Potyviridae

The Potyviridae is the largest family of RNA plant viruses, members of which have single-stranded, positive-sense RNA genomes and flexuous filamentous particles 680–900 nm long and 11–20 nm wide. There are eight genera, distinguished by the host range, genomic features and phylogeny of the member viruses. Genomes range from 8.2 to 11.3 kb, with an average size of 9.7 kb. Most genomes are monopartite but those of members of the genus Bymovirus are bipartite. Some members cause serious disease epidemics in cultivated plants. This is a summary of the International Committee on Taxonomy of Viruses (ICTV) Report on the taxonomy of the Potyviridae, which is available at www.ictv.global/report/ potyviridae.

Cassava brown streak disease (CBSD) has emerged as the most important viral disease of cassava (Manihot esculenta) in Africa and is a major threat to food security. CBSD is caused by two distinct species of ipomoviruses, Cassava brown streak virus and Ugandan cassava brown streak virus, belonging to the family Potyviridae. Previously, CBSD was reported only from the coastal lowlands of East Africa, but recently it has begun to spread as an epidemic throughout the Great Lakes region of East and Central Africa. This new spread represents a major threat to the cassava-growing regions of West Africa. CBSD-resistant cassava cultivars are being developed through breeding, and transgenic RNA interference-derived field resistance to CBSD has also been demonstrated. This review aims to provide a summary of the most important studies on the aetiology, epidemiology and control of CBSD and to highlight key research areas that need prioritization.

Potato Virus Y (PVY) is a pathogen of economic importance in pepper and other major crop species in the family Solanaceae. Three major PVY strain groups: O, C, and N, have been distinguished on the basis of genome sequencing. In this study, the first full-genome sequence of a PVY isolate (JVW-186) infecting pepper from the province of KwaZulu-Natal, Republic of South Africa is reported. The complete genome sequence of JVW-186 was assembled from overlapping RT-PCR clones using MEGA 5 software. Two ORFs were identified at position 186 and 2915 of the sequence encoding the viral polyprotein and the frameshift translated protein P3NPIPO, respectively. RDP4 software confirmed three recombination breakpoints at position 343, 1365, and 9308 of the sequence. At each recombination event, a 1,021-bp fragment at the 50 end in the region of the P1/HC-Pro protein and a 392-bp fragment in the region of the coat protein shared a high sequence similarity of 91.8 and 98.89 % to the potato borne PVYC isolate PRI-509 and the PVYO isolate SASA-110, respectively. The non-recombinant fragment 1 (342-bp) clustered within the C clade of PVY isolates; however, the large 7,942-bp fragment 3 did not cluster within any of the clades. This suggests the possibility of a PVY isolate that has evolved due to the dynamics of selection pressure or the likelihood of an ancestral PVY strain.

We present a detailed analysis of linkage disequilibrium (LD) in the physical and genetic context of the barley gene Hv-eIF4E, which confers resistance to the barley yellow mosaic virus (BYMV) complex. Eightythree SNPs distributed over 132 kb of Hv-eIF4E and six additional fragments genetically mapped to its flanking region were used to derive haplotypes from 131 accessions. Three haplogroups were recognized, discriminating between the alleles rym4 and rym5, which each encode for a spectrum of resistance to BYMV. With increasing map distance, haplotypes of susceptible genotypes displayed diverse patterns driven mainly by recombination, whereas haplotype diversity within the subgroups of resistant genotypes was limited. We conclude that the breakdown of LD within 1 cM of the resistance gene was generated mainly by susceptible genotypes. Despite the LD decay, a significant association between haplotype and resistance to BYMV was detected up to a distance of 5.5 cM from the resistance gene. The LD pattern and the haplotype structure of the target chromosomal region are the result of interplay between low recombination and recent breeding history.

Centro Internacional de Agricultura Tropical, Apartado Aé reo 6713, Cali, Colombia Cassava brown streak disease (CBSD) has emerged as the most important viral disease of cassava (Manihot esculenta) in Africa and is a major threat to food security. CBSD is caused by two distinct species of ipomoviruses, Cassava brown streak virus and Ugandan cassava brown streak virus, belonging to the family Potyviridae. Previously, CBSD was reported only from the coastal lowlands of East Africa, but recently it has begun to spread as an epidemic throughout the Great Lakes region of East Africa and Central Africa. This new spread represents a major threat to the cassava-growing regions of West Africa. CBSD-resistant cassava cultivars are being developed through breeding, and transgenic RNA interference-derived field resistance to CBSD has also been demonstrated. This review aims to provide a summary of the most important studies on the aetiology, epidemiology and control of CBSD and to highlight key research areas that need prioritization. %paper no. vir000014 charlesworth ref: vir000014& Plant -RNA viruses

Barley mild mosaic virus (BaMMV), a member of the family Potyviridae, genus Bymovirus, is involved in the economically important yellow mosaic disease of winter barley in East Asia and Europe. We investigated serological properties of bacterially expressed BaMMV coat protein (CP) of a German isolate. Ten mouse monoclonal antibodies were produced using purified E. coli expressed BaMMV-CP as immunogen. The reactivity of MAbs with different strains of BaMMV was analysed by several immunological methods that are frequently used in diagnostic virology: enzyme-linked immunosorbent assay (ELISA), dotblot, Western-blotting (WB), direct tissue blotting immunoassay (DTBIA) and immunoelectron microscopy (IEM). The amino acids involved in the formation of epitopes recognised by several MAbs were mapped by using synthetic pin-bound peptides and the localisation of epitopes in assembled virus particles was determined by electron microscope studies. MAbs V29 and M1 decorated the whole virion indicating that their epitopes 6 PDPI 9 and 96 ITDDEK 101 , respectively, are exposed on the surface. The MAbs V6 and V14 both interacted with 44 LPEPKM 49 , which seems to be accessible at only one end of the virus particle. The MAbs V6, V14, V29 and M1 detected epitopes common to a wide range of BaMMV isolates and can therefore be used effectively in routine diagnostic tests for BaMMV from barley leaves. We suggest that MAbs M1, V6, V14 and V29 are most suitable for use in TAS-ELISA, V6, V14 and V29 for Western blotting and V29 and M1 for electron microscope serology. 2502 D. Veliceasa et al.

The expanding cassava brown streak disease (CBSD) epidemic in East Africa is caused by two ipomoviruses (genus Ipomovirus; Potyviridae), namely, Cassava brown streak virus (CBSV), and Ugandan cassava brown streak virus (UCBSV) that was described recently. A reverse transcription polymerase chain reaction (RT-PCR) based diagnostic method was developed in this study for simultaneous virus-specific detection of the two viruses. Results showed that CBSV and UCBSV are distributed widely in the highlands (>1000 m above the sea level) of the Lake Victoria zone in Uganda and Tanzania and also in the Indian Ocean costal lowlands of Tanzania. Isolates of UCBSV from the Lake Victoria zone were placed to two phylogenetic clusters in accordance with their origin in Uganda or Tanzania, respectively. Mixed infections with CBSV and UCBSV were detected in many cassava plants in the areas surveyed. CBSV was also detected in the perennial species Manihot glaziovii (DNA-barcoded in this study) in Tanzania, which revealed the first virus reservoir other than cassava. The method for detection of CBSV and UCBSV described in this study has important applications for plant quarantine, resistance breeding of cassava, and studies on epidemiology and control of CBSD in East Africa.

RNA-mediated virus resistance is increasingly becoming a method of choice for antiviral defense in plants when effective natural resistance is unavailable. In this chapter we discuss the design principles of arti fi cial micro RNA (amiRNA), in which a natural miRNA precursor gene is modi fi ed to target a different species of RNA, in particular viral RNA. In addition, we explore the advantages and effectiveness of multiple amiRNAs within one polycistronic amiRNA precursor against a virus, as illustrated with Wheat streak mosaic virus , WSMV. The judicious selection of amiRNAs, which are sequences of short length as compared to other related methodologies of RNA interference, greatly assists in avoiding unintended off-targets in the host plant. The viral sequences targeted can be genomic or replicative and should be derived from conserved regions of the published WSMV genome. In short, using published folding and miRNA selection rules and algorithms, candidate miRNA sequences are selected from conserved regions between a number of WSMV genomes, and are BLASTed against wheat TIGR ESTs. Five miRNAs are selected that are least likely to interfere with the expression of transcripts from the wheat host. Then, the natural miRNA in each of the fi ve arms of the polycistronic rice miR395 is replaced in silico with the chosen arti fi cial miR-NAs. This arti fi cial precursor is transformed into wheat behind a ubiquitin promoter, and its integration into transformed wheat plants is con fi rmed by PCR and Southern blot analysis. We have demonstrated the effectiveness of this methodology using an amiRNA precursor that we have termed Fanguard. The processing of amiRNAs in transgenic leaves is veri fi ed through splinted ligation assay, and the functionality of the transgene in preventing viral replication is veri fi ed by virus bioassay. Resistance is con fi rmed using mechanical virus inoculation over two subsequent generations. This example demonstrates the potential of polycistronic amiRNA to achieve stable immunity to economically important viruses.

BACKGROUND: Bemisia tabaci, the sweetpotato whitefly, is a globally invasive pest that causes serious agricultural damage by transmitting plant viruses. This pest forms a cryptic species complex that displays morphologically indistinguishable biotypes. Among them, the B and Q biotypes are the most important pests worldwide. Because they have different levels of insecticide resistance, these biotypes must be identified in order to achieve proper pest control. Therefore, a convenient, rapid and specific detection method for identifying the two biotypes is necessary.

Arracacha mottle virus (AMoV) is the only potyvirus reported to infect arracacha (Arracacia xan-thorrhiza) in Brazil. Here, the complete genome sequence of an isolate of AMoV was determined to be 9,630 nucleotides in length, excluding the 3 0 poly-A tail, and encoding a polyprotein of 3,135 amino acids and a putative P3N-PIPO protein. Its genomic organization is typical of a member of the genus Potyvirus, containing all conserved motifs. Its full genome sequence shared 56.2 % nucleotide identity with sunflower chlorotic mottle virus and verbena virus Y, the most closely related viruses.

The SARS-nsp13 protein was identiWed as an mRNA cap1 methyltransferase. In this study, the nsp13 gene was cloned from the SARS-CoV PUMC02 strain viral RNA by RT-PCR, and inserted into the expression plasmid pET30a(+). The recombinant plasmid pET30a(+)-nsp13 was conWrmed by restriction enzymes and sequencing analysis, and transformed into Escherichia coli BL21(DE3). The His-tag-fused protein was expressed by induction of 0.5 mM IPTG and puriWed by a single Ni 2+ aYnity chromatography. The protein was validated by western blot and MS analysis. A large quantity of the nsp13 protein obtained with this method may be useful for further study of its structure and function. 

Complete genome sequences of two Yellow oatgrass mosaic virus (YOgMV) isolates have been determined to be 9,292 nucleotides excluding the 3 0 polyadenylated tail. The viral RNA encodes a large putative open reading frame (ORF) of a single polyprotein consisting of 3,002 amino acids with typical genome organization of monopartite potyvirids. A small overlapping ORF encoding a pretty interesting Potyviridae ORF of 122 amino acids is found in the P3 cistron of both YOgMV isolates. The nucleotide and amino acid identities between the two YOgMV isolates are 90 and 97 %, respectively. Pairwise comparison of YOgMV putative mature proteins and proteinase cleavage sites with those of representative members of the family Potyviridae indicated that YOgMV is more closely related to members of the genus Tritimovirus. In phylogenetic trees constructed with sequences of putative polyprotein, YOgMV consistently groups with members of the genus Tritimovirus. These results suggest that YOgMV should be classified as a distinct species in the genus Tritimovirus in the family Potyviridae.

Complete genome sequences of two Yellow oatgrass mosaic virus (YOgMV) isolates have been determined to be 9,292 nucleotides excluding the 3 0 polyadenylated tail. The viral RNA encodes a large putative open reading frame (ORF) of a single polyprotein consisting of 3,002 amino acids with typical genome organization of monopartite potyvirids. A small overlapping ORF encoding a pretty interesting Potyviridae ORF of 122 amino acids is found in the P3 cistron of both YOgMV isolates. The nucleotide and amino acid identities between the two YOgMV isolates are 90 and 97 %, respectively. Pairwise comparison of YOgMV putative mature proteins and proteinase cleavage sites with those of representative members of the family Potyviridae indicated that YOgMV is more closely related to members of the genus Tritimovirus. In phylogenetic trees constructed with sequences of putative polyprotein, YOgMV consistently groups with members of the genus Tritimovirus. These results suggest that YOgMV should be classified as a distinct species in the genus Tritimovirus in the family Potyviridae.

The Potyviridae is the largest family of RNA plant viruses, members of which have single-stranded, positive-sense RNA genomes and flexuous filamentous particles 680–900 nm long and 11–20 nm wide. There are eight genera, distinguished by the host range, genomic features and phylogeny of the member viruses. Genomes range from 8.2 to 11.3 kb, with an average size of 9.7 kb. Most genomes are monopartite but those of members of the genus Bymovirus are bipartite. Some members cause serious disease epidemics in cultivated plants. This is a summary of the International Committee on Taxonomy of Viruses (ICTV) Report on the taxonomy of the Potyviridae, which is available at www.ictv.global/report/ potyviridae.

In sub-Saharan Africa, maize is a staple food and key determinant of food security for smallholder farming communities. Pest and disease outbreaks are key constraints to maize productivity. In September 2011, a serious disease outbreak, later diagnosed as maize lethal necrosis (MLN), was reported on maize in Kenya. The disease has since been confirmed in Rwanda and the Democratic Republic of Congo, and similar symptoms have been reported in Tanzania, Uganda, South Sudan, and Ethiopia. In 2012, yield losses of up to 90% resulted in an estimated grain loss of 126,000 metric tonnes valued at $52 million in Kenya alone. In eastern Africa, MLN was found to result from co-infection of maize with Maize chlorotic mottle virus (MCMV) and Sugarcane mosaic virus (SCMV), although MCMV alone appears to cause significant crop losses. We summarize here the results of collaborative research undertaken to understand the biology and epidemiology of MLN in East Africa and to develop disease management...

Resumen (es_ES)
Los potyvirus son uno de los grupos de virus más limitantes en los cultivos de papa (Solanum tuberosum y S. phureja) en el mundo, siendo PVY, PVV y PVA las especies más prevalentes. En este trabajo se evaluó la presencia de estos potyvirus en cuatro lotes de S. tuberosum cv. Diacol-Capiro y cuatro lotes de S. phureja cv. Criolla-Colombia ubicados en el oriente de Antioquia, analizando la cápside viral mediante RT-PCR/secuenciación Sanger y secuenciación de nueva generación (NGS) para S. tuberosum. Los resultados indicaron la ocurrencia de los potyvirus PVY y PVV en las muestras de S. tuberosum y S. phureja, respectivamente; siendo detectadas mediante cebadores específicos la presencia de tres diferentes cepas de PVY (PVYN, PVYNTN y PVYO) en la región de estudio. Este hallazgo fue confirmado por NGS, obteniendo las secuencias completas de los genomas de estas tres cepas, lo que representa el primer reporte de PVYO en Colombia. Por su parte, los análisis de secuencias de la región CP de PVV indicaron niveles de identidad superiores a 99% con respecto a aislamientos del linaje PVVPhu reportado previamente en Antioquia. Estos hallazgos evidencian la necesidad de ajustar los sistemas de detección de virus en los programas de certificación de tubérculo-semilla de papa adelantados en el país.
Resumen (en_US)
Potyviruses are one of the most limiting viruses for the potato (Solanum tuberosum and S. phureja) production worldwide, being PVY, PVV and PVA the most prevalent species. In this work, we tested the presence of these viruses in four commercial S. tuberosum cv. Diacol-Capiro and S. phureja cv. Criolla-Colombia plots in eastern Antioquia using RT-PCR and Sanger sequencing of the coat protein (CP) region, as well as next generation sequencing (NGS) for S. tuberosum samples. Our results revealed the presence of a PVV strain infecting S. phureja with high sequence identity (>99%) to lineage PVVPhu previously reported in Antioquia. Three strains of PVY (PVYN, PVYNTN and PVYO) were found to infect S. tuberosum. The presence of these three PVY strains was confirmed by NGS, allowing the assembly of their complete genomes. This is the first report of the full genome sequence of PVYo strain in Colombia. These findings highlight the need to adjust the tuber-seed certification programs currently implemented in the country.

The genus Ipomovirus is one of six currently recognized genera in the family Potyviridae. The complete nucleotide sequence of Squash vein yellowing virus (SqVYV), a putative ipomovirus recently described in Florida, has been determined. The 9836 nt SqVYV genomic RNA [excluding the poly(A) tail] has one large open reading frame encoding a single polyprotein of 3172 amino acids, typical of the genome organization for most members in the family Potyviridae. The 10 mature proteins predicted to be derived from the SqVYV polyprotein include P1a and P1b but no HC-Pro, similar to Cucumber vein yellowing virus (CVYV) but different from Sweet potato mild mottle virus (SPMMV), both recognized members of the genus Ipomovirus. Phylogenetic analysis of these proteins supports classification of SqVYV as a novel species within the genus Ipomovirus. However, the similar genome organization strategy of SqVYV and CVYV, which differs from that of SPMMV, indicates that the taxonomy of the genus Ipomovirus needs to be re-examined and a new genus created within the family Potyviridae to accommodate the observed discrepancies in ipomovirus genome organization.

The P1a protein of the ipomovirus Cucumber vein yellowing virus is one of the self-cleavage serine proteases present in Potyviridae family members. P1a is located at the N-terminal end of the viral polyprotein, and is closely related to potyviral P1 protease. For its proteolytic activity, P1a requires a still unknown host factor; this might be linked to involvement in host specificity. Here we built a series of constructs and chimeric viruses to help elucidate the role of P1a cleavage in host range definition. We demonstrate that host-dependent separation of P1a from the remainder of the polyprotein is essential for suppressing RNA silencing defenses and for efficient viral infection. These findings support the role of viral proteases as important determinants in host adaptation.

Background: Potyviruses are found world wide, are spread by probing aphids and cause considerable crop damage. Potyvirus is one of the two largest plant virus genera and contains about 15% of all named plant virus species. When and why did the potyviruses become so numerous? Here we answer the first question and discuss the other.

Pepper, Capsicum annuum L., is an economically important crop in Zimbabwe, grown as a spice and vegetable for both the local and export markets. Pepper is susceptible to infection by up to 49 virus species, some of which cause serious yield loss (Hanssen et al. 2010). During tospovirus surveys conducted in January 2015, pepper plants with typical viral symptoms, including plant stunting, leaf chlorosis, mottling, and curling were observed at a farm in Goromonzi District of Zimbabwe. Visual observations estimated the symptoms incidence at 15%. In addition, there was a high incidence of Frankliniella occidentalis and Myzus persicae in the field. Ten symptomatic and four nonsymptomatic leaves were tested using LoeweFast Lateral Flow Kits (Loewe Biochemica GmbH, Germany) specific to tospoviruses and Potato virus Y (PVY). The tospovirus kit was specific to Tomato spotted wilt virus (TSWV), Tomato chlorotic spot virus (TCSV), and Groundnut ringspot virus (GRSV). Eight and 10 of the symptomatic leaves tested positive for tospoviruses and PVY, respectively, while all the symptomless leaves tested negative for both viruses. Plant sap from virus-infected leaves was imprinted onto FTA Whatman cards (Whatman International, USA), air dried, and shipped to the University of KwaZulu-Natal Plant Virology Laboratory (Pietermaritzburg, South Africa) for further diagnostic tests. Total nucleic acid was eluted from the FTA cards following manufacturer’s instructions. The presence of TSWV and PVY was further confirmed by reverse transcription (RT)-PCR using the TSWV nucleocapsid protein (TSWV 722: GCTGGAGCTAAGTATAGCAGC and TSWV 723: CACAAGGCAAAGACCTTGAG) and the PVY viral protein genome-linked (VPf-F: GAATYCAAGCHYTRAAGTTTCG and VPg-R: GCTTCATGYTCYACHTCCTG) gene-specific primers. The respective reverse primers and the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, USA) were used for cDNA synthesis. PCR was performed using KAPA2G Fast HotStart ReadyMix (Kapa Biosystems, USA) and the respective primer pairs for the viruses. These primers amplify 620 bp of the TSWV nucleocapsid gene (Adkins and Rosskopf 2002) and 547 bp of the PVY viral protein genome-linked gene (Ben Khalifa et al. 2009). Amplicons of the expected sizes obtained from symptomatic leaves only, were purified using QiaQuick Gel Extraction Kit (Qiagen, Germany) and directly sequenced at Inqaba Biotech (Pretoria, South Africa). The TSWV isolate sequence (Accession Number KU671049) shared 99% identity with sequences of pepper-infecting isolates from Turkey (KM379142), Serbia (KC182566), and South Africa (DQ834847), while the PVY isolate sequence (KU695465) shared at least 89% identity with sequences of pepper-infecting isolates from France (KF670594), The Netherlands (EF638905), and South Africa (KF770839). To our knowledge, this is the first record of a mixed infection of pepper by TSWV and PVY in Zimbabwe. This is also the first time both pepper-infecting viruses have been sequenced in Zimbabwe. Given the economic and nutritional importance of pepper in Zimbabwe, the occurrence of both viruses on pepper is likely to negatively affect yield and farmers’ income. There is need for further surveys to ascertain how widespread this phenomenon is and determine its economic impact on pepper production in Zimbabwe.

Soybean mosaic virus (SMV) and peanut mottle virus (PMV) are two potyviruses that cause yield losses and reduce seed quality in infested soybean (Glycine max (L.) Merr.) fields throughout the world. Rsv1 and Rpv1 are genes that provide soybean with resistance to SMV and PMV, respectively. Isolating and characterizing Rsv1 and Rpv1 are instrumental in providing insight into the molecular mechanism of potyvirus recognition in soybean. A population of 1056 F2 individuals from a cross between SMV- and PMV-resistant line PI 96983 (Rsv1 and Rpv1) and the susceptible cultivar 'Lee 68' (rsv1 and rpv1) was used in this study. Disease reaction and molecular-marker data were collected to determine the linkage relationship between Rsv1, Rpv1, and markers that target candidate disease-resistance genes. F2 lines showing a recombination between two of three Rsv1-flanking microsatellite markers were selected for fine mapping. Over 20 RFLP, RAPD, and microsatellite markers were used to map 3...

The wheat curl mite (WCM), Aceria tosichella, and the plant viruses it transmits represent an invasive mite-virus complex that has affected cereal crops worldwide. The main damage caused by WCM comes from its ability to transmit and spread multiple damaging viruses to cereal crops, with Wheat streak mosaic virus (WSMV) and Wheat mosaic virus (WMoV) being the most important. Although WCM and transmitted viruses have been of concern to cereal growers and researchers for at least six decades, they continue to represent a challenge. In older affected areas, for example in North America, this mite-virus complex still has significant economic impact. In Australia and South America, where this problem has only emerged in the last decade, it represents a new threat to winter cereal production. The difficulties encountered in making progress towards managing WCM and its transmitted viruses stem from the complexity of the pathosystem. The most effective methods for minimizing losses from WCM transmitted viruses in cereal crops have previously focused on cultural and plant resistance methods. This paper brings D. Navia (&) Á R.

In sub-Saharan Africa, maize is a staple food and key determinant of food security for smallholder farming communities. Pest and disease outbreaks are key constraints to maize productivity. In September 2011, a serious disease outbreak, later diagnosed as maize lethal necrosis (MLN), was reported on maize in Kenya. The disease has since been confirmed in Rwanda and the Democratic Republic of Congo, and similar symptoms have been reported in Tanzania, Uganda, South Sudan, and Ethiopia. In 2012, yield losses of up to 90% resulted in an estimated grain loss of 126,000 metric tonnes valued at $52 million in Kenya alone. In eastern Africa, MLN was found to result from co-infection of maize with Maize chlorotic mottle virus (MCMV) and Sugarcane mosaic virus (SCMV), although MCMV alone appears to cause significant crop losses. We summarize here the results of collaborative research undertaken to understand the biology and epidemiology of MLN in East Africa and to develop disease management...

Potato virus A (PVA) is a single-stranded positive-sense RNA virus and a member of the family Potyviridae. The PVA coat protein (CP) has an intrinsic capacity to self-assemble into filamentous virus-like particles, but the mechanism responsible for the initiation of viral RNA encapsidation in vivo remains unclear. Apart from virion assembly, PVA CP is also involved in the inhibition of viral RNA translation. In this study, we show that CP inhibits PVA RNA translation in a dose-dependent manner, through a mechanism involving the CP-encoding region. Analysis of this region, however, failed to identify any RNA secondary structure(s) preferentially recognized by CP, suggesting that the inhibition depends on CP-CP rather than CP-RNA interactions. In agreement with this possibility, insertion of an in-frame stop codon upstream of the CP sequence led to a marked decrease in the inhibition of viral RNA translation. Based on these results, we propose a model in which the cotranslational interactions between excess CP accumulating in trans and CP translated from viral RNA in cis are required to initiate the translational repression. This model suggests a mechanism for how viral RNA can be sequestered from translation and specifically selected for encapsidation at the late stages of viral infection. IMPORTANCE The main functions of the CP during potyvirus infection are to protect viral RNA from degradation and to transport it locally, systemically, and from host to host. Although virion assembly is a key step in the potyviral infectious cycle, little is known about how it is initiated and how viral RNA is selected for encapsidation. The results presented here suggest that CP-CP rather than CP-RNA interactions are predominantly involved in the sequestration of viral RNA away from translation. We propose that the cotranslational nature of these interactions may represent a mechanism for the selection of viral RNA for encapsidation. A better understanding of the mechanism of virion assembly may lead to development of crops resistant to potyviruses at the level of viral RNA encapsidation, thereby reducing the detrimental effects of potyvirus infections on food production.

The viral genome-linked protein (VPg) of Potato virus A (PVA) is a multifunctional protein that belongs to a class of intrinsically disordered proteins. Typically, this type of protein gains a more stable structure upon interactions or posttranslational modifications. In a membrane lipid strip overlay binding assay, PVA VPg was found to bind phosphatidylserine (PS), but not phosphatidylcholine (PC). According to circular dichroism spectroscopy, the secondary structure of PVA VPg was stabilized upon interactions with PS and phosphatidylglycerol (PG), but not with PC vesicles. It is possible that this stabilization favored the formation of α-helical structures. Limited tryptic digestion showed that the interaction with anionic vesicles protected certain, otherwise accessible, trypsin cleavage sites. An electron microscopy study revealed that interaction with VPg substantially increased the vesicle diameter and caused the formation of pore or plaque-like electron dense spots on the vesicle surface, which gradually led to disruption of the vesicles.

In sub-Saharan Africa, maize is a staple food and key determinant of food security for smallholder farming communities. Pest and disease outbreaks are key constraints to maize productivity. In September 2011, a serious disease outbreak, later diagnosed as maize lethal necrosis (MLN), was reported on maize in Kenya. The disease has since been confirmed in Rwanda and the Democratic Republic of Congo, and similar symptoms have been reported in Tanzania, Uganda, South Sudan, and Ethiopia. In 2012, yield losses of up to 90% resulted in an estimated grain loss of 126,000 metric tons valued at $52 million in Kenya alone. In eastern Africa, MLN was found to result from coinfection of maize with Maize chlorotic mottle virus (MCMV) and Sugarcane mosaic virus (SCMV), although MCMV alone appears to cause significant crop losses. We summarize here the results of collaborative research undertaken to understand the biology and epidemiology of MLN in East Africa and to develop disease management strategies, including identification of MLN-tolerant maize germplasm. We discuss recent progress, identify major issues requiring further research, and discuss the possible next steps for effective management of MLN.

Cassava brown streak disease (CBSD) and cassava mosaic disease (CMD) are currently two major viral diseases that severely reduce cassava production in large areas of Sub-Saharan Africa. Natural resistance has so far only been reported for CMD in cassava. CBSD is caused by two virus species, Cassava brown streak virus (CBSV) and Ugandan cassava brown streak virus (UCBSV). A sequence of the CBSV coat protein (CP) highly conserved between the two virus species was used to demonstrate that a CBSV-CP hairpin construct sufficed to generate immunity against both viral species in the cassava model cultivar (cv. 60444). Most of the transgenic lines showed high levels of resistance under increasing viral loads using a stringent top-grafting method of inoculation. No viral replication was observed in the resistant transgenic lines and they remained free of typical CBSD root symptoms 7 month post-infection. To generate transgenic cassava lines combining resistance to both CBSD and CMD the hairpin construct was transferred to a CMD-resistant farmer-preferred Nigerian landrace TME 7 (Oko-Iyawo). An adapted protocol allowed the efficient Agrobacterium-based transformation of TME 7 and the regeneration of transgenic lines with high levels of CBSV-CP hairpin-derived small RNAs. All transgenic TME 7 lines were immune to both CBSV and UCBSV infections. Further evaluation of the transgenic TME 7 lines revealed that CBSD resistance was maintained when plants were co-inoculated with East African cassava mosaic virus (EACMV), a geminivirus causing CMD. The innovative combination of natural and engineered virus resistance in farmer-preferred landraces will be particularly important to reducing the increasing impact of cassava viral diseases in Africa.

HCPro is the RSS of Potyvirus spp., and its activity is enhanced by the upstream P1 protein. Distinctively, the ipomovirus Cucumber vein yellowing virus (CVYV) lacks HCPro but contains two P1 copies in tandem (P1aP1b), the second of which functions as RSS. Using chimeras based on the potyvirus Plum pox virus (PPV), we found that P1b can functionally replace HCPro in potyviral infections of Nicotiana plants. Interestingly, P1a, the CVYV protein homologous to potyviral P1, disrupted the silencing suppression activity of P1b and reduced the infection efficiency of PPV in Nicotiana benthamiana. Testing the influence of RSS in host specificity, we found that a P1bexpressing chimera poorly infected PPV's natural host, Prunus persica. Conversely, P1b conferred on PPV chimeras the ability to replicate locally in cucumber, CVYV's natural host. The deleterious effect of P1a on PPV infection is host dependent, because the P1aP1b-expressing PPV chimera accumulated in cucumber to higher levels than PPV expressing P1b alone. These results demonstrate that a potyvirus can use different RSS, and that particular RSS and upstream P1-like proteins contribute to defining the virus host range.

The SARS-nsp13 protein was identiWed as an mRNA cap1 methyltransferase. In this study, the nsp13 gene was cloned from the SARS-CoV PUMC02 strain viral RNA by RT-PCR, and inserted into the expression plasmid pET30a(+). The recombinant plasmid pET30a(+)-nsp13 was conWrmed by restriction enzymes and sequencing analysis, and transformed into Escherichia coli BL21(DE3). The His-tag-fused protein was expressed by induction of 0.5 mM IPTG and puriWed by a single Ni 2+ aYnity chromatography. The protein was validated by western blot and MS analysis. A large quantity of the nsp13 protein obtained with this method may be useful for further study of its structure and function. 

Since 2003, a new viral disease of eggplant (Solanum melongena L.) has been spreading in fields in the Jordan and Arava Valleys, Israel. The symptoms of this disease include mild leaf mottling and varying degrees of fruit distortion. This disease can be transmitted by mechanical sap inoculation, as well as by the whitefly Bemisia tabaci (Homoptera, Aleyrodidae) and has been tentatively named eggplant mild leaf mottle virus (EM-LMV). Our study aimed to determine the complete sequence and genome organization of EMLMV. The extracted viral RNA was subjected to SOLiD next-generation sequence analysis and used as a template for reverse transcription synthesis, which was followed by ds-cDNA synthesis or PCR amplification. The ssRNA genome of EMLMV includes 9,280 nucleotides, excluding a 3 0 terminal poly-adenylated tail. The genome includes a putative single, large open reading frame (ORF) that encodes a polyprotein of 3,011 amino acids, a short overlapping ORF of PIPO protein comprised of 71 amino acids and 5 0 and 3 0 non-coding regions of 108 and 136 nucleotides, respectively. The deduced amino acid sequence of the EMLMV polyprotein is relatively close to that of sweet potato mild mottle virus (SPMMV), with 37% shared sequence identity. Among the four ipomoviruses, only SPMMV and the putative genus member EMLMV contain a helper component-proteinase (HC-Pro) gene. Like SPMMV-HC-Pro, EMLMV-HC-Pro also contains the highly conserved PTK domain that is thought to be involved in the aphid-assisted transmission of potyviruses.

The RNA silencing pathway mediated by small interfering RNAs (siRNAs) plays an important antiviral role in eukaryotes. To counteract this defense barrier, a large number of plant viruses express proteins with RNA silencing suppression activity. Recently, it was reported that the ipomovirus Cucumber vein yellowing virus (CVYV), which lacks the typical silencing suppressor of members of the family Potyviridae, i.e., HCPro, has a duplicated P1 coding sequence and that the downstream P1 copy, named P1b, has silencing suppression activity. In this study, we provide experimental evidence that P1b is a serine protease that self-cleaves at its C terminus but that its proteolytic activity is not essential for silencing suppression. In contrast, a putative zinc finger and a conserved basic motif in the N-terminal region of the protein are required for efficient silencing suppression. In vitro gel filtration-fast protein liquid chromatography and in vivo bimolecular fluorescence complementation assays showed that P1b binds itself to form oligomeric structures and that the zinc finger-like motif is essential for the self interaction. Moreover, we observed that CVYV P1b forms complexes with synthetic siRNAs, and this ability correlated with both silencing suppression activity and enhancement of Potato virus X pathogenicity in a mutational analysis. Together, these results suggest that CVYV P1b resembles potyviral HCPro and other viral proteins in interfering RNA silencing by preventing siRNA loading into the RNA-induced silencing complex.

Background: Translation initiation factors of the 4E and 4G protein families mediate resistance to several RNA plant viruses in the natural diversity of crops. Particularly, a single point mutation in melon eukaryotic translation initiation factor 4E (eIF4E) controls resistance to Melon necrotic spot virus (MNSV) in melon. Identification of allelic variants within natural populations by EcoTILLING has become a rapid genotype discovery method. Results: A collection of Cucumis spp. was characterised for susceptibility to MNSV and Cucumber vein yellowing virus (CVYV) and used for the implementation of EcoTILLING to identify new allelic variants of eIF4E. A high conservation of eIF4E exonic regions was found, with six polymorphic sites identified out of EcoTILLING 113 accessions. Sequencing of regions surrounding polymorphisms revealed that all of them corresponded to silent nucleotide changes and just one to a non-silent change correlating with MNSV resistance. Except for the MNSV case, no correlation was found between variation of eIF4E and virus resistance, suggesting the implication of different and/or additional genes in previously identified resistance phenotypes. We have also characterized a new allele of eIF4E from Cucumis zeyheri, a wild relative of melon. Functional analyses suggested that this new eIF4E allele might be responsible for resistance to MNSV. Conclusion: This study shows the applicability of EcoTILLING in Cucumis spp., but given the conservation of eIF4E, new candidate genes should probably be considered to identify new sources of resistance to plant viruses. Part of the methodology described here could alternatively be used in TILLING experiments that serve to generate new eIF4E alleles.