1.The codon which the release factor does not link with it is………..

a. UAA b. AUG
c. UGA d. UAG
……………………………………………………………………………………………………………………………………………
……………………………………………………………………………………………………………………………………………
……………………………………………………………………………………………………………………………………………
……………………………………………………………………………………………………………………………………………

2.If a molecule of DNA is composed of approximately 16.2% adenine ,

33.4% guanine , the percentage of thymine and cytosine must be
approximately:
a. 6.3% thymine to 16.3 cytosine
b. 34.1 thymine to 34.1 cytosine
c. 34.1 thymine to 16.3 cytosine
d. 34.1 cytosine to 16.3 thymine
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
…………………………………………

3.For the synthesis of a protein composed of 150 amino acids , the number
of nucleotides on mRNA should be………….at least
a. 50 b. 150
c. 300 d. 450
……………………………………………………………………………………………………………………………………………
……………………………………………………………………………………………………………………………………………
……………………………………………………………………………………………………………………………………………
……………………………………………………………………………………………………………………………………………
4.With the help of the following diagram that
represents a part of DNA molecule . put the
suitable number infront of each of the
following:
a. Deoxyribose sugar ( )
b. A weak hydrogen bond ( )
c. The phosphate group ( )
d. The nitrogenous base ( )
………………………………………………………………………………………………………………………………
………………………………………………………………………………………………………………………………
………………………………………………………………………………………………………………………………
………………………………………………………………………………………………………………………………

5.Complete the following

6.The following diagram shows how the gene of
insulin is prepared via mRNA , answer the
following questions
a. Write the base sequence in the two DNA
templates
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
b. Each of E1 and E2 is an enzyme plays a role in
the formation of the gene , name each of
them
c. …………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
d. What are the sources from which we can obtain each of mRNA and E1
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………

7.Eukaryotic cells are grown for a number of generations in a medium

containing thymine labeled with 13H they are then removed from the
radioactive medium , placed in an ordinary medium , and allowed to
divide studies of the distribution of the radioactive isotope are made
after each generation to determine the presence of radioactive
material in the chromatids
Chromatids contain 13H after one generation in the nonradioactive
medium , all the chromatids still contain radioactive 13H
a. Assuming each chromatid contains a single DNA molecule , explain the
results
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
 b. Is this in consistent with Watson-crick hypothesis?
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
c. What would be the distribution of the 13H after two generations in the
nonradioactive medium? Why?
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………

8.By using the table of codons , answer the following:

GUG AAA CGC CGG AUG CCC ACG
valine Lysine Arginine glycine methionine proline Arginine
If the arrangement of nucleotides on a piece of DNA strand is………..

3..TACCCCTTTTACTCCTTTGGGCACGCGATT…5

a. the nucleotide sequence on a transcribed mRNA

…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
b. the number of codons on mRNA
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
c. the arrangement of translate amino acids and their numbers
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
d. the number of tRNA and anticodons
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
e. the number of DNA turns in this piece
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………

9.using the diagram , answer the following questions (1-3)

1. what process is shown in diagram 1-3?
a. transription b. translation
c. translocation d. replication
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
2. what occurred between diagrams
2 and 3?
a. DNA was copied
b. DNA was translated
c. DNA mutated
d. DNA was unzipped
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………

3. What structure is represented by the

circle marked X?
a. Nitrogenous base b. nucleotide
c. deoxyribose d. phosphate group
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
10.the least number of amino acids codons on mRNA is………
a. 3 b. 20
c. 64 d. 64

…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
11.If there was a protein composed of 300 amino acids , therefore the
number of turns of DNA molecule that will be transcribed to form this
protein is approximately…………turns
a. 15 b. 45
c. 45 d. 90
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
12.if the number of nucleotides on a segment of DNA strand from which
the mRNA is transcribed equals (X) , so the number of amino acids that
forms the produced polypeptide equals…………
a. X b. X-1
c. 3X-3 d. X-3/3
………………………………………………………………………………………………………………………………………
………………………………………………………………………………………………………………………………………
……………………………………………………………………………….………………………………………

13.if the number of nucleotides in a fragment of DNA molecule is 270

nucleotides , therefore the least number of the formed amino acids
is……….
a. 44 b. 45
c. 90 d. 135
………………………………………………………………………………………………………………………………………
………………………………………………………………………………………………………………………………………
……………………………………………………………………………….………………………………………
14.the least number of tRNA molecules needed to form a polypeptide chain
that contains 50 amino acids formed from 150 types is………….molecules
a. 15 b. 20
c. 35 d. 50
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
15.to form a protein composed of 50 amino acids , the number of
nucleotides that found on the mRNA molecule must be…………nucleotides
a. 150 b. 151
c. 152 d. 153
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
16.if the number of nucleotides that found on mRNA is 45 nucleotides ,
therefore the number of nucleotides in a fragment of DNA molecule
from which mRNA is transcribed is……………nucleotides
a. 45 b. 48
c. 48 d. 96
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
17. A polypeptide chain consists of 12 amino acids , this represents a gene
consists of…………..pairs of nucleotides
a. 12 b. 13
c. 36 d. 39

…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
18.If the sequence of nucleotides in one strand of DNA segment runs , as
follows:
5… C – T – G – A – A – T – T – C – A – G…3
(a) Write this sequence and the complementary sequence of
nucleotides of the other strand for the same segment of DNA

…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
(b) If you have a restriction enzymes and its recognition site is

Illustrate by arrows the recognition site of this enzyme on

the two strands of DNA segment

…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
(c) Write the nucleotides sequence in the resulted segments from
the action of this restriction enzyme on the two strands of DNA
segment

…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………

19.if the sequence of nucleotides on mRNA strand runs as follows

5…G – C – U – C – C – A – A – A – A – C – C – A – G – C – U – U – G – A – A – A – A – A – A – A ….3

Mention :

(a)the anticodons on tRNA nucleic acids

…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
(b)the number of amino acids that are formed during the translation of
this sequence
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
(c)the number of tRNA types that are used in he translation of this
sequence
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
(d)the sequence of nucleotides that resulted from the treatment of this
sequence by the reverse transcriptase enzyme
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………

20.which of the following statements is incorrect?..............

a. the codon (AUG) represents the methionine amino acid in all the living
organisms
b. each codon represents a code for an amino acid
c. the number of codons that represents a code is 64 codons
d. the number of anticodons is 61
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
21.the opposite diagram illustrates the formation
process of casein protein that’s found in milk ,
this process takes place in………..
a. the cell of the anterior lobe of pituitary gland
b. the cells of the posterior lobe of pituitary gland
c. the cells of the mammary glands in human female
d. all the human body cells
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
22. the vital process that is illustrated
by the opposite figure can occur in
all the following living organisms ,
except the……………
a. E.coli bacteria
b. Yeast fungus
c. Amoeba
d. Human
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
 23.the opposite graph represents the production rate of substances
that form the bacteriophage inside the bacterial

cell, the reason for decreasing the amount of

(X) and (Y) inside the cell to zero after about

half an hour is the…………

a. resistance of bacteria to the phage

b. lysis of components of the phage
c. increase of radioactive Sulphur
d. burst of bacterial cell
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………

24.All corn plants contain the ZmLA1 gene. Some corn plants contain a
certain mutation in the ZmLA1 gene. The graph below shows the
amount of ZmLA1 RNA produced in plants with the normal gene and
in plants with the mutated gene.

Based on the graph, what most li kely happens in

corn plant cells as a direct result of the mutated

gene?

(a) DNA replication increases.

(b) Lipid production decreases.

(c) Glucose synthesis increases.

(d) Protein production decreases.

…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
 25.Methylation is a process that can add
methyl (CH3) groups to DNA. A gene containing methylated
nucleotides often cannot be transcribed. As a result, proteins will not
be produced. Which of the following cellular processes is most directly
affected by DNA methylation?

(a) mRNA production

(b) nitrogen fixation

(c) replication

(d) respiration

…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
26.The table below contains statements which may be TRUE or FALSE
concerning DNA replication and mRNA synthesis in eukaryotic cell.
Which line in the table is correct?

Statement DNA replication mRNA synthesis

(a) Occurs in the nucleus TRUE FALSE
(b) Involved in protein TRUE TRUE
synthesis
(c) Requires free nucleotides TRUE FALSE
(d) Involves complementary TRUE TRUE
base pairing
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
 27.The sequence of triplets on a strand of DNA is shown below.

CTCACACCGTAGCAAATTTAG

During translation of mRNA made from the above sequence, how many of
the tRNA anticodons will have at least one uracil base?

(a) 1 (b) 2 (c) 3 (d) 5 (e) 6

…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
28.Analysis of a molecule of DNA found it to contain 200 adenine bases,
20% of the total number of bases in the strand. How many phosphate
groups did it contain?

(a) 200 (b) 400 (c) 800

(d) 1000

…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
29.A piece of DNA was analysed and 15% of its nucleotides were
adenine. What percentage would be uracil?

(a) 0 % (b) 15 % (c) 30 % (d) 35 %

…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
 30.The graph shows how temperature changes during repeated cycles of a
polymerase chain reaction (PCR). If there were 500 molecules of DNA at the
start, predict how many copies there will be after 20 minutes.

(a) 3000
(b) 8000
(c) 2500
(d) 2000

…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
31. DNA from a mother, child and four men (A, B, C and D) in a paternity suit
was analysed. The DNA was amplified using PCR and separated. From the
results shown in the diagram, identify the likely father of the child.

…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………