or two pairs of these
karyotypes
75
76
77
78
79
80
81
82
83
84
85
86
4 18S RDNA AND SATDNAS MAPPING IN THE CHROMOSOMES OF

EUCHROMA GIGANTEA (COLEOPTERA: BUPRESTIDAE) HIGHLIGHTS
THE COMPLEX EVOLUTIONARY HISTORY OF DIVERGENT KARYOTYPES
Crislaine Xavier1; Octavio Manuel Palacios‑Gimenez2; Diogo Cavalcanti Cabral-

de-Mello2; Rita de Cássia de Moura1*
1Universidade de Pernambuco (UPE), Instituto de Ciências Biológicas,

Laboratório de Biodiversidade e Genética de Insetos, Recife, Pernambuco,
Brazil
2Universidade Estadual Paulista (UNESP), Instituto de Biociências,
Departamento de Biologia, Rio Claro, São Paulo, Brazil
* Rita de Cássia de Moura

Universidade de Pernambuco (UPE) – Instituto de Ciências Biológicas/ICB,
Laboratório de Biodiversidade e Genética de Insetos. Rua Arnóbio Marques
310, Santo Amaro. ZIP: 50.100-130 Recife – PE, Brazil.
e-mail: [email protected]
Este manuscrito será submetido à revista Molecular Genetics and Genomics

Qualis: B1 (CB1)
87
Abstract
Euchroma genus is monospecific to E. gigantea that possess a phenotypic

plasticity and a chromosomal polymorphism, which involves variations of the
diploid number, multiple sex mechanism and B chromosomes. All these
variations have been originated from chromosomal rearrangements, which may
be related to different repetitive sequences in the genome of the species. Here,
satDNA sequences were identified in E. gigantea genome and in addition to
18S rDNA were mapped in different karyotypes of this species. The satellite
sequence Egig1 (TACC) revealed conserved pattern of distribution in all tested
karyotypes, otherwise two large satDNA Egig2, Egig3 and 18S rDNA were co-
located and revealed variable pattern of distribution. Chromosomal
rearrangements and ectopic recombination may be responsible for repattern
localization of these sequences in chromosomes. Our results also indicate that
despite different chromosomal patterns of distributions of Egig2, Egig3 these
sequences possess high level of nucleotide conservation within and among
populations. On the other hand Egig1 could play an important role in
reorganization of E. gigantea karyotypes.
Keywords: Beetle, repetitive DNA, chromosomal polymorphism.
88
Introduction
High proportion of Eukaryotic genomes is composed by repetitive DNAs,
that plays an essential role in shaping genomes and could influence the
evolutionary trajectory and ecological adaptation (Long and Dawid 1980;
Charlesworth et al. 1994; Kim et al. 2014). These repettive DNAs may be
arranged in tandem as satellite DNA (satDNAs) and some multigene families, or
they may be dispersed in genomes as transposable elements (TEs) (Long and
Dawid 1980; Charlesworth et al. 1994; Kim et al. 2014). The enrichment of
repetitive sequences on specific chromosome sites may favor the occurrence
of chromosomal rearrangements like fissions, reciprocal translocations and
inversions, as reported in yeast (Fischer et al. 2000), nematodes (Coghlan and
Wolfe 2002), insects (Cáceres et al. 1999; Rousselet et al. 2000) and mammals
(Eichler and Sankoff 2003; Bailey et al. 2004). In addition, repetitive sequences
are often associated to ectopic recombination events (Cáceres et al. 1999;
Coghlan and Wolfe 2002; Paço et al. 2015) and may cause mutations in
repetitive sequence blocks or arrangements among different sequences, thus
reorganizing chromosomal structure (Paço et al. 2015).
The 45S (18S-5.8S-28S) rDNA is a multigene family that evolves through
birth-and-dead and/or in concerted manner through unequal crossover and
gene conversion mechanisms (Nei and Rooney 2005; Eickbush and Eickbush
2007). This sequence presents a low level of variability between copies within
an organism and across organisms as taxonomically diverse as plants and
animals (Nei and Rooney 2005; Eickbush and Eickbush 2007). It has been
proposed that concerted evolution also drive the evolution of satDNA repeats
within species (Dover 1982; Sawamura 2012). Furthermore, meiotic drive may
cause biased transmission of chromosomes harboring a particular kind of
satDNA and may influence the rate and type of chromosomal changes that are
selectively inherited (Brown and O’Neill 2010; Crespi and Nosil 2013; Lindholm
et al. 2016). These sequences could evolve independently and originate
lineage-specific modifications (in sequence identity, copy number and
chromosomal localization) generating incompatibilities both between species or
within populations of the same species (Henikoff et al. 2001; Ferree and
Barbash 2009; Pavlek et al. 2015). For example, rapid turnover of satDNA
sequences clustered within heterochromatin has been involved in post zygotic
89
isolation among Drosophila species demonstrating the crucial role of satDNA in

hybrid incompatibilities (Ferree and Barbash 2009).
Among beetles (Coleoptera), the 45S rDNA is the repetitive sequence
most mapped at cytogenetic point of view in some families, revealing from two
up to 16 sites with variable patterns of chromosomal distribution in both
autosomes and sex chromosomes (Colomba et al. 2004; Arcanjo et al. 2009;
Almeida et al. 2010; Cabral-de-Mello et al. 2011; Goll et al. 2015). On the other
hand, satDNA were poorly studied and data of structure and evolution of these
sequences are available only for species of Tenebrionidae, Chrysomelidae and
Coccinelidae families (Juan et al. 1993; Ugarković et al. 1996a; Ugarković et al.
1996b; Lorite et al. 2001; Lorite et al. 2002; Mravinac and Plohl 2010; Lorite et
al. 2013; Pavlek et al. 2015; Mora et al. 2017). Usually, these sequences are
enriched in pericentromeric region and comprises from 20-50% of the genome.
Euchroma is a monospecific genus to E. gigantea (Linnaeus) 1758 of
Buprestidae family that occurs in Neotropical region (Bellamy 2003). Brazilian
individuals show high intriguing variable karyotypes with 2n = 22 up to 2n = 36,
multiple sex mechanism (X1Y1X2Y2X3, X1Y1X2Y2X3Y3 or X1Y1X2Y2X3Y3X4Y4),
and B chromosomes with number varying from one to 32 (Mesa and Fontanetti
1984; Moura et al. 2008; Xavier et al. 2018). The karyotype variation in the
species is attributed to centric fissions and fusions, translocations and
pericentric inversions, which is supposed to have been triggered by ectopic
recombination of repetitive sequences (Xavier et al. 2018). Recently, based in
mitochondrial gene COI (cytochrome oxidase subunit I) analysis it was noticed
the occurrence of at least three chromosomally polymorphic lineages of E.
gigantea distributed in Brazil corresponding to three geographic groups, i.e.
North, Northeast and Southeast/Midwest (Xavier et al. 2018).
Although the intriguing chromosomal polymorphism is well documented
in E. gigantea there are few information concerning the chromosomal
organization of repetitive DNAs in this species, which could be prone to be
involved with karyotype variation. In this way, the aims of this work was to
understand the chromosomal organization of 18S rDNA and most satDNAs in
the species and their possible involvement with chromosomal variability. For
this purpose, we isolated and characterized three satDNAs by using deep
Illumina sequencing reads, graph-based clustering, and cytogenetic mapping
90
them and 18S rDNA within different population of E. gigantea with diploid
number ranging from 2n = 22 to 2n = 36 with five, six or eight sex
chromosomes.
Material and methods

Samples
Euchroma gigantea adult male specimens were manually collected on
Malvaceae tree of Pachira, Sterculia and Ceiba genera. The sampling have
been made in urban Brazilian areas of Belém, Pará state (PA) (01º28’13.55’’ S
48º26’49.98’’ W), Ribeirão Preto, São Paulo state (SP) (21º10’16.22’’ S
47º51’19.67’’ W), Brasília, Federal District (15°46'44.7"S 47°55'20.4"W), Recife,
Pernambuco state (PE) (08º03’060” S 34º57’200’’ W) and Maceió, Alagoas
state (AL) (09º33’4.11’’S 35º46’6.74’’ W), Brazil (Table 1). The sampling was
done between 2012-2016 in accordance with Brazilian laws of environmental
protection and IBAMA/SISBIO license (No. 16278-1). Voucher specimens are
deposited in the reference collection at the Laboratory of Biodiversity and
Genetics of Insects, University of Pernambuco, Recife, Pernambuco, Brazil.
DNA extraction, identification of satDNAs

Genomic DNA of E. gigantea individuals were extracted from femur
tissue following phenol:chloroform method (Sambrook and Russel 2001). The
genome of one individual with 2n = 34, X1Y1X2Y2X3Y3 from Pernambuco was
sequenced through Illumina HiSeq 2000 platform (paired-ends reads 2x100)
using the service of Macrogen Inc, Korea. DNA-seq reads were preprocessed
to check reads quality, filtered and joined using FASTQC and FASTX-Toolkit
suit available in the web server Galaxy (http://repeatexplorer.umbr.cas.cz). In
order to find out satDNAs the joined reads were clustered and assembled by
similarity using Repeat Explorer pipeline (Novák et al. 2013), set default
parameters. Assembled contigs belonging to every cluster were submitted to
Tandem Repeat Finder (TRF) (Benson 1999) to identify DNA sequences that
maximized the alignment scores among distinct monomers that could be
arranged in tandem. Furthermore, tandem organization was confirmed by
dotplot graphic alignment tool in Dotlet (Junier and Pagni 2000) and p distance
was calculated in MEGA 6.0 (Tamura et al. 2013).
91
PCR amplification and sequence analysis

After satDNAs identification, they were amplified through Polymerase
Chain Reaction (PCR) from genomic DNA of E. gigantea. Convergent (Egig1,
Egig2) and divergent (Egig3) primers for PCR were designed using the
Primer3plus or manually, Egig1F 5’-TACCTACCTACCTACCTACC-3’, Egi1R 5’-
GGTAGGTAGGTAGGTAGGTA-3’, Egig2F 5’-GCTCGCACCGAAACTGTTA-3’,
Egi2R 5’-GTTGTGGCCTCCGTGCA-3’ and Egi3F 5’-
TGTCGATGTCGGCCGTTCCT-3’ Egi3R 5’-TCCGTTACCTTCCTCCACAC-3’.
PCRs were performed in 50µL containing 1x Taq DNA polymerase recombinant
buffer (Invitrogen), 1.5 mM MgCl2, 0.02 mM of dNTP, 0.4 μM of each primer and
0.1 units of Taq DNA polymerase. The PCR for Egig1 followed an initial
denaturation of 5 min at 94 ºC, then 10 cycles of 1 min at 94 ºC, 30 s at 55 ºC
and 60 s at 72 ºC, and 35 cycles of 1 min at 94 ºC, 30 s at 60 ºC and 90 s at 72
ºC, with a final extension of 5 min at 72 ºC. SatDNA Egig2 and Egig3 were
amplified following an initial denaturation of 5 min at 94 ºC, 30 cycles of 30 sec
at 94 ºC, 30s at 55 ºC and 1 min at 72 ºC with a final extension of 5 min at 72
ºC.
To variability analysis the sequences Egig2 and Egig3 were amplified
from three pools of genomic DNA corresponding to lineages North (Belém –
PA), Northeast (Recife – PE and Maceió – AL) and Southeast/Midwest (Brasília
– DF and Ribeirão Preto – SP). Were used genomic DNA from four individuals
belonging to each lineage. PCR products were visualized in agarose gel
electrophoresis (1%) and monomers bands were recovered, purified (Zimoclean
™ Gel DNA Recovery Kit-Sinapse) and cloned in pGEM-T Easy vector
(Promega). Sixteen colonies of Egig2 and Egig3 sequences from each lineage
were Sanger sequenced by Macrogen (South Korea) facility.
Sequences were analyzed using Pregap4 software, STADEN package
(Bonfield et al. 1995) and submitted to Vecscreen
(https://www.ncbi.nlm.nih.gov/tools/vecscreen) to remove regions of cloning
vector. Sequences were used as query in GenBank and Repbase to search
similarity with other sequences. The alignments were done using Muscle
algorithm (Edgar 2004) and were displayed in logos format using Weblogo 3.3
software (Crooks et al. 2004). Haplotype analysis was done in Network 5.0
(http://www.fluxux-engineering.com) using median joining approach. To show
92
sequences as logos and to Network analysis, sequences of the primers were

removed to minimize a possible bias.
Chromosomal preparations and Fluorescence in situ Hybridization (FISH)
Chromosomal preparations were obtained for 14 E. gigantea specimens
from five populations (Table 1) by the classical method of testicular spreading.
In order to detect chromosomal location of satDNA and 18S rDNA, FISH
experiment were carried out as previously described in Pinkel et al. (Pinkel et al.
1986) with modifications proposed by (Cabral-de-Mello 2015). To obtain the
18S rDNA it was used the primers described by Cabral-de-Mello et al. (2010)
using genomic DNA from the beetle Dichotomius semisquamosus. The Egig1
and Egig3 probes were labeled with dUTP-digoxigenin by PCR and detected
with Anti-Digoxigenin-Rhodamine (Roche), while 18S rDNA and Egig2 probes
were labeled by Nick translation using biotin-14-dATP and detected with avidin-
FITC (fluorescein isothiocyanate) (Invitrogen, San Diego, CA, USA). Cells were
visualized using Olympus microscope BX61 equipped with a fluorescent lamp
and captured images using a DP70 cooled digital camera. The brightness and
contrast of photographs were optimized using Photoshop CC 2014.
Results
satellite DNAs
The three satDNAs recovered from E. gigantea genome (Egig1, Egig2
and Egig3) sequences correspond to clusters CL1, CL44 and CL83 identified by
RepeatExplorer, which are in decreasing order according to their genome
proportion, i.e., 9.71%, 0.299% and 0.09%, respectively. Egig1 corresponds to
a short motif (TACC)n and is the most abundant satellite sequence identified in
E. gigantea genome, while Egig2 and Egig3 are 172 and 202 bp long,
respectively and were the longest monomers identified. The long sequences
were deposited in GenBank under the follow access number: MH844826 for
Egig2 and MH844827 for Egig3. They did not show significant similarities with
other sequences deposited in Genbank or Repbase databases. Egig2 and
Egig3 are different families, since they showed less than 80% identity (42%).
Monomers found in the sequenced genome showed 9.6% of nucleotide
divergence (p-distance) within four monomers of Egig2 and 6% within three
monomers of Egig3.
93
The analysis of sequenced clones from three lineages revealed

nucleotide divergence of 7% and 1% for Egig2 and Egig3, respectively. Thirty-
nine haplotypes were recognized to Egig2, and nine haplotypes to Egig3. The
haplotype network showed sharing haplotypes among lineages for both
sequences and reveals the high haplotype diversity of 0.9823 to Egig2 while in
Egig3 it was 0.3750. Sequence logos and Network haplotypes (Fig 1) illustrates
the levels of identity and haplotypes relationship of these sequences within and
among the three DNA pools analyzed.
Chromosomal location of 18S rDNA and satDNAs

The specimens analyzed showed karyotypes with 2n = 22, 2n = 26, 2n =
32, 2n = 34, 2n = 35 and 2n = 36 with multiple sex mechanism composed by
five, six or eight chromosomes and plus punctiform B chromosomes present in
all karyotypes except in 2n=22 (Table 1) (Fig 3). All these karyotypes were
previously described by Xavier et al. (2018).
The mapping of 18S rDNA revealed variable number of sites all present
in pericentromeric region of chromosomes. Patterns of distribution were variable
and sites were found exclusively in autosomes or dispersed in autosomes and
sex chromosome (Fig. 2, S1). Karyotypes with 2n = 22, 2n = 26, 2n = 34 and 2n
= 36 presented sites of 18S rDNA in one autosomal pair (Fig. 2a-d, g, k).
However, in specimens with 2n = 22, one site per chromosome was observed in
the metacentric pair 4 (Fig. 2a-c), while in karyotypes 2n = 26, 2n = 34 and 2n =
36 the sites were present in pair one, that is acrocentric (Fig. 2d, g, k).
Furthermore, two individuals with 2n = 32 presented variable site number, with
one presenting sites of 18S rDNA in pairs 1, 2 and 4 (Fig 2e), while the second
one showed sites in pairs 1, 2, 3, 4 and 5 (Fig 2f). In both cases, the 18S rDNA
was homomorphic for pair 4 and heteromorphic for the other pairs i.e., only one
of the homologs was labeled. In karyotypes with 2n = 35, distribution of 18S
rDNA sites were also variable and clusters were found in autosomes and X3
chromosome (Fig. 2i-k). Among 2n = 35 karyotypes three patterns were
observed (i) sites only in pair 1, (ii) sites in pair 9 and in X3, and (iii) sites in pair
2, pair 9 (heteromorphic) and in X3 (Fig. 2h, i, j).
The satDNA Egig1 showed identical pattern of chromosomal distribution
in all tested karyotypes and it was localized in pericentromeric region of all
94
chromosomes (Fig 3). Egig2 and Egig3 were co-localized in two or four sites
per diploid genome in all karyotypes (Fig. 4). In all tested karyotypes, the
pattern of distribution of Egig2 and Egig3 was the same to those observed for
18S rDNA and it was demonstrated to karyotypes 2n = 26 and 2n = 35 (Fig. 5),
except for one individual with 2n = 22, X1Y1X2Y2X3Y3 that show two sites of 18S
rDNA, but exhibited four sites of Egig2 and Egig3 (Fig. 3b, 4b).
Discussion
The interesting intra and interpopulational chromosomal polymorphism
observed in Euchroma gigantea was previously described (Mesa and Fontanetti
1984; Moura et al. 2008; Xavier et al. 2018). There are evidences that
chromosomal evolutionary history of this species started from a set with 2n =
20, Xy, which underwent centric fissions and fusions, pericentric inversions,
autosome-autosome (A-A) and sex chromosome-autosome (A-X) translocation
and Y loss (Xavier et al. 2018). Because repetitive sequences could be hotspots
for chromosome breakage that precede rearrangements like fission, reciprocal
translocations and inversions (Cáceres et al. 1999; Fischer et al. 2000;
Coghlan and Wolfe 2002; Paço et al. 2015) these sequences were suggested
as promoter of chromosomal rearrangements in E. gigantea karyotypes (Xavier
et al. 2018). On the other hand, these chromosomal rearrangements could act
repatterning distribution of another sequences involved in rearranged areas
(Hirai et al. 1996; Paço et al. 2015).
Although E. gigantea presented highly diverse karyotypes, presence of
two sites of 18S rDNA per diploid genome in 2n = 22 2n = 26, 2n = 34, 2n = 35
and 2n = 36 karyotypes is a conserved condition. This suggests that
rearrangements involved in the increase of diploid number does not caused
dispersion of 18S rDNA in these karyotypes. However, the variable morphology
of chromosomes bearing 18S rDNA sites in karyotypes aforementioned could
be consequence of chromosomal rearrangements experienced by distinct
populations. In addition, dispersion of this sequence with no alteration of
chromosomal morphologies or increase of diploid numbers, as observed in 2n =
32 and 35 karyotypes, suggesting that chromosomal rearrangements are not
unique mechanism that triggered the repatterning distribution of 18S rDNA.
95
The presence of two sites per diploid genomes is the most common
pattern for major rDNA in Coleoptera as a whole, including representatives of
Polyphaga (Schneider et al. 2007; Almeida et al. 2010; Cabral-de-Mello et al.
2011; Goll et al. 2015; Lopes et al. 2017). However, an increasing of major
rDNA cluster and repositioning of them among different autosomes and sex
chromosomes was also reported in this order (Cabral-de-Mello et al. 2011). In
Coleoptera and other insect orders, both chromosomal rearrangements and
ectopic recombination have been proposed to dispersion of rDNA sequences
(Hirai et al. 1996; Nguyen et al. 2010; Cabral-de-Mello et al. 2011; Pita et al.
2016).
Considering that the ancestral sites of 18S rDNA in E. gigantea may be
those in pair 4 of the 2n = 22, which is the putative ancestral karyotype of the
species (Xavier et al. 2018), the most parsimonious scenario for rDNA
reshuffling in this species involves chromosomal rearrangements and events of
ectopic recombination. Two patterns of 18S rDNA dispersion were observed,
i.e. only in autosomes (2n = 32) or in autosomes and sex chromosomes (2n =
35), and this scenario indicate the existence of independent process for rDNA
dispersion as well as chromosomal repositioning of these sequences in these
karyotypes.
Presence and abundance of Egig1, Egig2 and Egig3 in distinct
karyotypes from all analyzed populations suggest that they originated before
karyotype diversification of E gigantea. Occurrence of Egig1, in pericentromeric
region of all chromosomes in different karyotypes reveals that this sequence is
probable involved with structural components of heterochromatin (Plohl et al.
2012). In addition, as well as histone sequences that are abundant in
pericentromeric region (Xavier et al. 2018), Egig1 may favor the occurrence of
ectopic recombination contributing to chromosomal rearrangements (Rousselet
et al. 2000; Coghlan et al. 2005) and to repatterning of rDNA (Nguyen et al.
2010).
Proportion of Egig1, Egig2 and Egig3 in genome, at least in part, reflect
in abundance divergences in number of chromosome sites of these sequences.
Egig1 was most abundant and highly represented in all karyotypes while
Egig2/Egig3 were less abundant and showed only two sites in most of
karyotypes. Dispersion of Egig2 and Egig3 together with 18S rDNA and restrict
96
to pericentromeric region of few chromosomes is uncommon in Coleoptera. In

this order, various satDNA cytogenetically studied are dispersed in constitutive
heterochromatin (CH) of all or almost all chromosomes (Juan et al. 1993;
Ugarković et al. 1996a; Ugarković et al. 1996b; Lorite et al. 2001; Lorite et al.
2002; Mravinac and Plohl 2010). However, restriction of satDNA in specific
chromosomes was also observed in Tribolium castaneum (Tenebrionidae) and
could be indicative of sequences diversity in CH of species, beyond the possible
existence of different chromosome-specific satDNA families (Pavlek et al.
2015). The presence of two sites of rDNA 18S, but four sites of Egig2 and Egig3
in karyotype 2n = 22, X1Y1X2Y2X3Y3 indicate that dispersion of these satDNA
sequences could also be independent (Macas et al. 2003; Jo et al. 2009) and
that possibly not all arrays of these sequences are intermingled with rDNA
sequences.
Some differences in sequence dynamics of Egig2 and Egig3 were
evident by nucleotide divergence and haplotype diversity. Nevertheless, both
sequences reveal high level of sequence conservation within and among
populations belongs to three lineages of E. gigantea described by Xavier et al.
(2018). The homogeneity of these sequences was evident in the haplotype
network, where haplotypes were shared among three lineages and haplotypes
from different lineages are located in the same branches without any pattern of
lineage-specific variation. As predict in concerted evolution model some satDNA
accumulate mutations rapidly, while others possess a low rate of modifications.
As consequence of low rates of evolution, many satDNA may be found in
different populations of one species or in a species group (Plohl et al. 2012). It
suggest that Egig2 and Egig3 sequences suffered low differentiation and were
conserved along lineage differentiation process of E. gigantea.
Conclusions
Dispersion of 18S rDNA, Egig2 and Egig3 in E. gigantea possibly started
in sites presents in metacentric pair 4 in karyotypes with 2n = 22, and were
dispersed in other karyotypes through events of chromosomal rearrangements
and ectopic recombination. Dispersion and repositioning of these sequences
seems follow independent paths in different populations/karyotypes. However,
despite the different patterns distribution and dispersion of Egig2 and Egig3,
97
they do not have significant differentiation in sequence level among the three
studied Brazilian lineages. Abundant distribution of Egig1 in pericentromeric
regions of chromosomes in all tested karyotypes reveals its origin before
chromosomal diversification of E. gigantea and may indicate an important role
of this sequence in chromosomal evolutionary history of E. gigantea.
Conflict of interest
The authors declare that they have no conflict of interest.
Acknowledgements
We are grateful to Dr. Fernando A. B. Silva and M.Sc. Amanda Arcanjo

for providing samples from Belém-PA. This work was supported by
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (Capes),
Fundação de Amparo à Ciência e Tecnologia de Pernambuco-FACEPE (APQ
process number 0777-2.02/15), Fundação de Amparo à Ciência do Estado de
São Paulo - FAPESP (2014/11763-8) and the Conselho Nacional de
Desenvolvimento Científico e Tecnológico-CNPq-Brazil (PQ-2 of RCM process
number 305298/2014-3).
References
Almeida MC, Goll LG, Artoni RF, et al (2010) Physical mapping of 18S rDNA
cistron in species of the Omophoita genus (Coleoptera, Alticinae) using
fluorescent in situ hybridization. Micron 41:729–34. doi:
10.1016/j.micron.2010.06.008
Arcanjo AP, Cabral-de-Mello DC, Barros e Silva AE, Moura R de C (2009)
Cytogenetic characterization of Eurysternus caribaeus (Coleoptera:
Scarabaeidae): evidence of sex-autosome fusion and diploid number
reduction prior to species dispersion. J Genet 88:177–82.
Bailey JA, Baertsch R, Kent WJ, et al (2004) Hotspots of mammalian
chromosomal evolution. Genome Biol 5:R23. doi: 10.1186/gb-2004-5-4-r23
Bellamy C (2003) An illustrated summary of the higher classification of the
superfamily Buprestoidea (Coleoptera). Folia Heyrovskiana 10:44.
Benson G (1999) Tandem repeats finder: a program to analyze DNA
98
sequences. Nucleic Acids Res 27:573–580.

Bonfield JK, Smith KF, Staden R (1995) A new DNA sequence assembly
program. Nucleic Acids Res 24:4992–4999.
Brown JD, O’Neill RJ (2010) Chromosomes, conflict, and epigenetics:
chromosomal speciation revisited. Annu Rev Genomics Hum Genet
11:291–316. doi: 10.1146/annurev-genom-082509-141554
Cabral-de-Mello DC (2015) Beetles (Coleoptera). In: Sharakhov I V (ed)
Protocols for Cytogenetic Mapping of Arthropod Genomes, I. CRC press,
Boca Raton, pp 171–217
Cabral-de-Mello DC, Moura RC, Martins C (2010) Chromosomal mapping of
repetitive DNAs in the beetle Dichotomius geminatus provides the first
evidence for an association of 5S rRNA and histone H3 genes in insects,
and repetitive DNA similarity between the B chromosome and A
complement. Heredity (Edinb) 104:393–400. doi: 10.1038/hdy.2009.126
Cabral-de-Mello DC, Oliveira SG, de Moura RC, Martins C (2011)
Chromosomal organization of the 18S and 5S rRNAs and histone H3
genes in Scarabaeinae coleopterans: insights into the evolutionary
dynamics of multigene families and heterochromatin. BMC Genet 12:88.
doi: 10.1186/1471-2156-12-88
Cáceres M, Ranz JM, Barbadilla A, et al (1999) Generation of a widespread
Drosophila inversion by a transposable element. Science (80- ) 285:415–
418. doi: 10.1126/science.285.5426.415
Charlesworth B, Sniegowski P, Stephan W (1994) The evolutinary dynamics of
repetitive DNA in eukaryotes. Nature 371:215–220.
Coghlan A, Eichler EE, Oliver SG, et al (2005) Chromosome evolution in
eukaryotes: A multi-kingdom perspective. Trends Genet 21:673–682. doi:
10.1016/j.tig.2005.09.009
Coghlan A, Wolfe KH (2002) Fourfold faster rate of genome rearrangement in
nematodes than in Drosophila. Genome Res 12:857–867. doi:
10.1101/gr.172702
Colomba M, Vitturi R, Volpe N, et al (2004) Karyotype, banding and rDNA FISH
in the scarab beetle Anoplotrupes stercorosus (Coleoptera Scarabaeoidea:
Geotrupidae). Description and comparative analysis. Micron 35:717–20.
doi: 10.1016/j.micron.2004.04.004
99
Crespi B, Nosil P (2013) Conflictual speciation: Species formation via genomic

conflict. Trends Ecol Evol 28:48–57. doi: 10.1016/j.tree.2012.08.015
Crooks GE, Hon G, Chandonia J-M, Brenner S (2004) WebLogo: a sequence
logo generator. Genome Res 14:1188–1190. doi: 10.1101/gr.849004.1
Dover G (1982) Molecular drive: a cohesive mode of species evolution. Nature
299:111–117.
Edgar RC (2004) MUSCLE: Multiple sequence alignment with high accuracy
and high throughput. Nucleic Acids Res 32:1792–1797. doi:
10.1093/nar/gkh340
Eichler EE, Sankoff D (2003) Structural dynamics of eukaryotic chromosomes
evolution. Science (80- ) 301:793–797. doi: 10.1126/science.1086132
Eickbush TH, Eickbush DG (2007) Finely orchestrated movements: Evolution of
the ribosomal RNA genes. Genetics 175:477–485. doi:
10.1534/genetics.107.071399
Ferree PM, Barbash DA (2009) Species-specific heterochromatin prevents
mitotic chromosome segregation to cause hybrid lethality in Drosophila.
PLoS Biol. doi: 10.1371/journal.pbio.1000234
Fischer G, James S, Roberts I, et al (2000) Chromosomal evolution in
Saccharomyces. Nature 25:451–4.
Goll LG, Matiello RR, Artoni RF, et al (2015) High-Resolution physical
chromosome mapping of multigene families in Lagria villosa
(Tenebrionidae): Occurrence of interspersed ribosomal genes in
Coleoptera. Cytogenet Genome Res 146:64–70. doi: 10.1159/000382047
Henikoff S, Ahmad K, Malik HS (2001) The centromere paradox: Stable
inheritance with rapidly evolving DNA. Science (80- ) 293:1098–1102. doi:
10.1126/science.1062939
Hirai H, Yamamoto MT, Taylor RW, Imai HT (1996) Genomic dispersion of 28S
rDNA during karyotypic evolution in the ant genus Myrmecia (Formicidae).
Chromosoma 105:190–196. doi: 10.1007/s004120050174
Jo S-H, Koo D-H, Kim JF, et al (2009) Evolution of ribosomal DNA-derived
satellite repeat in tomato genome. BMC Plant Biol 9:1–14. doi:
10.1186/1471-2229-9-42
Juan C, Pons J, Petitpierre E (1993) Localization of tandemly repeated DNA
sequences in beetle chromosomes by fluorescent in situ hybridization.
100
Chromosom Res 1:167–74.

Junier T, Pagni M (2000) Dotlet: diagonal plots in a web browser. Bioinformatics
16:178–179. doi: 10.1093/bioinformatics/16.2.178
Kim YB, Oh JH, McIver LJ, et al (2014) Divergence of Drosophila melanogaster
repeatomes in response to a sharp microclimate contrast in Evolution
Canyon, Israel. Proc Natl Acad Sci 111:10630–10635. doi:
10.1073/pnas.1410372111
Lindholm AK, Dyer KA, Firman RC, et al (2016) The ecology and evolutionary
dynamics of meiotic drive. Trends Ecol Evol 31:315–326. doi:
10.1016/j.tree.2016.02.001
Long EO, Dawid IB (1980) Repeated genes in eukaryotes. Annu Rev Biochem
49:727–764.
Lopes AT, Fernandes FR, Schneider MC (2017) Chromosome mapping of 28S
ribosomal genes in 11 species of Cassidinae (Coleoptera: Chrysomelidae).
Eur J Entomol 114:546–553. doi: 10.14411/eje.2017.069
Lorite P, Carrillo JA, Garnería I, et al (2002) Satellite DNA in the elm leaf beetle,
Xanthogaleruca luteola (Coleoptera, Chrysomelidae): characterization,
interpopulation analysis, and chromosome location. Cytogenet Genome
Res 98:302–307. doi: 10.1159/000071053
Lorite P, Palomeque T, Garnería I, Petitpierre E (2001) Characterization and
chromosome location of satellite DNA in the leaf beetle Chrysolina
americana (Coleoptera , Chrysomelidae). Genetics 110:143–150.
Lorite P, Torres MI, Palomeque T (2013) Characterization of two unrelated
satellite DNA families in the Colorado potato beetle Leptinotarsa
decemlineata (Coleoptera, Chrysomelidae). Bull Entomol Res 103:538–
546. doi: 10.1017/S0007485313000060
Macas J, Navrátilová A, Mészáros T (2003) Sequence subfamilies of satellite
repeats related to rDNA intergenic spacer are differentially amplified on
Vicia sativa chromosomes. Chromosoma 112:152–158. doi:
10.1007/s00412-003-0255-3
Mesa A, Fontanetti CS (1984) Multiple Sex-Chromosomes, autosomal
polymorphism and a high number of S chromosomes in Euchroma
gigantea L 1735 (Coleoptera, Buprestidae). Rev. Bras. Genet. 7:629–637.
Mora P, Vela J, Ruiz-Mena A, et al (2017) Characterization and transcriptional
101
analysis of a subtelomeric satellite DNA family in the ladybird beetle

Henosepilachna argus (Coleoptera: Coccinellidae). Eur J Entomol
114:481–487. doi: 10.14411/eje.2017.028
Moura R de C, Melo NF, Souza MJ (2008) High levels of chromosomal
Genet Mol Biol 31:431–437. doi: 10.1590/S1415-47572008000300007
Mravinac B, Plohl M (2010) Parallelism in evolution of highly repetitive DNAs in
sibling species. Mol Biol Evol 27:1857–67. doi: 10.1093/molbev/msq068
Nei M, Rooney AP (2005) Concerted and birth-and-death evolution of multigene
families. Annu Rev Genet 39:121–152. doi: 10.1002/nbm.3066.Non-
invasive
Nguyen P, Sahara K, Yoshido A, Marec F (2010) Evolutionary dynamics of
rDNA clusters on chromosomes of moths and butterflies (Lepidoptera).
Genetica 138:343–354. doi: 10.1007/s10709-009-9424-5
Novák P, Neumann P, Pech J, et al (2013) RepeatExplorer: A Galaxy-based
web server for genome-wide characterization of eukaryotic repetitive
elements from next-generation sequence reads. Bioinformatics 29:792–
793. doi: 10.1093/bioinformatics/btt054
Paço A, Adega F, Meštrović N, et al (2015) The puzzling character of repetitive
DNA in Phodopus genomes (Cricetidae, Rodentia). Chromosom Res
23:427–440. doi: 10.1007/s10577-015-9481-9
Pavlek M, Gelfand Y, Plohl M, Meštrović N (2015) Genome-wide analysis of
tandem repeats in Tribolium castaneum genome reveals abundant and
highly dynamic tandem repeat families with satellite DNA features in
euchromatic chromosomal arms. DNA Res 22:387–401. doi:
10.1093/dnares/dsv021
Pinkel D, Straume T, Gray JW (1986) Cytogenetic analysis using quantitative,
high-sensitivity, fluorescence hybridization. Proc Natl Acad Sci 83:2934–
2938.
Pita S, Lorite P, Nattero J, et al (2016) New arrangements on several species
subcomplexes of Triatoma genus based on the chromosomal position of
ribosomal genes (Hemiptera - Triatominae). Infect Genet Evol 43:225–231.
Plohl M, Meštrović N, Mravinac B (2012) Satellite DNA Evolution. In: Garrido-
Ramos MA (ed) Repetitive DNA. Karger, Basel, pp 126–152
102
Rousselet J, Monti L, Auger-Rozenberg M a, et al (2000) Chromosome fission

associated with growth of ribosomal DNA in Neodiprion abietis
(Hymenoptera: Diprionidae). Proc Biol Sci 267:1819–23. doi:
10.1098/rspb.2000.1216
Sambrook J, Russel DW (2001) Molecular Cloning. A Laboratory Manual, Third
Edit. Cold Spring Harbor, New York
Sawamura K (2012) Chromatin evolution and molecular drive in speciation. Int J
Evol Biol 2012:1–9. doi: 10.1155/2012/301894
Schneider MC, Rosa SP, Almeida MC, et al (2007) Chromosomal similarities
and differences among four Neotropical Elateridae (Conoderini and
Pyrophorini) and other related species, with comments on the NOR
patterns in Coleoptera. J Zool Syst Evol Res 45:308–316.
Tamura K, Stecher G, Peterson D, et al (2013) MEGA6 : Molecular evolutionary
genetics analysis version 6.0. Mol Biol Evol 30:2725–2729. doi:
10.1093/molbev/mst197
Ugarković D, Durajlija S, Plohl M (1996a) Evolution of Tribolium madens
(Insecta , Coleoptera) satellite DNA through DNA inversion and insertion. J
Mol Evol 42:350–358.
Ugarković D, Podnar M, Plohl M (1996b) Satellite DNA of the red flour beetle
Tribolium castaneum-comparative study of satellites from the genus
Tribolium. Mol Biol Evol 13:1059–66.
Xavier C, Soares RVS, Amorim IC, et al (2018) Insights into the karyotypic
evolution and speciation of the beetle Euchroma gigantea (Coleoptera:
Buprestidae). Chromosom Res 1–16.
103
Fig 1. Egig2 and Egig3 sequence logos (upper) and haplotype networks (bottom). In the logos each line represents sequence variation in lineages Northeast,
North and Southeast/Midwest. In nodes with more than one mutation between haplotypes, the number of steps are indicated. Small black circles correspond to
unsampled haplotypes and circles are proportional to the haplotypes frequencies.
104
Table 1. Chromosomal data of Euchroma gigantea analyzed individuals per sampling site. Note: “-”
identify individuals with no result to Egig2/Egig3 probes.
Localities Nº of Karyotypes B rDNA Egig2/Egig

individuals chromosome Sites 3
Distrito 1 2n = 22, X1Y1X2Y2X3Y3X4Y4 0
s 2 2
Sites
Federal - DF 2 2n = 22, X1Y1X2Y2X3Y3 0 2 4
1 2n = 22, X1Y1X2Y2X3 0 2 -
Ribeirão Preto 2 2n = 26, X1Y1X2Y2X3Y3 10/ 21 2 2
-Belém
SP - PA 2 2n = 32, X1Y1X2Y2X3Y3 3/ 4 4/6 4/-
Recife - PE 2 2n = 34, X1Y1X2Y2X3Y3 2, 5 2 2
1 2n = 36, X1Y1X2Y2X3Y3 3 2 -
Maceió - AL 3 2n = 35, X1Y1X2Y2X3 3/ 3/ 6 2/ 3/ 4 -/-/4
Fig 2. Fluorescence in situ hybridization with 18S rDNA probe on meiotic (a-f, h-j) and mitotic (g,k)
cells of Euchroma gigantea. The arrows indicate 18S rDNA sites and arrowheads indicate the ends
of sex chromosome chain with five (a, h-j), six (b, d-f) or eight chromosomes (c). Note in (a) the
presence of an autosomal trivalent – T. See the dot B chromosomes in (d, g-k). The diploid
numbers and location of sampling are indicated in each image. Bar = 10µm
105
Fig 3. FISH mapping of Egig1 in spermatogonial metaphases (a, c),

metaphases I (b, d) and metaphases II (e, f) of Euchroma gigantea. Note the
location of signals in pericentromeric regions of all chromosomes independent
of diploid number. The diploid numbers and location of sampling are indicated
directly in each cell. Bar: 5µm.
106
Fig. 4 Meiotic cells in metaphases II (a, b) and metaphases I (c-f) of Euchroma

gigantea probed for Egig2 (green) and Egig3 (red) through FISH. Inserts show
separated signals. The diploid numbers and location of sampling are indicated
directly in each image. Bar = 10µm
Fig. 5 Chromosomal mapping through FISH of Egig3 and 18S rDNA in Euchroma gigantea
metaphases I showing the co-location of both sequences. Inserts show the signals
separately. Bar 10 µm
107
Fig S1. Idiograms showing results of FISH with rDNA probe. The asterisks (*) identify heteromorphic pairs.
108
5 MITOGENOMA DE EUCHROMA GIGANTEA (COLEOPTERA:

BUPRESTIDAE) REVELA REDUÇÃO DO GENE COII, SEQUÊNCIA NÃO
CODIFICANTE E DUPLICAÇÃO DE GENES DE RNAT
Crislaine Xavier1; Igor Costa Amorim1; Diogo Cavalcanti Cabral-de-Mello2; Gabriel

da Luz Wallau3; Rita de Cássia de Moura1
1Universidade de Pernambuco (UPE), Instituto de Ciências Biológicas, Laboratório

de Biodiversidade e Genética de Insetos, Recife, Pernambuco, Brasil
2Universidade Estadual Paulista (UNESP), Instituto de Biociências, Departamento
de Biologia, Rio Claro, São Paulo, Brasil
3Departamento de Entomologia, Instituto Aggeu Magalhães - FIOCRUZ-IAM,
Recife, Pernambuco, Brasil
*Rita de Cássia de Moura

Universidade de Pernambuco (UPE), Instituto de Ciências Biológicas, Laboratório
de Biodiversidade e Genética de Insetos, Recife, Pernambuco, Brasil
E-mail: [email protected]
Este manuscrito será submetido à revista: Mitochrondrial DNA part A

109
Resumo
Euchoma é um gênero considerado monoespecífico para E. gigantea,
apesar de apresentar polimorfismos morfológicos ao longo de sua ocorrência na
região Neotropical. Além disso, E. gigantea possui três linhagens
cromossomicamente polimórficas descritas no Brasil. Neste trabalho, o
mitogenoma de E. gigantea foi montado e analisado quanto a sua estrutura. O
mitogenoma apresentou a redução do gene COII e uma região altamente variável
entre os genes RNAtAsp e ATP8, apesar de possuir uma estrutura típica do
genoma mitocondrial animal. A análise dessa região entre indivíduos das três
linhagens da espécie evidenciou a ocorrência de três padrões de organização
nesta região, a qual apresentou uma sequência não codificante e a duplicação do
gene RNAtAsp ou genes putativos de RNAtAsn ou RNAtTyr. A análise filogenética
realizada utilizando mitogenomas de espécies da ordem Coleoptera revelou a
estreita relação de E. gigantea com uma espécie da subfamília Chrysochroinae.
Os resultados deste trabalho demonstram que o mitogenoma de E. gigantea
possui um considerável nível de variação intraespecífico e apresenta
características que podem ser consideradas sinapomorfias no gênero.
Palavras-chave: besouro joia, buprestídeo gigante, polimorfismo, linhagens

mitocondriais, rearranjo molecular.
110
Introdução
O genoma mitocondrial apresenta particularidades em relação ao nuclear.
Em animais, por exemplo, a sua herança é predominantemente uniparental
(materna), o tamanho é relativamente pequeno (~16kb), apresenta baixa taxa de
recombinação e alta taxa de mutação (Wolstenholme 1992; Boore 1999). Na
maioria dos animais, incluindo os insetos, este genoma é composto por uma
região não codificante, 13 genes codificantes de proteínas, dois genes de RNA
ribossomal e 22 genes codificantes de RNA transportador (Boore 1999;
Ladoukakis & Zouros 2017). Com raras exceções, além da região não codificante
que contém os elementos controladores da replicação e transcrição, regiões não
codificantes são curtas e pouco frequentes no mitogenoma (Ladoukakis & Zouros
2017).
Em algumas espécies de animais o mitogenoma varia deste padrão, sendo
observadas perdas de genes de RNAt (Song et al. 2010; Nan et al. 2016; Tang et
al. 2017), duplicações gênicas (Liu et al. 2017) e fragmentação do mitogenoma
em duas ou mais moléculas de DNA circular ou linear (Smith et al. 2011; Shao et
al. 2012; Wei et al. 2012). Esses mitogenomas multipartidos variam de dois até 20
minicromossomos em espécies de piolho (Shao et al. 2012; Wei et al. 2012). Em
Coleoptera, grande parte das espécies com mitogenoma caracterizado mantém o
arranjo proposto como ancestral para insetos, o qual inclui 13 genes codificantes
de proteínas, 22 genes de RNAt e dois genes de RNA ribossomal (Timmermans
& Vogler 2012; Song et al. 2017).
Nos besouros da família Buprestidae, o sequenciamento de porções de
genes mitocondriais têm sido úteis em estudos de identificação molecular de
espécies (Wu et al. 2017), análises filogenéticas (Evans et al. 2015) e estudos
populacionais (Lopez et al. 2014). Entretanto, apenas oito espécies desta família
tiveram a descrição parcial (Antaxia sp., Agrilus sp., A. bigutatus, Acmaeodera
sp., Perotis lugubris) ou completa (Acmaeodera sp., Agrilus planipennis,
Chrysochroa fulgidíssima) do seu mitogenoma (Hong et al. 2009; Timmermans et
al. 2015; Duan et al. 2017). Nestes mitogenomas, a quantidade, orientação e
ordem dos genes mostroaram-se idênticas ao observado em outros insetos
(Hong et al. 2009; Timmermans et al. 2015), exceto o mitogenoma do buprestídeo
Chrysochroa fulgidíssima que apresentou sequências similares aos genes de
RNAtLeu e RNAtAsn na região controle (Hong et al. 2009). Estas sequências
111
possuem o anticódon e o potencial de gerar estruturas secundárias, porém, a

divergência de 50-58% dos genes originais e a presença de muitos mismatches
nas regiões do anticódon e aminoacil, põem em questão a funcionalidade dessas
sequências (Hong et al. 2009).
Euchroma é um gênero de Buprestidae considerado monoespecífico para
E. gigantea e com descrição de quatro subespécies com variações morfológicas
ao longo da sua distribuição (Blackwelder 1944; Bellamy 2008). Análises
citogenéticas revelaram polimorfismos cariotípicos entre indivíduos de seis
diferentes populações do Brasil. Foram descritos cariótipos com 2n = 22, 24, 26,
28, 32, 33, 34, 35 e 36, todos apresentando mecanismo de determinação sexual
múltiplo com cinco, seis ou oito cromossomos e dois tipos de cromossomos B, os
quais foram ausentes apenas em espécimes oriundos de uma das localidades
(Mesa & Fontanetti 1984; Moura et al. 2008; Xavier et al. 2018).
Análises filogenéticas utilizando um fragmento de 751 pb do gene da
subunidade I da Citocromo oxidase de E. gigantea revelou a ocorrência de três
linhagens no Brasil (Xavier et al. 2018). Além da incerteza taxonômica a nível
específico, existem ainda divergências sobre a posição de E. gigantea dentro das
subfamílias de Buprestidae, pois apesar de ser atualmente classificada na
subfamília Chrysochroinae (Bellamy 2003), em um estudo filogenético molecular
esta espécie formou um subclado inesperado dentro de um clado que agrupa
tanto espécies das subfamílias Chrysochroinae e Buprestinae (Evans et al. 2015).
As incertezas taxonômicas da espécie E. gigantea, além do seu alto
polimorfismo morfológico e cromossômico incitam o interesse na realização de
estudos sobre a sua diversificação e tornam esta espécie um interessante modelo
para estudos evolutivos. Neste trabalho, foi realizada a montagem do genoma
mitocondrial de E. gigantea, a fim de utilizar estas sequências em análises que
contribuam para o entendimento da diversificação da espécie e para posicionar
filogeneticamente o gênero Euchroma em relação a espécies de diferentes
gêneros da infraordem Elateriformia.
Material e métodos
Amostras
Os espécimes de Euchroma gigantea analisados neste trabalho foram
coletados em áreas urbanas do Distrito Federal e de quatro estados brasileiros
112
(Alagoas, Pará, Pernambuco e São Paulo). Estes indivíduos foram previamente

cariotipados por Xavier et al. (2018) (Tabela 1). Os espécimes foram depositados
na coleção científica do Laboratório de Biodiversidade e Genética de Insetos da
Universidade de Pernambuco, Recife, Pernambuco, Brasil.
Extração de DNA e sequenciamento de nova geração

O DNA total dos espécimes foi obtido do tecido muscular das pernas. A
extração foi realizada seguindo método fenol-clorofórmio (Sambrook & Russel
2001). As amostras foram analisadas em gel de agarose 1% para verificação da
integridade do DNA obtido.
O sequenciamento de nova geração do DNA genômico de um indivíduo
com 2n=34, X1Y1X2Y2X3Y3 oriundo da população de Recife, Pernambuco (CII8) foi
realizado em plataforma Illumina Hiseq 2000 (paired-ends e reads 2x100). Todo o
procedimento foi realizado pela empresa Macrogen, Seoul Korea.
Montagem e análise do genoma

Os reads obtidos do sequenciamento foram filtrados por qualidade usando
o software Trimmomatic (Bolger et al. 2014) e montados utilizando o pacote
MITObim (Hahn et al. 2013). Para a montagem do genoma mitocondrial de E.
gigantea duas estratégias foram realizadas: (1) utilizando como seed o
mitogenoma da espécie Melanotus sp (Coleoptera: Elateridae) (KT8769041.1) e a
outra (2) utilizando um fragmento de 150 pb do gene da subunidade II da
Citocromo oxidase identificado no mitogenoma de E. gigantea a partir da primeira
estratégia. A caracterização das sequências e a anotação do genoma foram
realizadas no web server MITOS (Bernt et al. 2013) e software UGENE
(Okonechnikov et al. 2012), respectivamente. O código genético mitocondrial de
invertebrados foi utilizado como padrão. A ordem e tamanhos dos genes nas duas
montagens foram comparados. Os reads foram mapeados utilizando o programa
Bowtie2 (Langmead & Salzberg 2012) e o mapa do mitogenoma foi gerado
utilizando o pacote de programas BRIG software (Alikhan et al. 2011).
Análise da região RNAtAsp – ATP8 por reação em cadeia da polimerase ( PCR)

Após as duas montagens, divergências relacionadas ao comprimento do
COII foram observadas. Além disso, a identificação de uma região não codificante
113
após o gene RNAtAsp e a duplicação deste gene, fizeram com que esta região
fosse estudada com maior detalhamento. Dessa forma, foram desenhados os
seguintes primers para o isolamento de um fragmento entre o gene COII e
qualquer uma das cópias do gene RNAtAsp: L2-COII F
5’TGGCAGAATAGTGCAATGGA e D-COII R
5’GGACATTTCCTCGGCTTCTT. As sequências foram amplificadas em reações
de PCR de 50 µL, contendo tampão de Taq polimerase 1x, 1,5 mM MgCl2, 0,02
mM de dNTP, 0,4 μM de cada primer e 0,1 U de Taq DNA polimerase
recombinante (Invitrogen). O programa de PCR foi realizado da seguinte forma:
uma desnaturação inicial de 5 min a 94 ºC, e 30 ciclos de 1 min a 94 ºC, 30 s a 55
ºC e 1 min 72 ºC, com uma extensão final de 5 min a 72 ºC. Os produtos
amplificados foram purificados (ExoSAP-IT - Affymetrix/USB) e sequenciados pela
Macrogen, Seoul Korea (ABI3730XL (ABI, CA, USA)).
As sequências foram analisadas no software Pregap4 do pacote STADEN
(Bonfield et al. 1995) e foram caracterizadas usando o web server MITOS (Bernt
et al. 2013) com a configuração padrão e código genético mitocondrial de
invertebrados. As sequências nucleotídicas e de aminoácidos foram alinhadas
utilizando o servidor MAFFT (https://mafft.cbrc.jp/alignment/server/).
Análise filogenética
Na análise filogenética foram utilizadas as sequências nucleotídicas e de
aminoácidos dos genomas mitocondriais completos ou parcialmente completos de
46 espécies da infraordem Elateriformia, depositadas no National Center for
Biotechnology Information (NCBI). As sequências do DNAmt de quatro espécies
de Scirtiformia disponíveis no GenBank foram utilizadas como grupo externo. O
alinhamento das sequências foi realizado no servidor MAFFT
(https://mafft.cbrc.jp/alignment/server/).
A árvore filogenética foi construída a partir de inferência Bayesiana no
programa Mr Bayes 3.2 (Ronquist et al. 2012) disponível no servidor CIPRES
(Miller et al. 2010), e de máxima verossimilhança no servidor PhyML 3.0
(http://www.atgc-montpellier.fr/phyml/). Nessas filogenias foram utilizados os
modelos de substituição GTR+I+G para sequências nucleotídicas e MtREV+I+G
para as sequências de aminoácidos. Esses modelos foram selecionados pelo
critério Akaike (AIC) implementado no JModelTest (Posada 2008) e ProtTest
114
(Abascal et al. 2005). Na análise por máxima verosimilhança foi utilizada a

estatística aLRT para avaliar o suporte de ramos. Na análise Bayesiana, quatro
MCMCs (Markov chain Monte Carlo) foram executadas com 10.000.000 gerações,
amostragem a cada 1.000 gerações e um descarte de 20% das cadeias. Nesse
último caso, o suporte de ramos foi avaliado pela probabilidade posterior das
árvores amostradas remanescentes. A árvore foi visualizada e personalizada no
Figtree v. 1.4.0 (Rambaut 2009).
Resultados
Caracterização do genoma mitocondrial de Euchroma gigantea
O DNA mitocondrial completo de E. gigantea nas duas montagens foi
similar. Na estratégia 1, o genoma apresentou 17701 pb, sendo 3032pb destes
correspondentes à região controle. Na estratégia 2, o genoma total apresentou
16294 pb, sendo 1200 pb correspondentes a região controle. Nestas duas
montagens houve diferenças quanto à região do gene COII. Na primeira
montagem este gene apresentou 150 pb mais um espaçador intergênico de 65
pb, enquanto na segunda montagem os comprimentos foram de 618 pb e 22 pb,
respectivamente. Considerando que o tamanho do gene COII com 618 pb foi
confirmado, a região codificante do mitogenoma de E. gigantea abrange 15094 pb
(Figura 1, Tabela S1) com conteúdo A+T de 65,5%. Um total de 128440 reads
foram mapeados, alcançando uma média de profundidade de sequenciamento de
722 vezes (X) e máxima cobertura de 2302 X.
O mitogenoma de E. gigantea contém 13 genes codificantes de proteínas
[Subunidades 1-6 e 4l da NADH desidrogenase (ND1-6, 4L), Subunidades I, II, e
III da citocromo oxidase (COI, COII, COIII), subunidades 6 e 8 da enzima ATP
sintase (ATP6 e ATP8) e Citocromo b (CYTB)], 22 genes de RNA transportador
(RNAt) e dois genes de RNA ribossomal (rRNA) (Figura 1 e S1). O gene da
subunidade II da citocromo oxidase apresentou divergências entre as duas
montagens realizadas. Na primeira, o seu tamanho foi de apenas 150 pb e 50
aminoácidos, e na segunda montagem o COII apresentou 618 pb, correspondente
a 206 aminoácidos (Figuras S2 e S3). Além disso, nas duas montagens, após o
gene RNAtAsp foi identificada uma região não codificante de 370 pb seguida da
duplicação do gene RNAtAsp (Figura 1), o qual apesar de ter sofrido mutações,
115
manteve seu anticódon e o potencial de formar a estrutura secundária similar

(Figura S1).
Análise da região variável do mitogenoma de E gigantea

Os fragmentos amplificados nas 15 amostras apresentaram tamanhos
entre 859 pb e 1108 pb, com média de 902 pb. Foi possível identificar em todos
os fragmentos: parte do gene RNAtL2 e os genes completos de COII, RNAtLys e
RNAtAsp. O tamanho de 618 pb para o gene COII foi confirmado para todos os
espécimes testados. Além disso, foram identificados três diferentes padrões de
organização para a região entre o gene RNAtAsp e o ATP8 (Figura 3). Estes
padrões foram identificados nas amostras CII08 de Recife-PE (Tipo I) através da
montagem do genoma, e nas amostras CII04 (Tipo II) e CII06 (tipo III) de Belém-
PA através dos fragmentos amplificados por PCR.
Na amostra CII8, o gene RNAtAsp foi duplicado dando origem a RNAtAsp2,
enquanto em CII04, a sequência duplicada do gene RNAtAsp sofreu mutações
dando origem a um gene putativo RNAtAsn2. No fragmento da amostra CII06, foi
identificado um gene putativo RNAtTyr2 (Figuras 2 e 3). Para as demais amostras
não foi possível analisar a região após o gene RNAtAsp. As sequências do gene
RNAtAsp de todas as amostras foram comparadas entre si sendo observadas
variações nucleotídicas e de tamanho (Figura 3). Além disso, a sequência do
gene RNAtAsp foi comparada com suas variantes (Figura 4), denominadas de
RNAtAsp2 e RNAtAsn2, sendo observado que as distâncias p entre essas
sequências variou de 6 a 15% (Tabela 3).
Análises filogenéticas
As árvores filogenéticas de inferência bayesiana e máxima verossimilhança
apresentaram topologias similares. Os resultados para as duas análises com as
sequências nucleotídicas estão resumidos na figura 5 e os resultados para as
análises com aminoácidos estão resumidos na figura 6. Em ambas as árvores foi
observada a monofilia de Elateriformia e o agrupamento das espécies em suas
respectivas superfamílias. As espécies representantes de todas as famílias foram
corretamente agrupadas, exceto Elateridae e Omethidae. Euchroma gigantea foi
agrupada com as espécies de Buprestoidea, apresentando estreita relação com a
espécie Chrysochroa fulgidissima (Chrysochroinae).
116
Discussão
Euchroma gigantea apresentou um mitogenoma com características
incomuns em Coleoptera e insetos em geral. O gene COII apresentou 618 pb
correspondente a 206 aminoácidos, quando o esperado para esta sequência em
insetos é entre 226-229 aminoácidos (Liu & Beckenbach 1992). Além disso, uma
região polimórfica entre os genes RNAtAsp e ATP8 foi identificada. Apesar desta
variação, o tamanho do mitogenoma de E. gigantea, bem como a estrutura
condizem com o observado para animais, especialmente representantes de
Coleoptera, nos quais a região codificante, que compreende os 37 genes
mitocondriais, é relativamente estável e possui cerca de 14700 pb (Sheffield et al.
2009; Cameron 2014).
O gene COII com 618 pb, identificado em todos os indivíduos das
diferentes populações testadas pode indicar uma sinapomorfia do gênero
Euchroma. A sequência possui uma redução de pelo menos 20 aminoácidos da
sequência proteica deste gene em relação à maioria dos insetos (Liu &
Beckenbach 1992), sendo 16 aminoácidos ausentes na região N terminal e 4, na
extremidade C terminal. No entanto, algumas características foram conservadas.
O códon iniciador ATA, foi previamente identificado como variante ao ATG em
Coleoptera e duas regiões conservadas em insetos ao nível de aminoácido foram
encontradas no COII de Euchroma. A primeira (I), que é envolvida no sistema de
transferência de elétrons, corresponde as posições 101 a 113. A segunda região
(II), entre as posições 193 a 203, inclui um sítio de ligação a cobre (Figura S3)
(Liu & Beckenbach 1992). Ademais, sítios conservados entre vertebrados,
levedura, milho e insetos incluem histidina (24, 161), ácido glutâmico (62 e 202) e
ácido aspártico (88, 139, 158 e 173) (Figura S3) (Liu & Beckenbach 1992). Estas
características conservadas indicam que, apesar de sua redução, o gene COII no
mitogenoma de E. gigantea pode não ter perdido sua função.
A sequência espaçadora entre os genes RNAtAsp e ATP8 observada no
mitogenoma de E. gigantea é uma característica incomum em Coleoptera. Em
geral, em espécies desta ordem apresentam apenas 1 pb entre estes dois genes
(Sheffield et al. 2009; Song et al. 2010; Liu et al. 2014; Timmermans et al. 2015;
Duan et al. 2017), com exceção da espécie Chryschroa fulgidissima (Buprestidae;
Chrysochroinae), que apresentou uma sequência de 37 pb entre RNAtAsp e ATP8
117
(Hong et al. 2009). No mitogenoma de E. gigantea, esta região foi mais de 10

vezes maior, sendo uma sequência variável inter e intrapopulacionalmente.
Considerando que dois tipos de organização diferentes foram identificados em
amostras de indivíduos do Norte (Belém-PA) e um terceiro tipo em uma amostra
do Nordeste (Recife-PE), a variação encontrada nesta região do mitogenoma
pode representar padrões linhagem-específicos e o potencial de variação desta
região ainda pode estar subestimado.
Chrysochroa fulgidissima e E. gigantea pertencem à subfamília
Chrisochroinae e são as únicas espécies da família Buprestidade com
mitogenomas sequenciados que possuem um espaçador intergênico entre
RNAtAsp e ATP8. Isto sugere que esta região do mitogenoma destas espécies
pode estar propensa a ocorrência e manutenção de rearranjos. Isto difere das
outras espécies de Buprestdae, nas quais apenas 1 pb separa o gene espaçador
RNAtAsp do ATP8 (Hong et al. 2009; Sheffield et al. 2009; Timmermans et al.
2015). Assim, uma investigação abrangente desta região no mitogenoma de
outras espécies de Buprestidae, especialmente da subfamília Chrysochroinae
pode fornecer indícios sobre a origem e evolução desta região espaçadora.
Considerando a análise de distância dos genes RNAtAsp, RNAtAsp2 e
RNAtAsn2, provavelmente a duplicação do gene RNAtAsp ocorreu antes na
linhagem Norte e foi dispersa para a linhagem Nordeste. Ao longo do tempo, esta
cópia sofreu mutações independentemente nas duas linhagens. Na linhagem
Nordeste a sequência deu origem ao gene RNAtAsp2, enquanto na linhagem Norte
a sequência acumulou mutações inclusive na região do anticódon, dando origem
ao gene RNAtAsn2. Dessa forma, é possível que apesar de RNAtAsp2 e RNAtAsn2
serem originados de uma mesma sequência, apresentem taxas evolutivas
distintas nas linhagens Norte e Nordeste da espécie E. gigantea. Por outro lado,
visto que aparentemente existe uma predisposição à ocorrência de rearranjos
nesta região, estas duplicações podem ter sido originadas a partir de eventos
independentes.
Alguns estudos revelaram a duplicação de genes de RNAt em insetos
(Lessinger et al. 2004; Beckenbach 2011; Cameron 2014; Amaral et al. 2016). Um
dos mecanismos que podem explicar a duplicação desses genes no mitogenoma
de E. gigantea é o modelo conhecido como tandem duplication–random loss
(TDRL). Neste modelo uma parte do genoma é duplicada através de replicação
118
slippage ou recombinação, por exemplo (Beckenbach 2011; Cameron 2014). Uma

vez duplicado, a ocorrência de mutações eventualmente torna um dos genes não
funcional e então a pressão seletiva tende a eliminar o gene não funcional para
redução do tamanho do genoma (Cameron 2014). Por outro lado, RNAtTyr2 não
apresentou similaridade significativa com a sequência regular do gene RNAtTyr e
sua origem permanece não identificada. Maiores estudos são necessários para
elucidar a origem e funcionalidade destes possíveis genes (RNAtAsp2, RNAtAsn2 e
RNAtTyr2) na transferência de seus respectivos aminoácidos.
A sequência de 370 pb identificada no mitogenoma de E. gigantea entre os
dois genes de RNAtAsp não produziu qualquer resultado significante no BLAST,
não apresentou potencial de gerar estrutura secundária de RNAt e não incluiu
ORFs em nenhuma direção, sugerindo que provavelmente esta sequência não é
codificante, nem funcional, visto que é dispensável em outras espécies. Embora
sequências espaçadoras intergênicas não codificantes tenham sido descritas em
vários mitogenomas de insetos, elas são pouco frequentes em espécies de
Coleoptera (Sheffield et al. 2009; Amaral et al. 2016). Nesta ordem as sequências
intergênicas variam de poucas unidades a centenas de pares de bases e suas
origens frequentemente permanecem desconhecidas (Hong et al. 2009; Amaral et
al. 2016).
As análises filogenéticas apresentaram o grupamento esperado entre as
superfamílias de Elateriformia (Timmermans et al. 2015), bem como a inserção de
E. gigantea na superfamília Buprestoidea (Bellamy 2008). A estreita relação de E.
gigantea com C. fulgidissima, reflete uma relação esperada entre estas espécies
visto que as duas pertencem à subfamília Chrysochroinae (Buprestidae). Estes
resultados demonstram que o mitogenoma de E. gigantea representa uma
informação útil para estabelecer a posição filogenética da espécie.
Considerando a variabilidade da região entre os genes RNAtAsp e ATP8 em
espécimes de E. gigantea, bem como o posicionamento da espécie na análise
filogenética, o mitogenoma da E. gigantea constitui uma importante ferramenta
para o estudo da espécie em diferentes níveis taxonômicos. De acordo com o
nível taxonômico que se pretende estudar, é possível adequar a utilização de
fragmentos gênicos ou do mitogenoma completo, sendo o primeiro muito útil e
acessível especialmente em estudos a nível de espécie e o segundo em níveis
superiores.
119
Conclusões
O mitogenoma de E. gigantea apresenta singularidades que podem ser
consideradas sinapomorfias no gênero, como tamanho reduzido do gene COII e a
presença de uma região não codificante entre os genes RNAtAsp e ATP8. Esta
região, que apresentou três padrões de organização, aparentemente linhagem-
específicos, pode ser útil na investigação da diversificação das linhagens
anteriormente identificadas em E. gigantea. Em um gênero considerado
monoespecífico como Euchroma que sabidamente possui distintas linhagens, a
separação de grupos geneticamente distintos pode direcionar análises de
taxonomia alfa. Ademais, o mitogenoma completo desta espécie constitui um
importante instrumento para estudos filogenéticos que visem investigar o
posicionamento de E. gigantea em diferentes níveis taxonômicos.
Referências
Abascal F, Zardoya R, Posada D. 2005. ProtTest: selection of best-fit models of

protein evolution. Bioinformatics. 21:2104–5.
Alikhan N, Petty N, Ben Zakour N, Beatson S. 2011. BLAST Ring Image
Generator (BRIG): simple prokaryote genome comparisons. BMC Genomics.
14:402.
Amaral DT, Mitani Y, Ohmiya Y, Viviani VR. 2016. Organization and comparative
analysis of the mitochondrial genomes of bioluminescent Elateroidea
(Coleoptera: Polyphaga). [place unknown]: Elsevier B.V. Beckenbach AT.
2011. Mitochondrial genome sequences of representatives of three families
of scorpionflies (Order Mecoptera) and evolution in a major duplication of
coding sequence. Genome [Internet]. 54:368–376.
Bellamy C. 2003. An illustrated summary of the higher classification of the
superfamily Buprestoidea (Coleoptera). Folia Heyrovskiana. 10:44.
Bellamy CL. 2008. A world catalogue and bibliography of the jewel beetles
(Coleoptera: Buprestoidea). Sofia-Moscow: Pensoft Publisher.
Bernt A, Donath F, Jühling F, Externbrink C, Florentz C, Fritsch C, Pütz J,
Middendorf M, Stadler P. 2013. MITOS: Improved de novo metazoan
120
mitochondrial genome annotation. Mol Phylogenet Evol. 69:313–319.

Blackwelder RE. 1944. Checklist of the coleopterous insects of Mexico, Central
America, The West Indies, and South America. Bull United States Natl
Museum. 185:189–341.
Bolger AM, Lohse M, Usadel B. 2014. Trimmomatic: A flexible trimmer for Illumina
sequence data. Bioinformatics. 30:2114–2120.
Bonfield JK, Smith KF, Staden R. 1995. A new DNA sequence assembly program.
Nucleic Acids Res. 24:4992–4999.
Boore J. 1999. Animal mitochondrial genomes. Nucleic Acids Res. 27:1767–80.
Cameron SL. 2014. Insect mitochondrial genomics: Implications for evolution and
phylogeny. Annu Rev Entomol [Internet]. 59:95–117.
Duan J, Quan G, Mittapalli O, Cusson M, Krell PJ, Doucet D. 2017. The complete
mitogenome of the Emerald Ash Borer (EAB), Agrilus planipennis (Insecta:
Coleoptera: Buprestidae). Mitochondrial DNA Part B. 2:134–135.
Evans AM, Mckenna DD, Bellamy CL, Farrell BD. 2015. Large-scale molecular
phylogeny of metallic wood-boring beetles (Coleoptera: Buprestoidea)
provides new insights into relationships and reveals multiple evolutionary
origins of the larval leaf-mining habit. Syst Entomol. 40:385–400.
Hahn C, Bachmann L, Chevreu B. 2013. Reconstructing mitochondrial genomes
directly from genomic next-generation sequencing reads—a baiting and
iterative mapping approach. Nucleic Acids Res. 41:E129.
Hong MY, Jeong HC, Kim MJ, Jeong HU, Lee SH, Kim I. 2009. Complete
mitogenome sequence of the jewel beetle, Chrysochroa fulgidissima
(Coleoptera : Buprestidae). Mitochondrial DNA. 20:46–50.
Ladoukakis ED, Zouros E. 2017. Evolution and inheritance of animal mitochondrial
DNA : rules and exceptions. J Biol Res. 24:1–7.
Langmead B, Salzberg S. 2012. Fast gapped-read alignment with Bowtie 2. Nat
Methods. 9:357–359.
Lessinger AC, Junqueira ACM, Conte FF, Azeredo Espin AML. 2004. Analysis of a
conserved duplicated tRNA gene in the mitochondrial genome of blowflies.
Gene. 339:1–6.
Liu F-F, Li Y-P, Jakovlic I, Yuan X-Q. 2017. Tandem duplication of two tRNA
genes in the mitochondrial genome of Tagiades vajuna (Lepidoptera:
Hesperiidae). Eur J Entomol. 114:407–415.
121
Liu H, Beckenbach AT. 1992. Evolution of the mitochondrial cytochrome oxidase II

gene among 10 orders of insects. Mol Phyligenetics Evol. 1:41–52.
Liu Q-N, Bian D-D, Jiang S-H, Li Z-X, Ge B-M, Xuan F-J, Yang L, Li C-F, Zhang D-
Z, Zhou C-L, Tang B-P. 2014. The complete mitochondrial genome of the red
flour beetle, Tribolium castaneum (Coleoptera: Tenebrionidae). Mitochondrial
DNA [Internet]. 27:1525–1527.
Lopez VM, Rugman-Jones PF, Coleman TW, Hoddle MS, Stouthamer R. 2014.
Population genetics of goldspotted oak borer, Agrilus auroguttatus Schaeffer
(Coleoptera: Buprestidae): investigating the origin of an invasive pest of
native oaks in California. Biol Invasions. 16:2393–2402.
Mesa A, Fontanetti CS. 1984. Multiple Sex-Chromosomes, autosomal
polymorphism and a high number of S chromosomes in Euchroma gigantea
L 1735 (Coleoptera, Buprestidae). Rev Bras Genet. 7:629–637.
Miller MA, Pfeiffer W, Schwartz T. 2010. Creating the CIPRES Science Gateway
for Inference of Large Phylogenetic Trees. In: Gatew Comput Environ Work.
[place unknown]; p. 1–8.
Moura R de C, Melo NF, Souza MJ. 2008. High levels of chromosomal
Genet Mol Biol. 31:431–437.
Nan X, Wei C, He H. 2016. The complete mitogenome of Eucryptorrhynchus
brandti (Harold) (Insecta: Coleoptera: Curculionidae). Mitochondrial DNA Part
A, DNA mapping, Seq Anal [Internet]. 27:2060–2061.
Okonechnikov K, Golosova O, Fursov M, Team U. 2012. Unipro UGENE : a unified
bioinformatics toolkit. Bioinfor. 28:1166–1167.
Posada D. 2008. jModelTest: phylogenetic model averaging. Mol Biol Evol.
25:1253–6.
Rambaut A. 2009. FigTree version 1.4.2 . Available from: http://tree.bio.ed.ac.uk
Ronquist F, Teslenko M, Van Der Mark P, Ayres DL, Darling A, Höhna S, Larget
B, Liu L, Suchard MA, Huelsenbeck JP. 2012. Mrbayes 3.2: Efficient
bayesian phylogenetic inference and model choice across a large model
space. Syst Biol. 61:539–542.
Sambrook J, Russel DW. 2001. Molecular Cloning. A Laboratory Manual. Third
Edit. Cold Spring Harbor Laboratory Press, editor. New York: Cold Spring
Harbor.
122
Shao R, Zhu X, Barker SC, Herd K. 2012. Evolution of extensively fragmented

mitochondrial genomes in the lice of humans. Genome Biol Evol. 4:1088–
1101.
Sheffield NC, Song H, Cameron SL, Whiting MF. 2009. Nonstationary evolution
and compositional heterogeneity in beetle mitochondrial phylogenomics. Syst
Biol. 58:381–394.
Smith DR, Kayal E, Yanaguhara AA, Collins AG, Pirro S, Keeling PJ. 2011. First
complete mitochondrial genome sequence from a box jellyfish reveals a
highly fragmented linear arquiteture and insights into telomere evolution.
Genome Biol Evol. 4:52–58.
Song HJ, Sheffield NC, Cameron SL, Miller KB, Whiting MF. 2010. When
phylogenetic assumptions are violated: base compositional heterogeneity
and among-site rate variation in beetle mitochondrial phylogenomics. Syst
Entomol. 35:429–448.
Song N, Yin X, Zhao X, Chen J, Yin J. 2017. Reconstruction of mitogenomes by
NGS and phylogenetic implications for leaf beetles. Mitochondrial DNA Part
A. 1394:1–10.
Tang P-A, Zhang L, Li X-P, Li F-F, Yuan M-L. 2017. The complete mitochondrial
genome of Sympiezomias velatus (Coleoptera: Curculionidae). Mitochondrial
DNA Part B [Internet]. 2:449–450.
Timmermans MJTN, Barton C, Haran J, Ahrens D, Culverwell CL, Ollikainen A,
Dodsworth S, Foster PG, Bocak L, Vogler AP. 2015. Family-level sampling of
mitochondrial genomes in Coleoptera: Compositional heterogeneity and
phylogenetics. Genome Biol Evol. 8:161–175.
Timmermans MJTN, Vogler AP. 2012. Phylogenetically informative
rearrangements in mitochondrial genomes of Coleoptera, and monophyly of
aquatic elateriform beetles (Dryopoidea ). Mol Phylogenet Evol. 63:299–304.
Wei D, Shao R, Yuan M, Dou W, Barker S, Wang J. 2012. The multipartite
mitochondrial genome of Liposcelis bostrychophila: insights into the evolution
of mitochondrial genomes in bilateral animals. PLoS One. 7:e33973.
Wolstenholme DR. 1992. Genetic novelties in mitochondrial genomes of
multicellular animals. Curr Opin Genet Dev. 2:918–925.
Wu Y, Trepanowski NF, Molongoski JJ, Reagel PF, Lingafelter SW, Nadel H,
Myers SW, Ray AM. 2017. Identification of wood-boring beetles
123
(Cerambycidae and Buprestidae) intercepted in trade- associated solid wood

packaging material using DNA barcoding and morphology. Sci Rep. 7:1–12.
Xavier C, Soares RVS, Amorim IC, Cabral-de-Mello DC, Moura RDC. 2018.
Insights into the karyotypic evolution and speciation of the beetle Euchroma
gigantea (Coleoptera: Buprestidae). Chromosom Res.:1–16.
124
Figura 1. Mapa circular do mitogenoma de Euchroma gigantea. Os genes de RNAt estão

indicados de acordo com o código de três letras para o aminoácido segundo a IUPAC.
Abreviações: ATP6, ATP8, genes das subunidades 6 e 8 da ATP sintase; Cob, gene da citocromo
oxidase b; COI, COII, COIII, genes das subunidades 1-3 da citocromo C oxidase; ND1-6, ND4L,
genes das subunidades 1-6 e 4L da NADH desidrogenase; rRNAL, rRNAS, subunidades do RNA
ribossomal. O círculo interno em azul representa a cobertura de reads para cada nucleotídeo. Azul
mais escuro marca regiões onde a profundidade de sequenciamento foi maior que 1000x. O
círculo externo indica as regiões anotadas pelo MITOS com RNAt em amarelo, genes codificantes
de proteínas em azul com exceção do COII em verde. Os genes de RNAr estão marcados em
vermelho e a região controladora em cinza.
125
Figura 2. Esquema do fragmento entre o gene RNAtL2 e ATP8. Os genes de RNAt estão indicados
de acordo com o código de três letras para o aminoácido segundo a IUPAC. Note o tamanho do
gene COII conservado (618 pb) e três tipos de organização na região após o gene RNAtAsp. No
tipo I, uma duplicação do gene RNAtAsp, está separada da sua cópia por uma região não
codificante de 370 pb; no tipo II, presença de um gene RNAtAsn2 e uma região não codificante de
171 pb; no tipo III, presença do gene RNAtTyr, no sentido inverso, que se sobrepõem em 1 pb ao
gene de RNAtAsp.
Figura 3. Predição de estruturas secundárias dos genes de RNAtAsp, RNAtTyr2 e RNAtAsn2

identificadas no mitogenoma de Euchroma. gigantea. Variações em cada sítio do RNAtAsp1 foram
indicadas próximo ao nucleotídeo correspondente. Cada amostra com mutações foi identificada
com uma cor e as que foram idênticas à sequência identificada na montagem do mitogenoma
foram mantidas em preto. Note em RNAtAsp1 e RNAtAsp1’ que a diferença em 1pb alterou o tamanho
do loop TψU.
126
Figura 4. Alinhamento entre as sequências variantes do gene RNAtAsp e do gene putativo

RNAtAsn2.
Tabela 1. Localidades de coleta dos espécimes analisados e cariótipos.2
Amostras Cariótipos Localidades Coordenadas

CII01 22, X1Y1X2Y2X3 Brasília, DF 15°46'44.7"S 47°55'20.4"W
CII02 22, X1Y1X2Y2X3Y3
CII03 26, X1Y1X2Y2X3Y3 Ribeirão Preto, SP 21º10’16.22’’ S 47º51’19.67’’ W
CII04 32, X1Y1X2Y2X3Y3 Belém, PA
CII05 32, X1Y1X2Y2X3Y3 01º28’13.55’’ S 48º26’49.98’’ W
CII08* 34, X1Y1X2Y2X3Y3 Recife, PE 08º03’060” S 34º57’200’’ W
CII10 35, X1Y1X2Y2X3 Maceió, AL 09º33’4.11’’S 35º46’6.74’’ W
CII13 35, X1Y1X2Y2X3
*Amostra utilizada para sequenciamento genômico.
Tabela 2. Distância par a par entre as sequências variantes do gene RNAtAsp e o gene RNAtAsn2.
RNAt genes
CII08_ RNAtAsp CII07_ RNAtAsp CII08_ RNAtAsp2
CII08_ RNAtAsp -
CII07_ RNAtAsp 0 -
CII08_ RNAtAsp2 0.08 0.08 -
CII04_ RNAtAsn2 0.15 0.15 0.06
127
Figura 5. Árvore filogenéticas bayesiana para as sequências de nucleotídeos dos genes codificantes de proteínas de Euchroma gigantea e outras espécies
da ordem Coleoptera. Os valores de probabilidade posterior/aLTR estão indicados próximos aos nós. A barra de escala indica o número de mutações por
sítio.
128
Figura 6. Árvore filogenética bayesiana para as sequências de aminoácidos dos genes codificantes de proteínas de Euchroma gigantea e outras espécies da
ordem Coleoptera. Os valores de probabilidade posterior/aLTR estão indicados próximos aos nós. A barra de escala indica o número de mutações por sítio.
129
Tabela S1. Resumo do mitogenoma de Euchroma gigantea.
Name Start Stop Strand Length

tRNAIle (atc) 222 284 + 63
tRNAGln (caa) 282 350 - 69
tRNAMet (atg) 350 418 + 69
NAD2 437 1405 + 969
tRNATrp (tga) 1441 1507 + 67
tRNACys (tgc) 1500 1563 - 64
tRNATyr (tac) 1565 1627 - 63
COI 1632 3140 + 1509
tRNAL2 (tta) 3160 3223 + 64
COII 3272 3421 + 150
tRNALys (aag) 3486 3555 + 70
tRNAAsp1 (gac) 3556 3621 + 66
tRNAAsp2 (gac) 3991 4053 + 63
ATP8 4082 4234 + 153
ATP6 4231 4896 + 666
COIII 4905 5690 + 786
tRNAGly (gga) 5692 5754 + 63
NAD3 5761 6102 + 342
tRNAAla (gca) 6107 6169 + 63
tRNAArg (cga) 6169 6232 + 64
tRNAAsn (aac) 6232 6295 + 64
tRNAS1(aga) 6296 6362 + 67
tRNAGlu (gaa) 6363 6427 + 65
tRNAPhe (ttc) 6426 6488 - 63
NAD5 6499 8160 - 1662
tRNAHis (cac) 8206 8268 - 63
NAD4 8288 9604 - 1317
NAD4l 9604 9855 - 252
tRNAThr (aca) 9885 9947 + 63
tRNAPro (cca) 9948 10010 - 63
NAD6 10016 10507 + 492
Cob 10519 11637 + 1119
tRNAS2 (tca) 11657 11723 + 67
NAD1 11761 12654 - 894
tRNAL1(cta) 12691 12756 - 66
rrnL 12693 14072 - 1380
tRNAVal (gta) 14037 14105 - 69
rrnS 14106 14890 - 785
130
Figura S1. Estruturas secundárias preditas para os 23 genes de tRNA do mitogenoma de

Euchroma gigantea.
131
Figura S2. Comparação da sequência de nucleotídeos do gene COII entre espécies de

Buprestoidea.
132
Figura S2. Continuação.

133
Figura S3. Comparação da sequência de aminoácidos do gene COII entre espécies de Buprestoidea. Note as regiões I e II, e os
sítios evolutivamente conservados entre vertebrados, levedura, milho e insetos: histidina (24, 161) em verde, ácido glutâmico
(62 e 202) em rosa e ácido aspártico (88, 139,158 e 173) em azul.
134
6 DISCUSSÃO GERAL
Diversidade e evolução cromossômica em Euchroma gigantea
A descrição de novos cariótipos com 2n = 22, 2n = 28 e 2n = 35 em E.
gigantea, a descoberta de variação morfológica entre cariótipos com mesmo
número diploide, bem como a variação de número e morfologia dos cromossomos
que compõem o mecanismo de determinação sexual múltiplo expandiram a visão
existente até então sobre o polimorfismo cromossômico nesta espécie. Estes
resultados representam uma variação cromossômica mais ampla do que foi
observada anteriormente por MESA; FONTANETTI (1984) e MOURA et al. (2008)
e sugerem que esta diversificação cromossômica na espécie poderia ser
resultante de especiação críptica no gênero Euchroma.
Em espécies da subordem Polyphaga, alguns rearranjos como fissões e
fusões cêntricas, translocações e perda do cromossomo Y geraram polimorfismos
cromossômicos em algumas espécies (BLACKMON; DEMUTH, 2015; DE JULIO
et al., 2010). No entanto, o polimorfismo observado em E. gigantea é mais amplo
do que o até então descrito ao nível de espécie na família Buprestidae e em
Coleoptera. Além disso, em Buprestidae, a presença de cromossomos B e
mecanismo de determinação sexual múltiplo são características incomuns e
restritas a E. gigantea (KARAGYAN; KUZNETSOVA, 2000; KARAGYAN;
KUZNETSOVA; LACHOWSKA, 2004; KARAGYAN; LACHOWSKA, 2007;
KARAGYAN; LACHOWSKA; KALASHIAN, 2012).
A análise comparativa dos diferentes cariótipos aliada à análise filogenética
de um fragmento do gene da subunidade I da citocromo oxidase (COI)
forneceram subsídios para a proposição de um modelo de diversificação

135
cromossômica para E. gigantea. Neste modelo, a partir de um cariótipo com 2n =
20, Xy, o qual é considerado plesiomórfico para Coleoptera, uma fissão
autossômica teria originado o cariótipo com 2n = 22, Xy, o qual é modal na família
Buprestidae (KARAGYAN; KUZNETSOVA, 2000; KARAGYAN et al., 2004; 2012).
A partir deste, o mecanismo de determinação sexual múltiplo com seis
cromossomos teria se originado através de eventos de translocação entre
autossomos e cromossomos sexuais. Visto que esta condição está presente em
todas as localidades amostradas e é predominante entre os espécimes
analisados, ela provavelmente representa uma condição ancestral para E.
gigantea (MESA; FONTANETTI 1984) e sua formação ocorreu antes de outras
reorganizações cromossômicas como o aumento do número diploide.
Após a origem da cadeia com seis cromossomos sexuais, a ocorrência de
eventos de translocação, fusão, bem como a perda do Y 3 provavelmente foram
responsáveis pela alteração de número de cromossomos envolvidos neste
mecanismo de determinação sexual múltiplo. Inversões pericêntricas foram
responsáveis pela alteração da morfologia dos cromossomos sexuais.
A ocorrência de translocações autossomo-autossomo, fissões, fusões e
inversões pericêntricas, bem como amplificação ou perda de heterocromatina
constitutiva possivelmente moldaram a diversificação cromossômica de E.
gigantea, dando origem à formação de multivalentes autossômicos, ao aumento
do número diploide, à formação de pares heteromórficos e alteração da
morfologia cromossômica (Fig. 6 do Cap. 1).
Cadeias meióticas como observadas em E. gigantea são também
encontradas em outros animais (GALIÁN; PROENÇA; VOGLER, 2007; RENS et
al., 2004; ROWELL, 1990; SHARP; ROWELL, 2007; SYREN; LUYKX, 1977;
136
WHITE, 1973). No entanto, polimorfismos nestas cadeias não são bem tolerados,
visto que podem alterar a correta segregação dos cromossomos e assim a
formação de gametas balanceados (GRUETZNER et al., 2006; SHARP;
ROWELL, 2007). Em E. gigantea, porém, a orientação alternada dos
cromossomos X e Y na meiose I pode ter favorecido a segregação correta e
consequente produção de gametas balanceados.
A presença de cromossomos B puntiformes em todas as localidades
amostradas, exceto em Brasília – DF, e a presença de grandes cromossomos B
exclusivamente em indivíduos de Belém – PA suportam ainda mais a extensiva
variabilidade cromossômica da espécie. Além disso, indicam que diferentes
fatores podem estar atuando na manutenção e dispersão destes cromossomos
em E. gigantea. Tais fatores podem ser mecanismos de origem, composição
desses cromossomos e a possível pressão seletiva a qual os indivíduos estão
sujeitos de acordo com diferentes condições ambientais (CAMACHO, 2005).
A origem de cromossomos B em E. gigantea pode ser diversa. Estes
cromossomos podem ser resultado de rearranjos cromossômicos como descrito
para Drosophila albomicans (ZHOU et al., 2012), bem como do cruzamento entre
indivíduos de linhagens diferentes, como foi experimentalmente testado em
Nasonia vitripennis (Hymenoptera), na qual quebras cromossômicas ocorreram
após sete sucessivas gerações de cruzamentos entre N. vitripennis e N. giraulti
(PERFECTTI; WERREN, 2001).
A presença de indivíduos com pares morfologicamente heteromórficos na
linhagem Nordeste (Recife-PE e Maceió-AL) e de cariótipos polimórfcos com 2n =
22 na linhagem Sudeste/Centro Oeste (Ribeirão Preto-SP e Brasília-DF) indicam
a possibilidade de cruzamento entre espécimes parentais com mesmo número

137
diploide, mas citogeneticamente distintos. No entanto, o decaimento de sobrevida
entre os estágios larvais de E. gigantea observado em indivíduos de Goiânia –
GO (GARCIA, 1998), que provavelmente apresentam polimorfismos como
observado na linhagem Sudeste/Centro Oeste na qual indivíduos desta localidade
foram incluídos (dados não mostrados), pode estar relacionado com a fertilização
de gametas não balanceados.
O agrupamento dos espécimes em três clados indicam a existência de pelo
menos três linhagens e sugere que a divergência cromossômica pode estar
envolvida no processo de especiação cromossômica de E. gigantea, como visto
em outras espécies de insetos (COLUZZI et al., 2002; MILLS; COOK, 2014). Além
disso, as três linhagens observadas foram formadas por indivíduos oriundos de
localidades que pertencem a distintos domínios fitogeográficos. Deste modo,
rearranjos cromossômicos podem estar correlacionados com diferenças
fenotípicas que conferem fitness variado em diferentes habitats (COGHLAN et al.,
2005).
Mapeamento de sequências repetitivas e contribuições ao entendimento dos
rearranjos cromossômicos
As sequências repetitivas mapeadas nos distintos cariótipos de E. gigantea
foram localizadas na região pericentromérica dos cromossomos e apresentaram
três padrões de distribuição para as sequências de DNAr 18S e os DNAsat Egig2
e Egig3: (I) localização restrita a um par autossômico; (II) dispersão apenas em
cromossomos autossômicos; (III) dispersão em autossomos e cromossomo X 3.

138
Para os genes de histonas e DNAsat Egig1 o padrão observado foi de dispersão
das sequências em todos os cromossomos do complemento.
A co-localização dos genes de histona H3 e H4 observada nos cariótipos
de E. gigantea foi esperada. Em Coleoptera e várias ordens de insetos estes
genes encontram-se arranjados em um quinteto que se repete em tandem
juntamente com os genes de histona H1, H2A e H2B (NAGODA et al., 2005;
ROEHRDANZ et al., 2010). No entanto, a dispersão dos genes de histonas em
todos os cromossomos dos diferentes cariótipos foi surpreendente, visto que em
Coleoptera a maioria das 15 espécies estudadas para este marcador
apresentaram apenas dois sinais em pares autossômicos (CABRAL-DE-MELLO
et al., 2011a; GOLL et al., 2015). A dispersão destes genes foi observada em
apenas três espécies da família Scarabaeidae, nas quais os genes de histonas
variaram de um a dois sítios em cromossomos sexuais ou seis sítios em
autossomos e no cromossomo X (CABRAL-DE-MELLO et al., 2011a). A dispersão
destas sequências também foi observada nos gafanhotos Rhammathocerus
brasiliensis (OLIVEIRA et al., 2011) e Abracris flavolineata (BUENO; PALACIOS-
GIMENEZ; CABRAL-DE-MELLO, 2013). Porém, nestas espécies esta
característica é variável entre diferentes indivíduos com o mesmo cariótipo
(BUENO; PALACIOS-GIMENEZ; CABRAL-DE-MELLO, 2013; OLIVEIRA et al.,
2011; PINE et al., 2017), enquanto que em E. gigantea a dispersão foi observada
em todos os indivíduos e em distintos cariótipos testados.
A presença das sequências de histonas nas regiões pericentroméricas de
todos os cromossomos contribuiu para a definição de polimorfismos morfológicos
de cromossomos autossomos. Além disso, inversões pericêntricas provavelmente
ocorreram no cromossomo Y2 do cariótipo 2n = 22, X1Y1X2Y2X3 e no cromossomo

139
X2 do cariótipo 2n = 26, X1Y1X2Y2X3Y3, originando um bloco de histonas que
ocupa a região pericentromérica/região proximal do braço curto e um segundo
bloco no braço longo dos cromossomos Y2 e X2 nos cariótipos com 2n = 22 e 2n =
26, respectivamente (Fig 3b, k Cap1).
A dispersão dos genes de histonas geralmente é atribuída a mecanismos
que mantêm sequências altamente repetitivas em regiões centroméricas, tais
como a mobilidade de elementos de transposição, recombinação ectópica ou
DNA circular extracromossômico, os quais são também propostos para explicar a
dispersão de outras classes de DNA repetitivo (BIONE; CAMPAROTO; SIMÕES,
2005; COHEN et al., 2010; FITCH; STRAUSBAUGH; BARRETT, 1990; NGUYEN
et al., 2010; RASKINA; BELYAYEV; NEVO, 2004).
A presença de Egig1 em todos os cromossomos dos cariótipos testados foi
de acordo com o mapeamento de sequências de DNAsat com monômeros curtos
em cariótipos de Coleoptera, os quais são predominantes na região
pericentromérica de cada cromossomo (ROSOLEN et al., 2016). Além disso, sua
presença e abundância em diferentes cariótipos sugere que Egig1 foi originado e
dispersou antes da diversificação cariotípica de E. gigantea, assim como os genes
de histonas.
Sequências repetitivas podem ser hotspots para quebras cromossômicas
que antecedem translocações (COGHLAN; WOLFE, 2002), fissões (ROUSSELET
et al., 2000) e inversões pericêntricas (PAÇO et al., 2015), rearranjos
cromossômicos que são frequentes na história evolutiva de E. gigantea. Por outro
lado, estes rearranjos cromossômicos podem originar novos padrões de
distribuição de sequências envolvidas em áreas rearranjadas (HIRAI et al., 1996;
PAÇO et al., 2015).

140
A dispersão dos genes de histonas, bem como a de Egig1, nos cariótipos
de E. gigantea deve ter ocorrido antes da diversificação cromossômica da
espécie, considerando que foi observada em todas as populações. Assim, a
presença de um grande número de cópias de genes de histonas e do DNAsat
Egig1 na região pericentromérica de todos os cromossomos nos cariótipos
testados pode ter promovido a ocorrência de recombinação ectópica contribuindo
para a origem de rearranjos cromossômicos (COGHLAN et al., 2005;
ROUSSELET et al., 2000), bem como para a dispersão das sequências de DNAr
(NGUYEN et al., 2010).
A conservação de dois sítios de DNAr 18S observada nos cariótipos com
2n = 22, 26, 34, 35 e 36 é comum em várias espécies de Coleoptera (ALMEIDA et
al., 2010; CABRAL-DE-MELLO et al., 2011a; GOLL et al., 2015) e tem sido
sugerida como a condição ancestral neste grupo. Em E. gigantea, os sítios de
DNAr 18S no par 4 dos indivíduos com 2n = 22 parecem ser os sítios mais
primitivos, visto que o 2n = 22, X1Y1X2Y2X3Y3 foi considerado o mais primitivo
baseado no cariótipo ancestral de Coleoptera e família Buprestidae.
Analisando os diferentes padrões de distribuição do DNAr 18S, o qual foi
coincidente com a maioria dos padrões observados para Egig2 e Egig3, foi
possível propor que a alta taxa de rearranjos cromossômicos pode atuar na
reorganização dos padrões de distribuição destas sequências. Isto ficou evidente
visto que existe variação na morfologia dos cromossomos portadores dos sítios
de DNAr 18S nos cariótipos com apenas dois clusters, ou seja, 2n = 22, 26, 34 e
36.
No entanto, a dispersão desta sequência sem alteração na morfologia
cromossômica ou aumento do número diploide foi observada em espécimes com

141
2n = 32 (Belém – PA) e 2n = 35 (Maceió – AL), indicando que os rearranjos
cromossômicos não são os únicos mecanismos envolvidos na distribuição do
DNAr 18S. Em outros insetos, tanto rearranjos cromossômicos como
recombinações ectópicas são propostos para a dispersão de sequências de DNAr
(HIRAI et al., 1996; NGUYEN et al., 2010; PITA et al., 2016). Assim, considerando
que o sítio primitivo de DNAr 18S está no par 4 de um cariótipo com 2n=22, foi
proposto que o cenário mais parcimonioso para a dispersão do DNAr envolve
rearranjos cromossômicos como inversões pericêntricas e translocações
robertsonianas, além de eventos de recombinação ectópica.
Assim como Egig1, a presença de Egig2 e Egig3 nos distintos cariótipos
das amostras analisadas sugerem que estas sequências também foram
originadas antes da diversificação cariotípica de E. gigantea. A dispersão destas
sequências em conjunto com o DNAr 18S e restrita a região pericentromérica de
poucos cromossomos é incomum em Coleoptera, visto que nesta ordem vários
DNAsat mapeados cromossomicamente são dispersos na heterocromatina
constitutiva (HC) de todos ou quase todos os cromossomos (JUAN; PONS;
PETITPIERRE, 1993; LORITE et al., 2001, 2002; MRAVINAC; PLOHL, 2010;
UGARKOVIĆ; PODNAR; PLOHL, 1996). Porém, restrição de DNAsat em
cromossomos específicos foi também observada em Tribolium castaneum
(Tenebrionidae) e pode ser indicativo de diversidade de sequências na HC da
espécie, além da possível existência de diferentes famílias de DNAsat
cromossomo-específicas (PAVLEK et al., 2015).
Apesar da idêntica distribuição de Egig2, Egig3 e DNAr 18S, similaridades
significativas entre estas sequências não foram observadas. Assim, considerando
a relação física entre estas sequências é possível que Egig2 e Egig3 estejam
142
relacionadas com o espaçador intergênico (IGS), como observado em espécies
dos gêneros Phaseolus (ALMEIDA et al., 2012), Solanum (JO et al., 2009) e Vicia
(MACAS; NAVRÁTILOVÁ; MÉSZÁROS, 2003).
Embora Egig2 e Egig3 tenham diferentes padrões de distribuição entre as
amostras de diferentes linhagens de E. gigantea, estas sequências apresentaram
alto nível de conservação dentro e entre as linhagens Norte, Nordeste e
Sudeste/Centro Oeste da espécie. Isto sugere que estas sequências sofreram
pouca diferenciação e foram conservadas ao longo do processo de especiação.
Mitogenoma de Euchroma gigantea
Inicialmente, a análise filogenética de um fragmento do COI de E. gigantea
revelou o agrupamento de espécimes citogeneticamente polimórficos em três
clados. O agrupamento coincidiu com as regiões geográficas do Brasil (Norte,
Nordeste e Sudeste/Centro Oeste) e os clados apresentaram entre si uma média
de 3% de distância genética. Resultados similares em espécies da família
Buprestidae foram suficientes para sugerir a especiação críptica ou
pseudocríptica nos gêneros Chrysochroa (HAN et al., 2012) e Chrysobothris
(HANSEN et al., 2015).
O agrupamento dos espécimes em três linhagens, bem como a distância
genética encontrada entre elas permitiu o direcionamento de estudos
morfológicos entre os espécimes analisados neste trabalho e outros oriundos de
mais seis localidades brasileiras. Neste estudo, foram identificadas três espécies
para gênero Euchroma no Brasil: Euchroma sp.1, com ocorrência na região
Nordeste, exceto Maranhão; Euchroma sp.2 ocorrrente no Maranhão, regiões

143
Sudeste e Centro-Oeste; e Euchroma sp.3 no Norte (RÓGEAN VINÍCIUS
SANTOS SOARES, 2018). Desse modo, as informações obtidas através das
análises apenas de um fragmento do mitogenoma forneceram indícios
fundamentais para a resolução do status taxonômico de E. gigantea.
Informações obtidas através da análise de apenas um fragmento do
mitogenoma impulsionaram avanços tanto no entendimento da diversificação do
gênero Euchroma, quanto no entendimento da evolução cromossômica
observada no gênero. Desse modo, a análise da estrutura do mitogenoma
completo da espécie de modo intra e interindividual apresentam potencial
informativo para entender a evolução do mitogenoma na espécie, bem como no
processo de especiação.
Apesar de o mitogenoma de E. gigantea possuir o número de genes e
estrutura geral do mitogenoma típico de insetos (BOORE, 1999; CAMERON,
2014), apresentou características incomuns tanto em Coleoptera quanto em
insetos em geral, tais como a redução do tamanho do gene COII e uma região
variável entre os genes RNAtAsp e ATP8.
O gene COII com 618 pb, identificado em todos os indivíduos das
diferentes populações testadas pode indicar uma sinapomorfia do gênero
Euchroma. A sequência possui uma redução de pelo menos 20 aminoácidos da
sequência proteica deste gene em relação a várias espécies de insetos (LIU;
BECKENBACH, 1992). Dezesseis aminoácidos estão ausentes na região N
terminal e quatro na extremidade C terminal. No entanto, algumas características
como o códon iniciador ATA e duas regiões conservadas a nível de aminoácido
entre insetos foram conservadas no COII de E. gigantea. Além disso, sítios
conservados entre levedura, milho, insetos e mamíferos (LIU; BECKENBACH,

144
1992) também foram observados, indicando que apesar de ter sofrido redução, o
gene COII em E. gigantea não deve ter perdido sua função.
A sequência entre os genes RNAtAsp e ATP8 observada no mitogenoma de
E. gigantea é uma característica incomum em Coleoptera (DUAN et al., 2017; LIU
et al., 2014; SHEFFIELD et al., 2009; SONG et al., 2010; TIMMERMANS et al.,
2015). Esta sequência foi variável intra e interpopulacionalmente, sendo
identificados três diferentes padrões de organização, dois em amostras de Belém
- PA e um em Recife – PE. Em Buprestoidea, apenas a espécie Chrysochroa
fulgidissima (Buprestidae; Chrysochroinae) apresentou uma sequência intergênica
de 37 pb entre RNAtAsp e ATP8 (HONG et al., 2009). O fato de E. gigantea
pertencer a mesma subfamília, pode indicar que neste grupo, esta região pode
estar propensa a rearranjos.
A duplicação de genes de RNAt no mitogenoma de E. gigantea pode ser
explicada pelo modelo conhecido como tandem duplication–random loss (TDRL),
no qual uma parte do genoma é duplicada através de replicação slippage ou
recombinação, e uma vez duplicado, a ocorrência de mutações eventualmente
torna um dos genes não funcional. A partir de então, a pressão seletiva tende a
eliminar o gene não funcional para redução do tamanho do genoma (CAMERON,
2014). Dessa forma, o gene RNAtAsp teria sido duplicado na linhagem Norte e
disperso para a Nordeste. Nestas linhagens, a cópia deste gene sofreu mutações
independentemente e deu origem a genes putativos RNAtAsn2 e RNAtAsp2 nas
linhagens Norte e Nodeste, respectivamente. Assim, aparentemente embora
RNAtAsp2 e RNAtAsn2 possam ser oriundos da mesma sequência, provavelmente
apresentam taxas evolutivas distintas em cada linhagem.

145
O posicionamento de E. gigantea na superfamília Buprestoidea, bem como
a sua estreita relação C. fulgidissima, refletiram o resultado esperado para a
análise filogenética do mitogenoma, visto que as duas pertencem à mesma
subfamília. Este resultado indica o potencial informativo do mitogenoma, que
constitui uma importante ferramenta para estudos que visem ampliar o
conhecimento acerca das relações filogenéticas de E. gigantea. Além de
contribuir para esclarecer o seu status taxonômico, fornecendo ainda subsídios
para o melhor entendimento da relação entre os rearranjos cromossômicos e o
processo de especiação no gênero Euchroma.

146
7 CONCLUSÕES
1. Eventos de translocações autossomo-autossomo, fissões, fusões e
inversões pericêntricas, bem como amplificação ou perda de
heterocromatina constitutiva moldaram a diversificação cromossômica da
espécie.
2. A cadeia de cromossomos sexuais, apesar de ser antiga e conservada
quanto ao número de cromossomos, continuou se diferenciando através de
translocações A-sexuais, inversões pericêntricas, perda do cromossomo Y
além de recombinação ectópica.
3. Existem pelo menos três linhagens cromossomicamente polimórficas de E.
gigantea no Brasil.
4. O acúmulo e fixação de diferentes rearranjos cromossômicos em E.
gigantea podem constituir barreira pós-zigótica entre as três linhagens da
espécie.
5. A dispersão dos sítios de histona e Egig1 ocorreu antes do processo de
diversificação cariotípica da espécie, enquanto que o DNAr 18S, Egig2 e
Egig3 provavelmente ocorreu concomitantemente ao processo.
6. Os diferentes padrões de distribuição do DNAr 18S deve-se a rearranjos
cromossômicos e recombinação ectópica. Tendo ocorrido
independentemente nas populações de Belém-PA e Maceió-AL.
7. A região entre os genes mitocondriais RNAtAsp e ATP8, a qual é variável
inter e intrapopulacionalmente, pode ser considerada uma sinapomorfia no
gênero e possivelmente apresenta padrões linhagem-específicos.

147
REFERÊNCIAS
ABBOTT, R. et al. Hybridization and speciation. Journal of Evolutionary

Biology, [s. l.], v. 26, p. 229–246, 2013.
ALMEIDA, C. et al. Contrasting evolution of a satellite DNA and its ancestral IGS
rDNA in Phaseolus (Fabaceae). Genome, [s. l.], v. 55, n. 9, p. 683–9, 2012.
ALMEIDA, M. C. et al. Physical mapping of 18S rDNA cistron in species of the

Omophoita genus (Coleoptera, Alticinae) using fluorescent in situ hybridization.
Micron Oxford England 1993, [s. l.], v. 41, n. 7, p. 729–734, 2010.
AMORIM, I. C. et al. Characterization and population mapping of the DiMarMITE

element in Dichotomius (Luederwaldtinia) sericeus species complex (Coleoptera:
Scarabaeidae). Comparative Cytogenetics, [s. l.], v. (Submitted, 2016.
ARCANJO, A. P. et al. Cytogenetic characterization of Eurysternus caribaeus

(Coleoptera: Scarabaeidae): evidence of sex-autosome fusion and diploid number
reduction prior to species dispersion. Journal of genetics, [s. l.], v. 88, n. 2, p.
177–82, 2009.
ARGUEDAS, M. Clasificación de tipos de daños producidos por insectos

forestales . Segunda parte. Kurú: Revista Forestal, [s. l.], v. 3, n. 9, p. 1–8, 2006.
BECKENBACH, A. T. Mitochondrial genome sequences of representatives of

three families of scorpionflies (Order Mecoptera) and evolution in a major
duplication of coding sequence. Genome, [s. l.], v. 54, n. 5, p. 368–376, 2011.
BELLAMY, C. An illustrated summary of the higher classification of the superfamily

Buprestoidea (Coleoptera). Folia Heyrovskiana, [s. l.], v. 10, p. 44, 2003.
BELLAMY, C. L. A world catalogue and bibliography of the jewel beetles

(Coleoptera: Buprestoidea). Sofia-Moscow: Pensoft Publisher, 2008.
BELLAMY, C. L.; VOLKOVITSH, M. G. Buprestoidea Crowson, 1955. In: BEUTEL

LESCHEN, R. A. (Ed.). Arthropoda: Insecta, Part 38, Coleoptera, Beetles,
Volume 1: Morphology and Systematics. Walter de ed. New York. v. IVp. 461–
468.
BERGSTEN, J. et al. Sympatry and colour variation disguised well-differentiated

sister species: Suphrodytes revised with integrative taxonomy including 5 kbp of
housekeeping genes (Coleoptera: Dytiscidae). DNA Barcodes, [s. l.], v. 1, p. 1–
18, 2012.
BERTI FILHO, E.; MENDES FILHO, J. M. A.; KRUGNER, T. L. Pragas e doenças

de Eucalyptus na região do Mato Grosso do Sul. Instituto de Pessquisas e
Estudos florestais Circular Técnica no106, [s. l.], p. 12, 1980.
148
BICKFORD, D. et al. Cryptic species as a window on diversity and conservation.

Trends in Ecology and Evolution, [s. l.], v. 22, n. 3, p. 148–155, 2007.
BIONE, E.; CAMPAROTO, M. L.; SIMÕES, Z. L. P. A study of the constitutive

heterochromatin and nucleolus organizer regions of Isocopris inhiata and
Diabroctis mimas ( Coleoptera : Scarabaeidae , Scarabaeinae) using C-banding,
AgNO3 staining and FISH techniques. [s. l.], v. 116, p. 111–116, 2005.
BLACKMON, H.; DEMUTH, J. P. Coleoptera Karyotype Database. The

Coleopterists Bulletin, [s. l.], v. 69, n. 1, p. 174–175, 2015.
BLACKWELDER, R. E. Checklist of the coleopterous insects of Mexico, Central

America, The West Indies, and South America. Bulletin of the United States
National Museum, [s. l.], v. 185, p. 189–341, 1944.
BOORE, J. Animal mitochondrial genomes. Nucleic Acids Research, [s. l.], v. 27,
n. 8, p. 1767–80, 1999.
BROWN, J. D.; O’NEILL, R. J. Chromosomes, conflict, and epigenetics:

chromosomal speciation revisited. Annual review of genomics and human
genetics, [s. l.], v. 11, n. April, p. 291–316, 2010.
BUENO, D.; PALACIOS-GIMENEZ, O. M.; CABRAL-DE-MELLO, D. C.

Chromosomal mapping of repetitive DNAs in the grasshopper Abracris flavolineata
reveal possible ancestry of the B chromosome and H3 histone spreading. PLoS
ONE, [s. l.], v. 8, n. 6, 2013.
CABRAL-DE-MELLO, D. C. et al. Karyotype differentiation patterns in species of

the subfamily Scarabaeinae (Scarabaeidae, Coleoptera). Micron (Oxford,
England : 1993), [s. l.], v. 39, n. 8, p. 1243–1250, 2008.
CABRAL-DE-MELLO, D. C. et al. Chromosomal organization of the 18S and 5S

rRNAs and histone H3 genes in Scarabaeinae coleopterans: insights into the
evolutionary dynamics of multigene families and heterochromatin. BMC genetics,
[s. l.], v. 12, n. 1, p. 88, 2011. a.
CABRAL-DE-MELLO, D. C. et al. Evolutionary dynamics of heterochromatin in the

genome of Dichotomius beetles based on chromosomal analysis. Genetica, [s. l.],
v. 139, n. 3, p. 315–25, 2011. b.
CABRAL-DE-MELLO, D. C.; MOURA, R. C.; MARTINS, C. Cytogenetic mapping

of rRNAs and histone H3 genes in 14 species of Dichotomius (Coleoptera,
Scarabaeidae, Scarabaeinae) beetles. Cytogenetic and genome research, [s. l.],
v. 134, n. 2, p. 127–35, 2011.
CAMACHO, J. P. M. B Chromosomes. In: Gregory TR editor. The evolution of

the genome. Elsevier, San Diego., [s. l.], p. 223–286, 2005.
CAMERON, S. L. Insect mitochondrial genomics: Implications for evolution and

phylogeny. Annual Review of Entomology, [s. l.], v. 59, n. 1, p. 95–117, 2014.
149
CASARI, S.; IDE, S. Coleoptera Linnaeus, 1758. In: RAFAEL, J. A. et al. (Ed.).
Insetos do Brasil : diversidade e taxonomia. Ribeirão Preto: Editora Holos,
2012. p. 454–535.
COGHLAN, A. et al. Chromosome evolution in eukaryotes: A multi-kingdom

perspective. Trends in Genetics, [s. l.], v. 21, n. 12, p. 673–682, 2005.
COGHLAN, A.; WOLFE, K. H. Fourfold faster rate of genome rearrangement in

nematodes than in Drosophila. Genome Research, [s. l.], v. 12, n. 6, p. 857–867,
2002.
COHEN, S. et al. Extrachromosomal circles of satellite repeats and 5S ribosomal

DNA in human cells. Mobile DNA, [s. l.], v. 1, p. 11, 2010.
COLOMBA, M. et al. Karyotype, banding and rDNA FISH in the scarab beetle
Anoplotrupes stercorosus (Coleoptera Scarabaeoidea: Geotrupidae). Description
and comparative analysis. Micron (Oxford, England : 1993), [s. l.], v. 35, n. 8, p.
717–20, 2004.
COLOMBA, M. S.; VITTURI, R.; ZUNINO, M. Chromosome analysis and rDNA

FISH in the stag beetle Dorcus parallelipipedus L . (Coleoptera : Scarabaeoidea :
Lucanidae). Hereditas, [s. l.], v. 133, p. 249–253, 2000.
COLUZZI, M. et al. A polytene chromosome analysis of the Anopheles gambiae

species complex. Science, [s. l.], v. 298, n. November, p. 1415–1418, 2002.
COSTA LIMA, A. Coleoptera. In: Insetos do Brasil. Rio de Janeiro. v. 329p. 470.
COUTINHO, L. M. O conceito de bioma. Acta Botanica Brasilica, [s. l.], v. 20, n.

1, p. 13–23, 2006.
COYNE, J. a; ORR, H. a. The evolutionary genetics of speciation. Philosophical

transactions of the Royal Society of London. Series B, Biological sciences,
[s. l.], v. 353, n. 1366, p. 287–305, 1998.
CREÃO-DUARTE, A. J. et al. Damages caused by the Nasutitermes spp.

(Isoptera: Termitiadae) in Eriotheca crenulaticalyx (Bombaceae) at the
Universidade Federal da Paraíba, João Pessoa (PB), Brazil. In: XXI
INTERNATIONAL CONGRESS OF ENTOMOLOGY 2000, Iguassu Falls, Brazil.
Anais... Iguassu Falls, Brazil: Abstract book, 2000.
CRESPI, B.; NOSIL, P. Conflictual speciation: Species formation via genomic

conflict. Trends in Ecology and Evolution, [s. l.], v. 28, n. 1, p. 48–57, 2013.
DE JULIO, M. et al. Mechanisms of karyotype differentiation in Cassidinae sensu

lato (Coleoptera , Polyphaga , Chrysomelidae) based on seven species of the
Brazilian fauna and an overview of the cytogenetic data. Micron, [s. l.], v. 41, p.
26–38, 2010.
150
DUAN, J. et al. The complete mitogenome of the Emerald Ash Borer (EAB),
Agrilus planipennis (Insecta: Coleoptera: Buprestidae). Mitochondrial DNA Part
B, [s. l.], v. 2, n. 1, p. 134–135, 2017.
EVANS, A. M. et al. Large-scale molecular phylogeny of metallic wood-boring

beetles (Coleoptera: Buprestoidea) provides new insights into relationships and
reveals multiple evolutionary origins of the larval leaf-mining habit. Systematic
Entomology, [s. l.], v. 40, n. 2, p. 385–400, 2015.
FARIA, R.; NAVARRO, A. Chromosomal speciation revisited: Rearranging theory

with pieces of evidence. Trends in Ecology and Evolution, [s. l.], v. 25, n. 11, p.
660–669, 2010.
FITCH, D. H. a.; STRAUSBAUGH, L. D.; BARRETT, V. On the origins of tandemly

repeated genes: Does histone gene copy number in Drosophila reflect
chromosomal location? Chromosoma, [s. l.], v. 99, n. 2, p. 118–124, 1990.
FONSECA, A. P. P. Da. Aspectos biológicos de Euchroma gigantea
(Linnaeus, 1758) (Coleoptera:Buprestidae) em Pachira aquatica Aubl.
(1775)(Bombacaceae). 2010. Universidade Federal de Alagoas, [s. l.], 2010.
FRYDRYCHOVÁ, R.; MAREC, F. Repeated losses of TTAGG telomere repeats in

evolution of beetles (Coleoptera). Genetica, [s. l.], v. 115, n. 2, p. 179–87, 2002.
GALIAN, J.; HUDSON, P. Cytogenetic analysis of Australian tiger beetles

(Coleoptera: Cicindelidae): chromosome number, sex-determining system and
localization of rDNA genes. Journal of Zoological Systematics and
Evolutionary Research, [s. l.], v. 37, n. 1, p. 1–6, 1999.
GALIÁN, J.; PROENÇA, S. J. R.; VOGLER, A. P. Evolutionary dynamics of

autosomal-heterosomal rearrangements in a multiple-X chromosome system of
tiger beetles (Cicindelidae). BMC evolutionary biology, [s. l.], v. 7, n. 1, p. 158,
2007.
GARCIA, A. H. Aspectos sobre a biologia de Euchroma gigantea (L., 1758)

(Coleoptera - Buprestidae) em Pachira aquatica AUBLET (Bombaceae). Anais da
Escola Agronomia e Veterinária, [s. l.], v. 28, p. 69–73, 1998.
GARCIA, A. H. Levantamento, identificação e avaliação dos danos de insetos em

árvores ornamentais na área urbana de Goiânia (GO). Pequisa Agropecuária
Tropical, [s. l.], v. 29, n. 1, p. 77–81, 1999.
GARCÍA, D. M. Á.; PÉREZ, W. Y. A.; IRIARTE, L. E. N. Registro De Euchroma

gigantea (Linnaeus, 1758) (Coleoptera: Buprestidae) para tres departamentos de
la región Caribe Colombiana. Acta Zoologica Mexicana, [s. l.], v. 30, n. 3, p.
727–730, 2014.
GOLL, L. G. et al. High-Resolution physical chromosome mapping of multigene

families in Lagria villosa (Tenebrionidae): Occurrence of interspersed ribosomal
genes in Coleoptera. Cytogenetic and Genome Research, [s. l.], v. 146, n. 1, p.
64–70, 2015.
151
GRUETZNER, F. et al. How did the platypus get its sex chromosome chain? A
comparison of meiotic multiples and sex chromosomes in plants and animals.
Chromosoma, [s. l.], v. 115, n. 2, p. 75–88, 2006.
HAJIBABAEI, M. et al. DNA barcoding: how it complements taxonomy, molecular

phylogenetics and population genetics. Trends in Genetics, [s. l.], v. Apr;23, n. 4,
p. 167–72, 2007.
HAN, T. et al. Pseudocryptic speciation of Chrysochroa fulgidissima (Coleoptera:
Buprestidae) with two new species from Korea, China and Vietnam. Zoological
Journal of the Linnean Society, [s. l.], v. 164, n. 1, p. 71–98, 2012.
HANSEN, J. A. et al. Molecular Systematics of the Chrysobothris femorata

Species Group (Coleoptera: Buprestidae). Annals of the Entomological Society
of America, [s. l.], v. 108, n. 5, p. 950–963, 2015.
HIRAI, H. et al. Genomic dispersion of 28S rDNA during karyotypic evolution in the
ant genus Myrmecia (Formicidae). Chromosoma, [s. l.], v. 105, n. 3, p. 190–196,
1996.
HONG, M. Y. et al. Complete mitogenome sequence of the jewel beetle,

Chrysochroa fulgidissima (Coleoptera : Buprestidae). Mitochondrial DNA, [s. l.],
v. 20, n. 3, p. 46–50, 2009.
INPA, I. N. de P. da A. Ciência para todos, 2013.
JO, S.-H. et al. Evolution of ribosomal DNA-derived satellite repeat in tomato

genome. BMC plant biology, [s. l.], v. 9, n. 42, p. 1–14, 2009.
JUAN, C.; PONS, J.; PETITPIERRE, E. Localization of tandemly repeated DNA

sequences in beetle chromosomes by fluorescent in situ hybridization.
Chromosome Research, [s. l.], v. 1, n. 3, p. 167–74, 1993.
KAJTOCH, Ł. et al. Evolutionary units of Coraebus elatus

(Coleoptera:Buprestidae) in central and eastern Europe – implications for origin
and conservation. Insect Conservation and Diversity (2014), [s. l.], v. 7, p. 41–
54, 2014.
KARAGYAN, G. Ag-banded karyotypes in six species of jewel-beetles (Coleoptera

, Buprestidae). Folia Biologica, [s. l.], v. 49, n. January 2001, p. 43–47, 2001.
KARAGYAN, G.; KUZNETSOVA, K. G. Chromosome numbers and sex

chromosome systems in buprestid beetles (Coleoptera, Buprestidae).
Entomological Review, [s. l.], v. 80, n. October 2016, p. 38–49, 2000.
KARAGYAN, G.; KUZNETSOVA, V. G.; LACHOWSKA, D. New cytogenetic data

on Armenian Buprestids (Coleoptera, Buprestidae) with a discussion of karyotype
variation within the family. Folia Biologica (Kraków), [s. l.], v. 52, n. 3–4, p. 151–
158, 2004.
KARAGYAN, G.; LACHOWSKA, D. Karyotypes of five species of jewel-beetles
152
and presumptive ancestral state of karyotypes of the subfamilies Polycestinae,

Chrysochroinae and Buprestinae (Insecta: Coleoptera: Buprestidae).
Comparative Cytogenetics, [s. l.], v. 1, n. 2, p. 121–127, 2007.
KARAGYAN, G.; LACHOWSKA, D.; KALASHIAN, M. Karyotype analysis of four

jewel-beetle species (Coleoptera, Buprestidae) detected by standard staining, C-
banding, agnor-banding and CMA3/DAPI staining. Comparative Cytogenetics,
[s. l.], v. 6, n. 2, p. 183–197, 2012.
KAWAKAMI, T.; BUTLIN, R. K.; COOPER, S. J. B. Chromosomal speciation

revisited: Modes of diversification in Australian morabine grasshoppers
(Vandiemenella, viatica species group). Insects, [s. l.], v. 2, n. 1, p. 49–61, 2011.
KEKKONEN, M.; HEBERT, P. D. N. DNA barcode-based delineation of putative

species: Efficient start for taxonomic workflows. Molecular Ecology Resources,
[s. l.], v. 14, n. 4, p. 706–715, 2014.
KIM, S. K.; HWANG, U. W.; KWON, O. Three different genetic lineages of the
jewel beetle Chrysochroa fulgidissima (Buprestidae; Chrysochroinae) inferred from
mitochondrial COI gene. Journal of Ecology and Environment, [s. l.], v. 37, n. 1,
p. 35–39, 2014.
KOBAYASHI, N. et al. Two cryptic species of the phytophagous ladybird beetle

Epilachna vigintioctopunctata (Coleoptera: Coccinellidae) detected by analyses of
mitochondrial DNA and karyotypes, and crossing experiments. Zoological
science, [s. l.], v. 17, n. 8, p. 1159–1166, 2000.
LADOUKAKIS, E. D.; ZOUROS, E. Evolution and inheritance of animal

mitochondrial DNA : rules and exceptions. Journal of Biological Research-
Thessalonik, [s. l.], v. 24, n. 2, p. 1–7, 2017.
LANDE, R. The fixation of chromosomal rearrangements in a subdivided

population with local extinction and colonization. Heredity, [s. l.], v. 54, n. October
1984, p. 323–332, 1985.
LIMA, R.; SOUZA, T. D. S.; LHANO, M. G. Catálogo de espécies de Coleoptera

depositados no museu de zoologia da Universidade Federal do Reconcavo da
Bahia, Cruz das Almas, Brasil. In: (G. Pereira, R. Maneyro, Eds.)III CONGRESO
URUGUAYO DE ENTOMOLOGIA 2014, Montevideo - Uruguay. Anais...
Montevideo - Uruguay
LIU, F.-F. et al. Tandem duplication of two tRNA genes in the mitochondrial
genome of Tagiades vajuna (Lepidoptera: Hesperiidae). European Journal of
Entomology, [s. l.], v. 114, p. 407–415, 2017.
LIU, H.; BECKENBACH, A. T. Evolution of the mitochondrial cytochrome oxidase

II gene among 10 orders of insects. Molecular Phyligenetics and Evolution, [s.
l.], v. 1, n. 1, p. 41–52, 1992.
LIU, Q.-N. et al. The complete mitochondrial genome of the red flour beetle,
153
Tribolium castaneum (Coleoptera: Tenebrionidae). Mitochondrial DNA, [s. l.], v.

27, n. 2, p. 1525–1527, 2014.
LIVINGSTONE, K.; RIESEBERG, L. H. Chromosomal evolution and speciation: a

recombination-based approach. New Phytologist, [s. l.], v. 161, n. 1, p. 107–112,
2004.
LOPES, C. M. et al. The role of chromosomal rearrangements and geographical

barriers in the divergence of lineages in a South American subterranean rodent
(Rodentia: Ctenomyidae: Ctenomys minutus). Heredity, [s. l.], v. 111, n. 4, p. 293–
305, 2013.
LOPEZ, V. M. et al. Population genetics of goldspotted oak borer, Agrilus

auroguttatus Schaeffer (Coleoptera: Buprestidae): investigating the origin of an
invasive pest of native oaks in California. Biological Invasions, [s. l.], v. 16, p.
2393–2402, 2014.
LORITE, P. et al. Characterization and chromosome location of satellite DNA in

the leaf beetle Chrysolina americana (Coleoptera , Chrysomelidae). Genetics, [s.
l.], v. 110, p. 143–150, 2001.
LORITE, P. et al. Satellite DNA in the elm leaf beetle, Xanthogaleruca luteola
(Coleoptera, Chrysomelidae): characterization, interpopulation analysis, and
chromosome location. Cytogenetic and Genome Research, [s. l.], v. 98, n. 4, p.
302–307, 2002.
LORITE, P.; TORRES, M. I.; PALOMEQUE, T. Characterization of two unrelated

satellite DNA families in the Colorado potato beetle Leptinotarsa decemlineata
(Coleoptera, Chrysomelidae). Bulletin of Entomological Research, [s. l.], v. 103,
n. 05, p. 538–546, 2013.
MACAS, J.; NAVRÁTILOVÁ, A.; MÉSZÁROS, T. Sequence subfamilies of satellite

repeats related to rDNA intergenic spacer are differentially amplified on Vicia
sativa chromosomes. Chromosoma, [s. l.], v. 112, n. 3, p. 152–158, 2003.
MAGRO, A. et al. Phylogeny of ladybirds (Coleoptera: Coccinellidae): are the

subfamilies monophyletic? Molecular phylogenetics and evolution, [s. l.], v. 54,
p. 833–48, 2010.
MECKE, R. Insects of Brazilian pine. Tubingen, Germany: Attempto Service,

2002.
MENDES-NETO, E. de O. et al. Cytogenetic analysis of Astylus antis (Perty, 1830)

(Coleoptera, Melyridae): Karyotype, heterochromatin and location of ribosomal
genes. Genetics and molecular biology, [s. l.], v. 33, n. 2, p. 237–43, 2010.
MESA, A.; FONTANETTI, C. S. Multiple Sex-Chromosomes, autosomal

polymorphism and a high number of S chromosomes in Euchroma gigantea
L 1735 (Coleoptera, Buprestidae), 1984.
154
MILLS, P. J.; COOK, L. G. Rapid chromosomal evolution in a morphologically

cryptic radiation. Molecular Phylogenetics and Evolution, [s. l.], v. 77, p. 126–
135, 2014.
MONNÉ, M.; MONNÉ, M.; SOUZA, D. Buprestidae. 2018. Disponível em:

<http://fauna.jbrj.gov.br/fauna/faunadobrasil/141186>. Acesso em: 10 mar. 2018.
MORA, P. et al. Molecular cytogenetic studies in the ladybird beetle

Henosepilachnaargus Geoffroy, 1762 (Coleoptera, Coccinellidae, Epilachninae).
Comp Cytogenet, [s. l.], v. 9, n. 3, p. 423–434, 2015.
MORENO, G. Besouro força derrubada de árvores na quadra 216 da Asa

Norte. 2010. Disponível em:
<http://correiobraziliense.com.br/app/noticia/cidades/2010/10/23/interna_cidadesdf
,219553/index.shtml>. Acesso em: 9 ago. 2015.
MOURA, R. de C.; MELO, N. F.; SOUZA, M. J. High levels of chromosomal

differentiation in Euchroma gigantea L. 1735 (Coleoptera, Buprestidae). Genetics
and Molecular Biology, [s. l.], v. 31, n. 2, p. 431–437, 2008.
MRAVINAC, B. et al. TCAGG, an alternative telomeric sequence in insects.

Chromosoma, [s. l.], v. 120, n. 4, p. 367–76, 2011.
MRAVINAC, B.; PLOHL, M. Parallelism in evolution of highly repetitive DNAs in

sibling species. Molecular biology and evolution, [s. l.], v. 27, n. 8, p. 1857–67,
2010.
NAGODA, N. et al. Molecular characterization and evolution of the repeating units

of histone genes in Drosophila americana: Coexistence of quartet and quintet units
in a genome. Insect Molecular Biology, [s. l.], v. 14, n. 6, p. 713–717, 2005.
NAN, X.; WEI, C.; HE, H. The complete mitogenome of Eucryptorrhynchus brandti
(Harold) (Insecta: Coleoptera: Curculionidae). Mitochondrial DNA. Part A, DNA
mapping, sequencing, and analysis, [s. l.], v. 27, n. 3, p. 2060–2061, 2016.
NGUYEN, P. et al. Evolutionary dynamics of rDNA clusters on chromosomes of

moths and butterflies (Lepidoptera). Genetica, [s. l.], v. 138, n. 3, p. 343–354,
2010.
NOOR, M. A. et al. Chromosomal inversions and the reproductive isolation of

species. Proceedings of the National Academy of Sciences of the United
States of America, [s. l.], v. 98, n. 21, p. 12084–12088, 2001.
OLIVEIRA, N. L. et al. Chromosomal mapping of rDNAs and H3 histone

sequences in the grasshopper Rhammatocerus brasiliensis (acrididae,
gomphocerinae): extensive chromosomal dispersion and co-localization of 5S
rDNA/H3 histone clusters in the A complement and B chromosome. Molecular
cytogenetics, [s. l.], v. 4, n. 1, p. 24, 2011.
OLIVEIRA, S. G. et al. Cytogenetic analysis of two Coprophanaeus species

155
(Scarabaeidae) revealing wide constitutive heterochromatin variability and the

largest number of 45S rDNA sites among Coleoptera. Micron (Oxford, England :
1993), [s. l.], v. 41, n. 8, p. 960–5, 2010.
OLIVEIRA, S. G. et al. Heterochromatin, sex chromosomes and rRNA gene

clusters in Coprophanaeus beetles (Coleoptera, Scarabaeidae). Cytogenetic and
Genome Research, [s. l.], v. 138, n. 1, p. 46–55, 2012.
OLIVEIRA, S. G.; MOURA, R. C.; MARTINS, C. B chromosome in the beetle

Coprophanaeus cyanescens (Scarabaeidae): emphasis in the organization of
repetitive DNA sequences. BMC genetics, [s. l.], v. 13, p. 96, 2012.
PAÇO, A. et al. The puzzling character of repetitive DNA in Phodopus genomes

(Cricetidae, Rodentia). Chromosome Research, [s. l.], v. 23, n. 3, p. 427–440,
2015.
PAVLEK, M. et al. Genome-wide analysis of tandem repeats in Tribolium

castaneum genome reveals abundant and highly dynamic tandem repeat families
with satellite DNA features in euchromatic chromosomal arms. DNA Research, [s.
l.], v. 22, n. 6, p. 387–401, 2015.
PENTINSAARI, M.; MUTANEN, M.; KAILA, L. Cryptic diversity and signs of

mitochondrial introgression in the Agrilus viridis species complex (Coleoptera:
Buprestidae). European Journal of Entomology, [s. l.], v. 111, n. 4, p. 475–486,
2014.
PEREIRA, M. L. L. et al. Inventário preliminar dos besouros (Insecta: Coleoptera)

que ocorrem no Cariri. In: I ENCONTRO UNIVERSITÁRIO DA UNIVERSIDADE
FEDERAL DO CARIRI 2013, Juazeiro do Norte - Ceará. Anais... Juazeiro do
Norte - Ceará
PERFECTTI, F.; WERREN, J. H. The interspecific origin of B chromosomes:

Experimental evidence. Evolution, [s. l.], v. 55, n. 5, p. 1069–1073, 2001.
PETITPIERRE, E. Cytogenetics, cytotaxonomy and chromosomal evolution of

Chrysomelinae revisited (Coleoptera, Chrysomelidae). ZooKeys, [s. l.], v. 79, n.
157, p. 67–79, 2011.
PFEILER, E. et al. Phylogenetic relationships of Sonoran Desert cactus beetles in

the tribe Hololeptini (Coleoptera: Histeridae: Histerinae), with comments on the
taxonomic status of Iliotona beyeri. Molecular phylogenetics and evolution, [s.
l.], v. 56, n. 1, p. 474–9, 2010.
PFENNINGER, M.; SCHWENK, K. Cryptic animal species are homogeneously

distributed among taxa and biogeographical regions. BMC evolutionary biology,
[s. l.], v. 7, p. 121, 2007.
PINE, M. B. et al. Chromosome mapping in Abracris flavolineata (De geer, 1773)

(Orthoptera) from the Iguaçu National Park - Foz do Iguaçu, Paraná, Brazil.
Comparative Cytogenetics, [s. l.], v. 11, n. 2, p. 203–212, 2017.
156
PITA, S. et al. New arrangements on several species subcomplexes of Triatoma

genus based on the chromosomal position of ribosomal genes (Hemiptera -
Triatominae). Infection, Genetics and Evolution, [s. l.], v. 43, n. September, p.
225–231, 2016.
RASKINA, O.; BELYAYEV, A.; NEVO, E. Activity of the En/Spm-like transposons

in meiosis as a base for chromosome repatterning in a small, isolated, peripheral
population of Aegilops speltoides Tausch. Chromosome Research, [s. l.], v. 12,
n. 2, p. 153–161, 2004.
RAUPACH, M. J.; HANNIG, K.; WÄGELE, J.-W. Identification of Central European

ground beetles of the genus Bembidion (Coleoptera: Carabidae) using DNA
barcodes: A case study of selected species. Angewandte Carabidologie, [s. l.],
v. 9, n. October 2015, p. 63–72, 2011.
RENS, W. et al. Resolution and evolution of the duck-billed platypus karyotype

with an X1Y1X2Y2X3Y3X4Y4X5Y5 male sex chromosome constitution. Proceedings
of the National Academy of Sciences of the United States of America, [s. l.],
v. 101, n. 46, p. 16257–16261, 2004.
RIESEBERG, L. H. Chromosomal Rearrangements and Speciation in Animals.

Trends in Ecology and Evolution, [s. l.], v. 16, n. 7, p. 351–358, 2001.
RODRIGUES-NETTO, S. M.; CAMPOS, T. B. De; IDE, S. Euchroma gigantea

(Linnaeus) (Coleoptera, Buprestidae) como causa da queda de Chorisia speciosa
St . Hil . (Bombacaceae). Arq. Inst. Biol., São Paulo, [s. l.], v. 70, n. 3, p. 381–
384, 2003.
ROEHRDANZ, R. et al. Histone and ribosomal RNA repetitive gene clusters of the
boll weevil are linked in a tandem array. Insect Molecular Biology, [s. l.], v. 19, n.
4, p. 463–471, 2010.
RÓGEAN VINÍCIUS SANTOS SOARES. Estudo taxonômico na espécie

Euchroma gigantea (Linnaeus, 1758) (Coleoptera: Buprestidae) utilizando
análise morfológica e DNA barcode. 2018. Universidade de Pernambuco, [s. l.],
2018.
ROSOLEN, L. et al. Molecular mapping of microsatellites and Retrotransposons:

Evidence of evolutionary mechanisms involved in the differentiation of giant sex
chromosomes in Omophoita (Coleoptera: Alticinae). Cytogenetic and Genome
Research, [s. l.], v. 148, p. 83–155 (100), 2016.
ROUSSELET, J. et al. Chromosome fission associated with growth of ribosomal

DNA in Neodiprion abietis (Hymenoptera: Diprionidae). Proceedings. Biological
sciences / The Royal Society, [s. l.], v. 267, n. 1455, p. 1819–23, 2000.
ROWELL, D. M. Fixed fusion heterozygosity in Delena cancerides Walck.

(Araneae: Sparassidae): an alternative to speciation by monobrachial fusion.
Genetica, [s. l.], v. 80, n. 2, p. 139–157, 1990.
157
ROZEK, M. et al. C-bands on chromosomes of 32 beetle species (Coleoptera:

Elateridae, Cantharidae, Oedemeridae, Cerambycidae, Anthicidae,
Chrysomelidae, Attelabidae and Curculionidae). Hereditas, [s. l.], v. 140, n. 3, p.
161–170, 2004.
SAHARA, K.; MAREC, F.; TRAUT, W. TTAGG telomeric repeats in chromosomes

of some insects and other arthropods. Chromosome research, [s. l.], v. 7, n. 6, p.
449–460, 1999.
SÁNCHEZ-GEA, J. F.; SERRANO, J.; GALIÁN, J. Variability in rDNA loci in

Iberian species of the genus Zabrus (Coleoptera: Carabidae) detected by
fluorescence in situ hybridization. Genome, [s. l.], v. 43, n. 1, p. 22–28, 2000.
SHARP, D. XVI. On the species of the genus Euchroma. Transactions of the

Royal Entomological Society of London, [s. l.], v. 29, n. 3, p. 289–295, 1881.
SHARP, H. E.; ROWELL, D. M. Unprecedented chromosomal diversity and

behaviour modify linkage patterns and speciation potential: Structural
heterozygosity in an Australian spider. Journal of Evolutionary Biology, [s. l.], v.
20, n. 6, p. 2427–2439, 2007.
SHEFFIELD, N. C. et al. Nonstationary evolution and compositional heterogeneity

in beetle mitochondrial phylogenomics. Systematic Biology, [s. l.], v. 58, n. 4, p.
381–394, 2009.
SONG, H. J. et al. When phylogenetic assumptions are violated: base

compositional heterogeneity and among-site rate variation in beetle mitochondrial
phylogenomics. Syst Entomol, [s. l.], v. 35, p. 429–448, 2010.
SYREN, R. M.; LUYKX, P. Permanent segmental interchange complex in the

termite Incisitermes schwarzi. Nature, [s. l.], v. 266, p. 167–168, 1977.
TANG, P.-A. et al. The complete mitochondrial genome of Sympiezomias velatus

(Coleoptera: Curculionidae). Mitochondrial DNA Part B, [s. l.], v. 2, n. 2, p. 449–
450, 2017.
TIMMERMANS, M. J. T. N. et al. Family-level sampling of mitochondrial genomes

in Coleoptera: Compositional heterogeneity and phylogenetics. Genome biology
and evolution, [s. l.], v. 8, n. 1, p. 161–175, 2015.
TIMMERMANS, M. J. T. N.; VOGLER, A. P. Phylogenetically informative

rearrangements in mitochondrial genomes of Coleoptera, and monophyly of
aquatic elateriform beetles (Dryopoidea ). Molecular Phylogenetics and
Evolution, [s. l.], v. 63, n. 2, p. 299–304, 2012.
UGARKOVIĆ, D.; DURAJLIJA, S.; PLOHL, M. Evolution of Tribolium madens

(Insecta , Coleoptera) satellite DNA through DNA inversion and insertion. Journal
of Molecular Evolution, [s. l.], v. 42, p. 350–358, 1996.
158
UGARKOVIĆ, D.; PODNAR, M.; PLOHL, M. Satellite DNA of the red flour beetle
Tribolium castaneum-comparative study of satellites from the genus Tribolium.
Molecular biology and evolution, [s. l.], v. 13, n. 8, p. 1059–66, 1996.
VICHIATO, M. R. M. et al. Ocorrência de Euchroma gigantea (Coleoptera :

Buprestidae) em Belo Horizonte , Minas Gerais. Tecnologia & Ciência
Agropecurária, [s. l.], v. 8, p. 7–11, 2014.
VOLKOVITSH, M. ark G. The comparative morphology of antennal structures in

Buprestidae (Coleoptera): evolutionary trends, taxonomic and phylogenetic
implications. Part 1. Acta Musei Moraviae, Scientiae Biologicae, [s. l.], v. 86, p.
43–169, 2001.
WHITE, M. J. D. Models of Speciation. Science, [s. l.], v. 159, n. 3819, p. 1065–

1070, 1968.
WHITE, M. J. D. Animal cytology and evolution. London: Cambridge University

Press, 1973.
WU, Y. et al. Identification of wood-boring beetles (Cerambycidae and

Buprestidae) intercepted in trade- associated solid wood packaging material using
DNA barcoding and morphology. Scientific Reports, [s. l.], v. 7, n. January, p. 1–
12, 2017.
XAVIER, C.; CABRAL-DE-MELLO, D. C.; MOURA, R. de C. Heterochromatin and

molecular characterization of DsmarMITE transposable element in the beetle
Dichotomius schiffleri (Coleoptera: Scarabaeidae). Genetica, [s. l.], v. 142, n. 6, p.
575–581, 2014.
ZHOU, Q. et al. Deciphering neo-sex and B chromosome evolution by the draft

genome of Drosophila albomicans. BMC Genomics, [s. l.], v. 13, n. 1, p. 109,
2012.
159
ANEXO A – NORMAS PARA PUBLICAÇÃO
Instructions for Authors

Molecular Genetics and Genomics
ISSN: 1617-4615 (print version)
ISSN: 1617-4623 (electronic version)
Manuscript Submission
Submission of a manuscript implies: that the work described has not been
published before; that it is not under consideration for publication anywhere else;
that its publication has been approved by all co-authors, if any, as well as by the
responsible authorities – tacitly or explicitly – at the institute where the work has
been carried out. The publisher will not be held legally responsible should there be
any claims for compensation.
Permissions
Authors wishing to include figures, tables, or text passages that have already been
published elsewhere are required to obtain permission from the copyright owner(s)
for both the print and online format and to include evidence that such permission
has been granted when submitting their papers. Any material received without
such evidence will be assumed to originate from the authors.
Online Submission
Please follow the hyperlink “Submit online” on the right and upload all of your
manuscript files following the instructions given on the screen.
Title Page
The title page should include:
 The name(s) of the author(s)
 A concise and informative title
 The affiliation(s) and address(es) of the author(s)
 The e-mail address, telephone and fax numbers of the corresponding
author
Abstract
160
Please provide an abstract of 150 to 250 words. The abstract should not contain
any undefined abbreviations or unspecified references.
Keywords
Please provide 4 to 6 keywords which can be used for indexing purposes.
English Language Support

For editors and reviewers to accurately assess the work presented in your
manuscript you need to ensure the English language is of sufficient quality to be
understood. If you need help with writing in English you should consider:
Asking a colleague who is a native English speaker to review your manuscript
for clarity.
Visiting the English language tutorial which covers the common mistakes when
writing in English.
Using a professional language editing service where editors will improve the
English to ensure that your meaning is clear and identify problems that require
your review. Two such services are provided by our affiliates Nature Research
Editing Service and American Journal Experts.
 English language tutorial
 Nature Research Editing Service
 American Journal Experts
Please note that the use of a language editing service is not a requirement for
publication in this journal and does not imply or guarantee that the article will be
selected for peer review or accepted.
If your manuscript is accepted it will be checked by our copyeditors for spelling
and formal style before publication.
Text
Text Formatting
Manuscripts should be submitted in Word.
 Use a normal, plain font (e.g., 10-point Times Roman) for text.
 Use italics for emphasis.
 Use the automatic page numbering function to number the pages.
 Do not use field functions.
161
 Use tab stops or other commands for indents, not the space bar.
 Use the table function, not spreadsheets, to make tables.
 Use the equation editor or MathType for equations.
 Save your file in docx format (Word 2007 or higher) or doc format (older
Word versions).
Headings
Please use no more than three levels of displayed headings.
Abbreviations
Abbreviations should be defined at first mention and used consistently thereafter.
Footnotes
Footnotes can be used to give additional information, which may include the
citation of a reference included in the reference list. They should not consist solely
of a reference citation, and they should never include the bibliographic details of a
reference. They should also not contain any figures or tables.
Footnotes to the text are numbered consecutively; those to tables should be
indicated by superscript lower-case letters (or asterisks for significance values and
other statistical data). Footnotes to the title or the authors of the article are not
given reference symbols.
Always use footnotes instead of endnotes.
Acknowledgments
Acknowledgments of people, grants, funds, etc. should be placed in a separate
section on the title page. The names of funding organizations should be written in
full.
Scientific style
 Please always use internationally accepted signs and symbols for units (SI
units).
 Genus and species names should be in italics.
 Generic names of drugs and pesticides are preferred; if trade names are
used, the generic name should be given at first mention
References
Citation
Cite references in the text by name and year in parentheses. Some examples:
162
Negotiation research spans many disciplines (Thompson 1990).

This result was later contradicted by Becker and Seligman (1996).
This effect has been widely studied (Abbott 1991; Barakat et al. 1995a, b; Kelso
and Smith 1998; Medvec et al. 1999, 2000).
Reference list
The list of references should only include works that are cited in the text and that
have been published or accepted for publication. Personal communications and
unpublished works should only be mentioned in the text. Do not use footnotes or
endnotes as a substitute for a reference list.
Reference list entries should be alphabetized by the last names of the first author
of each work. Order multi-author publications of the same first author
alphabetically with respect to second, third, etc. author. Publications of exactly the
same author(s) must be ordered chronologically.
Journal article
Gamelin FX, Baquet G, Berthoin S, Thevenet D, Nourry C, Nottin S, Bosquet L
(2009) Effect of high intensity intermittent training on heart rate variability in
prepubescent children. Eur J Appl Physiol 105:731-738. doi: 10.1007/s00421-008-
0955-8
Ideally, the names of all authors should be provided, but the usage of “et al” in
long author lists will also be accepted:
Smith J, Jones M Jr, Houghton L et al (1999) Future of health insurance. N Engl
J Med 965:325–329
Article by DOI
Slifka MK, Whitton JL (2000) Clinical implications of dysregulated cytokine
production. J Mol Med. doi:10.1007/s001090000086
Book
South J, Blass B (2001) The future of modern genomics. Blackwell, London
Book chapter
Brown B, Aaron M (2001) The politics of nature. In: Smith J (ed) The rise of
modern genomics, 3rd edn. Wiley, New York, pp 230-257
Online document
Cartwright J (2007) Big stars have weather too. IOP Publishing PhysicsWeb.
http://physicsweb.org/articles/news/11/6/16/1. Accessed 26 June 2007
Dissertation
163
Trent JW (1975) Experimental acute renal failure. Dissertation, University of

California
Always use the standard abbreviation of a journal’s name according to the ISSN
List of Title Word Abbreviations, see
ISSN LTWA
If you are unsure, please use the full journal title.
For authors using EndNote, Springer provides an output style that supports the
formatting of in-text citations and reference list.
EndNote style (zip, 2 kB)
Tables
 each table, please supply a table caption (title) explaining the components
of the table.
 Identify any previously published material by giving the original source in
the form of a reference at the end of the table caption.
 Footnotes to tables should be indicated by superscript lower-case letters (or
asterisks for significance values and other statistical data) and included
beneath the table body.
Artwork
For the best quality final product, it is highly recommended that you submit all of
your artwork – photographs, line drawings, etc. – in an electronic format. Your art
will then be produced to the highest standards with the greatest accuracy to detail.
The published work will directly reflect the quality of the artwork provided.
Electronic Figure Submission
 Supply all figures electronically.
 Indicate what graphics program was used to create the artwork.
 For vector graphics, the preferred format is EPS; for halftones, please use
TIFF format. MS Office files are also acceptable.
 Vector graphics containing fonts must have the fonts embedded in the files.
 Name your figure files with "Fig" and the figure number, e.g., Fig1.eps.
Line Art
 Definition: Black and white graphic with no shading.

 Do not use faint lines and/or lettering and check that all lines and lettering
within the figures are legible at final size.
164
 All lines should be at least 0.1 mm (0.3 pt) wide.

 Scanned line drawings and line drawings in bitmap format should have a
minimum resolution of 1200 dpi.
 Vector graphics containing fonts must have the fonts embedded in the files.
Halftone Art
 Definition: Photographs, drawings, or paintings with fine shading, etc.

 If any magnification is used in the photographs, indicate this by using scale
bars within the figures themselves.
 Halftones should have a minimum resolution of 300 dpi.
Combination Art
 Definition: a combination of halftone and line art, e.g., halftones containing

line drawing, extensive lettering, color diagrams, etc.
 Combination artwork should have a minimum resolution of 600 dpi.
Color Art
 Color art is free of charge for print and online publication.
 Color illustrations should be submitted as RGB.
Figure Lettering
 To add lettering, it is best to use Helvetica or Arial (sans serif fonts).
 Keep lettering consistently sized throughout your final-sized artwork, usually
about 2–3 mm (8–12 pt).
 Variance of type size within an illustration should be minimal, e.g., do not
use 8-pt type on an axis and 20-pt type for the axis label.
 Avoid effects such as shading, outline letters, etc.
 Do not include titles or captions within your illustrations.
Figure Numbering
 All figures are to be numbered using Arabic numerals.
 Figures should always be cited in text in consecutive numerical order.
 Figure parts should be denoted by lowercase letters (a, b, c, etc.).
 If an appendix appears in your article and it contains one or more figures,
continue the consecutive numbering of the main text. Do not number the
appendix figures, "A1, A2, A3, etc." Figures in online appendices (Electronic
Supplementary Material) should, however, be numbered separately.
165
Figure Captions
 Each figure should have a concise caption describing accurately what the
figure depicts. Include the captions in the text file of the manuscript, not in
the figure file.
 Figure captions begin with the term Fig. in bold type, followed by the figure
number, also in bold type.
 No punctuation is to be included after the number, nor is any punctuation to
be placed at the end of the caption.
 Identify all elements found in the figure in the figure caption; and use boxes,
circles, etc., as coordinate points in graphs.
 Identify previously published material by giving the original source in the
form of a reference citation at the end of the figure caption.
Figure Placement and Size
 When preparing your figures, size figures to fit in the column width.
 For most journals the figures should be 39 mm, 84 mm, 129 mm, or 174
mm wide and not higher than 234 mm.
 For books and book-sized journals, the figures should be 80 mm or 122 mm
wide and not higher than 198 mm.
Permissions
If you include figures that have already been published elsewhere, you must
obtain permission from the copyright owner(s) for both the print and online format.
Please be aware that some publishers do not grant electronic rights for free and
that Springer will not be able to refund any costs that may have occurred to
receive these permissions. In such cases, material from other sources should be
used.
Accessibility
In order to give people of all abilities and disabilities access to the content of your
figures, please make sure that
 All figures have descriptive captions (blind users could then use a text-to-
speech software or a text-to-Braille hardware)
 Patterns are used instead of or in addition to colors for conveying
information (color-blind users would then be able to distinguish the visual
elements)
 Any figure lettering has a contrast ratio of at least 4.5:1
166
Electronic Supplementary Material

Springer accepts electronic multimedia files (animations, movies, audio, etc.) and
other supplementary files to be published online along with an article or a book
chapter. This feature can add dimension to the author's article, as certain
information cannot be printed or is more convenient in electronic form.
Before submitting research datasets as electronic supplementary material, authors
should read the journal’s Research data policy. We encourage research data to be
archived in data repositories wherever possible.
Submission
 Supply all supplementary material in standard file formats.
 Please include in each file the following information: article title, journal
name, author names; affiliation and e-mail address of the corresponding
author.
 To accommodate user downloads, please keep in mind that larger-sized
files may require very long download times and that some users may
experience other problems during downloading.
Audio, Video, and Animations
 Aspect ratio: 16:9 or 4:3
 Maximum file size: 25 GB
 Minimum video duration: 1 sec
 Supported file formats: avi, wmv, mp4, mov, m2p, mp2, mpg, mpeg, flv,
mxf, mts, m4v, 3gp
Text and Presentations
 Submit your material in PDF format; .doc or .ppt files are not suitable for
long-term viability.
 A collection of figures may also be combined in a PDF file.
Spreadsheets
 Spreadsheets should be converted to PDF if no interaction with the data is
intended.
 If the readers should be encouraged to make their own calculations,
spreadsheets should be submitted as .xls files (MS Excel).
 Specialized Formats
167
 Specialized format such as .pdb (chemical), .wrl (VRML), .nb (Mathematica

notebook), and .tex can also be supplied.
Collecting Multiple Files
It is possible to collect multiple files in a .zip or .gz file.
Numbering
 If supplying any supplementary material, the text must make specific
mention of the material as a citation, similar to that of figures and tables.
 Refer to the supplementary files as “Online Resource”, e.g., "... as shown in
the animation (Online Resource 3)", “... additional data are given in Online
Resource 4”.
 Name the files consecutively, e.g. “ESM_3.mpg”, “ESM_4.pdf”.
Captions
For each supplementary material, please supply a concise caption describing
the content of the file.
Processing of supplementary files
Electronic supplementary material will be published as received from the author
without any conversion, editing, or reformatting.
Accessibility
In order to give people of all abilities and disabilities access to the content of your
supplementary files, please make sure that
 The manuscript contains a descriptive caption for each supplementary
material
 Video files do not contain anything that flashes more than three times per
second (so that users prone to seizures caused by such effects are not put
at risk)
Ethical Responsibilities of Authors
This journal is committed to upholding the integrity of the scientific record. As a
member of the Committee on Publication Ethics (COPE) the journal will follow the
COPE guidelines on how to deal with potential acts of misconduct.
Authors should refrain from misrepresenting research results which could damage
the trust in the journal, the professionalism of scientific authorship, and ultimately
the entire scientific endeavour. Maintaining integrity of the research and its
168
presentation can be achieved by following the rules of good scientific practice,

which include:
 The manuscript has not been submitted to more than one journal for
simultaneous consideration.
 The manuscript has not been published previously (partly or in full), unless
the new work concerns an expansion of previous work (please provide
transparency on the re-use of material to avoid the hint of text-recycling
(“self-plagiarism”)).
 A single study is not split up into several parts to increase the quantity of
submissions and submitted to various journals or to one journal over time
(e.g. “salami-publishing”).
 No data have been fabricated or manipulated (including images) to support
your conclusions
 No data, text, or theories by others are presented as if they were the
author’s own (“plagiarism”). Proper acknowledgements to other works must
be given (this includes material that is closely copied (near verbatim),
summarized and/or paraphrased), quotation marks are used for verbatim
copying of material, and permissions are secured for material that is
copyrighted.
 Important note: the journal may use software to screen for plagiarism.
 Consent to submit has been received explicitly from all co-authors, as well
as from the responsible authorities - tacitly or explicitly - at the
institute/organization where the work has been carried out, before the work
is submitted.
 Authors whose names appear on the submission have contributed
sufficiently to the scientific work and therefore share collective responsibility
and accountability for the results.
Compliance with Ethical Standards
To ensure objectivity and transparency in research and to ensure that accepted
principles of ethical and professional conduct have been followed, authors should
include information regarding sources of funding, potential conflicts of interest
(financial or non-financial), informed consent if the research involved human
169
participants, and a statement on welfare of animals if the research involved

animals.
Authors should include the following statements (if applicable) in a separate
section entitled “Compliance with Ethical Standards” when submitting a paper:
 Disclosure of potential conflicts of interest
 Research involving Human Participants and/or Animals
 Informed consent
Please note that standards could vary slightly per journal dependent on their peer
review policies (i.e. single or double blind peer review) as well as per journal
subject discipline. Before submitting your article check the instructions following
this section carefully.
The corresponding author should be prepared to collect documentation of
compliance with ethical standards and send if requested during peer review or
after publication.
The Editors reserve the right to reject manuscripts that do not comply with the
above-mentioned guidelines. The author will be held responsible for false
statements or failure to fulfill the above-mentioned guidelines.
Authors must disclose all relationships or interests that could have direct or
potential influence or impart bias on the work. Although an author may not feel
there is any conflict, disclosure of relationships and interests provides a more
complete and transparent process, leading to an accurate and objective
assessment of the work. Awareness of a real or perceived conflicts of interest is a
perspective to which the readers are entitled. This is not meant to imply that a
financial relationship with an organization that sponsored the research or
compensation received for consultancy work is inappropriate. Examples of
potential conflicts of interests that are directly or indirectly related to the research
may include but are not limited to the following:
Research grants from funding agencies (please give the research funder and
the grant number)
 Honoraria for speaking at symposia
 Financial support for attending symposia
 Financial support for educational programs
 Employment or consultation
170
 Support from a project sponsor

 Position on advisory board or board of directors or other type of
management relationships
 Multiple affiliations
 Financial relationships, for example equity ownership or investment interest
 Intellectual property rights (e.g. patents, copyrights and royalties from such
rights)
 Holdings of spouse and/or children that may have financial interest in the
work
In addition, interests that go beyond financial interests and compensation (non-
financial interests) that may be important to readers should be disclosed. These
may include but are not limited to personal relationships or competing interests
directly or indirectly tied to this research, or professional interests or personal
beliefs that may influence your research.
The corresponding author collects the conflict of interest disclosure forms from all
authors. In author collaborations where formal agreements for representation allow
it, it is sufficient for the corresponding author to sign the disclosure form on behalf
of all authors. Examples of forms can be found here:
The corresponding author will include a summary statement in the text of the
manuscript in a separate section before the reference list, that reflects what is
recorded in the potential conflict of interest disclosure form(s).
See below examples of disclosures:
Funding: This study was funded by X (grant number X).
Conflict of Interest: Author A has received research grants from Company A.
Author B has received a speaker honorarium from Company X and owns stock in
Company Y. Author C is a member of committee Z.
If no conflict exists, the authors should state:
Conflict of Interest: The authors declare that they have no conflict of interest.
Research involving human participants and/or animals
2) Statement on the welfare of animals
The welfare of animals used for research must be respected. When reporting
experiments on animals, authors should indicate whether the international,
national, and/or institutional guidelines for the care and use of animals have been
171
followed, and that the studies have been approved by a research ethics committee
at the institution or practice at which the studies were conducted (where such a
committee exists).
For studies with animals, the following statement should be included in the text
before the References section:
Ethical approval: “All applicable international, national, and/or institutional
guidelines for the care and use of animals were followed.”
If applicable (where such a committee exists): “All procedures performed in studies
involving animals were in accordance with the ethical standards of the institution or
practice at which the studies were conducted.”
If articles do not contain studies with human participants or animals by any of the
authors, please select one of the following statements:
“This article does not contain any studies with human participants performed by
any of the authors.”
“This article does not contain any studies with animals performed by any of the
authors.”
“This article does not contain any studies with human participants or animals
performed by any of the authors.”
After Acceptance
Upon acceptance of your article you will receive a link to the special Author Query
Application at Springer’s web page where you can sign the Copyright Transfer
Statement online and indicate whether you wish to order OpenChoice and
offprints.
Once the Author Query Application has been completed, your article will be
processed and you will receive the proofs.
Copyright transfer
Authors will be asked to transfer copyright of the article to the Publisher (or grant
the Publisher exclusive publication and dissemination rights). This will ensure the
widest possible protection and dissemination of information under copyright laws.
Creative Commons Attribution-NonCommercial 4.0 International License
Offprints
Offprints can be ordered by the corresponding author.
Color illustrations
Publication of color illustrations is free of charge.
172
Proof reading
The purpose of the proof is to check for typesetting or conversion errors and the
completeness and accuracy of the text, tables and figures. Substantial changes in
content, e.g., new results, corrected values, title and authorship, are not allowed
without the approval of the Editor.
After online publication, further changes can only be made in the form of an
Erratum, which will be hyperlinked to the article.
173
Instructions for Authors
Mitochondrial DNA part A

Print ISSN: 2470-1394 Online ISSN: 2470-1408
About the Journal
Mitochondrial DNA Part A is an international, peer-reviewed journal publishing

high-quality, original research. Please see the journal's Aims & Scope for
information about its focus and peer-review policy.
Please note that this journal only publishes manuscripts in English.
Mitochondrial DNA Part A accepts the following types of article: Original Articles,
Review Articles, Book Reviews, Letters to the Editor.
Peer Review
Taylor & Francis is committed to peer-review integrity and upholding the highest
standards of review. Once your paper has been assessed for suitability by the
editor, it will then be single blind peer reviewed by independent, anonymous expert
referees. Find out more about what to expect during peer review and read our
guidance on publishing ethics.
Preparing Your Paper
All authors submitting to medicine, biomedicine, health sciences, allied and public
health journals should conform to the Uniform Requirements for Manuscripts
Submitted to Biomedical Journals, prepared by the International Committee of
Medical Journal Editors (ICMJE).
Structure
Your paper should be compiled in the following order: title page; abstract;
keywords; main text introduction, materials and methods, results, discussion;
acknowledgments; declaration of interest statement; references; appendices (as
appropriate); table(s) with caption(s) (on individual pages); figures; figure captions
(as a list).
Word Limits
174
Please include a word count for your paper. There are no word limits for papers in
this journal.
Style Guidelines
Please refer to these quick style guidelines when preparing your paper, rather than
any published articles or a sample copy.
Please use American spelling style consistently throughout your manuscript.
Please use single quotation marks, except where ‘a quotation is “within” a

quotation’. Please note that long quotations should be indented without quotation
marks.
Periodical abbreviations. Periodical abbreviations should follow the style given

by Index Medicus
Latin terminology. Latin terminology, including microbiological and species

nomenclature, should be italicized.
Proprietary brands. Proprietary brands should be eschewed in favour of generic

drug names. If authors use proprietary brand names alongside generic drug
names, please include then in parentheses.
Use standard convention for human and animal genes and proteins: italics
for genes and regular font for proteins, and upper case for human products and
lower case for animal products.
Genetic notation. Please use the genetic notation and symbols approved by the
HUGO Gene Nomenclature Committee (HGNC). Nomenclature guidelines are
available and the Gene Name Proposal form may be completed on the NGNC
Web page (http://www.genenames.org/cgi-bin/request).
Nucleotide depositing. Please refer to the MIBBI Portal for prescriptive checklists
for reporting biological and biomedical research. Any novel nucleotide sequences
that are mentioned in submission require depositing with the Data Bank of Japan
(DDBJ), European Molecular Biology Laboratory (EMBL/EBI) Nucleotide
Sequence Database, or GenBank (National Centre for Biotechnology Information).
Please use GenBank Accession numbers and be sure to include them in the final
version of the manuscript. Single nucleotide polymorphisms that require
175
nomenclature should be submitted to the NCBI SNP database. Please include ID

numbers in the manuscript.
Formatting and Templates
Papers may be submitted in Word or LaTeX formats. Figures should be saved

separately from the text. To assist you in preparing your paper, we provide
formatting template(s).
Word templates are available for this journal. Please save the template to your
hard drive, ready for use.
A LaTeX template is available for this journal. Please save the LaTeX template to
your hard drive and open it, ready for use, by clicking on the icon in Windows
Explorer.
If you are not able to use the template via the links (or if you have any other
template queries) please contact [email protected].
References
Please use this reference guide when preparing your paper.
An EndNote output style is also available to assist you.
Checklist: What to Include
1. Author details. Please ensure everyone meeting the International

Committee of Medical Journal Editors (ICJME) requirements for authorship
is included as an author of your paper. Please include all authors’ full
names, affiliations, postal addresses, telephone numbers and email
addresses on the cover page. Where available, please also include
ORCiDs and social media handles (Facebook, Twitter or LinkedIn). One
author will need to be identified as the corresponding author, with their
email address normally displayed in the article PDF (depending on the
journal) and the online article. Authors’ affiliations are the affiliations where
the research was conducted. If any of the named co-authors moves
affiliation during the peer-review process, the new affiliation can be given as
a footnote. Please note that no changes to affiliation can be made after your
paper is accepted. Read more on authorship.
176
2. Should contain an unstructured abstract of between 100 and 150 words

words.
3. Graphical abstract (optional). This is an image to give readers a clear idea

of the content of your article. It should be a maximum width of 525 pixels. If
your image is narrower than 525 pixels, please place it on a white
background 525 pixels wide to ensure the dimensions are maintained. Save
the graphical abstract as a .jpg, .png, or .gif. Please do not embed it in the
manuscript file but save it as a separate file, labelled GraphicalAbstract1.
4. You can opt to include a video abstract with your article. Find out how
these can help your work reach a wider audience, and what to think about
when filming.
5. Between 3 and 6 keywords. Read making your article more discoverable,

including information on choosing a title and search engine optimization.
6. Funding details. Please supply all details required by your funding and
grant-awarding bodies as follows:
For single agency grants
This work was supported by the [Funding Agency] under Grant [number
xxxx].
For multiple agency grants
This work was supported by the [Funding Agency #1] under Grant [number
xxxx]; [Funding Agency #2] under Grant [number xxxx]; and [Funding
Agency #3] under Grant [number xxxx].
7. Disclosure statement. This is to acknowledge any financial interest or

benefit that has arisen from the direct applications of your research. Further
guidance on what is a conflict of interest and how to disclose it.
8. Biographical note. Please supply a short biographical note for each

author. This could be adapted from your departmental website or academic
networking profile and should be relatively brief (e.g. no more than 200
words).
9. Geolocation information. Submitting a geolocation information section, as

a separate paragraph before your acknowledgements, means we can index
your paper’s study area accurately in JournalMap’s geographic literature
177
database and make your article more discoverable to others. More

information.
10. Supplemental online material. Supplemental material can be a video,

dataset, fileset, sound file or anything which supports (and is pertinent to)
your paper. We publish supplemental material online via Figshare. Find out
more about supplemental material and how to submit it with your article.
11. Figures. Figures should be high quality (1200 dpi for line art, 600 dpi for
grayscale and 300 dpi for colour, at the correct size). Figures should be
supplied in one of our preferred file formats: EPS, PS, JPEG, GIF, or
Microsoft Word (DOC or DOCX). For information relating to other file types,
please consult our Submission of electronic artwork document.
12. Tables. Tables should present new information rather than duplicating what
is in the text. Readers should be able to interpret the table without reference
to the text. Please supply editable files.
13. Equations. If you are submitting your manuscript as a Word document,

please ensure that equations are editable. More information about
mathematical symbols and equations.
14. Units. Please use SI units (non-italicized).
Using Third-Party Material in your Paper
You must obtain the necessary permission to reuse third-party material in your
article. The use of short extracts of text and some other types of material is usually
permitted, on a limited basis, for the purposes of criticism and review without
securing formal permission. If you wish to include any material in your paper for
which you do not hold copyright, and which is not covered by this informal
agreement, you will need to obtain written permission from the copyright owner
prior to submission. More information on requesting permission to reproduce
work(s) under copyright.
Disclosure Statement
Please include a disclosure statement, using the subheading “Disclosure of

interest.” If you have no interests to declare, please state this (suggested wording:
The authors report no conflict of interest). For all NIH/Wellcome-funded papers,
178
the grant number(s) must be included in the declaration of interest statement.

Read more on declaring conflicts of interest.
Clinical Trials Registry
In order to be published in a Taylor & Francis journal, all clinical trials must have
been registered in a public repository at the beginning of the research process
(prior to patient enrolment). Trial registration numbers should be included in the
abstract, with full details in the methods section. The registry should be publicly
accessible (at no charge), open to all prospective registrants, and managed by a
not-for-profit organization. For a list of registries that meet these requirements,
please visit the WHO International Clinical Trials Registry Platform (ICTRP). The
registration of all clinical trials facilitates the sharing of information among
clinicians, researchers, and patients, enhances public confidence in research, and
is in accordance with the ICMJE guidelines.
Complying With Ethics of Experimentation
Please ensure that all research reported in submitted papers has been conducted
in an ethical and responsible manner, and is in full compliance with all relevant
codes of experimentation and legislation. All papers which report in vivo
experiments or clinical trials on humans or animals must include a written
statement in the Methods section. This should explain that all work was conducted
with the formal approval of the local human subject or animal care committees
(institutional and national), and that clinical trials have been registered as
legislation requires. Authors who do not have formal ethics review committees
should include a statement that their study follows the principles of the Declaration
of Helsinki.
Consent
All authors are required to follow the ICMJE requirements on privacy and informed
consent from patients and study participants. Please confirm that any patient,
service user, or participant (or that person’s parent or legal guardian) in any
research, experiment, or clinical trial described in your paper has given written
consent to the inclusion of material pertaining to themselves, that they
acknowledge that they cannot be identified via the paper; and that you have fully
anonymized them. Where someone is deceased, please ensure you have written
179
consent from the family or estate. Authors may use this Patient Consent Form,
which should be completed, saved, and sent to the journal if requested.
Health and Safety
Please confirm that all mandatory laboratory health and safety procedures have
been complied with in the course of conducting any experimental work reported in
your paper. Please ensure your paper contains all appropriate warnings on any
hazards that may be involved in carrying out the experiments or procedures you
have described, or that may be involved in instructions, materials, or formulae.
Please include all relevant safety precautions; and cite any accepted standard or
code of practice. Authors working in animal science may find it useful to consult
the International Association of Veterinary Editors’ Consensus Author Guidelines
on Animal Ethics and Welfare and Guidelines for the Treatment of Animals in
Behavioural Research and Teaching. When a product has not yet been approved
by an appropriate regulatory body for the use described in your paper, please
specify this, or that the product is still investigational.
Submitting Your Paper
This journal uses ScholarOne Manuscripts to manage the peer-review process. If

you haven't submitted a paper to this journal before, you will need to create an
account in ScholarOne. Please read the guidelines above and then submit your
paper in the relevant Author Centre, where you will find user guides and a
helpdesk.
If you are submitting in LaTeX, please convert the files to PDF beforehand (you
will also need to upload your LaTeX source files with the PDF).
Please note that Mitochondrial DNA Part A uses Crossref™ to screen papers for
unoriginal material. By submitting your paper to Mitochondrial DNA Part A you are
agreeing to originality checks during the peer-review and production processes.
On acceptance, we recommend that you keep a copy of your Accepted

Manuscript. Find out more about sharing your work.
Publication Charges
There are no submission fees or page charges for this journal.

180
Colour figures will be reproduced in colour in your online article free of charge. If it
is necessary for the figures to be reproduced in colour in the print version, a
charge will apply.
Charges for colour figures in print are £300 per figure ($400 US Dollars; $500
Australian Dollars; €350). For more than 4 colour figures, figures 5 and above will
be charged at £50 per figure ($75 US Dollars; $100 Australian Dollars; €65).
Depending on your location, these charges may be subject to local taxes.
Copyright Options
Copyright allows you to protect your original material, and stop others from using
your work without your permission. Taylor & Francis offers a number of different
license and reuse options, including Creative Commons licenses when publishing
open access. Read more on publishing agreements.
Complying with Funding Agencies
We will deposit all National Institutes of Health or Wellcome Trust-funded papers

into PubMedCentral on behalf of authors, meeting the requirements of their
respective open access policies. If this applies to you, please tell our production
team when you receive your article proofs, so we can do this for you. Check
funders’ open access policy mandates here. Find out more about sharing your
work.
Open Access
This journal gives authors the option to publish open access via our Open Select
publishing program, making it free to access online immediately on publication.
Many funders mandate publishing your research open access; you can check
open access funder policies and mandates here.
Taylor & Francis Open Select gives you, your institution or funder the option of
paying an article publishing charge (APC) to make an article open access. Please
contact [email protected] if you would like to find out more, or go to our
Author Services website.
For more information on license options, embargo periods and APCs for this
journal please go here.
181
ANEXO B - CURRICULUM VITAE (LATTES)
Crislaine Xavier da Silva

Curriculum Vitae restrito ao período de 03/2014 a 03/2018
_________________________________________________________________
Dados pessoais
Nome Crislaine Xavier da Silva
_________________________________________________________________
Formação acadêmica/titulação
2014 Doutorado em Genética.

Universidade Federal de Pernambuco, UFPE, Recife, Brasil
Título: Estudo da diversidade genética de Euchroma gigantea
(Coleoptera: Buprestidae): contribuições à elucidação do status
taxonômico e mecanismos evolutivos
Orientador: Dra. Rita de Cássia de Moura
Co-orientador: Dr. Diogo Cavalcanti Cabral de Mello
Bolsista do(a): Coordenação de Aperfeiçoamento de Pessoal de
Nível Superior
2011 - 2013 Mestrado em Biologia Celular e Molecular Aplicada.

Universidade de Pernambuco, UPE, Recife, Brasil
Título: Mapeamento físico de sequências de DNAs repetidos e
análise do transposon MarMITE no genoma de Dichotomius
schiffleri (Coleoptera; Scarabaeidae), Ano de obtenção: 2013
Co-orientador: Dr. Diogo Cavalcanti Cabral de Mello
Bolsista do(a): Fundação de Amparo à Ciência e Tecnologia do
Estado de Pernambuco
2007 - 2010 Graduação em Ciências Biológicas.

Universidade de Pernambuco, UPE, Recife, Brasil
Título: Caracterização cariotípica de Coprophanaeus
(Metallophanaeus) pertyi (Coleoptera: Scarabaeidae) com ênfase
em aspectos cromossômico-evolutivos
Bolsista do(a): Programa de Fortalecimento Acadêmico da
_________________________________________________________________
Formação complementar
2016 - 2016 Marcadores moleculares em genética e genômica, filogenia e

taxonomia. (Carga horária: 88h).
Empresa Brasileira de Pesquisa Agropecuária, EMBRAPA,
Brasília, Brasil
182
Atuação profissional
1. Universidade Federal de Pernambuco - UFPE

_________________________________________________________
Vínculo institucional
2014 - Atual Vínculo: Estudante, Enquadramento funcional:

Estudante de doutorado, Regime: Dedicação exclusiva
2. Universidade Estadual Paulista Júlio de Mesquita Filho - UNESP

_________________________________________________________
Vínculo institucional
2016 - 2016 Vínculo: Visitante, Enquadramento funcional: Estudante

de doutorado, Regime: Dedicação exclusiva
_________________________________________________________
Atividades
04/2016 - 10/2016 Outra atividade técnico-científica, Instituto de

Biociências de Rio Claro
Especificação:
Realização de experimentos do projeto "Estudo da
diversidade genética de Euchroma gigantea
(Coleoptera: Buprestidae): contribuições à elucidação
do status taxonômico e mecanismos evolutivos"
_________________________________________________________________
Projetos
Projetos de pesquisa
2015 - Atual Diversidade genética de Dichotomius schiffleri e dinâmica

evolutiva de elementos transponíveis no complexo sericeus
(Coleoptera: Scarabaeidae): contribuições conservacionistas e
cromossômico evolutivas
Descrição: Os besouros escarabeíneos são considerados bons bioindicadores de
conservação ambiental e merecem destaque devido à sua importância para o
funcionamento do ecossistema (reciclagem de matéria orgânica), à abundância
de seus representantes nos diferentes hábitats, à formação de grupos ecológicos
bem definidos e aos métodos de captura facilmente padronizados. Algumas
espécies desse grupo são encontradas em regiões de restinga, que são áreas de
mata próximas ao litoral e que desde a colonização vem sofrendo degradação
pela ação do homem, principalmente devido à alta especulação imobiliária. A
espécie Dichotomius schiffleri (popularmente conhecida como rola-bosta), por
exemplo, está em perigo de extinção e a principal causa disso é a perda do
habitat. A realização de estudos de diversidade genética de populações dessa
183
espécie é imprescindível, pois visa compreender como esta espécie se comporta

diante da degradação do seu habitat, o que é fundamental para futuro
planejamento de áreas de manejo e trabalhos de conservação da espécie. Além
disso, saber a localização de algumas sequências de DNA nos cromossomos
contribuem para conhecer melhor o genoma de D. schiffleri e outras espécies
evolutivamente próximas. Portanto, neste trabalho, diferentes populações da
espécie D. schifleri serão coletadas em regiões do litoral brasileiro, incluindo
Pernambuco, e serão analisadas com base em suas sequências de DNA quanto à
diversidade genética populacional e a localização de algumas dessas sequências
nos cromossomos. Os dados obtidos serão úteis no direcionamento dos esforços
de conservação da espécie, pois contribuirão para melhor entendimento da sua
diversidade, organização genômica e estrutura genética das populações
analisadas. Por fim, é importante destacar que o presente projeto está em sintonia
com propostas baseadas em políticas públicas ambientais designadas pelos
governos federal e de Pernambuco. Desta forma, este trabalho atende alguns
princípios e objetivos firmados nestas políticas, tais como: preservação e
conservação da biodiversidade, uso sustentado dos recursos naturais, proteção
da flora e fauna, dos processos ecológicos essenciais à promoção do manejo
ecológico das espécies e ecossistemas, preservação da biodiversidade e
integridade do patrimônio genético e estímulo ao estudo, à pesquisa e ao
desenvolvimento de tecnologias orientadas para o uso racional e a proteção de
florestas e demais formas de vegetação.
Situação: Em andamento Natureza: Projetos de pesquisa
Alunos envolvidos: Graduação (1); Mestrado acadêmico (1); Doutorado (2);
Integrantes: Crislaine Xavier da Silva; Rita de Cássia de Moura (Responsável);
Diogo Cavalcanti Cabral-de-Mello; Aline Priscila Felix; Geyner Alvez dos Santos
Cruz ; Rafaelle Graziele Coelho da Costa; Igor Costa Amorim; Fernando
Augusto Barbosa Silva
Financiador(es): Fundação de Amparo à Ciência e Tecnologia do Estado de
Pernambuco-FACEPE
2014 - Atual Estudo da diversidade genética de Euchroma gitantea

(Coleoptera: Buprestidae): contribuições à elucidação de status
taxonômico e mecanismos evolutivos
Descrição: O gênero Euchroma Solier, 1833, faz parte da família da família
Buprestidae (Coleoptera) e é monotípico para Euchroma gigantea. Devido a sua
alta capacidade de reprodução e voracidade das larvas E. gigantea, vulgarmente
conhecida como mãe-de-sol, tem sido considerada praga em espécies arbóreas,
tanto ornamentais quanto de importância agrícola, causando prejuízos diretos na
própria planta, que cai facilmente pela ação dos ventos devido a perda do sistema
de sustentação, e indiretos, resultantes de danos causados pela queda das
árvores. Foram descritas seis variedades para E. gigantea e análises
citogenéticas nesta espécie revelaram a presença de seis citótipos com número
diploide variando de 2n = 24 a 2n = 36, todos com mecanismo de determinação
sexual múltiplo X1Y1X2Y2X3Y3 e a presença de cromossomos supernumerários (5
a 32). Até o presente não foram realizados estudos correlacionando as
variedades de E. gigantea com as variações citogenéticas, bem como dados
cariotípicos com o resultado de outros marcadores genéticos em diferentes
populações. Propomos estudar sete populações de E. gigantea utilizando
marcadores moleculares, o que contribuirá efetivamente para verificação do
184
status de espécie e conhecimento de padrões de divesidade genômica das

populações, e marcadores citogenéticos, que permitirão estudar a diversidade
cariotípica e organização genômica da espécie, contribuindo para elucidação dos
mecanismos cromossômicos evolutivos presentes no gênero Euchroma.
Situação: Em andamento Natureza: Projetos de pesquisa
Alunos envolvidos: Mestrado acadêmico (1); Doutorado (1);
Integrantes: Crislaine Xavier da Silva; Rita de Cássia de Moura (Responsável);
Diogo Cavalcanti Cabral-de-Mello; Rógean Soares
Financiador(es): Coordenação de Aperfeiçoamento de Pessoal de Nível Superior-
CAPES
_________________________________________________________________
Prêmios e títulos
2017 3º Lugar - Modelo evolutivo de diversificação cromossômica na

espécie Euchroma gigantea (Buprestidae, Coleoptera), VII
Jornada de Pós-Graduação de Genética - Universidade Federal
de Pernambuco
2016 1º Lugar - Prêmio Jovem Geneticista - Evidências cromossômicas

e moleculares de especiação críptica em Euchroma gigantea
(Buprestidae, Coleoptera), XXI Encontro de Genética do
Nordeste/Sociedade Brasileira de Genética
Producão
_________________________________________________________________
Produção bibliográfica
Artigos completos publicados em periódicos
1. XAVIER,C.; Soares, R; Amorim, IC; Cabral-de-Melo, DC; Moura, RC

gigantea (Coleoptera: Buprestidae). Chromosome Research, 2018.V 1-16
2. XAVIER,C.; Cabral-De-Melo, DC; Moura, RC

Heterochromatin and molecular characterization of DsmarMITE transposable
element in the beetle Dichotomius schiffleri (Coleoptera: Scarabaeidae). Genetica
('s-Gravenhage). , v.142, p.575 - 581, 2014.
Artigos aceitos para publicação
2. Igor Costa Amorim; Rafaelle Graziele C. Costa; XAVIER,C.; Moura, RC

Characterization and population mapping of the DgmarMITE transposon in
Dichotomius (Luederwaldtinia) sericeus species complex (Coleoptera:
Scarabaeidae). Genetics and Molecular Biology, 2018.
Trabalhos publicados em anais de eventos (resumo)

185
1. SILVA, J. N.; COSTA M.R.; XAVIER C.; AMORIM, I.C.; MOURA R.C
Mapeamento cromossômico do microssatélite AG15 em espécies do
grupo Dichotomius (Luederwaldtinia) sericeus (Coleoptera: Scarabaeidae). In: VII
Jornada de pós-Graduação de Genética, 2017
2. COSTA M.R.; CRUZ, G.A.S.; XAVIER C.; AMORIM, I.C.; MOURA R.C
Caracterização e dinâmica evolutiva de DNA satélite em Dichotomius schiffleri
(Coleoptera:Scarabaeidae). In: VII Jornada de pós-Graduação de Genética,
2017
3. XAVIER,C.; SOARES, R; RIBEIRO, K. C. S.; CABRAL-DE-MELO, DC;

MOURA, RC
Evidências cromossômicas e moleculares de especiação críptica em Euchroma
gigantea (Buprestidae, Coleoptera). In: Encontro de Genética do Nordeste, 2016,
Recife - Pernambuco.
Anais do XXI Encontro de Genética do Nordeste, 2016. v.1. p.158 - 158
4. COSTA, C. M. Q.; XAVIER,C.; FERREIRA NETO, CA; BARRETO, J. W.;

MOURA, RC; LOUZADA, J.
Dung beetle communities in protected and unprotected areas of northeast
Brazilian coast. In: X Reunión Latinoamericana de Scarabaeoidología, 2014,
Colômbia. Anais da X Reunión Latinoamericana de Scarabaeoidología. 2014.
5. XAVIER,C.; RIBEIRO, K. C. S.; CABRAL-DE-MELO, DC; MOURA, RC

Novas evidências dos mecanismos cromossômico-evolutivos ocorrentes em
Euchroma gigantea (Coleoptera, Buprestidae). In: XX ENGENE, 2014, Camina
Grande - PB.
Anais do XX encontro de Genética do Nordeste. 2014.
Apresentação de trabalho e palestra
1. XAVIER,C.
Alto polimorfismo cromossômico em Euchroma gigantea (Buprestidae:
Coleoptera), 2016. (Seminário,Apresentação de Trabalho)
Orientações e Supervisões
Trabalhos de conclusão de curso de graduação
1. Rógean Vinícius Santos Soares. Análise do status taxonômico de Euchroma

gigantea (Coleoptera: Buprestidae) utilizando DNA barcode (Coorientação).
2015. Curso (Ciências Biológicas) - Universidade de Pernambuco
2. Karol Cristianne Silva Ribeiro. Análises de polimorfismos cromossômicos

em Euchroma gigantea (Coleoptera: Buprestidae). 2015. Curso (Ciências
Biológicas) - Universidade de Pernambuco
186
Eventos
Participação em eventos
1. Apresentação de Poster / Painel no(a) V Reunião Brasileira de Citogenética

e Citogenômica, 2017. (Congresso)
Caracterização e mapeamento cromossômico de duas famílias de DNA satélite
em Euchroma gigantea (Coleoptera: Buprestidae).
2. VII Jornada de pós-Graduação de Genética, 2017. (Outra)

Modelo evolutivo de diversificação cromossômica na espécie Euchroma gigantea
(Buprestidae, Coleoptera).
3. Apresentação Oral no(a) XXI Encontro de Genética do Nordeste, 2016.

(Encontro)
Evidências cromossômicas e moleculares de especiação críptica em Euchroma
gigantea (Buprestidae, Coleoptera).
4. Apresentação de Poster / Painel no(a) 4ª Reunião Brasileira de Citogenética,

2015. (Congresso)
Variabilidade cariotípica e dispersão de sítios de DNAr 18S em Euchroma
gigantea (Coleoptera: Buprestidae).
5. V Jornada de Pós-Graduação em Genética, 2015. (Outra)

Mapeamento cromossômico de DNAr e sequências teloméricas em Euchroma
gigantea (Buprestidae, Coleoptera): evidências sobre a evolução cariotípica.
6. Apresentação de Poster / Painel no XX Encontro de Genética do Nordeste,

2014. (Encontro)
Novas evidências dos mecanismos cromossômico-evolutivos ocorrentes em
Euchroma gigantea (Coleoptera, Buprestidae).
Organização de evento
1. XAVIER,C.; Comissão discente de organização

Encontro de Pós-graduação e pesquisa, 2014. (Outro, Organização de evento)
Bancas
Participação em banca de trabalhos de conclusão

Graduação
1. XAVIER,C.; ROCHA, M.F.

Participação em banca de Rafaelle Grazielle Coelho da Costa. Ocorrência,
caracterização e localização cromossômica de elementos de transposição
187
em Dichotomius Aff sericeus (Coleoptera: Scarabaeidae), 2015

(Ciências Biológicas) Universidade de Pernambuco
Participação em banca de comissões julgadoras
1. Avaliadora Ad Hoc do II Encontro de Extensão e Cultura - ENExC, 2016

2. Membro da comissão de avaliação dos pôsteres do Encontro de Pós-

Graduação e Pesquisa da UPE, 2014

TESE Crislaine Xavier Da Silva

Enviado por

Direitos autorais:

Formatos disponíveis

TESE Crislaine Xavier Da Silva

Enviado por

Dados do documento

Direitos autorais

Formatos disponíveis

Compartilhar este documento

Compartilhar ou incorporar documento

Opções de compartilhamento

Você considera este documento útil?

Este conteúdo é inapropriado?

Direitos autorais:

Formatos disponíveis

TESE Crislaine Xavier Da Silva

Enviado por

Direitos autorais:

Formatos disponíveis

UNIVERSIDADE FEDERAL DE PERNAMBUCO

CRISLAINE XAVIER DA SILVA

Estudo da diversidade genética de Euchroma gigantea (Coleoptera:

Estudo da diversidade genética de Euchroma gigantea (Coleoptera:

Tese apresentada ao Programa de Pós-Graduação

Orientadora: Rita de Cássia de Moura

Silva, Crislaine Xavier da

Orientador: Rita de Cássia de Moura

Inclui referências e anexos

1. Evolução cromossômica 2. Citogenética molecular 3. Euchroma

576.5 CDD (22.ed.) UFPE/CB-2018-406

Elaborado por Claudina Karla Queiroz Ribeiro CRB4/1752

Estudo da diversidade genética de Euchroma gigantea (Coleoptera:

Tese apresentada ao Programa de

Em 2008 fui apresentada a Euchroma gigantea. Na ocasião minha

O gênero Euchroma Solier, 1833 (Buprestidae, Coleoptera) considerado

Palavras-chave: Evolução cromossômica. Citogenética molecular. Filogenia.

Euchroma Solier, 1833 (Buprestidae, Coleoptera) is a monospecific genus for

Key words: Chromosomal evolution. Molecular cytogenetics. Phylogeny. Speciation.

1.1 OBJETIVOS ........................................................................................................ 23

1.1.1 Objetivo geral ................................................................................................. 23

1.1.2 Objetivos específicos..................................................................................... 23

2 REVISÃO DA LITERATURA ................................................................................. 25

2.1 CONSIDERAÇÕES GERAIS SOBRE A FAMÍLIA BUPRESTIDAE

2.1.1 Euchroma gigantea ........................................................................................ 26

2.2 CITOGENÉTICA DE BUPRESTIDAE ................................................................. 28

2.2.1 Citogenética de Euchroma gigantea............................................................. 32

2.3 REARRANJOS CROMOSSÔMICOS E ESPECIAÇÃO ...................................... 36

2.4 USO DE DNA REPETITIVO NO ENTENDIMENTO DA EVOLUÇÃO

2.5 O DNA MITOCONDRIAL E APLICAÇÃO EM INCERTEZAS TAXONÔMICAS .. 42

3 INSIGHTS INTO THE KARYOTYPE EVOLUTION AND SPECIATION OF THE

4 18S RDNA AND SATDNAS MAPPING IN THE CHROMOSOMES OF

5 MITOGENOMA DE EUCHROMA GIGANTEA (COLEOPTERA: BUPRESTIDAE)

6 DISCUSSÃO GERAL .......................................................................................... 134

7 CONCLUSÕES .................................................................................................... 146

ANEXO A – NORMAS PARA PUBLICAÇÃO ........................................................ 159

ANEXO B - CURRICULUM VITAE (LATTES) ........................................................ 181

Euchroma gigantea Linneus 1735 é um besouro pertencente à família

anteriormente. Assim, a ampliação da análise cariotípica em espécimes de

1.1.1 Objetivo geral

Realizar análises cromossômicas e moleculares em espécimes de Euchroma

1.1.2 Objetivos específicos

1. Descrever a macroestrutura cromossômica de espécimes de Euchroma

5. Determinar a estrutura do mitogenoma e verificar se existe variação

2.1 CONSIDERAÇÕES GERAIS SOBRE A FAMÍLIA BUPRESTIDAE

2.1.1 Euchroma gigantea

Euchroma Dejean, 1833 é um dos 79 gêneros da família Buprestidae com

Fonte: a-c) The Linnean Society of London, d) Autora.

Considerando a classificação de E. gigantea em subespécies, existe

a cabeça voltada para a entrada da galeria e após o período pupal, o adulto

2.2 CITOGENÉTICA DE BUPRESTIDAE

Os estudos citogenéticos prévios na família Buprestidae foram realizados

"pára-quedas" Xyp é o mais comum e foi registrado em 66 espécies (Tabela 1)

Tabela 1. Números diploides das espécies de Buprestidae analisadas citogeneticamente.

Poucos cariótipos de espécies da família Buprestidae foram analisados

as células não foram analisadas em prófase, fase na qual as RONs são

2.2.1 Citogenética de Euchroma gigantea

Na família Buprestidae, um alto polimorfismo cromossômico foi observado

por um cromossomo metacêntrico no centro e dois acrocêntricos nas

Figura 2. Células em metáfase I de três espécimes de