HHS Public Access

Author manuscript
Prostate. Author manuscript; available in PMC 2016 May 04.
Author Manuscript

Published in final edited form as:

Prostate. 2014 August ; 74(11): 1118–1131. doi:10.1002/pros.22828.

Androgen Receptor (AR) Suppresses Normal Human Prostate

Epithelial Cell Proliferation via AR/β-catenin/TCF-4 Complex
Inhibition of c-MYC Transcription
Lizamma Antony1,2,*, Freek van der Schoor1,2, Susan L. Dalrymple1,2, and John T. Isaacs1,2

1Chemical Therapeutics Program and Prostate Cancer Program, The Sidney Kimmel
Author Manuscript

Comprehensive Cancer Center at Johns Hopkins, Baltimore, Maryland 2Department of Urology,

The Brady Urological Institute, The Johns Hopkins School of Medicine, Baltimore, Maryland

Abstract
INTRODUCTION—Physiologic testosterone continuously stimulates prostate stromal cell
secretion of paracrine growth factors (PGFs), which if unopposed would induce hyperplastic
overgrowth of normal prostate epithelial cells (PrECs).

METHODS—Lentiviral shRNA stable knock down of c-MYC, β-catenin, or TCF-4 completely

inhibits normal (i.e., non-transformed) human PrECs growth. c-MYC enhancer driven reporter
expression and growth is inhibited by two chemically distinct molecules, which prevent β-catenin
signaling either by blocking TCF-4 binding (i.e., toxoflavin) or by stimulating degradation (i.e.,
Author Manuscript

AVX939). Recombinant DKK1 protein at a dose, which inhibits activation of canonical Wnt
signaling does not inhibit PrEC growth. Nuclear β-catenin translocation and PrEC growth is
prevented by both lack of PGFs or Akt inhibitor-I. Growth inhibition induced by lack of PGFs,
toxoflavin, or Akt inhibitor-I is overcome by constitutive c-MYC transcription.

RESULTS—In the presence of continuous PGF signaling, PrEC hyperplasia is prevented by

androgen binding to AR suppressing c-MYC transcription, resulting in G0 arrest/terminal
differentiation independent of Rb, p21, p27, FoxP3, or down regulation of growth factors receptors
and instead involves androgen-induced formation of AR/β-catenin/TCF-4 complexes, which
suppress c-MYC transcription. Such suppression does not occur when AR is mutated in its zinc-
finger binding domain.

DISCUSSION—Proliferation of non-transformed human PrECs is dependent upon c-MYC

Author Manuscript

transcription via formation/binding of β-catenin/TCF-4 complexes at both 5′ and 3′ c-MYC

enhancers stimulated by Wnt-independent, PGF induced Akt signaling. In the presence of
continuous PGF signaling, PrEC hyperplasia is prevented by androgen-induced formation of AR/
β-catenin/TCF-4 complexes, which retains binding to 3′ c-MYC enhancer, but now suppresses c-
MYC transcription.

*
Correspondence to: Lizamma Antony, The Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins, 1650 Orleans St.,
Baltimore, MD 21287. [email protected].
 Antony et al. Page 2

Keywords
Author Manuscript

androgen receptor; human prostate epithelial cells; c-MYC, β-catenin; TCF-4

INTRODUCTION
The prostate is the most common site of neoplastic transformation in the human body. Such
transformation can be either benign [i.e., benign prostatic hyperplasia (BPH)] or malignant
[i.e., prostate cancer (PCa)]. By the age of 50, half of males throughout the world have
histologically detectable BPH with eventually a quarter developing clinical symptoms of
BPH [1]. One in six American males will develop PCa during their lifetime [2]. Thus, it is
remarkable that despite these staggering demographic facts, the mechanism(s) for neoplastic
transformation of prostatic epithelium are not established. It is established that the prostate is
Author Manuscript

dependent upon sufficient level of circulating testosterone for its development, growth, and
maintenance. Circulating testosterone is converted in prostate tissue to dihydrotestosterone
(DHT), which is the major intracellular ligand, which binds to androgen receptor (AR)
initiating it’s signaling. The critical importance of chronically maintaining a sufficient level
of androgen is documented by the fact that androgen deprivation induces the regression of
the prostatic epithelium [3]. Such regression is fully reversible, however, since androgen
replacement results in complete epithelial cell regeneration, which is self-limiting so that
prostatic epithelial hyperplasia does not normally occur [4]. In fact, the prostate can undergo
more than 30 successive cycles of androgen deprivation and replacement without
diminishing its ability for full epithelial regeneration and without inducing hyperplasia [4].
A large number of independent groups have clarified that the prostate epithelium is
organized into adult epithelial stem cell units and how this organization allows such
Author Manuscript

profound cyclic regenerative growth capacity without hyperplasia [4–9].

In these adult prostate epithelial stem units, AR-negative adult prostate epithelial stem cells
are located in the basal epithelial layer in niches, which stimulates their survival but limits
their proliferation. The androgen independence of the adult prostate epithelial stem cells is
documented by the fact that epithelial morphogenesis occurs even when androgen receptor is
not expressed by prostate epithelial cells as long as there is expression and signaling of AR
in the supporting stromal cells [10]. The mechanism for how such epithelial morphogenesis
involves the hierarchical expansion/maturation of adult prostate epithelial stem cells and
their progeny [5]. Under the appropriate conditions, AR-negative adult prostate epithelial
stem cells divide asymmetrically to self-renew and to give rise to progeny, which
differentiate into either non-proliferating AR-negative neuroendocrine cells or ΔNp63-
positive/AR-negative transient amplifying (TA) cells. The basal located AR negative TA
Author Manuscript

cells undergo a limited number of amplifying rounds of proliferation before maturing into
ΔNp63-negative/prostate stem cell antigen (PSCA)-positive intermediate cells [5]. Such TA
proliferation requires androgen dependent AR signaling within AR expressing prostate
stromal cells, which stimulates production and secretion of diffusible stromal-derived
peptide growth factors collectively termed “andromedins” [11–14]. These paracrine-secreted
andromedins diffuse from the stroma into the epithelial compartment where their binding to
cognate receptors stimulates AR negative TA cell proliferation and maturation into

Prostate. Author manuscript; available in PMC 2016 May 04.

 Antony et al. Page 3

intermediate cells. Intermediate cells migrate to the luminal layer where they express AR
Author Manuscript

protein, which when occupied by DHT induces their terminally differentiate into prostate
specific antigen (PSA) positive secretory-luminal cells whose survival is critically dependent
upon adequate levels of andromedins [5]. Due to the hierarchically expanding nature of this
process, secretory-luminal cells are the most numerous cell type within an adult prostate
epithelial stem cell unit, even though they eventually terminally differentiate (i.e., terminally
arrested in G0).

In a non-castrated adult male, high level of circulating testosterone continuously stimulates

andromedin production, which if unopposed would induce hyperplastic overgrowth of the
gland. Since in the adult human male, only a small fraction [i.e., <1% per day] of prostate
epithelial cells (PrECs) are proliferating [15], there is a mechanism to suppress andromedin-
stimulated proliferation. Based upon the fact that the majority of epithelial proliferation is
located in the basal cells not expressing AR protein and that the AR positive secretory-
Author Manuscript

luminal cells are proliferatively quiescent [16,17], attention has focused on the role of the
AR as a suppressor of proliferation of prostate epithelial cells. For example, it has been
demonstrated experimentally that AR signaling activated by androgen binding in PrECs
induces their growth arrest [18–21] and eventual terminal differentiation into secretory-
luminal cells [21,22]. Likewise, transgenic mouse studies have documented that when the
AR gene is selectively knocked-out in secretory-luminal cells within the prostate, these AR
deficient cells become hyperplastic and do not terminally differentiate [23,24]. These
combined data demonstrate that androgen-dependent AR-signaling within AR expressing
PrECs suppresses their growth thus preventing prostatic epithelial hyperplasia even in the
presence of continuous andromedins production. The present studies focused upon
identifying the mechanism of androgen-dependent AR-mediated growth suppression in
normal AR-expressing PrECs.
Author Manuscript

MATERIALS AND METHODS

Reagents
The synthetic androgen R1881 was purchased from Perkin Elmer (Boston, MA). The AR
antagonist, Casodex was purchased from LKT laboratories (St. Paul, MN). Toxoflavin [i.e.,
(1-methyl-6-methylpyrimido[5,4-e]-1,2,4-triazine-5,7(1H,6H)-diones) also known as
PKF-118-310] was obtained from the Drug Synthesis and Chemistry Branch, Developmental
Therapeutics Program, Division of Cancer Treatment and Diagnosis, National Cancer
Institute (Bethesda, MD). XAV939 was obtained from Cellagen Technology (San Diego).
AKT-inhibitor I was obtained from EMD (La Jolla, CA). Recombinant DKK-1(cat#5439-
DK/CF) was purchased from R&D Systems (Minneapolis, MN). All other chemicals were
Author Manuscript

purchased from JT Baker (Phillipsburg, NJ) or Sigma–Aldrich (St. Louis, MO). PrEC and
PrEC-hTERT human prostate lines were obtained with informed consent according to Johns
Hopkins Medicine-IRB approved protocol NA_00001575 as previously described [25].
Human normal prostate epithelial cells (PrECs) from young donors were obtained
commercially from Lonza (Lonza/Cambrex, Walkersville, MD). Human normal prostate
stromal cells [PrSC] from older donors undergoing radical prostatectomy were established
according to a Johns Hopkins Medicine-IRB approved protocol NA_00001575 and grown in

Prostate. Author manuscript; available in PMC 2016 May 04.

 Antony et al. Page 4

RPMI-1640 plus 10% fetal bovine serum (FBS) as previously described [26]. PrEC and all
Author Manuscript

its derivatives were grown in Keratinoctye Serum Free defined media supplemented with
growth factors (GFs) [standard K-SFM] as supplied by manufacture (Invitrogen Life
Technologies, Carlsbad, CA). The WPMY-1 (cat# CRL-2854) immortalized human prostate
stromal cell line was obtained commercially from the ATCC (Manassas, VA) and serially
passaged in RPMI-1640 media plus 10% FBS. All cells were routinely screened for the
absence of mycoplasma contamination.

In Vitro Growth Assays and Time Lapse Microscopy

Cell growth over a 1-week period was measured by a 3-(4,5-dimethylthiazol-2-yl)-2,5-
diphenyltetrazolium bromide (MTT) assay [CellTiter 96 Non-Radioactive Cell Proliferation
Assay from Promega Corp. (Madison, WI)] as previously described [27]. Time lapse digital
microscopy was performed using a TE2000 (Nikon, Melville, NY) inverted microscope with
Author Manuscript

a heated stage and the Live Cell (Pathology Devices) CO2 chamber using an ELWD 20×
objective and the Photometric CoolSnap ES digital camera; images were captured using
Elements AR software program (Nikon).

Vectors
Creation of lentiviral-GFP control vector and the expression vector containing GFP and wild
type or mutant AR flanked by loxP sites (lenti-GFP/AR vector) were described previously
[28]. Isolation of GFP-expressing populations of cells following transduction with these
vectors was via a Becton Dickinson FACS Aria machine as described previously [21]. The
Lenti-GFP/AR(A573D) mutant vector was created by replacing the Bsu36I/Tth111I
fragment with the same fragment from an A573D mutant vector generously provided by Dr.
Hetty van der Korput [29]. The Lenti-GFP/AR(A573D) vector was sequenced to confirm the
Author Manuscript

presence of the DNA-binding domain mutation. The pWZL-Blast-MYC plasmid was

obtained from Addgene (Cambridge, MA; Plasmid 10674) as described previously [21].
This c-Myc plasmid was packaged using the LinX retroviral expression system and contains
the blasticidin resistance gene. Drug selection of transduced cells was via growth in 2.5
μg/ml of blasticidin. This same system was used to package the V2HS_130611 shRNA
construct coding for siRNA for Rb, which was purchased from Open Biosystems
(Huntsville, AL). Lentiviral shRNA vectors targeting p21 and p27 were constructed using
the pRNATin-H1.4-Lenti vector according to the manufacturer’s specifications (Genscript,
Piscataway, NJ). Targeted sequences were p21 (AACTTCGACTTTGTCACCGAG) and p27
(AACCCGGGACTTGGAGAAGCA) as previously reported [30]. A shRNA lentiviral
vector for c-Myc was purchased from Addgene (Plasmid 29435). A series (N = 3–5) of
shRNA lentiviral vectors for TCF-4 and β-catenin were obtained from the Sigma–Aldrich as
Author Manuscript

part of the mission-shRNA library. The best vector for TCF-4 was clone ID:
TRCN0000061893 and the best for β-catenin was clone ID: TRCN0000003843. Each of
these lentiviral vectors contains the puromycin resistance gene and was packaged and as
previously described [21]. PrECs were transduced with these package lenti-particles and cell
selection preformed using puromycin.

Prostate. Author manuscript; available in PMC 2016 May 04.

 Antony et al. Page 5

Western Blotting
Author Manuscript

Western blotting was performed as previously described [7]. Whole-cell lysates collected
from 100,000 cells were used per lane. Antibodies used were: anti-AR (N-20, Santa Cruz;
Santa Cruz, CA); anti-β-Actin (Cell Signaling; Beverly, MA); anti-ΔNp63 (4A4, Santa
Cruz); anti-p21 (Cell Signaling); anti-p27 (BD Transduction Labs; San Diego, CA); anti-RB
(4H1, Cell Signaling); anti-phospho-RB (Ser 608, Cell Signaling); anti-SKP2 (Zymed; San
Francisco, CA); anti EGF receptor (#2232, Cell Signaling); anti-IGF-type 1 receptor (#3018;
Cell Signaling); anti-CDK-2 (H-298; Santa Cruz); anti-Cyclin D1 (Upstate Biotechnology;
Lake Placid, NY); anti-c-MYC (Calbiochem; San Diego, CA); anti-TCF-4 (05-511,
Millipore; Billerica, MA); anti-active β-Catenin (05-665, Millipore); anti-phospho-S552 β-
catenin (#9566; Cell Signaling); anti-FOXP3 (mAbcam 450, Abcam; Cambridge, MA). All
secondary horseradish peroxidase-conjugated antibodies and chemiluminescent detection
reagents (ECL) were purchased from Amersham Biosciences (Piscataway, NJ).
Author Manuscript

c-MYC Enhancer Driven Luciferase Reporter Assays

The canonical wild type and loss of function 5′ c-MYC enhancer elements described by He
et al. [31] and wild type and loss of function 3′ c-MYC enhancer elements identified by
Yochum et al. [32] alone and in combination were used to drive SV40-promoter-firefly
luciferase constructs as described previously [32]. Cells were transiently transfected with
these vectors in combination with a control SV40-driven promoter-Renilla luciferase
construct. Twenty-four hours later, luciferase assays were performed using a dual luciferase
kit (Promega), and firefly and Renilla luciferase activities measured using a luminometer.
The results were initially normalized to the Renilla luciferase expression and these
normalized results were then divided by the normalized results for the construct containing
the loss of function mutated 5′ enhancer in front of the luciferase gene followed by the loss
Author Manuscript

of function mutated 3′ enhancer to obtain the fold increase in specific expression.

Chip Assay for TCF-4 Binding to c-MYC Enhancer Elements

The assay was performed using the Magna-ChIP kit from Upstate (Temecula, CA) according
to the recommended protocol using 4 μg of either non-specific mouse IgG or TCF-4 mouse
monoclonal antibody (Cat. # 05-511 from Millipore). To reverse the cross-linking, the
modification of Nelson et al. [33] was used. PCR was performed using primers for both 5′
and 3′ c-MYC enhancer elements as described previously [32].

Immunofluoresence (IF), Immunohistochemical (IHC), and SA β-Galactosidase Staining

Single and dual AR, c-MYC, and Ki67, IF staining of human prostate tissue obtained under
and IRB approved protocol were performed as described previously [34]. Senescence
Author Manuscript

associated β-galactosidase staining of cells in culture was performed as described previously

[35].

Statistics
All of the values are presented as means ± SE. Statistical analysis was performed by a one-
way ANOVA with the Newman–Keuls test for multiple comparisons.

Prostate. Author manuscript; available in PMC 2016 May 04.

 Antony et al. Page 6

RESULTS
Author Manuscript

Androgen-Dependent AR-Mediated Growth Suppression of Prostate Epithelial Cells Is Not

Due to Senescence and Is Cell-Context Dependent
To study the mechanism for androgen-dependent AR-mediated growth suppression of
human prostate epithelium, cultures were initiated from non-transformed adult human
prostate tissue using a low (<300 nM) calcium, serum-free paracrine growth factor (i.e.,
EGF, IGF, FGF) defined (SFD) media lacking androgen [25]. Even without added paracrine
growth factors, normal prostatic stem and TA cells survive in this low calcium media [7,27]
since in this media notch-1 signaling is constitutively activated while e-cadherin signaling is
inhibited [36]. In this media, prostatic stem and TA cells secrete and adhere to their own
laminin 5 rich extracellular matrix initiating an integrin-mediated, ligand-independent
activation of epidermal growth factor receptor [37]. The addition of paracrine growth factors
Author Manuscript

(i.e., EGF, IGF, FGF) to the low calcium media induces the proliferation of prostate
epithelial stem and TA cells neither of which expresses AR protein [27]. Under these
conditions, stem cells undergo asymmetric division to self-renew and also give rise to either
a minor population of progeny, which terminally differentiate into neuroendocrine cells or
more commonly into transit-amplifying (TA) cell progeny [5]. These TA cells undergo
several rounds of proliferation before eventually maturing into intermediate cells [5,25,27].
Such intermediate cells, however, do not complete their full maturation into AR-positive/
PSA-positive secretoryluminal cells in this low Ca2+ SFD medium [25]. Such full
maturation into secretory-luminal cells requires the addition of another stromally produced
andromedin, Keratinocyte growth factor [i.e., KGF aka FGF-7], and high cell density [22]
Under these conditions, the epithelium stratifies resulting in expression of AR in the upper
layer of cells, which in the presence of added androgen stop proliferating and produce PSA
[22]. In contrast, in low Ca2+ SFD medium containing paracrine growth factors but lacking
Author Manuscript

KGF, these normal human prostate epithelial cell (PrEC) remain AR negative and proliferate
rapidly [i.e., 45 hr doubling time] [25]. This situation is very different from that in vivo
where despite high level of paracrine growth factors present in the prostate of a non-
androgen ablated male, <1% of prostate epithelial cells are proliferating per day [15]. These
results suggest that the lack of androgen dependent AR signaling could be responsible for
the high proliferation rate of PrECs in vitro in low Ca2+ SFD medium without KGF.

To test this, both normal non-immortalized and telomerase-immortalized (i.e., hTERT)

PrECs were transduced with lentiviral (LV) GFP/AR constructs and GFP expressing
population isolated by FACs. The expression of AR protein in these cells was documented
by Western blots [21]. Immunocyochemical staining (IC) also documented that >98% of the
GFP positive cell co-expressed AR, which is present in both the cytoplasm and nuclei of
Author Manuscript

these transduced cells even without the addition of androgen to the serum free media [21].
Addition of a physiologic concentration of the synthetic androgen R1881 (i.e., 1 nM)
increases nuclear AR [21] and induces growth arrest of both AR-expressing non-
immortalized (i.e., PrEC-LVAR) and immortalized (i.e., PrEC-hTERT-LV-AR) cells, but has
no effect on such cells, which do not express AR (i.e., PrEC-LV-Control or PrEC-hTERT-
LV-Control) cells, Figure 1. Co-administering R1881 with the AR antagonist Casodex
blocks growth arrest of PrEC-hTERT-LV-AR cells demonstrating that this growth inhibition

Prostate. Author manuscript; available in PMC 2016 May 04.

 Antony et al. Page 7

is AR-dependent, Figure 1. Time-lapse microscopy demonstrates that androgen-dependent

Author Manuscript

AR signaling in PrEC-LV-AR and PrEC-hTERT-LV-AR cells results in irreversible

proliferative quiescence (i.e., terminal growth arrest). This androgen-dependent AR-induced
growth arrest is not due to cellular senescence as confirmed by the lack of expression of
senescence associated (SA) β-galactosidase. The observed androgen-dependent AR
signaling-induced growth arrest is consistently observed with a series (n = 4) of PrEC-LV-
AR cultures initiated from both a commercial source (i.e., donors less than 40 years of age)
as well as derived within our institution from patients undergoing radical prostatectomy (i.e.,
donors greater than 50 years of age).

To test whether AR-induced growth arrest is cell-context dependent and not a ubiquitous
cellular response, cultures of AR-positive normal non-immortalized human prostate stromal
cells (termed PrSCs) containing smooth muscle cells and fibroblasts were established from
fresh surgical material [26]. In addition, the immortalized but not transformed stromal
Author Manuscript

WPMY-1 cell line was also evaluated [38]. As expected, all of these prostate derived stromal
cells express detectable endogenous AR protein, which is stabilized by ligand [21]. In
contrast to PrEC cells, none of these independently derived stromal cell cultures is growth
inhibited by androgen-induced AR signaling [21]. These results document that AR-mediated
growth arrest of PrECs is cell-context dependent and not a ubiquitous cellular response.

Androgen-Dependent AR-Mediated Terminal G0 Growth Arrest and Differentiation of

Prostate Epithelial Cells Does Not Require Rb, p21, p27, Nor Down-Regulation of Growth
Factors Receptors
Flow cytometric DNA analysis documents that androgen-exposure of AR-expressing PrEC
cells induces their growth arrest in G0 [21]. Despite androgen-dependent growth arrest,
R1881-treated cells continue to remain viable with no increase in apoptosis as documented
Author Manuscript

both with flow cytometric DNA analysis (i.e., no sub-G0 population detected) as well as
time lapse microscopy. Such androgen-induced growth inhibition is associated with a
significant (P < 0.05) increase in the proportion of cells exiting cycle and arresting in G0, as
monitored by their lack of nuclear Ki67 expression, and undergoing differentiation, as
monitored both by down regulation of the basal marker ΔNp63 and an increase (P < 0.05) in
the mRNA expression for PSA, an androgen-regulated gene whose expression is
characteristic of differentiated prostatic secretory-luminal cells [21]. Androgen-dependent
AR-mediated growth arrest is distinctly different from growth arrest induced by growth
factor restriction, however, since growth factor restricted cells do not differentiate as
monitored by a lack of change in their ΔNp63 expression even though they growth arrest in
G0 as monitored by a decrease in nuclear Ki67 expression [21]. Such GF restriction-induced
growth arrest is reversible, however, since the re-addition of GFs stimulates subsequent
Author Manuscript

growth [27]. The decreased expression of the transit-amplifying specific marker ΔNp63
following androgen-dependent AR signaling induced growth arrest is significant for two
reasons. First, ΔNp63 is a marker of normal but not malignant prostate epithelial cells [39]
validating that these cells are derived from normal not malignant prostate epithelial cells.
Second, ΔNp63 protein expression decreases as PrECs differentiate into intermediate cells
[40].

Prostate. Author manuscript; available in PMC 2016 May 04.

 Antony et al. Page 8

Coincident with this androgen induced terminal growth arrest is a time dependent increase
Author Manuscript

of Cyclin-dependent kinase (Cdk) inhibitors p21 and p27 proteins coupled with a decrease in
Cyclin D1 and phospho-Rb [21]. Furthermore, decreased expression of the S-phase specific
protein p150 as well as the DNA licensing factor cdc6 is also observed [21]. RNAse
protection assays demonstrate, however, that the steady state level of p21, p27, and AR
mRNA remain unchanged throughout the growth arrest induced during the first 48 hr of
exposure to androgen [21]. In addition, shRNA knockdown documented that neither RB,
p21, p27 alone or in combination are required for such AR induced G0 growth arrest [21].

Removal of EGF, IGF-1, and FGFs from the serum free defined media arrests PrECs in G0
[27]. These ligands signal via their cognate receptors; EGFR or Erb1 for EGF and IGF-
Type1 receptor (IGF-1R) for IGFs and FGFR2 for FGFs. Western blot analysis documented
that androgen-dependent AR signaling in PrEC-hTERTLV-AR cells does not decrease the
expression of EGFR or IGFR proteins and instead elevates the expression of FGFR2-IIIB
Author Manuscript

protein [i.e., KGF receptor] without isotype switching [21]. Thus, androgen dependent AR-
mediated growth arrest of PrEC-AR cells does not involve repression of growth factor
receptor expression.

Androgen-Dependent AR-Mediated G0 Growth Arrest of Prostate Epithelial Cells Is

Dependent Upon Suppression of c-MYC Expression and Does Not Involve Nuclear FoxP3
Associated with the androgen induced growth arrest in PrEC-hTERT-LV-AR is a decrease in
c-MYC mRNA [21]. This transcriptional down-regulation results in a total loss of detectable
c-MYC protein from the nucleus and cytosol within 24 hr of androgen treatment [21]. Such
a decrease in c-MYC transcription could be either a consequence of growth arrest or causal,
inducing such growth arrest. To resolve this, PrEC-hTERT-LV-AR cells were transduced
(RV-c-MYC) and drug selection (i.e., blastacidin) used to isolate cells, which stably
Author Manuscript

transcribe c-MYC m-RNA constitutively even when androgen is added to the media [21].
Indeed, stable constitutive c-MYC transcription abrogated the cell proliferation block
induced by androgen-activated AR. This is demonstrated by an increase in cell growth,
Figure 2. These data demonstrate that down regulation of c-MYC transcription is required
for androgen-dependent AR mediated growth arrest of normal prostate epithelial cells.

To test the causal relationship between nuclear c-MYC transcription and proliferation of
basal PrECs induce in low Ca2+-serum free/growth factor supplemented media, lentiviral c-
MYC shRNA was used to stably knock down c-Myc by >90%, Figure 3A. c-MYC knock
down results in essentially complete inhibition (P < 0.05) of PrECs growth, Figure 3B.

Previous studies reported that FoxP3 is a tumor suppressor for prostate epithelial cells via its
Author Manuscript

ability to bind to the c-MYC promoter repressing its transcription [41]. Therefore, PrEC-
hTERT-LV-AR cells were treated with androgen and the cells analyzed for their nuclear level
of FoxP3 protein. The results of these studies documented that when PrEC-hTERT-LV-AR
cells are growing without androgen, FoxP3 is present only in the cytosol and that androgen
treatment does not result in nuclear localization of FoxP3 even though these androgen
treated cells down regulate their c-MYC transcription and arrest in G0, Figure 4.

Prostate. Author manuscript; available in PMC 2016 May 04.

 Antony et al. Page 9

β-Catenin/TCF-4 Complex Binding to 5′ Plus 3′ c-MYC Enhancers are Required for c-MYC
Author Manuscript

Transcription and Growth of Prostate Epithelial Cells

In a cell context dependent manner, β-catenin enters the nucleus, binds to TCF-4 complexes
displacing corepressors (e.g., Groucho), thus converting β-catenin/TCF-4 complexes from a
repressor to an activator of c-MYC transcription [31]. In PrECs, the majority (i.e., ~90%) of
β-catenin is cytoplasmic, however, ~10% is within the nucleus, Figure 5A. These Western
blot results are consistent with IHC analysis, which documents that besides its plasma
membrane localization, a fraction of the β-catenin is also present within the nuclei of
growing PrECs, Figure 5B. To test whether nuclear β-catenin/TCF-4 complexes are formed
during PrEC growth, co-immunoprecipitation (co-IP) was performed on nuclear extracts
using an antibody specific for TCF-4. These studies document that in growing PrEC cells, β-
catenin/TCF-4 complexes are detectable in the nuclei of these cells, Figure 5A. Once
formed, such nuclear β-catenin/TCF-4 complexes can bind to genomic DNA at enhancers
Author Manuscript

located at close proximity to both the 5′ and 3′ c-MYC gene boundaries [32] and form a
chromatin loop between the 5′ and 3′ enhancer driving c-MYC transcription [42]. To
determine whether such nuclear β-catenin/TCF-4 complexes bind 5′ and/or 3′ c-MYC
enhancers, chromatin-IP (ChIP) analyses using TCF-4 antibody was performed. These
studies document that TCF-4 binds to the 5′ and 3′ c-MYC enhancer in growing PrECs,
Figure 6A.

To determine if such binding of β-catenin/TCF-4 complexes induces c-MYC transcription,

PrECs were transiently transfected with a luciferase construct driven by either 5′ c-MYC
enhancer, 3′ c-MYC enhancer, 5′ enhancer in front of the luciferase gene followed by the 3′
enhancer (i.e., 5′ plus 3′ c-MYC enhancers), or loss of function mutated 5′ enhancer in front
of the luciferase gene followed by the loss of function mutated 3′ enhancer, and the
bioluminescence determined for each construct. These results documented that in growing
Author Manuscript

PrECs, there is no enhancement of luciferase expression in the cells transfected with wild
type 5′ c-Myc. In contrast, there is a 25.8 ± 3.5 fold (P < 0.05) increase in luciferase
expression in cells transfected with 3′ c-Myc enhancer compared to the loss of function
mutated 5′ enhancer in front of the luciferase gene followed by the loss of function mutated
3′ enhancer construct. Interestingly, when cells were transfected with a construct containing
the 5′enhancer in front of the luciferase gene followed by the 3′ enhancer, luciferase
expression was increased (P < 0.05) even more [i.e., 38.4 ± 5.5 fold compared to loss of
function mutated 5′ enhancer in front of the luciferase gene followed by the loss of function
mutated 3′ enhancer construct]. These results are consistent with formation of a chromatin
loop between the 5′ and 3′ enhancer being required for maximal c-MYC transcription in
prostate epithelial cells.
Author Manuscript

To determine whether such 5′ plus 3′ c-MYC enhancer driven expression requires binding of
β-catenin/TCF-4 complexes, the 5′ plus 3′ c-MYC enhancer driven luciferase reporter
response was evaluated with or without co-treatment with a small molecule inhibitor (i.e.,
toxoflavin), which specifically prevents β-catenin binding to TCF-4 [43]. These studies
document that 500 nM toxoflavin decreases (P < 0.05) 5′ 3′ c-MYC enhancer driven reporter
expression in PrECs, Figure 6B. Co-incidentally, this dose of toxoflavin inhibited the growth
of PrECs, Figure 6C. Such toxoflavin growth inhibition was confirmed in a series of five

Prostate. Author manuscript; available in PMC 2016 May 04.

 Antony et al. Page 10

independently derived non-immortalized PrECs. Importantly, such toxoflavin-induced

Author Manuscript

growth inhibition is overcome when the cells are transduced to constitutive express c-MYC
(i.e., RV-c-MYC) in a β-catenin/TCF-4 independent manner, Figure 2. To confirm that
toxoflavin’s ability to inhibit c-MYC transcription and growth is not an off-target effect,
these responses were evaluated on PrECs exposed to a second small molecule inhibitor,
XAV939, which selectively restricts β-catenin-mediated transcription via a mechanism
distinct from that of toxoflavin. XAV939 stimulates β-catenin degradation by inhibiting
tank-yrases, which stabilizes axin, the rate-limiting component of β-catenin degradation
[44]. Like the situation with toxoflavin, treatment of PrECs with XAV939 profoundly
inhibits their growth, Figure 6D.

As an additional validation of the causal role of the β-catenin/TCF-4 complex in c-MYC

driven proliferation of PrECs, appropriate lentiviral shRNAs was used to stably knock down
either β-catenin or TCF-4 by >85%, Figure 3A. Knock down of either genes results in
Author Manuscript

essentially complete inhibition (P < 0.05) of PrECs growth, Figure 3B.

Nuclear Translocation of β-Catenin in PrECs Is Induced by a Wnt-Independent Akt

Signaling Pathway
Nuclear translocation of β-catenin needed for β-catenin/TCF-4 complex formation can occur
via both Wnt-dependent and independent pathways [45]. In the absence of growth factor
signaling, cytoplasmic β-catenin interacts with axin, glycogen synthase kinase-3β (GSK-3β),
and the adenomatous polyposis coli (APC) protein. Within this complex, β-Catenin is
phosphorylated in its N-terminal domain at serines 31 and 33 and threonine 41 by GSK-3β
leading to its degradation via the ubiquitin/proteasome pathway. Wnt receptor activation
inhibits GSK-3β-dependent phosphorylation of β-catenin allowing N-terminal
hypophosphorylated β-catenin to translocates to the nucleus, where it interacts with
Author Manuscript

transcription factors of the TCF-4 [46]. To resolve whether a Wnt-dependent pathway is

involved, PrEC-hTERT-ARs were treated with recombinant DKK1 protein at a dose, which
totally inhibits activation of the canonical Wnt signaling pathway [47]. The results
documented that growth of these cells is not inhibited by DKK1 treatment, Figure 6C.

Feng et al. [45] documented that as an alternative to Wnt activation, β-catenin translocation
can be induced by other growth factors, such as EGF, IGF, etc., via activation of Akt since
activated Akt can elevate the level of N-terminal hypophosphorylated β-catenin through
phosphorylation and thus inhibition of GSK-3β and/or by directly phosphorylating β-catenin
at serine 552, resulting in its disassociation from cell to cell contacts and nuclear
translocation. Previously, we documented that removal of EGF, IGF-1, and FGFs from the
serum free defined media arrests PrECs in G0 [25,27,48]. Associated with this growth arrest
Author Manuscript

is loss of activated (i.e., phosphorylated) Akt [48]. Conversely, when PrECs growing in
serum free media containing these growth factors are treated with a small molecule AKT
inhibitor, they are growth arrested [48]. Like PrEC cell, PrEC-hTERT-AR cells are also
growth inhibited even without the addition of androgen by both removal of the growth
factors from the media and by treatment with the 20 μM Akt inhibitor, which is overcome
when the cells are transduced to constitutive express RV-c-Myc in a β-catenin/TCF-4
independent manner, Figure 6C.

Prostate. Author manuscript; available in PMC 2016 May 04.

 Antony et al. Page 11

To determine whether β-catenin/TCF-4 signaling is Akt dependent, nuclear extracts from

Author Manuscript

PrEC-hTERT-AR cells growth arrested by either treatment with Akt inhibitor or by

maintenance in serum free media without added growth factors versus growing in media
containing growth factors were evaluated by Western blots. For these analyses, two different
anti-β-catenin antibodies were used. The first antibody (termed anti-ABC) only binds β-
catenin when it is non-phosphorylated in serine 31 and 33 and threonine 41 [46]. The second
antibody (termed anti-phos-S552) binds β-catenin when it is phosphorylated at serine 552
[45]. These results document that β-catenin is present within the nucleus of paracrine growth
factor simulated, growing PrEC-hTERT-AR cells (i.e., denoted either as control or +GF)
where it is non-phosphorylated at serine 31 and 33 and threonine 41, but phosphorylated at
serine 552, Figure 7. In contrast, β-catenin is reduced by >90% within the nucleus of growth
arrested PrEC-hTERT-AR cells induced by either Akt inhibitor (i.e., denoted AIN) or
removal of the growth factors (i.e., denoted-GF) using either antibodies, Figure 7. These
results document that activated Akt is the major regulator of β-catenin nuclear trans-location
Author Manuscript

in PrECs induced by paracrine growth factors.

Androgen-Dependent Suppression of c-MYC Transcription in Prostate Epithelial Cells

Requires Binding of β-Catenin/TCF-4 Complexes to the Zinc-Finger Domain of AR
To determine whether the mechanism for androgen dependent c-Myc down regulation in AR
expressing PrECs involves a decrease in β-catenin/TCF-4 complex formation, TCF-4 co-IP
was performed. These studies document that exposure to androgen did not prevent formation
of nuclear β-catenin/TCF-4 complexes in androgen induced growth arrested PrECs
expressing wild type AR, Figure 4. Also, β-catenin is still non-phosphorylated at serine 31
and 33 and threonine 41, but phosphorylated at serine 552 within the nucleus of these
androgen-induced growth arrested PrEC-hTERT-AR cells [i.e., denoted +R1881], Figure 7.
Author Manuscript

Such androgen exposure, however, did result in AR binding to nuclear β-catenin/TCF-4

complexes in growth arrested PrECs expressing AR, Figure 4. These results are consistent
with the previous documentation that both β-catenin and TCF-4 bind AR in an androgen-
dependent manner [49–51]. AR binds via its ligand-binding domain (LBD) to sequences
encoded by exon-3 of β-catenin [52]. Binding toTCF-4 is via the zinc finger domain of AR
[53].

To test whether AR binding to TCF-4 is required to inhibit the growth of PrECs, cells
expressing a loss of function zinc-finger mutant AR [i.e., AR(A573D)] were tested for their
growth response to androgen and ability to form AR/β-catenin/TCF-4 complexes. These
PrEC-hTERT-AR(A573D) cells express a loss of function zinc-finger domain mutant AR,
which still translocates into the nucleus upon exposure to androgen, Figure 4. In contrast to
the situation for PrECs expressing wild type AR, androgen treatment of PrEC-hTERT-
Author Manuscript

AR(A573D) cells does not result in formation of AR/β-catenin/TCF-4 complexes, Figure 4,

nor does it inhibit growth, Figure 1. These data document that AR-mediated growth arrest of
prostate epithelial cells requires ligand dependent AR binding via its zinc-finger domain to
TCF-4 to suppress c-Myc transcription.

ChIP analysis documented that this androgen-dependent suppression of c-MYC transcription

is not due to inhibition of AR/β-catenin/TCF-4 complexes binding to the 3′ c-Myc enhancer

Prostate. Author manuscript; available in PMC 2016 May 04.

 Antony et al. Page 12

in androgen treated cells, but is associated with a decrease of binding to the 5′ c-MYC
Author Manuscript

enhancer, Figure 6A. This latter effect is associated with suppression of 5′ plus 3′ c-MYC
reporter expression in androgen treated cells, Figure 6A. These results are consistent with
binding of AR to the β-catenin/TCF-4 complex retarding the formation of the chromatin
loop between the 5′ and 3′ enhancers thus suppressing c-MYC transcription.

In Vivo β-Catenin Is Present in Nuclei of Terminally Differentiated Prostatic Secretory-

Luminal Cells, Which Co-Express Nuclear AR, But Not c-MYC
Previous studies have documented that in the prostate of an adult male, cell proliferation is
very low [i.e., <1% of epithelial cells are Ki67 positive] [15] and predominantly occurring in
basal epithelial cell despite the continuous presence of high levels of andromedins [16,17].
Thus, the results of the present studies predicts that in prostate of such an adult male, only
the small number of proliferating basal cells should express nuclear c-MYC protein and
Author Manuscript

these cells should not be express nuclear AR. In contrast, the terminally differentiated,
proliferatively quiescent, prostatic secretory-luminal epithelial cells should express nuclear
β-catenin plus AR and, but not nuclear c-MYC protein. To test these predictions, prostate
tissues harvested from non-androgen ablated patients without culturing were analyzed by
IHC or IF staining using appropriately validated antibodies. As predicted, these analyses
documented that only a rare basal cell expresses active β-catenin, Figure 8-upper panel, and
c-MYC Figure 8-lower left panel denoted by arrow in their nuclei and that these positive
basal cells are AR negative, Figure 8-lower middle panel denoted by arrow with the vast
majority of basal cells being negative for all three markers as predicted, Figure 8 lower right
panel denoted by arrow heads. In contrast, essential all of the terminally differentiated,
proliferatively quiescent, secretory-luminal cells express activated nuclear β-catenin, Figure
8-upper panel, and nuclear AR, Figure 8-lower middle panel, but not express c-MYC, Figure
Author Manuscript

8-lower left panel also as predicted.

DISCUSSION
The present studies documents that the growth of non-transformed adult human prostate
epithelial cells is dependent upon c-MYC transcription, which is stimulated by nuclear β-
catenin/TCF-4 complex binding to 5′ and 3′ enhancer elements in the c-MYC gene. Such
formation of nuclear β-catenin/TCF-4 complex is dependent upon Wnt-independent Akt
kinase dependent phosphorylation of β-catenin at serine 552 induced by paracrine growth
factors. In an adult male with a physiological normal level of circulation androgen, these
paracrine factors are continuously produced by the prostatic stromal cells and are thus
chronically present at high levels within the gland. Prostatic epithelial hyperplasia is
prevented despite chronic high levels of these paracrine growth factors by androgen
Author Manuscript

dependent AR signaling within the epithelial cells, which suppresses their proliferation.
Such androgen dependent AR signaling induces the G0 growth arrest of non-transformed
human prostate epithelial cells and directs their differentiation along a pathway to ΔNp63
negative, PSA-expressing secretory-luminal cells. The mechanism for such G0 growth arrest
involves androgen dependent binding of AR to β-catenin/TCF-4 complexes suppressing c-
MYC transcription.

Prostate. Author manuscript; available in PMC 2016 May 04.

 Antony et al. Page 13

Besides the present prostate studies, there are additional reports demonstrating that androgen
Author Manuscript

dependent AR signaling induces growth suppression and terminal differentiation in other

normal human epithelial cell types. For example, ligand-dependent endogenous AR
signaling suppresses growth of adrenocortical and thyroid epithelial cells, which is likewise
associated with a down regulation of c-MYC transcription [54,55]. Such AR signaling
induced growth arrest is cell-context dependent, however, and not a ubiquitous cellular
response. This is documented by the observations of the present studies that androgen
dependent signaling is not growth inhibitory to prostate stromal cells.

The conclusion that c-MYC transcriptional down regulation induced suppression of

proliferation is a major normal function of androgen-dependent AR signaling in prostatic
epithelial cells is supported by additional observations. For example, constitutive targeted
expression of floxed exon-3 deletion, dominant activating (DA), in AR-positive secretory-
luminal epithelial cells via AR-driven CRE robustly induces prostatic hyperplasia in mice
Author Manuscript

[56–58]. These results are supportive since AR does not bind β-catenin if exon 3 encoded
sequences are deleted [53] and thus AR cannot down regulate c-MYC transcription in these
secretory-luminal cells expressing DA mutant β-catenin. This inability of AR to down
regulate c-MYC results in the development of high-grade intraepithelial neoplasia (HGPIN),
but not invasive cancer in the mouse [56–58]. In contrast to the hyperplasia/HGPIN induced
in these exon-3 deleted DA β-catenin transgenic mice models in which constitutive c-MYC
transcription is maintained in an AR independent manner, invasive adenocarcinomas are
produced when c-MYC transcription is transgenically driven in rodent prostatic
secretoryluminal cells by androgen occupied AR [59] These latter results suggest that
malignant transformation of prostatic secretory-luminal cells requires additional events
besides c-Myc expression, which androgen occupied AR stimulates.
Author Manuscript

Using IHC analysis of human prostate tissues, elevated c-MYC protein expression occurs
very early during prostatic carcinogenesis (i.e., detectable in PIA and PIN lesions in addition
to frank cancer) in cells that co-express AR and cell proliferation marker Ki67 [34].
Elevation of c-MYC expression in AR expressing transformed prostate cells is thus
paradoxical to the situation in the normal prostate where c-MYC protein is undetectable in
Ki67 negative/AR expressing luminal cells even though AR is signaling as documented by
these cells expressing the AR dependent protein, PSA. These results are consistent with
studies demonstrating that for prostate cancer to develop; malignant cells must loss AR
dependent growth suppression and that this can occur independently from acquiring
oncogenic addiction to AR induced growth stimulation [60]. During prostate carcinogenesis,
however, the majority of human prostate cancers characteristically not only loose AR
dependent growth suppression, but acquire oncogenic addiction to androgen dependent AR
Author Manuscript

signaling for their growth [21,61]. This gain of oncogenic function is the basis for the use of
androgen ablation (i.e., castration) therapy for metastatic prostate cancer [62]. Associated
with this addiction, androgen-dependent AR signaling no longer inhibits but instead
stimulates c-Myc expression; however, this is via a non-transcriptional effect upon c-MYC
protein stability [63]. While these combined results document that AR signaling is
characteristically subverted from a growth suppressor to a growth stimulatory function in
prostate cancers [21], they do not clarify at what point in the carcinogenic process this
occurs. There are clinical data, which emphasize the critical importance of resolving this

Prostate. Author manuscript; available in PMC 2016 May 04.

 Antony et al. Page 14

issue since the answer has significant clinical implications for the use of androgen
Author Manuscript

deprivation as therapy for prevention verses treatment of prostate cancer.

For example, male dogs are often neutered at a young age and such long-term androgen
deprivation is associated with an increase incidence of developing symptomatic prostate
cancer and death [64]. Two large, randomized controlled human trials, the prostate cancer
prevention trial (PCPT) [65] and the reduction by dutasteride of prostate cancer events
(REDUCE) trial [66] evaluated daily use of 5α-reductase inhibitors for the reduction in the
risk of prostate cancer in men at least 50 years of age. The trials demonstrated an overall
25% reduction in prostate cancer diagnoses with 5α-reductase inhibitor treatment. This
overall reduction was due to a decreased incidence of lower risk (i.e., Gleason score 6)
prostate cancers. However, both trials showed an increased incidence of high-grade (i.e.,
Gleason score >7) prostate cancer with 5α-reductase inhibitor treatment. These data suggest
that: (1) Gleason 6 prostate cancer cells are still dependent upon AR mediated stromal
Author Manuscript

production of andromedin and therefore androgen ablation therapy by inhibiting andromedin

production inhibits their growth, and (2) in contrast, higher Gleason score cancer cells
acquire AR mediated ability to produce their own autocrine growth factors, but a subset of
these high grade cancers still retain the AR-dependent negative regulation of c-MYC
transcription and thus androgen ablation removes this growth constraint. Presently, this
concept is being tested experimentally in pre-clinical models, which form the basis of a
clinical trial using rapid cycling of super-physiologic androgen to stimulate growth
constraint followed by rapid androgen ablation to restrict autocrine growth factor production
in men with castration resistant metastatic prostate cancer [67,68].

ACKNOWLEDGMENTS
Author Manuscript

We wish to acknowledge the expert technical assistance of Lee Blosser and Ada Tam of the Johns Hopkins School
of Medicine Flow Sorting Facility (i.e., supported by NIH Grant U54CA091409) for their assistance. We also wish
to thank Angelo De Marzo and Alan Meeker, Department of Pathology and Helen Fedor and the Brady Urological
Institute Prostate Specimen Repository supported by the NIH-Prostate SPORE Grant (P50 CA058236) for Tissue
Microarrays and Jessica Hicks of the Comprehensive Cancer Center Histology Core (i.e., supported by NIH Grant
U54CA091409) for immuno-cytochemical staining. We wish to thank Gregory S. Yochum, Pennsylvania State
University, College of Medicine for generously supplying the c-Myc enhancer reporter constructs and Dr. Hetty van
der Korput, Department of Pathology, Erasmus University Medical Centre, Rotterdam, The Netherlands for
generously providing the A573D AR mutant vector.

Grant sponsor: NIH; Grant numbers: R01DK52645; U54CA091409; Grant sponsor: NIH-Prostate SPORE; Grant
number: P50 CA058236; Grant sponsor: Maryland Stem Cell Research Fund; Grant number: MSCRFII-0428-00.

Abbreviations

AR androgen receptor
Author Manuscript

ARE androgen response element

DHT dihydrotestosterone
FBS fetal bovine serum
FACS fluorescence activated cell sorting
GFP green fluorescence protein

Prostate. Author manuscript; available in PMC 2016 May 04.

 Antony et al. Page 15
Author Manuscript

hTERT human telomerase

PrEC prostate epithelial cell
PSA prostate specific antigen

REFERENCES
1. Berry SJ, Coffey DS, Walsh PC, Ewing LL. The development of human benign prostatic hyperplasia
with age. J Urol. 1984; 132:474–479. [PubMed: 6206240]
2. Siegel R, Ward E, Brawley O, Jemal A. Cancer statistics. 2011:the impact of eliminating
socioeconomic and racial disparities on premature cancer deaths. CA Cancer J Clin. 2011; 61:212–
236. [PubMed: 21685461]
3. Kyprianou N, Isaacs JT. Activation of programmed cell death in the rat ventral prostate after
castration. Endocrinology. 1988; 122:552–562. [PubMed: 2828003]
Author Manuscript

4. Isaacs, JT. Control of cell proliferation and cell death in the normal and neoplastic prostate: A stem
cell model. U.S. Dept. of Health and Human Services; 1987. NIH Publication # 87-2881
5. Isaacs JT. Prostate stem cells and benign prostatic hyperplasia. Prostate. 2008; 68:1025–1034.
[PubMed: 18386293]
6. Leong KG, Wang BE, Johnson L, Gao WQ. Generation of a prostate from a single adult stem cell.
Nature. 2008; 456:804–808. [PubMed: 18946470]
7. Vander Griend DJ, Karthaus WK, Dalrymple S, Meeker AK, De Marzo AM, Isaacs JT. The role of
CD133 in normal human prostate stem cells and malignant cancer initiating cells. Cancer Res. 2008;
68:9703–9711. [PubMed: 19047148]
8. Wang X, Julio MK, Economides KD, Walker D, Yu H, Halili MV, Hu YP, Price SM, Abate-Shen C,
Shen MM. A luminal epithelial stem cell that is a cell of origin for prostate cancer. Nature. 2009;
461:495–500. [PubMed: 19741607]
9. Goldstein AS, Huang J, Guo C, Garraway IP, Witte ON. Identification of a cell of origin for human
prostate cancer. Science. 2010; 329:568–571. [PubMed: 20671189]
Author Manuscript

10. Cunha GR, Chung LW, Shannon JM, Taguchi O, Fujii H. Hormone-induced morphogenesis and
growth: Role of mesenchymal–epithelial interactions. Recent Prog Horm Res. 1983; 39:559–598.
[PubMed: 6314450]
11. Yan G, Fukabori Y, Nikolaropoulos S, Wang F, McKeehan WL. Heparin-binding keratinocyte
growth factor is a candidate stromal-to-epithelial-cell andromedin. Mol Endocrinol. 1992; 6:2123–
2128. [PubMed: 1491693]
12. Lu W, Luo Y, Kan M, McKeehan WL. Fibroblast growth factor-10. A second candidate stromal to
epithelial cell andromedin in prostate. J Biol Chem. 1999; 274:12827–12834. [PubMed:
10212269]
13. Le H, Arnold JT, McFann KK, Blackman MR. DHT and testosterone, but not DHEA or E2,
differentially modulate IGF-I, IGFBP-2, and IGFBP-3 in human prostatic stromal cells. Am J
Physiol Endocrinol Metab. 2006; 290:E952–E960. [PubMed: 16368782]
14. Ohlson N, Bergh A, Persson ML, Wikstrom P. Castration rapidly decreases local insulin-like
growth factor-1 levels and inhibits its effects in the ventral prostate in mice. Prostate. 2006;
66:1687–1697. [PubMed: 16998818]
Author Manuscript

15. Berges RR, Vukanovic J, Epstein JI, CarMichel M, Cisek L, Johnson DE, Veltri RW, Walsh PC,
Isaacs JT. Implication of cell kinetic changes during the progression of human prostatic cancer.
Clin Cancer Res. 1995; 1:473–480. [PubMed: 9816006]
16. Bonkhoff H, Srein U, Remberger K. The proliferative function of basal cells in the normal and
hyperplastic human prostate. Prostate. 1994; 24:114–118. [PubMed: 7509483]
17. De Marzo AM, Meeker AK, Epstein JI, Coffey DS. Prostate stem cell compartments: Expression
of the cell cycle inhibitor p27Kip1 in normal, hyperplastic, and neoplastic cells. Am J Pathol.
1998; 153:911–919. [PubMed: 9736039]

Prostate. Author manuscript; available in PMC 2016 May 04.

 Antony et al. Page 16

18. Ling MT, Chan KW, Choo CK. Androgen induces differentiation of a human papillomavirus 16
E6/E7 immortalized prostate epithelial cell line. J Endocrinol. 2001; 170:287–296. [PubMed:
Author Manuscript

11431162]
19. Whitacre DC, Chauhan S, Davis T, Gordon D, Cress AE, Miesfeld RL. Androgen induction of in
vitro prostate cell differentiation. Cell Growth Differ. 2002; 13:1–11. [PubMed: 11801526]
20. Berger R, Febbo PG, Majumder PK, Zhao J, Mukherjee S, Signoretti S, Campbell K, Sellers WR,
Roberts TM, Loda M, Golub TR, Hahn WC. Androgen-induced differentiation and tumorigenicity
of human prostate epithelial cells. Cancer Res. 2004; 64:8867–8875. [PubMed: 15604246]
21. Vander Greind DJ, Litvinov IV, Isaacs JT. Conversion of androgen receptor signaling from a
growth suppressor in normal prostate epithelial cells to an oncogene in prostate cancer cells
involves a gain in c-Myc regulation. Int J Biol Sci. 2014 (in press).
22. Lamb LE, Knudsen BS, Miranti CK. E-cadherin-mediated survival of androgen-receptor-
expressing secretory prostate epithelial cells derived from a stratified in vitro differentiation model.
J Cell Sci. 2010; 123:266–276. [PubMed: 20048343]
23. Simanainen U, McNamara K, Gao YR, Handelsman DJ. Androgen sensitivity of prostate
epithelium is enhanced by postnatal androgen receptor in activation. Am J Physiol Endocrinol
Author Manuscript

Metab. 2009; 296:E1335–E1343. [PubMed: 19366880]

24. Wu CT, Altuwaijri S, Ricke WA, Huang SP, Yeh S, Zhang C, Niu Y, Tsai MY, Chang C. Increased
prostate cell proliferation and loss of cell differentiation in mice lacking prostate epithelial
androgen receptor. Proc Natl Acad Sci USA. 2007; 104:12679–12684. [PubMed: 17652515]
25. Litvinov IV, Vander Griend DJ, Xu Y, Antony L, Dalrymple SL, Isaacs JT. Low-calcium serum-
free defined medium selects for growth of normal prostatic epithelial stem cells. Cancer Res. 2006;
66:8598–8607. [PubMed: 16951173]
26. Gao J, Arnold JT, Isaacs JT. Conversion from a paracrine to an autocrine mechanism of androgen-
stimulated growth during malignant transformation of prostatic epithelial cells. Cancer Res. 2001;
61:5038–5044. [PubMed: 11431338]
27. Uzgare AR, Xu Y, Isaacs JT. In vitro culturing and characteristics of transit amplifying epithelial
cells from human prostate tissue. J Cell Biochem. 2004; 91:196–205. [PubMed: 14689591]
28. Litvinov IV, Vander Griend DJ, Antony L, Dalrymple SL, Becker R, Cheng L, Isaacs JT. PC3, but
not DU145, human prostate cancer cells retain the coregulators required for tumor suppressor
ability of androgen receptor. Prostate. 2006; 66:1329–1338. [PubMed: 16835890]
Author Manuscript

29. Farla P, Hersmus R, Trapman J, Houtsmuller AB. Antiandrogens prevent stable DNA-binding of
the androgen receptor. J Cell Sci. 2005; 118:4187–4198. [PubMed: 16141232]
30. Halfter H, Friedrich M, Resch A, Kullmann M, Stogbauer F, Ring’elstein EB, Hengst L.
Oncostatin M induces growth arrest by inhibition of Skp2, Cks1, and cyclin A expression and
induced p21 expression. Cancer Res. 2006; 66:6530–6539. [PubMed: 16818624]
31. He TC, Sparks AB, Rago C, Hermeking H, Zawel L, da Costa LT, Morin PJ, Vogelstein B, Kinzler
KW. Identification of c-MYC as a target of the APC pathway. Science. 1998; 281:1509–1512.
[PubMed: 9727977]
32. Yochum GS, Cleland R, Goodman RH. A genome-wide screen for beta-catenin binding sites
identifies a downstream enhancer element that controls c-Myc gene expression. Mol Cell Biol.
2008; 28:7368–7379. [PubMed: 18852287]
33. Nelson JD, Denisenko O, Bomsztyk K. Protocol for fast chromatin immunoprecipitation (ChIP)
method. Nat Protoc. 2006; 1:179–185. [PubMed: 17406230]
34. Gurel B, Iwata T, Koh CM, Jenkins RB, Lan F, Van Dang C, Hicks JL, Morgan J, Cornish TC,
Author Manuscript

Sutcliffe S, Isaacs WB, Luo J, De Marzo AM. Nuclear MYC protein over expression is an early
alteration in human prostate carcinogenesis. Mod Pathol. 2008; 21:1156–1167. [PubMed:
18567993]
35. Jarrard DF, Sarkar S, Shi Y, Yeager TR, Magrane G, Kinoshita H, Nassif N, Meisner L, Newton
MA, Waldman FM, Reznikoff CA. p16/pRb pathway alterations are required for bypassing
senescence in human prostate epithelial cells. Cancer Res. 1999; 59:2957–2964. [PubMed:
10383161]

Prostate. Author manuscript; available in PMC 2016 May 04.

 Antony et al. Page 17

36. Dalrymple S, Antony L, Xu Y, Uzgare AR, Arnold JT, Savaugeot J, Sokoll LJ, De Marzo AM,
Isaacs JT. Role of notch-1 and e-cadherin in the differential response to calcium in culturing
Author Manuscript

normal versus maligannt prostate cells. Cancer Res. 2005; 65:9269–9279. [PubMed: 16230388]
37. Edick MJ, Tesfay L, Lamb LE, Knudsen BS, Miranti1 CK. Inhibition of integrin-mediated
crosstalk with epidermal growth factor receptor/Erk or Src signaling pathways in autophagic
prostate epithelial cells induces caspase-independent death. Mol Biol Cell. 2007; 18:2481–2490.
[PubMed: 17475774]
38. Webber MM, Trakul N, Thraves PS, Bello-DeOcampo D, Chu WW, Storto PD, Huard TK, Rhim
JS, Williams DE. A human prostatic stromal myofibroblast cell line WPMY-1: A model for
stromal–epithelial interactions in prostatic neoplasia. Carcino-genesis. 1999; 20:1185–1192.
39. Parsons JK, Gage WR, Nelson WG, De Marzo AM. p63 protein expression is rare in prostate
adenocarcinoma: Implications for cancer diagnosis and carcinogenesis. Urology. 2001; 58:619–
624. [PubMed: 11597556]
40. Tran CP, Lin C, Yamashiro J, Reiter RE. Prostate stem cell antigen is a marker of late intermediate
prostate epithelial cells. Mol Cancer Res. 2002; 1:113–121. [PubMed: 12496358]
41. Wang L, Liu R, Li W, Chen C, Katoh H, Chen GY, McNally B, Lin L, Zhou P, Zuo T, Cooney KA,
Author Manuscript

Liu Y, Zheng P. Somatic single hits inactivate the X-linked tumor suppressor FOXP3 in the
prostate. Cancer Cell. 2009; 16:336–346. [PubMed: 19800578]
42. Yochum GS, Sherrick CM, Macpartlin M, Goodman RH. A beta-catenin/TCF-coordinated
chromatin loop at MYC integrates 5′ and 3′ Wnt responsive enhancers. Proc Natl Acad Sci USA.
2010; 107:145–150. [PubMed: 19966299]
43. Lepourcelet M, Chen YN, France DS, Wang H, Crews P, Petersen F, Bruseo C, Wood AW,
Shivdasani RA. Small-molecule antagonists of the oncogenic TCF/beta-catenin protein complex.
Cancer Cell. 2004; 5:91–102. [PubMed: 14749129]
44. Huang SM, Mishina YM, Liu S, Cheung A, Stegmeier F, Michaud GA, Charlat O, Wiellette E,
Zhang Y, Wiessner S, Hild M, Shi X, Wilson CJ, Mickanin C, Myer V, Fazal A, Tomlinson R,
Serluca F, Shao W, Cheng H, Shultz M, Rau C, Schirle M, Schlegl J, Ghidelli S, Fawell S, Lu C,
Curtis D, Kirschner MW, Lengauer C, Finan PM, Tallarico JA, Bouwmeester T, Porter JA, Bauer
A, Cong F. Tankyrase inhibition stabilizes axin and antagonizes Wnt signaling. Nature. 2009;
461:614–620. [PubMed: 19759537]
45. Fang D, Hawke D, Zheng Y, Xia Y, Meisenhelder J, Nika H, Mills GB, Kobayashi R, Hunter T, Lu
Author Manuscript

Z. Phosphorylation of β-catenin by AKT promotes β-catenin transcriptional activity. J Biol Chem.

2007; 282:11221–11229. [PubMed: 17287208]
46. Staal FJ, Noort MM, Strous GJ, Clevers HC. Wnt signals are transmitted through N-terminally
dephosphorylated beta-carenin. EMBO Rep. 2002; 3:63–68. [PubMed: 11751573]
47. Bafico A, Liu G, Yaniv A, Gazit A, Aaronson SA. Novel mechanism of Wnt signalling inhibition
mediated by Dickkopf-1 interaction with LRP6/arrow. Nat Cell Biol. 2001; 3:683–686. [PubMed:
11433302]
48. Uzgare AR, Isaacs JT. Enhanced redundancy in Akt and mitogen-activated protein kinase-induced
survival of malignant versus normal prostate epithelial cells. Cancer Res. 2004; 64:6190–6199.
[PubMed: 15342404]
49. Truica CI, Byers S, Gelmann EP. Beta-catenin affects androgen receptor transcriptional activity and
ligand specificity. Cancer Res. 2000; 60:4709–4713. [PubMed: 10987273]
50. Chesire DR, Isaacs WB. Ligand-dependent inhibition of beta-catenin/TCF signaling by androgen
receptor. Oncogene. 2002; 21:8453–8469. [PubMed: 12466965]
Author Manuscript

51. Mulholland DJ, Read JT, Rennie PS, Cox ME, Nelson CC. Functional localization and competition
between the androgen receptor and T-cell factor for nuclear beta-catenin: A means for inhibition of
the Tcf signaling axis. Oncogene. 2003; 22:5602–5613. [PubMed: 12944908]
52. Yang F, Li X, Sharma M, Sasaki CY, Longo DL, Lim B, Sun Z. Linking beta-catenin to androgen-
signaling pathway. J Biol Chem. 2002; 27:11336–11344. [PubMed: 11792709]
53. Amir A, Barua M, McKnight N, Cheng S, Yuan X, Balk SP. A direst beta-catenin-independent
interaction between androgen receptor and T cell factor 4. J Biol Chem. 2003; 278:30828–30834.
[PubMed: 12799378]

Prostate. Author manuscript; available in PMC 2016 May 04.

 Antony et al. Page 18

54. Rossi R, Zatelli MC, Franceschetti P, Maestri I, Magri E, Aguiari G, Cavazzini P, degli Uberti EC,
del Senno L. Inhibitory effect of dihydrotestosterone on thyroid cell growth. J Endocrinol. 1996;
Author Manuscript

151:185–194. [PubMed: 8958778]

55. Rossi R, Zatelli MC, Valentini A, Cavazzini P, Fallo F, del Senno L, degli Uberti EC. Evidence for
androgen receptor gene expression and growth inhibitory effect of dihydrotestosterone on human
adrenocortical cells. J Endocrinol. 1998; 159:373–380. [PubMed: 9834454]
56. Gounari F, Signoretti S, Bronson R, Klein L, Sellers WR, Kum J, Siermann A, Taketo MM, von
Boehmer H, Khazaie K. Stabilization of β-catenin induces lesions reminiscent of prostatic
intraepithelial neoplasia, but terminal squamous transdifferentiation of other secretory epithelia.
Oncogene. 2002; 21:4099–4107. [PubMed: 12037666]
57. Bierie B, Nozawa M, Renou JP, Shillingford JM, Morgan F, Oka T, Taketo MM, Cardiff RD,
Miyoshi K, Wagner KU, Robinson GW, Hennighausen L. Activation of β-catenin in prostate
epithelium induces hyperplasias and squamous differentiation. Oncogene. 2003; 22:3875–3887.
[PubMed: 12813461]
58. Yu X, Wang Y, Jiang M, Bierie B, Roy-Burman P, Shen MM, Taketo MM, Wills M, Matusik RJ.
Activation of β-catenin in mouse prostate causes HGPIN and continuous prostate growth after
Author Manuscript

castration. Prostate. 2009; 69:249–262. [PubMed: 18991257]

59. Ellwood-Yen K, Graeber TG, Wongvipat J, Iruela-Arispe ML, Zhang J, Matusik R, Thomas GV,
Sawyers CL. Myc-driven murine prostate cancer shares molecular features with human prostate
tumors. Cancer Cell. 2003; 4:223–238. [PubMed: 14522256]
60. D’Antonio JM, Vander Griend DJ, Antony L, Ndikueze G, Dalrymple SL, Koochekpour S, Isaacs
JT. Loss of androgen receptor-dependent growth suppression by prostate cancer cells can occur
independently from acquiring oncogenic addiction to androgen receptor signaling. PLoS ONE.
2010; 5:e11475. [PubMed: 20628607]
61. Vander Griend DJ, D’Antonio J, Gurel B, Antony L, De Marzo AM, Isaacs JT. Cell-autonomous
intracellular androgen receptor signaling drives the growth of human prostate cancer initiating
cells. Prostate. 2010; 70:90–99. [PubMed: 19790235]
62. Litvinov IV, De Marzo AM, Isaacs JT. Is the Achilles’ heel for prostate cancer therapy a gain of
function in androgen receptor signaling? J Clin Endocrinol Metab. 2003; 88:2972–2982. [PubMed:
12843129]
63. Bernard D, Pourtier-Manzanedo A, Gil J, Beach DH. Myc confers androgen-independent prostate
Author Manuscript

cancer cell growth. J Clin Invest. 2003; 112:1724–1731. [PubMed: 14660748]

64. Bryan JN, Keeler MR, Henry CJ, Bryan ME, Hahn AW, Caldwell CW. A population study of
neutering status as a risk factor for canine prostate cancer. Prostate. 2007; 67:1174–1181.
[PubMed: 17516571]
65. Thompson IM, Goodman PJ, Tangen CM, Lucia MS, Miller GJ, Ford LG, Lieber MM, Cespedes
RD, Atkins JN, Lippman SM, Carlin SM, Ryan A, Szczepanek CM, Crowley JJ, Coltman CA. The
influence of finasteride on the development of prostate cancer. N Engl J Med. 2003; 349:215.
[PubMed: 12824459]
66. Andriole GL, Bostwick DG, Brawley OW, Gomella LG, Marberger M, Montorsi F, Pettaway CA,
Tammela TL, Teloken C, Tindall DJ, Somerville MC, Wilson TH, Fowler IL, Rittmaster RS,
REDUCE Study Group. Effect of dutasteride on the risk of prostate cancer. N Engl J Med. 2010;
362:1192–1202. [PubMed: 20357281]
67. Denmeade SR, Isaacs JT. Bipolar androgen therapy: The rationale for rapid cycling of
supraphysiologic androgen/ablation in men with castration resistant prostate cancer. Prostate.
Author Manuscript

2010; 70:1600–1607. [PubMed: 20607766]

68. Isaacs JT, D’Antonio JM, Chen S, Antony L, Dalrymple SP, Ndikuyeze GH, Luo J, Denmeade S.
Adaptive auto-regulation of androgen receptor provides a paradigm shifting rationale for bipolar
androgen therapy (BAT) for castrate resistant human prostate cancer. Prostate. 2012; 72:1491–
1505. [PubMed: 22396319]

Prostate. Author manuscript; available in PMC 2016 May 04.

 Antony et al. Page 19
Author Manuscript
Author Manuscript

Fig. 1.
Androgen mediated AR inhibition of the growth of human prostate epithelial cells (PrECs)
and PrEC-hTERT cells in response to AR stimulation using physiologic levels of the
synthetic androgen R1881 (i.e., 1nM). Expression and ligand activation of AR in both PrEC-
LV-AR and PrEC-hTERT-LV-AR cells results in a significant growth suppression over a 1-
week observation period, which is inhibited by co-administration of the anti-androgen
Casodex (10 μM). An AR DNA-binding mutant (A573D) failed to inhibit growth when
ligand-activated [* indicates a P-value < 0.05].
Author Manuscript
Author Manuscript

Prostate. Author manuscript; available in PMC 2016 May 04.

 Antony et al. Page 20
Author Manuscript
Author Manuscript

Fig. 2.
Exogenous c-MYC expression (RV-c-MYC) overrides growth inhibition of PrEC-hTERT-
LV-AR cells induced by both AR-signaling and toxoflavin induced β-catenin inhibition [*
indicates a P-value < 0.05].
Author Manuscript
Author Manuscript

Prostate. Author manuscript; available in PMC 2016 May 04.

 Antony et al. Page 21
Author Manuscript
Author Manuscript

Fig. 3.
(A) Western blot determination of efficiency of lentiviral shRNA knockdown of c-MYC, β-
catenin, or TCF-4 protein expression in human PrECs. (B) Growth response to such specific
protein knock down[* indicates a P-value < 0.05].
Author Manuscript
Author Manuscript

Prostate. Author manuscript; available in PMC 2016 May 04.

 Antony et al. Page 22
Author Manuscript

Fig. 4.
Western blot documents a lack of FOXP3 nuclear translocation in response to AR-mediated
growth suppression of PrEC-hTERT-LV-AR cells. Cyt. ext, cytoplasmic extract; Nu. ext,
nuclear extract.
Author Manuscript
Author Manuscript
Author Manuscript

Prostate. Author manuscript; available in PMC 2016 May 04.

 Antony et al. Page 23
Author Manuscript
Author Manuscript

Fig. 5.
(A) β-Catenin and ligand (R1881)-bound wild type AR, but not DNA-binding AR mutant
A573D, co-immunoprecipitate (IP) with nuclear TCF-4 in PrEC-hTERT-LV-AR cells. Non-
specific IgG antibody was used as a negative control. (B) Immuno-histochemical staining of
Author Manuscript

active β-catenin in PrEC-hTERT-LV-AR cells.

Author Manuscript

Prostate. Author manuscript; available in PMC 2016 May 04.

 Antony et al. Page 24
Author Manuscript
Author Manuscript

Fig. 6.
(A) Chromatin immunoprecipitation (ChIP) documents that TCF-4 continues to bind the 3′
c-MYC enhancer elements of the c-MYC gene even in the presence of ligand-activated AR,
but there is a decrease binding to the 5′ c-MYC enhancer element. (B) Ligand-activated AR
Author Manuscript

and toxoflavin inhibition of β-catenin/TCF-4 complex formation inhibits the transcriptional

activity of the 5′ plus 3′ c-MYC enhancer element using appropriate luciferase reporter
constructs. (C) Toxoflavin dose-dependent growth inhibition of non-immortalized PrEC
cells. (D) Growth response of PrEC-hTERT-LVAR cells to growth factor removal, Wnt
inhibition (DKK1), or AKT inhibition (AKT-inhibitor) alone and in combination with
constitutive c-MYC expression (RV-c-MYC), and to XAV939 induced inhibition of β-
catenin signaling.
Author Manuscript

Prostate. Author manuscript; available in PMC 2016 May 04.

 Antony et al. Page 25
Author Manuscript

Fig. 7.
Phosphorylation status of β-catenin in nuclear extracts of PrEC-hTERT-LV-AR cells growth
arrested by treatment with AKT-inhibitor (AIN), removal of pararcrine growth factors
(−GF), or addition of androgen (+R1881) compared to growing cells (i.e., growth factor +).
Author Manuscript
Author Manuscript
Author Manuscript

Prostate. Author manuscript; available in PMC 2016 May 04.

 Antony et al. Page 26
Author Manuscript
Author Manuscript

Fig. 8.
Nuclear AR, c-MYC, and β-catenin are expressed in different populations in the normal
human prostate. Upper Panel-IHC staining for active (i.e., N-terminal hypo-
phosphorylated) nuclear β-catenin. Arrowheads indicated basal cells, which are usually
negative for active nuclear β-catenin. Secretory-luminal cells are nearly universally positive
for nuclear active β-catenin. Lower Left Panel-Immuno-fluorescent (IF) staining for nuclear
c-MYC and DAPI counter-stain. Arrows indicate occasionally c-MYC positive basal cells;
Author Manuscript

arrowheads usual c-MYC negative basal cells. Lower Middle Panel-IF staining for AR and
DAPI counter-stain. Arrows indicate occasionally c-MYC positive basal cells, which are AR
negative; arrowheads usual c-MYC negative basal cells, which are also AR negative. Lower
Right Panel-Dual IF staining for c-MYC plus AR and DAPI counter-stain. Arrows and
arrowheads are as described in left and middle panels.
Author Manuscript

Prostate. Author manuscript; available in PMC 2016 May 04.