Plant Breeding

PHENOTYPING AND QUANTITATIVE TRAIT LOCI
MAPPING OF THE HARD-TO-COOK AND

YIELD-RELATED AGRONOMIC TRAITS IN COMMON
BEAN (PHASEOLUS VULGARIS L.)
SAMUEL WANJOHI WAHOME
DOCTOR OF PHILOSOPHY
(Plant Breeding)
JOMO KENYATTA UNIVERSITY

OF
AGRICULTURE AND TECHNOLOGY
2023
Phenotyping And Quantitative Trait Loci Mapping
of the Hard-To-Cook and Yield-Related Traits in Common Bean
(Phaseolus vulgaris L.)
Samuel Wanjohi Wahome
A Thesis Submitted in Partial Fulfilment of the Requirements for

the Degree of Doctor of Philosophy in Plant Breeding of the
Jomo Kenyatta University of Agriculture and Technology
2023
DECLARATION
This thesis is my original work and has not been presented for a degree in any other
university.
Signature………………………...……… Date…..........................................
Samuel Wanjohi Wahome
This thesis has been submitted for examination with our approval as University supervisors
Signature…………………….…………….. Date……………………………
Prof. Stephen Mwangi Githiri, PhD
JKUAT, Kenya
Signature…………………………………. . Date……………………………
Prof. Geert Angenon, PhD
VUB, Belgium
Signature…………………………………… Date……………………………
Dr. Peter K. Kinyanjui, PhD
JKUAT, Kenya
ii
DEDICATION
I dedicate this thesis to my extended family for their encouragement, moral support, and
love. And to my promoters and all scientist who made this work possible through their great
contribution in various ways.
iii
ACKNOWLEDGEMENT
Firstly, I wish to thank the almighty God for good health and strength during the period of
my study. I would like to appreciate my supervisors Prof. Stephen Mwangi Githiri, Prof.
Geert Angenon and Dr. Peter Kinyanjui Kahenya for their guidance and support from
conceptualisation, experimentation, data analysis and write up of the research study. My
utmost gratitude goes to ‘Vlaamse Interuniversitaire Raad voor Universitaire
Ontwikkelingssamenwerking’ (VLIRUOS) for awarding me a study scholarship through
through Legume Centre of Excellence for Food and Nutrition Security Project.
I am grateful to member of staff in the Department of Horticulture and Food Security for
their guidance and support. I am grateful to Prof. Geert Angenon for his guidance and hosting
me at Laboratory of Plant Genetics, VUB, Belgium. Special thanks to the technical staff of
JKUAT Mr. Vodha Mumo and Mr. Patrick Amahema for their guidance in conducting
various experiments during the study. Special thanks to my colleagues Dr. Esther Toili and
Mr. John Kariuki for their moral support and ideas during this study.
I would like to acknowledge members of staff of SEQART AFRICA for genotyping services
and guidance in Genome Wide Association Analysis. The assistance in linkage mapping and
QTL analysis by Dr. Manje Gowda of CIMMYT is highly appreciated.
iv
TABLE OF CONTENT
DECLARATION ................................................................................................................. II
DEDICATION .................................................................................................................... III
ACKNOWLEDGEMENT ................................................................................................. IV
TABLE OF CONTENT ...................................................................................................... V
LIST OF TABLES ............................................................................................................. XI
LIST OF FIGURES ........................................................................................................ XIII
LIST OF APPENDICES ..................................................................................................XV
LIST OF ABBREVIATIONS AND ACRONYMS ...................................................... XVI
ABSTRACT .................................................................................................................. XVIII
CHAPTER ONE .................................................................................................................. 1
INTRODUCTION ................................................................................................................ 1
1.1 Background information .................................................................................................. 1
1.2 Statement of the problem ................................................................................................. 3
1.3 Justification of the study .................................................................................................. 4
1.4 Objectives ........................................................................................................................ 5
1.4.1 Main objective .............................................................................................................. 5
1.4.2 Specific objectives ........................................................................................................ 5
1.5 Null hypotheses ................................................................................................................ 5
CHAPTER TWO ................................................................................................................. 7
LITERATURE REVIEW ................................................................................................... 7
v
2.1 Botany, origin, and distribution of common bean ........................................................... 7
2.2 Traits of common bean targeted for improvement through breeding ............................. 8
2.3 Nutritional quality and health benefits of common beans ............................................. 10
2.4 Common bean production in eastern Africa .................................................................. 12
2.5 Seed yield ....................................................................................................................... 14
2.6 Storage, processing, and cooking quality of common beans ......................................... 15
2.7 Mechanism of common bean cotyledon hardening ....................................................... 16
2.8 Genetics of cooking time ............................................................................................... 18
2.9 Application of genetic markers ...................................................................................... 19
2.10 Quantitative Trait Loci (QTL) mapping ...................................................................... 20
2.11 Genome-Wide Association Studies ............................................................................. 22
CHAPTER THREE ........................................................................................................... 24
PHENOTYPING FOR YIELD-RELATED AGRONOMIC TRAITS IN A PANEL
OF LOCALLY CONSERVED COMMON BEAN (PHASEOLUS VULGARIS L.)
ACCESSIONS .................................................................................................................... 24
3.1 Abstract .......................................................................................................................... 24
3.2 Introduction .................................................................................................................... 25
3.3 Materials and methods ................................................................................................... 26
3.3.1 Field experimental site ................................................................................................ 26
3.3.2 Plant materials ............................................................................................................. 26
3.3.3 Experimental design and trial management ................................................................ 28
3.3.4 Agronomic data collection .......................................................................................... 29

vi
3.3.5 Statistical analysis ....................................................................................................... 30
3.4 Results ............................................................................................................................ 31
3.4.1 Descriptive statistics for agronomic and seed yield traits ........................................... 31
3.4.2 Estimation of genetic variables for traits measured .................................................... 32
3.4.3 Duration to flowering and maturity, and yield-related traits ...................................... 33
3.4.4 Cluster and correlation results..................................................................................... 37
3.4.5 Grain yields for common bean seed classes ............................................................... 39
3.4.6 Grain yields for large, medium, and small-seeded common bean lines ..................... 40
3.4.7 Grain yields for bush, semi climber, and climbing common bean lines ..................... 40
3.5 Discussion ...................................................................................................................... 41
3.6 Conclusion ..................................................................................................................... 46
CHAPTER FOUR .............................................................................................................. 47
GENOME WIDE ASSOCIATION STUDY OF VARIATION IN COOKING TIME
AMONG COMMON BEAN (PHASEOLUS VULGARIS L.) ACCESSIONS USING
DIVERSITY ARRAYS TECHNOLOGY MARKERS .................................................. 47
4.1 Abstract .......................................................................................................................... 47
4.2 Introduction .................................................................................................................... 48
4.3.1 Plant material and field multiplication ........................................................................ 50
4.3.2 Incubation of seed and determination of cooking time ............................................... 50
4.3.3 DNA extraction and genotyping ................................................................................. 51
4.3.4 Data analysis ............................................................................................................... 52

vii
4.3.5 Linkage disequilibrium ............................................................................................... 52
4.3.6 Marker-trait association .............................................................................................. 53
4.3.7 Identification of potential candidate gene ................................................................... 53
4.4 Results ............................................................................................................................ 54
4.4.1 Phenotypic Evaluation ................................................................................................ 54
4.4.2 Marker data ................................................................................................................. 65
4.4.5 Identification of potential candidate gene ................................................................... 69
4.5 Discussion ...................................................................................................................... 70
4.6 Conclusion ..................................................................................................................... 75
CHAPTER FIVE ............................................................................................................... 76
GENOME WIDE ASSOCIATION STUDY OF VARIATION IN AGRONOMIC
TRAITS AMONG COMMON BEAN (PHASEOLUS VULGARIS L.) ACCESSIONS
USING DIVERSITY ARRAYS TECHNOLOGY MARKERS .................................... 76
5.1 Abstract .......................................................................................................................... 76
5.2 Introduction .................................................................................................................... 77
5.3.1 Plant materials ............................................................................................................. 79
5.3.2 the experimental design and Experimental design and trial management .................. 79
5.3.3 DNA extraction and genotyping ................................................................................. 80
5.3.4 Data analysis ............................................................................................................... 80

viii
5.3.7 Identification of potential candidate genes ................................................................. 80
5.4 Results ............................................................................................................................ 80
5.4.1 Phenotypic traits.......................................................................................................... 80
5.4.2 Single Nucleotide Polymorphism markers ................................................................. 81
5.4.3 Duration to flowering and maturity ............................................................................ 82
5.4.4 Number of pods per plant and pod length ................................................................... 85
5.4.5 Number of seeds per pod, seed weight and grain yield .............................................. 88
5.5 Discussion ...................................................................................................................... 91
5.6 Conclusion ..................................................................................................................... 95
CHAPTER SIX .................................................................................................................. 97
QTLS FOR COOKING TIME AND MORPHOLOGICAL TRAITS USING
RECOMBINANT INBRED LINES OF COMMON BEAN (PHASEOLUS VULGARIS
L.) AND DIVERSITY ARRAYS TECHNOLOGY MARKERS................................... 97
6.1 Abstract .......................................................................................................................... 97
6.2 Introduction .................................................................................................................... 98
6.3.1 Plant material and field multiplication ........................................................................ 99
6.3.2 Incubation of seed and determination of cooking time ............................................. 101
6.3.3 DNA extraction and genotyping ............................................................................... 101
6.3.4 Data analysis ............................................................................................................. 101

ix
6.4 Results .......................................................................................................................... 102
6.4.1 Phenotypic correlation .............................................................................................. 102
6.4.2 QTL mapping ............................................................................................................ 104
6.4.3 Cooking time ............................................................................................................. 106
6.4.4 Days to flowering and maturity ................................................................................ 109
6.4.5 Number of pods per plant and pod length ................................................................. 112
6.4.6 Number of seeds per pod and seed weight................................................................ 114
6.5 Discussion .................................................................................................................... 116
6.6 Conclusion ................................................................................................................... 120
CHAPTER SEVEN .......................................................................................................... 122
CONCLUSION AND RECOMMENDATIONS ........................................................... 122
7.1 General conclusion ..................................................................................................... 122
7.2 Recommendations ...................................................................................................... 123
REFERENCES ................................................................................................................. 125
APPENDICES .................................................................................................................. 144
x
LIST OF TABLES
Table 2.1: Mean production figures of common bean in the eastern Africa region ........... 13
Table 3.1: Common bean accessions used in this study ..................................................... 28
Table 3.2: Quantitative agronomic traits recorded in field trials ........................................ 30
Table 3.3: Descriptive statistics for days to flowering and maturity, and yield-related ..... 32
Table 3.4: Estimation of genetic variables for days to flowering, days to maturity and
yield-related traits ........................................................................................................ 33
Table 3.5: Mean values for days to flowering, days to maturity and yield-related traits for
top 10, bottom 5 and checks ........................................................................................ 34
Table 3.6: Mean values for days to flowering, days to maturity and yield-related for top 10,
bottom 5 and checks..................................................................................................... 36
Table 3.7: Pearson correlation coefficient for days to flowering, days to maturity and
yield-related traits for ................................................................................................... 39
Table 3.8: Mean grain yield for common bean accessions grouped into their ................... 41
Table 4.1: Mean values of cooking time of common bean accessions for fresh and aged
seeds ordered based on cooking time of aged seeds .................................................... 55
Table 4.2: Pearson correlation coefficient between cooking time and seven agronomic
traits.............................................................................................................................. 62
Table 4.3: Cooking time of fresh and aged soaked seed of common bean market classes . 63
Table 4.4: Significant SNPs for cooking time of aged common bean accessions .............. 68
Table 4.5: Potential candidate genes identified in Phytozome data base around SNPs
significantly associated cooking time for common bean accessions ........................... 70
Table 5.1: Common bean accessions used in this study and their characteristics .............. 79
Table 5.2: Descriptive statistics for agronomic traits of common bean accessions ............ 81
Table 5.3: Number of significant SNPs identified for various agronomic traits ................ 82
Table 5.4: Chromosome, chromosome position, P-values, minor allele frequency for days
to flowering and maturity............................................................................................. 84
Table 5.5: Chromosome, chromosome position, P-values, minor allele frequency for
number of pods per plant and pod length..................................................................... 86
xi
Table 5.6: Chromosome, chromosome position, P-values, minor allele frequency for
number of seeds per pod, seed weight and yield.......................................................... 90
Table 6.1: Descriptive statistics for the parents and RILs for various phenotypic traits .. 103
Table 6.2: Pearson phenotypic correlation coefficient between various traits of RILs .... 104
Table 6.3: Population size and number of SNP markers sequenced ................................. 104
Table 6.4: Linkage map of F2:6 RILs of common bean..................................................... 105
Table 6.5: Significant QTLs for cooking time detected using inclusive composite interval
mapping...................................................................................................................... 108
Table 6.6: Significant QTLs for days to flowering and days to flowering detected using
inclusive composite interval mapping........................................................................ 110
Table 6.7: Significant QTLs for number of pods per plant and pod length detected using
Table 6.8: Significant QTLs for number of seeds per pod and seed weight detected using
xii
LIST OF FIGURES
Figure 3.1: A sample of seeds of various common bean accessions used in this study. .... 27
Figure 3.2: Field experiments at Jomo Kenyatta University of Technology experimental
farm. ............................................................................................................................. 29
Figure 3.3: Dendrogram showing relationship among 257 common bean genotypes ........ 38
Figure 4.1: Incubators used for storage of seed in a controlled temperature and relative
humidity chamber to artificially age the common bean accessions. ............................ 51
Figure 4.2: Cooking time profile of fresh and aged common bean seeds using mean
averages of all accessions evaluated. ........................................................................... 60
Figure 4.3: Cooking time profile of fresh common bean seeds of different market classes
...................................................................................................................................... 64
Figure 4.4: Cooking time profile of aged common bean seeds of different market classes 65
Figure 4.5: Population structure of common bean accession and amount of variation
accounted for by principal components ....................................................................... 66
Figure 4.6: Distribution of makers by correlation (r) in each of the 11 chromosomes,...... 67
Figure 4.7: Quantile-quantile plot of estimated -log (P) for association analysis of cooking
time............................................................................................................................... 68
Figure 5.1: Manhattan plot showing candidate SNPs and their P-values for days to
flowering of common bean accessions ........................................................................ 83
maturity ........................................................................................................................ 83
xiii
Figure 5.3: Manhattan plot showing candidate SNPs and their P-values for number of pods
per plant of common bean accessions .......................................................................... 87
Figure 5.4: Manhattan plot showing candidate SNPs and their P-values for pod length ... 87
Figure 5 5: Manhattan plot showing candidate SNPs and their P-values for number of
seeds ............................................................................................................................. 90
Figure 5.6: Manhattan plot showing candidate SNPs and their P-values for number of 100-
seed weight................................................................................................................... 91
Figure 5.7: Manhattan plot showing candidate SNPs and their P-values for grain yield ... 91
Figure 6.1: GLP2 and GLPx92 their F1 and F2’s seeds, GLPx92 and GBK035420 and
their F1’s and F2 seeds. ............................................................................................... 100
Figure 6.2: Development of RILs in a greenhouse at Jomo Kenyatta University of
Technology................................................................................................................. 100
Figure 6.3: Seeds from various single plants at F3 generation from a cross between GLP2X
GLPx92 and GLPx92 X GBK035420 ....................................................................... 101
Figure 6.4: Common bean linkage map constructed using Pinto x Rosecoco F2:6 RILs .. 106
Figure 6.5: Common bean linkage map constructed using Pinto x Black F2:6 RILs ........ 107
xiv
LIST OF APPENDICES
Appendix I: Analysis of variance for agronomic traits and cooking time of common bean
accession grown during year 2019/2020.................................................................... 144
Appendix II: Analysis of variance for agronomic traits and cooking time of recombinant
lines derived from a cross of GLPx92 (pinto) X GLP2 (rosecoco) ........................... 145
Appendix III: Analysis of variance for agronomic traits and cooking time of recombinant
inbred lines derived from a cross of GLPx92 (pinto) X GBK035420 (black coloured)
.................................................................................................................................... 146
Appendix IV: Average rainfall and temperature for Juja area in the year 2018/2019 ..... 147
xv
LIST OF ABBREVIATIONS AND ACRONYMS
AEZ Agroecological Zone
AFA Agriculture and Food Authority agency
ANOVA Analysis of variance
BecA Biosciences eastern and central Africa
ACIAR Australian Centre for International Agricultural Research Basic Local
BLASTn Alignment Search Tool for Nucleotides
CMLM Compressed Mixed Linear Models
CW Canadian Wonder
CGIAR The consultative Group for International Agricultural Research
CIAT International Center for Tropical Agriculture
CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
CV Coefficient of Variation
DArTseq Diversity Arrays Technology sequencing
DNA Deoxyribonucleic acid
ETC Easy-To-Cook
FAO Food and Agriculture Organisation
FAOSTAT Food and Agriculture Organisation Statistics
GAPIT Genomic Association and Prediction Integrated Tool
GBS Genotyping by Sequencing
GCV Genotypic Coefficient of Variation
GLM Generalised Linear Model
GWAs Genome Wide Association studies
HTC Hard-To-Cook
IRLI International Research of Livestock Institute
JKUAT Jomo Kenyatta University of Agriculture and Technology
KALRO Kenya Agricultural and Livestock Research Organisation
LCEFoNS Legume Centre of Excellence for Food and Nutrition Security
LD Linkage Disequilibrium
xvi
LSD Least Significant Difference
LOD Logarithm of the odds
MAF Minor Allele Frequency
MAS Markers Assisted Selection
MLM Mixed Linear Models
NO3 Nitrate
PME Pectin methylesterase
PCR Polymerase Chain Reaction
PC Principal component
PCV Phenotypic Coefficient of Variation
QTL Quantitative Trait Loci
RAPD Random Amplified Polymorphic DNA
NCBI National Center for Biotechnology Information
NGS Next Generation Sequencing
RCBD Randomized Complete Block Design
RFLP Restriction Fragment Length Polymorphism
RH Relative Humidity
RILs Recombinant Inbred Lines
SCA Specific Combining Ability
SCAR Sequence Characterised Amplified Region
SNP Single Nucleotide Polymorphism
SSRs Simple Sequence Repeats
RC Rosecoco
SE Standard Error
UM Upper Midland
xvii
ABSTRACT
Common bean (Phaseolus vulgaris L.) is a source of protein, carbohydrates, dietary fiber,
and essential minerals to a large population worldwide. However, prolonged cooking time
for dry beans is a factor that hinders the production and consumption of common bean seeds
in many communities. The study aimed to assess common bean accessions for variation in
cooking time of dry grains and identify regions in the genome that control the hard-to-cook
(HTC) trait. Plant material used in this study comprised 257 common bean accessions
sourced from the National Gene Bank of Kenya, Kenya Agricultural and Livestock Research
Organisation (KALRO)-Embu, and from randomly selected local farmers’ fields. F2:6
recombinant inbred lines (RILs) were developed using common bean varieties GLP2,
GLPx92, and accession GBK035420. Field experiments were carried out at Jomo Kenyatta
University of Agriculture and Technology (JKUAT), Kenya. The experiments were laid
down as a randomized complete block design (RCBD) with three replicates for over four
seasons. Morphological data recorded included days to flowering, days to maturity, number
of pods per plant, pod length, number of seeds for a pod, 100-seed weight, and grain yield.
Cooking time was determined for each genotype using freshly harvested seeds and seeds
stored at a temperature of 35oC and 50% relative humidity for four months. Beans were
soaked for 16 hours in distilled water and cooked at 96oC in a thermostatically controlled
water bath. DNA was isolated for each accession and RILs and genotyping were carried out
using Single Nucleotide Polymorphism markers (SNPs) markers using Diversity Arrays
Technology Sequencing (DArTseq). Data collected from field experiments was subjected to
a normality test and analysis of variance (ANOVA). Pearsons phenotypic correlations
analysis was conducted for the traits measured. Association analysis was conducted using
the genome-wide analysis studies (GWAs) method to identify Quantitative Trait Loci
(QTLs) associated with the hard-to-cook trait. Linkage mapping and QTL analysis were used
to analyse data collected for RILs. The field experiment study revealed that days to
flowering. 100-seed weight and grain yield had high broad-sense heritability and identified
19 common bean accessions that were both early maturing and high-yielding traits. The
results revealed significant differences (P≤0.05) among accessions for all the traits evaluated,
the seasonal and the interaction between accessions and seasons were also significant.
xviii
GWAS and QTL study identified QTLs region associated with all the agronomic traits.
Agamous-like MADS-box transcripts like Phvul.001G186400.1 locus co-localized with
QTLs for days to flowering and maturity. The study revealed significant differences (P≤0.05)
within and between fresh and aged bean accessions. Fresh seeds had a lower cooking time
with a mean of 40.8 minutes and ranged from 28.1 to 72.2 minutes while aged seeds had a
higher average cooking time of 54.1 minutes and ranged from 32.1 to 96.3 minutes. Genome
wide association and QTL studies identified a region on chromosome 10 to be significantly
associated (P≤0.05) with the cooking time of aged seeds. Consequently, two potential
candidate genes Phvul.010G038000 (galacturan 1,4-alpha galacturonidase) and
Phvul.010G038100 (polygalacturonase) were revealed. QTL analysis identified
polygalacturonase/pectinase, pectin methylesterase, pectinesterase inhibitor, and galacturan
1, 4 alpha-galacturonidase enzymes to co-localize with the detected QTLs for cooking time.
The characterized common bean accessions and the identified SNP markers could be utilized
in breeding programs to improve common bean for cooking quality. The identified QTLs
could be useful in introgressive hybridization of cooking time trait and implementation
Markers assisted Selection (MAS) in the common bean.
xix
CHAPTER ONE
INTRODUCTION
1.1 Background information
Common bean (Phaseolus vulgaris L.) holds a prominent position in human nutrition. It
is a source of protein, carbohydrates, dietary fibre, vitamins, and essential minerals to a
large population all over the world (Mecha et al., 2018; Murube et al., 2021). Common
bean belongs to a large and diverse Phaseolus genus that contains approximately 70 to 80
species, of which only five are domesticated (Freytag and Debouck, 2002). Within this
genus, common bean leads with wide geographical distribution, agronomic, nutritional,
and economic value (Gepts, 2014). Studies have shown that the common bean has two
distinct centres of genetic differentiation, namely the Middle American and Andean gene
pools (Bitocchi et al., 2012).
Common bean is cultivated in a wide range of environments which include tropics, sub-
tropics and temperate regions, its adaptation is mainly limited to abiotic stresses such as
extremes in temperatures, drought, Salinity in soils and photoperiod sensitivity (Sedlar et
al., 2019, Losa et al., 2022). According to the database of the Food and Agriculture
Organization (FAO) in 2023, the global production of dry common bean grains is 29
million, cultivated on 36 million hectares (FAOSTAT, 2023). Latin American is the
largest producer of common bean, particularly Brazil and Mexico, with a production of
approximately 5.5 million metric tons per year (Petry et al., 2015). In Eastern African,
Tanzania leads in production, followed by Uganda, Kenya and Ethiopia (Table 2.1)
(FAOSTAT, 2023). Kenya produces about 722551 metric tons of dry common bean grains
and has a deficit of 93100 metric tons (AFA, 2022).
Preference for common bean grains varies among consumers depending on taste, seed
colour and size, ease of cooking, cooking quality and cultural factors (Wairimu, 2015;
Swema and Mwinuka, 2021). Studies have shown that Kenyans still prefer the Grain
Legume Project (GLP) varieties; GLP 585 (Red haricot), GLP2 (Rosecoco), GLPx92
(Pinto), GLP 24 (Canadian wonder). It was also revealed that consumers preference for
each of these varieties ranked differently in urban and rural areas (Wairimu, 2015).
1
Common bean has a great number of varieties from the breeding programmes with
differences in agronomic traits such as growth habit, duration to maturity, seed size and
quality. These variations serve as genetic resources that have been extensively exploited
in breeding programs to develop varieties (Elena et al., 2010). In Eastern Africa, the
Calima seed type (Red speckled or Rosecoco type) is the most popular followed by
medium and small reds. Large reds including red kidney rank third in popularity, navy,
whites, purples and black follow respectively (Okii et al., 2014; Fisseha et al., 2018).
The International Centre for Tropical Agriculture (CIAT), in collaboration with its
partners in Africa, has been working to develop bean varieties that are tailored to consumer
demands and preferences, considering attributes like pest and disease resistance, abiotic
stress tolerance, and grain nutritional quality (Mukankusi et al., 2019). Ongoing projects
improving common bean in Kenya include the Australian Centre for International
Agricultural Research (ACIAR) in collaboration with Pan-Africa Bean Research Alliance
(PABRA), which is focusing on improving beans for rapid cooking and enhanced iron and
zinc content in East Africa (Onyango, 2023). The Legume Centre of Excellence for Food
and Nutrition Security (LCEFoNS) project of the Jomo Kenyatta University of
Agriculture and Technology (JKUAT) is focusing on different stages of the legumes value
chain, such as breeding, post-harvest storage, food processing and nutrition (Corporate
Communications Office, 2023).
Common bean is commonly cooked by boiling in hot water above starch gelatinization
temperature to produce a tender edible product and to develop aroma (Guzel and Sayar,
2012). The cooking duration varies among varieties and depends on previous storage
environments, genetic differences and treatment before cooking. Cooking time has been
reported to be a genetic trait which depends on seed characteristics such as the amount of
insoluble pectins at cell wall and middle lamella, seed size, seed coat colour and thickness
(Saha et al., 2009).
Common bean seeds that have been stored under elevated temperatures (>25 ◦C) and
relative humidity (>65%) develop the irreversible hard to cook trait characterised by
prolonged cooking time (Perera et al., 2023). Prolonged cooking consumes more fuel and
2
contributes to environmental degradation especially where firewood is the main source of
energy (Nyamboki et al., 2012). Development of easy to cook common bean varieties
would not only improve consumer acceptance for dry beans but it would also save on cost
of preparation and contribute to conservation of environment. Identification of the
genomic regions controlling hard-to-cook (HTC) trait would assist in improving common
bean varieties to produce easy to cook bean varieties.
1.2 Statement of the Problem

Common bean plays a critical role in nutrition security as a vital source of protein for a
large population in third world countries and a source dietary fiber worldwide. The crop
is rich in micronutrients such as vitamin B vitamins like thiamin, folic, niacin, and
minerals such as iron and zinc (Mitchell et al., 2009). The highest per capita consumption
of common bean in Africa is found in Burundi, Kenya, and Rwanda ranging from 31 kg
to 66 kg per year, equivalent to 180g per capita a day. It is a crucial dietary component in
social institutions like schools and hospitals and for low-income households in rural and
urban areas.
Culinary characteristics such as ease of preparation, the wholesomeness of grains after
cooking, and digestibility are the main factors that influence consumers’ choice of bean
varieties (Wairimu, 2015). Dry beans require a long cooking time, especially at high
altitudes, which is time and energy consuming. Common bean with HTC characteristic
causes economic loss due to rejection by consumers for their poor texture and the need for
increased energy required for cooking. HTC trait also affects the nutritional quality of
common bean by lowering bioavailability of vitamins and protein (Perera et al., 2023).
The main uses of energy in households are for cooking followed by lighting, firewood
being the main source of this energy for cooking especially in rural areas. It has been
reported that over-exploitation of this biomass fuel in rural households harms the
environment, which indicates the importance of sustainable use of the scarce resource
(Nyamboki et al., 2012). There is a need to identify easy-to-cook common bean lines to
provide breeding programs with raw materials and to understand the inheritance of the
HTC trait assist breeders to choose a suitable breeding method.
3
1.3 Justification of the study
Common bean grains stored in adverse storage conditions develop hard-to-cook
characteristics, which prolong cooking time and reduce digestibility (Perera et al., 2023).
The prolonged cooking time of stored common bean seeds leads to high fuel consumption
and ultimately lowers the consumption of common beans. Studies have shown that
cooking time is influenced by genetic differences among varieties, with some varieties
being more susceptible to hardening during storage (Maryange et al., 2010).
DNA analysis techniques make it possible to genotype large populations to identify alleles
associated with the HTC trait. It would also allow the application of marker-assisted
selection and other biotechnology techniques in the breeding process. This study utilised
Next-generation sequencing (NGS) which uses Single Nucleotide Polymorphism (SNP)
technology to identify Quantitative Trait Loci (QTLs) associated with common bean traits
including cooking time. SNP technology is more practical, fast, inexpensive, and
informative technique than the older generation markers that were gel-based (Gujaria-
Verma et al., 2016).
Reducing cooking time of common bean grains would contribute to environmental
conservation through reduced overexploitation of firewood which is the main source of
energy for cooking in the rural areas (Nyamboki et al., 2012). Developing easier to cook
varieties is the most economical solution to the HTC phenomenon. Easier to cook varieties
will save on the cost of preparation, improve sensory qualities, and ultimately increase the
consumption of common beans (Perera et al., 2023).
Several studies have characterized a large population of common bean germplasm to
identify genomic regions that control cooking time. Cichy et al., (2015) used 206 common
bean accessions of Andean origin and identified significant SNPs associated with cooking
time on chromosomes 2, 3, and 6. Berry et al., (2020) identified 10 QTLs on chromosomes
1, 2, 3, 5, 6, 10, and 11 using 146 recombinant inbred lines of common bean. The identified
regions in these studies require further exploration to determine their robustness and
stability across different genetic backgrounds and in a controlled storage condition. The
identified easy-to-cook lines would serve as raw materials for breeding programs
4
developing easier-to-cook varieties. Understanding the inheritance of the HTC trait would
assist breeders in selecting a suitable breeding method, and molecular markers identified
associated with the HTC trait would allow the application of marker-assisted selection and
identification of candidate genes that control the trait.
1.4 Objectives
1.4.1 Main objective
The overall objective of the study was to apply phenotyping and Quantitative Trait Loci
mapping to elucidate the hard-to-cook trait in common bean
1.4.2 Specific objectives
1. To determine variation in yield-related agronomic traits within a panel of Kenyan

common bean accessions
2. To investigate association of Single Nucleotide Polymorphisms (SNP) markers
with cooking time in common bean accessions
3. To investigate SNP markers associated with variation in yield-related agronomic
traits among common bean accessions
4. To assess Quantitative Trait Loci (QTL) associated with cooking time and selected
yield-related agronomic traits in recombinant inbred lines of common bean
1.5 Null hypotheses

Ho1: Locally conserved common bean accessions are not significantly different with
respect to evaluated yield-related agronomic traits
Ho2: Single Nucleotide Polymorphisms (SNP) markers are not significantly associated
with cooking time in common bean
Ho3: There are no Single Nucleotide Polymorphisms (SNP) markers significantly
associated with variation in yield-related agronomic traits among common bean
accessions
5
Ho4: There are no quantitative trait loci (QTL) significantly linked to cooking time and
selected yield-related agronomic traits of common bean
6
CHAPTER TWO
LITERATURE REVIEW
2.1 Botany, origin, and distribution of common bean
Common bean (Phaseolus vulgaris L.) belongs to the Leguminosae family that consists
of approximately 600 genera. Within this genus, the common bean leads with wide
geographical distribution, agronomic, nutritional, and economic value (Gepts, 2014).
Common bean is a diploid species (2n=2x=22) with a haploid of 11 chromosomes and a
genome of approximately 587 Mb (Schmutz et al., 2014).
Common bean was domesticated by Middle American and South American cultures
(Gepts, 1998) and dispersed to other regions of the world. Molecular, physiological, and
morphological studies show that there exist two distinct centers of origin, namely
Mesoamerican and Andean gene pools (Blair et al., 2007; Burle et al., 2010). The Andean
gene pool is generally large-seeded and adapted to relatively higher altitudes and lower
temperatures, while the Mesoamerican gene pool is small-seeded and adapted to lower
altitudes and higher temperatures (Beebe et al., 2011). Common bean has been adapted to
a wide range of environments and is currently cultivated in many countries in the tropics,
subtropics, and temperate regions (Burle et al., 2010).
It is an annual herbaceous plant with oval-shaped leaves that are composite with three
oval-shaped leaflets. The root system is made up of one main tap root and numerous
secondary roots. The stem color can be green or may have anthocyanin coloration.
Common bean has two major types of growth habits, bush and climbing types. The bush
cultivars are day-neutral and early maturing. They grow to a height of 20 cm to 60 cm and
have a lateral terminal inflorescence and determinate growth. Climbing types contain both
day-neutral and short-day cultivars, they have indeterminate growth and grow up to 3 m
in height, and they require staking for support. They have stems and fickle tendrils formed
by the modification of terminal leaflets that allow their climbing habit (Kinyuru et al.,
2011).
Flowers are asymmetrical with petals of the color white or purple, they are hermaphrodite
and predominately autogamous, with a 3% outcrossing. The standard of the flower is
7
reflexed, wings are of the same length or sometimes longer than the standard. The flower
has 10 stamens, which are diadelphous with free vexillary stamens of equal length. Style
is filiform, twisted, and bearded on the inner curve. Once the flower is pollinated it
produces a pod that contains 3 to 12 seeds. The coloration of pods ranges from yellow to
dark green (CIAT, 1986; Farrow and Andriatsitohaina, 2021). Seeds' colors vary from
white, brown, yellow, red, black, purple, grey, and pinto; some are dotted, speckled, or
have stripes. Common bean varieties vary in seed size, which depends on genetic variation
and environmental conditions. Seeds can either be small, medium, or large-seeded
depending on the weight of a random sample of a 100-seed (Angioi et al., 2010).
2.2 Traits of common bean targeted for improvement through breeding

A wide diversity of traits in common bean exist in terms of growth habit, duration to
maturity, resistance to biotic and abiotic stresses, seed size, seed color, cooking time,
nutritional quality, and yield (Okii et al., 2014; Wairimu, 2015). Characterization and
conservation of these traits in the common bean are crucial for improving the crop through
breeding. As earlier mentioned, common bean shows a variation in growth habits ranging
from determinate bush to indeterminate climbing. Schoonhoven and Pastor-Corrales
(1987) categorized growth habits into five groups. The bush types are preferred because
they do not require support and are hence convenient for market production (Okii et
al., 2014). Bush types are also popular for commercial production because they are early
maturing and require less labor. However, climbing common beans is popular in highland
areas because they are high-yielding and therefore ideal for small-scale farmers with a
limited size of land (Okii et al., 2014; Fisseha et al., 2018).
The development of cultivars with improved resistance to biotic and abiotic stresses is an
important goal in bean breeding throughout the world (Milkas et al., 2006). The use of
host resistance is a more economical method of controlling pests and disease, and
therefore varieties that are resistant to disease pathogens and pests are preferred. It is
expected that the distribution and severity of pathogens and pests are likely to be altered
by climate change (Garret et al., 2009). An increase in precipitation and humidity in some
areas is likely to favor pathogenic fungi that cause foliar and root diseases. There have
8
been efforts to breed common bean varieties that are drought resistant using
Mesoamerican and Durango races that are known to be good sources of drought stress
resistance (Villordo-Pineda et al., 2015). Plants that accelerate their cell cycle with early
flowering and maturity and rapidly relocate their metabolites to grain production are
known to escape drought (Beebe et al., 2009).
Consumer preference for common bean grains depends on seed size and color. Seed size
and color range from black, white, cream, yellow, brown-tan, red, and purple, they can be
stripped, mottled or dotted, large-seeded or small-seeded. Seed color is determined by the
presence and concentrations of flavanol glysides, anthocyanins, and condensed tannins on
the seed while seed size depends on the genetic difference among varieties and
environmental conditions (Reynoso et al., 2006). Common bean varieties vary in seed
size, those that weigh less than 25 g per 100-seed are classified as small-seeded, those that
range from 25 to 40 g are medium-sized and those that weigh more than 40 g are large-
seeded (Angioi et al., 2010; Lei et al., 2020). In eastern Africa, the Calima seed type (Red
speckled) is highly popular and accounts for about 22% of common bean production.
Medium and small reds follow in consumer preference accounting for approximately 20%
of the production. Large reds including red kidney rank third in popularity accounting for
about 10% of beans produced, navy, whites, purples, and black follow in popularity,
respectively (Wortmann et al., 1998).
Improving seed yield is a major objective for most common bean breeding programs
(Vandemark et al., 2014). The Andean bean types (large-seeded) are the most popular
beans in Africa even though their yield is low compared to the middle American bean
types (small-seeded) (Beebe, 2012). Seed yield is a polygenic trait that is conditioned by
three yield components, number of pods per plant, number of seeds per pod, and seed
weight (Negahi et al., 2014; Kamfwa et al., 2015). The knowledge of the association
between these seed yield attributes may help in selecting a good donor and improving this
trait.
Cooking is a fundamental part of bean preparation, it inactivates anti-nutritive factors,
increases digestibility, and improves the sensorial quality of beans (Costa et al., 2006).
9
Cooking beans is a high-energy demanding process due to their prolonged cooking time.
Cooking of beans is known to be influenced by genetic differences, growth environment,
post-harvest handling, storage conditions such as temperature and humidity, storage time,
and treatments before cooking (Arruda et al., 2012).
Common bean is a critical contributor to food security in the East African region and is a
good source of nourishment second only to cereals. Common beans increase the protein
content of the meal and improve the quality of the diet by a factor of 50% to 70% when
served with cereals (Bressani et al., 1988; Taptue, 2018). The common beans are also
known to contain a small percentage of oligo and monosaccharides. The raffinose family
of oligosaccharides, namely raffinose, stachyose, and verbascose are soluble
carbohydrates known to contribute to flatulence in humans and animals. The amount of
raffinose in common beans varies among common bean varieties (Reddy et al., 1984).
Common beans also contain Vitamin C, vitamin B and essential minerals (Mitova et al.,
2008; Mitchell et al., 2009).
2.3 Nutritional quality and health benefits of common beans

Common bean is an important contributor to food security in the East African region, and
it is a good source of nourishment second only to cereals but with a higher protein content
ranging from 20% to 25% of their dry matter. The grain of the common bean plays a
prominent role as a source of protein that supplements the low cereal proteins in
developing countries and the diets of many vegetarians (Haddad and Tanzman, 2003).
Common bean increases the protein content of the meal and improve the quality of the
diet by a factor of 50 to 70% when served with cereals (Bressani et al., 1988; Taptue,
2018). This is because beans are rich in lysine, complementing protein from cereals such
as rice and corn. The ratio of essential and non-essential amino acids in immature seeds
ranges from 0.82 (Mbithi-Mwikya et al., 2000) to 0.93 (Slupski, 2010) in common dry
beans. Common bean is an important source of protein where animal protein is limited
among the low-income population, to whom beans are a daily food (Taptue, 2018).
Nemeskeri (2012) reported that matured seeds have a higher protein content and mineral
10
composition than the green bean pods and dry bean seeds have a high level of serine,
leucine, phenylalanine, and histidine contents (Gyori et al., 1998).
Common bean contain about 60% carbohydrates of which two-thirds of it is in the form
of starch, with a high ratio of amylose to amylopectin and a small percentage of oligo and
monosaccharides (Hutchins et al., 2012). The raffinose family of oligosaccharides,
namely raffinose, stachyose, and verbascose are soluble carbohydrates found in legumes
that have been identified as one of the important contributors to flatulence in humans and
animals. The amount of raffinose depends on common bean varieties. Verbascose is
predominantly in black seeds, red seeds, and mung beans. Stachyose is the major
oligosaccharide in navy beans, pinto beans, red kidney beans, pink beans, and black eye
beans (Mecha et al., 2018).
Common beans contain a low saturated fat content and a high content of essential nutrients
such as vitamin B components thiamin, folate and niacin, and essential minerals iron, zinc,
magnesium, and potassium (Murube et al., 2021). They are therefore used to substitute
animal products in the diet as an alternative source of protein and the base for flours,
starches, and fiber ingredients (Virginia, 2014). Common beans are rich in dietary fiber
which is higher than that of other unrefined plant foods such as whole-grain meals
(Galisteo, 2008). Dietary fiber includes indigestible polysaccharides such as cellulose,
hemicellulose, oligosaccharides, and pectins, which affect gastrointestinal functions. A
higher intake of dietary fiber reduces the risk of heart disease, diabetes, obesity, and some
forms of cancers (Tosh and Yada, 2010).
Common bean is considered a good source of nourishment for people with diabetes. They
have a low glycemic index, resulting to a slower and steadier rise in blood sugar levels.
The protein and fiber content in beans help stabilize blood sugar levels, reducing the risk
of spikes and crashes (Nchanji and Ageyo, 2021). Common has been reported to be more
beneficial in weight management than in any other health issue, weight loss ranging from
2.24 kg to 2.93 kg in a period of four weeks has been reported (Wang et al., 2020).
However, promotion of consumption of beans for weight management faces challenge
11
due to the lack of standardization in terms of bean varieties, quantity consumed, and
number of times administered (Nchanji and Ageyo, 2021).
Protease inhibitors such as trypsin inhibitors, decrease the digestibility of proteins in
legumes (Van der Poel, 1990). Common bean genotypes vary greatly in trypsin inhibitor
activity (Nemeskeri, 2012). Cruz et al., (2003) reported that the digestibility varied among
common bean varieties, the most coloured varieties showed low digestibility indicating
that the pigments are related to the low protein quality of the varieties. The activity of
trypsin was found to be high in coloured beans especially those of red kidney type
(Nemeskeri, 2012).
Fertilizer application and soil types affect the ability of a plant to accumulate certain
micronutrients. Organic fertilizer application was reported to increase vitamin C content
in common beans (Mitova et al., 2008). The development of HTC trait during storage has
been reported to reduce the nutritional contents of common bean by lowering the
availability of vitamins and protein (Perera et al., 2023).
2.4 Common bean production and their ecological requirements

The global production of dry common bean grains is 29 million which is cultivated on 36
million hectares with an average yield of 1573 kgha-1 (FAOSTAT, 2023). According to
FAOSTAT data in 2020, Asia was the leading continent in common bean production,
accounting for 50% of the global production. The top five dry bean-producing countries
in the world from 2000 to 2019 were Myanmar, India, Brazil, China, and the United State
(Nadeem et al., 2021). In Eastern African, Tanzania leads in common bean production,
followed by Uganda, Kenya and Ethiopia (Table 2.1) (FAOSTAT, 2023). According to
Agricultural Foods Authority agency Kenya produces about 722551 metric tons of dry
common bean grains and has a deficit of 93100 metric tons (AFA, 2022).
Recent statistics on common bean production in Eastern Africa are presented in Table 2.1.
According to these statistics, Tanzania is the largest producer (1.3 million tons) of
common bean with the land area devoted to common bean cultivation (1.01 million ha).
Uganda follows with a production of 0.86 million tons with an area of 0.56 million ha
under bean cultivation. Dry bean production in Kenya is practiced on approximately 1.2
12
million hectares with an actual average yield of 568.3 kg/ha under farmers' management
(Table 2.1).
Common beans thrive in a wider range of soil types, ranging from light sand to heavy
clays. The best soil for growth should be friable, well-drained, loam soils with high
organic matter. Common bean requires the application of inorganic fertilizers especially
potassium and phosphorous. Beans can fix atmospheric nitrogen using rhizobium bacteria
which exist in root nodules. This bacterium is sensitive to cold and too much moisture
(Anonimo, 1982; Alexandre and Oliveira, 2012).
Table 2.1: Mean production figures of common bean in the eastern Africa region for
the year 2021
Country Area (ha) Yield (Kgha-1) Production (Tons)

Tanzania 1019495 1300.4 1325702.0
Uganda 461950 1852.6 855801.3
Kenya 1171869 568.3 666000.0
Ethiopia 355550 1741.2 619094.4
Rwanda 694481 708.4 491976.0
Burundi 827542 594.5 491967.8
DRC 483984 545.4 263961.0
FAOSTAT, 2023
Common beans are grown in areas with an average annual rainfall ranging from 900 to
2000 mm, which is well distributed during the growing season. Under moderate rainfall
conditions, supplementary irrigation may be beneficial. Heavy rainfall adversely affects
flower fertilization, resulting in a reduced pod set. The ideal altitude ranges between 1000
m to 2100 m above sea level (Greenlife, 2023). At higher altitudes the growth period is
prolonged and there is an increased incidence of diseases because of colder conditions.
Lower altitudes tend to have low rainfall, which is not ideal for common bean production
unless irrigation water is available. The optimum temperature range is 16 to 24°C. Below
10°C bean plants are destroyed by chilling, while at temperatures above 30 °C blossom
drop is very serious and may hamper pod formation and seed set (Burle et al., 2010).
13
2.5 Seed yield
Seed yield improvement for Andean bean types has lagged compared to Mesoamerican
beans, steady improvements in grain yield for Mesoamerican common beans have been
reported resulting from genetic improvement and crop management (Singh et al., 2007;
Vandemark et al., 2014). This is because greater genetic variability exists in the
Mesoamerican gene pool than in the Andean gene pool (Bitochi et al., 2013). As a result,
more progress in improvement for seed yield and other traits has been reported in
Mesoamerican bean types than in Andean bean types (Beebe et al., 2012; Vandemark et
al., 2014). Transferring the favourable genes from Mesoamerican bean types into Andean
bean types popular in Africa is a challenge due to incompatibility and linkage drag (Singh
et al., 2007, Beebe et al., 2011).
Improving seed yield is a major objective for most common bean breeding programs,
understanding the genetic architecture of this trait and its interaction with other yield
components would lay a genetic foundation for improving seed yield (Vandemark et al.,
2014). Seed yield is a quantitative trait governed by multiple genes, and is conditioned
primarily by three yield components namely, the number of pods per plant, number of
seeds per pod, and seed weight (Negahi et al., 2014). All the three yield components are
quantitative and their interaction with seed yield is based on physiological and
morphological features of the plant (Burbano-Erazo et al., 2021). Understanding the
interaction between these yield attributes and seed yield may help identify a suitable donor
for this trait.
Yohannes (2020) reported a moderate broad-sense heritability (30-60%) for the number
of seeds per pod. Several studies have observed a high heritability (>60%) for seed size
(Henry et al., 2019; Anunda et al., 2019; Yohannes et al., 2020). The number of pods per
plant, seed weight, and biomass yield were reported as the first-order yield components
with a positive direct effect on seed yield (Ghobary and Allah, 2010, Negahi et al., 2014).
High-yielding varieties were also reported to flower early, mature late, be taller, and had
a higher number of primary branches per plant, pods per plant, and seeds per pod (Ashango
and Alamerew, 2017). Several mapping studies on common beans have been carried out
14
to understand genomic regions contributing to seed yield and its components
(Mukeshimana et al., 2014; Kamfwa et al., 2015; Briñez et al., 2017; Sandhu et al., 2018).
2.6 Storage, processing, and cooking quality of common beans

The condition and time of storage affect the cooking time of common bean grains. Storage
in adverse conditions of high temperature and relative humidity makes beans susceptible
to hardening phenomenon, loss of colour, and decrease water absorption capacity
(Ousman et al., 2013). Common bean grains stored under high temperatures above 25°C
and high relative humidity above 65% developed the hard-to-cook trait with some
varieties showing a higher increase in cooking time than others when stored in these
adverse storage conditions (Perera et al., 2023). Higher temperatures and relative humidity
during storage reduce the hydration and swelling coefficient of common bean grains
which in turn causes low water uptake (Wacu, 2016). Vindiola (1986) accelerated the
hardening of beans by storing them at 100% relative humidity and a temperature of 45°C
using a desiccator, he observed that the rate of hardening among varieties differed. Red
beans tended to harden faster than brown beans while the white bean was the last to
harden, but all beans eventually become uncookable after 7 to 9 days.
Due to the hard texture of common beans, they are generally consumed after soaking
followed by cooking to produce acceptable sensory quality. Soaking is conducted at
temperatures below starch gelatinization temperature to increase the water content. This
accelerates the cooking process and helps leach out anti-nutritive compounds such as
phytates and tannins (Fabbri and Crosbi, 2016). Soaking in de-ionized water and sodium
carbonate is more effective in reducing the cooking time of common beans (Wacu, 2016).
Guzel and Saya (2011) reported a significant increase in the percentage of splits for beans
cooked under atmospheric pressure than those cooked under high pressure. They also
found that higher pressure cooking increases the loss of solidness of legume seeds.
Hard to cook phenomenon is a textural defect that causes seeds to have poor soaking
imbibition. Despite the prolonged cooking time, they do not achieve adequate texture due
to the failure of cotyledon cells to separate upon cooking (Garcia et al., 1998). Wacu
(2016) reported that common bean variety red kidney showed a higher increase in cooking
15
time compared to rosecoco after having been subjected to temperatures of 27°C and
relative humidity of 75%. Temperatures lower than 30°C and air humidity above 40%
during grain filling lower the cooking time of beans (Zilio et al., 2014). Long cooking
time limits the utilization of common beans, it affects market price, processing cost, shelf
life, and consumption patterns (Zaminder et al., 2013).
The cooking time of dry beans is experimentally determined using an automated Matson
pin dropper. In this method cooking time is defined as the time it takes to boil bean seeds
in water for 80% of the seeds to be completely pierced by a 2 mm stainless steel pin (Wang
and Daun, 2005). A cutting test using a Sun-Rheometer recorder is also used to determine
the cooking time for beans. This method uses a cutting probe to measure the maximum
force required to cut through a cooked bean at a speed of 100 mm per minute (Kinyanjui
et al., 2015). These methods are labour-intensive, slow, and expensive when evaluating
many genotypes. Another method used is the use of bags; a plastic bag is used to hold
other small bags containing bean seeds and hung in an upright position in boiling water
(Maryange et al., 2010). Finger pressing is used to determine the cooking time. In this
method, the softness/hardness of the beans is determined by squeezing the cooked beans
between the thumb and forefinger (Vindiola et al., 1986). Beans are classified as cooked
when the cotyledons are soft and free of graininess while hard beans are classified as not
cooked. The percentage of cooked beans in the batch is determined as a function of time
(Kinyanjui et al., 2015). The bag method is preferred over the Matson cooker due to the
low cost of material and the ability to cook many bean lines at a time (Maryange et al.,
2010). The use of a calibrated near-infrared spectroscopy and imaging is another method
that can provide a high-throughput phenotyping method to assess cooking time where a
large population of genotypes is involved (Mendoza et al., 2018).
2.7 Mechanism of common bean cotyledon hardening

Several causes have been suggested to explain the hard-to-cook phenomenon which may
occur also in combination. The widely accepted theory is the formation of insoluble
pectates at the cell wall and middle lamella which renders the tissue more resistant to cell
separation during cooking (Shomer et al., 1990, Hentges et al., 1990). Another theory
16
suggests degradation of cell membranes due to increased peroxidation within the
cytoplasm leads to loss of membrane integrity (Richardson and Stanley, 1991). An
increase in phenolic compounds that probably cause lignification of cells has also been
proposed. Garcia et al., (1998) confirmed this lignification by observing common bean
seed cell walls that had been stored at 5°C and 40% relative humidity and 35°C at 75%
relative humidity using scanning electron micrographs, which showed thickening of the
middle lamella.
A dual enzyme mechanism has been proposed to explain the development of HTC
conditions in storage at elevated temperatures and relative humidity (Jones and Boulter,
1983a). At high temperatures and relative humidity, pectin methylesterase (PME)
hydrolyses pectin molecules forming pectic acid and methanol. Also, enzyme phytase
hydrolyses phytic acid in the cells of the cotyledons to release inorganic phosphate and
magnesium, while at the middle lamella, pectin methyl esterase hydrolyzes pectin to
pectinic acid and methanol. The magnesium and calcium released in the cells migrate to
the middle lamella and produce an insoluble magnesium pectinate and calcium pectinate
that cements cells together hardening the cell wall (Jones and Boulter, 1983a; Kinyanjui
et al., 2015). According to this theory a Quantitative Trait Loci (QTLs) that control HTC
could contain a locus related to the formation or breakdown of insoluble pectin.
This hypothesis is supported by the decrease in pectin solubility from 31.4% in fresh beans
to 17.2% in hardened beans. Furthermore, the degree of pectin esterification decreased
from 51% to 15% and phytic acid from 29 mg/g to 10 mg/g (Jones and Boulter, 1983a).
In a similar study, Moscoso et al., (1984) observed that cooking time increased by
approximately 60% after incubating fresh beans in calcium ions with or without pectin
methyl esterase. Varieties that have a shorter cooking time like rosecoco had more hot
water-soluble pectin (8.44mg/g) than slow-cooking beans like pinto (5.51 mg/g) (Njoroge
et al., 2014). Steaming beans for a duration of two minutes at 120°C or ten minutes at
98°C retarded the rate of hardening during storage for a period of nine months at 90%
relative humidity and temperature of 25°C (Molina et al., 1976). Steaming could have
reduced the enzyme activity that causes hardening. However, excessive heat treatment of
17
beans may cause hydrolysis of pectin and extra mobility of calcium and magnesium ions
which reduce beans' cookability (Vindiola, 1986).
Irving (1980) found that fluoride ion, an inhibitor of phytase, prevented the hardening of
pinto beans during soaking in acetate buffer at pH 4.7 and 41°C. A decrease of pH in the
soaking solution of bean seeds from 4 to 1 causes the precipitated calcium and magnesium
pectinate to dissolve as pectinic acid and which improves the cookability (Mattson, 1946).
On the other hand, an increase in pH from 4 to 7, chelates phytate inside the cells to
calcium and magnesium ions which keep pectinic acid in soluble form and allows beans
to cook faster (Kon and Sanshuck, 2007). Kinyanjui et al., (2015) demonstrated that beans
soaked in calcium chloride and a solution of low pH (4) cooked slower than those soaked
in high pH (8.5) solution. On the other hand, those soaked in low pH (4) solution cooked
slower than those soaked in deionized water. He attributed this to the β-eliminative
depolymerization of pectin favored by high temperatures and pH.
2.8 Genetics of cooking time

Gene action or heritability of a trait influences the breeding procedure applied to improve
a trait, it aids a breeder to select a breeding procedure that will efficiently improve the
performance of the genes (Dudley and Moll, 1969). Elia (2003) reported a 0.9 narrow
sense heritability for the cooking time using F3 and F4 common bean populations
developed using 16 varieties using North Carolina Design II mating scheme. Cooking time
showed a degree of dominance less than one but larger than 0.0, which indicates that
cooking time is governed by multiple genes with partial dominance for short cooking time
over longer cooking time. Genes controlling cooking time for common bean were reported
to be all nuclear genes with no influence from cytoplasmic genes (Elia, 2003).
Jacinto et al., (2003) also estimated the heritability of cooking time at 0.74 using F 6 and
F7 recombinant inbred lines. Another study estimated narrow-sense heritability of cooking
time at 0.47 using F2 seeds (Mughi 2017). In latter study, some crosses showed a
significant negative Specific Combining Ability (SCA) effect for cooking time. This
confirmed the partial dominance of short cooking time over long cooking time reported
earlier. The differences observed in these studies on the magnitude of heritability can be
18
attributed to the different populations used in these research studies. However, the results
demonstrate that cooking time has a large genotypic effect which can be utilized to
improve common beans through selection based on the trait itself (Elia, 2003).
In a similar study by Mashi (2006) using cowpea, it was observed that short cooking time
was dominant over long cooking time and governed by two dominant alleles interacting
at different loci. It has also been observed that high water absorption capacity is associated
with short cooking time (Correa et al., 2010). Elia (2003) estimated narrow-sense
heritability for water absorption at 0.77 and a phenotypic correlation between water
absorption and cooking time at -0.78, suggesting that the quantity of water absorbed
during soaking can be used to predict the cooking time of bean accessions. Akinyele et
al., (1986) detected a positive correlation between cooking time and protein in cooked
beans. In recent study that evaluated 242 recombinant inbred line (RIL) population,
cooking time of pre-soaked seeds were found to exhibit high broad-sense heritability
(0.68) (Bassett et al., 2021).
2.9 Application of genetic markers

The application of DNA analysis techniques in common bean breeding programs has
improved our understanding of genetic factors controlling various traits. Molecular
markers have been utilized in breeding since the 1990s, the early generation markers were
based on RAPDs and SCARs derived from these polymorphic fragments. Some of these
markers are still in use in breeding programs like the SU91 marker for common bacteria
blight (CBB) tolerance (Viteri et al., 2014). The improvement of the DNA analysis
techniques has led to the development of genetic maps with appropriate saturation degrees
for mapping Quantitative Trait loci (QTLs).
Early generation markers are expensive and often cross-specific and therefore not ideal
for high throughput marker screening. They also do not readily transfer across species and
are hence limited in their use for comparative mapping. However, with the discovery of
next-generation sequencing (NGS), Single Nucleotide Polymorphism (SNPs) has become
more practical in genotyping and discovery of markers. Markers-assisted selection using
SNP technology is much faster and inexpensive than the older generation markers that
19
were gel-based (Gujaria-Verma et al., 2016). SNPs markers have been used in the
construction of dense linkage maps that allow the identification of QTL associated with
biotic and abiotic stress and other agronomic traits (Resende et al., 2018; Sandhu et al.,
2018). Cortes et al., (2011) reported that SNPs markers are useful in distinguishing
Andean and Mesoamerican gene pools, he also validated 84 gene-based and 10 nongenic
loci using KASPar technology in 70 genotypes. Sandhu et al.,, (2018) used SNP markers
to map seed hardness using 85 F2:7 RILs from a cross of hard and soft seeded black bean
parents H68-4 and BK04-001, respectively, and revealed a major QTL on chromosome
seven and two novel QTLs with significant effect on chromosome 1 and 2. A similar
study identified QTL for cooking time on Pv8 and Pv10 using 242 recombinant inbred
lines (RIL) population developed from a cross between Ervilha (Manteca) and PI527538
(Njano) using SNP markers (Bassett et al., 2021)
2.10 Quantitative Trait Loci (QTL) mapping

Genetic control for most plant traits is reported to be predominantly due to genes with
additive effects (Silva et al., 2013). A more detailed understanding of traits at a molecular
level is critical to improving beneficial traits of crops. Early genetic maps based on
molecular and protein markers had estimated the size of the common bean genome at 1200
cM (Nodari et al., 1993; Adam-Blondon et al., 1994). A consensus of these maps was
established in an integrated linkage map spanning 1226 cM and consisting of 563 markers
that included random amplified polymorphic DNA (RAPD), restriction fragment length
polymorphism (RFLP), sequence characterized amplified region (SCAR), isozyme and
phenotypic markers (Freyre et al., 1998). More linkage maps have subsequently been
developed using different parents, segregating populations, traits, and molecular markers
(Taran et al., 2002; Beattie et al., 2003; Blair et al., 2006b; Sandhu et al., 2018).
Many SNPs markers have been identified, which allow explorations of genetic diversity
and population structure (Cichy et al., 2015; Valdisser et al., 2016). SNPs markers have
been used to construct dense linkage maps that allow the identification of QTLs associated
with various traits. SNPs markers have been utilized for the mapping of QTLs controlling
for common bean traits like drought (Mukeshimana et al., 2014), agronomic traits (Hoyos-
20
Villegas et al., 2017), disease resistance (Nakedde et al., 2016), grain yield (Resende et
al., 2018), and cooking time (Cichy et al., 2015; Berry et al., 2020).
A QTL for the number of pods per plant in common bean was reported by Koinange et
al., (1996) on Pv01 and Pv08 in a population of 65 F8 recombinant inbred lines (RILs)
from a cross of Mildas and G12873. Blair et al., (2006b) reported a QTL of the same trait
on Pv07, Pv09, and Pv11 in an inbred backcross population of 157 BC 2 F3:5 from a cross
between ICA Cerinza and G24404. Tar'an et al., (2002) mapped the same QTL on Pv02
in 145 F4:5 RILs from a cross of OAC Seaforth and OAC 95-4 navy bean. Kamfwa et al.,
(2015) identified QTL for the number of pods per plant on Pv03 and Pv09 in 237
genotypes.
Several studies have reported QTLs associated with seed yield. Bettle et al., (2003) found
this QTLs for seed yield on Pv03 and Pv05 in a population of 110 F5:7 RILs from a cross
of W03391 and OAC Speedvale, Taran et al., (2002) on Pv05, Pv09, and Pv11, Blair et
al., (2006b) found this QTL on Pv02, Pv04, and Pv09. Wright and Kelly (2011) identified
QTLs for seed yield on Pv03, Pv05, Pv10, and Pv11 in a population of 96 F4:5 RILs from
a cross between Jaguar and 115 M. Mukeshimana et al., (2014) mapped QTLs for seed
yield on Pv03 and Pv09 in a population of 125 F5:7 RILs from an inter gene cross of SEA
5 and CAL 96. Lastly, Kamfwa et al., (2015) reported the QTLs for seed yield on Pv03
and Pv09 using 237 genotypes. Recently, through GWAs approach Resende et al., (2018)
detected two markers associated with grain yield on chromosome 3 using 188 common
bean accessions.
Several studies have been conducted to map QTLs that control cooking time. Random
amplified polymorphic DNA (RAPD) marker associated with cooking time was identified
using 104 RILs, the marker explained 23% of the variation in cooking time (Jancinto-
Hernandez et al., 2003). Garcia et al., (2012) mapped 6 QTLs that govern cooking time
on chromosomes 1 and 9 using 105 polymorphic simple sequence repeats (SSRs) markers
and 140 F2:4 RILs. The most promising QTL was CT1.1 which explained 21% of the
phenotypic variation.
21
In a recent study conducted by Berry et al., (2020) using 146 RILs of common bean, 10
QTLs on chromosomes 1, 2, 3, 5, 6, 10, and 11 were identified, with the most robust QTLs
being on chromosomes 3, 6, 10 and 11 that appeared in over two different environments.
In a genome-wide association study, significant SNPs associated with cooking time were
identified on chromosomes 2, 3, and 6 using 206 common bean accessions of Andean
origin, the SNPs marker explained between 4 to 8.7% of the phenotypic variation (Cichy
et al., 2015).
The differences observed in the above examples could have resulted due to the limited
number of markers, the type and size of the mapping populations used and the accuracy
of the phenotyping techniques employed resulting in low resolution results in some
studies, and the positioning of the candidate genes associated with the QTL become
difficult.
2.11 Genome-Wide Association Studies

Genome-Wide Association Studies (GWAS) is a popular method used to identify QTLs
associated with bean traits. GWAS invention was a result of several scientific discoveries
early in the 21st century like the completion of the human genome project that provided
much better context for the study of genetic variants (Hood and Rowen, 2013). GWAS
has been used to identify QTL related to biotic stress (Zuiderveen et al., 2016; Perseguini
et al., 2016), abiotic stress (Villordo-Pineda et al., 2015), agronomic traits (Kamfwa et
al., 2015; Rasende et al., 2018) and grain quality (Cichy et al., 2015). It involves the
application of molecular markers to plant breeding using statistical methods which enable
breeders to estimate with accuracy the position and effects of genomic regions associated
with variation in quantitative traits (Kafwa et al., 2015). Genome-wide association method
is dependent on genotype-environment interactions (GxE) (Beebe et al., 2011), thereby
giving an understanding of GxE at the molecular level, especially for a self-pollinating
plant-like common bean that has been adapting to a constantly changing environment (Li
et al., 2003).
A few studies have used genome-wide association to find markers associated with cooking
time. Cichy et al., (2015) used freshly harvested seeds, and identified SNPs that were
22
significantly associated with cooking time on chromosomes 2, 3, and 6. This study used
206 common bean accessions of Andean origin, the SNPs identified explained between 4
to 8.7% of the phenotypic variation (Cichy et al., 2015). Another study combined GWAS
and QTL analysis in a population of 922 lines of diverse origin to identify QTLs for
cooking time (Diaz et al., 2021).
GWAS is mainly concerned with determining alleles associated with various SNPs and
making statistical comparisons to identify SNPs associated with a particular trait (Resende
et al., 2018). The presence of alleles in individuals with a particular trait is evidence that
this allele may have an effect to some degree on this trait. Unlike in linkage mapping
where only QTLs for which parents show differences can be identified, GWAS can be
used to map various traits in a population at once. It has become a popular method that
provides insight into explaining the total genetic variance, especially for traits with low
heritability (Thorwarth et al., 2017).
To determine the SNP-trait association, a mixed linear model (MLM) equation is used
(Zhang et al., 2008; Resende et al., 2018)
Y=Xα+Pβ+Kµ+ɛ
Where Y= the vector of Phenotype, X= the vector of fixed effect of the SNP, P= the vector
of fixed effect of population structure, K= Random effect of relative kinship, that is cryptic
relatedness among genotypes from kinship matrix. ɛ= Error term which is assumed to be
normally distributed. The Bonferonni correction for multiple tests with a global α= 0.05
is used to determine the significance threshold for SNPs. Linkage Disequilibrium (LD)
analysis is used to position candidate genes identified in the genomic regions surrounding
significant SNPs (Zhang et al., 2008; Resende et al., 2018).
23
CHAPTER THREE
PHENOTYPING FOR YIELD-RELATED AGRONOMIC TRAITS IN A PANEL
OF LOCALLY CONSERVED COMMON BEAN (PHASEOLUS VULGARIS L.)
ACCESSIONS
3.1 Abstract
Characterization and conservation of common bean (Phaseolus vulgaris L.) germplasm is
a critical step towards the genetic improvement of the crop. Seed yield improvement for
the Andean bean types has lagged compared to Mesoamerican beans, thus improving seed
yield in a major objective of common bean breeding programs in east Africa. This study
assessed variation in 257 common bean genotypes which included 207 accessions
obtained from the National Gene Bank of Kenya, 33 accessions from Kenya Agricultural
and Livestock Research Organization (KALRO), 13 landraces collected from randomly
selected local farmers’ fields and four commercial varieties for yield-related agronomic
traits which included number of pods per plant, number of seeds per pod and 100-seed
weight. The experiments were laid out in a randomized complete block design with three
replicates at Jomo Kenyatta University of Agriculture and Technology (Kenya) for four
seasons between 2019 and 2020. Significant differences (P≤0.05) existed among the
common bean accessions for all traits studied. Seed yield ranged from 220.6 kg/ha to
4641.9 kg/ha (KNB0106) among the accessions with a mean of 1267.0 kg/ha. Significant
(P ≤0.05) positive correlation was recorded for days to flowering and days to maturity
(0.73), while 100-seed weight had a significantly negative correlation with the number of
pods per plant (-0.66) and the number of seeds per pod (-0.65). High (>20%) broad-sense
heritability was recorded for 100-seed weight (89.0%), days to flowering (76.8%), and
grain yield (60.5%). Nineteen accessions that were both early maturity and high-yielding
traits were identified. Higher seed yields were recorded for large-seeded and climbing
genotypes compared to small-seeded and bush types. Seasonal differences were
significant with higher yields during the long rain seasons. Common bean accessions
characterized can be exploited in breeding programs.
24
3.2 Introduction
Common bean (Phaseolus vulgaris L.) holds significant importance for human nutrition
due to its nutritional composition and various health benefits. The crop is a major source
of protein, carbohydrates, dietary fiber, and essential minerals to a large population
globally (Gepts et al., 2008, Murube et al., 2021). A wide diversity of traits exists in
common bean regarding growth habit, duration to maturity, resistance to biotic and abiotic
stresses, seed size, seed color, and yield (Okii et al., 2014; Fisseha et al., 2018). These
variations serve as genetic resources that have been extensively exploited in breeding
programs to develop varieties (Pérez-Vega et al., 2010). Previous studies have
demonstrated that the common bean has two distinct centers of genetic differentiation,
namely the Middle American and Andean gene pools (Bitocchi et al., 2012). The large-
seeded types (Andean) are the most popular beans in Africa though their yield has been
reported to be lower compared to the small-seeded types (Middle American) (Beebe
2012).
The growth habit of the common bean has been reported to range from determinate bush
to indeterminate climbing (Farrow and Andriatsitohaina, 2021). The bush types are
popular and preferred because they do not require support (Okii et al., 2014), they are also
early maturing, and can easily be mechanically harvested. On the other hand, climbing
common beans have higher yields and are ideal for small-scale farmers in highland areas
(Okii et al., 2014; Fisseha et al., 2018). Consumer preference for common bean grains
depends on seed color and seed size. The most popular seed type in Eastern Africa is
Calima (Red speckled or Rosecoco type) followed by medium and small red, while the
large red including red kidney ranks third in popularity (Farrow and Andriatsitohaina,
2021).
Heritability estimates of a trait indicate how much variation can be attributed to genetic
variation and the environmental influence in the expression of the trait. The heritability
estimates therefore aids a breeder to select a breeding procedure that will efficiently
improve the performance of the genes involved (Yohannes et al., 2020).
25
Improving seed yield is a primary objective for most common bean breeding programs
(Vandemark et al., 2014). Seed yield is a polygenic trait that is conditioned by three yield
components, the number of pods per plant, the number of seeds per pod, and seed weight
(Kamfwa et al., 2015). The knowledge of the association between these seed yield
attributes may help in the selection of a suitable donor to improve this trait. The objective
of this study was to assess common bean accessions for variation in yield related
agronomic traits which are essential for characterization, conservation, and variety
improvement.
3.3 Materials and Methods

3.3.1 Field experimental site
Field experiments were carried out for four seasons at Jomo Kenyatta University of
Agriculture and Technology (JKUAT) in Kiambu County Kenya. The site is located at
coordinates 3o 35’South and 36o 35’ East at an elevation of 1520 m above sea level. The
area falls within upper midland belt (UM) of agroecological zone (AEZ) IV (Jaetzold and
Schmidt, 1983). The site experiences bimodal pattern of rainfall with an annual mean of
856 mm. Long rains occur between March and May while short rains occur between
October and November with a monthly mean of 142 mm and 116 mm respectively. The
mean annual maximum and minimum temperatures are 20 oC and 30oC respectively. The
monthly rainfall and temperature during 2018 and 2019 are shown in Appendix 4. The
area has three types of soils namely, shallow clay soils, sandy clay soils, and deep clay
soils (vertisols).
3.3.2 Plant materials
Common bean genotypes in this study included 257 accessions sourced from the National
Gene Bank of Kenya, 33 accessions from the Regional Agricultural Research Centre-
Kenya Agricultural and Livestock Research Organization (KALRO)-Embu, 13 landraces
collected from randomly selected local farmers’ fields, and four commercial varieties
(GLP-2; GLP-24, GLPx92 and GLP1192a). The growth habits of the genotypes were type
26
I & II, III and IV with 124, 84 and 49 accessions, respectively. The genotypes belonged
to different market classes found in the region (Table 3.1 and Figure 3.1).
Rosecoco Pintos Yellows
Whites Blacks Small & medium reds
Brown & Tan Purples Sugars
Zebras Cariocas Creams
Figure 3.1: A sample of seeds of various common bean accessions used in this study
grouped into their respective seed classes based on seed colour and size
27
Table 3.1: Common bean accessions used in this study
Seed class Description Number of accessions
Pintos Cream with brown specks-GLPx92 type 22
Sugars Cream and can be speckled 39
Calima Rosecoco type 25
Small reds Red haricot type 15
Large reds Canadian wonder type 17
Purples Mwezimoja type 11
Medium whites Medium and large whites 13
Brown and tan Brown and orange 19
Cariocas Red and Red specks 28
Yellow Yellow coloured 8
Blacks Black coloured 23
Navy Small whites 37
Total 257
3.3.3 Experimental design and trial management
The experiment was conducted for four seasons during the long and short rains seasons of
2019 and 2020. The trial was laid out as a randomized complete block design with three
replicates. The bean lines were grown in single rows of 5m in length with an inter-row
spacing of 50 cm, the intra-row spacing of all the genotypes was 20 cm. Compound N.P.K
(17.17.17) fertilizer was applied at a rate of 200 kg/ha, evenly spread, and thoroughly
mixed with soil. The bean seeds were planted and lightly covered with soil.
The first manual weed control was conducted two weeks after emergence and the second
one at 40-50 days thereafter (Figure 3.2). Insect pests and diseases were controlled by the
application of chemical pesticides diazinon at a rate of 40 ml/20 litre and 500 g/litre
pymetrozine at a rate of 400 to 600 g/ha. Before flowering, the climbing genotypes were
supported with 1.5 m long sticks to prevent lodging.
28
3.3.4 Agronomic data collection
Data collection started one month after planting. Quantitative data recorded is described
in Table 3. 2. Qualitative data collected included growth habits (climbing, semi climbing,
and bush) and seed colour.
Common bean crop at third trifoliate

stage Common bean crop at pod filling stage
Figure 3.2: Field experiments at Jomo Kenyatta University of Technology

experimental farm
29
Table 3.2: Quantitative agronomic traits recorded in field trials
Trait Units Description
Days to flowering d Number of days from planting to the date when
50% of plants have one or more flowers
Days to maturity d Number of days after planting to the date when
50% of the plants have reached physiological
maturity
Number of pods no. The average total number of pods from five
randomly selected plants per plot at maturity.
Pod length cm Average pod length of five randomly selected
pods from each plot measured using a ruler
Number of seed per pod no. The average number of seeds of five randomly
selected pods from each plot
Seed weight g Weight of a random sample of 100 seeds from
each plot
Grain yield g Total seed yield per plot which will be used to
extrapolate Yield per hectare
3.3.5 Statistical analysis
Analysis of variance
Qualitative data collected was used to group the accessions into their growth habits and
market classes. Quantitative data collected from field experiments were combined over
seasons and analyzed using R software (version 4.0.2). All traits’ means were separated
using Fisher’s Least Significance Difference test (LSD) at 5% level. The significance of
correlations was tested at 0.05 and 0.01 levels of probability.
Phenotypic and genotypic coefficient of variation
The estimates of phenotypic and genotypic coefficient of variation were calculated as
described by Singh and Chaudhary (1985) as follows
30
√Vp √Vg
𝑃𝐶𝑉 (%) = 𝑋100, 𝐺𝐶𝑉 (%) = 𝑋100
Mean Mean
Where PCV is the phenotypic coefficient of variance, Vp is the phenotypic variance, GCV
is genotypic coefficient of variance, and Vg is the genotypic variance, GCV and PCV
values were categorized as low (0-10%), moderate (10-20%) and high (20% and above)
as indicated by Burton and de Vane (1953).
Heritability
Heritability was estimated as the ratio of genotypic variance to phenotypic variance as
described by Singh and Chaudhary (1985).
𝑉𝑔
𝐻2 = 𝑋100
𝑉𝑝
Where H2 is broad-sense heritability, Vp is phenotypic variance and Vg is genotypic
variance. Heritability percentage values were categorized as low (0-30%), moderate (30-
60%), and high (60% and above) as described by Johnson et al., (1955).
Cluster analyses were carried out based on Euclidean distance method. Complete
clustering method was used to determine the genetic relationship among genotypes based
on the agronomic data.
3.4 Results
3.4.1 Descriptive statistics for agronomic and seed yield traits
The means, range, variance, and coefficient of variation for recorded traits are summarized
in Table 3.3. The coefficient of variation ranged from 4.2% (days to flowering) to 36.1%
(number of pods per plant). The highest coefficient of variation registered was for the
number of pods per plant and grain yield at 36.1% and 32.3% respectively.
31
Table 3.3: Descriptive statistics for days to flowering, days to maturity and yield-
related for 257 common bean accessions grown at Juja in 2018 and 2019
Trait Mean Range Min Max Variance SE CV%
Days to flowering 37.8 12.6 32.5 45.1 16.4 0.09 4.2
Days to maturity 82.0 17.5 73.9 91.4 33.1 0.13 4.6
Pods/plant (no.) 12.6 24.0 5.9 29.9 56.6 0.19 36.1
Pod length (cm) 9.9 7.8 6.9 14.7 4.4 0.05 14.6
Seed/pod (no.) 4.6 3.7 3.0 6.7 1.1 0.02 17.3
Seed weight (g) 36.9 54.9 15.0 69.9 182.9 0.30 15.5
Yield (kg/ha) 1267.0 4421.3 220.6 4641.9 678470.6 18.23 32.3
n=257, SE=Standard error, CV=Coefficient of variation.
3.4.2 Estimation of genetic variables for traits measured
The extent of variance components and heritability estimates of seven common bean traits
are presented in Table 3.4. The phenotypic coefficient of variation ranged from 6.3% (days
to maturity) to 51.4% (grain yield). Days to flowering and days to maturity recorded a low
phenotypic coefficient of variation (0-10%) of 8.7% and 6.3% respectively. On the other
hand, pod length, seeds per pod, 100-seed weight, number of pods per plant, and grain
yield showed a high phenotypic coefficient of variation (>20%) of 20.8%, 22.8%, 36.5%,
43.6%, and 51.4% respectively (Table 3.4).
Genotypic coefficient of variation ranged from low (0-10%), moderate (10-20%) to high
(>20%). Days to maturity and days to flowering had a low genotypic coefficient of
variation of 4.2% and 7.6%, respectively, while the number of seeds per pod and pod
length had a moderate genotypic coefficient of variation of 12.6% and 14.6%,
respectively. High genotypic coefficients of variation were recorded for the number of
pods per plant, 100-seed weight, and grain yield of 24.4%, 34.3%, and 40.0%, respectively
(Table 3.4).
Grain yield, days to flowering and 100-seed weight recorded high broad-sense heritability
(H2>0.6) of 60.5%, 76.8%, and 89.0%, respectively. In contrast, the number of pods per
plant, number of seeds per pod, days to maturity, and pod length showed moderate broad
sense heritability (H2=0.3-0.6) of 32.2%, 38.7%, 51.1%, and 52.4%, respectively (Table
3.4).
32
Table 3.4: Estimation of genetic variables for days to flowering, days to maturity and
yield-related traits for 257 common bean accessions grown at Juja in 2018 and 2019
Pod 100-Seed
DF DM Pods/plant length Seed/ pod weight Yield
Components (days) (days) (no.) (cm) (no.) (g) (kg/ha)
E variation 2.5 14.8 20.8 2.1 0.8 21.8 303046.0

P variation 10.7 26.9 30.3 4.2 1.1 181.8 542948.4
G variation 8.2 12.1 9.5 2.1 0.3 160.0 239902.4
H2 (%) 76.9 51.1 32.2 52.4 38.7 89.0 60.5
PCV % 8.7 6.3 43.6 20.8 22.8 36.5 51.4
GCV % 7.6 4.2 24.4 14.6 12.6 34.3 40.0
DF=Days to flowering, DM=Days to maturity, H2=Broad sense heritability, E=Environment, P=Phenotypic,
G=Genotypic, PVC=Phenotypic coefficient of variation, GCV=Genotypic coefficient of variation
3.4.3 Duration to flowering and maturity, and yield-related traits
There were highly significant (P≤0.05) differences for all the traits studied among the 257
common bean accessions (Appendix 1). The seasonal and the interaction effect between
season and common bean accessions also significantly influenced all the evaluated traits.
For example, the mean for days to flowering, days to maturity, 100-seed weight, and grain
yield were higher in long rain seasons than in short rain seasons. However, the average
pods per plant and pod length were higher during the short rain than in long rain seasons.
33
Table 3.5: Mean values for days to flowering, days to maturity and yield-related traits for top
10, bottom 5 and checks of common bean accessions grown in Juja in 2018 and 2019 ranked
based on grain yield
DF DM Pods/plant Pod length Seed/ pod 100-Seed Yield

Name Season (days) (days) (no.) (cm) (no.) weight (g) (Kgha-1)
High yielding
KNB0106 S1 39.3 85.3 19.0 10.0 5.3 41.5 4926.3
S2 37.5 83.0 22.8 10.5 5.2 34.0 4357.5
NUA700 S1 40.8 88.0 12.5 11.5 3.5 42.5 2967.5
S2 38.5 85.3 16.3 11.9 3.8 37.3 2370.0
GBK035092 S1 38.8 82.0 14.0 10.3 5.3 37.5 2765.0
S2 39.0 79.3 13.5 11.1 4.9 31.5 2281.3
GBK035025 S1 38.5 82.5 12.5 11.3 5.0 44.3 3125.0
S2 39.8 78.8 12.8 11.8 3.6 43.8 1671.3
GBK035051 S1 37.5 83.5 13.5 11.3 5.5 25.5 2845.0
S2 37.0 84.0 16.3 10.2 5.1 27.3 1890.0
KNB0107 S1 35.0 83.8 12.5 9.5 4.8 24.8 1721.3
S2 34.8 79.8 17.8 11.3 5.2 26.3 3010.0
NUA637 S1 35.8 83.0 11.5 14.3 5.3 54.5 3078.8
S2 35.0 81.0 9.8 14.7 4.8 41.3 1645.0
GBK035447 S1 42.3 87.0 13.0 12.0 5.8 40.8 2913.8
S2 42.0 85.0 14.6 12.4 4.3 38.0 1801.3
NUA662 S1 39.5 84.5 9.0 10.8 4.0 62.8 3170.0
S2 38.0 84.0 13.1 10.2 3.2 36.3 1501.3
NUA640 S1 39.8 83.5 11.5 10.5 4.5 57.5 3241.3
S2 39.0 80.0 12.9 9.3 3.2 39.8 1223.8
Low yielding
GBK034995 S1 34.3 77.8 9.5 11.8 5.3 36.5 558.8
S2 33.7 81.3 12.7 9.9 3.7 29.3 176.7
GBK035023 S1 45.3 90.5 10.0 12.5 4.5 54.0 576.3
S2 41.3 86.8 3.8 10.9 3.3 48.3 75.0
GBK035295 S1 38.0 82.3 15.5 9.8 6.5 21.8 350.0
S2 37.8 82.0 13.3 8.7 4.3 34.8 227.5
GBK035320 S1 40.3 72.5 10.0 9.3 5.0 21.3 300.0
S2 38.5 83.5 8.3 8.6 3.9 32.8 200.0
GBK035350 S1 37.0 81.3 15.0 7.3 4.3 20.8 248.8
S2 37.0 87.8 14.5 6.6 3.8 35.5 192.5
Commercial varieties
GLPx92 S1 34.5 85.5 13.5 8.5 5.3 42.8 2306.3
S2 35.8 81.8 13.6 10.0 4.8 34.3 1683.8
34
GLP2
S1 37.3 78.0 7.0 12.0 4.3 60.3 2093.8
S2 37.3 80.3 7.4 13.1 4.8 46.5 751.3
GLP24 S1 38.8 82.3 16.0 10.0 5.5 24.0 2197.5
S2 38.0 85.3 22.3 9.7 5.8 33.5 787.5
GLP1127a S1 35.3 80.8 15.5 11.5 4.3 45.8 1631.3
S2 37.3 77.8 8.1 12.8 4.8 32.0 905.0
Overall mean 37.8 82.0 12.6 9.9 4.6 36.9 1267.0
LSD Accessions (A)** 1.9 3.4 5.1 1.4 0.7 4.4 322.5
LSD Seasons (S)** 0.2 0.4 0.6 0.2** 0.1 0.5 65.2
LSD AxS** 3.0 6.3 9.3 2.4 1.3 7.2 658.2
CV% 5.2 4.2 35.5 14.0 16.5 12.1 32.3
**=Significant at P≤0.05 probability levels respectively, LSD=Least significance difference, AxS=Interaction between
accession and seasons, CV=Coefficient of variation, DF=Days to flowering, DM=Days to maturity, S1=Season 1,
S2=Season 2.
The period between flowering and maturity ranged from 35.5 (GBK035394) to 53.6
(GBK035007) days with a mean of 44.1 days, the grain filling period varied from 41.9
(GLP 2) to 48.5 days (GLPx92) among the commercial varieties. Among the commercial
varieties evaluated in this study, GLPx92 was the earliest to flower (35.1 days) and had
the highest grain yield (1995 kg/ha) (Table 3.5). On the other hand, GLP2 was the earliest
to mature (79.1 days) had the longest pods (12.6cm) and the highest 100-seed weight
(59.8g), while GLP24 had the highest number of pods per plant (20.2) and the highest
number of seeds per pod (5.6) (Table 3.6). However, 57 accessions flowered earlier than
GLPx92, 69 accessions matured earlier GLP2 and 20 accessions outyielded GLP2 in grain
yield. Nineteen accessions had shorter duration to maturity and higher yields than the
earliest maturing commercial variety GLP2 (Table 3.7).
35
Table 3.6: Mean values for days to flowering, days to maturity and yield-related for top 10,
bottom 5 and checks of common bean accessions grown in Juja in 2018 and 2019 ranked based
on maturity
Early maturing
GBK035322 S1 34.8 74.8 12.0 8.3 4.8 33.5 616.3
S2 35.3 73.8 12.2 10.4 4.6 38.0 757.5
GBK035394 S1 39.3 78.5 17.0 8.0 5.0 17.5 1665.0
S2 38.3 70.0 10.3 8.7 4.5 18.8 487.5
GBK035284 S1 33.5 75.3 10.5 9.3 5.5 33.0 1871.3
S2 34.5 73.8 14.4 10.6 4.5 38.0 1142.5
GBK035338 S1 37.0 77.5 15.0 9.3 5.0 20.0 1320.0
S2 36.0 72.8 21.4 9.4 5.1 20.0 1086.3
GBK035378 S1 36.3 74.8 13.0 8.5 5.3 27.8 1970.0
S2 36.8 75.8 15.1 7.2 3.5 34.0 711.3
GBK035318 S1 33.8 75.8 8.5 10.5 4.5 47.0 740.0
S2 33.8 75.0 12.1 10.4 3.8 42.5 338.8
GBK034983 S1 35.4 76.8 9.5 9.1 5.1 27.5 1840.0
S2 35.8 74.1 13.8 9.5 4.8 32.5 1388.1
GBK035078 S1 35.5 75.0 6.5 7.8 4.0 48.8 1026.3
S2 32.3 76.5 11.0 8.5 3.3 33.8 951.3
NUA730 S1 33.0 76.0 10.0 9.5 4.5 47.5 1485.0
S2 34.0 75.8 7.7 8.5 3.8 40.0 1000.0
GBK035001 S1 34.3 77.5 14.5 9.8 4.8 25.8 2256.3
S2 35.0 74.5 16.4 7.4 3.8 36.8 686.3
Late maturing
GBK035023 S1 45.3 90.5 10.0 12.5 4.5 54.0 576.3
S2 41.3 86.8 3.8 10.9 3.3 48.3 75.0
GBK034966 S1 40.3 88.8 21.5 9.5 6.8 21.3 1218.8
S2 40.8 89.8 17.7 9.3 4.9 30.5 868.8
GBK035377 S1 43.5 91.0 10.5 11.3 6.3 25.0 601.3
S2 38.5 89.3 12.3 10.1 4.5 36.8 522.5
GBK034981 S1 43.8 93.8 14.5 8.3 6.0 16.8 1701.3
S2 36.8 88.8 15.0 9.4 4.8 21.0 716.3
GBK035007 S1 41.0 99.0 12.0 11.0 5.0 46.3 1343.8
S2 34.5 83.8 5.6 11.0 3.4 39.9 547.5
GLPx92 S1 34.5 85.5 13.5 8.5 5.3 42.8 2306.3
S2 35.8 81.8 13.6 10.0 4.8 34.3 1683.8
36
GLP2 S1 37.3 78.0 7.0 12.0 4.3 60.3 2093.8
S2 37.3 80.3 7.4 13.1 4.8 46.5 751.3
GLP24 S1 38.8 82.3 16.0 10.0 5.5 24.0 2197.5
S2 38.0 85.3 22.3 9.7 5.8 33.5 787.5
GLP1127a S1 35.3 80.8 15.5 11.5 4.3 45.8 1631.3
S2 37.3 77.8 8.1 12.8 4.8 32.0 905.0
Mean 37.8 82.0 12.6 9.9 4.6 36.9 1267.0
LSD Accessions (A)** 1.9 3.4 5.1 1.4 0.7 4.4 322.5
LSD seasons (S)** 0.2 0.4 0.6 0.2 0.1 0.5 65.2
LSD AxS** 3.0 6.3 9.3 2.4 1.3 7.2 658.2
CV% 5.2 4.2 35.5 14.0 16.5 12.1 32.3
**=Significant at P≤0.01 probability levels respectively, LSD=Least significance difference, AxS=Interaction between
accession and seasons, CV=Coefficient of variation, DF=Days to flowering, DM=Days to maturity, S1=Season 1,
S2=Season 2.
3.4.4 Cluster and correlation reaults
Cluster analysis based on the agronomic traits grouped the 257 genotypes into two major
groups. The largest group constituted 82.1 % of the genotypes, which had the highest pod
length, seed weight and yield with a mean of 10.4 cm, 45.5 g and 1322.1 kgha -1
respectively. The second group constituted 17.9 % of the genotypes and had the highest
days to flowering, days to maturity, number of pods per plant and number of seeds per
pod of 39.7 days, 84.1 days, 15.9 and 5.1 respectively (Figure 3.1).
37
Figure 3.3: Dendrogram showing relationship among 257 common bean genotypes
evaluated in this study, only 25 accessions are labelled on the ruler
The correlation coefficients among days to flowering, days to maturity, number of pods
per plant, number of seeds per pod, 100-seed weight, and grain yield are presented in
Table 3.7. A significant (P≤0.05) strong and positive correlation (0.73) was recorded
between days to flowering and days to maturity. A moderate positive and significant
association was revealed between pod length and 100-seed weight (0.51), between pods
per plant and seed per pod (0.5) and between days to flowering and seeds per pod (0.43).
A significant positive but weak relationship was revealed between days to flowering and
38
pods per plant (0.36), between days to maturity and number of seeds per pod (0.34),
between pod length and grain yield (0.34), between 100 seed weight and grain yield (0.31)
and between days to maturity and pods per plant (0.26). A significant extremely weak
positive correlation of 0.17 was recorded between pods per plant and grain yield at P≤0.05
(Table 3.7).
A significant (P≤0.05) strong negative correlation was recorded between the number of
pods per plant and 100-seed weight (-0.66) and between the number of seeds per pod and
100-seed weight (-0.65) among accessions. Furthermore, a significant moderate and
negative relationship between days to maturity and 100-seed weight (-0.45) was recorded.
Finally, a significant but weak negative association between pods per plant and pod length
(-0.34) and between days to maturity and 100-seed weight (-0.28) were also recorded
(Table 3.7).
Table 3.7: Pearson correlation coefficient for days to flowering, days to maturity and
yield-related traits for 257 common bean accessions grown at Juja in 2018 and 2019
Pod
Pods/plant length Seed/pod 100-Seed
DF (days) DM (days) (no.) (cm) (no.) weight (g)
DM 0.73**
Pods/plant 0.36** 0.26**
Pod length -0.02ns 0.05ns -0.34**
Seed/pod 0.43** 0.34** 0.50** 0.08ns
Seed weight -0.45** -0.28** -0.66** 0.51** -0.65**
Yield (kg/ha) -0.04ns 0.03ns 0.17** 0.34** 0.04ns 0.31**
*, **=Significant at P≤0.05 and P≤0.01 probability levels respectively, DF=Days to flowering, DM=Days to
maturity, ns=Not significant
3.4.5 Grain yields for common bean seed classes
The results revealed that the average grain yields varied with the seed size of the
accessions. The large-seeded (>40g) accessions had the highest yield of 1406.5 kg/ha,
followed by the medium-sized (25-40g) with an average of 1230.9 kg/ha, and lastly, small-
seeded (<25g) had the lowest mean yields of 1039.3 kg/ha (Table 3.8).
39
3.4.6 Grain yields for large, medium, and small-seeded common bean lines
The results revealed that the average grain yields varied with the seed size of the
accessions, the large-seeded (>40g) accessions had the highest yield of 1406.5 kg/ha,
followed by the medium-sized (25-40g) with an average of 1230.9 kg/ha, lastly, Small-
seeded (<25g) had the lowest mean yields of 1039.3 kg/ha (Table 3.8).
3.4.7 Grain yields for bush, semi climber, and climbing common bean lines
The result shows that the mean grain yield varied with the growth habit of the accessions.
Accessions with climbing growth habit had the highest average grain yields of 1644.6
kg/ha, followed by semi climbers with an average yield of 1289.8 kg/ha and lastly, bush
types had the lowest yields of 1102.3 kg/ha (Table 3.8).
40
Table 3.8: Mean grain yield for common bean accessions grouped into their different
growth habits, seed sizes and seed classes grown at Juja in 2018 and 2019
Grain yield (kgha-1)
Number Long Short
of rain rain
Trait Description accessions season season Mean
Growth
habit
Type I&II Bush bean and upright short 124 1382.2 822.4 1102.3
Type III vine type
Vine 84 1565.5 1014.1 1289.8
Type IV Climbing type 49 1835.6 1453.6 1644.6
Seed size
Large >40g for 100 seeds 127 1721.1 1091.8 1406.5
Medium 25-40g for 100 seeds 62 1452.8 1009.0 1230.9
Small <25g for 100 seeds 68 1237.9 840.6 1039.3
Market
classes
Pintos GLPx92 type 22 1765.2 1306.3 1535.7
Sugars Cream, can be speckled 39 1786.0 1192.6 1489.3
Calima Rosecoco type 25 1986.5 991.9 1489.2
Small reds Red haricot type 15 1585.9 1320.4 1453.1
Large reds Canadian wonder type 17 1612.6 1133.5 1373.0
Purples Mwezimoja type 11 1621.5 1122.1 1371.8
Medium Medium and large whites 13 1536.3 864.0 1200.1
whites
Brown/tan Brown and orange 19 1235.1 981.5 1108.3
Cariocas Red and Red specks 28 1379.8 781.4 1080.6
Yellow Yellow coloured 8 1273.6 874.7 1074.2
Blacks Black coloured 23 1303.8 727.0 1015.4
Navy Small whites 37 1129.0 773.8 951.4
3.5 Discussion
In the current study, grain yield and number of pods per plant had the highest coefficient
of variation, indicating a strong environmental influence among the genotypes evaluated
for these traits. Grain yield is a polygenic trait conditioned by the number of pods, seeds
per pod, and seed weight. On the other hand, pod yield is a product of successful
pollination, fertilization and pod setting which are highly influenced by the environment.
Comparable results were obtained for seed yield (50.7%) and the number of pods per plant
(38.9) in a previous study conducted by Negahi et al., (2014) using 284 genotypes.
41
The coefficient of variation is a scale that can be used to compare the extent of variation
of different traits with different measurement units. According to Burton and de Vane
(1953), phenotypic and genotypic coefficients of variation are categorized as 0-10% low,
10-20% high, and above 20% as high. The results show high genotypic coefficients of
variations for 100-seed weight, the number of pods per plant, and grain yield, which
indicates high genetic variation in these traits among the common bean accessions
evaluated. Similar results have been reported for number pods per plant, 100-seed weight,
and grain yield by Negahi et al., (2014), who observed a high phenotypic coefficient of
variation of 53.3%, 38.9%, and 50.7% for 100-seed weight, the number of pods per plant
and seed yield, respectively. On the contrary, a low genotypic coefficient of variation for
100-seed weight, number of pods per plant, and seed yield of 4.6%, 4.67%, and 2.2%,
respectively, have also been reported in a previous study that evaluated 52 common bean
landraces. The low genotypic coefficient could be attributed to low genetic diversity
among the accessions used in the study (Anunda et al., 2019).
Heritability estimates indicate how much variation in a trait can be attributed to genetic
variation and helps breeders to select based on the phenotypic performance of a trait.
Based on the categorization of heritability by Johnson et al., (1955), the traits days to
flowering, 100-seed weight, and grain yield traits recorded a high broad-sense heritability
(>60%). This indicates that the performance of these traits was majorly due to genetic
differences and could be improved through selection based on the trait itself. Yohannes et
al., (2020) reported a high broad-sense heritability of days to maturity and 100-seed
weight of 86.7% and 95.3%, respectively, and a moderate broad-sense heritability for days
to flowering and number of seeds per pod of 40%, and 51.6% respectively.
The significant seasonal differences for various traits between long and short rains is due
to differences in environmental conditions, especially temperatures and rainfall. Lower
temperatures prevail during long rain season, causing a prolonged vegetative state that
delay flowering and maturity. Heavy rainfall experienced during long rains adversely
affects flower fertilization, resulting in reduced pod sets hence the lower number of pods
in some cultivars during these seasons. On the other hand, short rain seasons tend to have
42
higher temperatures that lead to early termination of the vegetative state and initiation of
the reproductive phase (Greenlife, 2023). Genotypes that flower and mature early tend to
be more adapted to environment of growth than late maturing genotypes (Amanullah et
al., 2006). In this study nineteen accessions were found to combine early maturity and
reasonable yield higher than that of earliest maturing commercial variety GLP2.
Variety GLP 2 was the earliest to mature among the commercial varieties. However, there
were 19 bean accession that had higher seed yield and matured earlier than this variety.
These bean accessions are ideal for cultivation in areas with a short rainy season. On the
other hand, the variety GLPx92 was the earliest to flower, the latest to mature, and had
the highest seed yield among the commercial varieties. Therefore, GLPx92 had a
prolonged grain filling period that led to higher seed yield. Beebe et al., (2013) found that
that drought tolerant lines with improved yields also presented shorter period to maturity.
Cluster analysis grouped the common bean genotypes into two major groups. The cluster
with majority of genotypes (82.1%) contained the large-seeded (> 45 g 100-seed weight)
genotypes of Andean gene pool which are reported to be adapted to higher altitude and
cooler environments. The other groups consisted of small-seeded accessions with a mean
100-seed weight of 23.9 g of Mesoamerican gene pool which is adapted to lower altitudes
and higher temperatures (Beebe et al., 2011).
Grain yield is a polygenic trait that is conditioned by three yield components, the number
of pods per plant, the number of seeds per pod, and seed weight (Kamfwa et al., 2015).
Consequently, the knowledge of the association between these seed yield attributes may
help in selecting an excellent donor to improve this trait through indirect selection. A
target trait can be improved through indirect selection via other traits. A strong positive
relationship (0.73) between days to flowering and days to maturity indicates that days to
flowering can be used to predict days to maturity for common bean accessions. Strongly
associated traits are usually under the influence of the same gene or genes located close
together on the chromosome and can both be selected simultaneously (Lobo 2008). Days
to flowering have been reported to be under the control of dominance and additive gene
effect with the dominance effect being lower, and when present it reduces the number of
43
days to flowering (Mendes et al., 2008). A similar correlation result (0.7) between days to
flowering and days to maturity was reported in a previous study conducted by Kamfwa et
al., (2015).
The weak and moderate positive correlation between days to flowering and number of
pods per plant (0.36) and between days to flowering and number of seeds per pod (0.43)
indicates that the number of pods per plant and number of seeds per pod is, to an extent,
influenced by duration to flowering or time of flowering. For a crop that is largely self-
pollinated like the common bean, pollination vectors may not be a limiting factor but the
survival of pods and seeds after pollination may be affected by the competition of
photosynthetic assimilates, soil nutrients, and water. These results agree with a previous
study conducted by Marzooghian et al., (2014), who reported a positive correlation
between days to flowering with both the number of pods per plant (0.36) and the number
of seeds per pod (0.29).
The significant positive but weak relationship between grain yield and number of pods
per plant (0.17), pod length (0.34) and 100-seed weight (0.31) indicate that these traits
influence grain yields and should be put into consideration during selection to improve
grain yield. Strong positive correlations between seed yield per plant and the number of
pods per plant (0.67) (Anunda et al., 2019) have also been reported. A significant
correlation of 0.51 between 100-seed weight and pod length suggests that large-seeded
genotypes tend to have longer pods. Similar correlation result of 0.48 between 100-seed
weight and pod length was reported by Okii et al., (2014).
A significant strong negative correlation between 100-seed weight and the number of pods
per plant and between 100-seed weight and number of seeds per pod indicate
compensation among yield components (Negahi et al., 2014). This negative association
between yield components means that selecting for a greater number of pods per plant
would lead to small-seeded plants, and selection for large-seeded genotypes would lead
to plants with low seed locules per pod. It is critical to understand the nature of this
negative relationship if it is independent of competition or due to competition for a limited
resource. Similar negative correlation results between 100-seed weight with both number
44
of pods per plant and number of seeds per pod were reported by Negahi et al., (2014) and
Kamfwa et al., (2015). However, Kamfwa et al., (2015) reported weak negative
correlation between seed weight and the number of pods per plant (-0.17) and between the
number of seeds per plant (-0.38) and days to maturity (-0.27).
The results show that pinto, sugars, calima, small reds, large reds, and purples seed classes
were more adapted to the environment in which the experiment was conducted compared
to medium white, brown and tan, cariocas, yellows, blacks, and navy seed classes. It has
been reported that consumer preference for common beans depends on seed size and color
among other characteristics. In eastern Africa, the calima seed type (red speckled) is
highly popular and accounts for about 22% of common bean production. Medium and
small reds follow in consumer preference accounting for approximately 20% of the
production. Large reds including red kidney rank third in popularity accounting for about
10% of common beans produced, navy, whites, purples, and black follow in popularity,
respectively (Wortmann et al., 1998; Farrow and Andriatsitohaina, 2021). The results
show that the popular seed classes in the region were the highest yielding in this study,
which could have resulted from continuous selection by local common bean farmers that
improved their adaptability.
Common bean varieties vary in seed size, those that weigh less than 25 g per 100 seeds
are classified as small-seeded while those that range from 25 to 40 g are classified as
medium-sized, and those that weigh more than 40g are classified as large-seeded (Angioi
et al., 2010; Lei et al., 2020). The result in this study indicates that large-seeded accessions
are more adapted in this region, unlike the medium and small-seeded genotypes. Based on
seed size, the common bean has been categorized into two distinct centers of origin,
namely Mesoamerican and Andean gene pools (Blair et al., 2007; Burle et al., 2010).
Andean gene pool is generally large-seeded and adapted to relatively higher altitudes and
lower temperatures. In contrast, the Mesoamerican gene pool is small-seeded and adapted
to lower altitudes and higher temperatures (Beebe et al., 2011).
The high yielding potential of climbing common bean was revealed in this study.
However, climbing genotypes are labor-intensive as they require staking and may not be
45
ideal for mixed cropping. The results agree with Okii et al., (2014), and Farrow and
Andriatsitohaina, (2021), who reported that common beans with climbing growth habits
are higher-yielding and hence ideal for small-scale farmers with a limited size of land in
highland areas. Oppositely, the bush types are preferred because they do not require
support and are early maturing, hence convenient for commercial production (Okii et al.,
2014).
3.6 Conclusion
The study evaluated a panel of locally conserved common bean accessions for variation
in yield-related traits over four seasons. The results showed significant differences among
the common bean accession for all the evaluated traits. Significant higher yields were
recorded during the long rain seasons. High phenotypic and genotypic variation for 100-
seed weight, the number of pods per plant, and grain yield was observed. The traits days
to flowering, 100-seed weight, and grain yield showed high broad-sense heritability. Grain
yield had weak positive correlations with the number of pods per plant, pod length, and
100-seed weight. Large-seeded, climbing, and popular (pinto, calima, small reds, and
purples) bean accessions had higher yields. The study identified nineteen common bean
accessions that were significantly (P≤0.05) early maturing and had higher yields than the
commercial varieties. Majority of common bean accessions evaluated in this study were
of Andean origin and showed heritable variation that could be exploited in breeding
programs.
46
CHAPTER FOUR
GENOME WIDE ASSOCIATION STUDY OF VARIATION IN COOKING
TIME AMONG COMMON BEAN (PHASEOLUS VULGARIS L.) ACCESSIONS
USING DIVERSITY ARRAYS TECHNOLOGY MARKERS
4.1 Abstract
Stored grains of common bean (Phaseolus vulgaris L.) develop the hard to cook trait
(HTC) which is manifested in a prolonged cooking time thereby imposing time and energy
constraints. The objective of this study was to determine variation in cooking time among
common bean genotypes and to identify Single Nucleotide Polymorphism (SNP) markers
associated with cooking time. Seeds of 222 common bean accessions sourced from
Kenyan institutions were multiplied in JKUAT farm in 2019. Freshly harvested seeds and
those stored at 35°C and 50% RH for four months for accelerated aging were soaked in
distilled water for 16 hours and evaluated for cooking time using finger pressing method.
The accessions were also genotyped to determine variation in single nucleotide
polymorphism (SNP) markers using Diversity Arrays Technology Sequencing
(DArTseq). Genome-wide association study (GWAS) analysis was conducted to identify
SNPs significantly associated with cooking time. The study revealed that significantly
differences (P≤0.05) within and between fresh and aged bean accessions. Storage
significantly (P≤0.05) influenced the cooking time of common bean accessions. Fresh
seeds had a lower cooking time with a mean of 40.8 minutes and ranged from 28.1 to 72.2
minutes while aged seeds had a higher average cooking time of 54.1 minutes and ranged
from 32.1 to 96.3 minutes. Among the aged seeds genotype GBK034996 that took the
shortest time to cook (32.1 minutes) compared to 48.6 minutes of the easy to cook
commercial variety GLP2. The aging process affected the cooking time of bean accessions
differently with the least affected being NUA Ciankui (0.3% increase). GWAS identified
a region on chromosome 10 to be significantly (P≤0.05) associated with the cooking time
of aged seeds. Consequently, two potential candidate genes Phvul.010G038000
(galacturan 1,4-alpha galacturonidase) and Phvul.010G038100 (polygalacturonase) were
47
revealed. The characterized common bean accessions and the identified SNP markers can
be utilized in breeding programs to improve the cooking quality of the common bean.
4.2 Introduction
Common bean plays a critical role in the nutrition security of a large segment of the world
population, especially in third world countries. Its dry grains are used as a major source
of dietary protein. Cooking is a fundamental part of bean preparation, and it inactivates
anti-nutritive factors, increases digestibility, and improves the sensorial quality of beans
(Costa et al., 2006). Some samples of dry beans have been found to require a long cooking
time which is time and energy consuming (Kinyanjui et al., 2015). The cooking time of
beans has been reported to be influenced by a diversity of factors including, genetic
differences, growth environment, post-harvest handling, storage conditions such as
temperature and humidity, storage time, and treatments before cooking (Arruda et al.,
2012).
Farmers and traders commonly store the grains for long periods before availing them to
end-users. When storage occurs in adverse conditions of high temperature and high
relative humidity, the grains develop the hard-to-cook (HTC) phenomenon, which
increases the cooking time of beans. In addition, the improperly stored grains become
discolored and decrease water absorption capacity (Ousman et al., 2013). Further,
Vindiola (1986) reported that whereas all bean samples were affected by the HTC
phenomenon, the rate of hardening differed among varieties.
The formation of insoluble pectates at the cell wall and middle lamella that renders the
tissue more refractive to cell separation during cooking is believed to be the cause of HTC
(Shomer et al., 1990; Hentges et al., 1990). Pectin is made up of complex acid
polysaccharides with a backbone of galacturonic acid residue with an alpha 1,4 glycosidic
linkage. Homogalacturonan-rich pectin is commonly found in the middle lamella region
of plant cell walls where two cells border (Atkinson et al., 2002). The increase of phenolic
compounds that cause lignification of cells has also been proposed to cause HTC
(Elisabeth et al., 1998; Garcia et al., 1998). A dual enzyme mechanism has been proposed
to explain the development of HTC conditions in storage at elevated temperatures and
48
relative humidity (Jones and Boulter, 1983a). This theory suggests that at high
temperatures and relative humidity, the pectin methylesterase (PME) enzyme hydrolyses
pectin molecules in the middle lamella, forming pectic acid and methanol. Concurrently,
the phytase enzyme hydrolyses phytic acid in cotyledons cells to release inorganic
phosphate and magnesium ions. The magnesium and calcium ions released in the cells
migrate to the middle lamella and produce an insoluble magnesium pectinate and calcium
pectinate that cements cells together hardening the cell wall (Jones and Boulter, 1983a).
This hypothesis was supported by the presence of more water-soluble pectin (8.44 mg/g)
in varieties with shorter cooking time than slow cooking beans (5.51 mg/g) (Njoroge et
al., 2014).
The use of deoxyribonucleic acid (DNA) analysis techniques in common bean breeding
programs has improved the understanding of genetic factors controlling various traits.
Genome-wide association studies (GWAS) is a popular method used to identify
quantitative trait loci (QTLs) associated with bean traits. GWAS studies are mainly
concerned with determining alleles associated with various single nucleotide
polymorphisms (SNPs) and making statistical comparisons to identify SNPs associated
with a particular trait (Resende et al., 2018). SNPs markers are more practical in
genotyping and hence preferred in the construction dense linkage map (Gujaria-Vema et
al., 2016). In a previous GWAS study, significant SNPs associated with cooking time
were identified on chromosomes 2, 3, and 6 using 206 common bean accessions of Andean
origin; the significant SNPs identified explained between 4 to 8.7% of the phenotypic
variation (Cichy et al., 2015). In a recent study conducted by Berry et al., (2020) using
146 recombinant inbred lines of common bean, 10 QTLs on chromosomes 1, 2, 3, 5, 6,
10, and 11 were identified, with the most robust QTLs being on chromosome 3, 6, 10 and
11 that appeared in over two different environments. The identified regions require further
exploration to determine their robustness and stability across different genetic
backgrounds, growth environments, and storage conditions. This study aimed at
identifying common bean accessions that are easier to cook and investigate Single
Nucleotide Polymorphism (SNP) markers associated with cooking time.
49
4.3.1 Plant materials and field multiplication
A total of 222 of the 257 common bean accessions were successfully phenotyped and
genotyped in this study. These included 169 accessions from the National Gene Bank of
Kenya based at Kenya Agricultural and Livestock Research Organisation (KALRO) -
Muguga, 38 accesions from KALRO-Embu, 11 landraces collected from selected farmers’
fields, and four commercial varieties (GLP-2, GLP-24, GLPx92 and GLP1192a). The
accessions belonged to different market/seed classes including small whites, blacks,
yellows, cariocas, brown and tan, medium whites, purples, larges reds, small reds, calima,
sugars, and pintos. A single seed was randomly picked from each accession and grown in
the screenhouse. The harvested seeds were then multiplied during the short rain season of
the year 2019 (September 2019 – January 2020) at the Jomo Kenyatta University of
Agriculture and Technology (JKUAT) trial farm in Kenya. The site used for the
multiplication of the plant materials is describe in section 3.3.1 in details.
4.3.2 Incubation of seed and determination of cooking time
Cooking time was determined on each accession using freshly harvested seeds and aged
seeds. The aging process involved storing the seeds in a thermostatically controlled
incubator (HP300 G, China) at a temperature of 35°C and 50% relative humidity for a
period of four months (Figure 4.1). Freshly harvested and seeds removed from the
incubator after ageing treatment were stored at -20°C to prevent further aging during the
cooking experiment which took a period of two months. A sample of 100 whole grain
seeds of each accession was rinsed and soaked in distilled water for 16 hours. Hard-shelled
seeds that failed to absorb water were sorted out and excluded from the cooking
experiment to avoid the effect of impermeable seed coat on the cooking processes. Soaked
seeds were then subjected to standard cooking using distilled water at 96 oC in a
thermostatically controlled water bath (WBU-45; Memmert, Schwabach, Germany). Ten
(10) seeds were sampled from the cooking water bath after 20 minutes and at 5 minutes
intervals thereafter without interrupting the boiling. The 10 cooked bean seeds were
50
cooled in cold water for a minute and their softness/hardness determined using a
subjective finger pressing method (Vindiola et al., 1986; Kinyanjui et al., 2015). The bean
seeds were considered cooked when the cotyledon disintegrated on pressing and felt soft
(lack of graininess). Cooking of the beans was done in duplicate by two people and the
percentage of cooked beans in a batch was expressed as a function of time.
HP300 G incubator Moisture chamber
Figure 4.1: Incubators used for storage of seed in a controlled temperature and
relative humidity chamber to artificially age the common bean accessions
4.3.3 DNA extraction and genotyping
DNA isolation and genotyping were conducted at SEQART Africa laboratories housed in
the Biosciences eastern and central Africa (BecA) hub, in International Livestock
Research Institute (ILRI) Campus, Nairobi. Briefly, the procedure involved germinating
the seeds and growing the young seedlings in vermiculite for a period of 10 days. The
Nucleomag® Plant DNA extraction kit (Macherey-Nagel AG, Switzerland) was used for
DNA isolation from young leaves tissue of each common bean accession. The quality and
quantity of DNA was visualized using gel electrophoresis on a 0.8% agarose. Genotyping
by Sequencing (GBS) using DArTseqTM technology was used to identify variability in
51
single nucleotide polymorphism (SNP) markers. DNA libraries were constructed
according to Diversity Arrays Technology Sequencing (DArTseq) complexity reduction
method through the digestion of genomic DNA using a combination of two restriction
enzymes (PstI and MseI) and ligation of barcoded adapters followed by PCR amplification
of adapter-ligated fragments. Libraries were sequenced using single-read sequencing runs
for 77 cycles (Kilian et al., 2012). Illumina Hiseq2500 platform was used for high-
throughput sequencing and scoring of markers was achieved using DArTsoft14 Software
Version 1.5.2. beta (Diversity Arrays Technology 2017) as SilicoDArT markers and SNP
markers. Markers were scored as binary for presence /absence (1 and 0, respectively) of
the restriction fragment with the marker sequence in the genomic representation of the
sample. Both SilicoDArT markers and SNP markers were aligned to the reference
genomes of common bean (Phaseolus vulgaris 442 version 2.1) to identify chromosome
positions (Goodstein et al., 2012).
4.3.4 Data analysis
Logistic regression modeling was used to describe the relations between cooking time and
the percentage of cooked bean seeds as described by Wafula et al., (2020). Cooking time
was defined as the time corresponding to the probability that 95% of the bean seeds would
be cooked. The intercept and regression coefficients were used to generate graphs of
cooking time for different common bean accessions. Analysis of variance was performed
on the obtained cooking time using R software (version 4.0.2) and the mean values of
different accessions were compared using the least square difference (LSD) at 0.05%
significance level. Complete clustering analysis was conducted using NbClust package of
the R software considering Euclidean distances to determine the genetic relationship
among genotypes.
4.3.5 Linkage disequilibrium
A total of 19188 SNPs markers with minor allele frequency (MAF) > 0.05 and integrity >
0.8 were selected and used for subsequent analysis. Principal component (PC) (Q matrix)
and the relative kinship (K matrix) analyses were conducted using VanRaden method
52
within R based GAPIT package version 0.3.4 to account for the population structure. The
first three principal components were used to construct the PC matrix. Linkage
disequilibrium was estimated between SNPs on each chromosome by calculating the
square value of correlation (r2) between the pair of markers using KDCompute software
0.6.1.
4.3.6 Marker-trait association
Based on the 19188 SNPs markers and cooking time of 194 fresh and 222 aged common
bean accession, association analysis was performed using genome-wide association
mapping (GWAS) to identify SNPs associated with cooking time. Marker-trait association
analysis was conducted using the Generalized Linear Model (GLM), and Compressed
Mixed Linear Models (CMLM) of the default settings of Genomic Association and
Prediction Integrated Tool (GAPIT) software version 0.3.4. via the KDCompute interface
(https://kdcompute.seqart.net/kdcompute/login). The GWAS threshold for the significant
marker-trait association was the F-test for testing the null hypothesis that there is no
association between the SNP and trait.
4.3.7 Identification of potential candidate gene
Potential candidate genes that were flagged by the SNPs significantly associated with
cooking time, were identified using the jBrowse search tool against the reference genome
of common bean (Phaseolus vulgaris 442 version 2.1) which is available on the
Phytozome database (www.phytozome.net) (Goodstein et al., 2012). The maximum
threshold for identification of the potential candidate genes was set at 100kb around the
position of the trait-associated SNPs.
Additionally, the significant SNP sequences were utilized in a basic local alignment search
tool for nucleotides (BLASTn) within the National Center for Biotechnology Information
(NCBI) database to find potential matches (www.ncbi.nlm.nih.gov).
53
4.4 Results
4.4.1 Phenotypic evaluation
The results show that cooking time for fresh and aged seeds significantly (P≤0.05) varied
among common bean accessions (Appendix 2). The cooking time of fresh seeds ranged
from 28.1 to 72.2 minutes with a mean of 40.8±0.4 minutes, while that of aged seeds
ranged from 32.1 to 96.3 minutes with a mean of 54.9±0.7 minutes (Table 4.1). Storage
of the seeds increased cooking time of the accessions, but the increase varied among
common bean accessions. Accessions NUA Ciankui had the least increase in cooking time
due to storage of 0.3% in comparison to commercial variety GLP2 (Rosecoco) with the
least increase in cooking time of 0.8 % among the commercial varieties (Table 4.1).
Commercial varieties evaluated in this study were categorized into two groups based on
the least significant differences in cooking time, GLP2 and GLP24 had a shorter cooking
time while GLPx92 and GLP1127a had a longer cooking duration. GLP2 had the shortest
cooking duration of 47.2 minutes while GLP1127a had a longer cooking time of 61.1
minutes for aged seeds. Among the bean accessions evaluated, GBK034996 had the
shortest cooking time (32.1 minutes) while GBK035370 had the highest cooking time of
96.3 minutes for aged seeds (Table 4.1). A total of 133 and 65 bean accessions had a
shorter cooking time for fresh and aged seeds respectively than commercial variety GLP24
(Table 4.1).
54
Table 4.1: Mean values of cooking time of common bean accessions for fresh and aged seeds
ordered based on cooking time of aged seeds
Cooking time
Fresh Aged Mean Increase Growth Market 100-seed Yield
Name (min) (min) (min) (%) habit class DM weight (g) Kgha-1
GBK034996 29.8 32.1 31.0 7.8 C BT 84.0 28.0 1436.9
GBK035012 29.8 35.5 32.6 19.0 SC Pinto 83.3 42.4 1097.5
GBK035279 34.7 35.8 35.2 3.0 SC Black 87.3 21.6 1497.5
GBK035024 33.7 36.9 35.3 9.4 SC Sugar 87.1 47.9 903.1
GBK035353 31.8 37.0 34.4 16.6 B Navy 86.5 21.5 591.9
GBK035341 28.1 37.1 32.6 32.0 C BT 83.9 28.6 850.6
NUA611 31.4 37.5 34.4 19.4 SC Calima 87.4 49.8 1096.3
KMT0103 36.0 37.7 36.9 4.7 B Calima 78.0 50.3 1355.6
GBK035052 28.3 38.2 33.3 35.2 SC Carioca 81.3 38.5 1540.6
KNB0104 34.8 38.6 36.7 11.0 SC Small red 85.6 28.6 1006.9
GBK034975 34.1 38.9 36.5 13.8 C Black 84.6 21.4 581.3
GBK035419 33.0 39.3 36.1 18.9 B Black 86.5 18.9 690.6
GBK035334 30.2 39.5 34.8 30.6 SC Navy 87.8 20.6 801.3
KNB0118 39.5 40.1 39.8 1.6 SC BT 81.8 20.5 1413.5
NUA640 36.0 40.2 38.1 12.0 B Calima 81.8 56.8 2232.5
NUA631 36.6 40.3 38.4 10.0 B Calima 79.6 56.0 2140.0
NUA Ciankui 40.4 40.5 40.5 0.3 B Calima 83.6 49.4 939.4
GBK035060 31.5 40.7 36.1 29.4 SC Carioca 86.0 40.0 578.1
GBK035397 33.5 41.4 37.5 23.7 B BT 78.3 41.5 841.9
GBK035276 31.6 41.7 36.7 31.6 C Purple 85.4 35.0 1766.9
KNB0119 36.4 41.9 39.1 15.1 B Carioca 81.2 43.3 1069.2
GBK035005 36.6 42.1 39.4 14.9 SC Large red 86.6 22.0 1395.6
GBK035079 38.1 42.2 40.2 10.7 B Carioca 81.3 46.9 868.1
GBK035432 32.2 42.4 37.3 31.6 B Purple 79.0 45.3 1570.6
GBK035036 31.6 42.9 37.2 35.9 SC Small red 83.9 22.6 1559.4
KNB0101 37.0 42.9 39.9 16.1 C Small red 82.5 24.5 2082.5
GBK035055 39.4 43.1 41.3 9.4 B Carioca 76.9 47.8 1109.4
GBK035315 37.4 43.2 40.3 15.4 B Black 83.4 16.6 617.5
GBK035019 37.4 43.2 40.3 15.5 B Calima 84.0 37.8 1231.3
GBK035319 36.9 43.7 40.3 18.4 B Pinto 78.3 40.1 830.0
GBK035444b 33.3 43.9 38.6 31.8 C Sugar 84.3 46.5 788.5
GBK035062 39.3 44.0 41.6 11.9 B Carioca 77.9 47.8 1027.5
GBK035026 28.3 44.0 36.1 55.5 SC Pinto 76.6 35.3 1280.0
GBK035374b 35.5 44.1 39.8 24.1 SC BT 81.0 33.8 948.0
GBK035400 39.7 44.3 42.0 11.5 C Navy 86.3 16.1 1463.8
GBK035448 41.4 44.3 42.9 7.0 C Small red 85.5 24.4 1715.0
55
Cooking time
GBK035074 41.2 44.4 42.8 7.7 B Carioca 80.1 46.5 1375.0
GBK035035 35.0 44.5 39.7 27.0 B Small red 81.5 48.4 933.1
GBK034966 31.5 44.5 38.0 41.3 SC Black 89.3 21.4 1043.8
GBK035068 36.6 44.5 40.6 21.8 B Carioca 78.5 47.8 803.8
GBK035409b 33.2 44.6 38.9 34.4 C Yellow 81.3 34.0 861.9
KNB0111 41.9 44.7 43.3 6.5 B Large red 81.2 56.7 1479.0
GBK035046a 34.4 44.7 39.6 29.9 B Calima 76.0 54.3 123.0
GBK047121 35.3 44.8 40.0 27.1 B Large red 80.9 44.5 1108.1
NUA700 41.6 44.9 43.3 7.9 C Calima 86.6 43.6 2668.8
GBK035065 41.6 45.1 43.4 8.5 B Carioca 87.5 40.8 834.4
GBK035330 43.0 45.4 44.2 5.6 B Black 84.5 28.3 1224.4
GBK035072 30.0 45.5 37.8 51.4 C Carioca 78.5 44.5 1350.6
GBK035047 36.2 46.0 41.1 27.2 B Carioca 77.5 48.7 1163.1
GBK035449 39.1 46.1 42.6 17.8 SC Black 86.8 20.9 1346.9
GBK035381 34.4 46.4 40.4 35.0 C Pinto 89.9 26.9 1393.1
GBK035022 38.0 46.5 42.2 22.4 B Purple 76.4 46.0 1113.1
NUA596b 39.3 46.5 42.9 18.5 B Large red 81.5 43.2 708.5
GBK034978 33.9 46.6 40.3 37.4 C Large red 80.9 26.0 1320.6
GBK035085 37.7 46.6 42.1 23.8 B Sugar 80.8 69.1 1875.0
NUA637 37.2 46.7 41.9 25.7 B Large red 82.0 52.4 2361.9
GBK035009 31.5 46.8 39.2 48.9 B Pinto 79.0 20.6 1376.9
GBK035406 42.1 46.9 44.5 11.4 SC Small red 85.9 25.4 1316.3
GBK035033 42.6 47.1 44.9 10.4 SC Purple 77.5 43.5 1328.8
GBK035456 37.9 47.6 42.7 25.6 SC Large red 84.0 47.0 1846.3
GBK035280b 41.8 47.8 44.8 14.1 C BT 85.7 24.2 1016.0
GBK035020 31.5 47.9 39.7 51.9 C Small red 82.8 22.6 994.4
KMT0105 39.2 48.0 43.6 22.3 B Calima 78.1 46.4 993.8
GBK035025 39.6 48.2 43.9 21.5 SC Sugar 80.6 43.6 2398.1
GBK035367b 38.2 48.4 43.3 26.7 B Black 84.5 25.5 389.0
GBK035042 39.8 48.5 44.1 21.6 SC Pinto 79.3 36.6 976.3
KMT0110 38.6 48.5 43.6 25.4 SC Sugar 78.1 55.3 1631.3
GBK035450 32.7 48.7 40.7 49.1 SC Small red 85.0 23.8 1539.4
GBK034977b 41.2 48.7 45.0 18.3 B Carioca 76.2 56.5 954.0
GBK034968 43.7 48.9 46.3 12.0 B BT 81.0 34.9 615.0
GBK035425 45.6 49.0 47.3 7.3 B Purple 77.1 52.1 1413.8
GBK035437 39.3 49.0 44.1 24.9 SC Sugar 79.6 45.9 1141.3
GBK035377 40.8 49.0 44.9 20.1 SC BT 90.1 25.5 561.9
GBK035285 33.6 49.4 41.5 46.9 C Small red 81.8 32.3 1795.6
GBK035030 44.9 49.5 47.2 10.2 B BT 79.5 32.1 862.5
56
Cooking time
GBK035442 36.8 49.7 43.2 35.0 C Sugar 84.5 50.5 2048.1
GBK035025b 38.3 49.7 44.0 29.7 B Sugar 82.5 51.2 620.0
GBK035076 37.4 49.8 43.6 33.1 B Carioca 77.3 51.1 1073.8
GBK035438 42.6 49.9 46.3 17.1 B Large red 86.4 34.8 665.6
GBK035284b 39.4 50.0 44.7 26.9 C BT 79.3 34.7 1143.5
NUA739 41.3 50.0 45.7 21.1 SC Calima 81.0 46.9 1488.1
GBK035073 40.4 50.2 45.3 24.5 B Carioca 79.1 47.1 1437.5
GBK035446 41.9 50.4 46.2 20.2 SC Sugar 86.8 43.3 1399.4
KNB0112 46.1 50.5 48.3 9.7 B Large red 85.7 37.5 712.5
GBK035374 36.6 50.6 43.6 38.4 C Small red 86.4 23.4 1558.1
GBK035431 39.2 50.6 44.9 29.3 B Navy 84.6 21.6 370.6
GBK035420b 42.7 50.7 46.7 18.8 B Carioca 76.5 52.0 867.5
GBK035409b 49.7 50.9 50.3 2.4 B Yellow 81.3 34.0 862.0
NUA666 41.2 50.9 46.1 23.3 B Sugar 83.5 51.5 1917.5
GBK035439 48.2 51.0 49.6 5.7 B Sugar 83.0 63.9 1630.6
GBK035324 31.8 51.0 41.4 60.6 SC Purple 83.6 24.4 766.9
GBK035392 38.3 51.1 44.7 33.4 C Small red 85.8 23.4 1585.0
GBK035011 43.2 51.5 47.4 19.1 B Calima 81.1 48.6 906.9
GBK035021 36.5 51.6 44.1 41.4 SC Sugar 80.3 52.3 1398.1
GBK035444 45.6 51.6 48.6 13.1 SC Sugar 86.4 42.1 1260.0
GBK034099 38.0 51.7 44.8 35.8 SC BT 81.4 28.4 1520.6
GBK035376 38.3 51.9 45.1 35.5 B Yellow 77.3 47.6 1702.5
KMT0104 40.0 51.9 45.9 29.9 SC Calima 80.4 50.5 1761.9
GBK035037 30.7 52.1 41.4 69.6 C Small red 87.9 23.5 1334.4
GBK035310 49.2 52.2 50.7 6.1 SC Pinto 84.4 44.9 1601.9
NUA596 40.9 52.5 46.7 28.3 B Large red 82.6 43.4 1635.6
GBK035381 43.4 52.6 48.0 21.1 B Purple 77.9 53.4 1471.3
KMT0114 47.9 52.6 50.3 9.8 SC Sugar 78.9 63.0 1428.8
GBK035078 45.7 52.8 49.3 15.4 B Carioca 75.8 46.3 988.8
KMT0113 49.8 52.8 51.3 6.1 SC Sugar 80.8 46.8 1153.1
GBK035057 35.3 53.0 44.2 49.9 B Carioca 76.9 51.5 1279.4
KNB0114 44.1 53.0 48.5 20.4 SC Small red 81.3 36.5 903.5
GBK035006 39.0 53.1 46.1 36.2 B BT 76.8 47.9 1426.3
GBK034992 43.1 53.4 48.2 23.9 SC Sugar 81.9 44.3 971.9
GBK035331 44.6 53.4 49.0 19.6 B Yellow 79.5 51.1 848.1
GBK034997 34.2 53.6 43.9 56.5 C Pinto 80.8 34.8 1624.4
NUA680 33.7 53.8 43.8 59.5 SC Sugar 85.9 57.9 1542.5
NUA686 45.8 54.2 50.0 18.1 B Calima 81.9 40.5 1000.0
KMT0106 37.4 54.3 45.8 45.3 B Purple 80.3 63.4 2052.5
57
Cooking time
GBK035047b 35.5 54.4 44.9 53.4 B Calima 79.3 44.8 836.0
GBK035043 34.3 54.4 44.3 58.7 SC Sugar 82.0 44.1 1619.4
GBK035402b 38.1 54.6 46.4 43.4 B Large red 83.1 33.8 649.5
GBK035379 49.3 54.8 52.1 11.1 C Navy 86.9 17.1 816.9
GBK035346 45.3 54.8 50.1 20.9 SC black 82.4 26.1 590.0
GBK035434 43.0 54.9 48.9 27.7 SC Sugar 80.6 50.9 1866.3
GBK034965 48.9 54.9 51.9 12.2 B Sugar 82.5 38.9 938.8
GBK035332 42.3 55.1 48.7 30.3 C Black 87.3 20.3 1318.1
GBK035360 32.4 55.2 43.8 70.3 B Navy 83.0 20.6 513.1
NUA 619 39.3 55.2 47.3 40.6 B Large red 84.8 58.1 1200.6
GBK035362 42.7 55.4 49.0 29.8 B Navy 88.3 20.1 3618.8
KNB0116 30.7 55.7 43.2 81.6 B large red 80.2 34.5 620.0
GBK035063 41.5 55.8 48.6 34.3 SC Large red 86.6 48.0 1904.4
GBK035082 38.3 55.8 47.1 45.9 B Pinto 78.6 45.0 1276.3
NUA718 50.5 56.1 53.3 10.9 SC Calima 78.9 45.1 1543.8
KMT0102 40.4 56.4 48.4 39.7 SC Purple 80.3 47.5 1985.0
NUA604 38.3 56.6 47.5 48.0 B Small red 83.5 44.8 1080.0
GBK035071 43.9 57.0 50.4 30.0 B Carioca 80.0 51.5 1229.4
GBK035339 34.8 57.2 46.0 64.1 B BT 83.3 30.8 987.5
GBK035351 43.0 57.2 50.1 32.9 SC Navy 86.6 16.8 603.1
GBK034983b 41.3 57.2 49.3 38.5 C Sugar 83.5 33.7 1056.5
GBK035402 39.5 57.4 48.5 45.2 SC Purple 83.1 33.8 644.4
NUA612 44.7 57.5 51.1 28.4 B Small red 78.5 48.6 1538.1
GBK035324a 35.9 57.8 46.8 61.0 C Pinto 83.8 25.2 1284.0
GBK035416 50.5 58.1 54.3 14.9 C Navy 84.0 30.6 1678.1
GBK035090 48.8 58.5 53.7 19.8 SC Sugar 81.3 39.9 2001.9
GBK034345 36.8 59.1 47.9 60.6 C Purple 85.3 42.4 1440.0
NUA695 28.5 59.1 43.8 107.3 B Calima 80.9 49.6 1605.6
KNB0117 40.2 59.1 49.7 46.8 SC Pinto 83.8 22.3 399.0
KMT0117 57.9 59.3 58.6 2.3 SC Sugar 82.6 51.9 1407.5
NUA692 44.6 59.5 52.1 33.4 B Calima 84.1 56.3 2021.9
GBK035367 43.6 59.5 51.6 36.4 B Large red 81.6 45.3 1660.0
GBK035395 44.4 59.8 52.1 34.6 C MW 85.1 32.4 2211.3
KMT0112 38.0 60.4 49.2 59.0 SC Sugar 87.3 56.5 1709.4
GBK035021b 47.9 60.7 54.3 26.7 SC Pinto 79.5 35.7 896.0
GBK035396 35.3 61.0 48.1 72.9 B MW 74.0 31.6 1673.1
KNB0115 44.7 62.6 53.6 40.2 SC Navy 84.8 18.7 660.0
GBK035039 31.5 62.8 47.1 99.4 B BT 82.6 44.8 966.9
GBK035439b 45.6 63.0 54.3 38.1 B Sugar 80.6 51.2 1215.0
58
Cooking time
KMT0109 44.9 63.0 54.0 40.4 B Sugar 82.1 64.4 1923.1
GBK035395
a 50.2 64.2 57.2 27.9 SC Navy 83.4 20.1 713.1
KMT0108 45.3 65.2 55.3 43.7 B Yellow 77.1 47.6 860.0
GBK035092 40.9 65.6 53.2 60.5 SC Sugar 80.6 41.6 2523.1
GBK035391 52.7 65.7 59.2 24.8 B Navy 83.4 22.6 628.8
GBK035378 40.8 66.3 53.5 62.7 SC MW 75.3 27.3 1340.6
NUA709 44.5 67.8 56.2 52.5 B Yellow 76.1 48.5 1226.3
GBK035342 45.7 67.9 56.8 48.7 SC Navy 84.8 23.4 1353.8
GBK035034 39.0 68.6 53.8 76.0 B Navy 80.3 18.8 466.3
GBK035053 44.6 68.9 56.8 54.5 C Navy 87.5 26.8 1322.5
KNB0113 47.9 69.1 58.5 44.3 SC BT 83.5 25.2 833.5
GBK034987 63.8 69.1 66.5 8.4 B Black 85.1 17.8 1150.0
GBK035282 36.9 69.2 53.1 87.6 SC Navy 79.6 24.1 1132.5
GBK034307 61.9 69.8 65.9 12.8 SC Navy 85.6 16.9 1560.6
GBK035295 41.6 70.4 56.0 69.1 B Navy 82.1 20.4 288.8
GBK035354 39.8 70.9 55.3 78.3 SC Navy 83.5 22.3 1026.3
GBK035337 46.4 71.3 58.9 53.6 C Navy 83.8 19.6 858.8
GBK035413 42.4 72.8 57.6 71.6 B Navy 78.9 19.1 775.0
GBK035284 62.6 73.7 68.1 17.7 C MW 74.5 31.5 1506.9
GBK035341 44.7 74.6 59.7 67.1 B Navy 81.1 23.6 963.1
GBK035384 53.5 75.9 64.7 41.6 B Sugar 80.5 48.1 1548.1
GBK034999 34.8 76.2 55.5 118.6 SC Navy 79.0 24.1 1888.1
GBK035395a 39.5 77.1 58.3 94.9 SC MW 85.1 32.4 2211.5
GBK035277 66.3 77.2 71.8 16.4 SC Navy 80.4 19.1 1015.0
GBK035394 44.1 77.9 61.0 76.6 B Navy 74.3 18.1 1076.3
GBK035356 40.2 78.4 59.3 95.2 SC Navy 84.3 19.9 733.8
GBK035337 72.2 80.6 76.4 11.6 SC MW 75.0 32.1 1470.6
GBK035340 32.2 81.7 57.0 153.9 SC Navy 81.0 22.0 514.4
GBK035368 37.4 82.1 59.7 119.7 C Navy 84.3 16.1 1971.9
GBK035286 48.2 85.8 67.0 77.8 SC MW 76.1 28.8 1157.5
GBK035408 55.7 85.9 70.8 54.0 B MW 78.8 31.6 659.4
GBK035305 50.8 86.7 68.8 70.6 C MW 78.0 35.6 1118.1
GBK035355 61.2 87.3 74.2 42.5 B Navy 82.8 21.6 702.5
GBK035359 48.7 93.3 71.0 91.6 SC Navy 87.1 25.5 1148.8
GBK035338 51.4 94.8 73.1 84.2 B Navy 75.1 18.8 1203.1
GBK035322 54.5 96.3 75.4 76.7 B MW 74.3 31.3 686.9
GBK035370 54.9 96.3 75.6 75.6 C Navy 86.9 21.3 1724.4
59
Cooking time
GLP2 46.8 47.2 47.0 0.8 B Calima 79.1 59.8 1422.5
GLP24 43.0 48.4 45.7 12.5 C Small red 83.8 23.8 1492.5
GLPx92 49.7 60.8 55.3 22.3 C Pinto 83.6 41.0 1995.0
GLP1127a 52.2 61.1 56.7 17.1 B Purple 79.3 43.9 1268.1
Mean 40.8 54.5 47.7 34.5
LSD Accessions (A)** 4.8
LSD Storage (T)** 0.5
LSD Interaction (AxT)** 7.3
CV% 7.2
LSD= Least significant difference, min= Minutes, CV= Coefficient of variation, **=Significant at 0.01 level, DM=
Days to maturity, BT= Brown and Tan, B=Bush, SC=Semi climber, C=Climber, MW=Medium white
The cooking time profile of fresh and aged seeds was sigmoid; the difference between the
cooking time of fresh and aged seeds was due to the prolonged lag phase followed by the
slightly less steep exponential phase observed in the cooking time of aged seeds (Figure
4.2).
120
100
Cooked beans (%)
80
Fresh
60
Fresh (a)
40 Aged
Aged (a)
20
0
0 20 40 60 80 100 120
Cooking time (Minutes)
Figure 4.2: Cooking time profile of fresh and aged common bean seeds using mean
averages of all accessions evaluated
60
There was a significant moderate positive correlation (0.59) between the cooking time of
fresh and aged seeds. Cooking time for both fresh and aged seeds had a significant
extremely weak negative association with days to maturity (-0.2), whereas cooking time
of aged seeds had a significant but weak negative correlation with the number of pods per
plant (-0.18), pod length (-0.18), and seed weight (-0.25) (Table 4.2).
61
Table 4.2: Pearson correlation coefficient between cooking time and seven
agronomic traits of common bean
Aged Fresh Mean
CT CT CT DF DM PN PL SP SW
(Min) (Min) (Min) (days) (days) (no.) (cm) (no.) (g)
-
ACT 1 0.59** 0.95** -0.11 -0.2* 0.18* -0.18* 0.07 0.25**
FCT 1 0.82** -0.12 -0.16* 0.05 -0.03 -0.03 -0.03
Mean 1 -0.13 -0.2** 0.14 -0.14 0.04 -0.19*
CT= Cooking time, DF=Days to flowering, DM=Days to maturity, PN=Number of pods, PL=Number of pods,
SP= Number of seeds per pod, SW= 100 seed weight, ACT=Aged cooking time, FCT=Fresh cooking time,
*, **=Significant 0.05 and 0.01 respectively.
The common bean accessions used in this study belonged to twelve seed classes
commonly found in the eastern Africa region. The results show significant (P≤0.05)
differences in cooking time for fresh and aged seeds among seed classes. Carioca seed
class had the shortest cooking time while medium whites had the longest cooking time for
both fresh and aged seeds (Table 4.3). The seed classes were categorized into seven groups
based on the least significant difference in cooking duration (Table 4.3).
62
Table 4.3: Cooking time of fresh and aged soaked seed of common bean market classes
Range of cooking
Cooking time time
No. of Increase
Seed classes accessions Fresh Aged Mean (%) Fresh Aged
Medium Whites 7 51.9 78.6 65.2a 51.3 21.8 30.0
Navy 32 44.6 70.1 57.4b 57.4 42.0 56.9
Yellow 4 41.5 56.0 48.8c 34.9 11.4 17.0
Sugar 29 41.7 53.9 47.8c 29.4 26.4 31.9
Pinto 12 40.3 52.9 46.6cd 31.2 17.5 18.5
Purples 9 40.9 52.0 46.4cd 27.1 20.6 19.5
Calima 22 40.3 50.8 45.6cd 26.0 27.2 48.4
Large Reds 16 39.4 50.5 45.0cde 28.3 15.4 17.4
Small Reds 12 38.1 49.4 43.8def 29.7 11.5 18.1
Brown and tan 18 37.4 50.1 43.7def 33.9 19.8 36.9
Black 15 38.1 47.3 42.7ef 24.0 35.5 33.4
Carioca 18 37.4 45.8 41.6f 22.4 17.5 21.5
Overall mean 40.8 54.9 47.8 34.5
LSD Seed class** 1.1
LSD Storage** 0.5
LSD Seed class x Storage** 7.3
CV% 7.2
Means followed by the same letter are not significantly different, **=Significant at 0.001 level
The profile of cooking time for fresh and aged seeds for small and medium whites was
more distinct from the rest due to their prolonged cooking time mainly at the lag phase of
the curve (Figure 4.4 and 4.5).
63
120
Black
100 Black (a)
Brown and tan
Calima
80
Cooked beans (%)
Carioca
Carioca (a)
60
Large red
Medium white
40 Medium white (a)
Navy
20 Pinto
Purple
Small red
0
0 20 40 60 80 100 120 Small red (a)
Figure 4.3: Cooking time profile of fresh common bean seeds of different market
classes
64
120
Black
Black (a)
100 Brown and tan
Brown and tan (a)
Calima
80
Calima (a)
Cooked beans (%)
Carioca
60 Carioca (a)
Large red
Large red (a)
40
Medium white
Medium white (a)
Navy
20
Navy (a)
Pinto
0 Pinto (a)
0 20 40 60 80 100 120
Purple
Figure 4.4: Cooking time profile of aged common bean seeds of different market
classes
4.4.2 Marker data

The DArTseq produced 26945 SNPs markers of which 24878 were successfully assigned
chromosomes, after filtering out SNPs with minor allele frequency (MAF) of <5% and
missing data >20%, a final total of 19188 markers remained which were subjected to
maker-trait association analysis. The average number of SNPs markers per chromosome
was 1744.4, which ranged from 1387 markers on chromosome 4 to 2325 markers on
chromosome 11. In the PC analysis, the first principal components accounted for 53.8%
of the variation while the second and third principal components accounted for only 6.9%
of the variation (Figure 4.6).
65
Figure 4.5: Population structure of common bean accession, (a) amount of variation
accounted for by principal components, (b) three-dimensional plot from principal
component analysis for 222 common bean accessions and 1988 SNPs markers

Linkage disequilibrium (LD) analysis conducted using 1988 loci pairs showed pairwise
917276 loci with an average r2 of 0.43 and ranged from 0.36 on chromosome 11 to 0.53
on chromosome 1 and extended to an average distance of 4406.2kb. About 2.9% of SNPs
were in complete LD (r2= 1). The average D' was 0.88 ranging from 0.84 on chromosome
11 to 0.91 on chromosome 1 (Fig 4.7).
66
Figure 4.6: (a) Distribution of makers by correlation (r) in each of the 11
chromosomes, (b) distribution of markers by correlation (r) as a function of genetic
distance (kb), (c) distribution of SNPs markers by correlation (r), (d) distribution of
markers along the 11 chromosomes, (e) Linkage disequilibrium (LD, r2) decay plot
for pairwise markers as a function of genetic distance (kb), (f) distribution of 1988
SNPs markers by genetic distance (kb) for the 222 common bean accessions

Genome-wide analysis revealed two significant (P≤0.05) SNP markers associated with
the cooking time of aged seeds on chromosome 10 (Figure 4.8). However, no significant
SNP markers were identified associated with the cooking time of fresh seeds. The most
significant SNP maker was 100096770|F|0-21:G>A-21:G>A on chromosome 10 at
location 5600323 with a P-value of 6.9x10-7 which explained 36% of the phenotypic
variation. The second SNP marker that was significantly associated with the cooking time
of aged seeds was 3377419|F|0-24:A>T-24:A>T on chromosome 10 at location 4468450
67
with a P-value of 9.8x10-6 which explained 34% of the phenotypic variation. The two
significant SNPs 100096770|F|0-21:G>A-21:G>A and 3377419|F|0-24:A>T-24:A>T had
an allelic effect of 13.21% and 10.8% respectively were in strong linkage disequilibrium
linkage disequilibrium with r2 of 0.79, D prime of 0.95 (Table 4.4). The region around
these SNPs markers also had several other SNP markers near significance (P≤0.05)
threshold with a P-value ranging from 3.02x10-5 to 6.52x10-5 due to linkage disequilibrium
(LD) (Figure 4.7).
Figure 4.7: (a) Quantile-quantile plot of estimated -log (P) for association analysis of
cooking time. (b) Manhattan plot showing significant SNPs and their P-values for
cooking time of aged and soaked common bean accessions
Table 4.4: Significant SNPs associated with cooking time of aged common bean accessions
SNP Chr Position P-value MAF R2 AE (%)
100096770|F|0-21:G>A-21:G>A 10 5600323 6.9x10-7 0.1 0.36 13.2
3377419|F|0-24:A>T-24:A>T 10 4468450 9.8x10-6 0.15 0.34 10.8
SNP=Single Nucleotide Polymorphism, Chr=Chromosome, MAF=Minor allele frequency, R2=Phenotypic variation

explained by the SNP, AE=Allelic effect.
68
4.4.5 Identification of potential candidate gene
When potential candidate genes were explored in the Phytozome database, three potential
candidate genes were identified near the location of the most significant (P≤0.05) SNP
marker and eight potential candidate genes were identified around the second most
significant SNP marker at around 100kb of the location of the SNP markers. The nearest
gene to the location of the most significant SNP at Phytozome database on chromosome
10 were Phvul.010G038000 at 5575958 bp, Phvul.010G038100.1 at 5627743 bp and
Phvul.010G038200.1 at location 5644933 bp (Table 4.5).
A BLASTn search of the most significant SNP 100096770|F|0-21:G>A-21:G>A sequence
(TGCAGTACCAGAAAAACAATCGGTTGTTTTACAAAAACAATCGGTTGTTTT
ACAAAAACAATCGGTTGT) at NCBI database revealed Sequence ID AC254323.1 and
AC254327.1 of Phaseolus vulgaris L. with a 90.5% and 89.1% match, respectively. The
functional annotation for transcript Phvul.010G038000 indicated galacturan, 1, 4-alpha
galacturonidase enzyme, polygalacturonase/pectinase enzyme for Phvul.010G038100.1,
and NADPH-dependant alkenal reductase enzyme for Phvul.010G038200.1. There were
no defined functions for the genes identified in the NCBI database.
69
Table 4.5: Potential candidate genes identified in Phytozome data base around SNPs
significantly associated with cooking time of common bean accessions
Phytozome map
SNP Position in
Significant SNP position Phytozome transcript (100kb) Chr 10
100096770|F|0-21:G>A-21:G>A 5600172 Phvul.010G038100.1 5627744
Phvul.010G038000 5575959
Phvul.010G038200.1 5644934
3377419|F|0-24:A>T-24:A>T 4468484 Phvul. 010G030800.1 4468349

Phvul. 010G030900.1 4472539
Phvul. 010G030700.1 4462259
Phvul. 010G030600.2 4452797
Phvul. 010G031000.2 4482915
Phvul. 010G030500.2 4424827
Phvul. 010G030600.1 4452790
Phvul. 010G031100.1 4512862
SNP=Single Nucleotide Polymorphism, Chr=Chromosome
Most of the genes identified in the Phytozome database around the second significant SNP
marker SNP 3377419|F|0-24:A>T-24:A>T did not have a defined function, the nearest
transcript to the marker was Phvul.010G030800.1 with functional annotation of
asparagine tRNA ligase enzyme which belongs to class II family of tRNA synthetases
localized in the cytoplasm where it plays a role in protein synthesis. A BASTN in search
of the sequence of the second most significant SNP marker
(TGCAGTTCAGGATCTGAAGAAAACAAATGACCTGGCATCACAATTTGAAGC
AAGAGAAAACAGAAAGTT) in NCBI database revealed five genes with no defined
function (Table 4.5).
4.5 Discussion
The variation in cooking time was higher for aged seeds when compared to fresh seeds.
However, the cooking time for fresh seeds among bean accessions was also significantly
(P≤0.05) different. This indicates that progress can be made when selecting common bean
70
accessions with a shorter cooking time using both fresh and aged seeds since high narrow
sense heritability of 0.76 and 0.74 for cooking time has been reported in previous studies
by Elia (2003) and Jacinto-Hernandez et al., (2003) respectively. The significant
difference observed between the cooking time of aged and fresh seeds indicates that the
storage conditions significantly affected this trait. It is also evident that the extent of
increase in cooking time due to storage varied among common bean accessions. This
suggests that common bean susceptibility to hardening during storage varies among
accessions. Accessions NUA Ciankui and commercial variety GLP2 (Rosecoco) were less
susceptible to aging due to storage in adverse conditions. Previous studies have reported
an increase in the cooking time of common beans stored in higher temperatures and
relative humidity as demonstrated in this study (Nyakuni et al., 2008; Ousman et al.,
2013). Nyakuni et al., (2008) reported an increase in cooking time of four varieties stored
in ambient temperatures and relative humidity of 63-74% and the percentage increase in
the cooking time varied among varieties. Several other studies have reported that some
varieties have a shorter cooking time while others have a prolonged cooking time.
(Bressani and Chon 1996; Nyakuni et al., 2008; Kinyanjui et al., 2015).
The cooking time for commercial varieties observed in this study follows the same trend
as reported in previous studies, where Rosecoco (GLP2) and Red Haricot (GLP24) have
a relatively shorter cooking time in comparison to Pinto (GLPx92) and Canadian Wonder
(GLP1127a) (Kinyanjui et al., (2015). The genetic diversity in cooking time among the
common bean accessions evaluated provides variability that can be utilized in breeding.
The accessions with shorter cooking time can serve as genetic resources for selection or
hybridization schemes to generate new common bean varieties that are easy-to-cook.
Accessions with shorter cooking time can be improved through direct selection based on
other desirable traits.
The initial lag phase of the cooking time curve creates much of the cooking time difference
between fresh and aged seeds. The lag phase may be the stage at which the pectin is
solubilized within the middle lamella to allow water to imbibe into the cells of the
cotyledon. Njoroge et al., (2014) reported that varieties that have a shorter cooking time
71
had a higher hot water-soluble pectin (8.44 mg/g) than slow cooking beans like pinto (5.51
mg/g). If this is the case, the modification of the composition of middle lamella may make
beans easy to cook as proposed by Broughton et al., (2003). The cooking time profile in
this study agree with the findings of Kinyanjui et al., (2015) who reported that cooking
time is sigmoid with the lag and exponential phase being influenced by variety and
storage.
Classification of common bean market classes is based on seed size and color. Seed color
is determined by the presence and concentrations of flavanol glycosides, anthocyanins,
and condensed tannins in the seed coat (Reynoso et al., 2006). Lei et al., (2020) classified
those that weigh less than 25 g per 100 seeds as small-seeded while those that range from
25 to 40 g as medium-sized, and those that weigh more than 40 g are classified as large-
seeded. The cluster analysis results in this study classified the accession into two groups
mostly based on seed size. The results also indicate that large-seeded accessions had a
relatively shorter cooking time, unlike the medium and small-seeded genotypes. Seed size
depends on the genetic difference among varieties and can be traced back to the origin of
the common bean, namely Mesoamerican and Andean gene pools (Angioi et al., 2010).
The Andean gene pool is generally large-seeded while the Mesoamerican gene pool is
small-seeded and adapted to lower altitudes and higher temperatures (Beebe et al., 2011).
The significant results for the cooking time differences among the common bean seed
classes used in this study confirm that the trait varies between and within seed classes as
reported by Cichy et al., (2015). However, the findings in this study contradict those of
Cichy et al., (2015), which found the white seed class to have the shortest cooking time
in relative to other bean classes. This could be due to differences in the genetic background
of the white bean accessions used in these two studies, the environment they were grown
in, and the interaction between genotypes and the environment. In this study, the common
bean accessions were sourced from Gene Bank of Kenya which had been collected mainly
from Kenya while Cichy et al., (2015) evaluated common bean accessions of Andean
origin collected from Africa and North America.
72
The moderate (0.59) correlation in cooking time between fresh and aged seeds indicates
that accessions with a higher cooking time of fresh seeds are more susceptible to hardening
during storage in adverse conditions. This suggests that freshly harvested seed can be used
to an extent for indirect selection for easy-to-cook accessions. The significant extremely
weak negative association of cooking time with duration to maturity, pod length, and seed
weight indicates that common bean accessions that have a longer duration to mature, have
longer pods and larger seeds tend to have a slightly shorter cooking time. Similarly,
common bean accession with a higher number of pods per plant will tend to have a slightly
longer cooking time for aged seeds. This could be attributed to linkage disequilibrium
where some genes tend to be inherited together or the presence of a third variable such as
the prevailing temperature and humidity during growth. Similar negative correlation
results between cooking time and duration to maturity (-0.44), and seed weight (-0.21)
were reported in a previous study (Cichy et al., 2019). A study conducted by Berry et al.,
(2020) also revealed a negative correlation between cooking time and seed weight which
ranged from -0.3 to -0.8 depending on the environment the common bean was grown in.
For a rapid and effective breeding program, genetic markers are used to identify QTLs for
desirable traits. In this study, GWAS was used to identify the genomic regions that control
cooking time in common beans. The lack of significant SNP associated with the cooking
time of soaked freshly harvested seeds could be attributed to insufficient variation in the
cooking time among fresh common bean accessions.
Two significant SNP markers were identified to be associated with the cooking time of
soaked aged seeds. The study identified two positional potential candidate genes
Phvul.010G038000 and Phvul.010G038100.1 that control galacturan 1,4-alpha
galacturonidase and polygalacturonase enzymes, respectively, close to the position of the
most significant SNP marker. The two enzymes are known to be involved in the
breakdown of pectin in the plant cell wall. Therefore, this study supports the theory of the
formation of insoluble pectin as the cause of the hard-to-cook trait. The difference in
cooking time of stored bean accession is due to the activity of galacturan 1,4-alpha
galacturonidase and polygalacturonase enzymes that hydrolyse pectin. The hydrolyses of
73
pectin could probably have happened during storage as proposed by Jones and Boulter,
(1983) for pectin to translocate to middle lamella and combine with magnesium and
calcium ions to produce an insoluble magnesium pectinate and calcium pectinate that
cements cells together hardening the cell wall. Alternatively, the hydrolysis of pectin
could have occurred during the pre-soaking treatment of aged seeds before cooking.
Pectin is made up of complex acid polysaccharides with a backbone of galacturonic acid
residue with an alpha-1,4-glycosidic linkage. Homogalacturonan-rich pectin is commonly
found in the middle lamellar region of plant cell walls where two cells border (Atkinson
et al., 2002). Galacturan 1,4-alpha galacturonidase enzyme is known to hydrolyze the first
group of glycosidic bonds from the non-reducing end of the substrate, while
polygalacturonase enzymes break down the pectin components found in the middle
lamella of plant cells after PME makes the polymeric backbone accessible. The combined
effect of both PME and pectinase enzymes has been reported to give softer fruits and
vegetables at the end of maturation (Phutela et al., 2005).
The second most significant SNP marker associated with the cooking time marker may be
due to linkage disequilibrium (r2 = 0.74, D' = 0.95) because of its proximity to the gene
that controls HTC. The genes identified around this SNP allele variant marker may not be
involved in the control of cooking time but based on linkage disequilibrium the marker
can be used to determine the haplotype containing genes of interest. The identification of
the two enzymes supports the theory of the formation of insoluble pectin in the middle
lamella as the cause of the occurrence of HTC phenomena in common beans during
storage in conditions of high temperature and relative humidity (Jones and Boulter, 1983).
Several studies have been carried out to map QTLs that control cooking time. A random
amplified polymorphic DNA (RAPD) marker associated with cooking time was identified
using 104 recombinant inbred lines, the identified marker explained 23% of the variation
in cooking time (Jacinto-Hernandez et al., 2003). Garcia et al., (2012) mapped 6 QTLs
that govern cooking time on chromosomes 1 and 9 using 105 polymorphic SSR markers
and 140 F2:4 recombinant inbred lines. The study found QTL CT1.1 on chromosome 1
which explained 21% of the phenotypic variation to be the most promising.
74
In a genome-wide association study using freshly harvested seeds, significant SNPs
associated with cooking time were identified on chromosomes 2, 3, and 6 using 206
common bean accessions of Andean origin, the SNPs explained between 4 to 8.7% of the
phenotypic variation (Cichy et al., 2015). A recent study conducted by Berry et al., (2020)
using freshly harvested 146 recombinant inbred lines of common bean, identified 10 QTLs
on chromosomes 1, 2, 3, 5, 6, 10, and 11, with the most robust QTLs being on
chromosomes 3, 6, 10 and 11 that appeared in over two different environments. The
variations observed in these studies could have resulted from different number of markers
in some studies that affects markers saturation, pretreatments of seeds before the
determination of cooking time such storage conditions and soaking, and the limitations
and advantages different types mapping populations used in the studies.
4.6 Conclusion
This study assessed variation in cooking time among fresh and aged common bean
accessions. In addition, genotyping of the common bean accessions was conducted to
identify single nucleotide polymorphisms (SNPs) markers associated with cooking time.
Storage significantly (P≤0.05) increased the cooking time of the common bean accessions,
but the increase varied among the common bean accessions. Significant difference for
cooking time among the common bean accession was observed. Genome-wide association
analysis (GWAS) revealed two SNPs markers that were significant associated with the
cooking time of the aged common bean accessions on chromosome 10. Consequently, two
potential candidate genes co-localized with the most significant SNP marker. The two
genes Phvul.010G038000 and Phvul.010G038100 encode galacturan 1, 4-alpha
galacturonidase and polygalacturonase enzymes respectively. The two enzymes are
involved in the hydrolysis of pectin in the plant cell wall. The easy-to-cook accessions
and the SNP markers significantly associated with cooking time can be utilized in
breeding programs to improve the cooking time of the common bean.
75
CHAPTER FIVE
GENOME WIDE ASSOCIATION STUDY OF VARIATION IN AGRONOMIC
TRAITS AMONG COMMON BEAN (PHASEOLUS VULGARIS L.)
ACCESSIONS USING DIVERSITY ARRRAYS TECHNOLOGY MARKERS
5.1 Abstract
Common bean is a major source of nourishment for a large population of people globally.
Identifying genomic regions that control various critical agronomic traits of common bean
is crucial to aid in the efforts to improve the crop through breeding. genome-wide
association studies (GWAS) analysis is a popular method used to identify quantitative trait
loci (QTLs) associated with phenotypic traits. The objective of the study was to identify
genomic regions of common bean that control various agronomic traits using GWAS. A
total of 234 common bean accessions obtained from selected farmers’ fields and the
National Gene Bank of Kenya were used in this study. Field experiments were conducted
for four seasons at Jomo Kenyatta University of Agriculture and Technology (JKUAT),
Kenya. Agronomic data recorded included days to flowering, days to maturity, number of
pods per plant, pod length, number of seeds per pod, 100-seed weight, and seed yield.
Genotyping By Sequencing (GBS) approach was used to generate single nucleotide
polymorphism (SNP) markers using the Diversity Arrays Technology Sequencing
(DArTseq) method. Based on 24879 SNP markers and seven agronomic traits, association
analysis was carried out using the GWAS method to identify SNPs associated with various
agronomic traits. The results revealed significant differences (P≤0.05) among accessions
for all the traits evaluated, the seasonal and the interaction between accessions and seasons
were also significant. A total of 32 SNPs associated with various agronomic traits were
identified, and the association between trait and molecular marker was found to be
influenced by the seasonal changes. Various possible potential candidate genes for various
traits were identified around 100 kb, the position of the trait-associated SNP. The study
managed to estimate the position and effects of genomic regions associated with various
agronomic traits evaluated under different environmental conditions. The identified
76
markers can be used in developing varieties with desirable traits through markers assisted
selection (MAS).
5.2 Introduction
Common bean (Phaseolus vulgaris L.) is an important crop for human nutrition. It is rich
in proteins, dietary fibers, carbohydrates, vitamins, and minerals, playing a vital role in
the development of plant-based diets, addressing malnutrition and promoting food
security (Mecha et al., 2018; Murube et al., 2021). The crop is a major source of protein,
carbohydrates, dietary fiber, and essential minerals to a large population globally
(Broughton et al., 2003;). A wide diversity of traits in common beans exist in duration to
flowering and maturity, resistance to biotic and abiotic stresses, seed characteristics,
nutritional quality, and yield (Fisseha et al., 2018; Farrow and Andriatsitohaina, 2021).
Seed yield improvement is the most crucial breeding objective for the common bean.
Understanding the genetic architecture of yield and its interaction with other yield
components would lay a genetic foundation for improving seed yield (Vandemark et al.,
2014). Seed yield is a quantitative trait governed by multiple genes, and is conditioned
primarily by three yield components namely, the number of pods per plant, the number of
seeds per pod, and seed weight (Ghobary and Allah, 2010; Negahi et al., 2014). The three
yield components are quantitative and their interaction with seed yield is based on the
physiological and morphological features of a plant (Burbano-Erazo et al., 2021). The
knowledge of the interaction between these yield attributes and seed yield may help
identify a suitable donor for this trait.
Seed yield has been reported to be significantly positively associated with the number of
pods per plant, number of seeds per pod, seed weight, and biomass yield (Ghobary and
Allah, 2010; Negahi et al., 2014). Ghobary and Allah, (2010) noted that breeders should
be attentive to these traits as they are linked and exhibit a positive direct effect on seed
yield. High-yielding varieties were also reported to flower early, mature late, taller, and
have a higher number of primary branches per plant, pods per plant, and seeds per pod
(Ashango and Alamerew, 2017). Genetic control for most plant traits has been reported to
be predominantly due to genes with additive effects (Silva et al., 2013). A more detailed
77
understanding of important traits at the molecular level is therefore critical to improving
these traits in common bean.
The use of Deoxyribonucleic acid (DNA) analysis techniques in common bean breeding
programs has improved our understanding of genetic factors controlling various traits.
Several mapping studies in common bean have been conducted to understand genomic
regions contributing to traits using different techniques and populations (Mukeshimana et
al., 2014; Kamfwa et al., 2015; Briñez et al., 2017; Sandhu et al., 2018; Langat et al.,
2019).
Next-generation sequencing (NGS) using Single Nucleotide Polymorphism (SNPs) has
become more practical in genotyping and discovery of markers. Marker-assisted selection
(MAS) using SNP technology is much faster and inexpensive than the older generation
markers that were gel-based (Gujaria-Verma et al., 2016). The large number of SNPs that
have been identified allow explorations of genetic diversity and population structure
(Cichy et al., 2015; Valdisser et al., 2016). Genome-Wide Association (GWAS) is a
popular method used to identify QTLs associated with bean traits. It involves the
application of molecular markers to plant breeding using statistical methods to estimate
the position and effects of genomic regions associated with variation in quantitative traits
(Kafwa et al., 2015). GWAs has been used to identify QTL related to biotic stress
(Zuiderveen et al., 2016; Perseguini et al., 2016), abiotic stress (Villordo-Pineda et al.,
2015), agronomic traits (Kamfwa et al., 2015; Rasende et al., 2018), pod shattering
(Ugwuanyi et al., 2022) and grain quality (Cichy et al., 2015). This method is important
in breeding because it is dependent on genotype-environment interactions (GxE) (Beebe
et al., 2011), thereby giving an understanding of GxE at a molecular level, especially for
a self-pollinating plant like the common bean that has been adapting to a constantly
changing environment (Li et al., 2003). The objective of this study is to identify genomic
regions that control various agronomic traits of the common bean using GWAS.
78
5.3.1 Plant materials
A total of 234 of the 257 common bean accessions were used in this study sourced from
selected farmers field and the National Gene Bank of Kenya. The number of accessions
used, and their market classes is described in Table 5.1.
Field experiments were conducted for over four seasons at Jomo Kenyatta University of
Agriculture and Technology (JKUAT) farm, Kenya. The site coordinates, seasonal rainfall
and temperatures, and type of soil is described in section 3.3.1. The monthly rainfall and
temperature that prevailed in the area in 2018 and 2019 is shown in Appendix 4. Data
collected included days to flowering, days to maturity, number of pods per plant, number
of seeds per pod, seed weight, and plot seed yield as described in section 3.3.4.
Table 5.1: Common bean accessions used in this study and their characteristics
Number of
Seed class Description accessions
Sugars Cream, can be speckled 38
Carioca Red and Red specks 28
Navy Small whites 26
Calima Rosecoco type 24
Pinto Cream with brown specks-GLPx92 type 21
Black Black coloured 20
Brown and tan Brown and orange 17
Large Reds Canadian wonder type 16
Small Reds Red haricot type 14
Medium Whites Medium and large whites 12
Purples Mwezimoja type 11
Yellow Yellow coloured 7
Total 234
5.3.2 Experimental design and trial management

The experimental design used and the management of the field experiment is as described
in section 3.3.3.
79
DNA isolation and genotyping were conducted as described in section 4.3.3.
5.3.4 Data analysis
Data collected from field experiments was combined over seasons and subjected to a
normality test and analysis of variance (ANOVA) using R software (version 4.0.2). The
augmented block model described below was employed.
Y=Mx+Zg+Sβ+Tk+e
Where Y is the data vector, x is the vector of the assumed fixed effect (means of
genotypes), g is the vector of the genotypic effect of the bean accessions, β is the vector
of environmental (seasonal) effects, and k is the vector of the effects of the genotype and
environmental interaction (GxE), and e is the vector of the residual effects. The capital
letter M, Z, S, and T represents the incidence matrices for these effects.
Marker-trait association analysis and identification of potential candidate gene was
conducted as described in section 4.3.6 and 4.3.7 respectively.
Linkage disequilibrium analysis are described in section 4.3.5
Association analysis to identify SNP markers associated with phenotypic traits is
described in section 4.3.6
5.3.7 Identification of potential candidate genes
The identification of potential candidate gene is described in section 4.3.7
5.4 Results
5.4.1 Phenotypic traits
Significant differences (P≤0.05) were observed among accessions for all the traits, the
seasonal effect, and the interaction effect of seasons and accessions was also significant
for all traits evaluated (Appendix 1).
80
The means, range, residual mean squares, standard error, and coefficient of variation for
traits recorded are summarized in Table 5.2. The coefficient of variation ranged from 4.0%
(days to maturity) to 36.5% (number of pods per plant). Overall mean for days to
flowering, days to maturity, the number of seeds per pod, 100-seed weight, and grain yield
were high during the long rain season than short rain season while the number of pods per
plant and pod length was higher during the short rain season (Table 5.2).
Table 5.2: Descriptive statistics for agronomic traits of common bean accessions
Trait Season Mean Max Min MSE SE CV%
Days to flowering LR 38.4 48.0 32.5 2.41 0.14 4.0
SR 37.4 44 32.25 2.6 0.10 4.3
Days to maturity LR 82.3 99.0 72.0 16.0 0.18 4.9
SR 81.7 89.8 70.0 7.8 0.17 3.4
Pod length LR 9.9 14.8 7.0 1.6 0.06 12.8
SR 9.9 17.3 6.6 2.3 0.07 15.1
Seed per pod LR 4.9 7.5 3.3 0.6 0.03 15.1
SR 4.3 6.3 2.8 0.6 0.03 18.0
100 seed weight LR 37.6 67.8 15.0 20.0 0.44 11.9
SR 36.2 70.5 14.8 19.4 0.40 12.2
Pods per plant LR 12.3 27.5 5.5 13.9 0.24 30.3
SR 12.8 36.6 3.8 21.8 0.25 36.5
Yield (kgha-1) LR 1528.3 4926.3 248.8 212824 26.21 30.2
SR 1005.7 4357.8 75 121967.0 22.59 34.7
n=234, LR=Long rains, SR=Short rains, CV=Coefficient of variation, MSE=Residual mean sum of
squares, Max=Maximum, Min=Minimum, SE=Standard error.
5.4.2 Single Nucleotide Polymorphism markers
The number of SNPs significantly (P≤0.05) associated with each trait are displayed on
Table 5.3. The total number of significant SNPs obtained ranged from one to 14, with
81
days to flowering and pod length having the highest number of significant SNPs of 14 and
12 respectively (Table 5.3).
Table 5.3: Number of significant SNPs identified for various agronomic traits
SR
Trait season LR season Four seasons Total
Days to flowering 10 3 6 13
Days to maturity 0 0 2 2
Pods per plant 1 0 0 1
Pod length 3 10 7 12
Seeds per pod 1 0 1 2
100 seed weight 0 0 1 1
Grain yield 0 0 1 1
SNP=Single Nucleotide Polymorphism, SR=Short rain season, LR=Long rain season.
Results show that the number of identified SNPs varied with trait and the season, some
SNPs that were significantly associated with traits during long rain season were not
identified during short rain season and vice versa. The results did not reveal any significant
(P≤0.05) SNPs associated with days to maturity, number of seeds per pod, 100-seed
weight, and grain yield during long and short rain seasons, but when the overall average
of the four seasons for these traits was used in marker-trait association analyses we
identified a few significant SNPs. Furthermore, SNPs significantly (P≤0.05) associated
with the number of pods per plant and number of seeds per pod were only identified during
the short rain season (Table 5.4).
5.4.3 Duration to flowering and maturity
In total, thirteen significant (P≤0.05) SNPs markers were identified for days to flowering,
six SNPs were identified using average data from the four seasons (Figure 5.1) ten were
also identified during the short rain season, and three during the long rain season. Eight of
these SNPs were found on chromosome one all located around positions 44146828 to
44960059 bp. In this region SNP marker 8206455|F|0-42:G>A-42:G>A with a nucleotide
sequence TGCAGAAATTCTATCAGTGGCACTGATGAGTTGGATATGCATGCTG
82
GGGTAGTTGATTCCGTCCGTTCC was the most significant with a p-value 1.46x10-
10
and explained 50% phenotypic variation.
flowering of common bean accessions grown in the year 2018 and 2019
maturity of common bean accessions grown in the year 2018 and 2019
Other regions in the genome with SNPs marker significantly associated with days to
flowering were chromosomes number three at positions 12798228 and 5975107 kb,
chromosome eight at locations 19534456 and 48790667 kb, and lastly chromosome eleven
in position 15684107 kb (Table 5.4).
83
Table 5.4: Chromosome, chromosome position, P-values, minor allele frequency and proportion
of phenotypic variation explained of the most significant Single Nucleotide Polymorphisms
(SNPs) for days to flowering and maturity measured on 234 common bean accessions grown in
the year 2018 and 2019
Trait Season SNP ID Chr SNP Position P-value MAF R2
DF Both 8206455|F|0-42:G>A-42:G>A 01 44775515 3.67x10-10 0.43 0.53
DF Both 8215844|F|0-31:G>A-31:G>A 01 44680698 2.17x10-06 0.42 0.48
-06
DF Both 8215758|F|0-28:T>C-28:T>C 01 44386414 3.76x10 0.42 0.48
DF Both 3378093|F|0-35:C>T-35:C>T 01 44809453 7.00x10-06 0.42 0.48
DF Both 3381041|F|0-55:T>C-55:T>C 01 44146828 7.84x10-06 0.11 0.48
DF Both 100095511|F|0-43:A>G-43:A>G 03 12798228 8.47x10-06 0.06 0.48
DF LR 8206455|F|0-42:G>A-42:G>A 01 44775515 1.88x10-08 0.43 0.46
DF LR 100112791|F|0-25:C>A-25:C>A 08 48790667 4.93x10-06 0.31 0.42
DF LR 100038445|F|0-43:G>C-43:G>C 08 19534456 6.64x10-06 0.19 0.42
-10
DF SR 8206455|F|0-42:G>A-42:G>A 01 44775515 1.46x10 0.43 0.50
DF SR 100122138|F|0-19:A>G-19:A>G 11 15324966 5.29x10 -07 0.44 0.45
DF SR 8215758|F|0-28:T>C-28:T>C 01 44386414 5.67x 10-07 0.42 0.45
DF SR 8215844|F|0-31:G>A-31:G>A 01 44680698 1.40x10-06 0.42 0.44
DF SR 3383101|F|0-8:C>A-8:C>A 03 5975107 2.14x10-06 0.22 0.44
DF SR 3378093|F|0-35:C>T-35:C>T 01 44809453 2.63x10-06 0.42 0.44
DF SR 3383103|F|0-22:C>G-22:C>G 01 44604355 5.12x10-06 0.42 0.44
DF SR 100095511|F|0-43:A>G-43:A>G 03 12798228 5.71x10-06 0.06 0.44
DF SR 100097512|F|0-55:T>C-55:T>C 01 44960059 9.74x10-06 0.47 0.43
DF SR 3377352|F|0-18:T>C-18:T>C 01 44215472 1.05x10-05 0.41 0.43
DM Both 100166226|F|0-13:G>A-13:G>A 09 29625250 2.80x10-06 0.13 0.45
DM Both 100157386|F|0-13:A>G-13:A>G 11 27376763 3.53x10-06 0.34 0.44
2
SNP=Single Nucleotide Polymorphism, Chr=Chromosome, MAF=Minor allele frequency, R =Phenotypic variation
explained by the SNP, DF=Days to flowering, DM=Days to maturity.
Association analysis using combined data for days to maturity from four seasons revealed
two SNPs that were significantly associated with days to maturity (Figure 4.2). The two
84
SNPs were located at chromosomes nine (100166226|F|0-13:G>A-13:G>A) with a
nucleotide sequence TGCAGTTAGCCCGGAGTGTGACAGATGACGGGGCAGTCT
ACACGAGACGATCACGTAATGTTCATGGAT and eleven (100157386|F|0-13:A>G-
13:A>G) with a nucleotide sequence TGCAGTATACATAACCAGTTACC
GCCAAGATGAGTCATCGCCCAAGAGAAGGACATCGCCTAAGCAAGA and p-
values of 2.80x10-06 and 3.53x10-06, respectively. The SNP markers on chromosomes nine
and eleven accounted for 45% and 44% of the total phenotypic variation in days to
maturity, respectively (Table 5.4). There were no SNPs identified to be significantly
associated with days to maturity from the data recorded in separate seasons.
5.4.4 Number of pods per plant and pod length
One significant (P≤0.05) SNPs marker (100104488|F|0-33:C>T-33:C>T) with a

nucleotide sequence TGCAGCAACAATAGCAACCACCACTTCATATGCCACCCC
TGCTTCTAATATTAATATTAC on chromosome 11 at position 5531505bp was
associated with the number of pods per plant, the marker had a p-value of 1.0x05-05 and
accounted for about 54% of the total variability in the number of pods per plant during
short rain seasons (Table 5.5 and Figure 5.3).
85
Table 5.5: Chromosome, chromosome position, P-values, minor allele frequency and
proportion of phenotypic variation explained of the most significant Single Nucleotide
Polymorphisms (SNPs) for pod length and number of pods per plant measured on 234 common
bean accessions grown in the year 2018 and 2019
PL Both 3383789|F|0-8:A>G-8:A>G 02 47816492 1.29x10-07 0.27 0.50
PL Both 3379907|F|0-17:G>T-17:G>T 02 48172001 1.29x10-07 0.24 0.50
-07
PL Both 3374313|F|0-27:G>C-27:G>C 08 60205731 6.03x10 0.38 0.49
PL Both 100049685|F|0-55:T>A-55:T>A 05 3857206 1.93x10-06 0.30 0.48
PL Both 3368653|F|0-8:A>T-8:A>T 02 47364334 2.96x10-06 0.25 0.48
PL Both 3377440|F|0-53:A>G-53:A>G 02 47505888 3.85x10-06 0.37 0.48
PL Both 8668461|F|0-6:A>C-6:A>C 08 59503639 1.00x10-05 0.24 0.48
PL LR 3374313|F|0-27:G>C-27:G>C 08 60205731 3.01x10-07 0.38 0.46
PL LR 100088980|F|0-58:A>G-58:A>G 08 59997265 4.76x10-07 0.49 0.46
PL LR 3383789|F|0-8:A>G-8:A>G 02 47816492 5.96x10-07 0.27 0.46
PL LR 3379907|F|0-17:G>T-17:G>T 02 48172001 9.89x10-07 0.24 0.45
PL LR 3377435|F|0-27:G>A-27:G>A 03 38190877 1.95x10-06 0.30 0.45
PL LR 100049685|F|0-55:T>A-55:T>A 05 3857206 2.64x10-06 0.30 0.45
PL LR 3368653|F|0-8:A>T-8:A>T 02 47364334 3.11x10-06 0.25 0.45
PL LR 3377440|F|0-53:A>G-53:A>G 02 47505888 4.30x10-06 0.37 0.44
PL LR 8212905|F|0-6:G>A-6:G>A 02 48938155 5.49x10-06 0.38 0.44
PL LR 3372743|F|0-25:G>A-25:G>A 02 49029823 7.77x10-06 0.30 0.44
PL LR 3370435|F|0-48:G>C-48:G>C 04 44775515 9.50x10-06 0.33 0.44
PL SR 3383789|F|0-8:A>G-8:A>G 02 47816492 5.20x10-07 0.27 0.40
PL SR 3379907|F|0-17:G>T-17:G>T 02 48172001 1.58x10-06 0.24 0.39
PL SR 100092861|F|0-24:G>A-24:G>A 10 5758205 1.70x10-06 0.07 0.39
PP SR 100104488|F|0-33:C>T-33:C>T 11 5531505 1.00x10-05 0.09 0.54
2
SNP=Single Nucleotide Polymorphism, Chr=Chromosome, MAF=Minor allele frequency, R = Phenotypic variation
explained by the SNP, PP=Number of pods per plant, PL=Pod length.
86
Figure 5.3: Manhattan plot showing candidate SNPs and their P-values for number
of pods per plant of common bean accessions grown during short rain seasons of the
year 2018 and 2019
Figure 5.4: Manhattan plot showing candidate SNPs and their P-values for pod
length of common bean accessions grown in the year 2018 and 2019
There were no significant (P≤0.05) SNP markers associated with the number of pods per
plant identified during the long rain season or with the average data from both seasons.
However, one significant SNP associated with number of pods per plant was identified
during short rain seasons in chromosome eleven at position 5367046 with a P-value
1.0x05-05 and explained 54% of the total phenotypic variation.
87
Overall, thirteen significant (P≤0.05) SNPs associated with pod length were identified.
Seven significant SNPs were identified using combined data of pod length for all seasons
(Figure 5.4), eleven were identified during the long rain season, three during the short rain
season, and one in both seasons (Table 5.5). Two SNPs 3383789|F|0-8:A>G-8:A>G with
a nucleotide sequence of TGCAGGTTAGTGATCACAGAGGATTTTCCTGAGTGG
GAGAATGAGTTGATGCCTTCAGGGAGAACGATG and 3379907|F|0-17:G>T-
17:G>T (TGCAGACAGGAATACCAGTTTTCGTTCATCTCTGAACACAGATGCCC
GAACATGTCAAGATGTAATAAC) on chromosome two were the most significant
(P≤0.05) SNPs associated with pod length in both long rain and short rain seasons. These
two markers were located at position 47816492 and 48172001 bp respectively, both with
a p-value of 1.29x10-07 and explained 50% of the total variability. It was observed that the
most significant SNPs markers were on chromosome two in the region around 47364334
to 49029823 bp. Other regions with significant SNPs included chromosome three at
position 38190877 bp, chromosome four at position 46352340 bp, chromosome five at
position 3857206 bp, chromosome eight at position 59503639 to 59997265 bp and
60205731 bp, and lastly chromosome ten in position 5758205 bp.
5.4.5 Number of seeds per pod, seed weight and grain yield
Two significant (P≤0.05) SNP markers associated with the number of seeds per pod were
identified, one during short rain seasons and the other using the average data for both
seasons (Figure 5.5). Both SNPs were on chromosome ten with the most significant SNP
being 8669727|F|0-28:C>A-28:C>A with a nucleotide sequence TGCAGTGGGCAAG
ACTCAAACCCAAGTCCTCGAGTGACCAAAGAAGCTTTAC at position 32425106
bp with a p-value of 2.04x10-06. The SNP explained 65% of the total phenotypic variation
in the number of seeds per pod (Table 5.6). The second SNP significant (P≤0.05) SNP
marker was 100112078|F|0-38:T>C-38:T>C with a sequence TGCAGTTGATTCTTG
ATTGTGTGTGTTGCTTCCACGTGTGTTTTTTCCCATCGAGTGGTATCAAGAGC
T and was located at 35888476 bp with a p-value of 2.04x10-06. When marker-trait
association analysis was conducted using the average data for both seasons for this 100-
88
seed weight, one SNPs marker (3380104|F|0-61:T>A-61:T>A) was found to be
significantly (P≤0.05) associated with 100-seed weight. This SNPs had a nucleotide
sequence TGCAGCTATAGTCTCTGCAAATTTTGCCGGTAGAATTATATTACTG
AGATAAAATTTCTATTGAAAAAA and was located on chromosome eleven at
position 5893195bp with a p-value of 6.30x10-06 (Figure 6). This SNP explained 79% of
phenotypic variation in seed weight (Table 5.6). There were no significant (P≤0.05) SNPs
identified associated to 100-seed weight during long rain and short rain seasons.
89
Table 5.6: Chromosome, chromosome position, P-values, minor allele frequency and
proportion of phenotypic variation explained of the most significant Single Nucleotide
Polymorphisms (SNPs) for number of seeds per pod, seed weight and yield measured on 234
common bean accessions grown in the year 2018 and 2019
SP Both 8669727|F|0-28:C>A-28:C>A 10 32425106 2.04x10-06 0.09 0.65
SP SR 100112078|F|0-38:T>C-38:T>C 10 35888476 3.16x10-06 0.06 0.54
-06
SW Both 3380104|F|0-61:T>A-61:T>A 11 5893195 6.30x10 0.09 0.79
SY Both 3384204|F|0-17:T>C-17:T>C 01 724994 8.34x10-06 0.11 0.28
SNP=Single Nucleotide Polymorphism, Chr=Chromosome, MAF=Minor allele frequency, R2= Phenotypic variation
explained by the SNP, SP=Seeds per pod, SW=Seed weight, SY=Seed yield.
Figure 5 5: Manhattan plot showing candidate SNPs and their P-values for number
of seeds per pod of common bean accessions grown in the year 2018 and 2019
SNP marker 3384204|F|0-17:T>C-17:T>C with nucleotide sequence

TGCAGAGTGATGAAGTGTTGCCACGGTTTGATGGTGAGACGGAGGCTCATCT
GGGGTCCTTCTCAACAG was significantly (P≤0.05) associated with grain yield per
hectare on chromosome one at position 827668 bp and with a p-value of 8.34x10-06
(Figure 5.7). This marker was identified using combined data for grain yield of both
seasons and accounted for 28% of phenotypic variation in grain yield (Table 5.6). No
90
significant (P≤0.05) SNP was identified during long rain and short rain seasons.
Figure 5.6: Manhattan plot showing candidate SNPs and their P-values for number
of 100-seed weight of common bean accessions grown in the year 2018 and 2019
Figure 5.7: Manhattan plot showing candidate SNPs and their P-values for grain
yield of common bean accessions grown in the year 2018 and 2019
5.5 Discussion
The results showed significant (P≤0.05) variability for various traits among the accessions
in different seasons which is ideal for association mapping. Significant seasonal effects
on traits could be attributed to changes in temperature and amount of rainfall that affected
plant morphology and the expression of genes. The effect of seasonal variation on the
expression of genetic loci was also revealed by trait-marker association analysis in that
91
the number of identified SNPs varied with trait and the seasons. The complex interactions
of diverse environments and multiple genetic loci suggest an evaluation method that
considers the interaction of genes and environment in analysis such as the trait-marker
association studies. A GWAs approach involves rapidly scanning markers across the
entire genome of many accessions to find genetic variations associated with phenological
and yield component traits. This method allows simultaneous characterization of many
accessions as well as examining thousands of genes under different environmental
conditions to find a new genetic association with observable traits. Several studies have
also reported the influence of the environment on the association of SNP marker to
morphological traits (Kamfwa et al., 2015) and cooking time (Berry et al., 2020).
Optimal flowering time is an important agronomic trait that is a prerequisite to successful
sexual reproduction and production of seed yield, it is an adaptive trait that is of interest
to plant breeders (Muller, 2009). High-yielding varieties have been reported to flower
early and mature late (Ashango and Alamerew, 2017), studies on flowering time for
various plants have revealed that flowering time is controlled by many genes with diverse
responses to seasonal cues (Andrés and Coupland, 2012). NCBI BLASTn search of the
sequence of the most significant SNP marker (8206455|F|0-42:G>A-42:G>A) on
chromosome one revealed a 100% sequence similarity match to sequence ID
XM_007162819.1 (PHAVU_001G188400g).
QTL for flowering time on chromosome one had been reported in previous studies by
Koinange et al., (1996), Blair et al., (2006), Perez-Vega et al., (2010), Mukeshimana et
al., (2014), Kamfwa et al., (2015) and (Langat et al., 2019). Other QTLs have been
reported on chromosome four by Mukeshimana et al., (2014) and Langat et al., 2019, on
chromosome eight by Koinange et al., (1996), Perez-Vega et al., (2010), Kamfwa et al.,
(2015), (Briñez et al., 2017).
Duration to maturity is a critical trait for adaptation to geographical areas with varying
seasonal duration and amounts of rainfall. Several common bean growing areas have
irregular and marginal rainfall which makes them unreliable for production, this
necessitates the use of early maturing and high-yielding common bean varieties. However,
92
earliness embodies an inherent loss of yield potential due to the short growth cycle and
sub-optimal canopy (Mduruma et al., 1998). Earliness has therefore been a breeding
objective for many crops. In this study, two significant SNPs associated with duration to
maturity were identified on chromosomes nine and eleven.
A BLASTn search of the nucleotide sequence of the two significant SNP markers
100166226|F|0-13:G>A-13:G>A on chromosome 9 and 100157386|F|0-13:A>G-13:A>G
on chromosome 11 which were significantly (P≤0.05) associated to duration to maturity
at NCBI database did not reveal any significant match similar to the nucleotide sequences.
In previous studies, QTL for the duration to maturity has been reported on chromosome
one (Langat et al., 2019), chromosomes four (Mukeshimana et al., 2014; Langat et al.,
2019), chromosome seven (Mukeshimana et al., 2014), and chromosome nine
(Mukeshimana et al., 2014; Kamfwa et al., 2015).
MADS-box loci also known as MICK-type genes have been reported to control various
plant development processes like vegetative growth and reproductive organ development
(Adamzyk and Fernandez, 2009). Phytochrome-interacting factors are basic helix-loop-
helix transcription factors that play critical roles in the germination of seeds,
photomorphogenesis, responses to shading, flowering time, and leaf senescence
(Sakuraba et al., 2014; Shi et al., 2018). However, in this study, the MADS-box and
phytochrome loci were not identified close to the position of the most significant SNPs
associated with duration to flowering and maturity on the Phytozome genetic map.
The number of pods per plant is a primary yield component and part of the accumulated
aerial biomass that is later partitioned to seed yield (Negahi et al., 2014). A BLASTn
search of the sequence of the identified significant SNP marker (100104488|F|0-33:C>T-
33:C>T) associated with the number of pods per plant at NCBI revealed a sequence ID
XM_007131979.1 (PHAVU_011G061900g) with a 100% match.
QTLs for the number of pods per plant have been identified in previous studies using
different methods and populations. QTL for the number of pods per plant has been
reported on chromosome one (Koinange et al., 1996, Langat et al., 2019), on chromosome
two (Beattie, 2003; Mukeshimana, et al., 2014; Langat et al., 2019), on chromosome three
93
(Beattie, 2003; Langat et al., 2019), on chromosome 5 (Beattie, 2003; Kamfwa et al.,
2015), on chromosome seven (Blair, 2006; Kamfwa et al., 2015; Briñez et al., 2017), on
chromosome eight (Mukeshimana, et al., 2014) and chromosome nine and eleven (Blair,
2006).
Pod length is a measure of the size of the harvested part of a snap bean, it is one of the
quality traits that appeal to the consumer in green beans (Wahome et al., 2013). Pod length
is negatively associated with the number of pods per plant and is positively correlated with
seed weight (Ghobary and Allah, 2010). A BLASTn search of the nucleotide sequence for
the most significant (P≤0.05) SNP marker 3383789|F|0-8:A>G-8:A>G associated to pod
length at NCBI revealed sequence ID XM_007160253.1 (PHAVU_002G311300g) with
a 100% match. When the second most significant SNP (3379907|F|0-17:G>T-17:G>T )
sequence on the same chromosome two was searched it revealed sequence ID
XM_007160298.1 (PHAVU_002G315000g) with also a 100% match.
The number of seeds per pod is a primary yield component for seed yield (Ghobary and
Allah, 2010; Negahi et al., 2014). Higher-yielding varieties have been reported to have
more seeds per pod (Ashango and Alamerew, 2017). A BLASTn search of the two SNP
markers 8669727|F|0-28:C>A-28:C>A and 100112078|F|0-38:T>C-38:T>C significantly
associated with the number of seeds per pod at the NCBI database did not identify
significant (P≤0.05) similarity with any known sequence. QTLs for the number of seeds
per pod have been reported in previous studies on chromosomes two (Langat et al., 2019)
on chromosomes 6 and 7 (Briñez et al., 2017) and on chromosome 8 (Briñez et al., 2017;
Langat et al., 2019).
Seed weight is also a primary yield component that exhibits higher heritability than the
number of pods per plant and the number of seeds per pod (Vandemark et al., 2014).
Large-seeded (Andean bean type) has been reported as the most popular in Africa
compared to the small-seeded type (Beebe, 2012). A BLASTn of the SNP marker
3380104|F|0-61:T>A-61:T>A significantly associated with seed weight at NCBI revealed
sequence ID CP039347.1, XM_028053922.1, XM_028053921.1, XM_028053920.1 and
XM_028053918.1 of cowpea with 92.75% match. Several QTLs for seed weight have
94
been mapped in previous studies on chromosome one (Koinange et al., 1996; Broughton
et al., 2003; Briñez et al., 2017), chromosome five (Blair et al., 2012; Briñez et al., 2017),
on chromosome seven (Koinange et al., 1996; Mukeshimana et al., 2014), on chromosome
eight (Langat et al., 2019) and chromosome eleven (Koinange et al., 1996).
Seed yield is a polygenic trait determined primarily by the number of pods per plant,
number of seeds per pod, and seed weight (Negahi et al., 2014). Identifying QTLs that
control the three yield components and their interaction with seed yield would assist
breeding efforts aimed at improving the seed yield of common bean (Burbano-Erazo et
al., 2021). In this study SNPs marker significantly associated with grain yield was
identified on chromosome one, around this SNP twelve positional candidate genes were
revealed in the phytozome database. A BLASTn search of the SNP marker 3384204|F|0-
17:T>C-17:T>C sequence which was significantly associated with seed yield at NCBI
revealed a sequence ID XM_007160638.1 encoding for a hypothetical protein
PHAVU_001G009700g in common bean with 100% match.
QTLs for seed yield had been reported in various studies using different methods and
populations, QTL for seed yield has been identified on chromosome one (Briñez et al.,
2017; Resende et al., 2018; Langat et al., 2019), on chromosome two (Langat et al., 2019),
on chromosome three (Mukeshimana et al., 2014, Kamfwa et al., 2015; Sandhu et al.,
2018; Resende et al., 2018), on chromosome four (Resende et al., 2018), on chromosome
seven (Sandhu et al., 2018), on chromosome eight (Sandhu et al., 2018; Resende et al.,
2018), on chromosome nine (Mukeshimana et al., 2014, Kamfwa et al., 2015) and
chromosome eleven (Briñez et al., 2017).
5.6 Conclusion
The study estimated the position and effects of genomic regions associated with various
agronomic traits evaluated in different seasons. The association between trait and marker
was influenced by the seasonal changes which validate the effectiveness of GWAs in
identifying QTLs under different environmental conditions. A total of 33 SNPs were
significantly (P≤0.05) associated with various agronomic traits were identified, and 296
potential candidate genes for various traits were identified around 100kb the position of
95
the trait-associated SNPs. These potential candidate genes require further investigations
to ascertain whether they are in linkage disequilibrium with the loci or play a role in the
expression of the trait. The findings expand the current knowledge on genomic regions
known to control various traits in common beans, and the identified SNPs markers can be
used in developing varieties with desirable traits through markers-assisted selection
(MAS).
96
CHAPTER SIX
QUANTITATIVE TRAIT LOCI FOR COOKING TIME AND
MORPHOLOGICAL TRAITS OF COMMON BEAN (PHASEOLUS VULGARIS
L.) USING RECOMBINANT INBRED LINES AND DIVERSITY ARRAYS
TECHNOLOGY MARKERS
6.1 Abstract
Common bean is a critical source of nourishment globally, second only to cereals.
Common bean seeds stored in adverse storage conditions develop a hard-to-cook trait that
prolongs cooking time leading to a high cost of preparation. The aim of this study was to
map Quantitative Trait Loci (QTLs) associated with the hard-to-cook trait and
morphological traits of agronomic importance using F2:6 recombinant inbred lines (RILs)
of common beans derived from two biparental crosses. Two common bean varieties GLP2
(easy-to-cook), GLPx92 (hard-to-cook) sourced from Kenya Seed Company, and
accession GBK035420 (easy-to-cook) from the National Gene Bank of Kenya were used
in this study to develop F2:6 recombinant inbred lines. The populations were advanced
using the single seed descent method in a greenhouse and later multiplied in the field at
the Jomo Kenyatta University of Agriculture and Technology (JKUAT) farm. The RILs
were genotyped using Diversity Arrays Technology Sequencing (DArTseqTM) to identify
variation in single nucleotide polymorphism markers (SNP). Seed samples of RILs were
stored at a temperature of 35oC and 50% RH for four months and later used for a cooking
experiment to determine their cooking time using a subjective finger-pressing method. A
total of 35246 SNP markers were scored, out of which 11277 markers were found
polymorphic. A linkage genetic map was constructed with a distance and marker density
that ranged from 2513 to 3352 cM and 0.5 to 3.5, respectively. This study identified QTLs
responsible for cooking time and some morphological traits. QTLs influencing cooking
duration were detected on chromosome 1, 2, 3, 5, 6, 9, 10, and 11. QTLs on chromosomes
3 and 10 had the highest additive effect of 27.2 towards longer cooking time and both
explained 37.7% of the phenotypic variance. The study identified genes known to control
97
polygalacturonase/pectinase, pectin methylesterase, pectinesterase inhibitor, and
galacturan 1, 4 alpha-galacturonidase enzymes to co-localize with the QTLs detected.
6.2 Introduction
The common bean crop is an important contributor to food security worldwide, it is a good
source of nourishment second only to cereals. Common bean seeds increase the protein
content of a meal, improving the quality of the diet by a factor of 50% to 70% when served
with cereals (Bressani et al., 1988; Taptue, 2018). Common bean is also a source of
vitamin C, vitamin B components such as thiamine, folate, and niacin, and essential
minerals such as iron, zinc, magnesium, and potassium (Mitova et al., 2008; Mitchell et
al., 2009).
Cooking beans is a fundamental practice of bean preparation, as it enhances their
digestibility, nutrient availability, and taste while reducing the levels of antinutrients that
could interfere with nutrient absorption (Costa et al., 2006). Cooking beans is a high-
energy demanding process due to their prolonged cooking time. The cooking time is
influenced by genetic differences, growth environment, post-harvest handling, storage
conditions such as temperature and humidity, storage time, and treatments before cooking
(Arruda et al., 2012; Kinyanjui et al., 2015). Common bean seeds that have been stored
for a while develop hard-to-cook (HTC) characteristics, which affect cooking time and
digestibility (Kinyanjui et al., 2015). It is proposed that storage of common beans at high
temperatures and relative humidity leads to the formation of insoluble pectin in the cell
wall and middle lamella that cements cells together rendering the cotyledon cells fail to
separate easily upon cooking (Jones and Boulter, 1983a; Kinyanjui et al., 2015).
DNA analysis techniques in common bean breeding programs have improved our
understanding of genetic factors controlling various traits. The discovery of next-
generation sequencing (NGS) Single Nucleotide Polymorphism (SNPs) has become more
practical in genotyping and the discovery of molecular markers (Gujaria-Verma et al.,
2016). The identified single nucleotide polymorphism (SNPs) markers for common bean
allow explorations of genetic diversity and population structure in common beans (Cichy
et al., 2015; Valdisser et al., 2016).
98
Several studies have mapped QTLs that control cooking time. A random amplified
polymorphic DNA (RAPD) marker associated with cooking time was identified using 104
recombinant inbred lines, the marker explained 23% of the variation in cooking time
(Jancinto-Hernandez et al., 2003). Garcia et al., (2012) mapped 6 QTLs that govern
cooking time on chromosomes 1 and 9 using 105 polymorphic SSR markers and 140 F2:4
recombinant inbred lines. A study conducted by Berry et al., (2020) using 146
recombinant inbred lines of common bean, 10 QTLs on chromosomes 1, 2, 3, 5, 6, 10,
and 11 were identified, with the most robust QTLs being on chromosome 3, 6, 10 and 11
that appeared in over two different environments. In a recent study, QTLs for cooking
time were identified on Pv8 and Pv10 using 242 recombinant inbred lines population
developed from a cross between Ervilha (Manteca) and PI527538 (Njano) (Bassett et al.,
2021). This study aimed at mapping Quantitative Trait Loci (QTLs) associated with the
hard-to-cook trait using F2:6 recombinant inbred lines of common bean derived from two
biparental crosses.

6.3.1 Plant material and field multiplication
Two common bean varieties GLP2 (Rosecoco type), GLPx92 (Pinto type) sourced from
Kenya Seed Company, and GBK035420 (Black type) from the National Gene Bank of
Kenya were used to develop F2:6 RILs (Table 3.1). GLPx92 contributed the hard-to-cook
(HTC) characteristic, while GLP2 and GBK035420 provided the easy-to-cook (ETC)
trait. HTC parent (pinto) was intercrossed with ETC parents (rosecoco and black) to
generate an F1 populations which were self-pollinated to produce F2 population. A random
sample of 300 F2 segregating populations were advanced using Single Seed Descent
(SSD) method in a greenhouse to produce F2:6 Recombinants Inbred Lines (RILs) for each
cross (Figure 6.1, 6.2 and 6.3).
99
Rosecoco X Pinto Pinto X Black
Figure 6.1: (a) GLP2 (Rosecoco) and GLPx92 (Pinto) their F1 and F2’s seeds, (b)
GLPx92 (pinto) and GBK035420 (black) and their F1’s and F2 seeds
RILs at 1st trifoliate stage Climbing RILs
Figure 6.2: Development of RILs in a greenhouse at Jomo Kenyatta University of

Technology
100
Rosecoco X Pinto RILs Pinto X Black RILs
Figure 6.3: Seeds from various single plants at F 3 generation from a cross between
(a) GLP2 (Rosecoco) X GLPx92 (Pinto) and (b) between GLPx92 X GBK035420
(Black)
At F6 generation the lines were multiplied in the field at the Jomo Kenyatta University of
Agriculture and Technology (JKUAT) farm. Morphological traits recorded included days
to flowering, days to maturity, number of pods per plant, pod length, number of seeds per
pod, and seed weight during field multiplication as described in section 3.3.4.
6.3.2 Incubation of seed and determination of cooking time
The storage and cooking experiment were conducted as described in section 4.3.2; and
cooking time was defined as time taken for 95% of a 100 seed sample to cook.
DNA isolation and genotyping were conducted as described in section 4.3.3.
6.3.4 Data analysis
The relationship between cooking time and the percentage of cooked bean seeds was
demonstrated with Logistic regression modelling as described by Wafula et al., (2020).
Cooking time was defined as the time corresponding to the probability of having 95% of
the bean seeds cooked (Table 6.1). Analysis of variance was performed on the obtained
cooking time using R software (version 4.0.2) at a 95% confidence interval.
101
Linkage mapping and Quantitative Trait Loci (QTL) analysis were conducted using QTL
IciMapping software version 4.0.6.0 in its default settings. SNPs markers with minor allele
frequency (MAF) < 0.05 and integrity < 0.2 were filtered out from QTLs mapping
analysis. The remaining SNPs markers were grouped based on the LOD score of 3.0.
Most SNPs markers were assigned their respective chromosomes by anchoring based on
the Phaseolus vulgaris L. genetic map (Phaseolus vulgaris 442 version 2.1) (Schmutz et
al., 2014; Goodstein et al., 2012). The loci order of each linkage group was established
using the nnTwoOpt algorithm. Rippling criteria to fine-tune the order of the
chromosomes was performed using the sum of Adjacent Recombination Frequencies
(SARF) (Meng et al., 2015). Inclusive composite interval mapping for the Additive and
Dominance QTL (ICIM-ADD) method was used in QTL analysis with map distances in
(centiMorgans, cM) calculated using the kosambi mapping function. A walking speed of
1.0 cM was used to determine the experiment-wise threshold at P≤0.05 and a LOD score
threshold of 2.5 (Meng et al., 2015).
The sequences of flanking SNPs markers of each QTL were used to identify potential
candidate genes using the BLASTn search tool in the phytozome database
(www.phytozome.net) to reveal the position of QTL in the physical map of Phaseolus
vulgaris v2.1. The genes within the QTL region were selected based on their function in
the formation of pectin in the cell wall.
6.4 Results
6.4.1 Phenotypic data
There were significant (P≤0.05) differences among RILs for all traits measured (Table
6.1, and appendix 3). Results revealed a significant (P≤0.05) moderate and positive
correlation between days to flowering and days to maturity (0.5) and between pod length
and seed weight (0.47) (Table 6.2).
102
Table 6.1: Descriptive statistics for the parents and RILs for various phenotypic traits
Parent Pinto x Rosecoco RILs Pinto x Black RILs

P- P-
Trait Pinto Rosecoco Black Mean value Min Max Mean value Min Max
CT (min) 58.0 50.3 43.9 49.4 ** 32.0 103.2 52.9 ** 30.7 90.0
DF 40.0 42.0 45.0 41.4 ** 34.0 51.0 40.0 ** 31.0 54.0
DM 92.0 84.5 90.0 87.4 ** 78.0 100.0 87.4 ** 78.0 103.0
PP 11.0 6.2 12.8 14.5 * 3.3 41.7 9.5 ** 2.5 28.7
PL 7.4 12.8 7.4 8.3 ** 6.4 10.3 9.6 * 5.7 15.5
SP 3.7 4.0 5.5 4.9 * 3.0 6.7 4.3 ** 2.3 8.5
SW 41.5 56.5 19.0 25.5 ** 8.7 54.0 36.1 ** 19.0 65.0
*, **= significant at P≤0.05 and P≤0.01 probability level, CT=Cooking time, DF=Days to flowering, Days to maturity,
PL=Pod length, SP=Seeds per pod, SW=Seed weight.
The results also revealed significant (P≤0.05) weak positive associations between
cooking time and days to flowering (0.16), days to flowering and number of seeds per pod
(0.2), days to maturity and pod length (0.12), days to maturity and number of seeds per
pod (0.11), number of pods per plant and number of seeds per pod (0.21) and between pod
length and number of seed per pod (0.27) (Table 6.2). A significant (P≤0.05) weak
negative relationship was observed between cooking time and number of pods per plant
(-0.13), number of pods per plant and pod length (-0.19), number of pods per plant and
seed weight (-0.27), and between the number of seeds pod and seed weight (-0.2) (Table
6.2).
103
Table 6.2: Pearson phenotypic correlation coefficient between various traits of RILs
CT DF DM PP PL SP SW
CT (min) 1.00
DF (days) 0.16** 1.00
DM (days) 0.08 0.52** 1.00
PP (no.) -0.13* 0.04 -0.04 1.00
PL (cm) 0.04 0.05 0.12* -0.19** 1.00
SP (no.) -0.08 0.20* 0.11* 0.21** 0.27* 1.00
SW (gms) 0.05 -0.04 0.24 -0.27** 0.47** -0.20** 1.00
*, **= significant at P≤0.05 and P≤0.01 probability level, CT=Cooking time, DF=Days to flowering, Days
to maturity, PL=Pod length, SP=Seeds per pod, SW=Seed weight
6.4.2 QTL mapping
A total of 11277 markers were found to be polymorphic out of the 35246 markers scored,
the number of polymorphic markers for each population are presented in Table 6.3. The
polymorphic markers were used to construct a linkage genetic map for the four
populations with a distance that ranged from 2513 to 3352 cM and marker density that
ranged from 0.5 to 3.5 (Table 6.4). Various QTLs were identified for days to flowering,
days to maturity, number of pods per plant, pod length, number of seeds per pod, seed
weight, and cooking time (Tables 6.5 and 6.6).
Table 6.3: Population size and number of SNP markers sequenced

Population SNP Markers Polymorphic SNP
Cross size sequenced markers
PintoXRosecoco 137 9127 3507
RosecocoXPinto 129 8913 4156
BlackxPinto 79 7102 1329
PintoxBlack 131 10104 2285
SNP=Single nucleotide polymorphism
104
Table 6.4: Linkage map of F2:6 RILs of common bean
Pinto x Rosecoco Rosecoco x Pinto Black x Pinto Pinto x Black
No. of Chr size Marker No. of Chr size Marker No. of Chr size Marker No. of Chr size Marker
Chr
markers (cM) density markers (cM) density markers (cM) density markers (cM) density
1 371.0 256.4 0.7 399.0 298.1 0.7 134.0 175.1 1.3 179.0 312.6 1.7
2 401.0 321.4 0.8 503.0 429.0 0.9 152.0 330.0 2.2 272.0 233.1 0.9
3 404.0 417.5 1.0 467.0 368.0 0.8 161.0 285.7 1.8 275.0 273.3 1.0
4 176.0 338.1 1.9 223.0 424.0 1.9 55.0 192.4 3.5 91.0 151.2 1.7
5 243.0 193.2 0.8 311.0 187.2 0.6 86.0 226.8 2.6 170.0 223.3 1.3
6 338.0 192.9 0.6 307.0 157.2 0.5 104.0 180.4 1.7 174.0 185.8 1.1
7 333.0 325.2 1.0 423.0 321.6 0.8 101.0 268.5 2.7 204.0 241.4 1.2
8 412.0 334.5 0.8 452.0 283.2 0.6 160.0 300.3 1.9 296.0 286.6 1.0
9 356.0 338.1 0.9 423.0 203.1 0.5 90.0 164.4 1.8 165.0 331.9 2.0
10 234.0 221.8 0.9 246.0 294.3 1.2 154.0 127.0 0.8 233.0 220.8 0.9
11 239.0 304.4 1.3 402.0 386.2 1.0 131.0 262.4 2.0 226.0 369.6 1.6
Chr=Chromosome
105
6.4.3 Cooking time
From the two crosses, QTLs affecting cooking time were detected on chromosomes 1, 2,
3, 5, 6, 9, 10, and 11. Three QTLs were on chromosome 1, and two QTLs were detected
on chromosomes 3 and 10, while chromosomes 2, 5, 6, 9, and 11 had one QTL each
affecting cooking time (Figures 6.3 and 6.4).
Figure 6.4: Common bean linkage map constructed using Pinto x Rosecoco F2:6 RILs,
the arrows point to locations of QTL for cooking time on chromosome
106
Figure 6.5: Common bean linkage map constructed using Pinto x Black F 2:6 RILs,
the arrows point to locations of QTL for cooking time on chromosome
The additive effect of the QTLs detected ranged from -4.2 to 27.2. QTLs that contributed
towards shorter cooking time were only detected in the cross of PintoXRosecoco. QTL on
chromosome eight that contributed most towards shorter cooking time had an additive
effect of -4.2, a LOD score of 6, and explained 16.8% of the phenotypic variance for
cooking time. QTLs with the highest additive effect contributed to the hard-to-cook trait.
QTLs on chromosomes three and ten had the highest additive effect towards longer
cooking time with a LOD score of 5.0 and 3.8, respectively, and both explained 37.7%
phenotypic variance for cooking time (Tables 6.5).
107
Table 6.5: Significant QTLs for cooking time detected using inclusive composite interval mapping for Pinto (GLPx92) X
Rosecoco (GLP2) and Pinto (GLPx92) X Black (GBK035420) F2:6 RILs
LOD PVE
Cross Type Chr Position Left marker Right marker score (%) Add
PintoXRosecoco R 1 230 3369772|F|0-15:G>A-15:G>A 3380651|F|0-45:G>C-45:G>C 3.2 8.0 -3.0
PintoXRosecoco R 2 16 3380232|F|0-6:T>C-6:T>C 13121299|F|0-23:C>G-23:C>G 3.3 21.4 10.0
PintoXRosecoco R 6 30 3381145|F|0-24:T>A-24:T>A 3378882|F|0-16:T>C-16:T>C 3.9 9.4 3.2
RosecocoXPinto R 3 277 3373798|F|0-56:C>G-56:C>G 8198235|F|0-24:T>C-24:T>C 6.0 13.8 3.8
RosecocoXPinto R 5 29 3377170|F|0-7:C>T-7:C>T 3365727|F|0-33:T>C-33:T>C 3.8 17.5 4.4
RosecocoXPinto R 10 189 3365755|F|0-41:C>A-41:C>A 3377779|F|0-55:G>C-55:G>C 6.5 14.1 4.1
BlackXPinto R 1 92 3379442|F|0-64:A>G-64:A>G 8202872|F|0-22:G>A-22:G>A 3.9 38.6 19.6
BlackXPinto R 3 256 3377474|F|0-24:C>T-24:C>T 13122417|F|0-6:T>A-6:T>A 5.0 37.7 27.2
BlackXPinto R 9 133 3382186|F|0-32:G>A-32:G>A 3377625|F|0-15:T>C-15:T>C 5.7 38.8 17.8
PintoXBlack R 1 21 8214403|F|0-30:C>T-30:C>T 8198338|F|0-64:A>T-64:A>T 4.0 28.3 12.0
PintoXBlack R 11 243 100052374|F|0-6:T>C-6:T>C 100052136|F|0-16:C>T-16:C>T 4.4 33.0 6.9
BlackXPinto R 10 15 3382815|F|0-17:G>A-17:G>A 3383861|F|0-67:G>A-67:G>A 3.8 37.7 27.1
PintoXRosecoco C 2 218 3383226|F|0-59:T>C-59:T>C 3378069|F|0-44:T>G-44:T>G 2.7 3.0 -1.8
PintoXRosecoco C 3 236 3382182|F|0-44:T>C-44:T>C 3382093|F|0-58:T>A-58:T>A 3.0 3.4 1.9
PintoXRosecoco C 5 125 3381095|F|0-11:A>G-11:A>G 3377582|F|0-21:A>G-21:A>G 5.8 14.2 -3.9
PintoXRosecoco C 8 43 3378448|F|0-17:A>T-17:A>T 3381609|F|0-25:C>T-25:C>T 6.0 16.8 -4.2
PintoXBlack C 1 126 8669561|F|0-16:C>T-16:C>T 3379475|F|0-52:T>C-52:T>C 4.6 8.9 6.2
PintoXBlack C 8 87 3380849|F|0-46:A>G-46:A>G 3384254|F|0-57:A>T-57:A>T 3.1 5.6 2.3
PintoXBlack C 9 18 3381479|F|0-62:C>T-62:C>T 8200928|F|0-43:C>A-43:C>A 3.1 5.8 2.4
PintoXBlack C 9 35 8215841|F|0-30:A>G-30:A>G 3382186|F|0-32:G>A-32:G>A 3.3 26.2 12.1
PintoXBlack C 9 39 3382186|F|0-32:G>A-32:G>A 3377625|F|0-15:T>C-15:T>C 4.1 26.2 12.3
Chr=Chromosome, PVE=Phenotypic variance explained, Add=Additive effect, LOD=Log of odds, CT=Cooking time, R= RILs from population of individual
reciprocal cross, C=RILs where reciprocals were combined.
108
6.4.4 Days to flowering and maturity
In total, seventeen QTLs affecting days to flowering were detected from the two crosses,
and most of them (15) were detected in RILs from the cross-involving pinto and rosecoco.
QTLs for days to flowering were on chromosomes 1, 2, 3, 5, 7, 8, 9, and 11, with
chromosome one having the highest number (6) of QTLs for days to flowering. QTLs
detected had a LOD score ranging from 2.9 to 30.6 and explained phenotypic variance in
the range of 4.3 to 40.5, the additive effect of these QTLs ranged from -2.3 to 4.2. Two
QTLs with the highest contribution towards early and late flowering were on chromosome
one. QTL with an additive effect (-2.3) towards early flowering had a LOD score of 18.0
and explained 37.5% of the phenotypic variance. On the other hand, QTLs with the highest
positive additive effect had a LOD score of 6.7 and explained 24.4% of the phenotypic
variance (Tables 6.6). The region with QTL with the highest additive effect on late-
flowering was also detected in the genome-wide association study (GWAS) in section
4.4.5.
We detected eleven QTLs that influenced duration to maturity, the majority (7) of them
were in RILs derived from the cross of pinto x rosecoco. The QTLs were detected on
chromosomes 1, 2, 3, 4, 7, 8, 10, and 11. Seven of these QTLs contributed toward early
maturity with an additive effect that ranged from -1.1 to -2.2. The QTL that contributed
most to early maturing (-2.2) was found on chromosome one with a LOD score of 12.1
and explained 17.6% of the phenotypic variance. QTLs with the highest (3.3) positive
additive effect was detected on chromosome nine with a LOD score of 3.3 and explained
15.3% of the phenotypic variance (Table 6.6).
109
Table 6.6: Significant QTLs for days to flowering and days to flowering detected using inclusive composite interval mapping for
Pinto (GLPx92) X Rosecoco (GLP2) and Pinto (GLPx92) X Black (GBK035420) F2:6 RILs
LOD PVE
Cross Trait Chr Position Left marker Right marker score (%) Add
PintoXRosecoco DF 1 42 8214729|F|0-29:A>G-29:A>G 100042247|F|0-52:G>T-52:G>T 9.6 8.2 1.2
PintoXRosecoco DF 1 48 8208744|F|0-19:C>T-19:C>T 3380734|F|0-38:G>A-38:G>A 6.7 5.2 1.0
PintoXRosecoco DF 1 165 3377876|F|0-30:A>C-30:A>C 3382650|F|0-43:G>A-43:G>A 30.6 40.5 2.7
PintoXRosecoco DF 2 234 8198597|F|0-15:T>G-15:T>G 3377263|F|0-22:G>C-22:G>C 4.3 4.3 -0.9
PintoXRosecoco DF 5 186 3365766|F|0-14:T>C-14:T>C 3367185|F|0-53:G>A-53:G>A 2.9 6.2 -1.0
PintoXRosecoco DF 8 118 3378175|F|0-46:T>G-46:T>G 3384226|F|0-45:G>A-45:G>A 6.3 11.4 1.4
PintoXRosecoco DF 9 288 3377566|F|0-12:C>G-12:C>G 3366375|F|0-37:T>C-37:T>C 8.1 8.6 1.2
PintoXRosecoco DF 11 270 16646762|F|0-26:T>C-26:T>C 8210375|F|0-19:G>A-19:G>A 12.7 11.8 -1.5
RosecocoXpinto DF 1 46 3378970|F|0-9:C>T-9:C>T 3381677|F|0-26:C>G-26:C>G 3.3 3.7 -0.7
RosecocoXpinto DF 1 194 3383103|F|0-22:C>G-22:C>G 8213730|F|0-21:G>A-21:G>A 18.0 37.5 -2.3
RosecocoXpinto DF 3 277 3373798|F|0-56:C>G-56:C>G 8198235|F|0-24:T>C-24:T>C 3.2 3.5 0.7
RosecocoXpinto DF 5 74 8211088|F|0-29:A>G-29:A>G 3381994|F|0-45:G>C-45:G>C 3.9 6.5 2.7
RosecocoXpinto DF 7 1 13122512|F|0-38:G>C-38:G>C 100051674|F|0-17:G>A-17:G>A 16.2 22.2 1.8
RosecocoXpinto DF 7 150 16646999|F|0-5:T>C-5:T>C 3378944|F|0-45:C>T-45:C>T 3.2 7.9 1.1
RosecocoXpinto DF 9 181 8207343|F|0-60:T>A-60:T>A 8209966|F|0-27:A>G-27:A>G 3.2 3.8 -0.7
BlackXPinto DF 2 52 100051993|F|0-12:G>A-12:G>A 100045876|F|0-40:A>G-40:A>G 2.9 20.6 -1.4
PintoXBlack DF 8 4 100045132|F|0-46:A>T-46:A>T 3370680|F|0-21:C>T-21:C>T 3.0 7.7 1.0
PintoXBlack DF 1 21 8214403|F|0-30:C>T-30:C>T 8198338|F|0-64:A>T-64:A>T 6.7 24.4 4.2
PintoXRosecoco DM 1 198 3381013|F|0-65:T>C-65:T>C 8200984|F|0-48:A>T-48:A>T 12.1 17.6 -2.2
PintoXRosecoco DM 3 276 8198780|F|0-17:C>G-17:C>G 100051248|F|0-28:C>T-28:C>T 3.2 4.5 -1.1
PintoXRosecoco DM 4 251 100027868|F|0-27:C>T-27:C>T 13122574|F|0-38:A>G-38:A>G 2.9 3.3 0.9
PintoXRosecoco DM 7 196 3378670|F|0-18:T>A-18:T>A 3381830|F|0-48:C>T-48:C>T 6.8 9.8 1.6
PintoXRosecoco DM 8 55 3378594|F|0-55:T>C-55:T>C 3371535|F|0-27:C>T-27:C>T 4.2 5.4 -1.2
PintoXRosecoco DM 10 151 8215179|F|0-27:T>G-27:T>G 8213716|F|0-42:A>G-42:A>G 5.4 6.6 1.4
PintoXRosecoco DM 11 207 100042431|F|0-24:C>T-24:C>T 100075102|F|0-9:T>C-9:T>C 8.5 11.1 -1.8
RosecocoXpinto DM 1 193 3378093|F|0-35:C>T-35:C>T 8215758|F|0-28:T>C-28:T>C 7.1 23.9 2.6
RosecocoXpinto DM 2 315 8212471|F|0-56:G>A-56:G>A 3384276|F|0-35:C>G-35:C>G 3.5 10.3 -1.7
110
LOD PVE
RosecocoXpinto DM 9 28 3379459|F|0-65:G>A-65:G>A 3379459|F|0-44:T>G-44:T>G 3.3 15.3 3.3
PintoXBlack DM 3 68 8215537|F|0-49:G>T-49:G>T 3380638|F|0-9:A>G-9:A>G 3.0 13.6 -1.6
Chr=Chromosome, PVE=Phenotypic variance explained, Add=Additive effect, LOD=Log of odds, DF=Days to flowering, Days to maturity.
111
6.4.5 Number of pods per plant and pod length
QTLs detected to control the number of pods per plant were five in total located on
chromosomes 2, 4, and 6. Four of these QTLs contributed toward a higher number of pods
per plant in the range of 1.8 to 8.7. QTLs on chromosome six had a negative additive
effect of -3.4 and -1.3. QTLs with the highest positive additive effect of 8.7 was found on
chromosome four with a LOD score of 4.8 and explained 25.6% of the phenotypic
variance (Table 6.7).
A total of eight QTLs affecting pod length were detected on chromosomes 2, 3, 7, 8, 10,
and 11. Six of these QTLs had a positive additive effect ranging from 0.3 to 0.6, while the
rest had a negative additive effect of -0.4 to -0.5. The QTLs with the highest contribution
towards longer pods were found on chromosome seven, with a LOD score of 6.9, and
explained 19.4% of the phenotypic variance. On the other hand, the QTL that contributed
most to shorter pods was detected on chromosome ten with a LOD score of 2.8 and
explained 11.2% of the phenotypic variance of pod length (Tables 6.7).
112
Table 6.7: Significant QTLs for number of pods per plant and pod length detected using inclusive composite interval mapping
for Pinto (GLPx92) X Rosecoco (GLP2) and Pinto (GLPx92) X Black (GBK035420) F2:6 RILs
LOD PVE
PintoXRosecoco PP 2 121 100027117|F|0-24:G>A-24:G>A 13122120|F|0-29:T>C-29:T>C 2.6 18.8 2.5
PintoXRosecoco PP 6 134 3384331|F|0-44:T>A-44:T>A 3370745|F|0-5:T>A-5:T>A 2.6 8.4 -1.3
RosecocoXpinto PP 2 13 3379962|F|0-20:T>G-20:T>G 3366452|F|0-28:A>G-28:A>G 5.5 18.9 1.8
BlackXPinto PP 6 89 8200710|F|0-22:A>G-22:A>G 3383514|F|0-39:A>G-39:A>G 2.8 40.9 -3.4
PintoXBlack PP 4 55 100050314|F|0-30:A>G-30:A>G 100047639|F|0-26:T>A-26:T>A 4.8 25.6 8.7
PintoXRosecoco PL 3 108 3378047|F|0-31:G>A-31:G>A 8211763|F|0-5:A>G-5:A>G 4.3 8.8 0.5
RosecocoXpinto PL 2 251 100035053|F|0-45:A>G-45:A>G 3383135|F|0-59:G>C-59:G>C 3.3 8.0 -0.4
RosecocoXpinto PL 7 86 100036259|F|0-29:T>G-29:T>G 3379840|F|0-28:C>A-28:C>A 6.9 19.4 0.6
RosecocoXpinto PL 10 151 100084370|F|0-68:T>C-68:T>C 8216613|F|0-45:G>C-45:G>C 2.8 11.2 -0.5
BlackXPinto PL 8 73 3377109|F|0-54:C>T-54:C>T 3380605|F|0-10:A>G-10:A>G 2.5 29.1 0.5
BlackXPinto PL 11 207 3380363|F|0-29:G>A-29:G>A 8209950|F|0-19:T>A-19:T>A 2.7 22.4 0.4
PintoXBlack PL 2 53 3377989|F|0-43:T>A-43:T>A 8206626|F|0-65:A>G-65:A>G 9.4 27.7 0.4
PintoXBlack PL 11 175 3382513|F|0-19:T>A-19:T>A 8215619|F|0-50:A>T-50:A>T 4.7 16.3 0.3
PVE=Phenotypic variance explained, Add=Additive effect, LOD=Log of odds, CT=Cooking time, PP=number of pods per plant, PL=Pod length.
113
6.4.6 Number of seeds per pod and seed weight
QTLs detected to affect the number of seeds per pod were five in total and were on
chromosomes 1, 8, and 10. Three QTLs found on chromosomes 1, 8, and 10 contributed
towards more seeds per pod with an additive effect of 0.2 to 1.3, while two QTLs found
on chromosome 10 contributed toward fewer seeds per pod with both having an additive
effect of (-0.4). QTLs on chromosome one had the highest additive effect (1.3) with a
LOD score of 2.5 and explained 17.3% of the phenotypic variance of the number of seeds
per pod (Tables 6.8).
In total, 10 QTLs affecting seed weight were detected on chromosomes 1, 5, 6, 7, 9, and
11. The majority (13) of the QTLs for seed weight were detected in RILs from the cross-
involving pinto and black (Tables 6.8). Six of these QTLs contributed toward low seed
weight with a negative additive effect ranging from -2.5 to -0.4. The rest had a positive
additive effect that ranged from 1.3 to 7.2. The QTLs which contributed most to more
seed weight were on chromosome nine with a LOD score of 3.8 and explained 8.8% of
the phenotypic variance. QTLs that had the highest effect towards less seed weight were
on chromosome one with a LOD score of 4.4 and explained 9.2% of the phenotypic
variation in seed weight (Tables 6.8).
114
Table 6.8: Significant QTLs for number of seeds per pod and seed weight detected using inclusive composite interval mapping
for Pinto (GLPx92) X Rosecoco (GLP2) and Pinto (GLPx92) X Black (GBK035420) F2:6 RILs
LOD PVE
PintoXRosecoco SP 10 37 3375452|F|0-32:C>A-32:C>A 3377795|F|0-13:G>A-13:G>A 3.0 17.3 -0.4
RosecocoXpinto SP 1 181 100052110|F|0-16:G>A-16:G>A 3378280|F|0-49:A>G-49:A>G 2.5 17.3 1.3
RosecocoXpinto SP 10 151 100084370|F|0-68:T>C-68:T>C 8216613|F|0-45:G>C-45:G>C 3.5 18.1 -0.4
PintoXBlack SP 8 240 100033278|F|0-24:C>A-24:C>A 100046319|F|0-27:T>C-27:T>C 5.3 17.8 0.3
PintoXBlack SP 10 48 3382802|F|0-10:A>T-10:A>T 100031864|F|0-56:G>T-56:G>T 2.8 9.9 0.2
PintoXRosecoco SW 5 110 3365598|F|0-34:T>G-34:T>G 3378671|F|0-39:C>T-39:C>T 3.4 3.9 2.0
PintoXRosecoco SW 9 116 3382317|F|0-31:A>G-31:A>G 3384285|F|0-55:A>C-55:A>C 2.8 6.5 -2.1
PintoXRosecoco SW 9 172 3381643|F|0-47:C>T-47:C>T 3381371|F|0-8:A>C-8:A>C 2.6 3.1 1.4
BlackXPinto SW 7 129 3384098|F|0-23:C>T-23:C>T 3384303|F|0-57:C>G-57:C>G 2.5 15.4 -1.7
PintoXBlack SW 1 215 8214289|F|0-18:G>A-18:G>A 3382934|F|0-49:A>G-49:A>G 4.7 10.6 -1.6
PintoXBlack SW 6 185 100031585|F|0-22:G>T-22:G>T 100031452|F|0-6:C>A-6:C>A 2.7 6.2 -1.2
PintoXBlack SW 9 242 3377682|F|0-11:G>A-11:G>A 8196251|F|0-26:A>G-26:A>G 3.8 8.8 7.2
PintoXBlack SW 11 174 3369798|F|0-10:G>A-10:G>A 3382513|F|0-18:C>T-18:C>T 6.3 16.2 -1.9
PintoXBlack SW 11 305 16649721|F|0-25:T>A-25:T>A 3383217|F|0-7:T>C-7:T>C 5.5 15.7 1.9
RosecocoXpinto SW 1 45 100058942|F|0-48:T>C-48:T>C 3383292|F|0-60:T>A-60:T>A 4.4 9.2 -2.5
PVE=Phenotypic variance explained, Add=Additive effect, LOD=Log of odds, SP=Seeds per pod, SW=Seed weight.
115
6.5 Discussion
The results showed significant (P≤0.05) differences among RILs for all the traits
recorded, which indicates that there existed genetic variability for the traits in the
population. The study ended up with an unequal number of RILs due to root rot
diseases during the final multiplication of seeds in the field (Table 6.3). The correlation
analysis result shows a significant (P≤0.05) moderate positive correlation between
duration to flowering and duration to maturity indicating that the two traits might be
under the influence of the same genes. This suggests that duration to flowering can be
used to predict duration to maturity and both can be selected simultaneously (Lobo,
2008). Duration to flowering is under the control of a lower dominance and a higher
additive gene effect (Mendes et al., 2008). When the dominance effect is present it
reduces the number of days to flowering. A high correlation of 0.7 between days to
flowering and days to maturity has been reported in a previous study conducted by
Kamfwa et al., (2015). Days to flowering has been reported in various studies to be
highly associated with days to maturity (Okii et al., 2014; Kamfwa et al., 2015). Seed
weight is used as a proxy of seed size, a significant correlation of 0.47 between pod
length and 100-seed weight suggests that large-seeded genotypes tend to have longer
pods. Okii et al., (2014) reported a similar correlation result (0.48) between a 100-seed
weight and pod length.
The formation of insoluble pectates at the cell wall and middle lamella is believed to
be the cause of HTC in common bean (Shomer et al., 1990; Hentges et al., 1990).
Pectin comprises complex acid polysaccharides with a backbone of galacturonic acid
residue with an alpha-1,4-glycosidic linkage (Atkinson et al., 2002).
Homogalacturonan-rich pectin is commonly found in the middle lamella region of
plant cell walls where two cells border (Atkinson et al., 2002). At high temperatures
and relative humidity, pectin methylesterase (PME) hydrolyses pectin molecules
forming pectic acid and methanol. The magnesium and calcium released in the cells
migrate to the middle lamella and produce an insoluble magnesium pectinate and
calcium pectinate that cements cells together hardening the cell wall (Jones and
Boulter, 1983a).
This study revealed two major QTLs on chromosomes 3 and 10 with the highest
additive effect and explained the highest phenotypic variation in cooking time. The
116
region on chromosome 10 with the QTL for cooking time, was also detected in the
genome wide study discussed in chapter 4. The QTL was at 15 cM on the linkage map
and around 3968311 to 11971124 bp on the physical map. The QTL co-localized with
12 genes related to the formation of pectin at the cell wall, six genes encoded enzyme
polygalacturonase/pectinase, three for pectin methylesterase, two genes for
pectinesterase inhibitor, and one gene for galacturan 1, 4 alpha-galacturonidase. The
co-localization of these loci with the identified QTLs supports the theory of insoluble
pectin at the cell wall and middle lamella as the cause of hard-to-cook trait. However,
there were no candidate genes related to the formation of pectin in the cell walls found
within the QTL region on chromosome three. QTL for the cooking time on
chromosome nine at position 133 cM on the linkage map had an additive effect of 17.8
and was located around 23833662 to 25258872 bp in the physical map. The region
contained six genes encoding pectinesterase inhibitor, one gene for pectinesterase, and
one gene related to the pectate lyase family.
Another region with QTL for the cooking time detected on chromosome one at 92 cM
on the linkage map had an additive effect of 19.6. The QTL region was at 34267322
to 33304000 bp on the physical map and co-localized with two genes for
polygalacturonase, one gene for polygalacturonase inhibitor, and one gene for
pectinesterase.
Using the flanking markers to locate the QTL on the physical map for the cooking time
on chromosome one at 21 cM, the region was located at 42975691 to 51047749 bp.
The region had nine genes for pectin methylesterase inhibitor, three genes for pectin
methylesterase, three genes for pectate lyase, one gene for polygalacturonase, and one
gene for alpha-galactosidase.
In total, 52 candidate genes that play a role in the formation of pectin co-localized with
QTLs for cooking time with an additive effect of ten and above. Pectinase and
polygalacturonase enzymes are used to break down the pectin compound found in
plant cell walls particularly, middle lamella to extract cell sap (Phutela et al., 2005).
This study supports the theory of the formation of insoluble pectin at the cell wall and
middle lamella as the cause of HTC.
Several studies have reported QTLs that control cooking time. Jacinto-Hernandez et
al., (2003) reported a random amplified polymorphic DNA (RAPD) marker associated
117
with the cooking time that explained 23% of the variation in cooking time using 104
RILs. Six QTLs that govern cooking time were reported on chromosomes 1 and 9
using 105 polymorphic SSR markers and 140 F2:4 RILs (Garcia et al., 2012).
Significant SNPs markers associated with cooking time were identified on
chromosomes 2, 3, and 6 using GWAS on 206 common bean accessions, the SNPs
explained between 4 to 8.7% of the phenotypic variation (Cichy et al., 2015). Berry et
al., (2020) identified 10 QTLs on chromosomes 1, 2, 3, 5, 6, 10, and 11, with the most
robust QTLs being on chromosomes 3, 6, 10, and 11 detected in over two different
environments using 146 RILs of common bean.
A transcript locus for phytochrome interacting factor and agamous-like MADS-box
loci have been reported to control plant development (Li et al., 2017). Agamous-like
MADS-box transcript Phvul.001G186400.1 was located within the area of the
identified QTL for days to flowering on chromosome one at 21 cM that had the highest
negative additive effect (-2.3) and was in the region 43921483 to 44604321 bp on the
physical genetic map. Results show a cluster of QTLs with a positive additive effect
for days to flowering on chromosome one. Four loci that may play a role in flowering
were also found within the QTL region with the highest positive additive defect (4.2)
on chromosome one at 194 cM, located around 42975691 to 51047749 bp on the
physical map. Loci found in this region include two genes encoding for phytochrome
interacting transcription factor, one for growth regulator factor and one for agamous-
like box protein.
MADS-box loci also known as MICK-type genes have been reported to control various
plant development processes like vegetative growth and reproductive organ
development (Adamczyk and Fernandez, 2009). Phytochrome-interacting factors are
basic helix-loop-helix transcription factors that play critical roles in the germination of
seeds, photomorphogenesis, responses to shading, flowering time, and leaf senescence
(Sakuraba et al., 2014; Shi et al., 2018). However, Phytochrome-interacting loci were
not found in the QTL regions detected in this study. QTLs for the duration to flowering
on chromosome one had been reported in previous studies by Koinange et al., (1996),
Blair et al., (2006b), Perez-Vega et al., (2010), Mukeshimana et al., (2014), Kamfwa
et al., (2015) and Langat et al., (2019). Other QTLs have been reported on
chromosome four by Mukeshimana et al., (2014) and Langat et al., (2019), on
118
chromosome eight by Koinange et al., (1996), Perez-Vega et al., (2010), Kamfwa et
al., (2015), and Briñez et al., (2017).
The search for candidate genes within the QTL with high negative (-2.2) and positive
(3.3) additive effects on duration to maturity located on chromosomes one and nine,
respectively, showed no gene of interest. Agamous-like transcript
Phvul.001G186400.1 co-localized with the QTL with an additive effect of 2.6 on
chromosome one for the duration to maturity located at 193 cM on the linkage map
and 44386397 to 44809486 bp on the physical map. Langat et al., (2019) reported a
QTL for the duration to maturity that co-localized with QTL for the duration to
flowering on chromosome one. QTLs for the duration to maturity have been reported
on chromosome four (Mukeshimana et al., 2014; Langat et al., 2019), chromosome
seven (Mukeshimana et al., 2014), and chromosome nine (Mukeshimana et al., 2014;
Kamfwa et al., (2015).
The number of pods per plant is a primary yield component and part of the accumulated
aerial biomass partitioned to seed yield (Negahi et al., 2014). A significant (P≤0.05)
strong and positive correlation between grain yield and the number of pods per plant
has been reported (Langat et al., 2019). Five QTLs for the number of pods per plant
were identified in this study, QTLs with the highest positive additive effect of 8.7 was
found on chromosome four. QTLs for the number of pods per plant have been
identified in previous studies using different methods and populations. QTL
controlling the number of pods per plant was reported by Koinange et al., (1996) on
Pv01 and Pv08 in a population of 65 F8 RILs developed from a cross of Mildas and
G12873. Blair et al., (2006b) reported a QTL of the same trait on Pv07, Pv09, and
Pv11 in an inbred backcross population of 157 BC2 F3:5 from a cross between ICA
Cerinza and G24404. Tar’an et al., (2002) mapped a QTL for the number of pods per
plant on Pv02 using 145 F4:5 RILs from a cross of OAC Seaforth and OAC 95-4 navy
bean. Kamfwa et al., (2015) identified QTL for the number of pods per plant on Pv03
and Pv09 using 237 genotypes.
Pod length is a measure of the size of the harvested part of French beans, consumers
prefer straight, rounded pods with a length ranging from 10 to 16 cm depending on the
grade of the harvested pods (Wahome et al., 2013). A total of eight QTLs affecting
pod length were detected, six of these QTLs had a positive additive effect ranging from
119
0.3 to 0.6. The QTLs with the highest contribution towards longer pods were found on
chromosome seven. This study and others have shown that pod length is also positively
correlated with seed weight (Okii et al., 2014), suggesting that the genes controlling
these two traits are linked.
The number of seeds per pod is one of the primary seed yield components (Ghobary
and Allah, 2010; Negahi et al., 2014), high yielding varieties have a higher number of
seeds per pod (Ashango and Alamerew, 2017). A total of five QTLs on chromosomes
1, 8, and 10 were detected in this study. Three of these QTLs contributed toward more
seeds per pod with QTLs on chromosome one having the highest additive effect. QTLs
for the number of seeds per pod have been reported on chromosome 2 (Langat et al.,
2019), chromosomes 6 and 7 (Briñez et al., 2017), and chromosome 8 (Briñez et al.,
2017; Langat et al., 2019).
Seed weight quantifies the size of the seeds, and it is one of the first-order yield
components (Negahi et al., 2014). The Andean gene pool is generally large-seeded
and adapted to relatively higher altitudes and lower temperatures, on the other hand,
the Mesoamerican gene pool is small-seeded and adapted to lower altitudes and higher
temperatures (Beebe et al., 2011). Ten QTLs affecting seed weight were detected on
chromosomes in this study. Six of these QTLs contributed toward low seed weight,
while the rest had a positive additive effect. The QTL which contributed most to higher
seed weight was detected on chromosome nine while QTL with the highest effect
towards less seed weight was on chromosome one. Several QTLs for seed weight have
been mapped in previous studies on chromosome one (Koinange et al., 1996;
Broughton et al., 2003; Briñez et al., 2017), chromosome five (Briñez et al., 2017), on
chromosome seven (Koinange et al., 1996; Mukeshimana et al., 2014), on
chromosome eight (Langat et al., 2019) and chromosome eleven (Koinange et al.,
1996).
6.6 Conclusion
The study identified QTLs affecting cooking time and various morphological traits of
common bean using F2:6 recombinant inbred lines of common bean derived from two
biparental crosses. QTLs associated with days to flowering, days to maturity, number
of pods per plant, pod length, number of seed per pod and seed weight were detected.
120
Agamous-like MADS-box transcripts like Phvul.001G186400.1 locus co-localized
with QTLs for days to flowering and maturity. QTLs controlling cooking duration
were detected on chromosomes 1, 2, 3, 5, 6, 9, 10, and 11, with chromosomes one and
two having more than one QTL. QTLs on chromosomes three and ten had the highest
additive effect of 27.2 towards longer cooking time and both explained 37.7% of the
phenotypic variance. The study identified gene transcripts in the QTLs regions in the
genome known to control enzymes involved in the formation and breakdown of pectin
in plant cell walls. The genes found to co-localize with the detected QTLs for cooking
time encodes for polygalacturonase/pectinase, pectin methylesterase, pectinesterase
inhibitor, and galacturan 1, 4 alpha-galacturonidase enzymes. Therefore, this study
points towards the theory of the formation of insoluble pectin as the cause of the HTC
trait. The identified QTLs could be useful in the introgression of cooking time traits
and implementation of MAS in common bean breeding.
121
CHAPTER SEVEN
CONCLUSION AND RECOMMENDATIONS
7.1 General conclusion
Common bean plays a critical role in the nutrition security of a large population as a
vital source of protein in third-world countries and the diet of vegetarians. Identifying
genomic regions that control the cooking time of grains and traits of agronomic
importance of common bean is crucial to aid plant breeding efforts to improve the
crop. Further, understanding the inheritance of these traits in common bean would
assist breeders to choose an appropriate breeding method. This study evaluated the
cooking time of fresh and aged seeds, duration to flowering and maturity, number of
pods per plant, pod length, number of seeds per pod, seed weight, and seed yield of
common bean through phenotyping and genotyping.
This study characterized and genotyped a population of common bean accessions and
F2:6 recombinant inbred lines (RILs) and identified easy-to-cook genotypes and
quantitative trait loci (QTLs) associated with the cooking time, duration to flowering
and maturity, number of pods per plant, pod length, number of seeds per pod, seed
weight and seed yield. Significant variation existed among the common bean
accessions and RILs evaluated for all the traits recorded. Traits that showed high broad
sense heritability (H2) included days to flowering, 100-seed weight and grain yield.
Large-seeded accessions, climbing accessions, and popular seed classes (pinto, calima,
small reds, and purples) had higher yields. The study found that storage of common
grains at temperature of 35°C and relative humidity of 50% significantly increased
cooking time by an average of 14.1 minutes.
Genome wide association study (GWAS) identified a total of 33 SNPs markers
significantly associated with days to flowering, days to maturity, number of pods per
plant, pod length, number of seed per pod, seed weight and yield. Two SNPs markers
were also found to be significantly (P≤0.05) associated with cooking time of aged
seeds. The association between trait and marker was found to be influenced by
seasonal changes.
QTL analysis study identified various QTLs associated with days to flowering, days
to maturity, number of pods per plant, pod length, number of seed per pod and seed
weight. The genomic regions on chromosome one with QTLs for the days to flowering
122
and chromosome 10 for the cooking time were detected on both GWAS and QTL
analyses studies.
The study found that agamous-like MADS-box transcript (Phvul.001G186400.1) loci
co-localized with QTL for days to flowering and maturity, while galacturan 1,4-alpha
galacturonidase (Phvul.010G038000) and polygalacturonase (Phvul.010G038100)
loci co-localized with the QTL for cooking time. Other loci found to co-localize with
the detected QTLs for cooking time include pectin methylesterase, pectinesterase
inhibitor, and galacturan. These enzymes are involved in the formation and breakdown
of pectin in the plant cell wall responsible for the development of the hard-to-cook
trait. The findings of the GWAS and QTL analysis support the theory of the formation
of insoluble pectin in the cell wall and middle lamella as the cause of the HTC trait.
Common bean accessions evaluated in this study showed heritable variation that can
be exploited to improve common bean in breeding programs. QTLs identified could
be useful by enabling marker-assisted selection (MAS) in breeding of common bean
breeding.
7.2 Recommendations
Common bean accessions evaluated in this study showed heritable variation that can
be exploited to improve common beans in breeding programs. The identified accession
with shorter cooking time and higher yields can be evaluated in different locations to
determine their adaptability and stability of their performance in yield.
Higher yields were recorded for large-seeded accessions, climbing accessions, and
popular (pinto, calima, small reds, and purples) seed classes. Farmers with small pieces
of land could be encouraged to grow popular climbing common bean varieties to
increase the productivity.
The identified quantitative trait loci (QTLs) for cooking time require further
investigations to identify their robustness under different environment, storage
conditions and with common bean of different genetic backgrounds. A replication of
the GWAS study is recommended using cooking time of accessions grown in different
locations to evaluate the robustness of the QTL regions identified. Further
investigation using linkage study using recombinant inbred lines (RILs) developed
from Easy-to-cook (ETC) and hard-to-cook (HTC) accessions identified in this study
123
as the parents. A combination of differential expression-based study and QTL mapping
to identify the candidate gene would improve the precision in pursuit of candidate
genes.
The identified molecular markers can be used in developing varieties with desirable
traits through markers-assisted selection (MAS), and the identified potential candidate
genes can be utilized in breeding programs to improve the cooking quality of the
common bean.
124
REFERENCES
Adamczyk, B., & Fernandez, D. E. (2009). MIKC* MADS domain heterodimers are
required for pollen maturation and tube growth in Arabidopsis. Plant Physiology,
149:1713–1723. https://doi.org/10.1104/pp.109.135806
Agriculture and Food authority (2022). Year book of statistics 2022. 141 pages.
Retrieved from the link https://www.agricultureauthority.go.ke › index.php
Akinyele, I. O., Onigbinde, A. O., Hussain, M. A., & Omololu, A. (1986).
Physicochemical characteristics of 18 cultivars of Nigerian cowpeas (V.
unguiculata) and their cooking properties. Journal of Food Science, 51, 1483-
1485. https://doi.org/10.1111/j.1365-2621.1986.tb13840.x
Alexandre, A., & Oliveira, S. (2012). Response to temperature stress in rhizobia.
Critical reviews in microbiology, 39. DOI. 10.3109/1040841X.2012.702097
Amanullah, Khan, A. A., Nawab, K., & Sohail, Q. (2006). Performance of promising
common bean (Phaseolus vulgaris L.) germplasm at Kala-Swat. Pakistan Journal
of Biological Sciences, 9(14):2642-2646. https://doi.org/10.3923/pjbs.2006.
2642.2646
Andrés, F., & Coupland, G. (2012). The genetic basis of flowering responses to
seasonal cues. Nature Reviews Genetics, 13(9):627–639.
https://doi.org/10.1038/nrg3291
Angioi, S. A., Rau, D., Nanni, l., Attene, G., & Bellucci, E. (2010). Beans in Europe:
origin and structure of the European landraces of Phaseolus vulgaris L. Theoretical
and Applied Genetics, 121:829–843. doi 10.1007/s00122-010-1353-2
Anonimo (1982). Morphology of the common bean plant study guide to be used as a
complement to the tutorial unit. CIAT, Cali Colombia, 50 pages.
Anunda, H. N., Nyaboga, E.N., & Amugune, N. O. (2019). Evaluation of genetic
variability, heritability, genetic advance and correlation for agronomic and yield
components in common bean landraces from southwestern Kenya. Journal of
Plant Breeding and Crop Science, 11(5):144-147. https://doi.org/10.5897/jpbcs
2018.0800
Arruda, B., Altamir, F., Jerfferson, L., & Jaqueline, B. (2012). Environment is crucial
to the cooking time of beans. Ciencia e Tecnologia de Alimentos, 110:573-578
https://doi.org/10.1590/s0101-20612012005000078
125
Ashango, Z., & Alamerew, S. (2017). Seed yield and its related traits performance of
common bean (Phaseolus vulgaris L.) varieties in Dawro zone, southwest
Ethiopia. Advances in Life Science and Technology, 53:24-35. Retrieved from
https://api.semanticscholar.org/CorpusID:56325410
Atkinson, R., Schroder, R., Hallett, C., Cohen, D., & Macke, E. (2002).
Overexpression of polygalacturonase in transgenic apples tress leads to a range of
novel phenotypes involving changes in adhesion. Plant Physiology, 129(1):122-
133. doi: 10.1104/pp.010986
Bassett, A., Katuuramu, D. N., Song, Q., & Cichy, K. (2021). QTL mapping of seed
quality traits including cooking time, flavor, and texture in a yellow dry bean
(Phaseolus vulgaris l.) population. Frontier in Plant Science, 12:670284. doi:
10.3389/fpls.2021.670284
Beattie, A. D., Larsen, J., Michaels, T. E., & Pauls, K. P. (2003). Mapping quantitative
trait loci for a common bean (Phaseolus vulgaris L.) ideo-type. Genome,
46(3):411-422. https://doi.org/10.1139/g03-015
Beebe, S. (2012). Common bean breeding in tropics. Plant Breeding Reviews, Pages
357-426. https://doi.org/10.1002/9781118358566.ch5
Beebe, S., Ramirez, J., Jarvis, A., Rao, I., & Mosquera, G. (2011). Genetic
improvement of common beans and the challenge of climate change. In: Yadav s,
Redden J, Hatfield L, Lotze-Campen, Hall E (ed) Crop adaptation to climate
change. Wiley-Blackwell, Oxford, pages 356-369. https://doi.org/10.1002/
9780470960929.ch25
Beebe, S., Rao, I., & Blair, M. (2009). Breeding for abiotic stress tolerance in common
bean: Present and future challenges. SABRAO Journal of Breeding and Genetics,
41. Retrieved from the link https://www.researchgate.net/publication/228612601
Berry, M., Izquierdo, P., Jeffery, H., Shaw, S., Nchimbi‑Msolla, S., & Cichy, K.
(2020). QTL analysis of cooking time and quality traits in dry bean (Phaseolus
vulgaris L.). Theoretical and Applied Genetics, 133(7):2291–2305.
https://doi.org/10.1007/s00122-020-03598-w
Bitocchi, E., Nanni, L., Bellucci, E., Rossi, M., Giardini, A., Zeuli, P. S., Logozzo, G.,
Stougaard, J., McClean, P., Attene, G., & Papa, R. (2012). Mesoamerican origin
of the common bean (Phaseolus vulgaris L.) is revealed by sequence data.
126
Proceedings of the National Academy of Sciences, 109(14), E788-E796.
https://doi.org/10.1073/pnas.1108973109
Blair, M. W., Galeano, C. H., Tovar, E., Torres, M. C., Castrillón A. V., Beebe, S. E.,
& Rao, I. M. (2012). Development of a Mesoamerican intra-genepool genetic map
for quantitative trait loci detection in a drought tolerant × susceptible common bean
(Phaseolus vulgaris L.) cross. Molecular Breeding, 29(1):71-88.
https://doi.org/10.1007/s11032-010-9527-9
Blair, M., Diaz, J., Hildago, R., Diaz, L., & Duque, M. (2007) Microsatellite
characterization of Andean races of common bean (Phaseolus vulgaris L.).
Theoretical and Applied Genetics, 116(1):29-43. https://doi.org/10.1007/s00122-
007-0644-8
Blair, W., Iriate, G., & Beebe, S. (2006). QTL analysis of yield traits in an advanced
backcross population derived from in an Andean X wild common bean (Phaseolus
vulgaris L.) cross. Theoretical and Applied Genetics, 112(6):1149-1163.
https://doi.org/10.1007/s00122-006-0217-2
Bressani, R., & Chon, C. (1996). Effects of altitude above sea level on the cooking
time and nutritional value of common beans. Plants Food for Human Nutrition,
49:53-61. https://doi.org/10.1007/bf01092522
Bressani, R., Navarrete, D. A., & Garcia-Soto, A. (1988). Culinary practices and
consumption characteristics of common beans at the rural home level. Archvos
Latina Americans de Nutricio, 38: 925-934.
Briñez, B., Perseguini, J., Rosa, J. S., Bassi, D., Gonçalves, J.G., Almeida, C., Paulino,
J. F., Blair, M. W., Chioratto, A. F., Carbonell, S. A., Valdisser, P. A., Vianello,
R. P., & Benchimol-Reis, L. B. (2017). Mapping QTLs for drought tolerance in a
SEA 5 x AND 277 common bean cross with SSRs and SNP markers. Genetics and
Molecular Biology, 40(4) 813-823. https://doi.org/10.1590/1678-4685-gmb-2016-
0222
Broughton, J. W., Hernandez, G., Blair, M., Beebe, S., & Vanderleyde, J. (2003).
Beans (Phaseolus spp.) model food legumes. Plant and Soil, 252(1):55-128.
https://doi.org/10.1023/a:1024146710611
Burbano-Erazo, E., León-Pacheco, R. I., Cordero-Cordero, C. C., López-Hernández,
F., Cortés, A. J., & Tofiño-Rivera, A. P. (2021). Multi-Environment Yield
127
Components in Advanced Common Bean (Phaseolus vulgaris L.) × Tepary Bean
(P. acutifolius A. Gray) Interspecific Lines for Heat and Drought Tolerance.
Agronomy, 11(10):1978. https://doi.org/10.3390/agronomy11101978
Burle, M., Fonseca, J., Kami, J., & Gepts, P. (2010). Microsatellite diversity and
genetic structure among common bean (Phaseolus vulgaris L.) landraces in Brazil,
a secondary center of diversity. Theoretical and Applied Genetics, 121:801-813.
https://doi.org/10.1007/s00122-010-1350-5
Burton, G. W., & De vane, E. H. (1953). Estimating heritability in tall fescue (Festuca
arundinacea) from replicated clonal material. Agronomy Journal, 45:478-481.
https://doi.org/10.2134/agronj1953.00021962004500100005x
CIAT (International Center for Tropical Agriculture) (1986). Morphology of the
common bean (Phaseolus vulgaris L.), CIAT, Cali, Colombia CIAT, 56 Pages.
Cichy, K., Wiesinger, J., & Mendoza, F. (2015). Genetic diversity and genome-wide
association analysis of cooking time in dry bean (Phaseolus vulgaris L.).
Theoretical and Applied Genetics, 128:1555–1567. DOI:10.1007/s00122-015-
2531-z
Cichy, K., Wiesinger, J., Berry, M., Nchimbi-Msolla, S., Fourie, D., Porch, T.,
Ambechew, D., & Miklas, P. (2019). The role of genotype and production
environment in determining the cooking time of dry beans (Phaseolus vulgaris L.).
Legume Science, 1:1–15 https://doi.org/10.1002/leg3.13
Corporate Communications Office (2023). LCEFoNS phase ii to enhance legume
value chain in kenya. Retrieved 13th August 2023 from the link
https://www.jkuat.ac.ke/lcefons-phase-ii-to-enhance-legume-value-chain-in-
kenya/
Corrêaa, M. M., Carvalhoa, L. M., Nuttib, M. R., Carvalhob, J. L., Netob, A. R., &
Ribeiro, E. M. (2010). Water Absorption, Hard Shell and Cooking Time of
Common Beans (Phaseolus vulgaris L.). African Journal of Food Science, 1, 13-
20. Retrieved from https://api.semanticscholar.org/CorpusID:5504320
Cortes, A. C., Blair, W., & Chavaro, C. (2011). SNP marker diversity in common bean
(Phaseolus vulgaris L.). Theoretical and Applied Genetics, 123(5):827-845.
https://doi.org/10.1007/s00122-011-1630-8
Costa, A., Quieroz-Monici, K., & Oliveira, S. (2006). Chemical composition, dietary
128
fiber and resistant starch contents of raw and cooked pea, common bean, chickpea
and lentil legumes. Food Chemistry, 94: 327-330.
https://doi.org/10.1016/j.foodchem.2004.11.020
Cruz, G., Oliveira, M., Pires, C., Gomes, M., Costa, N., Brumano, M., & Moreira, M.
(2003). Protein quality and in vivo digestibility of different varieties of bean
(Phaseolus vulgaris L.). Brazil Journal of Food Technology, 6: 157-162. Retrieved
from https://www.researchgate.net/publication/313662870
Diaz, S., Ariza-Suarez, D., Ramdeen, R., Aparicio, J., Arunachalam, N., Hernandez,
C., Diaz, H., Ruiz, H., Piepho, H. P. & Raatz, B. (2021). Genetic architecture and
genomic prediction of cooking time in common bean (Phaseolus vulgaris L.).
Frontier in Plant Science, 11:622213. doi: 10.3389/fpls.2020.622213
Dudley, J. W., Moll, R. H. (1969). Interpretation and use of estimates of heritability
and genetic variances in plant breeding. Crop Science, 9(3):257-262.
https://doi.org/10.2135/cropsci1969.0011183x000900030001x
Elena, P., Cristina, R., Astrid, P., & Ana, C. (2010). Mapping QTLs for morph-
agronomic and seed quality traits in RILs population of common bean (Phaseolus
vulgaris L.). Theoretical and Applied Genetics, 120: 1367-1380.
https://doi.org/10.1007/s00122-010-1261-5
Elia, F. M. (2003). Heritability of cooking time and water absorption traits in common
bean (Phaseolus vulgaris L.) using a North Carolina design II mating scheme.
Tanzania Journal of Science, 29(1). https://doi.org/10.4314/tjs.v29i1.18364
Fabbri, A., Crosby, G. (2016). A review of the impact of preparation and cooking on
the nutritional quality of vegetables and legumes. International Journal of
Gastronomy and Food Science, 3:2-11. https://doi.org/10.1016/j.ijgfs.2015.11.001
FAOSTAT (Food and Agriculture Organisation Statistics) (2023). Food and
Agriculture Organisation of the United Nations. Statistic division. Retrieved
23/06/2022 from the link https://www.fao.org/faostat/en/#data/QCL
Farrow, A. & Andriatsitohaina, R. (2021). Atlas of Common Bean Production in
Africa. Pan-Africa Bean Research Alliance (PABRA); International Center for
Tropical Agriculture (CIAT), ISBN: 978958694227-0. Retrieved from
https://www.researchgate.net/publication/348860644
Fisseha, Z. & Kyallo, M., T., Kassahun, H., Jagger D., K. & Opiyo, S. (2018).
129
Integrating phenotypic evaluations with a molecular diversity assessment of an
Ethiopian collection of common bean landraces. African Crop Science Journal,
26. DOI 10.4314/acsj.v26i2.12.
Freyre, R., Skroch, P. W., Geffroy, V., Adam-Blondon, A., Shirmohamadali A.,
Johnson W. C, Llaca, V., Nodari, R. O., Pereira, P. A., Tsai, S. M., Tohme, J.,
Dron, ., Nienhuis, J., Vallejos, C. E., & Gepts, P. (1998). Towards an integrated
linkage map of common bean. Development of a core map and alignment of RFLP
maps. Theoretical Applied Genetics, 97(5-6):847-956. https://doi.org/10.1007/
s001220050964
Freytag, G., & Debouck, D. (2002). Review of taxonomy, distribution and ecology of
the genus Phaseolus (Lefuminosae-papilionoidae) in North Americca, Mexico and
Central America. Botanical Miscellany, 23: 1-300. Retrieved from the link
Galisteo, M., Duarte, J., & Zarzuelo, A. (2008). Effects of dietary fibers on
disturbances clustered in the metabolic syndrome. The Journal of Nutritional
Biochemistry, 19(2):71-84. https://doi.org/10.1016/j.jnutbio.2007.02.009
Garcia, E., Filisetti, C., Udaeta, M., Lajolo, M. (1998). Hard-to-cook Beans (Phaseolus
vulgaris L.): Involvement of phenolic compounds and pectates. Journal of
Agricultural and Food Chemistry, 46(2):2110-2116. https://doi.org/10.1021/
jf970848f
Garcia, R., Rangel, P., Bassinello, P., Brondani, C., Melo, L., Sibov, S., Vianello-
Brondani, R. (2012). QTL mapping for the cooking time of common beans.
Euphytica, 186:779–792 https://doi.org/10.1007/s10681-011-0587-7
Garret, A., Nita, M., De Wolf, D., Gomez, L., & Sparks, A. H. (2009). Plant pathogens
as indicators of climate change. Climate change: Observed impacts on plant earth.
Elsevier BV, Amsterdam pages 425-437. https://doi.org/10.1016/B978-0-444-
63524-2.00021-X
Gepts, P. (1998). Origin and evolution of common bean: Past events and recent trends.
American Society for Horticultural Science, 33(7):1124-1130.
https://doi.org/10.21273/hortsci.33.7.1124
Gepts, P. (2014). Beans: Origins and development. Encyclopedia of Global
Archaeology, Springer, pages 822-827. https://doi.org/10.1007/978-1-4419-0465-
130
2_2169
Gepts, P., Aragão, F. J., de Barros, E., Blair, M. W., Brondani, R., Broughton, W.,
Galasso, I., Hernández, G., Kami, J., Lariguet, P., McClean, P., Melotto, M.,
Miklas, P., Pauls, P., Pedrosa-Harand, A., Porch, T., Sánchez, F., Sparvoli, F., Yu,
k. (2008). Genome of Phaseolus beans, a major source of dietary protein and
micronutrients in the tropics. In: Moore, P., Ming, R. (ed) Plant Genetics and
Genomics: Crops and Models, Springer New York, pages 1:113-143.
https://doi.org/10.1007/978-0-387-71219-2_5
Ghobary, H., & Abd Allah, S. (2010). Correlation and path- coefficient studies in
common bean (Phaseolus vulgaris L.). Journal of Plant Production, 1(9), 1233–
1239. https://doi.org/10.21608/jpp.2010.86576
Goodstein, M., Shu, S., Howson, R., Neupane, R., Hayes, R. D., Fazo, J., Mitros, T.,
Dirks, W., Hellsten, U., Putnam, N., & Rokhsar, D. S. (2012). Phytozome: a
comparative platform for green plants genomics. Nucleic Acid Research 40(D1):
D1178-D1186. https://doi.org/10.1093/nar/gkr944
Greenlife (2023). French beans. Retrieved 14th August 2023 from the link
https://www.greenlife.co.ke/french-beans/
Gujaria-Verma, N., Ramsay. L., Sharpe, A. G., Sanderson, L., Debouck, D. G., Tar’an,
B., & Bett, K. E. (2016). Gene-based SNP discovery in tepary bean (Phaseolus
acutifolius) and common bean (P. vulgaris) for diversity analysis and comparative
mapping. BMC Genomics, 17, 239. https://doi.org/10.1186/s12864-016-2499-3
Güzel, D., & Sayar, S. (2012). Effect of cooking methods on selected physiochemical
and nutritional properties of barlotto bean, chickpea, faba bean and white kidney
bean. Journal of Food Science and Technology, 49(1):89-95.
https://doi.org/10.1007/s13197-011-0260-0
Gyori, Z., Nemeskeri, E., & Szilagyi, S. (1998). Legumes grown under nonirrigated
conditions. Journal of Agricultural and Food Chemistry, 46(8):3087-3091.
https://doi.org/10.1021/jf980060c
Haddad, E. H., & Tanzman, J. S. (2003). What do vegetarians in the United States eat?
The American Journal of Clinical Nutrition, 78(3):626S-632S.
https://doi.org/10.1093/ajcn/78.3.626s
131
Henry, A. N., Evans, N. N., & Nelson, A. O. (2019). Evaluation of genetic variability,
heritability, genetic advance and correlation for agronomic and yield components
in common bean landraces from Southwestern Kenya. Journal of Plant Breeding
and Crop Science, 11(5):44-147. https://doi.org/10.5897/jpbcs2018.0800
Hentges, L., Weaver, M., & Nielsen, S. (1990). Reversibility of the hard-to-cook
defect in dry beans (Phaseolus vulgaris L.) and cowpeas (Vigna unguiculata).
Journal of Food Science, 55(5):1474-1474. https://doi.org/10.1111/j.1365-
2621.1990.tb03965.x
Hoyos-Villegas, V., Song, Q., & Kelly, J. (2017). Genome-wide association analysis
for drought tolerance and associated traits in common bean. The Plant Genome,
10(1). https://doi.org/10.3835/plantgenome2015.12.0122
Hutchin, A.M., Winham, D.M., & Thompson, S.V. (2012). Phaseolus beans: Impact
on glycaemic response and chronic disease risk in human subjects. British Journal
of Nutrition 108(S1):52-65. https://doi.org/10.1017/s0007114512000761
Irving, G. C. (1980). Inositol phosphates : their chemistry, biochemistry, and
physiology. (Ed) D.J. Cosgrove. D.J. Elsevier, pages 85-96. Retrieved from the
link https://api.semanticscholar.org/CorpusID:82565617
Jacinto-Hernandez, C., Azpiroz-Rivero, S., Acosta-Gallegos, A., Hernandez-Sanchez,
H., & Bernal-Lugo, I. (2003). Genetic analysis and random amplified polymorphic
DNA markers associated with cooking time in common bean. Crop Science,
43(1):329. https://doi.org/10.2135/cropsci2003.3290
Jaetzold, R., & Schmidt, H. (1983). Farm Management Handbook of Kenya. Ministry
of Agriculture, Kenya, in cooperation with the German Agricultural Team (GAT),
German Agency for Technical Cooperation (GTZ) 2, 245-285. Retrieved from the
link https://edepot.wur.nl/487562
Johnson, H. W., Robinson, H., & Comstock, R. (1955). Estimates of Genetic and
Environmental Variability in Soybeans. Agronomy Journal, 47(7):314–318.
https://doi.org/10.2134/agronj1955.00021962004700070009x
Jones, B., & Boulter, D. (1983). The analysis of development of hard bean during
storage of black beans (Phaseolus vulgaris L.). Qualitas Plantarum Plant Foods
for Human Nutrition, 33(1):77-85. https://doi.org/10.1007/bf01093740
132
Kamfwa, k., Cichy, K., & Kelly, J. (2015). Genome wide association study for
agronomic traits in common bean. The Plant Genome, 8(2).
https://doi.org/10.3835/plantgenome2014.09.0059
Kilian, A., Wenzl, P., Huttner, E., Carling, J., Xia, L., Blois, H., Caig, V., Heller-
Uszynska, K., Jaccoud, D., Hopper, C., Aschenbrenner-Kilian, M., Evers, M.,
Peng, K., Cayla, C., Hok, P., & Uszynski, G. (2012). Diversity Arrays Technology:
a generic genome profiling technology on open platforms. Data Production and
Analysis in Population Genomics, 67–89. https://doi.org/10.1007/978-1-61779-
870-2_5
Kinyanjui, P., Njoroge, D., Makokha, A., Christiaens, S., Ndaka, D., & Hendricky, M.
(2015). Hydration properties and texture fingerprints of easy- and hard-to-cook
bean varieties. Food Science and Nutrition, 3(1):39-47.
https://doi.org/10.1002/fsn3.188
Kinyuru, J., Kinyanjui, P., Muchui, M., & Mungai, H. (2011). Influence of Post-
harvest Handling on the Quality of Snap Bean (Phaseolus vulgaris L.). Journal of
Agriculture and Food Technology 1. Retrieved from the link
Koinange, K., Singh, P., & Gepts, P. (1996). Genetic control of the domestication
syndrome in common bean. Crop Science, 36(4):1037-1045.
https://doi.org/10.2135/cropsci1996.0011183x003600040037x
Kon, S., & Sanshuck, D. (2007). Phytate content and its effect on cooking quality of
beans. Journal of Food Processing and Preservation, 5. 169 - 178. 10.1111/j.1745-
4549.1981.tb00632.x.
Langat, C., Omwoyo-Ombori, Cheruiyot. R., Gathaara, M., Karanja, D., Leley, P.
(2019). Mapping of Quantitative Trait Loci (QTL) related to drought tolerance in
common bean (Phaseolus vulgaris L.) using f2 population from (KATB1 Χ GLP2).
International Annals of Science, 8(1):75-86. https://doi.org/10.21467/ias.8.1.75-86
Lei, L., Wang, L., Wang, S., & Wu, J. (2020) Marker-trait association analysis of seed
traits in accessions of common bean (Phaseolus vulgaris L.) in China. Frontiers in
Genetics, 11:698. doi: 10.3389/fgene.2020.00698
Li, Y., Yang, K., Yang, W., Chu, L., Chen, C., Zhao, B., Li, Y., Jian, J., Yin, Z., Wang,
T., & Wan, P. (2017). Identification of QTL and qualitative trait loci for agronomic
133
traits using SNP markers in the adzuki bean. Frontiers in Plant Science, 8:
https://doi.org/10.3389/fpls.2017.00840
Li, Z., Yu, S., Lafitte, H., Huang, N., Courtois, B., Hittalmani, S., Vijayakumar, C.,
Liu, G., Wang, G., Shashidhar, H., Zhuang, J., Zheng, K., Singh, V., Sidhu, J.,
Srivantaneeyakul, S., & Khush, G. (2003). QTL × environment interactions in rice.
I. Heading date and plant height. Theoretical and Applied Genetics 108(1):141-
153. https://doi.org/10.1007/s00122-003-1401-2
Lobo, I. (2008) One gene can affect multiple traits. Nature education 1(1)10. Retrieved
from https://www.nature.com/scitable/topicpage/pleiotropy-one-gene-can-affect-
multiple-traits-569/
Maryange, M., Msolla, N., Sawargonkar, S., Hudge, B., & Thanki, H. (2010).
Screening of 39 advanced beans (Phaseolus vulgaris L.) lines for short cooking
time using two different methods. Electronic Journal of Plant Breeding, 4:505-
511. Retrieved from https://www.researchgate.net/publication/46179223
Marzooghian, A., Moghaddam, M., Valizadeh, M., Kooshki, M. H. (2014). Genetic
diversity of common bean genotypes as revealed by seed storage proteins and some
agronomic traits. Plant Breeding and Seed Science, 67:125-137.
https://doi.org/10.2478/v10129-011-0075-1
Mashi, D. S. (2006). Genetic studies on seed coat texture and cooking time in some
varieties of cowpea (Vigna unguiculata L.). PhD Thesis, University of Jos, Ibadan.
Mattson, S. (1946). The cookability of yellow peas. Acta Agriculturae Suecana. The
Royal Swedish Academy of Agriculture Stockholm, Pages 185-231.
https://doi.org/10.1097/00010694-194807000-00009
Mbithi-Mwikya, S., Ooghe, W., Van Camp, J., Ngundi, D., & Huyghebaert, A. (2000).
Amino acid profiles after sprouting, autoclaving, and lactic acid fermentation of
finger millet (Eleusine Coracan) and kidney beans (Phaseolus Vulgaris L.). Food
Science and Technology, 48(8):3081-3085. https://doi.org/10.1021/jf0002140
Mduruma, Z., Nchimbi-Msolla, S., & Reuberi, M. R. (1998). Evaluation of maturity
characteristics and of yield components of high protein bean (Phaseolus vulgaris
L.) varieties in Morogoro, Tanzania. Tanzania Journal of Agricultural Sciences,
1(2):131-140. Retrieved from the link https://www.ajol.info/index.php/tjags/
article/view/116323
134
Mecha, E., Figueira, M., Vaz Patto, M., & Bronze, M. (2018). Two sides of the same
coin: The impact of grain legumes on human health: Common bean (Phaseolus
vulgaris L.) as a case study. IntechOpen, DOI:10.5772/intechopen.78737
Mendes, M., Botello, F., Ramalho, M., Abreu, A., & Furtini, I. (2008). Genetic control
of the number of days to flowering in common bean. Crop Breeding and Applied
Biotechnology, 8(4):279-282. https://doi.org/10.12702/1984-7033.v08n04a04
Mendoza, M., Karen, C., Sparague, C., Goffnet, A., Lu, R., & Kelly, J. (2018).
Prediction of canned black bean texture (Phaseolus vulgaris L.) from intact dry
seeds using visible/near infrared spectroscopy and hyper-spectral imaging data.
Journal of the Science of Food and Agriculture, 98(1):283-290.
https://doi.org/10.1002/jsfa.8469
Meng, L., Li, H., Zhang, L., & Wang, J. (2015). QTL IciMapping: Integrated software
for genetic linkage map construction and quantitative trait locus mapping in
biparental populations. The Crop Journal, 3(3): 269-283.
https://doi.org/10.1016/j.cj.2015.01.001
Milkas, N., Kelly, D., Beebe, E., & Blair, W. (2006). Common bean breeding for
resistance against biotic and abiotic stresses: From classical to MAS breeding.
Euphytica ,147(1-2):105-131. https://doi.org/10.1007/s10681-006-4600-5
Mitchell. D., Lawrence, F., Hartman, J., & Curran, J. (2009). Consumption of dry
beans, peas and lentils could improve diet quality in the US Population. Journal of
American Diet Association, 109(5): 909-913.
https://doi.org/10.1016/j.jada.2009.02.029
Mitova, I., Dimitrov, I., Atanasova, E., Stancheva, I. (2008). Effects of fore-crop
fertilization on the yield and quality of kidney beans under vegetable crop rotation
conditions. Acta Agronomica Hangarica, 56(4): 449-454.
https://doi.org/10.1556/aagr.56.2008.4.11
Molina, M., Baten, M., Gomez-Brenes, R., King, R., & Bressani, R. (1976). Heat
treatment: Process to control the development of the hard-to-cook phenomenon in
black beans (Phaseolus vulgaris L.). Journal of Food Science, 41(3):661-666.
https://doi.org/10.1111/j.1365-2621.1976.tb00694.x
Moscoso, W., Bourne, C., & Hood, F. (1984). Relationships between the hard-to-cook
Phenomenon in red kidney beans and water absorption, puncture force, pectin,
135
phytic acid, and minerals. Journal of Food Science, 49:1577-1583.
Mughi, I. M. (2017). Inheritance and characterization of cooking time, seed iron and
zinc content in selected African common bean germplasm. Dissertation, Makerere
University.
Mukeshimana, G., Butare, L., Cregan, P., Blair, M., & Kelly, J. (2014). Quantitative
trait loci associated with drought tolerance in common bean. Crop Science,
54(3):923-938. https://doi.org/10.2135/cropsci2013.06.0427
Muller, A., & Jung, C. (2009). Flowering time control and applications in plant
breeding. Trends in Plant Science, 14(10):563–573.
https://doi.org/10.1016/j.tplants.2009.07.005
Murube, E., Beleggia, R., Pacetti, D., Nartea, A., Frascarelli, G., & Lanzavecchia, G.
(2021). Characterization of nutritional quality traits of a common bean germplasm
collection. Foods, 10(7):1-26. https://doi.org/10.3390/foods10071572
Nadeem, M. Y., Mehmet, S., Muhammad, Q.H., Ephrem, Y., Hilal, A., Ahmad, H.,
Rustu, C., Yeter, K., Khalid, M.L., Ndiko, A., Muhammad, K., Tolga, B., &
Faheem (2021). Common bean as a potential crop for future food security: an
overview of past, current and future contributions in genomics, transcriptomics,
transgenics and proteomics. Biotechnology & Biotechnological Equipment, 35.
758-786. DOI.10.1080/13102818.2021.1920462.
Nakedde, T., Ibara-Perez, F., Mukankusi, C., Waines, J., & Kelly, J. (2016). Mapping
of QTL associated with fusarium root rot resistance and root architecture traits in
black beans. Euphytica, 212(1):51-63. https://doi.org/10.1007/s10681-016-1755-6
Nchanji, E. B., & Ageyo, O. C. (2021). Do common beans (Phaseolus vulgaris L.)
promote good health in humans? A systematic review and meta-analysis of clinical
and randomized controlled trials. Nutrients, 13(11):3701. doi:
10.3390/nu13113701
Negahi, A., Bihamta, M. R., Negahi, Z., & Alidoust, M. (2014). Evaluation of genetic
variation of some agronomical and morphological traits in Iranian and exotic
common bean (Phaseolus vulgaris L.). Agricultural Communications, 2(3): 22-26.
Retrieved from the link https://api.semanticscholar.org/CorpusID:55632633
136
Nemeskéri, E. (2012). Relationship between nutritional quality of beans and growing
conditions. Beans: Nutrition, Consumption and Health. 249-264. Retrieved from
the link https://www.researchgate.net/publication/287320796
Njoroge, M., Kinyanjui, K., Makokha, O., Christiane, S., Shpigelman, A., Sila, N., &
Hendrickx, E. (2014). Extraction and characterisation of pectic polysaccharides
from easy and hard-to-cook common beans (Phaseolus vulgaris). Food Research
International, 64:314-322. https://doi.org/10.1016/j.foodres.2014.06.044
Nodari, R., Tsail, M., Gilbertson, R., & Gepts, P. (1993). Towards an integrated
linkage map of common bean 2. Development of an RFLP-based linkage map.
Theoretical and Applied Genetics, 85(5):513-520.
https://doi.org/10.1007/bf00220907
Nyakuni, G. A., Kikafunda, J. K., Muyonga, J. H., Kyamuhangire, W. M.,
Nakimbugwe, D., & Ugen, M. (2008). Chemical and nutritional changes
associated with the development of the hard-to-cook defect in common beans.
International Journal of Food Sciences and Nutrition, 59(7-8):652–659.
https://doi.org/10.1080/09637480701602886
Nyamboki, L. (2012). Environmental implications of household energy use. M.Sc.
Thesis, Institute of Development Studies, University of Nairobi.
Oki, D, Tukamuhabwa, P., Odong, T., Namayanja, A., Mukabaranga, J., Paparu, P., &
Gepts, P. (2014). Morphological diversity of tropical common bean germplasm.
African Crop Science Journal, 22: 59-67. Retrieved form the link
https://hdl.handle.net/1807/47678
Onyango, P. (2023). Common bean breeding in Africa takes new and more rapid
innovative techniques. Retrieved 13th August 2023 from https://www.pabra-
africa.org/common-bean-breeding-in-africa-takes-new-and-more-rapid-
innovative-techniques/
Ousman, B. (2013). Non-destructive determination of bean water absorption capacity
using CFA images analysis for hard-to-cook evaluation. International Journal of
Electrical and Computer Engineering, 3(3).
https://doi.org/10.11591/ijece.v3i2.2149
137
Perera, D., Devkota, L., Garnier, G., Panozzo, J., & Dhital, S. 2023. Hard-to-cook
phenomenon in common legumes: Chemistry, mechanisms and utilization. Food
Chemistry, 415(2):135743. DOI:10.1016/j.foodchem.2023.135743
Pérez-Vega, E., Pañeda, A., Rodríguez-Suárez, C., Campa, A., Giraldez, R., &
Ferreira, J. (2010). Mapping of QTLs for morpho-agronomic and seed quality traits
in a RIL population of common bean (Phaseolus vulgaris L.). Theoretical and
Applied Genetics, 120(7):1367–1380. https://doi.org/10.1007/s00122-010-1261-5
Perseguini, J., Oblessuc, P., Rosa, J., Gomes, K., & Chiorato, A. (2016). Genome-wide
association studies of anthracnose and angular leaf spot resistance in common bean
(Phaseolus vulgaris L.). PLoS One, 11(1): e0150506.
https://doi.org/10.1371/journal.pone.0150506
Petry, N., Erick, D., James, W., & Richard, H. (2015). Review: The potential of the
common bean (Phaseolus vulgaris) as a vehicle for iron biofortification. Nutrients,
7(2):1144-1173. https://doi.org/10.3390/nu7021144
Phutela, U., Dhuna, V., Sandhu, S., & Chadha, B. (2005). Pectinase and
polygalacturonase production by thermophilic aspergillus fumigatus isolated from
decomposing orange peels. Brazilian. Journal of Microbilogy, 36:63-69.
https://doi.org/10.1590/s1517-83822005000100013
Reddy, R., Pierson, D., Sathe, K., & Salunke, K. (1984). Chemical, nutritional and
physiological aspects of dry bean carbohydrates: A review. Food Chemistry,
13(1):25-68. https://doi.org/10.1016/0308-8146(84)90026-8
Resende, R. T., Resende, M. D., Azevedo, C. F., Silva, F. F., Melo, L. C., Pereira, H.
S., Souza, T., Valdisser, P.C., & Vianello, R. P. (2018). Genome-Wide Association
and regional heritability mapping of plant architecture, lodging and productivity in
Phaseolus vulgaris. G3 Genes|Genomes|Genetics, 8(8):2841-2854.
https://doi.org/10.1534/g3.118.200493
Reynoso, C., Gomez, R., & Pina, L. (2006). Bioactive components in common beans
(Phaseolus vulgaris L.). Advances in Agriculture and Food Biotechnology, 34:
217-236.
Richardson, C., & Stanley, W. (1991). Relationship of loss of membrane functionality
and hard-to-cook defect in aged beans. Journal of Food Science, 56(2):590-591.
138
Saha, S., Singh, G., Mahajan, V., & Gupta, H. (2009). Variability of nutritional and
cooking quality in bean (Phaseolus vulgaris L) as a function of genotype. Plant
Foods for Human Nutrition, 64 (2):174-180. https://doi.org/10.1007/s11130-009-
0121-4
Sakuraba, Y., Jeong, J., Kang, M. Y., Kim, J., Paek, N. C., & Choi G (2014).
Phytochrome interacting transcription factors PIF4 and PIF5 induce leaf
senescence in Arabidopsis. Nature Communications, 5(1).
https://doi.org/10.1038/ncomms5636
Sandhu, S., You, M., Conner, L., Balasubramanian, M., & Hou, A. (2018). Genetic
analysis and QTL mapping of the seed hardness trait in a black common bean
(Phaseolus vulgaris) recombinant inbred line (RIL) population. Molecular
Breeding, 38(3). https://doi.org/10.1007/s11032-018-0789-y
Schmutz, J., McClean, P. E., Mamidi, S., Wu, G., Cannon, S., Grimwood, J., Jenkins,
J., Shu, S., Song, Q., Chavarro, C., Torres-Torres, M., Geffroy, V., Moghaddam,
S., Gao, D., Abernathy, B., Barry, K., Blair, M., Brick, M. A., Chovatia, M., Gepts,
P., Goodstein, D. M., Gonzales, M., Hellsten, U., Hyten, D. L., Jia, G., Kelly, J.
D., Kudrna, D., Lee, R., Richard, M., Miklas, P., Osorno, J. M., Rodrigues, J.,
Thareau, V., Urrea, C. A., Wang, M., Yu, Y., Zhang, M., Wing, R.A., Cregan, P.
B., Rokhsar, D. S., & Jackson, S. A. (2014). A reference genome for common bean
and genome-wide analysis of dual domestications. Nature Genetics, 46(7):707-
713. https://doi.org/10.1038/ng.3008
Sgarbieri, C., & Whitaker, R. (1982). Physical, chemical, and nutritional properties of
common bean (Phaseolus) proteins. Advances in Food Research, 28(3):93-166.
https://doi.org/10.1016/s0065-2628(08)60111-1
Shehata, E. A. (1992). Hard-to-cook phenomenon in legumes. Food Reviews
International, 8(2):191-221. https://doi.org/10.1080/87559129209540938
Shi, Q., Zhang, H., Song, X., Jiang, Y., Liang, R., & Li, G. (2018). Functional
characterization of the maize phytochrome-interacting factors PIF4 and PIF5.
Frontiers in Plant Science, 8. https://doi.org/10.3389/fpls.2017.02273
Shomer, I., Paster, H., Linder, P., & Vasiliver, R. (1990). The role of cell wall structure
in the hard-to-cook phenomenon in beans (Phaseolus vulgaris L.) Journal of Food
Structure, 9(2):10. Retrieved from the link https://digitalcommons.usu.edu/
139
foodmicrostructure/vol9/iss2/10
Silva, V., Menezes-Junior, J., Carneiro, P., Carneiro, J., Cruz, C. (2013). Genetic
improvement of plant architecture in the common bean. Genetics and Molecular
Research, 12(AOP). https://doi.org/10.4238/2013.january.30.8
Singh, R. K., & Chaudhary, B. D. (1985). Biometrical methods in quantitative genetic
analysis. Kalyani Publishers, New Delhi, India pages 78-101.
Slupski, J. (2010). Effect of cooking and sterilisation on the composition of amino
acids in immature seeds of flageolet bean (Phaseolus vulgaris L.) cultivars. Food
Chemistry, 121(4):1171-1176. https://doi.org/10.1016/j.foodchem.2010.01.066
Swema, E., & Mwinuka, L. (2021). Understanding consumer preference for common
beans from manifold viewpoints of attributes in Dar es Salaam, Tanzania.
Theoretical Economics Letters, 11, 1038-1054.
https://doi.org/10.4236/tel.2021.115066
Taptue, C. (2018). Nutritional properties and nutrients chemical analysis of common
beans seed. MedCrave Online Journal of Biology and Medicine, 3.
10.15406/mojbm.2018.03.00074.
Tar’an, B., Michaels, T., & Pauls, K. P. (2002). Genetic mapping of agronomic traits
in common bean. Crop Science, 42(2):544–556.
https://doi.org/10.2135/cropsci2002.5440
Tar'an, B., Michaels, T. E., & Pauls, K. P. (2002). Genetic mapping of agronomic traits
in common bean. Crop Science, 42: 544–556. doi: 10.2135/cropsci2002.0544
Thorwarth, P., Yourself, A., & Schmid, K. (2017). Genomic prediction and association
mapping of curd-related traits in gene bank accessions of cauliflower. G3: Genes,
Genomes, Genetics 8. https://doi.org/10.1534/g3.117.300199
Tosh, S., & Yada, S. (2010). Dietary fibres in pulse seeds and fractions:
Characterization, functional attributes, and applications. Food Research
International, 43(2):450-460. https://doi.org/10.1016/j.foodres.2009.09.005
Ugwuanyi, S., Udengwu, O. S., Snowdon, R. J., & Obermeier, C. (2022). Novel
candidate loci for morpho-agronomic and seed quality traits detected by targeted
genotyping-by-sequencing in common bean. Frontier in Plant Science,
13:1014282. doi: 10.3389/fpls.2022.1014282
140
Valdisser, R., Pappas, G., Menezes, I., Müller, B., Pereira, W., Narciso, M., Brondani,
C., Souza, T., Borba, T., & Vianello, R. (2016). SNP discovery in common bean
by restriction-associated DNA (RAD) sequencing for genetic diversity and
population structure analysis. Genetics and Genomics, 291(3):1277-1291.
https://doi.org/10.1007/s00438-016-1182-3
Van der Poel, A. F. B. (1990). Effect of processing on antinutritional factors and
proteins nutritional value of dry beans (Phaseolus vulgaris L.). Animal Feed
Science and Technology, 29(3-4):179-208. https://doi.org/10.1016/0377-
8401(90)90027-6
Van Schoonhoven, A., & Pastor-Corrales, M. A. (1987). Standard system for the
evaluation of bean germplasm. Cali, Colombia. 54pages
Vandemark, G. J., Brick, M. A., Orsono, J. M., Kelly, J. D., & Urrea, C. A. (2014).
Edible Grain Legumes. In: Smith S, Diers B, Specht J, Carver B (ed) Yield Gains
in Major U.S. Field Crops. Madison pp 87-124.
https://doi.org/10.2135/cssaspecpub33.c5
Villordo-Pineda, E., González-Chavira, M. M., Giraldo-Carbajo, P., Acosta-Gallegos,
J., & Caballero-Pérez, J. (2015) Identification of novel drought-tolerant-associated
SNPs in common bean (Phaseolus vulgaris). Frontiers in Plant Science, 6.
https://doi.org/10.3389/fpls.2015.00546
Vindiola, L., Seib, A., & Hoseney, C. (1986). Accelerated development of hard-to-
cook state in beans. Cereal Foods World, 31(8):608. Retrieved from the link
https://eurekamag.com/research/004/650/004650915.php
Virginia, M. (2014). Nutritional and health benefits of dry beans. The American
Journal of Clinical Nutrition, 100:437-442. DOI: 10.3945/ajcn.113.071472
Viteri, D.M., Terán, H., Asensio-S.-Manzanera, M.C., Asensio, C., Porch, T.G.,
Miklas, P.N., & Singh S.P. (2014). Progress in Breeding Andean Common Bean
for Resistance to Common Bacterial Blight. Crop Science, 54:2084–2092. doi:
10.2135/cropsci2014.03.0177
Wacu, V. K. (2016). Effect of storage conditions and pre-processing treatments on
physical, cooking and nutritional properties of two common beans varieties in
Kenya. M.Sc. Thesis, Food science and Nutrition JKUAT.
141
Wafula, E. N., Wainaina, I. N., Buve, C., Nguyen, N., Kinyanjui, P. K., Saeys, W.,
Sila, D. N., & Hendrickx, M. (2020). Application of near-infrared spectroscopy to
predict the cooking times of common beans (Phaseolus vulgaris L.). Journal of
Food Engineering, 284:110056. https://doi.org/10.1016/j.jfoodeng.2020.110056
Wahome, S., Kimani, P., Muthomi, J., & Narla, R. (2013). Quality and yield of snap
bean lines locally developed in Kenya. International Journal of Agronomy and
Agricultural Research, 3(7):1-10. Retrieved from the link
https://innspub.net/quality-and-yield-of-snap-bean-lines-locally-developed-in-
kenya/
Wairimu, N. G. (2015). Analysis of consumer preference in product attributes: a case
study of common beans in Kiambu county, Kenya. M.Sc. Thesis, Agribusiness
management and Trade, Kenyatta University.
Wang, N., & Daun, K. (2005). Determination of cooking times of pulses using an
automated Mattson cooker apparatus. Journal of the Science of Food and
Agriculture, 85(10):1631-1635. https://doi.org/10.1002/jsfa.2134
Wang, S., Chen, L., Yang, H., Gu, J., Wang, J., & Ren, F. (2020). Regular intake of
white kidney beans extract (Phaseolus vulgaris L.) induces weight loss compared
to placebo in obese human subjects. Food Science and Nutrition, 8:1315–1324.
doi: 10.1002/fsn3.1299
Wortmann, C. S., Kirkby, R. A., Eledu, C. A., & Allen, D. J. (1998). Atlas of common
bean (Phaseolus vulgaris L.) production in Africa. Centro Internacional de
Agricultura Tropical, (CIAT), Cali, Colombia 297:131 pages. Retrieved from the
link https://www.researchgate.net/publication/348860644
Yohannes, S., Loha, G., & Gessese, M. K. (2020). Performance evaluation of common
bean (Phaseolus vulgaris L.) genotypes for yield and related traits at Areka,
southern Ethiopia. Advances in Agriculture, 2020:1-8.
https://doi.org/10.1155/2020/1497530
Zaminder, N., Baghekhandan, S., Nasirpour, A., & Sheikhzeinoddin, M. (2013). Effect
of lime, soaking and cooking on water absorption texture and splitting of red
kidney beans. Journal of Food Science and Technology, 50(1):108-114.
https://doi.org/10.1007/s13197-011-0234-2
Zhang, X., Blair, M. W., & Wang, S. (2008). Genetic diversity of Chinese common
142
bean (Phaseolus vulgaris L.) landraces assessed with simple sequence repeat
markers. Theoretical and Applied Genetics, 117(4):629-640.
https://doi.org/10.1007/s00122-008-0807-2
Zilio, M., Souza, A. C., Coelho, M. C., & Jose, D. (2014). The genotype and crop
environment effect on the technological quality of common beans grains.
American-Eurasian Journal of Agriculture and Environmental Science, 14:212-
220. DOI: 10.5829/idosi.aejaes.2014.14.03.12315
Zuiderveen, G., Padder, B., Kamfwa, K., Song, Q., & Kelly, J. (2016). Genome-wide
association study of anthracnose resistance in Andean beans (Phaseolus vulgaris
L.). PLoS One, 11(6): e015639. https://doi.org/10.1371/journal.pone.0156391
143
APPENDICES
Appendix I: Analysis of variance for agronomic traits and cooking time of
common bean accession grown during year 2019/2020
Sources of Variation DF SS MS F-value Pr (>F)

(a) Days to flowering
Block 1 97.9 97.9 25.5 5.35E-07 ***
Seasons 3 3741.4 1247.1 324.2 < 2.2e-16 ***
Accessions 256 17172.3 67.1 17.4 < 2.2e-16 ***
Season X Accession 768 8689.2 11.3 2.9 < 2.2e-16 ***
Residuals 1027 3950.2 3.9
(b) Number of number pods per plant
Block 1 3170.8 3170.8 157.1 < 2.2e-16 ***
Seasons 2 28416.1 14208 704.1 < 2.2e-16 ***
Accessions 256 24841.4 97 4.8 < 2.2e-16 ***
Season X Accession 512 15160.5 29.6 1.5 7.73E-07 ***
Residuals 770 15538.8 20.2
(c) Days to maturity
Block 1 33.6 33.6 2.8 0.09
Seasons 3 11008.9 3669.6 307.6 < 2e-16 ***
Accessions 256 28478.5 111.2 9.3 < 2e-16 ***
Season X Accession 768 16235.9 21.1 1.8 < 2e-16 ***
Residuals 1027 12240.5 11.9
(d) Pods length (cm)
Block 1 44.7 44.7 23.2 1.70e-06 ***
Seasons 3 194.7 64.9 33.7 < 2.2e-16 ***
Accessions 256 4849.7 18.9 9.8 < 2.2e-16 ***
Residuals 1027 1978.5 1.9
(e) Number of seeds per pod
Block 1 5.2 5.2 9.1 2.66E-03 **
Seasons 3 226.4 75.5 131.6 < 2.2e-16 ***
Accessions 256 885.1 3.5 6.0 < 2.2e-16 ***
Residuals 1027 588.2 0.6
(f) Number of 100-seed weight
Block 1 56 56.2 2.8 9.31e-02
Seasons 3 1272 424.1 21.3 2.12e-13 ***
Accessions 256 333195 1301.5 65.4 < 2.2e-16 ***
Season X Accession 768 22658 29.5 1.5 2.04e-09 ***
Residuals 1027 20429 19.9
(g) Seed yield (Kgha-1)
Block 1 17025456 17025456 101.5 < 2.2e-16 ***
Seasons 3 2.15E+08 71647938 427.2 < 2.2e-16 ***
Accessions 256 5.69E+08 2222240 13.3 < 2.2e-16 ***
Season X Accession 768 4.21E+08 548375 3.3 < 2.2e-16 ***
144
Residuals 1027 1.72E+08 167714
(h) Cooking time of fresh and aged seeds (min)
Block 1 8.0 7.7 0.5 4.65E-01
Storage 1 26823.0 26822.9 1860.8 <2e-16 ***
Accessions 230 76213.0 331.4 23.0 <2e-16 ***
Accession X Storage 230 31164.0 135.5 9.4 <2e-16 ***
Residuals 461 6645.0 14.4
DF=Degree of freedom, SS=Sum of squares, MS=Mean sum squares, , '*' ‘**’***= Significant at
P≤0.05, P≤0.01 and P≤0.001 respectively
Appendix II: Analysis of variance for agronomic traits and cooking time of
recombinant lines derived from a cross of GLPx92 (pinto) X GLP2 (rosecoco)

(a) Days to flowering
Block 1 1.6 1.6 1.2 2.79e-01
Maternal effect 1 108.7 108.7 80.7 3.19e-16 ***
RIL 189 3859.6 20.4 15.2 < 2.2e-16 ***
Residuals 183 246.5 246.5 1.347
(b) Days to maturity
Block 1 34.4 34.4 9.9 1.91e-03 **
Maternal effect 1 66.9 66.9 19.3 1.89e-05 ***
RIL 189 6537.7 34.6 10.0 < 2.2e-16 ***
Residuals 183 634 3.5
(c) Number of pods per plant
Block 1 1162.5 1162.5 155.9 < 2.2e-16 ***
Maternal effect 1 42.6 42.7 5.7 1.78e-02 *
RIL 189 2984.3 15.8 2.1 2.35e-07 ***
Residuals 183 1364.9 7.5
(d) Pod length (cm)
Block 1 5.34 5.3 13.2 3.58e-04 ***
Maternal effect 1 0.59 0.6 1.5 2.28e-01
RIL 189 671.2 3.6 8.8 < 2.2e-16 ***
Residuals 183 73.84 0.4
Block 1 1.723 1.7 9.1 2.95E-03 **
Maternal effect 1 0.428 0.4 2.3 1.35E-01
RIL 189 194.3 1.0 5.4 < 2.2e-16 ***
Residuals 183 34.7 0.2
(f) 100 seed weight (g)
Block 1 39.4 39.4 15.8 0.0 ***
Maternal effect 1 20.9 20.9 8.4 0.0 **
RIL 189 20311.4 107.5 43.0 < 2.2e-16 ***
Residuals 183 457.1 2.5
145
(g) Cooking time (min)
Block 1 5 5.4 0.8 3.71e-01
Maternal effect 1 127 127.2 19.0 2.16e-05 ***
RIL 193 42572 220.6 32.9 < 2.2e-16 ***
Residuals 193 1294 9.1
DF=Degree of freedom, SS=Sum of squares, MS=Mean sum squares, '*' ‘**’***= Significant at
P≤0.05, P≤0.01 and P≤0.001 respectively
Appendix III: Analysis of variance for agronomic traits and cooking time of
recombinant inbred lines derived from a cross of GLPx92 (pinto) X
GBK035420 (black coloured)

(a) Days to Flowering
Block 1 0.36 0.4 0.4 5.38E-01
Maternal effect 1 9.41 9.4 9.9 1.98E-03 **
RIL 166 2936.5 17.7 18.6 < 2.2e-16 ***
Residuals 165 157.14 1.0
(b) Days to maturity
Block 1 41.7 41.7 26.6 7.18E-07 ***
Maternal effect 1 39.2 39.2 25.0 1.48E-06 ***
RIL 166 3875.3 23.3 14.9 < 2.2e-16 ***
Residuals 165 258.8 1.6
(c) Number of pods/plant
Block 1 763.5 763.6 64.9 1.52E-13 ***
Maternal effect 1 88.3 88.3 7.5 6.84E-03 **
RIL 166 4168.4 25.1 2.1 7.66E-07 ***
Residuals 165 1942.5 11.8
(d) Pod length (cm)
Block 1 2.04 2.0 10.8 1.26E-03 **
Maternal effect 1 0.165 0.2 0.9 3.52E-01
RIL 166 140.674 0.8 4.5 < 2.2e-16 ***
Residuals 165 31.249 0.2
Block 1 2.166 2.2 15.2 1.41E-04 ***
Maternal effect 1 0.955 1.0 6.7 1.05E-02 *
RIL 166 95.758 0.6 4.0 < 2.2e-16 ***
Residuals 165 23.522 0.1
(f) 100-seed weight (g)
Block 1 122.4 122.4 69.7 2.63E-14 ***
Maternal effect 1 256.3 256.3 146.0 < 2.2e-16 ***
RIL 166 4650.6 28.0 16.0 < 2.2e-16 ***
Residuals 165 289.6 1.8
146
(g) Cooking time (min)
Block 1 0 0.0 0.0 9.48E-01
Maternal effect 1 37.4 37.4 5.9 1.60E-02 *
RIL 198 29202.1 147.5 23.3 < 2.2e-16 ***
Residuals 197 1247.2 6.3
DF=Degree of freedom, SS=Sum of squares, MS=Mean sum squares, '*' ‘**’***= Significant at
P≤0.05, P≤0.01 and P≤0.001 respectively, RIL=Recombinant inbred lines.
Appendix IV: Average rainfall and temperature for Juja area in the year
2018/2019
Rainfall (mm) Temperature (oC)

Month 2018 2019 2018 2019
1 38.0 34.0 21.7 21.1
2 27.0 17.8 21.1 19.7
3 33.0 36.0 20.1 20.2
4 60.0 63.9 20.5 20.3
5 45.0 48.6 19.5 20.0
6 11.0 6.8 18.9 17.9
7 8.0 10.0 16.5 17.0
8 7.0 8.0 17.0 18.0
9 4.0 5.0 19.0 19.4
10 30.0 27.0 19.5 20.5
11 43.0 62.2 19.4 20.0
12 27.0 24.5 19.2 19.5
147

Plant Breeding

Uploaded by

Copyright:

Available Formats

Plant Breeding

Uploaded by

Document Information

Original Description:

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Plant Breeding

Uploaded by

Copyright:

Available Formats

PHENOTYPING AND QUANTITATIVE TRAIT LOCI

MAPPING OF THE HARD-TO-COOK AND

SAMUEL WANJOHI WAHOME

JOMO KENYATTA UNIVERSITY

Samuel Wanjohi Wahome

A Thesis Submitted in Partial Fulfilment of the Requirements for

contribution in various ways.

conceptualisation, experimentation, data analysis and write up of the research study. My

utmost gratitude goes to ‘Vlaamse Interuniversitaire Raad voor Universitaire

Ontwikkelingssamenwerking’ (VLIRUOS) for awarding me a study scholarship through

QTL analysis by Dr. Manje Gowda of CIMMYT is highly appreciated.

DEDICATION .................................................................................................................... III

TABLE OF CONTENT ...................................................................................................... V

LIST OF TABLES ............................................................................................................. XI

LIST OF FIGURES ........................................................................................................ XIII

LIST OF APPENDICES ..................................................................................................XV

LIST OF ABBREVIATIONS AND ACRONYMS ...................................................... XVI

ABSTRACT .................................................................................................................. XVIII

CHAPTER ONE .................................................................................................................. 1

1.1 Background information .................................................................................................. 1

1.2 Statement of the problem ................................................................................................. 3

1.3 Justification of the study .................................................................................................. 4

1.4 Objectives ........................................................................................................................ 5

1.4.1 Main objective .............................................................................................................. 5

1.4.2 Specific objectives ........................................................................................................ 5

1.5 Null hypotheses ................................................................................................................ 5

CHAPTER TWO ................................................................................................................. 7

LITERATURE REVIEW ................................................................................................... 7

2.3 Nutritional quality and health benefits of common beans ............................................. 10

2.4 Common bean production in eastern Africa .................................................................. 12

2.5 Seed yield ....................................................................................................................... 14

2.6 Storage, processing, and cooking quality of common beans ......................................... 15

2.7 Mechanism of common bean cotyledon hardening ....................................................... 16

2.8 Genetics of cooking time ............................................................................................... 18

2.9 Application of genetic markers ...................................................................................... 19

2.10 Quantitative Trait Loci (QTL) mapping ...................................................................... 20

2.11 Genome-Wide Association Studies ............................................................................. 22

CHAPTER THREE ........................................................................................................... 24

PHENOTYPING FOR YIELD-RELATED AGRONOMIC TRAITS IN A PANEL

OF LOCALLY CONSERVED COMMON BEAN (PHASEOLUS VULGARIS L.)

3.1 Abstract .......................................................................................................................... 24

3.2 Introduction .................................................................................................................... 25

3.3 Materials and methods ................................................................................................... 26

3.3.1 Field experimental site ................................................................................................ 26

3.3.2 Plant materials ............................................................................................................. 26

3.3.3 Experimental design and trial management ................................................................ 28

3.3.4 Agronomic data collection .......................................................................................... 29

3.4 Results ............................................................................................................................ 31

3.4.2 Estimation of genetic variables for traits measured .................................................... 32

3.4.3 Duration to flowering and maturity, and yield-related traits ...................................... 33

3.4.4 Cluster and correlation results..................................................................................... 37

3.4.5 Grain yields for common bean seed classes ............................................................... 39

3.5 Discussion ...................................................................................................................... 41

3.6 Conclusion ..................................................................................................................... 46

CHAPTER FOUR .............................................................................................................. 47

GENOME WIDE ASSOCIATION STUDY OF VARIATION IN COOKING TIME

AMONG COMMON BEAN (PHASEOLUS VULGARIS L.) ACCESSIONS USING

DIVERSITY ARRAYS TECHNOLOGY MARKERS .................................................. 47