Lesson 0: Molecular Structure of DNA, DNA

RNA, and Proteins

- repository of genetic information;
Nucleic Acid sequence of bases encodes the
blueprint for life processes.
Two types:

a. Deoxyribonucleic acid (DNA- double

helix)
b. Ribonucleic acid (RNA-single strand)

Nucleic acid are composed of long chains

of nucleotides linked by dehydration
synthesis.

Overall Function Of Nucleic Acid

The sequence of nucleotides in a nucleic

acid molecule serves as a blueprint to
encode the correct sequence of amino
RNA
acids for a protein. The code for a specific
protein is called a “gene.” - information in the form of base
sequence is transformed (transcribed)
The building blocks of any nucleic acid are
into mRNA, tRNA and rRNA.
the nucleotides.
- DNA is the template copied into RNA
Nucleotide by base pairing. G with C; A with U.

A nucleotide is composed of a phosphate Protein

group (with negative charges), a sugar
- Functional products of genes
portion and an N-base.
- Executes cellular functions
Nucleic acids
Protein Structures
Nucleotides include:

1. phosphate group
2. pentose sugar (5-carbon)
 Ribose (found in RNA)
 Deoxyribose (found in DNA)
-
3. Nitrogenous bases:
 Purine
- adenine (A)
- guanine (G)
 B. Pyrimidine
- thymine (T) DNA only
- uracil (U) RNA only Primary
- cytosine (C)
Sequence of amino acids in the
polypeptide chain.
Secondary 1. DNA unwinds
2. mRNA copy is made of one of the DNA
When the polypeptide chain form a helix
strands.
or beta-pleated sheet structure
3. mRNA copy moves out of nucleus into
Tertiary cytoplasm.
4. tRNA molecules are activated as their
Coiling of polypeptide, combining helices
complementary amino acids are
and sheet forms.
attached to them.
Quarternary 5. mRNA copy attaches to the small
subunit of the ribosomes in cytoplasm.
The association of two or more 6 of the bases in the mRNA are
polypeptides in space. exposed in the ribosome.
6. A tRNA bonds complementarily with
the mRNA via its anticodon.
7. A second tRNA bonds with the next
three bases of the mRNA, the amino
acid joins onto the amino acid of the
first tRNA via a peptide bond.
8. The ribosome moves along. The first
tRNA leaves the ribosome.
9. A third tRNA brings a third amino acid
10. Eventually a stop codon is reached on
the mRNA. The newly synthesized
polypeptide leaves the ribosome.

DNA replication

- DNA strands separate and serve as

templates for the production of new
DNA molecules.
- Replication of a chromosome begins at
Given the following coding sequence for particular sites called origins of
DNA, provide the sequence of the replication
complementary (template) sequence. - Proteins initiate DNA replication
recognize the sequence and will
Coding Sequence: separate the DNA strand that will open
5’ ATGCATAGATTAGGATATCCCAGATAG 3’ up a “replication bubble”
- Replication of DNA occurs in both
Complementary Sequence: direction until the entire molecule is
3’ TACGTATCTAATCCTATAGGGTCTATC 5’ copied.
- In contrast in bacterial chromosome,
Lesson 0.1: Gene To Protein Synthesis eukaryotic chromosome may have
hundred or even few thousands of
replication origins
- At each end of a replication bubble is a
replication fork, a Y- shaped region
 where the parental strands of DNA are D. Semi-discontinuous. The leading strand
being unwound is synthesized in a continuous manner
- Helicases are enzymes that separates (5’ to 3’) while the lagging strand is
the two parental strands and making produced discontinuously in short
them available as template strands. stretches called Okazaki fragments.
- Single-strand binding proteins bind to
DNA Replication: PLOT TWIST
the unpaired DNA strands, keeping
them from re-pairing. - However, the enzymes that synthesize
- The untwisting of the double helix DNA cannot initiate the synthesis of a
causes tighter twisting and strain polynucleotide; they can only add DNA
ahead of the replication fork. nucleotides to the end of an already
- Topoisomerase helps relieve this existing chain that is base-paired with
strain by breaking, swiveling, and the template strand.
rejoining DNA strands - The initial nucleotide chain that is
- The unwound sections of parental produced during DNA synthesis is a
DNA strands are now available to short stretch of RNA, NOT DNA.
serve as templates for the synthesis of - This RNA chain is called a primer and
new complementary DNA strands. is synthesized by the enzyme primase.
The following are features of replication: Primer
A. Semi-conservative- the resulting DNA - starts a complementary RNA chain
consists of one old and one new from a single RNA nucleotide, adding
strand more RNA nucleotides one at a time,
B. Base pairing is maintained; Adenine using the parental DNA strand as a
pairs with Thymine, Guanine pairs template.
with Cytosine - The completed primer, generally 5–10
C. New DNA molecules are produced in nucleotides long, is thus base-paired
the 5’ to 3’ direction to the template strand.
- The new DNA strand will start from
the 3′ end of the RNA primer.

Synthesizing a New DNA Strand

- Enzymes called DNA polymerases

catalyze the elongation of new DNA at
a replication fork
- Most DNA polymerases require a
primer and a DNA template strand
- The rate of elongation is about 500
nucleotides per second in bacteria and
50 per second in human cells
- Each nucleotide that is added to a
growing DNA strand is a nucleoside
triphosphate
- dATP supplies adenine to DNA and is Proofreading and Repairing DNA
similar to the ATP of energy
- DNA polymerases proofread newly
metabolism
made DNA, replacing any incorrect
- The difference is in their sugars: dATP
nucleotides
has deoxyribose while ATP has ribose
- In mismatch repair of DNA, repair
- As each monomer of dATP joins the
enzymes correct errors in base pairing
DNA strand, it loses two phosphate
- DNA can be damaged by exposure to
groups as a molecule of
harmful chemical or physical agents
pyrophosphate
such as cigarette smoke and X-rays; it
Antiparallel Elongation can also undergo spontaneous
changes
- The antiparallel structure of the
- In nucleotide excision repair, a
double helix affects replication
nuclease cuts out and replaces
- DNA polymerases add nucleotides
damaged stretches of DNA
only to the free 3’ end of a growing
strand; therefore, a new DNA strand Deeper Look: DNA Replication
can elongate only in the 5’ to 3’
After RNA primer is made, DNA pol III
direction
starts to synthesize the leading strand
- Along one template strand of DNA, the
DNA polymerase synthesizes a leading The flow from Gene to Protein
strand continuously, moving toward
- Triplet code
the replication fork
- The genetic instructions for a
- To elongate the other new strand,
polypeptide chain are written in the
called the lagging strand, DNA
DNA as a series of non-overlapping,
polymerase must work in the direction
three-nucleotide words.
away from the replication fork
- The series of words in a gene is
- The lagging strand is synthesized as a
transcribed into a complementary
series of segments called Okazaki
series of non-overlapping, three-
fragments, which are joined together
nucleotide words in mRNA, which is
by DNA ligase
then translated into a chain of amino
The DNA Replication Complex acids
- The proteins that participate in DNA Transcription
replication form a large complex, a
- Messenger RNA, the carrier of
“DNA replication machine”
information from DNA to the cell’s
- The DNA replication machine may be
protein- synthesizing machinery, is
stationary during the replication
transcribed from the template strand
process
of a gene.
- Recent studies support a model in
- An enzyme called an RNA polymerase
which DNA polymerase molecules
pries the two strands of DNA apart
“reel in” parental DNA and “extrude”
and joins together RNA nucleotides
newly made daughter DNA molecules
complementary to the DNA template
strand, thus elongating the RNA
polynucleotide
DNA polymerases VS RNA polymerases Transcription Steps

DNA polymerases 1. RNA polymerase binds to the

promoter site (TATA box) (start) on the
 Function in DNA replication
DNA
 Needs primer
2. RNA polymerase adds RNA nucleotides
RNA polymerases complimentary to the DNA strand
3. mRNA building is complete when the
 assemble a polynucleotide only in its RNA polymerase reaches a
5’ to 3’ direction. Termination (stop) site on the DNA
 able to start a chain from scratch; they 4. This strand of mRNA is EDITED before
don’t need a primer leaving the nucleus & carrying the
 attaches and initiates transcription is code into the cytoplasm
known as the promoter;
DNA never leaves the nucleus
3 types of RNA are made from DNA
How is mRNA Edited?
mRNA “messenger”
On a mRNA strand there are areas called:
– Made from DNA in nucleus Exons and Introns
– Travels out of nucleus and finds the
ribosome Introns are cut out before leaving the
– Carries copies of instructions for nucleus. Exons are left, and this shortened
assembling amino acids into proteins. piece of mRNA leaves the nucleus and gets
Translated into Proteins
tRNA “Transfer”
Translation Or Protein Synthesis
– Brings amino acids to the ribosomes
– Found in Cytoplasm Main stages:

rRNA ribosomal 1. Initiation

– Part of the ribosome - when an mRNA molecule attaches to a

– This is where the proteins are made ribosome.
- promoter of a gene includes within it
Transcription Or RNA Synthesis
the transcription start point and
Transcription typically extends several dozen or
more nucleotide pairs “upstream”
- RNA molecules are produced by
from the start point.
copying part of a nucleotide sequence
- Ribosomes contain three binding sites:
of DNA into a complementary
an A site, a P site, and an E site. The
sequence in RNA.
mRNA will shuffle through from A to P
- This process is called transcription.
to E.
- Transcription requires the enzyme
- As the mRNA codons are read, the
RNA polymerase.
polypeptide will be built. In all
organisms, the start codon for the
initiation of protein synthesis is A–U–
G, which codes for the amino acid
methionine.
- Proteins can have AUGs in the rest of • In eukaryotes, the mRNA is
the protein that code for methionine “processed” by having its introns, or
as well, but the special first AUG of an noncoding sequences, removed. A 5’
mRNA is the one that will kick off cap and a 3’ tail are also added.
translation. • Now, ready to be translated, mRNA
- The tRNA with the complementary proceeds to the ribosome.
anticodon, U–A–C, is methionine’s • Free-floating amino acids are picked
personal shuttle; when the AUG is up by tRNA and shuttled over to the
read on the mRNA, methionine is ribosome, where mRNA awaits.
delivered to the ribosome. • In translation, the anticodon of a tRNA
molecule carrying the appropriate
2. Elongation amino acid base pairs with the codon
on the mRNA.
- In the ribosome, amino acids are • As new tRNA molecules match up to
transferred to the growing polypeptide new codons, the ribosome holds them
chain by the action of the tRNA in place, allowing peptide bonds to
(elongation) form between the amino acids.
- Addition of amino acids is called • The newly formed polypeptide grows
elongation. until a stop codon is reached.
- Remember that the mRNA contains • The polypeptide or protein folds up
many codons, or “triplets,” of and is released into the cell.
nucleotide bases.
Lesson 1: Genetic Engineering
- As each amino acid is brought to the
mRNA, it is linked to its neighboring Central Dogma
amino acid by a peptide bond.
- the directional command of creating
- When many amino acids link up, a
proteins from genetic information
polypeptide is formed.
(DNA) was dubbed by Francis Crick in
1956.
3. Termination
- The central dogma in prokaryotic and
eukaryotic cells do not differ greatly,
- When the “STOP” codon is reached
difference lies mostly in the site of the
the mRNA uncouples from the
process and the characteristics of the
ribosome
genetic information.
- The synthesis of a polypeptide is
ended by stop codons.
- A codon doesn’t always code for an
amino acid; there are three that serve
as a stop codon.
- Termination occurs when the
ribosome runs into one of these three
stop codons.

Summary:
Some genetic engineering techniques are
• In transcription, mRNA is created from as follows:
a particular gene segment of DNA.
1. Artificial selection - The cat that was cloned had the same
exact DNA but different color fur than
- breeders choose which organism to mate
the mother.
to produce offspring with desired traits.
- How can this be?
A. selective breeding - Environment plays a huge part in the
B. hybridization way organisms develop.
C. Inbreeding
Eggs are haploid
Artificial selection - Selective Breeding
Haploid: half the chromosomes, 23 in
Hybridizations humans

Inbreeding Body cells are diploid:

 Variation: difference between Diploid: two sets of chromosomes, one

individuals of a species. from mom and one set from dad 46 in
 The differences are in the genes but humans.
we see the physical differences. How could you clone a human?
 For example: Some humans have
blond hair and some have brown. Step 1:
This is a variation among humans.
 An egg is removed from a female
 Some finches have short beaks, some
human
have long beaks.
 The nucleus of the egg is removed and
 Inbreeding decreases variations.
is thrown away.

2. Cloning Step 2:

 A body cell is removed from another

- creating an organism that is an exact
person.
genetic copy of another.
 The nucleus of the body cell is
- There are human clones in our school.
removed
- identical twins are naturally created
 Body cells are diploid: 46
clones.
chromosomes.
- Clone: group of cells or organisms that
are genetically identical as a result of Step 3:
asexual reproduction
- They will have the same exact DNA as  The nucleus of the diploid body cell is
the parent. put into the egg.
 This egg no longer needs to TH De
How is cloning done? fertilized since it has all 46
chromosomes.
- A single cell is removed from a parent
organism. Step 4:
- An entire individual is grown from that
cell.  The egg is then charged with
electricity to start mitosis.
Dolly

- Since Dolly, cats and other organisms

have been cloned.
Step 5: How are genes cut for gene splicing?

 Its then put into a surrogate mother so  A bacterial plasmid is used.

it can grow.  Plasmid: circular DNA in a bacteria
 It’s going to be genetically identical to cell.
the parent of the body cell.  It is very simple and easy to
 But it will be a baby. manipulate.
 Plants and animals can be cloned.
restriction enzyme
Benefits of cloning:
- enzyme that cuts the DNA at a specific
 you can make exact copies of code.
organisms with strong traits. - There are thousands of restriction
 Increase food supply enzymes.
 Medical purposes: clone organs for - Each cuts DNA at a different sequence.
transplants. - Some look for GGCC and cut in
 Bring back or Stop species from going between the G and C.
extinct. - Every time GGCC is found in the DNA it
is cut by the restriction enzyme
Risks of cloning:
How is gene splicing done?
 Decreases genetic diversity
 If one of your clones gets a disease, A. A restriction enzyme cuts the insulin
they all get it: same immune system. gene out of the human DNA.
 Inefficient: high failure rate: 90%+ B. A plasmid is removed from a bacteria
 Expensive and cut with a restriction enzyme
C. The human gene is place into the
3. Gene splicing bacteria plasmid
D. The plasmid is placed back into the
- DNA is cut out of one organism and bacteria.
put into another organism  The cell now has directions (DNA) to
- A trait will be transferred from one make insulin.
organism to another.  That's exactly what it does.
- For example: the human insulin gene  Its human insulin, bacteria do not
can be removed from a human cell. make insulin on their own.
- It can be put into a bacterial cell. Transformation
- The bacterial will now make human
insulin. - when a gene from one organism is
transferred to different organism.
Benefits: - The organisms that have DNA
- insulin is cheaper transferred to them are called
- There are no side effects because it is transgenic organisms.
human insulin. - trans: means different,
- We once used pig insulin but there are - genic: refers to genes
side effects and it more expensive. - Genetic engineering has given rise to a
new technological field called
biotechnology (technology of life).
 1. Transgenic (GMO) Venomous cabbage

Animals - gene from a scorpion ails inserted into

cabbage.
- genes inserted into animals so they
- Cabbage now produces that chemical.
produce what humans need.
- Why? Limit pesticide use while still
• Why?: A way to improve the food supply: preventing insects from damaging
crops.
Transgenic cows
- Corporations state the toxin is
- gene inserted to increase milk modified so it isn't harmful to humans.
production. - virus is injected into a banana, the
virus DNA becomes part of the plant.
Spider goat: - As the plant grows, it produces the
- gene from spider inserted into goat. virus proteins - but not the disease
- Goats makes silk of the spider web in part of the virus.
their milk. - When people eat a bite, their immune
- Flexible, stronger than steel. Used in systems creates antibodies to fight the
bullet proof jackets. disease - just like a traditional vaccine
- Vaccines for hepatitis and cholera
Glow-in-the-dark cats
A virus is often used to deliver DNA.
- Scientist used a virus to insert DNA
from jellyfish In the movie "I Am Legend," A healthy
- The gene made the cat produce a gene was inserted into a virus.
fluorescent protein in its fur. The virus invaded the cancer cells and
inserts the healthy gene to cure cancer.
2. Transgenic bacteria
Worked at first but the virus mutated and
- gene inserted into bacteria so they became deadly.
produce things humans need.
This is being attempted in real life.
For example: insulin and clotting factors in
blood are now made by bacteria. Gene therapy

3. Transgenic plants - when disease causing genes are cut

out and good gene are inserted.
- plants are given genes so they meet - Restriction enzymes are used to cut
human needs. out bad genes.
Transgenic corn - Viruses are used to insert good genes.
- Not approved for human use yet.
- given a gene so corn produces a - Some possible side effects.
natural pesticide. 4. Gel electrophoresis
- Now they don't have to be sprayed
with cancer causing pesticides. - a technique used to compare DNA from
- 25% of all corn is like this. two or more organisms.

Why compare DNA:

Find your baby's daddy Who committed a

crime. How closely species are related.
How is electrophoresis done?

A. The DNA is cut into fragments with a plasmid

restriction enzyme.
- small, circular pieces of DNA located in
B. The cut DNA is then put into the wells
the cytoplasm of many bacteria;
of a machine filled with gel. The gel is
separate from the main bacterial
spongy and the DNA squeezes through
chromosome.
the pores.
C. The machine is plugged in and the Cloning
fragments get separated based on
- using live organisms to replicate DNA
their size. The smaller fragments move
(such as bacterial transformation lab
further than the large. Electricity
technique)
provides the energy
Transgenic
Why does DNA move?
- Organism contains genes from other
- DNA has a negative charge.
organisms
- When the machine is plugged it, its
moves towards the positive pole Gene Therapy
created by the electricity
- a technique that places a gene into a
Does cloning create organisms with cell to correct a hereditary disease or
recombinant DNA? to improve the genome.
- No, the DNA from one organism is
copied. DNA is not recombined

Summary

Genetic engineering creates organisms

with Pre-combinant DNA.

Recombinant DNA: when DNA is combined

from at least two organisms.

Which techniques create recombinant

DNA

1. Sexual reproduction: natural

2. selective breeding
3. Hybridization
4. Gene splicing

Lesson 2: Applications of Recombinant

DNA

Gel electrophoresis

- Technique for separating molecules

(usually DNA fragments) based on size
and/or charge.