Lesson 0: Molecular Structure of DNA, thymine (T) DNA only

RNA, and Proteins

uracil (U) RNA only
Nucleic Acid
cytosine (C)
Two types:
DNA
a. Deoxyribonucleic acid (DNA- double
- repository of genetic information;
helix)
sequence of bases encodes the
b. Ribonucleic acid (RNA-single strand) blueprint for life processes.

Nucleic acid are composed of long chains

of nucleotides linked by dehydration
synthesis.

Overall Function Of Nucleic Acid

The sequence of nucleotides in a nucleic

acid molecule serves as a blueprint to
encode the correct sequence of amino
acids for a protein. The code for a specific
protein is called a “gene.”

The building blocks of any nucleic acid are

the nucleotides. RNA

Nucleotide - information in the form of base

sequence is transformed (transcribed)
A nucleotide is composed of a phosphate into mRNA, tRNA and rRNA.
group (with negative charges), a sugar
portion and an N-base. DNA is the template copied into RNA by
base pairing. G with C; A with U.
Nucleic acids
Protein
Nucleotides include:
- Functional products of genes
1. phosphate group - Executes cellular functions
2. pentose sugar (5-carbon) The four structural levels of protein are:
Ribose (found in RNA)

Deoxyribose (found in DNA)

3. Nitrogenous bases:

A. Purine

adenine (A)

guanine (G) 1. Primary

B. Pyrimidine Sequence of amino acids in the
polypeptide chain.
Secondary Given the following coding sequence for
DNA, provide the sequence of the
When the polypeptide chain form a helix
complementary (template) sequence.
or beta-pleated sheet structure
Coding Sequence:
Tertiary
5’ ATGCATAGATTAGGATATCCCAGATAG 3’
Coiling of polypeptide, combining helices
and sheet forms. Complementary Sequence:

Quarternary 3’ TACGTATCTAATCCTATAGGGTCTATC 5’

The association of two or more Lesson 0.1: Gene To Protein Synthesis

polypeptides in space.

Protein Structures

1. DNA unwinds
2. mRNA copy is made of one of the DNA
strands.
3. mRNA copy moves out of nucleus into
cytoplasm.
4. tRNA molecules are activated as their
complementary amino acids are
attached to them.
5. mRNA copy attaches to the small
subunit of the ribosomes in cytoplasm.
6 of the bases in the mRNA are
exposed in the ribosome.
6. A tRNA bonds complementarily with
the mRNA via its anticodon.
7. A second tRNA bonds with the next
three bases of the mRNA, the amino
acid joins onto the amino acid of the
first tRNA via a peptide bond.
8. The ribosome moves along. The first
tRNA leaves the ribosome.
9. A third tRNA brings a third amino acid
10. Eventually a stop codon is reached on
the mRNA. The newly synthesized
polypeptide leaves the ribosome.
DNA replication B. Base pairing is maintained; Adenine
pairs with Thymine, Guanine pairs
- DNA strands separate and serve as
with Cytosine
templates for the production of new
C. New DNA molecules are produced in
DNA molecules.
the 5’ to 3’ direction
- Replication of a chromosome begins at
particular sites called origins of
replication
- Proteins initiate DNA replication
recognize the sequence and will
separate the DNA strand that will open
up a “replication bubble”
- Replication of DNA occurs in both
direction until the entire molecule is
copied.
- In contrast in bacterial chromosome,
eukaryotic chromosome may have
hundred or even few thousands of
replication origins
- At each end of a replication bubble is a
replication fork, a Y- shaped region
where the parental strands of DNA are
being unwound
- Helicases are enzymes that separates D. Semi-discontinuous. The leading strand
the two parental strands and making is synthesized in a continuous manner
them available as template strands. (5’ to 3’) while the lagging strand is
- Single-strand binding proteins bind to produced discontinuously in short
the unpaired DNA strands, keeping stretches called Okazaki fragments.
them from re-pairing.
- The untwisting of the double helix DNA Replication: PLOT TWIST
causes tighter twisting and strain
- However, the enzymes that synthesize
ahead of the replication fork.
DNA cannot initiate the synthesis of a
- Topoisomerase helps relieve this
polynucleotide; they can only add DNA
strain by breaking, swiveling, and
nucleotides to the end of an already
rejoining DNA strands
existing chain that is base-paired with
- The unwound sections of parental
the template strand.
DNA strands are now available to
- The initial nucleotide chain that is
serve as templates for the synthesis of
produced during DNA synthesis is a
new complementary DNA strands.
short stretch of RNA, NOT DNA.
The following are features of replication: - This RNA chain is called a primer and
is synthesized by the enzyme primase.
A. Semi-conservative- the resulting DNA
consists of one old and one new Primer
strand
- starts a complementary RNA chain
from a single RNA nucleotide, adding
 more RNA nucleotides one at a time, polymerase must work in the direction
using the parental DNA strand as a away from the replication fork
template. - The lagging strand is synthesized as a
- The completed primer, generally 5–10 series of segments called Okazaki
nucleotides long, is thus base-paired fragments, which are joined together
to the template strand. by DNA ligase
- The new DNA strand will start from
The DNA Replication Complex
the 3′ end of the RNA primer.
- The proteins that participate in DNA
Synthesizing a New DNA Strand
replication form a large complex, a
- Enzymes called DNA polymerases “DNA replication machine”
catalyze the elongation of new DNA at - The DNA replication machine may be
a replication fork stationary during the replication
- Most DNA polymerases require a process
primer and a DNA template strand - Recent studies support a model in
- The rate of elongation is about 500 which DNA polymerase molecules
nucleotides per second in bacteria and “reel in” parental DNA and “extrude”
50 per second in human cells newly made daughter DNA molecules
- Each nucleotide that is added to a
Proofreading and Repairing DNA
growing DNA strand is a nucleoside
triphosphate - DNA polymerases proofread newly
- dATP supplies adenine to DNA and is made DNA, replacing any incorrect
similar to the ATP of energy nucleotides
metabolism - In mismatch repair of DNA, repair
- The difference is in their sugars: dATP enzymes correct errors in base pairing
has deoxyribose while ATP has ribose - DNA can be damaged by exposure to
- As each monomer of dATP joins the harmful chemical or physical agents
DNA strand, it loses two phosphate such as cigarette smoke and X-rays; it
groups as a molecule of can also undergo spontaneous
pyrophosphate changes
- In nucleotide excision repair, a
Antiparallel Elongation
nuclease cuts out and replaces
- The antiparallel structure of the damaged stretches of DNA
double helix affects replication
Deeper Look: DNA Replication
- DNA polymerases add nucleotides
only to the free 3’ end of a growing After RNA primer is made, DNA pol III
strand; therefore, a new DNA strand starts to synthesize the leading strand
can elongate only in the 5’ to 3’
direction The flow from Gene to Protein
- Along one template strand of DNA, the - Triplet code
DNA polymerase synthesizes a leading - The genetic instructions for a
strand continuously, moving toward polypeptide chain are written in the
the replication fork DNA as a series of non-overlapping,
- To elongate the other new strand, three-nucleotide words.
called the lagging strand, DNA
- The series of words in a gene is rRNA ribosomal
transcribed into a complementary
– Part of the ribosome
series of non-overlapping, three-
– This is where the proteins are made
nucleotide words in mRNA, which is
then translated into a chain of amino Transcription Or RNA Synthesis
acids
Transcription
Transcription
- RNA molecules are produced by
- Messenger RNA, the carrier of copying part of a nucleotide sequence
information from DNA to the cell’s of DNA into a complementary
protein- synthesizing machinery, is sequence in RNA.
transcribed from the template strand - This process is called transcription.
of a gene. - Transcription requires the enzyme
- An enzyme called an RNA polymerase RNA polymerase.
pries the two strands of DNA apart
and joins together RNA nucleotides
complementary to the DNA template
strand, thus elongating the RNA
polynucleotide

DNA polymerases VS RNA polymerases

DNA polymerases
Transcription Steps
 Function in DNA replication
 Needs primer 1. RNA polymerase binds to the
promoter site (TATA box) (start) on the
RNA polymerases DNA
2. RNA polymerase adds RNA nucleotides
 assemble a polynucleotide only in its
complimentary to the DNA strand
5’ to 3’ direction.
3. mRNA building is complete when the
 able to start a chain from scratch; they
RNA polymerase reaches a
don’t need a primer
Termination (stop) site on the DNA
 attaches and initiates transcription is
4. This strand of mRNA is EDITED before
known as the promoter;
leaving the nucleus & carrying the
3 types of RNA are made from DNA code into the cytoplasm

mRNA “messenger” DNA never leaves the nucleus

– Made from DNA in nucleus How is mRNA Edited?

– Travels out of nucleus and finds the
On a mRNA strand there are areas called:
ribosome
Exons and Introns
– Carries copies of instructions for
assembling amino acids into proteins. Introns are cut out before leaving the
nucleus Exons are left, and this shortened
tRNA “Transfer”
piece of mRNA leaves the nucleus and gets
– Brings amino acids to the ribosomes Translated into Proteins
– Found in Cytoplasm
TRANSLATION OR PROTEIN SYNTHESIS - As each amino acid is brought to the
mRNA, it is linked to its neighboring
Main stages:
amino acid by a peptide bond.
1. Initiation - When many amino acids link up, a
polypeptide is formed.
- when an mRNA molecule attaches to a
ribosome. 3. Termination
- promoter of a gene includes within it
the transcription start point and - When the “STOP” codon is reached
typically extends several dozen or the mRNA uncouples from the
more nucleotide pairs “upstream” ribosome
from the start point. - The synthesis of a polypeptide is
- Ribosomes contain three binding sites: ended by stop codons.
an A site, a P site, and an E site. The - A codon doesn’t always code for an
mRNA will shuffle through from A to P amino acid; there are three that serve
to E. as a stop codon.
- As the mRNA codons are read, the - Termination occurs when the
polypeptide will be built. In all ribosome runs into one of these three
organisms, the start codon for the stop codons.
initiation of protein synthesis is A–U–
Summary:
G, which codes for the amino acid
methionine. • In transcription, mRNA is created from
- Proteins can have AUGs in the rest of a particular gene segment of DNA.
the protein that code for methionine • In eukaryotes, the mRNA is
as well, but the special first AUG of an “processed” by having its introns, or
mRNA is the one that will kick off noncoding sequences, removed. A 5’
translation. cap and a 3’ tail are also added.
- The tRNA with the complementary • Now, ready to be translated, mRNA
anticodon, U–A–C, is methionine’s proceeds to the ribosome.
personal shuttle; when the AUG is • Free-floating amino acids are picked
read on the mRNA, methionine is up by tRNA and shuttled over to the
delivered to the ribosome. ribosome, where mRNA awaits.
• In translation, the anticodon of a tRNA
2. Elongation molecule carrying the appropriate
amino acid base pairs with the codon
- In the ribosome, amino acids are on the mRNA.
transferred to the growing polypeptide • As new tRNA molecules match up to
chain by the action of the tRNA new codons, the ribosome holds them
(elongation) in place, allowing peptide bonds to
- Addition of amino acids is called form between the amino acids.
elongation. • The newly formed polypeptide grows
- Remember that the mRNA contains until a stop codon is reached.
many codons, or “triplets,” of • The polypeptide or protein folds up
nucleotide bases. and is released into the cell.