Applied Aquaculture Biofloc Technology

APPLIED AQUACULTURE
BIOFLOC TECHNOLOGY
The intent of this book is to provide a detailed and specific set of guidelines for
both aquapreneurs and researchers related to the application of Biofloc
Technology in aquaculture. The goal of the book is to remove the false claims
and untrue stories on biofloc from scientific point of view as it is applied to
aquaculture and to provide a guide for its accurate application. This book
discusses key issues related to both adoption and practices for aquaculture
businesses, how to monitor and assess quality and quantity of biofloc, and how
to manage the microbial composition and sludge reduction risk in the fish and
shrimp culture. The book works through the specific application of disease and
feed management tools for aquaculture from the perspective of this technology.
Particular attention is paid on comparing the prototypes of floc development and
evaluation on its efficacy in aquaculture. A section on application of biofloc
technology in research should assist aquaculture researchers to avoid common
mistakes. Additional chapter on design and operation of exsitu bioreactor models
provide a sense of more applicability in replacing fish meal.
Prof. S. Felix has 38 years of teaching and research experience in aquaculture.

He is the Past President of World Aquaculture Society-Asian Pacific Chapter and
he has also served as the Director of the World Aquaculture Society (APC). Prof.
S.Felix has served as Second Vice Chancellor of Tamil Nadu Dr. J. Jayalalithaa
Fisheries University and also served as Dean of the Fisheries College in
Tamilnadu, India.
Dr. 0 Menaga is currently working as an Assistant Professor in the
Department of Aquaculture at Tamil Nadu Dr.J Jayalalithaa Fisheries
University and she’s also the Student Director of World Aquaculture Society- Asia
Pacific Chapter. She has a M.F.Sc in Aquaculture from Central Institute of Fisheries
Education, Mumbai and a Ph.D. in Tamil Nadu Dr.J Jayalalithaa Fisheries
University (TNJFU).
APPLIED AQUACULTURE
BIOFLOC TECHNOLOGY
S. Felix
Former Vice Chancellor
Tamilnadu Dr. J.J. Fisheries University
Vettar River View Campus,
Nagapattinam, Tamil Nadu 611002
and
M. Menaga
Assistant Professor
Tamilnadu Dr. J.J. Fisheries University
Vettar River View Campus,
Nagapattinam, Tamil Nadu 611002
NARENDRA PUBLISHING HOUSE

DELHI (INDIA)
First published 2022
by CRC Press
2 Park Square, Milton Park, Abingdon, Oxon, OX14 4RN
and by CRC Press
6000 Broken Sound Parkway NW, Suite 300, Boca Raton, FL 33487-2742
© 2022 Narendra Publishing House
CRC Press is an imprint of Informa UK Limited
The right of S. Felix and M. Menaga to be identiﬁed as authors of this work has been
asserted in accordance with sections 77 and 78 of the Copyright, Designs and Patents
Act 1988.
All rights reserved. No part of this book may be reprinted or reproduced or utilised in
any form or by any electronic, mechanical, or other means, now known or hereafter
invented, including photocopying and recording, or in any information storage or
retrieval system, without permission in writing from the publishers.
For permission to photocopy or use material electronically from this work, access www.
copyright.com or contact the Copyright Clearance Center, Inc. (CCC), 222 Rosewood
Drive, Danvers, MA 01923, 978-750-8400. For works that are not available on CCC
please contact [email protected]
Trademark notice: Product or corporate names may be trademarks or registered
trademarks, and are used only for identiﬁcation and explanation without intent to
infringe.
Print edition not for sale in South Asia (India, Sri Lanka, Nepal, Bangladesh, Pakistan
or Bhutan).
British Library Cataloguing-in-Publication Data
A catalogue record for this book is available from the British Library
Library of Congress Cataloging-in-Publication Data
A catalog record has been requested
ISBN: 978-1-032-15124-3 (hbk)
ISBN: 978-1-003-24261-1 (ebk)
DOI: 10.1201/9781003242611
Contents
Preface ...................................................................................... vii
1. Applied Aquaculture Biofloc Technology...................................... 1
2. In-situ and Ex-situ Biofloc on Immune Response of

Gift Tilapia .................................................................................. 25
3. Fertilization Prototype on Biofloc Development in

Gift Tilapia Culture ..................................................................... 59
4. Distillary Spent Wash as a Carbon Source in Intensive Biofloc

Nursery Rearing of Penaeus vannamei .................................... 83
5. In-vivo Study of Bacillus sp Isolated from Biofloc System

in Gift Tilapia ............................................................................ 113
6. Probiotic Potential of Bacillus Strains of Biofloc System

on Growth Performance in Penaeus vannamei ...................... 137
7. Extra Cellular Polymer Substances (EPS) Producing Bacteria

From Biofloc of Nile Tilapia Culture System
using Distillery Spent Wash as Carbon Source ........................ 175
8 Ex-situ Production of Biofloc in In-Pond Raceways and

Photobioreactor ......................................................................... 195
v
Preface
T he expansion of the aquaculture production is restricted

due to the pressure it causes on the environment by the
discharge of waste products in the water bodies and by its
dependence on fishoil and fishmeal. Aquaculture using biofloc
technology (BFT) offers a solution to both problems. It combines
the removal of nutrients from the water with the production of
microbial biomass, which can be adopted in-situ and ex-situ
wise by the culture species as additional food source.We are very
much concerned about our contribution in promoting this
technology as the science behind the technology has not reached
the aquapreneuers adequately and considering the current trend
of exploitation of resources and methods of production this
technology will be the most ideal culture technique for
aquaculture. Biofloc technology in the past decade has taken
great leaps forward in efficiency and hence economic viability
through a wide range of technological advances has been achieved
in several countries. Presently, our ability to understand the
environmental costs of industrial farming increases, we are more
capable of developing technologies to ensure that farming is more
productive and less damaging to the environment. This eco-
friendly technology allows us to be more productive, and although
we have no certainty that we can and will effectively solve climate
change, we still have hope that there will be a future where
people will be healthy and fed with nutritious food. We make an
unique effort to explore the applications of biofloc technology as
vii
we, realise that we are but small fry in a world of much bigger
fish, but we are more than hopeful, indeed confident, that biofloc
technology has a role to play in the world’s future food production.
This volume is testament to the knowledge and enthusiasm we
have in promoting this green aqua farming technique with a
motive of reducing carbon emission in aquaculture. We made
strenuous effort and we are sure this would definitely pave a way
to learn the applications of the biofloc technology along with the
knowhows on operation and maintenance. This Volume-I will
agument our capability to steer the microbial aggregation to
obtain optimal morphological characteristics (floc size and floc
size distribution) to serve as food for the culture species. Our
research focusing on the nutrient removal from the water and on
the compositional aspects (protein, polyunsaturated fatty acids,
lipids, poly-E-hydroxybutyrate, etc) of the bioflocs, was also dealt
in this book for the added value for aquaculture.
S. Felix
M. Menaga
viii
APPLIED AQUACULTURE BIOFLOC TECHNOLOGY
CHAPTER 1
APPLIED AQUACULTURE BIOFLOC

TECHNOLOGY
A quaculture as a food-producing sector is recognized for its

ability to contribute to the global fish supply. Aquaculture
production is projected to rise to 82 million tonnes in 2050
(FAO, 2016). To prevent and treat diseases in aquatic animals,
antibiotics have been used for improving aquaculture production.
Frequent usage of antibiotics may result in the development of
antibiotic resistant bacteria, antibiotic residues in the flesh and
the microbial population destruction in the aquatic environment
(Marques et al., 2005). This leads to the adoption of various
alternative strategies for the antibiotic including the use of pre
and probiotics. Sustainable intensification by the adoption of
advanced culture systems and technologies becomes inevitable to
improve the production and productivity of the sector. One of
such advanced technologies is biofloc technology (BFT) also
called as aerobic microbial floc (AMF), a minimal or zero water
exchange technology, which allows the animals to stock at higher
densities. Bioflocs are conglomerates of algae, bacteria, protozoans,
1
faecal matter and uneaten feed which are held together in a loose
matrix by the secretions of filamentous microorganisms or by
electrostatic attraction (Hargreaves, 2013). Their growth is
influenced by various physico chemical factors such as
temperature, pH, salinity and aeration of the culture systems.
The growth and stability of the flocs formed can also be
determined by using different carbon sources and at various
C/N ratios. This technology by maintaining the carbon and
nitrogen in the culture water uses the dense microbial biomass
to strip the ammonia and serves as a nutritional supplement
(Schneider et al., 2005). Unlike Recirculatory Aquaculture
Systems (RAS) this technology does not require any external
filtration rather dense microbial biomass, strips the ammonia in
turn to serve as a nutritional source. As biofloc technology deals
with bacteria and bacterial products bioflocs might also contain
immunostimulatory compounds such as PHB exhibiting possible
probiotic effect. The heterotrophic bacteria in biofloc (Halet
et al., 2007) produce some natural substances (Dinh et al., 2010;
Iyapparaj et al., 2013) and suppress the growth of other
pathogenic species like Vibrio harveyi (Defoirdt et al., 2007).The
various carbon sources such as rice bran, rice flour, and wheat
flour have been previously used for the floc development. These
carbon sources tend to slowly dissolve in water thereby increasing
the suspended solids concentration. The distillery spent wash
considered as a major waste from sugarcane industry with a
higher dissolving capacity than the complex carbon sources can
be used. They have the ability to rapidly release the carbon sources
paving the way for the heterotrophic bacteria to assimilate the
ammonia with decreased concentrations of TSS thereby
2
maintaining an ideal water quality (Felix et al., 2015). The use

of distillery spent wash as a carbon source has been recommended
for shrimp as well as GIFT Tilapia (Menaga et al., 2017). The
nutrient profile of biofloc ranges from 25 to 50 percent of protein
and 0.5 to 15 percent of fat on dryweight basis. Bioflocs are also
valuable source of limiting amino acids such as methionine and
lysine, vitamins (Vitamin C in range of 0 to 54 μg /g dry matter)
and limiting mineral such as phosphorus (Crab, 2010). In aqua
feeds, dried biofloc can be used possibly to replace fishmeal or
soybean meal as cheaper sources of protein. Extensive and
traditional systems with no or little use of fishmeal supplies
nutrient-rich materials to the culture water enhancing the growth
of algae and other indigenous organisms on which the fish can
feed (Naylor et al., 2000).The effluent waters from aquaculture
systems were used for ex-situ biofloc production in suspended
growth bioreactors. The bioflocs produced can be dried and
used as a feed supplement for shrimp or fish (Kuhn and
Lawrence, 2012).The use of biofloc as a feed has been studied in
aquaculture and the uptake of biofloc as feed depends on the
nature of species and its feeding ability, size of the animal and
floc and the density of floc (Avnimelech, 2009).The findings
from the previous study proved that freshwater prawn, shrimp
and tilapia uptake the biofloc as the additional protein source
indicating that it can be applicable to both freshwater and
seawater culture (Crab, 2010; Crab et al.,2009, 2010a). Biofloc
helps in the potential feed gain with decreased production cost
(Craig and Helfrich, 2002) which can be estimated to be in the
order of 10– 20% (De Schryver et al., 2008).
3
DIFFERENT TYPES OF BIOFLOC SYSTEMS

Various biofloc systems have been evaluated in research and are
also used in commercial aquaculture. The type includes the system
that is sunlight dependant and sunlight independant. The
outdoor system includes lined ponds or tanks and indoor system
includes lined raceways in green houses for the culture of shrimp
or tilapia. In “green water” biofloc systems a conglomerate of
algae and bacteria controls water quality. Most of the biofloc in
outdoor commercial system use green water. However, some
biofloc systems (raceways and tanks) with no exposure to natural
light have been installed in closed buildings. These systems are
categorized as “brown- water” biofloc systems which involves
bacterial processes for controlling water quality (Hargreaves,
2013). Hargreaves (2013) stated the types of phytoplankton
addition in the biofloc culture system. They can be added through
the water at the time of system start-up or inoculated from the
phytoplankton stock. He also stated that in green-water biofloc
system, phytoplankton are the major groups involved in
maintaining the water quality by assimilation of excess ammonia-
nitrogen. Phytoplankton due to is autotrophic nature by involving
in photosynthesis enriches the culture system with the oxygen
produced. Choo et al., (2015) observed that in indoor tanks
ammonia concentrations are mainly controlled by the
heterotrophic bacterial population in the biofloc. In indoor system,
C/N ratio is increased through supplementation of an organic
carbon or reduced protein levels in feed, the heterotrophic bacteria
create a demand for nitrogen in the form of ammonia in the
water and as organic carbon and inorganic nitrogen are generally
taken up by the bacteria controlling the ammonia concentration.
4
McIntosh (2001) reported the biofloc types based on the colour

as green, brown and black and when ingested the animals showed
an improved results in both shrimp as well as fishes.
In-situ and Ex-situ Culture in Biofloc Technology

In biofloc systems, intake of microbial flocs in insitu manner and
the supplementation of processed floc as feed ingredient has
been evaluated (Kuhn et al., 2009, 2010; Anand et al., 2014). Ju
et al., (2008) showed that the free amino acid concentrations like
alanine, glutamate, arginine and glycine,which serve as an
attractants in shrimp diet (Nunes and Martin, 2004), are known
to be present in bioflocs. Bioflocs are considered as food particles
by some micro and macro aquaculture organisms since it is
suggested that the nutrient levels in bioflocs were similar to the
fish commercial diet. Furthermore, in larviculture, application
of biofloc technology may provide food source that are easily
accessible for the larvae beside the intake of commercial diets,
thus serves as an alternative strategy for reducing cannibalism
during feeding (Ekasari et al., 2015). In culture ponds or tanks
insitu bioflocs are formed by management of carbon and nitrogen
ratio (C:N) to values of 8:1 or higher by the supplementation of
carbon source such as glycerine, sucrose, molasses and calcium
acetate. In other way, low protein feeds can also be used to
maintain a higher C: N ratio in the culture water. Heterotropic
bacteria are the primary components of bioflocs under the
conditions of higher C:N ratios for the intake of these bioflocs
by shrimp and fish(Kuhn et al., 2010).’ Avnimelech et al., (1986)
stated that biofloc technology retains waste and converts into
5
food. Avnimelech (1999) found 20% reduction in feed

requirement, while culturing tilapia in pond in which animal
can utilize the biofloc and digest it as insitu food source which
was available for 24 hours in the culture system. Hari et al.,
(2006) showed the stimulation of heterotrophic bacteria for the
synthesis of microbial protein by increasing the C/N ratio
through external carbohydrate addition to the culture systems.
The biofloc technology (BFT) is an advanced technique deployed
in aquaculture for maintaining the optimal water quality
parameters with the development of heterotrophic microbial
biofloc by supplementing carbohydrate source to the culture
water (Avnimelech et al., 1989; Avnimelech, 1999; Crab et al.,
2007; Crab et al., 2009; Crab et al., 2010a).Sinha et al., (2008)
further reviewed the prospective use of biofloc as a functional
ingredient in aquaculture and suggested that insitu biofloc culture
can be an alternative strategy for disease management to other
existing applications such as use of probiotic, antibiotic and
prebiotic. Hargreaves (2013) reported that insitu shrimp culture
water, boost the growth of animal and floc since it possess growth
stimulating components such as microbial and animal proteins,
and can be used as a food source for the grazers like shrimp or
tilapia. The formation of ex-situ biofloc is carried out in
suspended-growth biological reactors where settled solids and
nitrate were removed from aquaculture used culture waters. To
promote biological activity carbon supplementation can be
adopted in the bioreactors. The used culture water from
aquaculture ponds can be diverted for biofloc production using
biological reactors or fermentors (Kuhn and Lawrence, 2012).
Kuhn et al., (2009) prepared ex-situ biofloc feed by using
6
sequential batch reactors, these biofloc meal were used as

ingredient for juvenile shrimp diet. On the other hand, biofloc
meal was produced with activated sludge system by Neto et al.,
(2015) fed to shrimp at 30% replacement of fishmeal in diet.
Hende et al., (2014) also reported the production of biofloc by
using pikeperch culture water treated in a pilot reactor. The
incorporation of biofloc meal at a rate of 80g/kg to the shrimp
diet showed no deleterious effect on growth and survival. Biofloc
meal produced from culture waters of super intensive shrimp
farm was reported by Bauer et al., (2012). Izquierdo et al., (2006)
have demonstrated that the supplementation of the floc to shrimp
in mesocosm culture reduced the use of fish oil in pelleted diets.
Ju et al., (2008) collected biofloc from marine shrimp culture
tanks as whole floc and with several extraction modes as a diet
or diet component for shrimp. McIntosh et al., (2000) analysed
suspended flocs from commercial shrimp ponds in BFT systems
at Belize. They found higher protein levels in suspended floc
derived from the floc compared to the commercial feeds. To
replace fishmeal or soybean meal in aqua feed, dried biofloc had
been proposed as an ingredient as biofloc meals are rich in
nutrients while they are also free from mycotoxins levels, anti-
nutritional factors and other components that restrict its use in
aqua feeds (Emerenciano et al., 2013). Large scale biofloc meal
production for use in aquaculture at commercial scale results in
the environmental advantages to various ecosystems, thus demand
of fish meal/oils an ingredient will be minimized (Kuhn et al.,
2010; Bauer et al., 2012).
7
BIOFLOC AS FEED
Owing to the increased demand of seafood for human
consumption, the demand for fishmeal and fish oil used for
aqua feed production by feed manufacturers also increases (Péron
et al., 2010). Besides its application in aquaculture, fish meal and
fish oil are used as feed ingredient for poultry, pigs and other
animal husbandry sectors. Aquaculture production relies on
capture fisheries, as fish oil and fish meal are important
components of the diet of many aquaculture species, both
herbivorous and carnivorous fishes. In aquaculture about 5–6
million tonnes of low-value/trash fish were used as feed or feed
ingredient (FAO, 2009). FAO (2009) reported that between
1992 and 2006, in aqua feeds the total amount of fishmeal and
fish oil used was grown more than three fold from 0.96-3.06
million tonnes and from 0.23 - 0.78 million tonnes, respectively.
Based on the feed conversion ratio of major aquaculture species,
an average of 1.9 kg of wild fish is needed for 1kg of fish
production (Naylor et al., 2000). An increased use of fish rates,
protein in terms of fish meal upto 2-5 times has been used in
many intensive and semi-intensive aquaculture systems (Naylor
et al., 2000). Therefore, recent research has focused on the
alternatives of fish oil and fishmeal, using cheaper sources of
plant and animal proteins. The use of fishmeal in extensive or
any conventional systems was limited due to the growth of algae
and other native microorganisms in the culture water compared
to intensive and semi intensive systems (Naylor et al., 2000).
Thus biofloc technology, was developed to overcome the use of
fishmeal as an alternative in intensive and semi-intensive systems.
Nitrogenous waste generated by the cultured organisms in biofloc
8
technology is converted into microbial protein through the external

supplementation of carbon source and hence insitu feed
production can be stimulated (Schneider et al., 2005).
BIOFLOC ON BIOSECURITY
In aquaculture development, green water technology has been
adopted with varied perceptions. So far, aquaculture has been
misunderstood due to the poor handling of antibiotics; which
encouraged scientists to discover new strategies for controlling
pathogenic infections (Naylor et al., 2000). According to Defoirdt
et al., (2011), in treating bacterial disease most antibiotics were
no longer effective because of the development of antibiotic
resistance. Crab et al., (2010) reported that in aquaculture
facilities biofloc technology could be an alternative strategy to
defend against bacterial pathogens. In bioflocs some groups of
bacteria tend to involve in cell-to-cell communication (quorum
sensing) with small signal molecules (Defoirdt et al., 2008). In
fact, Defoirdt et al., (2004) reported the expression of virulence
factors is disrupted by bacterial cell-to-cell communication to
maintain the healthy environment. Studies of Lezama-Cervantes
and Michel (2010) showed the increased primary production
and beneficial bacterial group promotion in insitu biofloc based
shrimp culture and to some extent it was proved in Tilapia
culture as well. Recently to provide in depth knowledge on disease
resistance towards pathogenic infections scientists have
hypothesized the presence of immunostimulatory compounds
in biofloc (Crab et al., 2012). According to Wang et al., (2008),
immuno-stimulants are group of active compounds which
includes complex carbohydrates, animal extracts, bacteria and
9
bacterial products, nutritional factors, cytokines, lectins and plant

extracts.
BIOFLOC ON PROBIOTIC EFFECT

In contrast to conventional approaches such as antibiotic,
antifungal, probiotic and prebiotic application biofloc can be a
novel strategy for aquatic health management. In BFT the
“possible probiotic” effect against Vibrio sp. and ectoparasites
either internally or externally was observed. Mostly bacteria and
large groups of microorganisms promote this effect. Internally,
bacteria and the bacterial products have a similar effect like
organic acids acting as an effective biocontrol agent to maintain
microbial balance in the gut (Sinha et al., 2008). The frequent
addition of carbon source in the water is known to promote
polyhydroxyalkanoates (PHA) accumulating bacteria and similar
groups of bacteria that accumulate PHA granules. Poly-B
hydroxybutyrate (PHB), a biodegradable polymer, the microbial
storage product is the single compound of a whole family
belonging to polyhydroxyalkanoates. PHB is produced from
soluble organic carbon by various microorganisms such as Bacillus
sp., Alcaligenes sp., Pseudomonas sp. and have a role in energy
storage and carbon metabolism (Sinha et al., 2008). Meanwhile
the presence of PHB in biofloc has been reported upto 16% on
dry weight basis (De Schryver et al., 2012). Different carbon
sources or carbon substrate structures will result in different
types of PHA (De Schryver et al., 2012). Under limiting nitrogen
conditions with excess carbon such granules are synthesized
(Sinha et al., 2008). The degradation of these polymers by
chemical and enzymatic hydrolysis in the animal gut could exert
10
antibacterial activity similar to organic acids and short chain

fatty acids SCFAs) (Yu et al., 2005). Enzyme hydrolysis takes
place by extracellular depolymerases activity of bacteria and fungi,
acting as antimicrobial agents against Vibrio sp. infections and
stimulates growth and survival of fish larvae and shrimp (De
Schryver et al., 2012). The working mechanism of antibacterial
activity of PHAs is not well understood (Sinha et al., 2008). As
they act similar to SCFA, the speculated working mechanism
includes (i) reduction of pH to increase the antibacterial activity
(Ricke, 2003); (ii) the pathogenic bacterial growth is inhibited
by its interaction on cell membrane structure and permeability,
depletion of ATP cellular energy, instability of internal proton
balance (Russel, 1992) and (iii) reduced virulence factor
expression influencing the gut health (Teitelbaum and Walker,
2002). To maximize PHA content in bioflocs further research is
needed for analysing and characterizing their bio-control
efficiency in host microbe systems (Sinha et al., 2008). Externally
against pathogens the working efficiency of biofloc
microorganisms seems to be affected through competition for
space, substrate and nutrients. Essentials nutrients such as
nitrogen are needed by both nitrifying bacteria vs Vibrio sp.
restricting their growth inhibiting compounds secreted by
beneficial microorganisms. The type of carbon source and light
intensity could also reduce the growth of pathogen. Unfortunately
in this field only limited information is available. Studies with
fish fingerlings (Ekasari et al., 2015) recorded that tilapia (initial
weight 0.98 ± 0.1g) reared under BFT exhibited lower degree of
parasitical infections in gills as compared to conventional water-
exchange system (CW) after 60 days.
11
BIOFLOC ON WATER QUALITY

In aquaculture to maintain optimum water quality biofloc
technology has become a sustainable technique and this can be
achieved with the presence of dense heterotrophic bacterial groups
with the supplementation of carbon source to the water
(Avnimelech et al., 1989; Avnimelech, 1999; Crab et al., 2007;
Crab et al., 2009). However, the evidences from the previous
studies showed that the type of carbon source influences the
culture water quality and nutritional composition of floc (Crab,
2010). According to Avnimelech and Ritvo (2003), only 25% of
the feed nutrients are fed by the culture animals leading to higher
nitrogen accumulation, particularly total ammonia nitrogen. In
aquaculture systems nitrogen pathways that naturally remove
ammonia nitrogen includes autotrophic mode of conversion from
ammonia-nitrogen to nitrate-nitrogen, Photoautotrophic removal
by algae and heterotrophic bacterial removal of ammonia-
nitrogen directly to microbial protein (Ebeling et al., 2006).
Therefore, the presence of dense heterotrophic microbial load in
ponds can speed up the biological removal of organic and
inorganic wastes in ponds (Avnimelech, 1986; Azim et al., 2003a).
Invitro Probiotic Properties

Multiple benefits of biofloc in sustainable disease management
practices for protecting the culture animal with proper biosecurity
measures was compared with the traditional aquaculture practices
such as use of probiotics, prebiotics and antibiotics by Sinha et
al., (2008).The heterotrophic bacterial dominance established by
maintaining C/N ratio in the water with the interventions in
12
using different external carbohydrate sources or by using low

protein feeds helps the bacteria to assimilate the ammonia for
converting to microbial biomass (Avnimelech, 1999).The
heterotrophic bacteria in biofloc (Halet et al., 2007) produce
some natural substances (Dinh et al., 2010; Iyapparaj et al., 2013)
and suppress the growth of other pathogenic species like Vibrio
harveyi (Defoirdt et al., 2007).
Polyhydroxy Butyrate (PHB) Producing Bacteria in

Biofloc Systems
Biofloc is the conglomeration of bacteria, plankton, algae, faecal
wastes and excess feed. PHB producing bacteria are found in
bioflocs and levels of PHBs in biofloc ranges from 0.5 -18% of
the dry matter (Crab 2010; De Schryver and Verstraete, 2009).
The presence of PHB producing bacteria in different ecologies
ranging from freshwater to marine water as well as in the
estuarine sediments and air was reported by Jendrossek &
Handrick (2002). Supplementation of PHB in feed improved
growth and survival of Macrobrachium rosenbergii (freshwater
prawn) larvae (Nhan et al., 2010), Oncorhynchus mykiss (rainbow
trout) (De Wet 2005), Dicentrarchus labrax (European seabass)
juveniles (De Schryver et al.,2010) and also showed protection
against vibriosis in Artemia franciscana (Defoirdt et al., 2007),
Eriocheir sinensis (Chinese mitten crab) larvae (Sui et al., 2012).
Extracellular Polysaccharides (EPS) Producing Bacteria

in Biofloc Systems
As sludge from aquaculture ponds is negatively charged they
13
can interact with EPS, a synthetic polymers in combination with

cations to neutralize the surface charges thereby aiding the
flocculation and settling (Higgins and Novak, 1997b). However
these synthetic polymers when added to the sludge water not
only enhance the flocculation and sludge dewatering but also
when discharged into the environment affects the soil
microorganism as a major disadvantage.
CONCLUSION
To support aquacultural growth, taking into account sustainability,
researchers stand for challenges regarding water quality control
tools and fish feed technology. This book aimed at evaluating
the possibility of using biofloc technology as a sustainable tool to
support the necessary future increase in aquaculture production
by accomplinning water quality control and immune
enhancement through insitu and exsitu feeding of biofloc. Due
to the novelty of the technique, many research fields remain
unexplored and further development of those domains is needed.
Since so many study directions show a great potential, the objective
here was to look at biofloc technology from various research
angles to enlighten the aspects of the advantages of biofloc
technology. This book was chose to enlighten an in depth research
on biofloc technology with respect to the microbial composition
and its role in biofloc to improve the over all performance of the
aquatic animals.
14
REFERENCES
Anand, P.S., Kohli, M.P.S., Sundaray, J.K., Roy, S.D.,
Venkateshwarlu, G., Sinha, A.,Pailan, G.H., 2014. Effect of
dietary supplementation of biofloc on growth per-formance and
digestive enzyme activities in Penaeus monodon. Aquaculture.
418, 108-115.
Avnimelech, Y., 1999. Carbon/nitrogen ratio as a control element
in aquaculture systems. Aquaculture. 176, 227–235.
Avnimelech, Y., Mokady, S., Schroeder, G.L. 1989. Circulated ponds
as efficient bioreactors for single cell protein production. Israeli
Journal of Aquaculture. 41(2), 58-66.
Avnimelech, Y., 1999. Carbon/nitrogen ratio as a control element
in aquaculture systems. Aquaculture. 176, 227–235.
Avnimelech, Y., 2009. Biofloc technology: a practical guide book.
World Aquaculture Society.
Avnimelech, Y., Weber, B., Hepher, B., Milstein, A., Zorn, M.,
1986. Studies in circulated fish ponds: organic matter recycling
and nitrogen transformation. Aquaculture Research.17(4), 231
242.
Avnimelech, Y., Ritvo, G., 2003. Shrimp and fish pond soils:
processes and management. Aquacult. 220(1-4), 549-567.
Azim, M.E., Milstein, A., Wahab, M.A., Verdegam, M.C.J., 2003.
Periphyton–water quality relationships in fertilized fish ponds
with artificial substrates. Aquacult. 228, 169-187.
Bauer, W., Prentice-Hernandez, C., Tesser, M. B., Wasielesky Jr,
W., Poersch, L. H., 2012. Substitution of fishmeal with
microbial floc meal and soy protein concentrate in diets for the
pacific white shrimp Litopenaeus vannamei. Aquaculture.342,
112-116.
15
Craig, S., Helfrich, L.A., 2002. Understanding Fish Nutrition, Feeds

and Feeding (Publication 420–256). Virginia Cooperative
Extension, Yorktown (Virginia).4 pp.
Crab, R., 2010. Bioflocs technology: an integrated system for the
removal of nutrients and simultaneous production of feed in
aquaculture. PhD thesis submitted to Ghent University. 178
pp
Crab, R., Kochva, M., Verstraete, W., Avnimelech, Y., 2009.Bio
flocs technology application in over-wintering of
tilapia.Aquaculture Engineering. 40, 105–112.
Crab, R., Chielens, B., Wille, M., Bossier, P., Verstraete, W., 2010a.
The effect of different carbon sources on the nutritional value
of bioflocs, a feed for Macrobrachium rosenbergii postlarvae.
Aquaculture Research. 41, 559–567.
Choo, H.X., Caipang, C.M.A., 2015. Biofloc technology (BFT)
and its application towards improved production in freshwater
tilapia culture. Aquac. Aquar. Conserv. Legis Int. J of Bioflux
(AACL Bioflux). 8(3).
Crab, R., Avnimelech, Y., Defoirdt, T., Bossier, P., Verstraete, W.,
2007. Nitrogen removal techniques in Aquaculture for a
sustainable production. Aquacult. 270, 1–14.
Crab, R., Defoirdt, T., Bossier, P., Verstraete, W., 2012. Biofloc
technology in aquaculture: beneficial effects and future
challenges. Aquaculture. 356, 351-356.
Dinh, T.N., Wille, M., De Schryver, P., Defoirdt, T., Bossier, P.,
Sorgeloos, P., 2010. The effect of poly-β-hydroxybutyrate on
larviculture of the giant freshwater prawn (Macrobrachium
rosenbergii). Aquaculture.302, 76–81.
Defoirdt, T., Halet, D., Vervaeren, H., Boon, N., Van de Wiele, T.,
Sorgeloos, P., Bossier, P., Verstraete, W., 2007. The bacterial
storage compound poly-β-hydroxybutyrate protects Artemia
16
franciscana from pathogenic Vibrio campbelli. Environmental

Microbiology. 9 (2), 445–452.
De Schryver, P., Crab, R., Defoirdt, T., Boon, N., Verstraete, W.,
2008. The basics of bioflocs technology: the added value for
aquaculture. Aquaculture. 277, 125–137.
Defoirdt, T., Sorgeloos, P., Bossier, P., 2011. Alternatives to
antibiotics for the control of bacterial disease in aquaculture.
Current opinion in microbiology. 14(3), 251-258.
Defoirdt, T., Boon, N., Sorgeloos, P., Verstraete, W., Bossier, P.,
2008. Quorum sensing and quorum quenching in Vibrio harveyi:
lessons learned from in vivo work. The ISME journal.2(1),19.
Defoirdt, T., Boon, N., Bossier, P., Verstraete, W., 2004. Disruption
of bacterial quorum sensing: an unexplored strategy to fight
infections in aquaculture. Aquaculture.240(1-4), 69-88.
De Schryver, P., Boon, N., Verstraete, W., Bossier, P., 2012. The
biology and biotechnology behind bioflocs. In Biofloc
technology: a practical guide book. World Aquaculture Society
(WAS). pp. 199-215.
Dinh, T.N., Wille, M., De Schryver, P., Defoirdt, T., Bossier, P.,
Sorgeloos, P., 2010.The effect of poly-â-hydroxybutyrate on
larviculture of the giant freshwater prawn (Macrobrachium
rosenbergii). Aquaculture.302, 76–81.
De Schryver, P., Verstraete, W., 2009. Nitrogen removal from
aquaculture pond water by heterotrophic nitrogen assimilation
in lab-scale sequencing batch reactors. Bioresource Technology.
100(3), 1162-1167.
De Wet, L., 2005. Can organic acids effectively replace antibiotic
growth promotants in diets for rainbow trout Oncorhynchus
mykiss raised under sub-optimal water temperatures. Abstract
CD-Rom. World Aquaculture Society.9–13.
17
De Schryver, P., Sinha, A.K., Baruah, K., Verstraete, W., Boon, N.,
De Boeck, G., Bossier, P., 2010. Poly-beta-hydroxybutyrate
(PHB) increases growth performance and intestinal bacterial
range-weighted richness in juvenile European sea bass,
Dicentrarchus labrax. Appl. Microbiol. Biotechnol. 86, 1535–
1541
Emerenciano, M., Cuzon, G., Paredes, A., Gaxiola, G., 2013.
Evaluation of biofloc technology in pink shrimp
Farfantepenaeus duorarum culture: growth performance, water
quality, microorganisms profile and proximate analysis of biofloc.
Aquaculture international.21(6), 1381-1394.
Ebeling, J.M., Timmons, M.B., Bisogni, J.J., 2006. Engineering
analysis of the stoichiometry of photoautotrophic, autotrophic,
and heterotrophic removal of ammonia- nitrogen in aquaculture
systems. Aquacult. 257, 346–358.
Ekasari, J., Rivandi, D.R., Firdausi, A.P., Surawidjaja, E.H., Zairin
Jr, M., Bossier, P., De Schryver, P., 2015. Biofloc technology
positively affects Nile tilapia (Oreochromis niloticus) larvae
performance. Aquaculture. 441, 72-77.
FAO, 2016. The State of World Fisheries and Aquaculture(SOFIA):
Contributing to food security and nutrition for all. Food and
Agriculture Organization (FAO), Rome. 200p.
Felix, S., Antony Jesu Prabhu, P., Cheryl Antony, Gopalakannan,
A., Rajaram, R., 2015.Studies on nursery rearing of Genetically
Improved Farmed Tilapia (GIFT) in Biosecured raceway systems
in India. J. Indian Fish. Assoc. 42, 1-10.
FAO (Food and Agriculture Organization of the United Nations).
2009. Fishmeal market report — May 2009. Food and
Agriculture Organization of the United Nations Globefish.
18
Hargreaves, J.A., 2013. Biofloc production systems for aquaculture.1

11.
Halet, D., Defoirdt, T., Van Damme, P., Vervaeren, H., Forrez, I.,
Van de Wiele, T., Boon, N.,Sorgeloos, P., Bossier, P., Verstraete,
W., 2007. Poly-β-hydroxybutyrate-accumulating bacteria protect
gnobiotic Artemia franciscana f rom pathogenic Vibrio
campbelli. FEMS Microbiology Ecology. 60, 363–369
Hari, B., Kurup, B.M., Varghese, J.T., Schrama, J.W., Verdegem,
M.C.J., 2006. The effect of carbohydrate addition on water
quality and the nitrogen budget in extensive shrimp culture
systems. Aquacult. 252, 248-263.
Hende, S.F.D., Claessens, L., Muylder, E.D., Boon, N., Vervaeren,
H., 2014. Microbial bacterial flocs originating from aquaculture
wastewater treatment as diet ingredient for Litopenaeus
vannamei (Boone). Aquac Res. 47, 1075 – 1089
Halet, D., Defoirdt, T., Van Damme, P., Vervaeren, H., Forrez, I.,
Van de Wiele, T., Boon, N.,Sorgeloos, P., Bossier, P., Verstraete,
W., 2007. Poly-β-hydroxybutyrate-accumulating bacteria protect
gnobiotic Artemia franciscana f rom pathogenic Vibrio
campbelli. FEMS Microbiology Ecology. 60, 363–369.
Higgins, M.J., Novak, J.T., 1997b. Characterization of exocellular
protein and its role in bioflocculation, J. Environ. Eng. 123,
479–485.
Iyapparaj, P., Maruthiah, T., Ramasubburayan, R., Prakash, S.,
Kumar, C., Immanuel, G., Palavesam, A., 2013.Optimization of
bacteriocin production by Lactobacillus sp. MSU3IR against
shrimp bacterial pathogens. Aquatic Biosystems.9 (1), 12
Izquierdo, M., Forster, I., Divakaran, S., Conquest, L., Decamp, O.,
Tacon, A., 2006. Effect of green and clear water and lipid
source on survival, growth and biochemical composition of
19
Pacific white shrimp Litopenaeus vannamei. Aquacult. Nutr.12,

192- 202.
Ju, Z.Y., Forster, I., Conquest, L., Dominy, W., 2008. Enhanced
growth effects on shrimp (Litopenaeus vannamei) from
inclusion of whole shrimp floc fractions to a formulated diet.
Aquac.Nutr.14, 533e543.
Jendrossek, D., Handrick, R., 2002. Microbial degradation of
polyhydroxyalkanoates. Annual Review of Microbiology. 56(1),
403-432.
Kuhn, D.D., Boardman, G.D., Lawrence, A.L., Marsh, L., Flick,
G.J., 2009. Microbial floc meal as a replacement ingredient for
fish meal and soybean protein in shrimp feed. Aquaculture.
296, 51-57.
Kuhn, D.D., Lawrence, A.L., Boardman, G.D., Patnaik, S., Marsh,
L., Flick, G.J., 2010. Evaluation of two types of bioflocs derived
from biological treatment of fish effluent as feed ingredients
for Pacific white shrimp, Litopenaeus vannamei. Aquaculture.
303, 28-33.
Kuhn, D.D., Lawrence, A., 2012. Ex-situ biofloc technology. In:
Biofloc Technology a practical guide book. (2nd edition).edited
by Avnimelech, Y., 217-230. Journal of the World Aquaculture
Society, Baton Rouge, Louisiana, USA.
Kuhn, D.D., Lawrence, A., 2012. Ex-situ biofloc technology. In:
Biofloc Technology a practical guide book. (2nd edition).edited
by Avnimelech, Y., 217-230. Journal of the World Aquaculture
Society, Baton Rouge, Louisiana, USA.
L., lick, G.J., 2010. Evaluation of two types of bioflocs derived
from biological treatment of fish effluent as feed ingredients
for Pacific white shrimp, Litopenaeus vannamei. Aquaculture.
303, 28-33.
20
Kuhn, D.D., Boardman, G.D., Lawrence, A.L., Marsh, L., Flick,

G.J., 2009. Microbial floc meal as a replacement ingredient for
fish meal and soybean protein in shrimp feed. Aquaculture.
296, 51-57.
Lezama-Cervantes, C., Paniagua-Michel, J., 2010.Effects of
constructed microbial mats on water quality and performance
of Litopenaeus vannamei post-larvae. Aquacultural engineering.
42(2), 75-81.
Marques, A., Dinh, T., Ioakeimidis, C., Huys, G., Swings, J.,
Verstraete, W., Dhont, J., Sorgeloos, P., Bossier, P., 2005.Effects
of bacteria on Artemia franciscana cultured in different
gnotobiotic environments. Applied and Environmental
Microbiology.71, 4307-4317.
McIntosh, D., Samocha, T.M., Jones, E.R., Lawrence, A.L., McKee,
D.A., Horowitz, S., Horowitz, A., 2001.The effect of a bacterial
supplement on the high-density culturing of Litopenaeus
vannamei with low-protein diet in outdoor tank system and no
water exchange. Aquac Eng. 21, 215–227.
Menaga, M., Felix, S., Gopalakannan, A., 2017.Identification of
Bacterial Isolates from Aerobic Microbial Floc Systems by 16sr
DNA Amplification and Sequence Analyses. Indian Vet. J. 94,
24 – 26.
McIntosh, D., Samocha, T.M., Jones, E.R., Lawrence, A.L., McKee,
D.A., Horowitz, S., Horowitz, A., 2000.The effect of a bacterial
supplement on the high-density culturing of Litopenaeus
vannamei with low-protein diet in outdoor tank system and no
water exchange. Aquac Eng. 21, 215–227
Neto, H.S., Santaella, S.T., Nunes, A.J.P., 2015. Bioavailability of
crude protein and lipid from biofloc meals produced in an
activated sludge system for white shrimp, Litopenaeus vannamei.
Rev. Bras. Zootecn. 44, 269- 275.
21
Naylor, R.L., Goldburg, R.J., Primavera, J.H., Kautsky, N., Beveridge,

M.C.M., Clay, J., Folke, C., Lubchenco, J., Mooney, H., Troell,
M., 2000.Effect of aquaculture on world fish supplies.Nature.
405, 1017–1024.
Nunes, A.J.P., Martins, P.C.C., Gesteira, T.C.V., 2004.
Carcinicultura ameaçada: produtores sofrem com as mortalidades
decorrentes do vírus da mionecrose infecciosa (IMNV ).
Pan.Aquic. 14, 37–51.
Naylor, R.L., Goldburg, R.J., Primavera, J.H., Kautsky, N., Beveridge,
M.C.M., Clay, J., Folke, C., Lubchenco, J., Mooney, H., Troell,
M., 2000.Effect of aquaculture on world fish supplies.Nature.
405, 1017–1024.
Nhan,D.T., Wille,M., De Schryver,P., Defoirdt,T., Bossier,P.,
Sorgeloos,P., 2010. The effect of poly –â -hydroxybutyrate on
larviculture of the giant freshwater prawn Macrobrachium
rosenbergii. Aquaculture. 302, 76-81.
Péron, G., Mittaine, J.F., Le Gallic, B., 2010. Where do fishmeal
and fish oil products come from? An analysis of the conversion
ratios in the global fishmeal industry. Marine Policy. 34, 815–
820.
Ricke, S.C., 2003. Perspectives on the use of organic acids and
short chain fatty acids as antimicrobials. Poultry science.82(4),
632-639.
Russel, J.B., 1992. Another explanation for the toxicity of
fermentation acids atlow pH: anion accumulation versus
uncoupling. Journal of Applied Bacteriology. 73, 363–370.
Schneider, O., Sereti, V., Eding, E.H., Verreth, J.A.J., 2005. Analysis
of nutrient flows in integrated intensive aquaculture systems.
Aquaculture Engineering. 32, 379–401.
22
Sinha, A.K., Baruah, K., Bossier, P., 2008. Horizon scanning: the
potential use of biofloc as an anti-infective strategy in
aquaculture -an overview. Aquaculture Health International.13,
8-10.
Sui, L., Liu, Y., Sun, H., Wille, M., Bossier, P., De Schryver, P.,
2012.The effect of poly-β-hydroxybutyrate on the performance
of Chinese mitten crab (Eriocheirsinensis Milne-Edwards) zoea
larvae. Aquaculture Research. 1-8
Teitelbaum, J.E., Walker, W.A., 2002. Nutritional impact of pre-
and probiotics as protective gastrointestinal organisms. Annual
review of nutrition. 22(1), 107-138.
Wang, Y.C., Chang, P.S., Chen, H.Y., 2008. Differential time-
series expression of immune-related genes of Pacific white
shrimp Litopenaeus vannamei in response to dietary inclusion
of â-1,3-glucan. Fish Shellfish Immunol. 24(1), 113–121
Yu, K.S.H., Wong, A.H.Y., Yau, K.W.Y., Wong, Y.S., Tam, N.F.Y.,
2005. Natural attenuation, biostimulation and bioaugmentation
on biodegradation of polycyclic aromatic hydrocarbons (PAHs)
in mangrove sediments. Marine pollution bulletin. 51(8-12),
1071-1077.
23
IN-SITU AND EX-SITU BIOFLOC ON IMMUNE RESPONSE OF GIFT TILAPIA
CHAPTER 2
IN-SITU AND EX-SITU BIOFLOC ON

IMMUNE RESPONSE OF GIFT TILAPIA
T he present study is aimed to investigate the effect of biofloc

intake on Genetically Improved Farmed Tilapia (GIFT),
developed within the system and its influence as feed
supplementation on water quality, growth performance,
immunological parameters, antioxidant status, immune gene
expression, and its resistance to Aeromonas hydrophila infection.
GIFT Tilapia juveniles of 5.1 g (±0.05) were stocked at a density
of 15/m3 in lined ponds of 300 m2 in triplicates for 180 days.
The experimental groups consisted of T1- biofloc developed
within the culture systems (insitu), T2- biofloc supplementation
in fish feed (exsitu) and C- Control without biofloc. Distillery
Spent wash was used as a carbon source to maintain the C/N
ratio of 10:1 for floc development in T1. Free CO2, pH, BOD,
dissolved oxygen, alkalinity, Calcium and Magnesium ions,
Nitrate, Nitrite and Ammonia were found to be significantly
different between the treatments and control throughout the
25
experiment. The immunological (Serum protein, Respiratory

burst test (RBT) and Myeloperoxidase) and antioxidant
indicators (Glucose, Superoxide dismutase (SOD) and catalase)
were found to be significantly higher in T1 at the end of the
trial. Increased weight gain, specific growth rate, survival and
decreased feed conversion ratio was found in T1 when compared
with the other experimental groups. Real time quantitative PCR
analysis revealed that there was no folded expression of the
immunological genes such as Metallothionein gene, Cathepsin
L, Toll like receptor 7, Interleukin 1 β and Tumour necrosis
factor α in liver and intestine for both control and treatment.
However, the upregulated expression of targeted genes except
tumour necrosis factor α was found in head kidney of T1. At
the end of the study, GIFT Tilapia when infected with Aeromonas
hydrophila showed an improved immune response in T1 and T2
with lesser signs of infection than Control. The findings of the
present study affirmed the importance of biofloc technology in
triggering the immunomodulatory response of GIFT Tilapia
with its upregulated immune gene expression and its role as an
antimicrobial agent against Aeromonas hydrophila. This study
suggests the adoption of in-situ (T1) based biofloc method to
obtain better performance of GIFT Tilapia culture.
INTRODUCTION
Tilapia, considered to be a hardy species, is the second most
cultured freshwater fish globally. In 2016, the total production of
tilapia was roughly about 6.69 million tonnes (FAO, 2018) and
is expected to rise to 7.3 million tonnes by the end of 2030
26
(Bhera et al., 2018). The most distinct characteristic traits of this

species include its euryphagic feeding habit, captive breeding
potential, tolerance to high stocking density and improved growth
performance in various aquaculture systems.
The rapidly rising global population and decline in capture
fisheries has accorded greater significance to aquaculture than
ever. However, the expansion of aquaculture is limited to land
and water utilization which hinders the productivity of
aquaculture activities, particularly in Tilapia farming (Brune
et al., 2003; Delgado et al., 2020; Piedrahita et al., 2003;
Avnimelech et al., 2008). To overcome these bottlenecks,
sustainable intensification by the adoption of advanced culture
systems and technologies becomes inevitable to improve the
production and productivity of the sector.
One of the best benefits is is on the biofloc technology which
requires a minimal or zero water exchange and allows stocking of
animals at higher densities. Biofloc are conglomerates of algae,
bacteria, protozoans, fecal matter and uneaten feed which are held
together in a loose matrix by the secretions of filamentous
microorganisms or by electrostatic attraction (Hargreaves, 2013).
This technology maintains the carbon and nitrogen content in
the culture water and uses the dense microbial biomass to strip
the ammonia and serves as a nutritional supplement (Schneider
et al., 2005). The external addition of carbon sources to the culture
water stimulates the growth of heterotrophic bacteria and its uptake
of nitrogen by the production of the microbial protein
(Avnimelech, 1999) faster than regular nitrification process
(Hargreaves, 2006). The nutrient profile of biofloc ranges from
27
25 to 50 percent of protein and 0.5 to 15 percent of fat on a dry-

weight basis. Bioflocs are also a valuable source of limiting amino
acids such as methionine and lysine, vitamins (Vitamin C in the
range of 0 to 54 ìg/g dry matter) and limiting mineral such as
phosphorus (Crab, 2010). In aquafeeds, dried biofloc can be used
possibly to replace fishmeal or soybean meal as cheaper sources of
protein. Extensive and traditional systems with no or little use of
fishmeal supplies nutrient-rich materials to the culture water
enhancing the growth of algae and other indigenous organisms
on which the fish can feed (Naylor et al., 2000). The effluent waters
from aquaculture systems are used for ex-situ biofloc production
in suspended growth bioreactors. The biofloc produced can be
dried and used as a feed supplement for shrimp or fish (Kuhn et
al., 2012). But the uptake of biofloc as feed depends on the nature
of species, its feeding ability, size of the animal, and size and density
of the floc (Avnimelech et al., 2009).
According to the findings from the previous study, the
uptake of biofloc as an additional protein source by freshwater
prawn, shrimp, and tilapia indicates that the technology can be
applied to both freshwater and seawater culture (Crab, 2010;
Crab et al., 2009; Crab et al., 2010a). Biofloc helps in the potential
feed gain with decreased production cost (Craig et al., 2002)
which can be estimated to be in the order of 10–20% (Schryver
et al., 2008). As biofloc technology deals with bacteria and
bacterial products, it is likely to come across immunostimulatory
compounds exhibiting possible probiotic effects. However, the
relative efficiency of in-situ and ex-situ biofloc with respect to
the immune gene expression of the animal has not been attempted
so far particularly in GIFT Tilapia. The Genetically Improved
28
Farm Tilapia (GIFT) strain has been developed using eight

different species of Tilapia under selective breeding by World
Fish Centre (Eknath et al., 1998) as a consequence to the
emergence of new diseases and lack of fish seed availability. The
objective of this study is thus aimed to determine the intake of
biofloc by GIFT Tilapia using different incorporation methods
and its impact on animal immunological performance along with
its gene expression.
METHODOLOGY
Experimental Design
A 180-days culture was carried out in the Advanced Research
Farm Facility, Madhavaram in Chennai (13.1478° N, 80.2310°
E). The experimental group included in-situ biofloc developed
within the culture systems - Treatment-1 (T1), biofloc
incorporated fish feed developed by ex-situ method as Treatment
2 (T2), and animals reared without biofloc as control (C).
Animals weighing 5.1 g (±0.05) were stocked at a density of
15/m3 in lined ponds of 300 m2 , in all the experimental groups
in triplicates. The animals were fed with isoenergetic and
isonitrogeneous diet as per their average body weight in all the
treatments. The proximate composition of the biofloc and the
experimental diets are presented in Table 1 and 2.
Production of Biofloc
In T1, development and maintenance of biofloc in the freshwater
culture ponds was adopted as suggested by Taw (2006) at C:N
29
Table 1: Proximate composition of biofloc
Nutritional Parameters Composition (%)

Crude Protein 29.82 ±0.60
Crude Lipid 4.45 ±0.5
Crude Fibre 3.51±0.32
Ash 33.2 ±0.7
Acid insoluble ash 11.25 ±0.5
Moisture 8.34 ±0.64
Organic matter 66.8 ±0.32
Total NFE 26.35 ±0.58
Gross Energy Kcal / 100g 331.42 ±5.5
Organic matter (OM) = 100- Ash

Nitrogen free extract (NFE) = 100- (CP+ CL+ CF+ Ash + Moisture)
Gross energy (GE) = (CP X 5.6) + (CL X 9.44) + (CF X 4.1) + (NFE X 4.1) K Cal
/100g
Table 2: Formulation and proximate composition of the diets used in the

experiments (% dry matter)
Ingredients (%) Control (C) In-situ (T1) Ex-situ (T2)

Soybean meal 43.55 43.55 33.55
Corn 15.99 15.99 09.10
Fish meal 10.00 10.00 0.00
Biofloc meal 0.00 0.00 26.89
Ricebran 10.00 10.00 10.00
Bentonite 8.54 8.54 8.54
Limestone 4.57 4.57 4.57
Dicalcium phosphate 4.65 4.65 4.65
Cellulose 0.40 0.40 0.40
Sodium chloride 0.50 0.50 0.50
Vitamin & mineral supplemental mix 0.40 0.40 0.40
[Table Contd.
30
Contd. Table]
Ingredients (%) Control (C) In-situ (T1) Ex-situ (T2)

L-Lysine 0.95 0.95 0.95
DL-Methionine 0.35 0.35 0.35
Vitamin –C 0.07 0.07 0.07
BHT(Butylated Hydroxy toluene) 0.02 0.02 0.02
Dry matter 92.34 92.34 92.79
Digestible dry matter (%) 56.45 56.45 55.13
Crude protein (%) 30.15 30.15 30.10
Digestible protein (%) 27.65 27.65 27.11
Gross energy (KJ/g) 14.36 14.36 14.53
Digestible energy (KJ/g) 11.49 11.49 11.78
Ether extract (%) 2.01 2.01 2.04
Ash (%) 19.74 19.74 19.96
ratio of 10:1. The addition of carbon source to maintain the

C:N ratio was followed using the method of Avnimelech
(Avnimelch et al., 2009) for the transition of the heterotrophic
system. For T2, biofloc production was carried out in two indoor
raceway tanks (50 tonnes; 15m x 3m x 1m) in six batches at 10
days interval during January to March, 2018. Tanks were filled
with used culture water taken from the fish ponds and 100L
biofloc inoculum with bacterial floc developed in a separate tank
was added to each raceway. Spentwash obtained from M/s.
Rajshree Biosolutions Private Ltd was used as a carbon source.
The addition of carbon source promotes the heterotrophic
bacteria to reduce the organic matter and assimilate the nitrogen
waste into microbial protein. The C:N ratio was maintained at
31
10:1 for the development of biofloc and addition of urea for

nitrogen source. Spentwash as carbon source was added for the
maximum utilization of left over inorganic nitrogen and to reduce
the chance of occurrence of inorganic nitrogen in the form of
total ammonia nitrogen in the collected biofloc. On the 7thday,
biofloc was collected using harvest pit by closing the aeration
and subsequently harvested by passing water in a nylon filter
bag with 10 μm pore size. The collected floc was centrifuged at
2000 rpm and the supernatant water was discarded. To remove
the traces of ammonia nitrogen level, bioflocs were washed twice
with filtered freshwater. Flocs were dried in a hot air oven at
45 °C. The dried flocs were ground into fine powder (less than
200 ìm), packed in airtight containers and kept in refrigerator
until experimental diets were made.
Experimental Diets used in the Trial

A diet without biofloc used in C and T1 was compared against
the biofloc incorporated diet in T2 by manipulating soyabean
meal, cornmeal and fish meal levels. All the ingredients except
biofloc powder, amino acids, butylated hydroxyl toluene (BHT)
and vitamin-mineral mixture were mixed with water to make
dough. The dough was steam cooked using a pressure cooker for
20 min at 15 psi. Bioflocs and other additives were mixed after
cooling and the dough was pressed through a pelletizer with 2
mm die and then dried at 60°C till the desired moisture level
was reached. The feed was then stored at 4°C until use.
32
Water Quality Parameters

Temperature (mercury thermometer) and pH (Labtronics) were
monitored daily. Dissolved oxygen, BOD, Free Carbon dioxide,
Alkalinity, Calcium and Magnesium ion concentration were
measured on weekly basis. Nitrate-N (NO3–N), Nitrite-N
(NO2–N) and Ammonia were (NH3–N) estimated using the
filtered water samples (APHA, 2006) on a weekly basis.
Immunological Parameters and Antioxidant Indicators

Fish were anesthetized to collect blood samples from the caudal
vein. EDTA coated vials were used to collect the blood, and to
separate the serum, the blood was allowed to clot and centrifuged.
Respiratory burst activity was analyzed using the modified method
of Anderson and Siwiki (Anderson, 1995). Myeloperoxidase
activity in serum was performed according to Quade and Roth
(Quade et al., 1997) with slight modifications. The serum sample
was analyzed for glucose level using a kit from Beacon diagnostics
Pvt. Ltd. The protein estimation of fish serum was carried out by
Lowry’s method (Lowry et al., 1951). Catalase stress enzyme assay
and Superoxide Dismutase (SOD) assay were performed by
following the method of Takahara et al. (Takahara et al., 1960)
and Misra and Fridovich (1972). All these analyses were performed
at the end of the experiment.
Growth Parameters
The growth parameters of GIFT Tilapia were monitored on a
weekly basis and various growth indices were calculated:
33
● Weight gain (WG in g) = Final weight- Initial weight

● Feed conversion ratio = Feed given /Body weight gain
● Specific growth rate (%) =Ln (Final weight) –Ln (Initial
weight) x 100 /Number of days
● Survival rate (%) =Total number of Fish harvested/Total
number of Fish stocked x 100
Gene Expression
The Immune-related gene expression was studied in Head kidney,
liver, hepatopancreas and intestine of the experimental animals
in all the treatments. The tissue sample was homogenized in
TRI Reagent for RNA isolation and the isolated RNA was
stored in -20°C for further use. The RNA isolated was converted
to cDNA for Metallothionein gene, Cathepsin L, Toll like
receptor 7, Interleukin 1 β and Tumour necrosis factor α using
the primers listed in Table 3. The cDNA obtained through
reverse transcriptase PCR was serially diluted and used for
amplification, melt curve analysis and relative quantification of
the target genes was carried out using the Real-Time PCR
(Applied Biosystem’s Real-Time PCR system StepOnePlus®).
The temperature cycling parameters for the two-step PCR
reaction were as follows: Initial denaturation at 95°C for 10 min,
denaturation at 95°C for 15 sec, annealing and extension at 60
°C for 1min for 45 cycles. The PCR was performed with 20 μL
total reaction volume containing 10 μL of 2X SYBR®Greenq
PCR master mix (Bio-Rad, USA), 1 μL each of forward and
reverse primers (10 pmol), 1 μL of template DNA (30–60 ng)
and 7 μL of Nuclease free water. The samples were analysed in
triplicates and the relative expression was determined by the
comparative threshold cycle method 2DDCT (Delta-Delta CT
method) using b-actin as internal control (Pfaffl, 2001).
34
Table 3: Primers used for five immune- related genes in qRT-PCR

S. Gene name Accession Primers Base
No Number pair
1 Metallothionein XM_003447045.5 GCCACTCCTACACCGTCATTC (FP) 63
gene CTGGCGTTGCTCTTGTCTCTT (RP)
2 Cathepsin L XM_003444107.5 TGTCTTGCTCGTGGGCTATG (FP) 63
CAGCTATTTTTCACCAGCCAGTAG (RP)
3 Toll like XM_019352834.2 CCTATTTTGGCAACTGGCATCT (FP) 78
receptor 7 CACTTCACTCCCATTGTTGATCTC (RP)
4 Interleukin 1 β KF747686.1 TGTCGCTCTGGGCATCAA (FP) 63
GGCTTGTCGTCATCCTTGTGA (RP)
5 Tumour XM_003438427.5 GCTACGACTCCCAGCACTTTG (FP) 72
necrosis GCGGTACTGCTCGGATCTCT (RP)
factor α
35
Histopathology
The animals were stocked at 1.25 kg/m3 in the 2000 L FRP
tanks in triplicates from all the experimental groups for the
challenge study. Before the challenge study, the Lethal dose
(LD50) has been derived based on the experiments carried out
with four different dosages delivering the bacteria (104, 105, 106
and 107). Low relative percent survival was found in tilapias
when they were infected with bacteria of 107concentrations. The
pathogenic dose has been arrived at, based on these results. At
the end of the 180-day culture, the experimental animals were
challenged with Aeromonas hydrophila pathogen obtained from
State Referral Laboratory under Tamil Nadu Dr J. Jayalalithaa
Fisheries University. The isolate was grown in tryptic soy broth
(TSB Hi- Media, India) for 24 h (30-31 oC) and was harvested
by centrifugation at 10,000 rpm for 10 min. This was followed
by re-suspending the pellet in phosphate buffered saline (PBS,
pH 7.2). The suspension in sterile PBS was injected
intramuscularly (0.1ml) in healthy tilapia (Yardimci et al., 2011)
from all the treatments delivering 107 CFU/fish. The infected
moribund fish with typical haemorrhagic wounds at the site of
injection were sacrificed for the histopathological study after 4
dpi. Kidney, liver, hepatopancreas and intestine were dissected,
rinsed in normal saline and fixed in 10% formalin buffer for 24
hrs. After fixation, the tissues were dehydrated in a series of
alcohol concentration (70%, 80%, 90%, and 100% respectively),
embedded in paraffin, sectioned at 5 mm and later stained with
hematoxylin-eosin (H&E) (AlYahya et al., 2018). The
histopathological analysis was performed in the Department of
Pathology, Madras Veterinary College, Chennai.
36
Water quality, growth, survival, immunological parameters,

antioxidant status and gene expression of the culture animals were
analysed using ANOVA to find out any significant difference
between the treatments and control and post hoc analysis using
Duncan Multiple range test for the significant values. Statistical
analysis was performed using SPSS software version 20.0.The
significant differences were calculated at 5% level.
RESULTS AND CONCLUSIONS

The various water quality parameters along with statistical
analysis are shown in Table 4.
Different superscripts denote the significant difference
(P<0.05) between groups for each parameter.
Temperature found to have no significant difference between
the treatments and control. Free CO2, pH, BOD, Dissolved oxygen,
Alkalinity, Nitrate-N, Nitrite-N and Ammonia-N were found to
be significantly different between the treatments and control.
Calcium and Magnesium ion concentrations were found to be
significantly higher in T1 than in control and T2. The floc volume
in T1 was maintained at 15 ml/L for the first 60 days of the culture
and it was increased to 45 ml/L at the end of the experiment.
Immunological and Antioxidant Indicators

The immunological and antioxidant indicators were analysed
and the graphs along with the standard deviation were constructed
which are represented in Figure.1.
37
Table 4: Water quality parameters of experimental groups in the 180 days culture trial of GIFT Tilapia

38
Parameters C T1 T2
pH 7.51± 0.01a 7.31± 0.02b 7.47± 0.01c
(7.22-7.4) (7.36-7.66) (7.37-7.75)
Temperature (°C) 30.36± 0.29a 30.52± 0.32a 30.62± 0.30a
(28.02-31.4) (28.0-31.3) (28.03-31.3)
DO (mg/l) 6.12±0.05a 5.36±0.04b 5.87±0.04c
(4.12-6.34) (3.29-5.78) (3.17-5.92)
Free carbon di oxide (mg/l) 5.82±0.58 a 6.65±0.82b 6.04±0.78c
(4.06-8.4) (4.15-8.73) (5.06-8.53)
Alkalinity (mg/l) 70.58±0.61 a 65.08±0.60 b 67.71±0.75c
(45.13-81.6) (45.86-84.3) (54.03-86.45)
Calcium ions (mg/l) 54.48±0.57 a 57.70±0.58 b 55.14±0.66 a
(50.53-63.41) (49.6-65.73) (47.5-60.24)
Magnesium ions (mg/l) 46.01±0.61 a 49±0.61 b 45.23±0.62 a
(30.63-62.83) (31.7-67.1) (32.6-64.2)
Nitrate (mg/l) 0.163±0.0004 a 0.124±0.0004 b 0.174±0.0004c
(0.001-0.17) (0.002-0.18) (0.001-0.18)
Nitrite (mg/l) 0.017±0.001 a 0.004±0.0004 b 0.007±0.002c
(0.002-0.02) (0.002-0.01) (0.002-0.01)
Ammonia (mg/l) 0.154±0.0002 a 0.073±0.0003 b 0.120±0.0004c
(0.001-0.16) (0.001-0.08) (0.001-0.21)
BOD (mg/l) 6.30±0.39a 6.85±0.76b 6.57±0.65c
(3.53-8.73) (4.05-8.03) (5.4-7.46)
39
Figure 1. Immunological and antioxidant indicators of GIFT tilapia in various treatments.


At the end of the study, serum protein, RBT, glucose levels,
catalase, SOD and Myeloperoxidase were found to be significantly
different between control and treatments.
Growth Performance
The weight gain, specific growth rate, feed conversion ratio and
survival rate of GIFT Tilapia along with the statistical analysis
are shown in Table 5.
Table 5: Growth Performance of GIFT Tilapia at the end of the culture trial
Parameters C T1 T2
Initial Weight (g) 5.12 ± 0.04 a 5.23 ± 0.05 a 5.18± 0.04 a
Final Weight (g) 253.33 ± 4.4 a 323 ± 4.16 b 282.33 ± 4.33 c
Weight gain (g) 248.21 ± 4.39 a 317.77 ± 4.12 b 277.15 ± 4.3 c
Specific growth rate 2.16 ± 0.37 a 2.29 ± 0.01 b 2.22 ± 0.03 c
Feed conversion ratio 1.42± 0.01 a 1.27± 0.01 b 1.31± 0.005 c
Survival rate 83 ± 1.85 a 91 ± 1.52 b 89 ± 1.15 c

Weight gain, specific growth rate, feed conversion ratio and
survival rate were found to be significantly different between
control and treatments. The results of the study showed improved
performance of GIFT Tilapia in T1 compared to T2.
40
Gene Expression
The results of the gene expression showed upregulated immune
gene expression in head kidney compared to liver and intestine
in all the experimental groups. The gene expression in the head
kidney was found to be significantly different between the
treatments and control with a higher level of expression in T1.
In head kidney, relative mRNA expression of target genes was
upregulated except tumor necrosis factor alpha gene.
Metallothionein is expressed threefold in T2 whereas in T1, a
sevenfold higher expression of this gene was observed. Cathepsin
L is expressed fourfold in T2 and sixfold in T1 respectively. Toll
like receptor expression levels was up-regulated in both T1 and
T2. Interleukin 1 beta gene expressions levels were one to
threefold higher in T1 and T2 compared to C. Tumor necrosis
factor Alpha gene showed no marked level of expression in all
the experimental groups. In liver and intestine there was no folded
expression of targeted genes in both control and treatment. The
gene expression levels in head kidney are shown in Figure 2.
Histopathology
No mortality was observed when the cultured animals were
challenged with Aeromonas hydrophila at the end of the trial. The
results from histopathology showed the presence of lower degree
levels of infection in T1 followed by T2 and C. The
histopathological analysis of intestine, liver, hepatopancreas and
kidney were shown in the Figures 3, 4 and 5.
41
42
Figure 2. Gene expression levels in the head kidney of

GIFT Tilapia in experimental groups
Figure 3: A: Intestine Control - Congestion and mild degeneration of villi; B:

Intestine control- Fusion of villi and the separation of lamella propria from the
epithelium; C: Intestine control- Mild degenerative necrosis of
mucosoepithelial cells; D: T1 Intestine- Mild Inflammation of infiltration cells;
E: T1-Intestine- Mild Infiltration of Inflammatory Cells; F: T1 Intestine- NAD; G:
T2 Intestine- Fusion of villi and mild degeneration of mucosal epithelium; H:T2
Intestine- Mild inflammation of infiltration cells; and I: T2 Intestine- NAD
43
Figure 4: A: Liver Control - Degenerative Necrosis & Congestion of

haemorrhages; B: Liver control- Fatty Degeneration of hepatocytes; C: Liver
control- Mild haemocytic infiltration & degenerative haemorrhages; D:
Hepatopancreas Control - Degenerative Pancreatic Cell Haemorrhages; E:
Hepatopancreas Control - Degenerative Sinusoidal Congestion ; F:
Hepatopancreas Control -Mild haemocytic infiltration; G: T2 Liver- Mild
degenerative changes of hepatocytes; H: T2 Liver- Sinusoidal congestion &
mild fatty degeneration and I: T2 Liver - Very mild degeneration of pancreatic
cells.
44
Figure 5: A: Kidney Control - Congestion and vacuolar degeneration of nephritic

tubules; B: Kidney Control - Degenerative necrosis tubular epithelial cells; C:
Kidney Control - Hyperemia of glomeruli; D: Kidney Control - Mild dilatation of
bowman’s capsule; E: Kidney Control -Melanomacrophage aggregation and
infiltration; F: Kidney Control -Necrosis of tubular epithelial cells along with
pyknotic nuclei; G: Kidney Control - Partial loss of glomeruli tuft; H: Kidney
Control - Haemorrhages; I: Kidney Control - Melanomacrophage centres and
congestion; J: T1 Kidney - Mild tubular degeneration of epithelial cells; K: T2
Kidney- Mild Degenerative tubular epithelial cells ; L: T2 Kidney- Few
Melanomacrophage centre aggregation
45
Temperature and DO (> 3mg/L) in the experimental groups

were maintained at levels ideal for the growth of GIFT tilapia
(Santos et al., 2013). Lower levels of alkalinity were found in T1
due to the presence of dominant heterotrophic bacterial groups
which are responsible for nitrogen uptake due to carbon
supplementation. This was in agreement with the studies of
Ebeling et al., 2006. As alkalinity concentration alters the
buffering capacity of the water it was found that in T1 the effect
of low alkalinity leads to lower pH levels. A higher concentration
of free CO2 and BOD with lower levels of dissolved oxygen in
T1 was also found. This may be due to respiration by the fish
as well as microbes present in the biofloc. However lower levels
of CO2 and BOD were found in control due to its photosynthetic
oxygen production. The levels of Calcium and Magnesium were
found to be improved in T1 as this ionic concentration influences
the floc formation (Schryver et al., 2008) and adhesion by
neutralizing the negative charges of the particles. Ammonia-N
in T1 remained stable (< 0.02mg/L) throughout the culture trial.
The increased levels of Nitrate-N and Nitrite-N in control and
T2 indicate the existence of autotrophic nitrification.
The higher level of serum protein in T1 helps to reduce the
dietary protein levels of the pelleted feed with the enhancement
of the non-specific immune response (Rao et al., 2006). In this
study, the RBT of tilapia showed an improved performance in
T1 than C and T2. This may be related to the intake of biofloc
by the culture animals in T1, which not only boosts the nutrition
of the animal but also stimulates the fish cellular defence
mechanism in the mode of respiratory burst and phagocytosis
(Sharp et al., 1993 and Xu, 2014). The myeloperoxidase (MPO),
46
an antimicrobial enzyme acts by utilizing one of the oxidative

radicals to produce hypochlorous acid. The increased MPO
activity was seen more in T1 than the other experimental groups.
This was concurrent with the findings of Long et al., 2015 who
reported increased MPO activity in GIFT when grown in biofloc
system for a period of 8 weeks. Increased glycogenolysis and the
glucose synthesis from extrahepatic tissue proteins and amino
acids aggravates the glucose content in blood as an indicator of
stress in animals (Almeida et al., 2001). In the present study, T1
was found to have lesser glucose level when compared with other
treatments which in turn indicates the reduced stress level in
animals. Biofloc reduced the physiological stress in GIFT which
agrees with the studies of Verma et al., 2016 who reported the
reduced levels of Cortisol and glucose in Labeo rohita when
reared in biofloc systems.
The results from the present study revealed increased SOD
and catalase level in T1, followed by T2 and C. A spurt in the
levels of SOD and catalase improves the antioxidant status of the
animal by preventing lipid peroxidation through conversion of
superoxide anion to water and oxygen (Tao et al., 2013). Similar
studies were done by Yilmaz (Yilmaz, 2019) where Nile tilapia
when fed with 5 g/ kg of caffeic acid as a dietary supplement for
60 days improved the fish immune parameters, antioxidant status,
as well as survival rate against A. veronii. SOD and catalase
under hypoxia conditions are involved in the antioxidant defence
system by removing and detoxifying oxygen radicals generated
within the cells under normal or stressful conditions (Kurata et
al., 1993). Lower levels of SOD and catalase indicate cell damage
due to the accumulation of high-level free radicals in cells
47
affecting the quality and palatability of fish which impacts human

consumption. GIFT Tilapia in T1 & T2 reared under biofloc
technology showed improved antioxidant status with increased
SOD and catalase levels thus paving the way for easy consumer
acceptance. Animals in T1 were found to have increased weight
gain, specific growth rate, survival and decreased feed conversion
ratio. This may be due to the consumption of microbial floc
which is produced as cellular protein by the assimilation of waste
nitrogen in the culture animal. The increased intake of the animal
in the culture ponds is attributed to the enhanced floc production
by the heterotrophic bacterial population in T1 (Wang et al.,
2015). The feed response of biofloc incorporated diet in T2 and
control was similar as animals tend to jump to fetch feed at the
time of application. The animal’s response in T1 was not high
and this may be due to the existence of biofloc in the culture
system consistently throughout the experiment. The total feed
applied in T2 and control disappeared in a short span of time,
whereas increased feed retention was observed in T1. This led
to decreased pellet feeding to the animals in T1. These
observations are similar to the findings of Avnimelech
(Hargreaves, 2006) as tilapia has the ability to harvest the flocs
continuously for feeding in the culture ponds with decreased
pellet feeding.
The up-regulation of IL- 1β was observed in head kidney,
which indicates its influence in stimulation of immune response.
This was also proven from the studies of Kheti et al., 2017 who
reported that microbial floc supplemented in the diet of rohu
potentiates the expression of IL- 1β and TNF-α in head kidney
and liver. Similar kind of upregulated expression of IL-1β and
48
TNF-α in intestinal tissue was found when Echinacea purpurea

extract and/or vitamin C in combination or individually
supplemented along with the basal diet by Rahman et al., 2018.
IL-1β activates the lymphocytes and stimulates the release of
other cytokines during the microbial invasion or when there is
a tissue injury (Low et al., 2003). TNFs play a role in inflammatory
response, proliferation and differentiation of cells, and stimulation
of the immune system (Savan et al., 2004 and Wang et al., 2013).
The pattern of this cytokine gene expression predicts the changes
in immune response. The upregulated expression of these
immune genes in T1 enhances the immune cell secretions such
as proinflammatory cytokines like TNF-α and IL-1β to modulate
the innate immune response of the culture animals. However,
there are not too many previous studies reporting the immune
gene expression in Tilapia either by rearing in biofloc based
culture system or feeding with biofloc meal.
Histopathological manifestations in kidney, liver, pancreas
and intestine of GIFT Tilapia against its challenge with
Aeromonas hydrophila were similar to the observations of Roberts
(Roberts, 2012). Degenerative necrosis of tubular epithelial cells
along with the melanomacrophage centre aggregation was the
major histopathological observation in the kidney. Fatty
degeneration of hepatocytes with sinusoidal congestion was found
in the liver and pancreas. Fusion of villi with inflammation of
infiltration cells and infiltration of inflammatory cells were
commonly seen in intestine. These major manifestations were
observed with the higher degree of infection in control followed
by T2 and T1. This may be due to the toxins and extracellular
products produced by A.hydrophila such as hemolysin, protease,
49
and elastase causing severe necrosis in the liver and other tissues
(Afifi et al., 2000). The infection in T1 fish was found to be
lesser due to the production of immunostimulatory compounds
(Sakai, 1999 and Abraham et al., 2007) by the heterotrophic
bacteria in the biofloc produced within the culture ponds.
Microbial floc has also been reported for the presence of bioactive
compounds such as carotenoids, polysaccharides, phytosterols,
taurine and poly-β-hydroxybutyrate (PHB) (De Schryver et al.,
2008; Ray et al., 2010 and De Schryver et al., 2010). The results
of the present study can be related to the antioxidant status of
the animal and it is found that animals in T1 had a higher
immune potential towards the infection followed by T2 and
Control. Similar study was performed by Kheti et al., 2017 who
administered the microbial floc in the diets of Rohu and showed
the increased survival rate when infected with Edwardsiella tarda.
Thus, from the above research findings, the present study
reveals the improved performance of in-situ based biofloc
compared to ex-situ feeding as it exhibits ideal water quality
parameters, improved growth performance, modulatory immune
response as well as the upregulated expression of genes responsible
for immune system and the resistance towards pathogenic
infection.
Biofloc technology is one of the advanced culture
technologies adopted for tilapia farming due to its innumerable
benefits. It serves as feed for the culture animals, improves the
biosecurity of the farm with minimal or zero water exchange.
This study and its findings are the first to know the effect of
biofloc intake relating to the immunological performance of
GIFT Tilapia with gene expression. This gives strong insights
50
on the dietary supplementation of biofloc in feed and its

development within the culture ponds for the maintenance of
the optimum water quality parameters, growth performance and
immune gene regulations in the grow out culture systems of
GIFT Tilapia.
ACKNOWLEDGEMENT
This research work was part of the Project funded by the
Department of Biotechnology, Govt of India (Project code: DBT
507: PI: S.Felix).
REFERENCES
Abraham, T.J., Babu, C.H.S., Mondal, S. and Banerjee, T. 2007.
Effects of dietary supplementation of commercial human
probiotic and antibiotic on the growth rate and content of
intestinal microflora in ornamental fishes, Bangladesh J. Fish.
Res. 11: 57–63.
Afifi, S.H., Al-Thobiati, S., Hazaa, M.S. et al. 2000. Bacteriological
and histopathological studies on Aeromonas hydrophila
infection of Nile tilapia (Oreochromis niloticus) from fish farms
in Saudi Arabia, Assiut. Vet. Med. J. 42: 195–205.
Almeida, J.A., Novelli, E.L.B., Dal-Pai Silva, M. and Alves Jr, R.
2001. Environmental cadmium exposure and metabolic
responses of the Nile tilapia Oreochromis niloticus, Environ.
Pollut. 114 (2001) 169–175.
AlYahya, S.A., Ameen, F., Al-Niaeem, K.S., Al-Sa’adi, B.A., Hadi,
S., and Mostafa, A. 2018. Histopathological studies of
experimental Aeromonas hydrophila infection in blue tilapia,
Oreochromis aureus, Saudi journal of biological sciences. 25:
182-185.
51
Anderson, D.P. and Siwicki, A.K. 1995. Basic hematology and

serology for fish health programs.
APHA (American Public Health Association). 2006. Standard
Methods for the Examination of Water and Wastewater,
American Public Health Association. Washington, DC.
Avnimelech, Y. 1999. Carbon/nitrogen ratio as a control element
in aquaculture systems, Aquaculture. 176: 227–235.
Avnimelech, Y., Kochba, M. 2009. Evaluation of nitrogen uptake
and excretion by tilapia in bio floc tanks, using 15 N tracing,
Aquacult. 287: 163-168.
Avnimelech, Y., Verdegem, M.C.J., Kurup, M. and Keshavanath,
P. 2008. Sustainable land-based aquaculture: rational utilization
of water, land and feed resources, MediterrAquac J. 1: 45-55.
Behera, B.K., Pradhan, P.K., Swaminathan, T.R., Sood, N., Paria,
P., Das, A., Verma, D.K., Kumar, R., Yadav, M.K., Dev, A.K.,
Parida, P.K., Das, B.K., Lal, K.K. and Jena, J.K. 2018. Emergence
of Tilapia Lake Virus associated with mortalities of farmed Nile
Tilapia Oreochromis niloticus (Linnaeus 1758) in India,
Aquaculture. 484: 168-174.
Brune, D.E., Schwartz, G., Eversole, A.G., Collier, J.A., Schwedler,
T.E. 2003. Intensification of pond aquaculture and high rate
photosynthetic systems,AquacEng. 28: 65-86. http://dx.doi. org/
10.1016/S0144-8609(03)00025-6.
Crab, R. 2010. Bioflocs technology: an integrated system for the
aquaculture, PhD thesis, Ghent University. 178.
Crab, R., Chielens, B., Wille, M., Bossier, P., and Verstraete, W.
2010a. The effect of different carbon sources on the nutritional
value of bioflocs, a feed for Macrobrachium rosenbergii post
larvae, Aquaculture Research. 41: 559–567.
52
Crab, R., Kochva, M., Verstraete, W. and Avnimelech, Y. 2009.

Bio-flocs technology application in over-wintering of tilapia,
Aquaculture Engineering. 40: 105–112.
Craig, S., Helfrich and L.A. 2002. Understanding Fish Nutrition,
Feeds and Feeding (Publication 420–256), Virginia Cooperative
Extension, Yorktown (Virginia). 4.
De Schryver, P., Crab, R., Defoirdt, T., Boon, N., and Verstraete,
W. 2008. The basics of bioflocs technology: the added value
for aquaculture, Aquaculture. 277: 125–137.
De Schryver, P., Sinha, A.K., Baruah, K., Verstraete, W., Boon, N.,
De Boeck, G. and Bossier, P. 2010. Poly-beta-hydroxybutyrate
(PHB) increases growth performance and intestinal bacterial
range-weighted richness in juvenile European sea bass,
Dicentrarchus labrax, Appl. Microbiol. Biotechnol. 86 1535–
1541.
Delgado, C.L., Wada, N., Rosegrant, M.W., Meijer, S., Ahmed,
M. 2003. Fish to 2020: Supply and demand in changing global
markets, Washington, D.C.: International Food Policy Research
Institute, World Fish Center Technical Report no 62.
Ebeling, J.M., Timmons, M.B. and Bisogni, J.J. 2006 Engineering
and heterotrophic removal of ammonia–nitrogen in aquaculture
systems, Aquaculture. 257: 346-358.
Eknath, A.E. and Acosta, B.O. 1998. Genetic improvement of
farmedtilapia project final report (1988-1997), International
Center for Living Aquatic Resources Management, Manila,
Philippines, 75.
FAO, 2018. Global aquaculture production, in: FaAOotU, Nations
(Ed.).
Hargreaves, J.A. 2006. Photosynthetic suspended-growth systems
in aquaculture, Aquaculture Engineering. 34: 344–363.
53
Hargreaves, J.A. 2013. Biofloc production systems for aquaculture,

1-11.
Kheti, B., Kamilya, D., Choudhury, J., Parhi, J., Debbarma, M.,
Singh, S.T. 2017. Dietary microbial floc potentiates immune
response, immune relevant gene expression and disease resistance
in rohu, Labeo rohita (Hamilton, 1822) fingerlings, Aquaculture.
468: 501-507.
Kuhn, D.D., Lawrence, A. 2012. Ex-situ biofloc technology. In:
Biofloc Technology a practical guide book, 2nd edn., edited by
Avnimelech, Y., 217-230, Journal of The World Aquaculture
Society. Baton Rouge, Louisiana, USA.
Kurata, M., Suzuki, M. and Agar, N.S. 1993. Antioxidant systems
and erythrocyte life-spanin mammals, Comp. Biochem. Physiol.
B. 106: 477–487.
Long, L., Yang, J., Li, Y., Guan, C. and Wu, F. 2015. Effect of
biofloc technology on growth, digestive enzyme activity,
hematology, and immune response of genetically improved
farmed tilapia (Oreochromis niloticus), Aquaculture. 448: 135–
141.
Low, C., Wadsworth, S., Burrells, C. and Secombes, C.J. 2003.
Expression of immune genes in turbot (Scophthalmus maximus)
fed a nucleotide-supplemented diet, Aquaculture. 221: 23–40.
Lowry, O.H., Rosebrough, N.J., Farr, A.L. and Randall, R.J. 1960.
J. Biol. Chem.193 (1951) 265-275.
Misra, H.P. and Fridovich, I. 1972. The role of superoxide anion
in the autoxidation of epinephrine and a simple assay for
superoxide dismutase, Journal of Biological chemistry. 247:
3170-3175.
Naylor, R.L., Goldburg, R.J. , Primavera, J.H., Kautsky, N., Beveridge,
M.C.M., Clay, J. Folke, C., Lubchenco, J., Mooney, H., and
54
Troell, M. 2000. Effect of aquaculture on world fish supplies,

Nature. 405: 1017–1024.
Pfaffl, M.W. 2001. A new mathematical model for relative
quantification in real-time RT–PCR, Nucleic acids research. 29:
45.
Quade, M.J. and Roth, J.A. 1997. A rapid, direct assay to measure
degranulation of bovine neutrophil primary granules. Veterinary
Immunology and Immunopathology. 58: 239-248.
R.H. Piedrahita, Reducing the potential environmental impact of
tank aquaculture effluents through intensification and
recirculation, Aquaculture. 226 (2003) 35-44. http://dx.doi.org/
10. 1016/S0044-8486(03)00465-4.
Rahman, A.N.A., Khalil, A.A., Abdallah, H.M. and ElHady, M.
2018. The effects of the dietary supplementation of Echinacea
purpurea extract and/or vitamin C on the intestinal
histomorphology, phagocytic activity, and gene expression of
the Nile tilapia, Fish & shellfish immunology. 82: 312-318.
Rao, Y.V., Das, B., Jyotyrmayee, P. and Chakrabarti, R. 2006. Effect
of Achyranthes aspera on the immunity and survival of
Labeorohita infected with Aeromonas hydrophila, Fish Shellfish
Immunol. 20: 263-273.
Ray, A.J., Seaborn, G., Leffler, J.W., Wilde, S.B., Lawson, A. and
Browdy, C.L. 2010. Characterization of microbial communities
in minimal-exchange, intensive aquaculture systems and the
effects of suspended solids management, Aquaculture. 310:
130–138.
Roberts, R.J. 2012. Fish pathology, (Fourth ed.), Wiley-Blackwell,
UK, 590.https://doi.org/10.1002/9781118222942.
Sakai, M. 1999. Current research status of fish immunostimulants,
Aquaculture. 172: 63–92.
55
Santos, V.B., Mareco, E.A., Silva, M.D.P. 2013. Growth curves of

Nile tilapia (Oreochromis niloticus) strains cultivated at different
temperatures, Acta Sci. Anim. Sci. 35: 235–242.
Savan, R. and Sakai, M. 2004. Presence of multiple isoforms of
TNF alpha in carp (Cyprinus carpio L): genomic and expression
analysis, Fish Shellfish Immunol. 17: 87–94.
Schneider, O., Sereti, V., Eding, E.H. and Verreth, J.A.J. 2005.
Analysis of nutrient flows in integrated intensive aquaculture
systems, Aquaculture Engineering. 32: 379–401.
Sharp, G.J.E. and Secombes, C.J. 1993. The role of reactive oxygen
species in the killing of the bacterial fish pathogen Aeromonas
salmonicida by rainbow trout macrophages, Fish& Shellfish
Immunology. 3: 119-129.
Takahara, S., Hamilton, H.B., Neel, J.V., Kobara, T.Y. and Y.
Ogura E.T. 1960. Nishimura, Hypocatalasemia: a new genetic
carrier state, The Journal of Clinical Investigation. 39: 610-619.
Tao, Y., Pan, L., Zhang, H. and Tian, S. 2013. Assessment of the
toxicity of organochlorine pesticide endosulfanin clams
Ruditapes philippinarum, Ecotoxicology and environmental
safety. 93: 22-30.
Taw, N. 2006. Shrimp production in ASP system, CP Indonesia:
Development of the technology from R&D to commercial
production, Aquaculture America.
Verma, A.K., Rani, A.B., Rathore, G., Saharan, N., Gora, A.H.
2016. Growth, non-specific immunity and disease resistance of
Labeo rohita against Aeromonas hydrophila in biofloc systems
using different carbon sources, Aquaculture. 457: 61-67.
Wang, G., Yu, E., Xie, J., Yu, D., Li, Z., Luo, W., Qiu, L. and
Zheng, Z. 2015. Effect of C/N ratio on water quality in zero-
water exchange tanks and the biofloc supplementation in feed
56
on the growth performance of crucian carp, Carassius

auratus, Aquaculture. 443: 98-104.
Wang, T. and Secombes, C.J. 2013. The cytokine networks of
adaptive immunity in fish, Fish Shellfish Immunol. 35: 1703–
1718.
Xu, W.J. and Pan, L.Q. 2014. Evaluation of dietary protein level
on selected parameters of immune and antioxidant systems,
and growth performance of juvenile Litopenaeus vannamei
reared in zero-water exchange biofloc-based culture
tanks, Aquaculture. 426: 181-188.
Yardimci, B. and Aydin, Y. 2011. Pathological findings of
experimental Aeromonas hydrophila infection in Nile tilapia
(Oreochromis niloticus), Ankara Univ Vet FakDerg. 58: 47
54.
Yilmaz, S. 2019. Effects of dietary caffeic acid supplement on
antioxidant, immunological and liver gene expression responses,
and resistance of Nile tilapia, Oreochromis niloticus to
Aeromonas veronii, Fish & shellfish immunology. 86: 384-392.
57
FERTILIZATION PROTOTYPE ON BIOFLOC DEVELOPMENT IN GIFT .....
CHAPTER 3
FERTILIZATION PROTOTYPE ON
BIOFLOC DEVELOPMENT IN GIFT
TILAPIA CULTURE
A study was conducted to evaluate the effect of different

fertilizers in GIFT Tilapia culture using biofloc technology.
Animals (5±0.23g) were stocked at a density of 30m-3 in 500
litres FRP tanks and spentwash was used as a carbon source to
maintain a C:N ratio of 10:1 for 42 days. The experimental
group includes fertilization using ammonia sulphate alone (T1)
and fertilization using different inorganic fertilizers (T2). No
significant differences in FCR, specific growth rate, weight gain
and survival of animals were found between the treatments.
Proximate composition and fatty acid profile of floc were
comparatively rich in T2.Increased solid concentrations with
higher Floc volume index and floc sizes were recorded in T2.
The rapid floc development along with multiplication of
heterotrophic bacteria and decreased vibrio population was
observed in T2. The present study confirmed the influence of
fertilizers on the physical and nutritional quality of biofloc in
GIFT tilapia culture.
59
INTRODUCTION
The intensification of the aquaculture can be driven by many
advanced technologies and one among them was the biofloc
technology. This technology allow aquaculture animals to grow
at higher stocking densities with minimal water exchange. The
nitrogen recovery in the biofloc technology aids in the prevention
of disease outbreak by providing proper biosecurity. Unlike
recirculatory aquaculture systems this technology does not require
any external filtration rather dense microbial biomass, strips the
ammonia inturn to serve as a nutritional source. Tilapia is a
hardy species and its omnivorous feeding habit accommodates
this fish in the intensive culture practices. Its tolerance to the
wide environmental conditions has exceeded the production of
5 million tonnes per year with steady growth rate of 5-8 percent
globally (Menaga and Fitzsimmons, 2017).The suspended growth
in ponds such as phytoplankton, bacteria, live and dead
particulates and grazers constitutes the floc. Their growth is
influenced by various physico chemical factors such as
Temperature, pH, Salinity and aeration of the culture systems.
The growth and stability of the flocs formed can also be
determined by using different carbon sources and at various
C/N ratios. The growth of heterotrophic bacteria can be
promoted by the external supplementation of carbon sources
such as dextrose, sugar, rice flour, wheat flour, rice bran, molasses
etc. However the use of distillery spentwash as a carbon source
in the biofloc technology is limited. The synergistic way of
utilization of distillery spent wash (DSW) by the microbes for
its effective degradation brings an eco-friendly application in
60
aquaculture. The ability of the DSW in rapid release of the

carbon content paves the way for the growth of heterotrophic
bacteria to assimilate ammonia with decreased concentrations of
TSS. Assimilation of ammonium by heterotrophic bacteria takes
place rapidly due to the faster growth rate as heterotrophic biomass
yield per unit substrate are a factor of 10 higher than autotrophic
bacteria (Hargreaves,2006).The use of distillery spentwash as a
carbon source has been recommended for shrimp as well as
GIFT Tilapia (Menaga et al. 2017). The balance of carbon and
nitrogen with the external supplementation of carbon will convert
the ammonium and other organic nitrogenous waste into bacterial
biomass (Schneider et al. 2005). The chemo-autotrophic system
exhibits the classic increase and sudden fall out in ammonia
concentration as the nitrifying bacteria oxidize the nitrite-nitrogen
to nitrate-nitrogen with the help of available CO2 in the systems.
Another disadvantage of nitrifying bacteria includes its higher
sensitivity to the increased ammonia and decreased dissolved
oxygen level which in turn impacts the maintenance of optimum
water quality parameters (Masser et al. 1999; Villaverde et al.
2000; Ling and Chen, 2005). In addition, both the heterotrophic
and the chemoautotrophic show very low concentrations of
nitrite-nitrogen, because nitrite is not a product in either
pathway.The biofloc technology has been implemented in various
countries and its adoption strategies vary for different countries.
The fertilization prototype adopted by the farmers on biofloc
has not been discussed much so far. The use of inorganic
fertilizers such as Urea, Triple Super Phosphate has been in
practice as a source of Nitrogen and Phosphorus in the
aquaculture systems. As the pond fertilization augment the
61
production of plankton thereby the different trophic levels

including autotrophic and heterotrophic bacterial population
helps in increased fish production (Grag and Bhatnagar, 2000).
The objective of the present study was to assess the different
methods of fertilization prototype for the biofloc development
using distillery spentwash as a carbon source at constant C:N
ratio 10:1 in the tank culture of GIFT Tilapia.
METHODOLOGY
The experiment consists of two treatments such as fertilization
of water using 20 gm L-1 pond soil, 10 mg L-1 ammonium
sulphate and 200 mg L-1 distillery spentwash as described by
(Avnimelech and Kochba, 2009) (T1) and fertilization of water
using various inorganic fertilizers as suggested by (Taw, 2006)
(T2) in freshwater (0 ppt).The list of fertilizers used in T2 study
were given in the Table 1. Distillery spent wash (DSW) was
used as the carbon source to maintain the C:N ratio at 10:1 and
it was added thrice to the culture tanks following standard
protocols of Crab et al. (2010) with slight modification based on
the carbon content of Distillery spentwash. The DSW used in
the current study was collected from M/s. Rajshree Biosolutions
Private Limited, Coimbatore and stored in room temperature.
The main characteristics of DSW were analysed at Central
Leather Research Institute, Chennai and the results were listed
in Table 2. The GIFT Tilapia fingerlings (5±0.23g) were stocked
at a density of 30/m3 in 500m3 FRP tanks in triplicates. Animals
were fed with 30% crude protein feed daily as per their body
weight for 42 days. The water quality and floc characteristics
were investigated throughout the culture trial.
62
Table 1: Fertilizers used for biofloc development
Day Fertilizers Quantity (g/ton)

1 Urea 1.1
Triple Super Phosphate (TSP) 0.14
Grain pellet 4
Dolomite 7
2 Grain pellet 4
Dolomite 7
3 Grain pellet 4
Dolomite 7
4 Grain pellet 4
DSW 10.1
5 Grain pellet 4
6 DSW 7
Table 2: Physico-chemical properties of Distillery Spentwash
Parameters in mg/L Results

Colour Dark Brown Coloured Liquid
pH @ 25ºC 6.25
Total Chlorides 7729
Total Suspended Solids 42730
Total Phosphorus 66.6
Total Solids 326980
Calcium 6072.1
Magnesium 4421.4
Potassium 23055
Carbonates Nil
Electrical Conductivity Micro ohms/cm @ 25 degree 112652
Total Organic Carbon 26%
Total Nitrogen 834
[Table Contd.
63
Contd. Table]
Parameters in mg/L Results

Organic Solids 252340
BOD 16500
COD 33520
Bicarbonate 13320
Sulphate 5350
Inorganic Solids 74640
Growth Parameters
The growth parameters of GIFT Tilapia were monitored on
weekly basis and various growth indices were calculated:
Feed conversion ratio = Feed given /Body weight
Specific growth rate (%) =Ln (Final weight) –Ln (Initial weight)
x 100 /Number of days
Survival rate (%) =Total number of Fish harvested/Total number
of Fish stocked x 100

Temperature ( YSI, ProDSS Multiparameter) and pH
(Labtronics instruments) were measured daily. Dissolved oxygen,
Free Carbon dioxide, Salinity, Alkalinity, Hardness, Calcium and
Magnesium ion concentration were measured weekly as per
APHA (2008). Water samples were filtered using No.1
Whatman filter paper and collected filtrate was analysed using
Resorcinol method for nitrate-N (NO3 -N) and nitrite-N (NO2
-N).Phenol hypochlorite method was used for total ammonia
64
nitrogen (TAN) and Orthophosphate (APHA, 2008) were

recorded weekly once. Total heterotrophic bacteria (THB) and
Vibrio were estimated and expressed as colony forming units
(CFU) on weekly basis as per Bergey’s manual of systematic
bacteriology (Holt et al. 1989).
Floc Parameters
Biofloc water was collected using Imhoff Cone and it is kept
undisturbed for 20 minutes for the floc to settle down. After 20
minutes the particles settled at the bottom was measured as floc
volume (Avnimelech and Kochba, 2009).
Floc porosity was calculated by the volume of water and floc
settled in Imhoff Cone according to Smith and Coakley, (1984).
Porosity = (FV/WV)* 100
Floc volume index was obtained using floc volume and floc
concentration (TSS) according to Mohlman (1934). It is
calculated using the formula
FVI = Floc volume (ml)/ Floc concentration (g)
Floc density index was calculated using floc volume index
and it is the grams of floc which occupies a volume of 100 ml
after 30 minutes of settling (WHO international reference centre,
1978).
FDI = 100/FVI
Total organic carbon was analysed according to Walkley
and Black (1934). From the titre value TOC was calculated
according to the formula,
65
TOC % = [10- (10 * y/x)] * 0.003 * 100/Vs

Where x = Titrite value of blank; y = Titrite value of
sample; Vs = Volume of sample
Floc size and shape were recorded under digital microscope
(Lawrence & Mayo, NLCD-120e). Floc settling velocity was
determined using Megara et al. (1976). BOD,TS,TDS,TSS and
VSS were determined according to APHA (2008) and expressed
in mg L-1.These quantitative and qualitative characteristics of
floc were determined weekly once during the culture trial.
Biochemical Composition of Biofloc

Proximate composition of the floc were performed as per standard
method of AOAC (2005). Extraction of lipid from the biofloc
was done as per Folch et al. (1957) with slight modifications and
fatty acid analysis of the floc was analyzed in GC-MS at
Veterinary College and Research Institute, Nammakkal.
Water and Floc quality were analysed using one way
ANOVA between treatments at 5% level of significance. Growth
parameters of the culture animals were analysed using one way
ANOVA and post hoc analysis using Duncan Multiple range
test for the significant values. Statistical analysis were performed
using SPSS software version 20.0.

There was no significant difference in Temperature, Salinity,
Dissolved oxygen, pH, Hardness, Magnesium, Ammonia-N,
Nitrate-N and Phosphorus. The nitrite concentration pattern
66
was different for both the treatments. Accumulation of nitrite

concentrations was seen at the end of the second week in T1 and
this may be due to the slow growth of heterotrophs in T1 than
T2.The low concentrations of nitrite in T2 reveals the complete
assimilation of ammonia to nitrate by heterotrophic bacteria
under the similar environmental conditions (Ebeling and
Timmons, 2007). In the present study, optimum NH3-N and
NO3-N concentrations were observed in all the treatments as
cited by Hargreaves, 2013 and their accumulated concentrations
did not vary with the effect of carbon supplementation. The
concentration of CO2 was relatively higher in T2 (4-4.9 ppm)
and this may be due to the ammonia regeneration by the bacterial
biomass under biofloc culture systems (Avnimelech, 2015). Total
alkalinity and Calcium concentration found significantly different
between the treatments. The lower level occurrence in T2 may
be due to the buffering action of bacteria as reported by Ebeling
et al. (2006).
In both treatments the pH and temperature were within
the desirable ranges favouring the growth of the culture species
(Table 3) (Crab, 2009). The presence of vibrio bacteria population
was seen in both the treatments, however inclined multiplication
rate was found in T1 compared to T2. This may be due to the
faster replication rate of heterotrophs compared to slower growth
rate of autotrophs (Ebeling et al. 2006).
The mean final weight, survival and FCR values for the
fertilization study were presented in Table 5. Based on the
statistical analysis; there was no significant differences between
the treatments however improved final mean weight of the fishes
67
in T2 culture tanks was recorded. This may be due to the

enhanced floc production and thereby the consumption of floc
lead to increased weight gain.
Table 3: Water quality parameters of experimental groups for the 42 days

of culture trial
Parameters T1 T2
DO (mg/l) 6.15 ± 0.11a 5.24 ± 0.17a
(4.3 - 6.6) (5.3 - 6.6)
Temperature (ºC) 26.45 ± 0.15a 26.26 ± 0.1a
(25– 27) (25 – 27)
Salinity (ppm) 0.01± 0.001a 0.01± 0.001a
pH 8.23 ± 0.04a 8.68 ± 0.04a
(8.2 - 8.6) (8.5 - 8.9)
CO2 (mg/l) 2.8± 0.19 a 4.33 ± 0.09b
(1.8 - 3.4) (4 - 4.9)
Alkalinity (mg/l) 56.77 ± 2.5a 47.89 ± 2.9b
(40 – 63) (37 – 83)
Hardness (mg/l) 259.2 ± 3.6a 249 ± 5.16a
(236 – 292) (219 – 279)
Calcium (mg/l) 43.59 ± 4.8a 53.1 ± 2.98b
(46 – 71) (34 – 72)
Magnesium (mg/l) 79.03 ± 2.9a 62.11 ± 2.79a
(49 – 89) (41.4 – 92)
NH3 (mg/l) 0.007 ± 0.0a 0.006 ± 0.0a
(0.001 – 0.044) (0.004 – 0.011
NO2 (mg/l) 0.014 ± 0.0 a 0.009 ± 0.0b
(0.003 – 0.019) (0.003 – 0.015)
NO3 (mg/l) 0.178 ± 0.02a 0.15 ± 0.02a
(0.115 – 0.199) (0.04– 0.269)
Phosphate (mg/l) 0.082± 0.02a 0.09 ± 0.01a
(0.049 – 0.159) (0.049 – 0.15)
68
Table 4: Total Heterotrophic bacteria and Vibrio count in culture water of the experimental groups
DOC TPC (CFU/ml) water Vibrio (CFU/ml) water

T1 T2 P value T1 T2 P value
0 3.11 x 104 5.98 x 104 0.001** 6.6 x102 5.1 x102 0.01*
± 2 x 103 ±4.3 x 104 ± 0.04 x 103 ±2 x 101
7 6.37 x 104 13.41 x 104 0.001** 7.7 x 102 4.7 x 102 0.01*
± 1.94 x 104 ±2.1 x 104 ± 0.03 x 103 ±2 x 101
14 12.41 x 104 21.63 x 104 0.001** 1.01 x 103 4.0 x 102 0.01*
± 3.2 x 103 ±1.6 x 104 ± 0.02 x 103 ±2 x 101
21 1.02 x 105 3.8 x 105 0.01* 1.21 x 103 3.1 x 102 0.01*
± 2.1 x 103 ±3.8 x 103 ± 0.01 x 103 ±2 x 101
28 2.34 x 105 4.6 x 105 0.01* 2.48 x 103 2.7 x 102 0.001**
± 1.6 x 103 ±2.8 x 103 ± 0.03 x 103 ±2.1 x 101
35 3.64 x 105 5.2 x 105 0.01* 4.11 x 102 2.1 x 102 0.001**
± 2.2 x 103 ±3.1 x 103 ± 0.01 x 103 ±1 x 101
42 5.9 x 105 4.4 x 106 0.001** 5.32 x 102 1.9 x 102 0.01*
± 3.1 x 103 ±4.2 x 103 ± 0.02 x 103 ±1 x 101
* P< 0.01 & **P< 0.001– significant

Values (Mean ± SE) in the same row with different superscript differ significantly (Duncan Multiple Range Test
(p<0.05).
69
Table 5: Growth Parameters of GIFT Tilapia of the experimental groups at

the end of the culture trial
Parameters Treatment 1 Treatment 2

Initial weight (gm) 5± 0.23a 5 ± 0.20a
Final weight (gm) 14 ± 0.16a 15 ± 0.12a
Weight gain (gm) 8± 0.99a 9 ± 0.99a
Specific growth rate 8.02 ± 0.23a 8.16 ± 0.34a
Feed Conversion Ratio 1.2 ± 0.04a 1.2 ± 0.09a
Survival (%) 99 ± 0.02a 98 ± 0.4a
Values (Mean ± SE) in the same row with different superscript differ significantly
(Duncan Multiple Range Test (p<0.05).
The small changes in the floc will be highly influenced by

the ionic composition of the culture water and its relative changes
in the ionic strength will bring a substantial change in the floc
morphology. The other factors influencing the physical and
chemical characteristics of biofloc includes the type of carbon
source, C/N ratio, DO concentrations, shear force caused due to
aeration and settling time. The fluctuations of floc quality
characteristics throughout the culture trial was given in figure 1
and table 6.
The concentration of Total solids, Total suspended solids
and Total dissolved solids found to be higher in T2 than T1.This
may be due to the addition of grain pellets and carbon source in
the prototype of T2 which paves the way for the faster
development of biofloc.Also the percentage of nitrogen in Urea
constitutes about 45% and in ammonium sulphate it is closely to
20% (Boyd, 2012). This leads to the presence of increased floc
volume in T2 than T1.The inclined trend of BOD level in T2
can be correlated with the abundance of the heterotrophic
70
microorganisms. Significant difference was found between the

treatments in total plate count and vibrio count of the culture
water (Table 4). The increase in total plate count in T2 with
decreased vibrio count revealed the multiplication of beneficial
heterotrophic organisms in the culture water. The increased
oxygen demand of microbes, culture animal and the organic
matter was vividly observed in T2 with the constant C/N ratio
under vigorous aeration.
Table 6: Quantitative and Qualitative Characteristics of biofloc in the

experimental groups of GIFT Tilapia culture
Parameters T1 T2
Total Solids (mg/L) 184.4-699 294.4-1240
Total Suspended Solids (mg/L) 98-236 139-589
Total Dissolved Solids (mg/L) 57.9-326 159.4-641
Biochemical Oxygen Demand (mg/L) 3.0-7.4 4.2-8.3
Volatile Suspended Solids (mg/L) 12.2-103.4 48.5-230.9
Total Organic Carbon (%) 0.04-1.54 0.56-1.76
Floc Size (Pm) 50.14-378.98 119.54-1058.42
Settling Velocity (mm/sec) 0.47-1.98 0.89-3.15
Porosity (%) 95.11-98.70 97.50-98.74
Floc Volume (ml/L) 0.21-18.76 8-46
Floc Volume Index (ml/g) 0.002-0.079 0.05-0.100
Floc Density Index (g/100ml) 1233.99-2666.67 996.66-1823.07
Mean values in the same row with different superscript differ significantly (P<0.05)
Due to the increased solid concentrations in T2 the presence

of higher organic particulate particles was observed with higher
Volatile suspended solids. The total organic carbon content of
the floc is directly proportional to the VSS and hence the amount
71
72
Figure 1: Quantitative and Qualitative Characteristics of biofloc in the experimental groups of GIFT Tilapia culture
73
74
of total organic carbon was found higher in T2. The floc size of
250-1200 m was recommended as it serve as a nutrition source
for the aquaculture animals (Barros and Valenti, 2003). The floc
sizes observed in the study were within the desirable range for
the intake of GIFT Tilapia and a steady state was observed in
the treatments based on the floc volume. The floc porosity was
higher in T1 compared to T2. The floc porosity is indirectly
proportional to the floc size as the flocs are highly porous, the
filtration of the suspension will be higher and hence porosity of
smaller sized flocs will be higher than larger flocs. The floc volume
index (FVI) was found to determine the settleability as well as
the age of the floc. Lower the FVI higher the settleablity and it
can improve the performance of the culture systems as a source
of nutrition thereby maintaining the optimum water quality
parameters.
The higher FVI was observed in T2 and this pave more

opportunity for the animal to filter the floc with improved floc
intake. However the higher FVI also would cause possible
clogging of fish gills was also observed as suggested by
Avnimelech (2012). The better settleability of floc was observed
in T1 due to decreased floc volume and lower FVI. The floc
density index (FDI) is an index to determine the compaction
and settling ability of floc. The flocs in T1 possessed higher FDI
with good compact ability compared to T2.However these
changes were observed in a very small level.
In the proximate composition, crude protein, crude lipid

and total ash were significantly different (p<0.05) between the
treatments. This may be due to the rapid formation of floc leading
75
to increased floc volume in T2 by the use of different inorganic

fertilizers. These results also indicate the fact that the nutritional
quality of floc was not only related to protein content of the feed
and carbon source but also on the use of fertilizers triggering the
growth of favourable micro-organisms in the culture systems.
The proximate analysis of the biofloc obtained from both
treatments were similar to the nutritional profile of floc developed
using wheat flour and molasses as carbon sources (Ballester et al.
2010). The crude protein content of biofloc collected from two
treatments were within the range and confirmed the use of
biofloc as a nutritional source to the culture animals (Azim and
Little, 2008; De Schryver and Verstraete, 2009; Crab et al. 2010;
Ekasari et al. 2010).
The ash content in the floc may vary based on the
accumulation of solid concentrations in the biofloc systems. As
the suspended and dissolved solid concentrations were higher in
T2 the increased ash content (45%) was found in T2 which is
similar to the findings of De Schryver and Verstraete (2009). It
is interesting to note the increased gross energy level was observed
in the treatments and this may be due to the use of Distillery
spentwash as carbon source. The dominant fatty acids such as
palmitic acid, linoleic acid and oleic acid in the biofloc samples
of T1 and T2 were recorded. The optimum level of Omega 3
fatty acids were observed in T1 and T2 and lower level of PUFA
was found in T1 compared to T2.The difference in PUFA level
may be due to the huge heterotrophic bacterial population which
acts as a nutrient source for the animals to consume (Meyers
and Latscha, 1997). The multifold increase of heterotrophic
bacteria improved the growth of GIFT Tilapia juveniles in T2
76
than T1 (Table 7). By the use of different inorganic fertilizers

along with dolomite supplementation positively promoted the
floc concentration for the maintenance of desirable water quality
parameters. In addition the use of grain pellets also triggers the
proliferation rate of bacteria for the optimum utilization of
nutrients in the biofloc systems. The results of the present study
confirmed the use of different inorganic fertilizers as an effective
method for the biofloc production in GIFT Tilapia culture tanks.
Table 7: Nutritional Composition of biofloc obtained from the experimental
groups in the GIFT Tilapia culture
Nutritional composition T1 T2
Crude protein 29.82 ±0.60a 35.22±1.80 b
Crude lipid 6.5 ±0.5a 4.4±0.1 b
Crude Fibre 4.71±0.32a 4.6±0.2a
Total Ash 41.2 ±0.7a 45.5±0.5b
Ether Extract 1.215 ±0.02a 1.85±0.02b
Total Carbohydrate 23.12±1.31 a 25.01±0.7b
Gross Energy KJ g-1 229.5±5.5a 287.7±6.2b
Myristic Acid (14:0) 2.92±0.5 a 3.68 ±0.04a
Palmitic Acid (16:0) 29.69 ±0.5a 24.995 ±0.57a
Stearic Acid (18:0) 10.84 ±0.5a 5.155 ±0.17a
Oleic Acid (18:1) 31.91 ±0.5a 21.165 ±0.98b
Linoleic Acid (18:2n-6) 13.23±0.5 a 14.325 ±1.29a
Linolenic Acid (18:3n-3) 1.5 ±0.5a 13.05 ±0.35b
Arachidic Acid (20:1) 0.375±0.5 a 1.81 ±0.19a
Behenic Acid (22:0) 1.24 ±0.5a 1.445 ±0.10a
Eicosapentaenoic Acid (20:5n-3) 0.665 ±0.5a 0.78 ±0.05a
Docosahexaenoic Acid (22:6n-3) 0.79 ±0.5a 1.035 ±0.08a
Palmitoleic Acid (16:1n-7) 6.995 ±0.5a 9.465 ±0.51b
Others 0.84 ±0.5a 0.6 ±0.01a
77
The biofloc developed from the different fertilization

prototypes influenced the physical and nutritional quality of the
floc by favouring the utilization of major nutrients from the
fertilizers in the culture tanks. The stability of the flocs and its
characteristics vary for the initial days of the culture for the two
methods of fertilization however, the steady state floc quality
maintenance after thirty days of the culture remained the same.
The development of floc was very rapid and increased floc volume
in the use of combination of different inorganic fertilizers
throughout the experiment was observed. The lower floc volume
was maintained in the ammonium sulphate based fertilization
in the freshwater. Thus the findings of the study suggested the
adoption of use of inorganic fertilizers for the faster development
of floc with the predominant heterotrophic bacterial community.
The floc stability and floc volume maintenance can be monitored
with the addition of the distillery spentwash for the optimum
water quality to improve the animal performance.The present
findings can be further studied in different salinities as this
biofloc technology is applied in both fresh water and sea water.
REFERENCES
AOAC. 2005. Official method of Analysis. 18th Edition,
Association of Officiating Analytical Chemists, Washington
DC, Method 935.14 and 992.24.
Methods for the Examination of Water and Wastewater.
American Public Health Association, Washington, DC.
78
Avnimelech, Y. and Kochba, M. 2009. Evaluation of nitrogen

uptake and excretion by tilapia in bio floc tanks, using 15 N
tracing. Aquacult., 287: 163-168.
Avnimelech, Y. 2015. Biofloc Technology-A Practical Guide Book
(3rd Edn.). The World Aquaculture Society, Baton Rouge,
United States, pp-37-46
Avnimelech, Y. 2012. Biofloc technology- A Practical Guide Book
(2nd Edn.). The World Aquaculture Society, Baton Rouge,
Louisian, United States.
Azim, M.E. and Little, D.C. 2008. The biofloc technology (BFT)
in indoor tanks:Water quality, biofloc composition, and growth
and welfare of Nile tilapia (Oreochromis niloticus). Aquacult.,
283: 29-35.
Ballester, E.L.C., Abreau, P.C., Cavalli, R.O., Emerenciano, M.,
Abreu, L. and Wasielesky, W. 2010. Effect of practical diets
with different protein levels on the performance of
Farfantepenaeus paulensis juveniles nursed in a zero exchange
suspended microbial flocs intensive system. Aquaculture Nutri.,
16:163-172.
Boyd, C. E., and Tucker, C.S. 2012. Pond aquaculture water quality
management. Springer Science & Business Media.
Crab, R., Kochva, M., Verstraete, W. and Avnimelech, Y. 2009.
Bio-flocs technology application in over-wintering of tilapia.
Aquacult. Eng., 40(3): 105-112.
Crab. R., Chilelens, B., Wille, M., Bossier, P. and Verstraete, W.
2010. The effect of different carbon sources on the nutritional
value of bioflocs, a feed for Macrobrachium rosenbergii
postlarvae. Aquacult. Res., 41: 559-567.
79
de Barros, H. P. and Valenti, W. C. 2003. Food intake of

Macrobrachium rosenbergii during lar val development.
Aquaculture, 216(1-4): 165-176.
De Schryver, P. and Verstraete, W. 2009. Nitrogen removal from
aquaculture pond water by heterotrophic nitrogen assimilation
in lab-scale sequencing batch reactors. Bioresource Technology,
100(3): 1162-1167.
Ebeling, J. M. and Timmons, M. B. 2007. Stoichiometry of
ammonia-nitrogen removal in zero-exchange systems. World
aquaculture.
Ebeling, J.M., Timmons, M.B. and Bisogni, J.J. 2006. Engineering
and heterotrophic removal of ammonia-nitrogen in aquaculture
systems. Aquacult., 257: 346–358.
Ekasari, J., Crab, R. and Verstraetehayati, W. (2010). Primary
nutritional content of bio-flocs cultures with different organic
carbon sources and salinity. HAYATI J. Biosci., 17(3): 125
130.
Folch, J., Lees, M., and Sloane Stanley, G. H. 1957. A simple
method for the isolation and purification of total lipides from
animal tissues. J biol Chem, 226(1): 497-509.
Grag, S.K. and Bhatnagar, A. 2000. Effect of fertilization frequency
on pond productivity and fish biomass in still water ponds
stocked with Cirrhinusmrigala (Ham.). Aquac. Res., 31: 409
414.
Hargreaves, J.A. 2013. Biofloc production systems for aquaculture.
SRAC, 4503: 1-12.
80
Hargreaves, J.A. 2006. Photosynthetic suspended-growth systems

in aquaculture. Aquac. Eng, 34: 344–363.
Holt, J. G., Williams, S. T. and Holt. 1989. Bergey’s manual of
systematic bacteriology, Vol. 4. Lippincott Williams & Wilkins.
Ling, J. and Chen, S. 2005. Impact of organic carbon on
nitrification performance of different biofilters. Aquac. Eng,
33: 150–162.
Masser, M.P., Rakocy, J. and Losordo, T.M. 1999. Recirculating
aquaculture tank production systems — management of
recirculating systems. SRAC Publication, 452.
Menaga, M. and Fitzsimmons, K. 2017. Growth of the Tilapia
Industry in India. World Aquaculture. 49.
Menaga, M., Felix, S. and Gopalakannan, A. 2017. Distillery
wastage (spentwash) as a Novel carbon source for Aquaculture
Intensification. Indian Vet. J., 94(12): 15 – 17.
Meyers, S.P. and Latscha, T. 1997. Carotenoids. In: D’Abramo,
L.R., Conklin, D.E., Akiyama, D.M. (Eds.), Crustacean
Nutrition, Advances in World Aquaculture, 6. World Aquacult
Soc, Baton Rouge, LA, pp. 164–193.
Mohlman, F.W. 1934. The sludge index. Sewage Works Journal,
119-122.
Schneider, O., Sereti, V., Eding, E.H. and Verreth, J.A.J. 2005.
Analysis of nutrient flows in integrated intensive aquaculture
systems. Aquac. Eng., 32: 379–401.
Smith, P.G. and Coackley, P. 1984. Diffusivity, tortuosity and pore
structure of activated sludge. Water Res., 18(1): 117-122.
81

production. Aquaculture America.
Villaverde, S., Fdz-Polanco, F. and García, P.A. 2000. Nitrifying
biofilm acclimation to free ammonia in submerged biofilters,
Start-up influence. Water Res., 34: 602–610.
Walkley, A. and Black, I.A. 1934. An examination of the Degtjareff
method for determining soil organic matter, and a proposed
modification of the chromic acid titration method. Soil Sci.,
37(1): 29-38.
WHO international reference center. 1978. Methods of Analysis
of Sewage Sludge Solid Waste and Compost, Switzerland, 49.
82
DISTILLARY SPENT WASH AS A CARBON SOURCE IN INTENSIVE .....
CHAPTER 4
DISTILLARY SPENT WASH AS A

CARBON SOURCE IN INTENSIVE
BIOFLOC NURSERY REARING OF
PENAEUS VANNAMEI
A thirty days experimental trial was performed to investigate

the effect of aerobic microbial floc system (AMFS) and
aerobic microbial floc/ biofloc incorporated feed (AMFF) on
water quality, growth performance, survival and the digestive
enzyme activity of the Penaeus vannamei in 30-tonnes raceways.
Shrimp post larvae (PL15) were stocked at a density of 1500/m3
in different treatments such as aerobic microbial floc system +
commercial feed (AMFS+CF), aerobic microbial floc system +
aerobic microbial floc incorporated feed (AMFS+ AMFF), clear
water system + commercial feed (CWS + CF) in triplicates.
Distillery spent wash was used as a carbon source in the AMFS
to maintain the C/N ratio at 15:1. At the end of the experiment,
AMFS + AMFF showed significantly (P < 0.05) higher digestive
enzyme activity such as protease, amylase, and lipase in stomach,
83
intestine and hepatopancreas of the shrimp. AMFS + AMFF

showed significantly (P < 0.05) higher growth performance,
survival (89.44±1.23) and better FCR (1.044±0.002) than the
other treatments. Significant difference (P < 0.05) in RNA:DNA
ratio was found in CWS + CF followed by AMFS. The results
from the present study suggests the suitability of AMFS+AMFF
treatment for the enhanced growth and digestive enzyme activity
of white leg shrimp.
INTRODUCTION
To encounter the growing food demand of the rapidly growing
haman population the shrimp farming industry is likely to shift
from semi intensive rearing to intensive rearing systems with
multiple crops/year. Intensive aquaculture systems efficiently
produce dense biomass of shrimp and fish. However, the intensive
system results in a rapid accumulation of feed, toxic materials,
organic matter and nitrogen compounds in the culture system
(Sahu et al., 2013b; Sun and Boyd, 2013). Around 70 to 80% of
nitrogen which is added as input to the aquaculture system,
remains unutilized and released to the adjacent environment in
the form of ammonia, organic nitrogen in feces and residues
(Funge-Smith and Briggs, 1998; Avnimelech and Ritvo, 2003;
Jackson et al., 2003; Sahu et al., 2013a). Intensive shrimp culture
system faces several inevitable environmental problems such as
deterioration of water quality, eutrophication, pathogen spread,
and disease outbreak (Avnimelech, 2007; Zhang et al., 2012; Liu
et al., 2014). To overcome these constraints, nitrogen removal
techniques were developed and adopted. Aerobic microbial floc
84
(Biofloc) has recognized as one among many advanced

technologies for solving the impacts aforesaid to attain sustainable
aquaculture (Avnimelech, 2007; Crab et al., 2007; De Schryver
et al., 2008).
Aerobic microbial floc technology has been gaining
importance and found to be lucrative for treating in-situ culture
water without affecting the shrimp production. This technology
mainly depends on the manipulation and regulation of carbon/
nitrogen ratio (C/N ratio) at 10:1 to 20:1 in culture water through
the addition of carbon source (molasses, sugar, wheat, feed etc.)
and uptake of ammonia by microbial community (Avnimelech
et al., 1994; Avnimelech, 1999; Crab et al., 2007) to minimize
the regular water exchange. The nutrients from excretion and
remnant feed are recycled by microbial community such as
heterotrophic bacteria, protozoa, phytoplankton and zooplankton
of high quality feed for fish and shrimp (McIntosh, 2000;
Avnimelech, 2007) and reduce the potential spread of pathogen
(Burford et al., 2003; Crab et al., 2010; Xu and Pan, 2013). Biofloc
floc improves the water quality, growth performance, and FCR
in a zero water exchange intensive culture system of shrimp
(Schveitzer et al., 2013; Xu et al., 2012).
Although microbial floc technology has been applied and
developed in intensive shrimp culture system especially for P.
vannamei (Crab et al., 2007; Ballester et al., 2010; Xu and Pan
2012; Xu et al., 2012), the information concerning how microbial
floc can maximize the nutritional benefits to the cultured shrimp
is limited. Also, the impact of floc intake directly or through
feed by shrimp has not been investigated much in the earlier
85
studies. This study was designed and conducted to evaluate the

effect of aerobic microbial floc system (AMFS) and aerobic
microbial floc incorporated feed (AMFF) on inorganic nitrogen
control, the digestive enzyme activity of the shrimp, growth
performance of P. vannamei in the intensive nursery culture
system
METHODOLOGY
Experimental Design
The experiment was carried out in raceways with 30-ton capacity,
over a period of thirty days in indoor nursery raceways at Brackish
Water Research Farm Facility, TNJF U-OMR Campus,
Fisheries College and Research Institute, Ponneri, TNJFU. A
clear water system and aerobic microbial floc system were
compared with AMFF and commercial shrimp feed containing
a similar level of crude protein (35%). The experimental group
includes aerobic microbial floc system + commercial feed
(AMFS+CF), aerobic microbial floc system + aerobic microbial
floc incorporated feed (AMFS+ AMFF), clear water system +
commercial feed (CWS + CF).
Distillery spent wash (DSW) (24% of the carbon source)
was collected from M/s. Rajshree Biosolutions Pvt. Ltd. situated
at Coimbatore district, Tamil Nadu, India. It was used as a
carbon source for maintaining the feed carbon-nitrogen ratio at
15:1, in AMF system (Avnimelech, 1999) and clear water system
was operated with regular water exchange throughout the trial.
86
Seed Stocking and Tank Management

PL 15 shrimp (0.02±0.01 g) (Penaeus vannamei), used for the
experiments were procured from Aqua Nova shrimp hatchery
Kanathur, OMR Road, Chennai and acclimatized for 3 days at
20 ‰. The seed samples were tested for WSSV, AHPND and
EHP infections at Molecular diagnostic laboratory, Dr. MGR
Fisheries College and Research Institute, Ponneri. The healthy
shrimp were stocked in raceways at the rate of 1500 PL/m3
(Silva et al., 2015) and shrimp were fed with CF and AMFF
containing 35% crude protein (Table 1). Feeding was done
manually at four times a day (6.00, 10.00, 14.00, and 18.00) based
on the average body weight of the shrimp.
Table 1: T he proximate composition of the (% dry weight basis) feeds used
for culture
Parameters Commercial feed Aerobic Microbial Floc

incorporated Feed
Moisture 11.66 13.57
Protein 36.35 35
Fiber 2.85 3.62
Fat 5.62 6.77
Total ash 8.99 10.94
Gross energy (kcal kg-1) 4083 3885
Water Quality and Biofloc Parameters

The physicochemical parameters of water from the experimental
groups has been analyzed daily for the whole experimental period.
Visual analysis of water quality, such as color and flocculation was
also observed daily. Temperature, salinity, pH, total alkalinity,
87
dissolved oxygen (DO), total hardness, nitrate-nitrogen(N-NO3),

nitrite-nitrogen(N-NO2), ammonia-nitrogen(N-NH4-), total
suspended solids (TSS) were measured following standard
protocols (APHA, 2005). AMF volume was obtained using Imhoff
cones for every three days (Avnimelech and Kochaba, 2009).
Aerobic Microbial Floc and Shrimp Sampling

At the end of experiment, floc samples were collected through 20
micron mesh nylon filter bag. The samples were dried in a hot air
oven at 105°C until a constant weight was achieved. The crude
protein, lipid, fiber, and carbohydrate of the microbial floc and
shrimp were analyzed using standard methods (A.O.A.C., 1995).
Protein was determined by measuring nitrogen using the Kjeldahl
method multiplying with 6.25; lipid by ether extraction using
soxhlet and ash by oven incineration at 550°C, moisture content
was determined by hot air oven drying at 105°C for 24 hours.
100 shrimp were collected randomly from each treatment
for enzyme analysis at the end of the experiment. Shrimp
hepatopancreas, stomach and intestine were pooled, and
homogenized.The homogenate (10%) was prepared with
phosphate buffer (pH 7.5 and 0.1 M). 0.5 ml of Tween 20 and
1 ml of homogenized sample was taken for the extraction of the
enzyme. The suspension was centrifuged at 5000 rpm for 15
minutes and the supernatant was collected.
Enzyme Activity
Amylase activity assay was done according to 3,5 dinitrosalicylic
acid colorimetric method by Clark (1964) using starch as the
88
substrate. Protease activity was analysed by azocasein as the

substrate (Sarath et al.,1989). Lipase activity was determined by
Cherry and Crandel, (1932) based on the measurement of fatty
acid release due to enzymatic hydrolysis of olive oil. Enzyme
activity was measured as the changes in the absorbance, using
the spectrophotometer (Lamba 25 UV Win Lab V 6.0) and
expressed as specific activity (Umg-1protein-1-min--1). Total
soluble protein content was measured by adopting Bradford
(1976) method.
Growth analysis
At the end of the experiment, the growth performance of stocked
shrimp was estimated as follows:
i) Percentage weight gain = [Final weight (g) – Initial weight
(g) X 100] / Initial weight (g)
Specific growth rate {SGR (%/day)} = [(ln final weight – ln
initial weight) ×100] / Rearing period (days)
ii) Feed Conversion Ratio = Feed given (dry weight) / Body
weight gain (wet weight)
iii) Protein Efficiency Ratio = Body weight gain (wet weight) /
Crude Protein fed
iv) Survival (%) = (Total number of shrimp harvested / Total
number stocked) x 100
Quantitative determination of nucleic acids (RNA-DNA
ratio) in shrimp abdomen muscle was done by Pentose analysis
following the method of Schneider, (1957).
Statistical analysis were performed using SPSS 24.0 for
Windows. One-way analysis of variance (ANOVA) was
89
performed to examine the difference in growth parameters, water

quality parameters, digestive enzyme activity and RNA- DNA
ratio, among the treatments. The post hoc analysis was performed
using Duncan’s multiple range test to determine the significant
difference among the treatments.

Water Quality and AMF Development
Water quality parameters such as TAN, alkalinity, and BOD
significantly differed in all treatments (Fig. 1). No significant
difference was observed in dissolved oxygen, temperature, salinity,
pH, and hardness. The documented water quality in all
experimental groups remained within the limit for shrimp culture
throughout the culture period (Table 2).
Table 2: Water quality parameters of experimental groups for the 30 days

of culture trial
Parameter AMFS CF AMFS AMFF CSW CF

DO (ppm) 5.2 –8.6 5.2 – 7 3.2 – 5.6
Temperature (°C) 25–30 25–30 25–30
Salinity (‰) 19.5–21.5 19.5–21.5 19.5–21.5
pH 7–8.5 7–8.5 7–8.5
Nitrite (N-NO2) (mg / L-1) 0.1–1.2 0.1–1.2 0.1–1.1
Nitrate ( N-NO3)(mg / L-1) 0.3–1.0 0.3–1.0 0.6–1.3
(Duncans Multiple Range Test (p<0.05)). All the values in percentage were
transformed for ANOVA.
90
Figure 1. Fluctuation of BOD, Alkalinity and Ammonia concentration in different experimental groups stocked with
91
P.vannamei during the 30 days experimental period

92
Figure 1. Fluctuation of BOD, Alkalinity and Ammonia concentration in different experimental groups stocked with
P.vannamei during the 30 days experimental period
Significantly higher TSS, and floc volume was recorded in

AMFS+AMFF and FVI was significantly higher in the AMFS
+ CF treatment. (Fig. 2). The average floc volume and TSS
ranged from 14 –18 ml L-1 and 300 -– 420 mg L-1 in AMFS
based treatments.
Digestive Enzyme Activity of Shrimp

Significant differences (P>0.05) in the digestive enzyme activity
were observed in all the treatments. The specific activity of the
protease, amylase, and lipase in hepatopancreas, stomach, and
intestine were significantly higher in AMFS + AMFF followed
by CWS + AMFF (Fig 3).
Zoo Technical Performance of the Shrimp

The growth performance of the shrimp in AMFS+AMFF was
significantly (P<0.05) higher than other treatments (Table. 3).
Mean survival rate was higher than 88% in AMFS based
treatments. AMFS+AMFF treatment showed a better FCR and
PER when compared to other treatments.
RNA - DNA ratio was observed fortnightly in different
experimental groups during the culture period (Fig. 4). The
ratio between RNA and DNA ranged from 0.20 to 0.33 in all
the experimental groups. At DOC 15, the ratio was higher in
AMFS + CF and lowest level was observed in AMFS + AMFF.
At the end of the experiment (30th day), CWS + CF reared
shrimps showed the highest RNA -DNA ratio, which was
significantly different (P<0.05) from other treatment groups.
93
94
Figure 2. Changes in floc volume, total suspended solids (TSS), and floc volume index (FVI) in different experimental
groups stocked with P.vannamei during the 30 days experimental period.
Figure 2. Changes in floc volume, total suspended solids (TSS), and floc volume index (FVI) in different experimental
groups stocked with P.vannamei during the 30 days experimental period.
95
96
Figure 3. Specific activity of total protease, amylase, and lipase in the hepatopancreas (H), intestine (I), and
stomach (S) of P.vannamei in different experimental groups at the end of 30 day feeding experiment.
Figure 3. Specific activity of total protease, amylase, and lipase in the hepatopancreas (H), intestine (I), and
stomach (S) of P.vannamei in different experimental groups at the end of 30 day feeding experiment.
97
98
Figure 4. RNA-DNA ratio of P.vannamei in different experimental groups at the middle (15 days) and end of (30
days) feeding experiment.
Table 3: Growth performance and feed utilization of juvenile Penaeus vannamei
S. Growth parameters CSW AMFS AMFS

No + CF + CF + AMFF
1. Initial body weight (g) 0.02 0.02 0.02
2. Final body weight (g) 1.0048 b ±0.052 1.0322 a±0.01 1.0352 a±0.025
3. Percentage weight 49.24±0.01 b 50.61±0.05 a 50.76±0.05 a
gain (%)
4. Survival rate (%) 79.99 b±0.5 88.88a±1.1 89.44a±1.23
5. SGR (% day-1) 13.05b±0.2 13.14a±0.5 13.15a±0.3
6. FCR 1.08b±0.001 1.047a±0.005 1.044a±0.002
7. PER 0.028b ±0.001 0.023c ±0.001 0.031 a±0.001
(Duncans Multiple Range Test (p<0.05)). All the values were transformed for
ANOVA. *SGR: Specific Growth Rate; FCR: Feed Conversion Ratio; FER: Feed
Efficiency Ratio; PER: Protein Efficiency Ratio.

Water quality parameters recorded in all the experimental groups
during the experiment were in the optimal range for the nursery
rearing of P. vannamei. This indicates that the experimental
condition was conducive to the growth of the shrimp in AMF
(Felix et al., 2015). Dissolved oxygen observed in this study (4 –
8.5 mg L-1) improved the survival and growth of P. vannamei
(McGraw et al., 2001). The adequate DO level in all the
treatments during the experimental period was attributed due to
continuous aeration. Water pH in all the treatments was found
within the ideal range of 7.0-8.8 (Van Wyk et al., 1999). The
alkalinity levels were found optimum as suggested by Boyd et al.,
2002 and this might have improved the physiological conditions
of shrimp allowing shedding and proper formation of the
99
exoskeleton, promoting growth and survival of organisms

(McGraw and Scarpa, 2003).
In the present study, use of distillery spent wash to maintain
the C/N ratio 15:1 was efficient to remove all forms of nitrogen
compounds (NH4-N, NO2-N, NO3-N) without a substantial
increase in BOD (Avnimelech, 1999). DSW assimilated the
ammonia and thus produced good quality microbial floc protein
(Felix et al., 2015; Liu et al., 2017). The presence of high
concentration of NO2-N & NO3-N in AMFS treatments
indicates the occurrence of nitrification processes in the culture
systems. The nitrogen dynamics and reduction in TAN
concentration confirms the conversion of organic nitrogen by
using distillery spent wash as a substrate and this finding was
consistent, with those of the previous studies (Liu et al., 2017;
Raj et al., 2017; Felix et al., 2015; Luo et al., 2013; Yao et al., 2013;
Lu et al., 2012).
In AMFS, floc volume and TSS levels increased gradually
and were kept within the acceptable range for shrimp culture
(Samocha et al., 2007). Several authors have indicated a similar
trend of concentration of TSS, which is beneficial to the shrimp
and the system stability (De Schryver et al., 2008). The levels of
TSS in AMFS+AMFF treatment were significantly higher than
the AMFS + CF. These differences stemmed due to the
ingredient composition of AMFF and intake of floc by the
culture shrimp.
Digestive Enzyme Activity

Biochemical composition of the diet plays a vital role in the
digestive enzyme profile of shrimp (Gamboa-delgado et al., 2003).
100
In the present study, dietary supplementation of AMFF

significantly (P<0.05) improved the specific activity of the
digestive enzymes like protease, amylase, and lipase in
AMFS+AMFF treatment compared to other treatments. The
increased digestive enzyme activity in AMFS+AMFF treatment
enhanced the digestion and nutrient absorption of shrimp and
recorded significantly higher (P<0.05) growth rate. A previous
study by Xu and Pan, (2012) in microbial floc based system
reported similar results in P. vannamei. This may also be due to
the interference of live microorganisms attached to the aerobic
microbial floc after transition through the stomachs with resident
intestinal microflora (Moss et al., 2000), which plays an important
role in the production or secretion of digestive enzymes (Harris,
1993; Moss et al., 2000; Moss et al., 2001; Xu and Pan, 2012).
Thus, the aerobic microbial floc could influence the digestive
processes of the shrimp due to the presence of enzymes secreted
by microbial floc, inducing endogenous enzymes and altering
intestinal microflora balance.
Similarly, an enhanced level of digestive enzyme activity has
been reported in fish and shrimp fed with probiotic, microalgae
and periphyton supplemented diet (Anand et al., 2013 and Lara-
Flores et al., 2003) and the presence of microbial compounds in
the microbial floc supplemented diet might have stimulated the
production of an endogenous enzyme by the shrimp digestive
organs (Ziaei-Nejad et al. 2006). Despite the higher ash and
fiber level recorded in the AMFF diet, the cultured shrimp
showed higher specific enzyme activity compared to other
treatments. Nevertheless, this may be because, the shrimp possess
a suite of a digestive enzymes capable of hydrolyzing a variety of
101
substances and several factors have been implicating in altering

digestive enzyme activity including diet (Lee et al., 1984).
Biogrowth Parameters
In the present study, P. vannamei reared under AMFS using
distillery spent wash showed a better performance in terms of
mean body weight, SGR, FCR, PER, survival, and yield
compared to CWS. The results agreed with the findings of Xu
and Pan, (2012); Serra et al. (2015) as AMFS impacts positively
on shrimp growth performance. The inclusion of aerobic
microbial floc as a dietary ingredient in shrimp diet (AMFF)
found to improve the growth performance and relatively higher
survival of P. vannamei when compared to CWS+CF treatment
( Ju et al., 2008; Kuhn et al., 2009, 2010). This difference was
mainly due to the composition of microbial floc, as they are the
rich source of many bioactive compounds such as carotenoid,
chlorophylls, phytosterols, bromophenols, amino sugars ( Ju et
al., 2008) and antibacterial compounds (Crab, 2010). The
presence of microbial compounds, unknown growth factors,
beneficial micro-organisms in the Aerobic microbial floc might
have resulted in a significantly higher growth rate and better
FCR in shrimp fed with AMFF. FCR in AMFS was better
when compared to CWS and agrees with the findings of
Avnimelech et al. (1994) who found that lowering feed
application up to 30 % of conventional feeding ration, did not
lower shrimp growth. This may be due to the presence of AMF,
where animals were fed continuously with floc and thus
supplementary feed intake was less leading to improved FCR.
102
AMFS treatments resulted in higher survival due to the provision

of essential nutrients, such as amino acids, vitamins, and minerals
present in the flocs (Decamp et al., 2002).
Quantification of RNA - DNA Ratio in Muscle

The RNA content in AMFS+ CF was high on 15th day
compared to other treatments. As the somatic growth of shrimp
is directly related to the protein synthesis in tissues. RNA-DNA
ratio is directly correlated with protein synthesis as RNA is the
precursor for the protein synthesis. RNA-DNA ratio was
significantly higher in AMFS than CSW due to favorable water
quality parameters and nutrient rich feed availability in the
system. It indicates the production of higher level of protein and
tissue formation, caused by aerobic microbial floc (Wilder and
Stanley 1983). The changes in nucleic acids implicate changes in
growth performance of the shrimp and this parameter as an
indicator for growth, and nutritional status of the shrimp was
observed between AMFS and CWS (Tewary and Patra, 2008).At
the end of the trial, the RNA:DNA ratio were found in the
decreasing trend in AMFS treatments and this may be due to
stress caused by the increased biomass. However, the result
obtained from the present study was within the suitable range
of 0.20 to 0.32 and agreed with the findings of Moss, (1994).Thus
presence of AMF improved the growth performance in AMFS
treatments.
Distillery spent wash induced nitrogen management through
aerobic microbial floc system will go long way, enabling enhanced
shrimp production with reduced input cost. Aerobic microbial
103
floc system could significantly impact the NH3-N, NO2-N

concentration and TSS, FV level in the system under limited
water exchange. All water quality parameters were maintained
within the optimal ranges for shrimp culture. The supplied
aerobic microbial floc incorporated diet (AMFF) and AMFS
positively influenced the growth performance and feed utilization
of shrimp by enhancing the digestive enzyme activities. This
study, elucidates the suitability of aerobic microbial floc system
and incorporation of aerobic microbial floc in shrimp feed for
the nursery rearing of P. vannamei.
ACKNOWLEDGMENT
The research work was part of the project funded by the
Department of Biotechnology, Govt of India , New Delhi ( DBT
– Project code : 507; PI: Dr.S.Felix ).
REFERENCES
A.O.A.C. 1995. Official methods of analysis of AOAC
International. Arlington, Va.: AOAC Intl. pv (loose-leaf ).
Ajiboye, O.O., Yakubu, A.F. and Adams, T.E. 2012. A perspective
on the ingestion and nutritional effects of feed additives in
farmed fish species. World J. Fish Mar. Sci., 4, 87-101.
Anand, P.S., Kohli, M.P.S., Kumar, S., Sundaray, J.K., Roy, S.D.,
Venkateshwarlu, G., Sinha, A. and Pailan, G.H. 2014. Effect
of dietary supplementation of biofloc on growth performance
and digestive enzyme activities in Penaeus monodon.
Aquaculture, 418: 108-115.
104
Anand, P.S., Kohli, M.P.S., Roy, S.D., Sundaray, J.K., Kumar, S.,
Sinha, A., Pailan, G.H. and kumar Sukham, M. 2013. Effect
of dietary supplementation of periphyton on growth
performance and digestive enzyme activities in Penaeus
monodon. Aquaculture, 392: 59-68.
APHA, A. 2005. Standard methods for the estimation of water
and waste water, 20th ed. Am. Public Health Assoc. Am.
Water Works Assoc. Water Environ. Fed, Washington, D.C
21: 258-259.
Avnimelech, Y. and Kochba, M. 2009. Evaluation of nitrogen
uptake and excretion by tilapia in bio floc tanks, using 15N
tracing. Aquaculture, 287: 163-168.
Avnimelech, Y. and Ritvo, G. 2003. Shrimp and fish pond soils:
processes and management. Aquaculture, 220: 549-567.
Avnimelech, Y. 1999. Carbon/nitrogen ratio as a control element
in aquaculture systems. Aquaculture, 176: 227-235.
Avnimelech, Y. 2007. Feeding with microbial flocs by tilapia in
minimal discharge bio-flocs technology ponds. Aquaculture,
264: 140-147.
Avnimelech, Y., Kochva, M. and Diab, S. 1994. Development of
controlled intensive aquaculture systems with a limited water
exchange and adjusted carbon to nitrogen ratio. Isr. J. Aquacult.
Bamidgeh, 46: 119-131.
Ballester, E.L.C., Abreu, P.C., Cavalli, R.O., Emerenciano, M., De
Abreu, L. and Wasielesky Jr, W. 2010. Effect of practical
diets with different protein levels on the performance of
Farfantepenaeus paulensis juveniles nursed in a zero exchange
suspended microbial flocs intensive system. Aquacult.
Nutr., 16(2): pp.163-172.
105
Boyd, C.E., Thunjai, T. and Boonyaratpalin, M. 2002. Dissolved

salts in water for inland low-salinity shrimp culture. Global
Aquacult. Advocate, 5: 40-45.
Bradford, M.M. 1976. A rapid and sensitive method for the
quantitation of microgram quantities of protein utilizing the
principle of protein-dye binding. Anal. Biochem., 72(1-2): 248
254.
Burford, M. A., Thompson, P. J., Mc Intosh, Bauman, R. H. and
Pearson, D. C. 2003. Nutrient and microbial dynamics in
high intensity, zero exchange shrimp ponds in Belize.
Aquaculture, 219: 393 – 411.
Cherry, I.S. and Crandall Jr, L.A. 1932. The specificity of pancreatic
lipase: its appearance in the blood after pancreatic injury. Am.
J. Physiol. -Legacy Content, 100: 266-273.
Clark, J. M. 1964. Experimental Biochemistry, W. H. Freeman
and Company, San Francisco and London, 228.
Crab, R. 2010. Bioflocs technology: an integrated system for the
aquaculture (Doctoral dissertation, Ghent University).
Crab, R., Avnimelech, Y., Defoirdt, T., Bossier, P. and Verstraete,
W. 2007. Nitrogen removal techniques in aquaculture for a
sustainable production. Aquaculture, 270: 1-14.
De Schryver, P., Crab, R., Defoirdt, T., Boon, N. and Verstraete,
W. 2008. The basics of bio-flocs technology: the added value
for aquaculture. Aquaculture, 277: 125-137.
Decamp, O., Conquest, L., Forster, I. and Tacon, A.G.J. 2002. The
nutrition and feeding of marine shrimp within zero-exchange
aquaculture production system: role of Eukar yotic
microorganisms. Microbial approaches to the aquatic nutrition
106
within environmentally sound aquaculture production systems.

World Aquaculture Society. Baton Rouge. USA, 86p..
Felix, S., Cheryl Antony, Gopalakannan. A., Antony Jesu Prabhu,
P., Rajaram R. 2015. Intensive nursery rearing of Litopenaeus
vannamei in Aerobic Microbial Floc (BIOFLOC) driven low
saline raceway system. World Aquaculture 2015 - Meeting
Abstract.
Funge-Smith, S.J. and Briggs, M.R. 1998. Nutrient budgets in
intensive shrimp ponds: implications for sustainability.
Gamboa delgado, J., Molina poveda, C. and Cahu, C. 2003.
Digestive enzyme activity and food ingesta in juvenile shrimp
Litopenaeus vannamei (Boone, 1931) as a function of body
weight. Aquacult. Res., 34: 1403-1411.
Harris, J.M. 1993. The presence, nature, and role of gut microflora
in aquatic invertebrates: a synthesis. Microb. Ecol., 25: 195
231.
Jackson, C., Preston, N., Thompson, P.J. and Burford, M. 2003.
Nitrogen budget and effluent nitrogen components at an
intensive shrimp farm. Aquaculture, 218: 397-411.
Ju, Z.Y., Forster, I., Conquest, L. and Dominy, W. 2008. Enhanced
growth effects on shrimp (Litopenaeus vannamei) from
inclusion of whole shrimp floc or floc fractions to a formulated
diet. Aquacult. Nut., 14: 533-543.
Kuhn, D.D., Boardman, G.D., Lawrence, A.L., Marsh, L. and
Flick Jr, G.J. 2009. Microbial floc meal as a replacement
ingredient for fish meal and soybean protein in shrimp
feed. Aquaculture, 296: 51-57.
107

L. and Flick Jr, G.J. 2010. Evaluation of two types of bioflocs
derived from biological treatment of fish effluent as feed
ingredients for Pacific white shrimp, Litopenaeus
vannamei. Aquaculture, 303: 28-33.
Lara-Flores, M., Olvera-Novoa, M.A., Guzmán-Méndez, B.E. and
López-Madrid, W. 2003. Use of the bacteria Streptococcus
faecium and Lactobacillus acidophilus, and the yeast
Saccharomyces cerevisiae as growth promoters in Nile tilapia
(Oreochromis niloticus). Aquaculture, 216: 193-201.
Lee, P.G., Smith, L.L. and Lawrence, A.L. 1984. Digestive
proteases of Penaeus vannamei Boone: relationship between
enzyme activity, size and diet. Aquaculture, 42: 225-239.
Liu, L., Hu, Z., Dai, X. and Avnimelech, Y. 2014. Effects of
addition of maize starch on the yield, water quality and
formation of bioflocs in an integrated shrimp culture
system. Aquaculture, 418: 79-86.
Liu, W.C., Luo, G.Z., Li, L., Wang, X.Y., Wang, J., Ma, N.N.,
Sun, D.C. and Tan, H.X. 2017. Nitrogen Dynamics and
Biofloc Composition using Biofloc Technology to Treat
Aquaculture Solid Waste Mixed with Distillery Spent
Wash. N. Am. J. Aquac., 79: 27-35.
Lu, L., Tan, H., Luo, G. and Liang, W. 2012. The effects of
Bacillus subtilis on nitrogen recycling from aquaculture solid
waste using heterotrophic nitrogen assimilation in sequencing
batch reactors. Bioresour. Technol., 124: 180-185.
Luo, G.Z., Avnimelech, Y., Pan, Y.F. and Tan, H.X. 2013.
Inorganic nitrogen dynamics in sequencing batch reactors
108
using biofloc technology to treat aquaculture sludge. Aquacult.

Eng., 52, 73-79.
McGraw, W., Teichert-Coddington, D.R., Rouse, D.B. and Boyd,
C.E. 2001. Higher minimum dissolved oxygen concentrations
increase penaeid shrimp yields in earthen ponds. Aquaculture,
199: 311-321.
McGraw, W.J. and Scarpa, J. 2003. Minimum environmental
potassium for survival of Pacific white shrimp Litopenaeus
vannamei (Boone) in freshwater. J. Shellfish Res., 22: 263-268.
McIntosh, R.P. 2000. Changing paradigms in shrimp farming IV,
low protein feeds and feeding strategies, Global Aquacult.
Advocate, 3: 44-50.
Moss, S.M. 1994. Growth rates, nucleic acid concentrations, and
RNADNA ratios of juvenile white shrimp, Penaeus vannamei,
fed different algal diets. J. Exp. Mar. Biol. Ecol., 182: 193
204.
Moss, S.M., Arce, S.M., Argue, B.J., Otoshi, C.A., Calderon, F.R.
and Tacon, A.G. 2001. Greening of the blue revolution: efforts
toward environmentally responsible shrimp culture. In The
New Wave, Proceedings of the special session on sustainable
shrimp culture, Aquaculture, 1-19.
Moss, S.M., LeaMaster, B.R. and Sweeney, J.N. 2000. Relative
Abundance and Species Composition of Gram Negative,
Aerobic Bacteria Associated with the Gut of Juvenile White
Shrimp Litopenaeus vannamei Reared in Oligotrophic Well
Water and Eutrophic Pond Water. J. World Aquacult. Soc., 31:
255-263.
109
Raj, A., Menaga, M. and Felix, S. 2017. Effect of C/N ratio on

water quality using distillery spentwash as a carbon source in
indoor aerobic microbial floc tanks. Int. J. Sci. Environ.
Technol., 6: 1865-1869.
Sahu, B.C., Adhikari, S. and Dey, L. 2013a. Carbon, nitrogen and
phosphorus budget in shrimp (Penaeus monodon) culture ponds
in eastern India. Aquacult. Int., 21: 453-466.
Sahu, B.C., Adhikari, S., Mahapatra, A.S. and Dey, L. 2013b.
Carbon, nitrogen, and phosphorus budget in scampi
(Macrobrachium rosenbergii) culture ponds. Environ. Monit.
Assess., 185: 10157-10166.
Samocha, T.M., Patnaik, S., Speed, M., Ali, A.M., Burger, J.M.,
Almeida, R.V., Ayub, Z., Harisanto, M., Horowitz, A. and
Brock, D.L. 2007. Use of molasses as carbon source in limited
discharge nursery and grow-out systems for Litopenaeus
vannamei. Aquac. Eng., 36: 184-191.
Sarath, G., De La Motte, R.S. and Wagner, F.W. 1989. Proteolytic
enzymes: a practical approach. Oxford UK, 25.
Schneider, W.C. 1957. [99] Determination of nucleic acids in
tissues by pentose analysis.
Schveitzer, R., Arantes, R., Costódio, P.F.S., do Espírito Santo,
C.M., Arana, L.V., Seiffert, W.Q. and Andreatta, E.R. 2013.
Effect of different biofloc levels on microbial activity, water
quality and performance of Litopenaeus vannamei in a tank
system operated with no water exchange. Aquac. Eng., 56:
59-70.
Serra, F.P., Gaona, C.A., Furtado, P.S., Poersch, L.H. and
Wasielesky, W. 2015. Use of different carbon sources for the
110
biofloc system adopted during the nursery and grow-out culture

of Litopenaeus vannamei. Aquacult. Int., 23, 1325-1339.
Silva, E., Silva, J., Ferreira, F., Soares, M., Soares, R. and Peixoto,
S. 2015. Influence of stocking density on the zootechnical
performance of Litopenaeus vannamei during the nursery phase
in a biofloc system. Boletim do Instituto de Pesca, 41: 777
783.
Sun, W. and Boyd, C.E. 2013. Phosphorus and nitrogen budgets
for inland, saline water shrimp ponds in Alabama. Fish. Aquac.
J., 4: 1–5.
Tewary, A. and Patra, B.C. 2008. Use of vitamin C as an
immunostimulant. Effect on growth, nutritional quality, and
immune response of Labeo rohita (Ham.). Fish Physiol
Biochem., 34: 251-259.
UNDESA. 2014. United Nations Department of Economic and
Social Affairs (2015): World Urbanization Prospects.
Van Wyk P and Scarpa, J. 1999. Water quality requirements and
management in: Van Wyck P (ed) Farming marine shrimp in
recirculating freshwater systems. Florida Department of
Agriculture and Consumer Services, Tallahasee, 128–138.
Wilder, I.B. and Stanley, J.G. 1983. RNA DNA ratio as an index
to growth in salmonid fishes in the laboratory and in streams
contaminated by carbaryl. J. Fish Biol., 22: 165-172.
Xu, W.J. and Pan, L.Q. 2012. Effects of bioflocs on growth
performance, digestive enzyme activity and body composition
of juvenile Litopenaeus vannamei in zero-water exchange tanks
manipulating C/N ratio in feed. Aquaculture, 356: 147-152.
111
Xu, W.J. and Pan, L.Q. 2013. Enhancement of immune response

and antioxidant status of Litopenaeus vannamei juvenile in
biofloc-based culture tanks manipulating high C/N ratio of
feed input. Aquaculture, 412: 117-124.
Xu, W.J., Pan, L.Q., Zhao, D.H. and Huang, J. 2012. Preliminary
investigation into the contribution of bioflocs on protein
nutrition of Litopenaeus vannamei fed with different dietary
protein levels in zero-water exchange culture tanks.
Yao, C., Tan, H.X., Luo, G.Z. and Li, L. 2013. Effects of
temperature on inorganic nitrogen dynamics in sequencing
batch reactors using biofloc technology to treat aquaculture
sludge. N. Am. J. Aquac., 75: 463-467.
Zhang, J., Liu, Y., Tian, L., Yang, H., Liang, G. and Xu, D. 2012.
Effects of dietary mannan oligosaccharide on growth
performance, gut morphology and stress tolerance of juvenile
Pacific white shrimp, Litopenaeus vannamei. Fish Shellfish
Immunol., 33: 1027-1032.
Ziaei-Nejad, S., Rezaei, M.H., Takami, G.A., Lovett, D.L.,
Mirvaghefi, A.R. and Shakouri, M. 2006. The effect of Bacillus
spp. bacteria used as probiotics on digestive enzyme activity,
survival and growth in the Indian white shrimp Fenneropenaeus
indicus. Aquaculture, 252: 516-524.
112
IN-VIVO STUDY OF BACILLUS sp ISOLATED FROM BIOFLOC SYSTEM .....
CHAPTER 5
IN-VIVO STUDY OF BACILLUS SP

ISOLATED FROM BIOFLOC SYSTEM IN
GIFT TILAPIA
B iofloc technology is emerging as one of the sustainable

technologies to increase the aquaculture production. It is
known to possess several immunostimulatory compounds
exhibiting possible probiotic effect in the culture of aquatic
animals. The present study aimed to evaluate the in vivo efficiency
of Bacillus infantis (T1), Bacillus subtilis (T2), Exiguobacterium
profundum (T3) and Bacillus megaterium (T4) isolated from
biofloc systems for improving the growth and immune
performance of GIFT Tilapia. Animals (10±0.08g) were stocked
at a density of 100 per m-3 in 500 liters FRP tanks for 42 days
in triplicates. All the four probiotics (OD =1) were mixed with
basal diet in treatments and feed without probiotic maintained
as Control (C). A significant difference (P< 0.05) in weight
gain, specific growth rate and FCR were observed between
treatments and control with 100% survival. Serum albumin,
globulin, protein, total blood count, glucose, myeloperoxidase
113
activity and SOD were significantly different (P< 0.05) between

treatments and control. T4 and T2 showed better immunological
and anti-oxidant ability when compared to other strains. Results
from principal component analysis demonstrated that B.
megaterium and B. subtilis can be the promising probiotic bacteria
isolated from biofloc systems exhibiting multiple benefits with
improved growth and health of the culture animals.
INTRODUCTION
Tilapias, the second most farmed freshwater fish, have intrinsic
feature like fast growth rate, disease resistance ability, low trophic
level feeding and good flesh quality. The total production of
tilapia in was 6.8 million tonnes in 2018 (FAO, 2020) and
expected to produce 7.3 million tonnes by 2030 (Behera et al.,
2018). The rapid expansion and intensification of aquaculture
resulted in the outbreak of diseases leading to considerable
economic losses and thereby hindering the sustainable
development of the industry (Rico et al., 2014 and Barria et al.,
2020).
To prevent and treat diseases in aquatic animals, antibiotics
have been used for improving aquaculture production.
Indiscriminate usage of antibiotics may result in the development
of antibiotic resistant bacteria, antibiotic residues in the flesh
and the microbial population destruction in the aquatic
environment (Marques et al., 2015 and Kuebutornye et al., 2020).
This leads the adoption of various alternative strategies to replace
the use of antibiotics with pre and probiotics.
114
As probiotics gained its success in human and animal

feeding practices now the attention is on aquaculture. Probiotics,
live microbes when administered as a dietary supplement in
Oreochromis niloticus, confer benefits to the host by improving
the balance of the intestinal microbiota, exclusion of pathogens
and growth performance. The commercially available probiotics
used for tilapia culture were isolated from a wide range of sources
such as tilapia culture water, sediment and its intestine (Apún
Molina et al., 2009; Aly et al., 2008; El-Rhman et al., 2009 and
Del’Duca et al., 2013). Bacillus sp. is one of the most commonly
used probiotics compared to other species due to its active role
in enhancing immune mechanism of tilapia (He et al., 2013).
Bacillus sp. has the efficient enzymatic pathway in breaking the
complex carbohydrates, proteins and lipids (Menaga et al., 2017)
and its spore- forming ability (Hong et al., 2005) adds an extra
advantage of using it in the commercial aquaculture practices.
In recent years, adoption of biofloc technology, a minimal water
exchange technology promotes heterotrophic bacteria has replaced
the commercial probiotics usage as it exerts the possible probiotic
effect in various aquaculture animals (Hargreaves, 2013).
However, reports on the identification and isolation of Bacillus
sp. from biofloc based tilapia culture are limited. This study
attempts to determine the efficiency of 4 Bacillus sp. namely
Bacillus subtilis, B. megaterium, B. infantis and Exiguobacterium
profundum from biofloc systems of GIFT tilapia. This study also
involves the strict process of selection of probiotics from biofloc
systems using in vivo test associated with extensive evaluation in
different aspects such as immunological, haematological
parameters and antioxidant status of GIFT tilapia.
115
MATERIALS AND METHODS

Isolation of Probiotic Bacteria from Biofloc Culture Water
The biofloc was developed and maintained in the 500 litres FRP
tank according to Taw, 2006. Distillery spentwash as a carbon
source was used to maintain C: N ratio at 10:1. The biofloc
water sample was fortnightly screened for probiotic bacteria by
spread plating on MRS agar. The morphologically different
isolates were characterized according to Bergey’s Manual of
Determinative Bacteriology. DNA was isolated from the bacterial
culture using phenol- chloroform method later amplified for its
16s rRNA region using For ward primer
5’AGAGTTTGATCCTGG CTCAG3’ and Reverse primer-
5’CGGTTACCTTGTTACG ACTT3’. The amplified DNA
was sequenced using Sanger’s method and obtained sequences
were aligned and submitted in Genbank. The accession numbers
for the Bacillus sp. were obtained as Bacillus infantis- MH424755
Bacillus subtilis- MH424900, Exiguobacterium profundum
MH424898 and Bacillus megaterium- MH424904.
Experimental Design
A commercial fish feed (30% protein, 4% fat, 4% fibre and 14%
ash of Grobest Feed, India) was used as the basal diet. The
experimental diet includes the basal diet supplemented with four
bacterial cultures isolated from biofloc water which were grown
in LB medium (37 °C for 16 h). The cell pellets were washed
and resuspended in PBS to attain the OD value of 1.00. Later
bacterial suspension was homogenized and sprayed on the
116
experimental diets at a rate of 100ml bacterial suspension/kg of

feed (Zokaeifar et al., 2012). Without bacteria the same volume
of PBS was added to the basal diet for control. The viability of
bacteria in the experimental diets remains stable for seven days
based on the confirmation with plating on the nutrient agar.
Hence, these diets were prepared weekly once to warrant the
bacterial performance.
GIFT tilapia juveniles (10+0.08g) were stocked in fifteen
FRP tanks of 500 litres capacity (50 animals per tank) filled with
freshwater. The experiment was conducted for 42 days and
treatments include: Control (basal diet without bacteria), T-1
(basal diet supplemented with Bacillus infantis), T-2 (basal diet
supplemented with Bacillus subtilis), T-3 (basal diet supplemented
with Exiguobacterium profundum) and T-4 (basal diet
supplemented with Bacillus megaterium) in triplicates. The
animals were fed with two rations at 3% of average body weight
throughout the experimental trial. Regular siphoning of water
from the experimental units was carried out to maintain the
optimum water quality.
Growth Performance
The growth performance and survival of juvenile fishes for all
groups were calculated using the following equations:
Weight gain (WG in g) = Wt – W0
Specific growth rate (SGR, % day-1) = [lnWt – lnW0] / t ×100
FCR = feed offered (dried weight)/weight gain (wet weight);
Survival rate (in %) = (Nt x100) / N0
117
Where W0 and Wt are the initial weight (g) and final

weight (g) of fish, N0 and Nt are initial and final number of fish,
and t represents culture duration in days.

Temperature (mercury thermometer) and pH (Labtronics pH
meter) were measured on a daily basis. As per APHA (2008),
parameters like dissolved oxygen, free carbon dioxide, alkalinity,
hardness, calcium and magnesium ion concentration were
measured weekly. Nitrate-N (NO3 -N) and nitrite nitrogen
(NO2 -N) were estimated using the filtered water samples and
analysed using Resorcinol method. Ammonia was estimated by
phenol hypochlorite method and orthophosphate according to
APHA (2008) every week.
Haematological, Immunological and Anti-Oxidant

Indicators
Fishes were anesthetized using clove oil and the blood samples
were drawn from the caudal vein. The blood was then transferred
to EDTA (an anticoagulant) coated vials and for serum separation
the blood sample was allowed to clot for 15min, centrifuged and
used for further analysis.
Total Blood Count, Albumin and Globulin Content

The total blood count of the experimental animals was enumerated
using Giemsa staining method.
118
To the 10L of serum, 2.5mL of reagent R containing

200mM/L of succinate buffer, 0.4mM/L of bromocresol green
and 4mM/L of sodium azide was added. 10L of albumin (4g/
dL) served as standard. The mixture was incubated for 5min at
20-25°C. The absorbance was read at 623nm against blank
(Doumas et al., 1971).
Albumin concentration (g/dL) = (Aspecimen / Astandard) x 4
Globulin= Total serum protein – albumin
Respiratory Burst Activity

Respiratory burst activity was performed following the modified
method of Anderson and Siwiki (1995). 0.2% of nitroblue
tetrazolium (NBT) solution was added to the 0.1mL blood
sample and incubated for 30min at room temperature (30°C).
1.0 mL N, N-dimethyl formamide (DMF) was added to the
0.05mL of the NBT blood cell suspension and centrifuged for
5 min at 5000 rpm. The collected supernatant was read on a
spectrophotometer at 540 nm.
Myeloperoxidase Activity
Total MPO content present in serum was measured according
to Quade and Roth (1997) with slight modification. Ten μL of
serum sample collected was diluted with 90 μL of Hank’s
balanced salt solution (HBSS). 35 μL of 20 mM 3,3’,5,5’
tetramethyl benzidine hydrochloride (TMB) and five mM H2O2
(freshly prepared) were added to the serum. The colour change
reaction was stopped after 2 min by adding 35 μL of 4 M
sulphuric acid (H2SO4) and the OD was read at 450 nm.
119
Units/mL enzyme = (A470nm Test at 1 min - A470nm

Blank at 1 min) (df ) / (1.0) (0.035)
df = Dilution factor
1.0 = The increase in A470nm/minute per unit of enzyme
0.035 = Volume of enzyme used (mL)
Glucose and Protein Estimation

The serum sample was analysed for glucose level using Beacon
diagnostics pvt. Ltd., kit. The protein estimation in blood as
well in serum was done by Lowry’s method (Lowry et al., 1951).
Catalase stress Enzyme Assay

The blood sample (10-50L) was added to 2.5mL of phosphate
buffer (50mM/ pH7). 1mL of 0.3% H202 (freshly prepared)
was added to the above suspension. The decrease in the
absorbance was read at 240 nm for 3mins at 30 sec interval
(Takahara et al., 196).
CAT (units/mg protein) = [OD/min (3) x total volume]/ [34
x sample volume x protein] x 1000
Super Oxide Dismutase (SOD) Assay

The blood sample (10-50l) was added to 1.5mL of carbonate
buffer (0.1 M/ pH10.2). 0.5mL of epinephrine (freshly prepared)
was added to the above suspension. The increase in the
absorbance was read at 480 nm for 3mins at 30 sec interval
120
(Misra et al., 1972).

Inhibition % = OD blank-change in OD/min/OD blank x 100
SoD unit/mg of protein = inhibition %/50 x sample vol x 18 x
mg of protein
One-way ANOVA was performed to find the significant
difference between the treatments and control using SPSS version
20.0 for the immunological, haematological, growth and water
quality parameters. Statistical difference was found at P < 0.05.
The principal component analysis was performed to find the
overall immune performance of probiotic isolates.

Growth Performance
The weight gain, specific growth rate and feed conversion ratio
of GIFT tilapia fed with different experimental diets along with
the statistical analysis were shown in the table 1. All the growth
parameters showed significant difference between control and
treatments (P<0.05). Bacillus megaterium and Bacillus subtilis fed
animals possessed higher weight gain with improved FCR.

The various water quality parameters along with the statistical
analysis were shown in the table 2. There was no significant
difference between control and treatments for all the parameters
analysed.
121
Table 1. Growth Performance of GIFT Tilapia fed with different experimental diets at the end of the culture trial
122

Parameters Control B. infantis B. subtilis E. profundum B. megaterium
Initial Weight(gm) 10 ± 0.05 a 10 ± 0.08 a 10± 0.06 a 10 ± 0.02 a 10 ± 0.04 a
Final Weight(gm) 20.6 ± 1.13 a 26.3 ± 1.64 b 27.2 ± 0.81 b 25.9± 0.32 b 27.96 ± 1.00 b
Weight gain (gm) 10.6 ± 1.13 a 16.3 ± 1.64 b 17.2 ± 0.81 b 15.9± 0.32 b 17.96 ± 1.00 b
Specific growth rate 1.73 ± 0.16 a 2.28 ± 0.33 b 2.41 ± 0.15 b 2.29 ± 0.11 b 2.45 ± 0.16 b
Feed conversion ratio 2.55± 0.15 a 2.12± 0.24 b 2.1± 0.2 b 2.21± 0.18 b 2.09± 0.24 b
Data assigned with different superscripts denote significant difference in a row (P < 0.05)
Table.2 - Water quality parameters of experimental groups in the 42 days culture trial of GIFT Tilapia
Parameters Control B. infantis B. subtilis E. profundum B. megaterium

pH 7.24 ± 0.1a 7.22 ± 0.15a 7.37 ± 0.17a7.33 ± 0.21a
7.42 ± 0.22a
(7.12 – 7.36) (7.14 – 7.3) (7.33 – 7.79) (7.16 – 7.5) (7.25 – 7.59)
Temperature (°C) 27.45 ± 0.19a 27.26 ± 0.12a 27.45 ± 0.1a 27.26 ± 0.12a 27.56 ± 0.17a
(27– 30) (27 – 30) (27– 30) (27 – 30) (27 – 30)
DO (mg/L) 5.45 ± 0.04a 5.7 ± 0.04a 5.55 ± 0.04a 5.72 ± 0.04a 5.65 ± 0.04a
(4.1- 5.7) (4.2 – 5.9) (4.3 - 5.7) (4.5 - 5.9) (4.4 - 5.8)
Free carbon di oxide (mg/L) 2.4± 0.15a 2.33 ± 0.1a 2.65 ± 0.15a 2.77 ± 0.15a 2.55 ± 0.12a
(1.9 - 3.2) (1.7 - 3.3) (1.7 - 3.4) (1.9 – 3.5) (1.8- 3.3)
Alkalinity (mg/L) 55 ± 2.5a 57.89 ± 2.9a 56.8 ± 2.45a 57.25 ± 2.6a 56.89 ± 2.75a
(45 – 65) (38 – 79) (36 – 65) (39 – 78) (37 – 75)
Hardness (mg/L) 250 ± 3.6a 249 ± 5.6a 252 ± 3.9a 248 ± 5.1a 251 ± 5.15a
(236 – 292) (219 – 279) (225 – 277) (210 – 269) (241 – 267)
Calcium ions (mg/L) 55.59 ± 4.75a 55 ± 3.77a 53.59 ± 4.54a 53.1 ± 4.98a 54.5 ± 3.98a
(44 – 75) (34 – 65) (46 – 69) (34 – 68) (38 – 70)
Magnesium ions (mg/L) 79 ± 2.7a 78 ± 2.7a 79.55 ± 2.74a 77.5 ± 2.55a 78.12 ± 2.9a
(45 – 85) (42 – 88) (42 – 80) (41– 85) (42 – 88)
Nitrate (mg/L) 0.007 ± 0.0a 0.006 ± 0.0a 0.007 ± 0.0a 0.006 ± 0.0a 0.008 ± 0.0a
(0.004 – 0.012) (0.004 – 0.015) (0.005 – 0.008) (0.003 – 0.01) (0.004 – 0.015)
Nitrite (mg/L) 0.014 ± 0.0a 0.011 ± 0.0a 0.013 ± 0.0a 0.012 ± 0.0a 0.011 ± 0.0 a
(0.007 – 0.019) (0.006 – 0.015) (0.008 – 0.019) (0.005 – 0.015) (0.004 – 0.015)
Ammonia (mg/L) 0.07 ± 0.02a 0.05 ± 0.025a 0.04 ± 0.03a 0.06 ± 0.032a 0.05 ± 0.024a
(0.05 – 0.19) (0.04– 0.26) (0.04 – 0.19) (0.04– 0.29) (0.05– 0.25)
Phosphate (mg/L) 0.08 ± 0.02a 0.085 ± 0.01a 0.082± 0.02a 0.09 ± 0.015a 0.083 ± 0.018a
(0.05 – 0.15) (0.04 – 0.17) (0.033 – 0.12) (0.044 – 0.16) (0.04 – 0.19)
123
Data assigned with different superscripts denote significant difference in a row (P < 0.05)
124
Haematological, Immunological and Anti-Oxidant

Indicators
The immunological and haematological parameters were analysed
and the graphs along with the standard deviation were constructed
which were represented in the figure 1.
From the One way ANOVA performed, the results confer
that there is a significant difference between treatments (T1, T2,
T3 and T4) and control (C) for serum albumin, globulin, protein,
total blood count, glucose, myeloperoxidase and SOD. No
significant difference was found in the blood protein levels of
animals fed with Bacillus infantis and Bacillus subtilis diets.
Respiratory burst activity of the experimental animals fed with
Bacillus subtilis and Exiguobacterium profundum showed no
significant differences.
The first four principal components (PCs) accounted for
92.45% of the total variance which was listed in the table 3. The
distribution plot variables of PC 1 and PC 2 on the plane, which
are mainly related to serum protein and myeloperoxidase are
presented in the figure.2. These two selected components made
up to 50.79 and 17.40% of the variance in the model, suggesting
that they were key factors in distinguishing the different strains
used. It could be inferred that strains presented in quadrant IV
were significant as they showed high correlation with respect to
variables. Bacillus megaterium and B. subtilis had the highest
contribution to PC 1 and may be preferentially used as potential
probiotics among all the strains.
125
Fig.1. Haematological, Immunological and Anti Oxidant Indicators of GIFT

Tilapia in the in vivo feeding trial of 42 days.
Data assigned with different superscripts denote the significant difference
(P < 0.05).
126
Fig. 2. Principal component analysis based on four probiotic strains and tested parameters
127
Table 3: Correlation of variables obtained from total variance with the factors
of the PCA analysis
PC 1 PC 2 PC 3 PC 4
Albumin 0.408 0.037 0.201 0.129
Globulin 0.406 0.014 0.195 0.133
Serum protein 0.417 0.030 0.200 0.114
Blood Protein 0.379 -0.152 0.016 -0.373
Total blood count (*103 cells/μl) 0.321 0.402 0.193 -0.312
Glucose -0.283 0.558 0.071 -0.098
Myeloperoxidase 0.060 0.575 -0.476 0.069
RBT 0.321 0.281 -0.275 0.105
Catalase 0.211 -0.206 -0.541 0.498
SOD -0.125 0.221 0.495 0.665
% variance 50.79 17.40 13.22 11.04
Growth performance of GIFT tilapia fed with probiotics

showed positive results and ascertained with the fact of early
findings (Avella et al., 2010; Hoseinifar et al., 2015; Doan et al.,
2018; Liu et al., 2012 and Liu et al., 2017). Higher growth rate
was found in B. megaterium fed animals and lower growth rate
was seen in control. 100% survival in all the experimental groups
was observed and this may be due to the regular water exchange
favouring good environmental condition for the animals. Water
quality parameters showed no significant differences with the
supplementation of probiotics along with the feed.
The haematological parameters such as albumin, globulin
and total blood count were found to be more pronounced in
probiotics fed tilapia than control. Albumin and globulins are
the two major groups of serum proteins and taken as total protein.
Blood globulin contents are inevitable for the healthy culture of
128
animals with improved immune functions. However, for

sustaining the osmotic pressure, albumin is the vital need for
proper distribution of body fluids as it acts as a plasma carrier
( Jha et al., 2007). High concentrations of total protein in fish
serum can be correlated with enhancement of the non-specific
immune response. The results indicated higher (P < 0.05)
albumin and globulin concentrations of tilapia blood serum were
obtained in probiotic fed fishes compared with that of the control
in the present study. Higher levels of albumin and globulin were
found in Bacillus megaterium and this may be due to the presence
of carotenoids and its antioxidant potential (Mitchell et al., 1986).
The increase in blood cell count in tilapia due to probiotic feed
indicates an immunostimulant effect. The possible explanation
for the variation of blood cells could be attributed to the various
probiotic feed.
Immunological parameters such as respiratory burst and
myeloperoxidase activity was significantly higher in the probiotic
mixed diets than control. Immune systems can be activated in
several ways like enhancing the number of phagocytes, activating
phagocytes or increasing the synthesis of the involved molecules.
Increased bacterial pathogen killing ability of phagocytes can be
inferred from increased respiratory burst activity which is a most
important bactericidal mechanism in fishes (Sharp et al., 1993).
It had been demonstrated that the RBT of tilapia when
administered with bacterial probiotics isolated from biofloc
culture systems showed an improved performance than control.
Similar results were observed in the administration of
Lactobacillus rhamnosus (strain ATCC 53103) in rainbow trout
(Oncorhynchus mykiss) (Nikoskelainen et al., 2003). The
129
myeloperoxidase (MPO) utilizes one of the oxidative radicals to

produce hypochlorous acid thereby acting as an antimicrobial
enzyme. The MPO was mostly released by the azurophilic
granules of neutrophils during oxidative respiratory burst. The
improved MPO activity was seen in treatment with addition of
B. subtilis as a probiotic to tilapia. This was in concurrent with
the findings of Wang et al. ( 2008) on the addition of E. faecium
ZJ4 to the aquaria.
Anti-oxidant status such as glucose, SOD and catalase
activity was significantly different in the treatment than control.
Intensive glycogenolysis and the synthesis of glucose from extra
hepatic tissue proteins and amino acids increases the glucose
content in blood as an indicator of stress in animals (Almeida et
al., 2001; Nakno and Tomlinson et al., 1967) observed that all
types of stress elevated the secretion of catecholamine which
stimulates the breakdown of glycogen thereby increasing blood
glucose level. In the present study, B. megaterium fed tilapia has
less glucose level when compared with other treatments indicating
the lesser stress levels in animals.
SOD and catalase are two important enzymes in the cellular
antioxidant defence system, means of dealing with oxidative stress.
SOD and catalase remove oxygen radicals produced within the
cells (Kurata et al., 1993) and are expected to increase under hypoxia
to detoxify ROS. Lower levels of SOD and catalase are indication
for cell damage due to the accumulation of the high-level free
radical. The experimental animals fed with probiotic
supplemented diets possessed increased SOD and catalase levels
compared to control. However, within the treatments,
130
Exiguobacterium profundum and Bacillus infantis supplemented

diets enhanced the SOD and catalase levels of the animals. The
overall performance of the Bacillus sp. examined using Principal
component analysis (PCA) of in vivo characteristics particularly
immunological, haematological and anti-oxidant status revealed
Bacillus megaterium and Bacillus subtilis as a superior strain with
desirable qualities compared to the other strains for the GIFT
tilapia culture. The results from the present study also confirmed
the probiotic effect of biofloc as the strains were isolated from the
biofloc systems probing the ecological health of culture animals.
The four bacterial species isolated from the biofloc water
sample were tested for in- vivo probiotic efficiency in GIFT
tilapia. Improved performance of the culture animals was found
in probiotics fed animal and among the four bacillus strains,
Bacillus megaterium and B. subtilis can be used as potential
probiotics as they exhibited better performance in terms of
immunological, haematological and growth parameters
throughout the experimental trial. These two strains can further
be commercialised and used as effective probiotics in aquaculture.
The different physical forms of the tested probiotics and its
combined performance would further help to determine its
efficiency for the mass scale production in aquaculture.
ACKNOWLEDGEMENT
The authors express their heartfelt gratitude to Department of
Biotechnology, Government of India, New Delhi for financially
supporting this research project (DBT-Project Code: SU7; PI:
Dr. S. Felix).
131
REFERENCES
Almeida, J.A., Novelli, E.L.B, Dal-Pai Silva, M. and Alves, Jr., R.
2001. Environmental cadmium exposure and metabolic
responses of the Nile tilapia Oreochromis niloticus. Environ.
Pollut. 114: 169–175.
Aly, S.M., Abd-El-Rahman, A.M., John, G. and Mohamed, M.F.
2008. Characterization of some bacteria isolated f rom
Oreochromis niloticus and their potential use as probiotics.
Anderson, D.P. and Siwicki, A.K. 1995. Basic hematology and
serology for fish health programs.
Methods for the Examination of Water and Wastewater.
American Public Health Association, Washington, DC.
Apún Molina, J.P., Santamaría, Miranda, A., Luna González, A.,
Martínez Díaz, S.F. and Rojas Contreras, M. 2009. Effect of
potential probiotic bacteria on growth and survival of tilapia
Oreochromis niloticus L., cultured in the laboratory under
high density and suboptimum temperature. Aquaculture
Research, 40: 887-894.
Avella, M.A., Gioacchini, G., Decamp, O. 2010. Makridis
P, Bracciatelli C & Carnevali O, Application of multi-species
of Bacillus in sea bream larviculture. Aquaculture, 305: 12-19.
Barría, A., Trinh, T.Q., Mahmuddin, M., Benzie, J.A., Chadag,
V.M. and Houston, R.D. 2020. Genetic parameters for
resistance to Tilapia Lake Virus (TiLV ) in Nile tilapia
(Oreochromis niloticus). Aquaculture, 522: 735126.
Behera, B.K., Pradhan, P.K., Swaminathan, T.R., Sood, N., Paria,
P., Das, A., Verma, D.K., Kumar, R., Yadav, M.K., Dev, A.K.,
132
Parida, P.K., Das, B.K., Lal, K.K. and Jena, J.K. 2018.
Emergence of Tilapia Lake Virus associated with mortalities
of farmed Nile Tilapia Oreochromis niloticus (Linnaeus 1758)
in India. Aquaculture, 484: 168-174.
Del’Duca, A., Cesar, D.E., Diniz, C.G. and Abreu, P.C. 2013.
Evaluation of the presence and efficiency of potential probiotic
bacteria in the gut of tilapia (Oreochromis niloticus) using the
fluorescent in situ hybridization technique. Aquaculture, 388:
115-121.
Doan, H.V., Hoseinifar, S.H., Khanongnuch, C., Kanpiengjai,
A., Unban, K., Kim, V.V. and Srichaiyo, S. 2018. Host-
associated probiotics boosted mucosal and serum immunity,
disease resistance and growth performance of Nile tilapia
(Oreochromis niloticus). Aquaculture, 491: 94-100.
Doumas, B.T., Watson, W.A. and Biggs, H.G. 1971. Albumin
standards and the measurement of serum albumin with
bromocresol green. Clinica chimica acta, 31: 87-96.
El-Rhman, A.M.A., Khattab, Y.A. and Shalaby, A.M. 2009.
Micrococcus luteus and Pseudomonas species as probiotics
for promoting the growth performance and health of Nile
tilapia, Oreochromis niloticus. Fish & Shellfish Immunology,
27: 175-180.
FAO. 2020. The State of World Fisheries and Aquaculture 2020,
Sustainability in action, Rome.
SRAC, 4503: 1-12.
He, S., Zhang, Y., Xu, L., Yang, Y., Marubashi, T., Zhou, Z. and
Yao, B. 2013. Effects of dietary Bacillus subtilis C-3102 on the
production, intestinal cytokine expression and autochthonous
133
bacteria of hybrid tilapia Oreochromis niloticus@&×

Oreochromis aureusB&. Aquaculture, 412: 125-130.
Hong, H.A., Duc, L.H. and Cutting, S.M. 2005. The use of
bacterial spore formers as probiotics. FEMS Microbiol Rev.
29: 813-835.
Hoseinifar, S.H., Roosta, Z., Hajimoradloo, A. and Vakili, F. 2015.
The effects of Lactobacillus acidophilus as feed supplement on
skin mucosal immune parameters, intestinal microbiota, stress
resistance and growth performance of black swordtail
(Xiphophorus helleri). Fish & shellfish immunology, 42: 533-538.
Jha, A.K., Pal, A.K., Sahu, N.P., Kumar, S. and Mukherjee, S.C.
2007. Haemato-immunological responses to dietary yeast
RNA, w-3fatty acid and b-carotene in Catla catla juveniles.
Fish & Shellfish Immunology, 23: 917–927.
Kuebutornye, F.K. and Abarike, E.D. 2020. The contribution of
medicinal plants to tilapia aquaculture: a review. Aquaculture
International, 1-19.
Kurata, M., Suzuki, M. and Agar, N.S. 1993 Antioxidant systems
and erythrocyte life-span in mammals, Comp. Biochem. Physiol.
B, 106: 477–487.
Liu, H., Wang, S., Cai, Y., Guo, X., Cao, Z., Zhang, Y., Liu,
S., Yuan, W., Zhu, W., Zheng, Y., Xie, Z., Guo, W. and
Zhou, Y. 2017 Dietary administration of Bacillus subtilis
HAINUP40 enhances growth, digestive enzyme activities,
innate immune responses and disease resistance of tilapia,
Oreochromis niloticus. Fish Shellfish Immunol., 60: 326-333.
Liu,C.H., Chiu, C.H., Wang, S.W. and Cheng W. 2012. Dietary
administration of the probiotic, Bacillus subtilis E20, enhances
the growth, innate immune responses, and disease resistance
134
of the grouper, Epinephelu scoioides. Fish Shellfish Immunol.,

33: 699-706.
J. Biol. Chem., 193: 265-275.
Marques, A., Dinh, T., Ioakeimidis, C., Huys, G., Swings, J.,
Verstraete, W., Dhont, J., Sorgeloos, P. and Bossier, P. 2005.
Effects of bacteria on Artemia franciscana cultured in different
gnotobiotic environments. Applied and Environmental
Microbiology, 71: 4307-4317.
Menaga, M., Felix, S. and Gopalakannan, A. 2017. Identification
of Bacterial Isolates from Aerobic Microbial Floc Systems by
16sr DNA Amplification and Sequence Analyses. Indian Vet.
J., 94: 24 – 26.
superoxide dismutase. Journal of Biological chemistry, 247: 3170
3175.
Mitchell, C., Iyer, S., Skomurski, J.F. and Vary, J.C. 1986. Red
pigment in Bacillus megaterium spores. Appl. Environ.
Microbiol., 52: 64-67.
Nakno, T. and Tomlinson, N. 1967. Catecholamine and
carbohydrate concentrations in rainbow trout (Salmo gairdneri)
in relation to physical disturbance. J. Fish. Res. Bd. Can. 24:
1701–1715.
Nikoskelainen, S., Ouwehand, A., Bylund, G., Salminen, S. and
Lilius, E.M. 2003. Immune enhancement in rainbow trout
(Oncorhynchus mykiss) by potential probiotic bacteria
(Lactobacillus rhamnosus). Fish & Shellfish Immunology, 15:
443-452.
135
Quade, M.J. and Roth, J.A. 1997. A rapid, direct assay to measure
degranulation of bovine neutrophil primary granules. Veterinary
Immunology and Immunopathology, 58: 239-248.
Rico, A., Oliveira, R., McDonough, S., Matser, A., Khatikarn, J.,
Satapornvanit, K., Nogueira, A.J., Soares, A.M., Domingues,
I. and Brink, P.J. 2014. Use, fate and ecological risks of
antibiotics applied in tilapia cage farming in Thailand.
Environmental Pollution, 191: 8-16.
Sharp, G.J.E. and Secombes, C.J. 1993. The role of reactive oxygen
species in the killing of the bacterial fish pathogen Aeromonas
salmonicida by rainbow trout macrophages. Fish & Shellfish
Immunology, 3: 119-129.
Takahara, S., Hamilton, H.B., Neel, J.V., Kobara, T.Y., Ogura, Y.
and Nishimura, E.T. 1960. Hypocatalasemia: a new genetic
carrier state. The Journal of Clinical Investigation, 39: 610-619.
Wang, Y.B., Tian, Z.Q., Yao, J.T. and Li, W.F. 2008. Effect of
probiotics, Enteroccus faecium, on tilapia (Oreochromis
niloticus) growth performance and immune response.
Zokaeifar, H., Balcázar, J.L., Saad, C.R., Kamarudin, M.S., Sijam,
K., Arshad, A. and Nejat, N. 2012. Effects of Bacillus subtilis
on the growth performance, digestive enzymes, immune gene
expression and disease resistance of white shrimp, Litopenaeus
vannamei. Fish & shellfish immunology, 33: 683-689.
136
PROBIOTIC POTENTIAL OF BACILLUS STRAINS OF BIO FLOC SYSTEM ON .....
CHAPTER 6
PROBIOTIC POTENTIAL OF BACILLUS

STRAINS OF BIOFLOC SYSTEM ON
GROWTH PERFORMANCE IN
PENAEUS VANNAMEI
T his study established the effectiveness of four different

Bacillus sp., i.e., Bacillus subtilis, B. megaterium, B. cereus and
B. infantis on growth performance, digestive enzyme activity
and immune response in Penaeus vannamei. Experimental diets
were identical in all the aspects except Bacillus incorporation:
control (basal diet without probiotic) and four treatment diets
T 1 (basal diet + B. subtilis), T 2 (basal diet + B. megaterium),
T 3 (basal diet + B. cereus), T 4 (basal diet + B. infantis). Each
diet was fed at 10% of animal body weight, four times in a day
and reared for 6 weeks in triplicate tanks. Among the treatments,
final weight (0.97 ± 0.06g), weight gain, specific growth rate and
survival rate (64.66 ± 4.16%) were significantly greater in B.
subtilis treated group. Interestingly, in digestive enzyme activities,
protease (3.57 ± 0.42U/mg protein), lipase (747.83 ± 139.03 U/
137
mg protein) and amylase (7.53 ± 1.27U/mg protein) were

considerably higher in B. subtilis supplemented diet fed group
compared to other treatments. However, cellulase (246.83 ±
29.77U/mg protein) activity was much greater in the group that
received B. megaterium. Activities of superoxide dismutase, phenol
oxidase and catalase were analysed and the B. subtilis incorporated
diet fed group exhibited better performance. Thus its concluded
that B.subtilis improves digestive enzyme activities and growth
performance and down-regulates the reactive oxygen species
(ROS). This proved the versatility of B. subtilis as a probiotic in
shrimp farming practices.
INTRODUCTION
Aquatic probiotics are considered as a safe additive, to provide
health benefits to the cultured fish by enhancing growth and
immunity, improving feed utilisation rate, increasing digestive
enzyme activity, maintaining water quality, controlling diseases,
modulating microbial colonisation in the intestine and pre
digestion of anti-nutritional factors present in the feed (Shen,
Fu, Li, & Zhu, 2010; Selim & Reda, 2015; Amoah et al., 2019).
Therefore, probiotics have been considered as an effective
alternative in place of the much criticised and banned antibiotics
(Dawood, Koshio, & Esteban, 2018).
Among the probiotics, lactic acid bacteria (LAB) and Bacillus
sp., have been proven to possess the capabilities of a long-lasting
shelf life, production of antimicrobial substances as a secondary
metabolite (non-pathogenic and non-toxic) and resistance to
extreme pH and temperature. In addition to that, vast
138
documentation of their beneficial effects in the aquaculture

industry, encouraged their usage in several parts of the world
(Zokaeifar et al., 2014; Nimrat, Khaopong, Sangsong, Boonthai,
& Vuthiphandchai, 2019). A growing number of studies in
relation to probiotic administration revealed that, among the
probiotics, Bacillus sp. has become more popular and widely
used in shrimp aquaculture (Liu, Chiu, Ho, & Wang, 2009).
Bacillus sp. a gram positive, rod shaped, endospore-forming
bacteria enhances the antioxidant enzyme activity, involving in
the expressions of immune and stress related genes (Liu et al.,
2009; Nayak, 2010; Buruiana, Profir & Vizireanu, 2014) and
inhibits the virulent gene expression (quorum-sensing inhibition)
(Musthafa,Saroja, Pandian, & Ravi, 2011; Subramenium, Swetha,
Iyer, Balamurugan & Pandian, 2018).
B. subtilis, a probiotic spore forming bacterium, has been
used in shrimp aquaculture as a growth and immune enhancer
(Shen et al., 2010). In the experimental diets, B. subtilis survived
in greater numbers than Lactobacillus acidophilus at 4oC and
25oC (Aly, Ahmed, Ghareeb, & Mohamed, 2008). Similarly, a
comparative study revealed that B. subtilis could provide better
protection against vibriosis than Lactobacillus plantarum in larvae
of sea bass (Touraki, Karamanlidou, Karavida & Chrysi, 2012).
Likewise, inclusion of Bacillus megaterium in feed, as a probiotic,
maintained the intestinal micro-flora balance which enhanced
the growth and digestive enzyme activities in Clarias sp.
(Afrilasari & Meryandini, 2016). It has been reported that,
comparably, B. infantis has potential probiotic properties
including, resistance to acid and bile salt, tendency to adhere to
the intestinal wall and possess antagonistic activity against fish
139
pathogens (Dharmaraj & Rajendren, 2014). Experimental

inclusion of Bacillus cereus (108CFUg-1), in the piglet rearing
feed, enhanced the overall weight gain (Kirchgessner, Roth,
Eidelsburger & Gedek, 1993). However, closely related bacterial
strains might have different clinical effects and it is also
emphasised that beneficial effects yielded by one bacterial strain
cannot be assumed to occur with another bacterial strain (FAO,
2001). Similarly, antagonist activity shown by the probiotic
bacteria vary according to microbial strains (Veron, Di Risio,
Isla, & Torres, 2017). Therefore, it is necessary to identify the
organisms at strain level for clinical studies.
Pacific white shrimp (Penaeus vannamei) serves as a widely
cultured and economically important species in India as well as
in the world, at a commercial level. It has the ability to grow in
a wide range of salinities and temperatures and can be bred
easily. It exhibits faster growth and higher survival rate even at
a high stocking density, attains an attractive size in a short crop
period and has high market demand. Another positive aspect is
the availability of disease-free and disease resistant juveniles for
culture (Chiu, Guu, Liu, Pan, & Cheng, 2007). However, in the
recent times, a series of disease outbreaks have been encountered.
Unlike, other aquatic animals, Pacific white shrimp lack in
adaptive immune functions; instead they possess innate immune
features to tackle such threats (Bachère et al., 2004; Runsaeng,
Kwankaew & Utarabhand, 2018).
Available evidence of close association and positive results
between intestinal bacterial communities and host health in
human (Nyangale, Farmer, Keller, Chernoff, & Gibson, 2014;
140
Majeed et al., 2015), have given us much knowledge of probiotics.

However, the information on the effects of probiotics in aquatic
animals is yet to ascertain whether the supplementation of
probiotics will positively impact the shrimps’ intestinal microbial
community and intestinal health as was reported in humans and
other animals (Clemente, Ursell, Parfrey & Knight, 2012). The
effect of probiotics on fish and shrimp has been reported (Wang,
2007; Krummenauer et al., 2014; & García Bernal et al., 2018).
The present study was designed to find out the potential probiotic
strain, among the Bacillus strains, which could be suggested as a
future probiotic to enhance shrimp production.
METHODOLOGY
The study was conducted at the Advanced Research Farm Facility
(ARFF), Tamil Nadu Dr. J. Jayalalithaa Fisheries University
(TNJFU), Chennai, Tamil Nadu, India.
Bacterial spp Isolated from Bio Floc System

B. subtilis, B. megaterium, B. cereus and B. infantis were used as
potential probiotics in this experiment. These bacterial species
were isolated and identified from the biofloc system of GIFT
tilapia culture at ARFF,Chennai. The four Bacillus sp. were
received f rom Advanced Research Farm Facility
(ARFF),Chennai. Under aseptic laboratory conditions, all the
four Bacillus sp. were revived on MRS (de Man, Rogosa, and
Sharpe) agar.The pure colonies were used for feed preparation.
The Bacillus sp. were preserved at -20oC in 25% sterile glycerol
stock solution for maintaining the pure stocks.
141
Probiotic Characterisation
Morphological and biochemical characterisation was performed
in order to confirm the probiotic characteristics of those Bacillus
sp. according to Bergey’s Manual of Determinative Bacteriology
(Schubert, Buchanan, & Gibbons, 1974). DNase activity was
checked by using toluidine blue DNA agar base (Hi-Media,
M6131-100G).
Determination of Antibacterial Activity Against Shrimp

Pathogens
The antibacterial activity for all the four Bacillus sp. were
performed, using agar well diffusion method, against the Vibrio
pathogens (Vibrio parahaemolyticus and V. alginolyticus). Briefly,
pathogenic bacteria, V. parahaemolyticus and V. alginolyticus were
cultured in tryptone soy broth (TSB) supplemented with 1.5%
of NaCl. After incubation at 30oC for 24 h, the bacterial density
was approximately adjusted to 108 cfu ml-1. Subsequently, pour
plates were prepared using 20 ml of melted tryptone soy agar
(TSA) with 10 l of each pathogenic strain, in separate sterile
petri-dishes. Then, the solidified medium was punched with a
sterile steel borer of diameter 6.0 mm. Four Bacillus sp. were
individually cultured in TSB and incubated at 30oC for 24 h
using orbital shaker at 120 rpm. Then culture broth was
centrifuged at 7000 rpm for 10 min at 4oC. 50 l of supernatant
was taken from the tube and slowly added into the previously
prepared agar plates with corresponding pathogens. All the plates
were incubated at 30oC for 24 h. After incubation, plates were
142
observed and zone of inhibition was measured using a vernier

caliper.
Experimental Diet Preparation

Four experimental diets were prepared, namely; Treatment-1
(basal diet + B. subtilis -T1), Treatment-2 (basal diet + B.
megaterium -T2), Treatment-3 (basal diet + B. cereus -T3),
Treatment-4 (basal diet + B. infantis -T4) and control (basal diet
without probiotic).
Commercial shrimp feed (crude 35% protein) was used as
a basal diet. While preparing the experimental diets, pure colonies
of four Bacillus sp. were individually cultured in 250 ml flask
with TSB broth in an orbital shaker (150 rpm) at 30oC for 24
h. The bacterial cells were harvested by centrifugation (7000
rpm for 5 minutes at 4oC). The bacterial pellets were then washed
and re-suspended in sterile normal saline solution (NSS, 0.9%
NaCl), and the optical density (OD) was adjusted to 1.000 at
540 nm. To the OD value adjusted culture, 0.5% of sodium
alginate was added and 600 ml of bacterial inoculum was sprayed
over 1kg of commercial feed. Then, the feed was transferred to
an incubator, for drying at 37oC for 5 h, to obtain a required
dosage of bacterial concentration in feed (108cfu g-1). After
incubation, feed was kept at 4oC and the cell viability was
monitored. Feed was prepared, once in five days, to ensure the
maximum survival of probiotic in the experimental diets.
Experimental Design and Animal Rearing

The study followed a completely randomised design, with one
control and four treatments, receiving four different Bacillus sp.
143
at same concentration (108 cfu g-1) each of which were triplicated.

The trial was conducted for 6 weeks using low saline borewell
water (2 ppt). Specific pathogen free healthy juvenile shrimp
were procured f rom Aqua Nova Hatcheries (P) Ltd.,
Kancheepuram, Tamil Nadu. The procured seed were maintained
in a Fiber Reinforced Plastic (FRP) tank of 1.5 tonne capacity,
provided with an aeration system. The shrimp were acclimatised
in the FRP tanks for a period of 10 days and fed with a
commercial diet (crude protein – 35%), four times in a day
(07:00, 11:00, 17:00 and 21:00) at 10% of its body weight.
Prior to stocking, (750 numbers; average weight- 0.02 ±
0.00 g) shrimps were starved for 24 h, and randomly weighed
and stocked in 15 glass tanks (100 l capacity) at 50 shrimp per
tank. The animals were fed with their respective treatment diets,
four times in a day, at 10% of its body weight. Physico-chemical
parameters of water such as dissolved oxygen and temperature
were measured on daily basis and ammonia (NH4+/NH3) – N,
nitrite (NO2) – N, nitrate (NO3) – N, and pH once in a week,
following the standard methods of APHA, (1995).
Bacteriological Analysis
The changes in total plate count (TPC), total Vibrio count (TVC)
and total Lactobacillus count (TLC) of culture water and shrimp
gastrointestinal tract (GIT) were examined on weekly basis.
During each week, two shrimps from each tank (n=6/treatment)
were randomly collected and their gastro-intestinal tract (GIT)
was removed aseptically and macerated with saline for
bacteriological plating. TPC, TVC, and TLC counts were
144
estimated using tryptone soy agar (TSA, Hi-Media),

thiosulphate-citrate-bile salt agar (TCBS, Hi-Media) and de
Man, Rogosa, and Sharpe agar (MRS, Hi-Media), respectively
(Vieira et al., 2016).
Growth Performance
Weight gain of shrimp was monitored on weekly basis, using 10
shrimps f rom each tank (n=30/treatment). The growth
parameters such as final weight, weight gain, specific growth
rate (SGR), food conversion ratio (FCR) and survival rate were
determined according to Zokaeifar et al. (2012): weight gain
(WG; g) = Final weight (g) – Initial weight (g), Specific growth
rate (SGR; %/ day) = (In [Final body weight (g)] - [Initial body
weight (g)]/ Days of experiment) × 100, Food conversion ratio
(FCR) = Total feed intake (g)/weight gain (g), Survival rate (%)
= (Number of shrimp harvested / Number of shrimp stocked)
× 100
Digestive Enzyme Analysis

At the end of feeding trial, three shrimps from each glass tank
(n=9/treatment) were taken out and their GIT was collected for
digestive enzyme analysis. Following the removal of ingested
food items, the dissected GIT was mixed with chilled sucrose
solution (0.25 M) and homogenised (5% homogenate) using
poly pestles. The homogenate was then centrifuged at 5000 rpm
for 10 min at 4oC. After centrifugation, supernatant was collected
and used for further analysis. All the enzymatic activities were
expressed in specific activity (U/ mg protein). Intestinal protein
was estimated by following Lowry et al. (1951).
145
The protease activity of GIT was determined by following

Drapeau (1976). A reaction mixture consisting of 2.5 ml of 1%
casein (prepared in 0.01 N NaOH), 0.05 M tris-phosphate buffer
(pH 7.8) and 0.1 ml tissue homogenate was incubated at 37oC
for 15 min. Then 2.5 ml of 10% trichloroacetic acid (TCA) was
added to start the reaction. Later, the whole content was filtered
and the final OD was measured at 280 nm in UV
spectrophotometer (UV-1800, Sl. No. 11635203671 CD,
Shimadzu Corporation, Japan). In this assay, 1% casein was used
as a substrate and a calibration curve was prepared using tyrosine
as a standard solution. One unit of protease activity was defined
as the number of micromoles of tyrosine released/min/mg of
protein at 37oC.
The amylase activity of GIT samples were analysed according
to Bernfeld (1955) using 1% of soluble starch as a substrate.
Reaction was initiated by adding 1 ml of tissue homogenate into
1 ml of starch (prepared in 0.1 M phosphate buffer, pH 7.0)
solution, in a test tube, and incubated for 15 min at 37oC. The
reaction was stopped by the addition of 2 ml of 3, 5 dinitrosalicylic
acid (DNSA). Later, the tubes were placed in a boiling water
bath for 5 min. Then tubes were cooled and the volume was
made up to 10 ml using distilled water. The intensity of the
colour developed was recorded in a UV spectrophotometer at
560 nm. A calibration curve was prepared using maltose as a
standard solution. One unit of amylase activity was defined as
the number of micromoles of maltose released/min/mg of protein
at 37oC.
146
The lipase activity of GIT samples were determined

according to Cherry and Crandell (1932) using a stabilised
emulsion of olive oil. A reaction mixture consisted of 3 ml of
distilled water, 1 ml of tissue homogenate, 0.5 ml of phosphate
buffer (0.1 M, pH 7.0), and 2 ml of olive oil emulsion, which
was incubated for 24 h at 27oC. Subsequently, 3 ml of alcohol
(95%) and two drops of phenolphthalein indicator were added
and it was titrated against alkali (0.05 N NaOH), until the
appearance of a permanent pink colour. At the same time, a
control was prepared using an enzyme source and the enzyme
activity was inactivated by keeping it in a boiling water bath for
15 min, prior to the addition of buffer and olive oil emulsion. A
calibration curve was prepared using porcine type pancreatic
lipase. One unit of lipase activity was expressed as the numbers
of fatty acid released/min/mg of protein at 27oC.
Cellulase activity was determined by following Gonzalez-
Peña, Anderson, Smith & Moreira (2002). The reaction mixture
consisted of 1 ml of carboxymethyl cellulose (CMC) as a
substrate, 1 ml of phosphate buffer (0.1 M, pH 6.8) and 1 ml of
tissue homogenate in a test tube and it was incubated at 37oC
for 1 h. After incubation, 0.5 ml of DNSA reagent was added
to stop the reaction. The final absorbance was recorded in a
spectrophotometer at 540 nm. A calibration curve was prepared
using glucose. One unit of cellulase activity is defined as the
amount of glucose released/min/mg protein.
147
Immunological Parameters
The haemolymph was drawn from the ventral sinus cavity of
shrimp (two shrimps from each tank; n=6/treatment) using 1
ml syringe and 22 gauge needle. The collected haemolymph was
allowed to clot for 2 h at room temperature (37oC). After
centrifugation at 6000 rpm for 10 min, the serum was carefully
transferred to 1 ml vials which was used for the analysis of serum
protein and phenoloxidase (PO). The total serum protein was
estimated by following the Lowry, Rosebrough, Farr & Randall
(1951) method.
The phenoloxidase activity was measured by following the
method of Gollas-Galván, Hernández-López & Vargas-Albores
(1997) with slight modifications. PO activity was measured by
recording the formation of dopachrome f rom L
diydroxyphenylalanine (L-DOPA, Sigma) spectrophotometrically
at 490 nm for 60 min at 2 min intervals. The activity was
determined by the increase of O.D/min under the assay
conditions.
Antioxidant Enzymes
The catalase activity of hepato-pancreas samples was performed
as described by Takahara et al. (1960). The supernatant (0.2 ml)
was mixed with 1.2 ml of 0.05 M phosphate buffer (pH 7.0) in
a reaction tube. Then, 1 ml of 0.03 M H2O2 (prepared in
phosphate buffer) was added to the reaction mixture. The OD
value was recorded at 240 nm for 2 min at 30 sec interval.
Simultaneously, the blank was run with 1 ml of distilled water
instead of H2O2. Catalase activity was expressed as moles of
H2O2 decomposed/min/mg protein.
148
Superoxide dismutase (SOD) activity of hepato-pancreas

samples was performed by following the method of Mishra and
Fridovich (1972) with slight modifications. The reaction mixture
was prepared using 50 l of tissue homogenate, 0.5 ml of
epinephrine (0.03 M) and 1.5 ml of phosphate buffer (pH 7.4).
The mixture was well mixed and the changes in OD was recorded
at 480 nm for 2 min at 30 sec interval in UV spectrophotometer.
One unit of SOD activity was determined by the amount of
protein required to give 50% inhibition of epinephrine auto-
oxidation.
The collected data on growth parameter, bacteriological
analysis of culture water and digestive tract of cultured shrimp,
enzymatic activities and immunological parameters were analysed
in one-way analysis of variance (ANOVA) using SPSS version
16.0. Duncan’s multiple range test was used for post hoc
comparison of mean values among the treatments and the
statistical significance of the test was set at P<0.05.

Probiotic Characterisation
Probiotic properties of the four Bacillus sp. were characterised
and presented in Table 1. All the four Bacillus sp. were positive
in catalase activity, casein hydrolysis and starch hydrolysis and
were negative in DNase activity. In the amino acid (AA)
utilisation test, serine was the only amino acid utilised by all the
Bacillus sp. and histidine was used only by B. cereus.
149
Table 1: Morphological and biochemical characteristics of four different

strains of Bacillus sp. isolated from the biofloc system of GIFT tilapia
culture
Test items B. subtilis B. megaterium B. cereus B. infantis

Gram staining Positive Positive Positive Positive
Cell morphology Rod Rod Rod Rod
Spores-forming + + + +
Motility + + + +
Catalase + + + +
DNase activity – – – –
Proline – – – –
Lysine – – – –
Ornithine – – – –
Serine + + + +
Histidine – – + –
Arginine – – – –
Casein hydrolysis + + + +
Starch hydrolysis + + + +
Gelatin hydrolysis + + +
Citrate utilization – – – –
Growth at 5% NaCl + + + +
Growth (+) or No growth (–) after incubation for 24 hours at 30oC.
Antibacterial Activity of Bacillus sp. Against Shrimp

Pathogens
In the present study, B. subtilis and B. cereus exhibited maximum
inhibition zone of (14, 15 and 13, 16 mm) against V.
parahaemolyticus and V. alginolyticus, respectively, followed by B.
infantis (Table 2). No inhibition zone was observed in B.
megaterium against shrimp pathogenic species.
150
Table 2: Determination of antagonism of selected strains of Bacillus sp.

against shrimp pathogens (Vibrio parahaemolyticus and Vibrio
alginolyticus)
Strains VP (mm) VA (mm)

B. subtilis 14 15
B. megaterium - -
B. cereus 13 16
B. infantis 12 12
VP, V. parahaemolyticus; VA, V. alginolyticus
Bacteriological Analysis
A substantial difference (P< 0.05) in total plate count was
recorded in culture water, except the first and third week (Table
3). The total plate count was observed to be much lower in all
the treatments, except in control (3.30 ± 0.23 × 105 cfu/ml) during
the last week. The difference (P< 0.05) in total Vibrio count was
recorded among the treatments, except second and third week.
The total Vibrio count in control was observed to be much higher
(1.76 ± 0.29 × 105 cfu/ml) in the last week. A large difference in
the total Lactobacillus count (P< 0.05) was observed in third,
fifth and last week. Shrimp group fed with diet incorporated
with B. subtilis displayed significantly higher total Lactobacillus
count in culture water (6.66 ± 1.33 × 103 cfu/ml). In contrast
Lactobacillus count was not observed in control group in the last
week.
In intestinal tract, major difference (P< 0.05) in total plate
count was recorded in fifth and last week. Significantly higher
total plate count was observed in control group (2.70 ± 0.64 ×
107 cfu/ g) in second week. The study did not find any
151
Table 3: Bacterial microbiota in the culture water and intestinal tract of P. vannamei fed with control diet and
152

diet supplemented with different Bacillus strains
Time Group Microbial evaluation of the culture water (cfu/ml) Microbial evaluation of the intestinal tract (cfu/g)
(Week) TPC TVC TLC TPC TVC TLC
1 Control 4.50 ± 0.50 × 103 1.96 ± 0.06 × 104(a) 5.00 ± 0.25 × 101 3.83 ± 0.20 × 105 4.23 ± 0.22 × 104 1.30 ± 0.86 × 102
T1 3.30 ± 1.20 × 104 8.33 ± 1.45 × 103(b) 9.00 ± 0.41 × 102 1.30 ± 0.25 × 105 1.90 ± 0.12 × 104 5.63 ± 0.91 × 102
T2 2.00 ± 0.57 × 104 8.66 ± 0.37 × 103(b) 2.70 ± 1.19 × 103 7.66 ± 0.33 × 104 4.03 ± 0.70 × 104 4.06 ± 0.20 × 102
T3 4.30 ± 0.20 × 104 7.33 ± 1.45 × 103(b) 3.70 ± 1.30 × 103 1.30 ± 0.26 × 105 4.33 ± 0.16 × 104 8.96 ± 0.65 × 102
T4 1.60 ± 0.30 × 104 7.83 ± 1.74 × 103(b) 1.60 ± 0.60 × 103 4.16 ± 0.48 × 105 2.83 ± 0.60 × 104 1.47 ± 0.11 × 103
P value 0.382 0.008 0.391 0.394 0.535 0.515
2 Control 1.30 ± 0.05 × 105(a) 1.96 ± 0.06 × 104 1.00 ± 0.01 × 102(b) 2.70 ± 0.64 × 107(a) 3.56 ± 1.58 × 106 1.70 ± 0.11 × 102(b)
T1 4.00 ± 0.57 × 10 4(b) 1.20 ± 0.56 × 104 1.40 ± 0.90 × 104(a) 1.20 ± 0.58 × 107(ab) 1.40 ± 0.65 × 106 2.90 ± 0.15 × 10 2(a)
T2 6.66 ± 1.66 × 10 4(b) 8.00 ± 0.36 × 104 5.00 ± 0.20 × 103(ab) 2.03 ± 0.89 × 107(ab) 4.20 ± 0.23 × 106 1.66 ± 0.33 × 10 2(a)
T3 1.10 ± 0.20 × 10 5(a) 1.30 ± 0.32 × 104 3.00 ± 1.15 × 103(ab) 5.46 ± 0.47 × 10 6(b) 3.93 ± 1.14 × 106 2.33 ± 0.33 × 10 2(a)
T4 1.26 ± 0.12 × 10 5(a) 2.66 ± 0.21 × 104 2.33 ± 0.88 × 103(ab) 1.36 ± 0.60 × 107(ab) 4.53 ± 0.58 × 106 5.00 ± 0.20 × 10 2(a)
P value 0.000 0.781 0.203 0.236 0.138 0.389
3 Control 9.00 ± 1.15 × 104 3.65 ± 0.27 × 104(b) 1.33 ± 0.33 × 102(c) 1.10 ± 0.65 × 107 1.36 ± 0.96 × 106(a) 5.00 ± 0.23 × 102(c)
T1 5.33 ± 1.45 × 104 3.33 ± 0.23 × 103(b) 1.10 ± 0.49 × 103(bc) 1.36 ± 0.82 × 106 1.20 ± 0.41 × 105(c) 1.76 ± 0.78 × 10 4(a)
T2 6.33 ± 0.33 × 104 5.00 ± 0.30 × 103(b) 1.13 ± 0.46 × 103(bc) 1.60 ± 0.80 × 106 5.70 ± 0.96 × 105(b) 4.66 ± 0.27 × 10 3(b)
T3 5.66 ± 1.76 × 104 1.00 ± 0.04 × 105(a) 3.33 ± 0.88 × 103(b) 5.33 ± 0.33 × 106 3.96 ± 0.70 × 105(b) 1.46 ± 0.12 × 10 4(a)
T4 5.13 ± 1.16 × 104 1.03 ± 0.54 × 103(b) 5.33 ± 1.76 × 103(a) 3.73 ± 0.46 × 106 3.96 ± 0.89 × 105(b) 1.56 ± 0.12 × 10 4(a)
P value 0.304 0.300 0.017 0.275 0.448 0.707
[Table Contd.
Contd. Table]

Time Group Microbial evaluation of the culture water (cfu/ml) Microbial evaluation of the intestinal tract (cfu/g)
(Week) TPC TVC TLC TPC TVC TLC
4 Control 9.00 ± 2.30 × 10 4(a) 1.20 ± 0.20 × 105(a) 3.00 ± 0.57 × 102(b) 2.13 ± 0.44 × 106(ab) 5.50 ± 0.32 × 105(a) 3.10 ± 0.19 × 10 2(b)
T1 3.33 ± 0.88 × 10 4(b) 4.36 ± 1.73 × 103(b) 1.66 ± 0.66 × 103(ab) 7.66 ± 0.48 × 10 5(b) 1.10 ± 0.10 × 105(b) 2.73 ± 0.81 × 104(ab)
T2 2.00 ± 0.57 × 10 4(b) 3.66 ± 0.26 × 103(b) 1.33 ± 0.33 × 103(ab) 5.66 ± 0.29 × 10 5(b) 1.10 ± 0.23 × 105(b) 4.36 ± 1.73 × 10 4(a)
T3 3.00 ± 0.00 × 104(b) 7.00 ± 1.52 × 103(b) 2.00 ± 0.57 × 103(a) 1.20 ± 0.11 × 106(b) 2.80 ± 0.16 × 105(b) 2.73 ± 1.39 × 104(ab)
T4 5.33 ± 0.88 × 10 4(b) 3.00 ± 1.52 × 103(b) 1.33 ± 0.33 × 103(ab) 3.70 ± 0.14 × 10 6(a) 2.30 ± 0.13 × 105(b) 1.43 ± 0.80 × 104(ab)
P value 0.006 0.000 0.177 0.055 0.380 0.162
5 Control 2.10 ± 0.30 × 10 5(a) 1.20 ± 0.20 × 105(a) 3.33 ± 0.33 × 102(b) 7.33 ± 2.33 × 10 6(a) 5.73 ± 0.28 × 105(a) 6.66 ± 0.88 × 10 2(b)
T1 6.00 ± 0.26 × 104(bc) 7.66 ± 1.76 × 103(b) 2.33 ± 0.33 ×103(a) 1.00 ± 0.15 × 10 6(b) 5.63 ± 0.23 × 104(ab) 4.66 ± 0.36 ×104(a)
T2 4.20 ± 1.94 × 104(c) 5.00 ± 0.23 × 103(b) 2.00 ± 0.02 × 103(a) 1.33 ± 0.33 × 10 6(b) 2.53 ± 0.22 × 105(ab) 4.33 ± 0.66 × 10 4(a)
T3 1.56 ± 0.37 × 105(ab) 7.00 ± 1.52 × 103(b) 2.33 ± 0.33 × 103(a) 1.90 ± 0.58 × 10 6(b) 4.66 ± 1.45 × 104(b) 2.50 ± 0.50 × 10 4(a)
T4 1.43 ± 0.49 × 104(c) 5.33 ± 0.23 × 103(b) 2.00 ± 0.57 × 103(a) 3.16 ± 1.92 × 10 5(b) 1.12 ± 0.94 × 105(ab) 7.66 ± 1.61 × 10 4(a)
P value 0.015 0.000 0.005 0.005 0.196 0.621
Last Control 3.30 ± 0.23 × 10 5(a) 1.76 ± 0.29 × 105(a) 0.00(c) 1.90 ± 0.60 × 10 7(a) 7.00 ± 0.23 × 105(a) 8.33 ± 2.40 × 102(c)
week T1 3.33 ± 0.88 × 10 3(b) 4.40 ± 0.28 × 103(b) 6.66 ± 1.33 × 103(a) 1.66 ± 0.20 × 10 5(b) 1.93 ± 0.10 × 104(b) 5.33 ± 0.88 × 10 4(b)
T2 2.00 ± 0.57 × 10 3(b) 1.20 ± 0.43 × 104(b) 2.33 ± 0.88 × 103(b) 9.33 ± 0.88 × 10 5(b) 2.56 ± 0.17 × 104(b) 4.33 ± 1.45 × 104(ab)
T3 3.00 ± 0.01 × 10 3(b) 1.43 ± 0.20 × 104(b) 2.23 ± 0.76 × 103(b) 6.36 ± 0.30 × 10 5(b) 3.46 ± 0.19 × 104(b) 4.33 ± 0.88 × 104(ab)
T4 3.23 ± 1.29 × 10 4(b) 1.00 ± 0.37 × 104(b) 1.66 ± 0.66 × 103(b) 3.76 ± 0.21 × 10 5(b) 1.06 ± 0.54 × 104(b) 8.66 ± 1.24 × 10 4(a)
P value 0.000 0.000 0.006 0.001 0.001 0.006
In each column values (mean ± SD, n=6) with different superscripts differ significantly (P < 0.05).
153
noteworthy difference (P> 0.05) in total Vibrio count in the

shrimp’s intestinal tract, except in last week. Interestingly, in last
week, higher total Vibrio count was recorded in control (7.00 ±
0.23 × 105cfu/g). There was not much of a difference (P> 0.05)
in total Lactobacillus count, except last week. In Lactobacillus count,
among the different treatments, significantly higher total
Lactobacillus count was recorded in T4 group (8.66 ± 1.24 × 104
cfu/g) in the last week.
Growth Performance and Water Quality Parameters

The present study found a considerable difference (P< 0.05) in
the final weight, weight gain and specific growth rate (Table 4).
Significantly higher and lower growth performance of final weight
(0.97 ± 0.06 & 0.64 ± 0.01 g), weight gain (0.94 ± 0.06 & 0.61
± 0.01 g) and specific growth rate (7.88 ± 0.18 & 6.96 ± 0.04 %/
day) were recorded in T1 and control, respectively. Similarly, a
remarkably higher survival rate was noticed in T1 (64.66 ± 4.16%).
Further, the shrimp fed with B. subtilis and B. megaterium
incorporated diets exhibited better FCR (1.04 ± 0.05 & 1.13 ±
0.06). In contrast to this, the control group showed poor feed
utilisation, in terms of FCR (1.31 ± 0.03).
All the water quality parameters within the acceptable ranges;
DO (5.0 ± 0.5 mg/l), temperature (30 ± 1.0oC), pH (7.8 – 8.3),
ammonia-N (< 0.1 ± 0.01 mg/ l), nitrite-N (< 0.05 ± 0.001 mg/
l) and nitrate-N (< 3.0 ± 1.0 mg/l) were recorded during the
experimental period.
154
Table 4: Effect of supplementation of different Bacillus strains on growth performance and survival of P.

vannamei
Treatments Initial weight (g) Final weight (g) Weight gain (g) SGR (%/day) FCR Survival (%)
Control 0.02 ± 0.00 0.64 ± 0.01c 0.61 ± 0.01c 6.96 ± 0.04c 1.31 ± 0.03a 51.33±2.30c
T1 0.02 ± 0.00 0.97 ± 0.06a 0.94 ± 0.06a 7.88 ± 0.18a 1.04 ± 0.05b 64.66±4.16 a
T2 0.02 ± 0.00 0.72 ± 0.00bc 0.69 ± 0.00bc 7.25 ± 0.02b 1.13 ± 0.06b 56.00±4.00bc
T3 0.02 ± 0.00 0.81 ± 0.06b 0.78 ± 0.06b 7.46 ± 0.15b 1.22 ± 0.08ab 60.66±3.05 ab
T4 0.02 ± 0.00 0.78 ± 0.03b 0.75 ± 0.03b 7.40 ± 0.20b 1.16 ± 0.04ab 60.66±6.42 ab
P value 0.587 0.002 0.002 0.002 0.065 0.006
In each column, values (mean ± SD, n=30) with different superscripts differ significantly (P < 0.05)
Table 5: Effect of supplementation of different strains of Bacillus sp. dietary probiotic on immune
performance of P. vannamei
Treatments Serum protein (g/dl) SOD (U/mg protein) Catalase (U/mgprotein) PO (U/mg protein)
Control 3.60 ± 0.26 287.44 ± 34.55a 8.92 ± 0.59a 20.24 ± 2.77a
T1 3.83 ± 0.36 129.72 ± 28.04c 3.67 ± 0.98b 9.60 ± 0.61b
T2 3.52 ± 0.57 232.51 ± 16.79ab 5.17 ± 0.22b 22.83 ± 4.26a
T3 3.76 ± 0.39 217.41 ± 17.58ab 6.34 ± 1.46b 21.65 ± 2.46a
T4 4.16 ± 0.55 144.29 ± 17.99bc 3.84 ± 1.12b 8.93 ± 0.46b
P value 0.883 0.018 0.007 0.013
155
In each column, values (mean ± SD, n=6) with different superscripts differ significantly (P < 0.05)
Digestive Enzyme Activity

A significant difference (P< 0.05) in amylase activity was
observed among the shrimp groups fed with different probiotic
sp (Fig.1). Among these, a higher amylase activity was recorded
in B. subtilis supplemented group (T1) (7.53 ± 1.27 U/mg
protein) and lower amylase activity in the control group (1.59 ±
0.28 U/mg protein). There was no substantial difference in lipase
activity reported in the Bacillus sp. fed groups (Fig.2). However,
a lower lipase activity was recorded in control group (210.23 ±
26.33 U/mg protein). The protease activity differed widely (P<
0.05) among the different treatment groups (Fig. 3). A notably
higher protease activity was noticed in B. subtilis (T1) fed group
(1.89 ± 0.41U/mg protein) followed by B. megaterium (T2) fed
group (2.23 ± 0.03U/mg protein). In cellulase activity, a
considerable difference (P< 0.05) was observed among the
treatments. A much higher cellulase activity was recorded in T2
group (246.83 ± 29.77 U/mg protein) (Fig. 4).
Immunological Parameters
There was no major difference in serum protein levels of different
treatment groups. The phenol oxidase was significantly lower in
T4 (8.93 ± 0.46U/mg protein) followed by T1 (9.60 ± 0.61 U/
mg protein) compared to other treatment groups.
Antioxidant Enzymes
In SOD, a vital difference (P< 0.05) was observed among the
different treatment groups. A higher SOD was recorded in
156
Fig. 1. Specific activity of intestinal amylase (U/mg protein) from shrimp fed
with different strains of Bacillus incorporated diets. Bars with different
superscripts differ significantly at P < 0.05.
Fig. 2. Specific activity of intestinal lipase (U/mg protein) from shrimp fed with
different strains of Bacillus incorporated diets. Bars with different
157
Fig. 3. Specific activity of intestinal protease (U/mg protein) from shrimp fed with
different strains of Bacillus incorporated diets. Bars with different superscripts
differ significantly at P < 0.05.
Fig. 4. Specific activity of intestinal cellulase (U/mg protein) from shrimp fed
with different strains of Bacillus incorporated diets. Bars with different
158
control (287.44 ± 34.55 U/mg protein) followed by T2 (232.51

± 16.79 U/mg protein) and lower superoxide dismutase activity
was observed in T1 (129.72 ± 28.04 U mg/ protein). The catalase
activity, in the control group, was significantly higher than the
other treatment groups.
Almost all the practices have been tried in aquaculture sector,
to challenge pathogenic intruders, except the eco-friendly practice
of probiotic supplementation. Many studies have suggested the
usage of probiotics as a part of aquaculture practice (Liu et al.,
2009; Buruiana et al., 2014 & Zokaeifar et al., 2014). It has been
well documented that Bacillus sp. are able to produce ranges of
extracellular substances and antimicrobial peptides, which in turn
improve growth, digestion and absorption of feed, health,
immunity and survival against pathogenic microorganisms
(Zokaeifar et al., 2012; Wang, Hu, Chiu,& Liu, 2019).
The effective concentration of single probiotic strain in a
diet, to improve the growth performance and health status of
aquatic animal is 108 cfu g-1 (Zokaeifar et al., 2012; Amoah et
al., 2019). Therefore, in the present study, concentration of 108
cfu g-1 was supplemented to the different treatment diets with
their respective probiotic bacteria. In aquaculture, most of the
studies on probiotics have been carried out using a single
probiotic strain or compared two species. Notably, less is known
about the potential effects of different species of Bacillus in a
particular sphere of work.
DNase is an enzyme holding the potential virulence factors
(bacterial innate immune avoidance mechanisms), such as
subdual effect on bactericidal activity of macrophage and TLRs
159
(toll like receptors) - mediated innate immune response. The

findings of the present study illustrated that none of the Bacillus
sp. were able to produce DNase which confirmed the probiotic
potentiality of the selected species.
In the selected strain, B. subtilis and B. cereus showed
inhibitory activity against V. parahaemolyticus and V. alginolyticus
with an average inhibition zone of 14, 15 and 13, 16 mm,
respectively. Gullian, Thompson & Rodriguez. (2004) reported
that, species of Bacillus P64 had a maximum inhibition effect
against V. harveyi S2 with 15.3 mm of inhibition zone. Similar
results were reported by Luis-Villasenor, Macías-Rodríguez,
Gómez-Gil, Ascencio-Valle & Campa-Córdova (2011) using
Bacillus spp. against V. parahaemolyticus (CAIM 170) and V.
harveyi (CAIM 1793) with an inhibition zone of 11 and 17.5
mm, respectively. Generally, Bacillus sp. are well known for its
ability to produce proteinaceous substances, which encompass
antibacterial compounds such as enzymes and bacteriocins or
bacteriocin like inhibitory substances (BLIS) (Zokaeifar et al.,
2012). These may exert a bactericidal or bacteriostatic effect on
ranges of Gram-positive and Gram-negative pathogens (Schulz
et al., 2005). This could be the reason for the inhibitory activity
of Bacillus sp. against Vibrio pathogen.
Recently, the intestinal microflora gained more attention
due to its crucial role on shaping structural integrity of intestinal
features (Amoah et al., 2019). It has also been confirmed that
probiotic supplementation positively alters the gut microflora by
producing antimicrobial peptides to override the growth of other
organisms (Kar and Ghosh, 2008). The first line of action of
160
probiotic on host is competitive exclusion- a mechanism by

which the probiotic creates a hostile environment for pathogen
colonisation in the GIT of the host animal. Interestingly, in the
present study, successful colonisation of different Bacillus sp. and
considerable reduction of total Vibrio count in the GIT of fed
animal was noticed. This proved the successful competitive
exclusion of pathogen by the supplemented Bacillus sp. from the
shrimp GIT. Similar results were obtained by Zokaeifar et
al.(2012) using B. subtilis species L10 and G1 as probiotics. It
has been reported that probiotic, Bacillus can multiply in the
digestive tract of host animal and perform, similar to oral vaccines
(Interaminense et al., 2018).
In shrimp culture, the emerging threats, namely new disease
outbreaks and stressful conditions, could be reduced and higher
production, with improved weight gain, SGR, FCR, digestion
and nutrient absorption, can be achieved using probiotics (Chai,
Song, Chen, Xu & Huang, 2016). In the present study,
significantly improved growth performance, in terms of weight
gain, SGR, FCR and better survival, was observed in B. subtilis
incorporated diet than the other treatment groups. Similarly, P.
vannamei fed with B. subtilis incorporated diet showed increased
growth performance than control and B. megaterium supplemented
groups (Olmos, Ochoa, Paniagua-Michel, & Contreras, 2011).
The present study noticed a significant increase in digestive
enzyme activity of probiotic supplemented diet fed groups. In
addition to this, good appetite behaviour was observed in all the
treatment groups, except control group. Previous reports suggest
that incorporation of Bacillus sp. or probiotics enhances the
161
specific activity of lipase, amylase and protease in the digestive

tract (Ziaei-Nejad, 2006; Amoah et al., 2019). The reason for
elevated digestive enzyme activities in the supplemented groups
is due to the production of exogenous digestive enzymes by the
probiotic bacterial species, after successful colonisation in GIT,
which subsequently induce the endogenous production of
digestive enzymes (Wang, 2007 & Liu et al., 2009). Overall, B.
subtilis fed group exhibited increased digestive enzyme activities,
except cellulase, which can be further correlated with increased
growth of the shrimp in that group. Similarly, P. vannamei
juveniles fed with B. subtilis in the diet displayed increased
digestive enzyme activities, protease and amylase and better
growth performance (Zokaeifar et al., 2014).
Higher vertebrates, while encountering a foreign substance,
activate acquired immune responses, whereas invertebrates,
especially shrimps, use innate immune responses (Tseng et al.,
2009). To further strengthen the simple immune system of
shrimp, probiotics are intended to be used in aquaculture as a
sustainable practice to encounter the bacterial or viral intruders.
Serum protein concentration indicates the immune status of
fish. Higher concentration directly correlates with stronger
immune response. Serum proteins (albumin and globulin) are
novel components necessary for the efficient functioning of the
immune system (Yengkokpam et al., 2016). The present study
did not find any significant difference in total serum protein
among the different treatment groups. In contrast, Ferreira et al.
(2015) reported increased serum protein in shrimp fed with
Bacillus sp. than compared to control. However, no major
difference was observed in total serum protein of P. vannamei
fed with Bacillus sp. (Gullian et al., 2004; Liu et al., 2009).
162
The present study revealed that PO activity was considerably

higher in all the treated groups, except those fed with B. infantis
and B. subtilis incorporated diet. Ferreira et al. (2015) noticed
lower PO activity in P. vannamei treated with Bacillus spp.
supplemented diet. In contrary to that, Gullian et al. (2004)
noticed a much higher PO activity in shrimp fed with probiotics.
A striking increase in PO activity of groups treated with
probiotics has been attributed only after challenging the shrimp
with Vibrio spp. or any other pathogens (Chiu et al., 2007).
The superoxide dismutase activity was significantly higher
in control and lower in B. subtilis supplemented diet fed groups.
In the process of metabolism, aerobic organisms continuously
produce endogenous reactive oxygen species (ROS), which in
turn cause potential cytotoxic problems to the host (Munoz et
al., 2000). Therefore, in the present study, to avoid the cytotoxic
effect by nullifying the excessive ROS (Shen et al., 2010), SOD
level might have increased in control, T2, T3 groups.
Catalase (CAT), another antioxidant enzyme, protects
organisms against the oxidative stress by decomposing hydrogen
peroxide (Tavares-Sánchez et al., 2004). The present study found
significantly lower catalase activity in different Bacillus species
treated groups compared to control group. The result indicated
lower generation of H2O2 in treatment groups, which received
different Bacillus species as a feed supplement. Castex, Lemaire,
Wabete & Chim (2010) reported decreased CAT and lower
free radical generation when Pacific blue shrimp, (Litopenaeus
stylirostris) was supplemented with effective microorganisms
(EM) in diet.
163
The presence of too many toxic molecules, such as quinones,

hemiquinones and free radicals (ROIs and NIRs), in the absence
of infection, leads to unnecessary energy burden to the shrimp,
which in turn negatively affects the tissues (Munoz et al., 2000).
While considering the above statement, findings of the present
study revealed that B. subtilis could be a better probiotic strain,
among the other Bacillus sp. by reducing the superoxide
dismutase, and catalase activities.
Shrimp fed with B. subtilis incorporated diet showed
potential competitive exclusion, better growth performance and
improved digestive enzyme activities, with optimal anti-oxidant
defence performance. This proved that B. subtilis would be a
better single probiotic strain for ensuring complete biosecurity
of shrimp farming practices in future.
ACKNOWLEDGEMENT
This research has been supported by grants from Department of
Biotechnology (DBT), Govt of India, New Delhi (Project code:
507; 2016 -2019; PI: Dr.S.Felix).
REFERENCES
Afrilasari, W. and Meryandini, A. 2016. Effect of probiotic Bacillus
megaterium PTB 1.4 on the population of intestinal microflora,
digestive enzyme activity and the growth of Catfish (Clarias
sp.). Hayati Journal of Biosciences, 23(4): 168-172. https://
doi.org/10.1016/j.hjb.2016.12.005
Aly, S.M., Ahmed, Y.A.G., Ghareeb, A.A.A. and Mohamed, M.F.
2008. Studies on Bacillus subtilis and Lactobacillus acidophilus,
164
as potential probiotics, on the immune response and resistance

of Tilapia nilotica (Oreochromis niloticus) to challenge infections.
Fish & Shellfish Immunology, 25(1-2): 128-136. https://doi.org/
10.1016/j.fsi.2008.03.013
American Public Health Association, A.P.H.A. 1995. Standard
methods for the examination of water and wastewater (Vol.
21). Washington, DC: American Public Health Association.
Amoah, K., Huang, Q.C., Tan, B.P., Zhang, S., Chi, S.Y., Yang,
Q.H., Liu, H.Y. and Dong, X.H. 2019. Dietary
supplementation of probiotic Bacillus coagulans ATCC 7050,
improves the growth performance, intestinal morphology,
microflora, immune response, and disease confrontation of
Pacific white shrimp, Litopenaeus vannamei. Fish & Shellfish
Immunology, 87: 796-808. https://doi.org/10.1016/j.fsi.2019.
02.029
Bachère, E., Gueguen, Y., Gonzalez, M., De Lorgeril, J., Garnier,
J. and Romestand, B. 2004. Insights into the anti microbial
defense of marine invertebrates: the Penaeid shrimps and the
oyster Crassostrea gigas. Immunological Reviews, 198(1): 149
168. https://doi.org/10.1111/j.0105-2896.2004.00115.x
Bernfeld, P. 1955. Amylase α and β. Methods in Enzymology, 1:
149-151. https://doi.org/10.1016/0076-6879 (55)01021-5
Buruiana, C.T., Profir, A.G. and Vizireanu, C. 2014. Effects of
probiotic Bacillus species in aquaculture-an overview. The
Annals of the University of Dunarea de Jos of Galati. Fascicle
VI. Food Technology, 38: p.9.
Castex, M., Lemaire, P., Wabete, N. and Chim, L. 2010. Effect of
probiotic Pediococcus acidilactici on antioxidant defences and
oxidative stress of Litopenaeus stylirostris under Vibrio
165
nigripulchritudo challenge. Fish & Shellfish Immunology, 28(4):

622-631. https://doi.org/10.1016/j.fsi.2009.12.024
Chai, P.C., Song, X.L., Chen, G.F., Xu, H. and Huang, J. 2016.
Dietary supplementation of probiotic Bacillus PC465 isolated
from the gut of Fenneropenaeus chinensis improves the health
status and resistance of Litopenaeus vannamei against White
Spot Syndrome virus. Fish & shellfish immunology, 54: 602
611. https://doi.org/10.1016/j.fsi.2016.05.011
Cherry, I.S. and Crandall Jr, L.A. 1932. The specificity of pancreatic
lipase: its appearance in the blood after pancreatic injury.
American Journal of Physiology-Legacy Content, 100(2): 266
273. https://doi.org/10.1152/ajplegacy.1932.100.2.266
Chiu, C.H., Guu, Y.K., Liu, C.H., Pan, T.M. and Cheng, W.
2007. Immune responses and gene expression in white shrimp,
Litopenaeus vannamei, induced by Lactobacillus plantarum. Fish
& Shellfish Immunology, 23(2): 364-377. https://doi.org/
10.1016/j.fsi.2006.11.010
Clemente, J.C., Ursell, L.K., Parfrey, L.W. and Knight, R. 2012.
The impact of the gut microbiota on human health: an
integrative view. Cell, 148(6): 1258-1270. https://doi.org/
10.1016/j.cell.2012.01.035
Dawood, M.A., Koshio, S. and Esteban, M.Á. 2018. Beneficial
roles of feed additives as immunostimulants in aquaculture: a
review. Reviews in Aquaculture, 10(4): 950-974. https://
doi.org/10.1111/req.12209
Dharmaraj, R. and Rajendren, V. 2014. Probiotic assessment of
Bacillus infantis isolated from gastrointestinal tract of Labeo
rohita. International Journal of Scientific and Research Publications,
4(7): 1-6.
166
Drapeau, G.R. 1976. Protease from Staphyloccusaureus. In Methods

in enzymology, 45: 469-475. Academic Press. https://doi.org/
10.1016/S0076-6879(76)45041-3
Ferreira, G.S., Bolívar, N.C., Pereira, S.A., Guertler, C., do
Nascimento Vieira, F., Mouriño, J.L.P. and Seiffert, W.Q.
2015. Microbial biofloc as source of probiotic bacteria for the
culture of Litopenaeus vannamei. Aquaculture, 448: 273-279.
https://doi.org/10.1016/j.aquaculture.2015.06.006
Food and Agriculture Organization of the United Nations (FAO)/
World Health Organization (WHO). 2001. Joint FAO/WHO
expert consultation on evaluation of health and nutritional
properties of probiotics in food including powder milk and live
lactic acid bacteria.
García Bernal, M., Medina Marrero, R., Rodríguez Jaramillo, C.,
Marrero Chang, O., Campa Córdova, Á.I., Medina García, R.
and Mazón Suástegui, J.M. 2018. Probiotic effect of
Streptomyces spp. on shrimp (Litopenaeus vannamei) post larvae
challenged with Vibrio parahaemolyticus. Aquaculture
Nutrition, 24(2): 865-871. https://doi.org/10.1111/anu.12622
Gollas-Galván, T., Hernández-López, J. and Vargas-Albores, F.
1997. Effect of calcium on the prophenoloxidase system
activation of the brown shrimp (Penaeus californiensis, Holmes).
Comparative Biochemistry and Physiology Part A: Physiology,
117(3): 419-425. https://doi.org/10.1016/S0300-9629
(96)00363-5
González-Peña, M.C., A.J. Anderson, D.M. Smith & G.S. Moreira.
2002. Effect of dietary cellulose on digestion in the prawn
Macrobrachium rosenbergii. Aquaculture, 211: 291-303. https:/
/doi.org/10.1016/S0044-8486 (02)00129-1
167
Gullian, M., Thompson, F. and Rodriguez, J. 2004. Selection of

probiotic bacteria and study of their immunostimulatory effect
in Penaeus vannamei. Aquaculture, 233(1-4): 1-14. https://
doi.org/10.1016/j.aquaculture.2003.09.013
Interaminense, J.A., Vogeley, J.L., Gouveia, C.K., Portela, R.W.,
Oliveira, J.P., Andrade, H.A., Peixoto, S.M., Soares, R.B.,
Buarque, D.S. and Bezerra, R.S. 2018. In vitro and in vivo
potential probiotic activity of Bacillus subtilis and Shewanella
algae for use in Litopenaeus vannamei rearing. Aquaculture,
488: 114-122. https://doi.org/10.1016/j.aquaculture.2018.01.
027
Kar, N. and Ghosh, K. 2008. Enzyme producing bacteria in the
gastrointestinal tracts of Labeo rohita (Hamilton) and Channa
punctatus (Bloch). Turkish Journal of Fisheries and Aquatic
Sciences, 8(1): 115-120.
Khademzade, O., Zakeri, M., Haghi, M. and Mousavi, S.M. 2020.
The effects of water additive Bacillus cereus and Pediococcus
acidilactici on water quality, growth performances, economic
benefits, immunohematology and bacterial flora of white leg
shrimp (Penaeus vannamei Boone, 1931) reared in earthen
ponds. Aquaculture Research, 51(5): 1759-1770. https://doi.org/
10.1111/are.14525
Kirchgessner, M., Roth, F.X., Eidelsburger, U. and Gedek, B. 1993.
The nutritive efficiency of Bacillus cereus as a probiotic in the
raising of piglets. 1. Effect on the growth parameters and
gastrointestinal environment. Archiv fur Tierernahrung, 44(2):
111-121. https://doi.org/10.1080/17450399309386062
Krummenauer, D., Poersch, L., Romano, L.A., Lara, G.R.,
Encarnação, P. and WasieleskyJr, W. 2014. The effect of
168
probiotics in a Litopenaeus vannamei biofloc culture system

infected with Vibrio parahaemolyticus. Journal of applied
Aquaculture, 26(4): 370-379. https://doi.org/10.1080/
10454438.2014.965575
Lafferty, K.D., Harvell, C.D., Conrad, J.M., Friedman, C.S., Kent,
M.L., Kuris, A.M., Powell, E.N., Rondeau, D. and Saksida,
S.M. 2015. Infectious diseases affect marine fisheries and
aquaculture economics. Annual Review of Marine Science, 7:
471-496. https://doi.org/10.1146/annurev-marine-010814
015646
Liu, C.H., Chiu, C.S., Ho, P.L. and Wang, S.W. 2009.
Improvement in the growth performance of white shrimp,
Litopenaeus vannamei, by a protease producing probiotic, Bacillus
subtilis E20, from natto. Journal of Applied Microbiology, 107(3):
1031-1041. https://doi.org/10.1111/j.1365-2672.2009.04284.x
Protein measurement with the Folin phenol reagent. Journal
of Biological Chemistry, 193: 265-275.
Luis-Villasenor, I.E., Macías-Rodríguez, M.E., Gómez-Gil, B.,
Ascencio-Valle, F. and Campa-Córdova, Á.I. 2011. Beneficial
effects of four Bacillus strains on the larval cultivation of
Litopenaeus vannamei. Aquaculture, 321(1-2): 136-144. https:/
/doi.org/10.1016/j.aquaculture.2011.08.036
Majeed, M., Nagabhushanam, K., Natarajan, S., Sivakumar, A.,
Ali, F., Pande, A., Majeed, S. and Karri, S.K. 2015. Bacillus
coagulans MTCC 5856 supplementation in the management
of diarrhoea predominant Irritable Bowel Syndrome: a double
blind randomized placebo controlled pilot clinical study.
Nutrition Journal, 15(1): 21. https://doi.org/10.1186/s12937
016-0140-6
169

superoxide dismutase. Journal of Biological chemistry, 247(10):
pp.3170-3175. https://www.jbc.org/content/247/10/3170.short
Muñoz, M., Cedeño, R., Rodrýìguez, J., van der Knaap, W.P.,
Mialhe, E. and Bachère, E. 2000. Measurement of reactive
oxygen intermediate production in haemocytes of the penaeid
shrimp, Penaeus vannamei. Aquaculture, 191(1-3): 89-107.
https://doi.org/10.1016/S0044-8486 (00)00420-8
Musthafa, K.S., Saroja, V., Pandian, S.K. and Ravi, A.V. 2011.
Antipathogenic potential of marine Bacillus sp. SS4 on N
acyl-homoserine-lactone-mediated virulence factors production
in Pseudomonas aeruginosa (PAO1). Journal of Biosciences, 36(1):
55-67. https://doi.org/10.1007/s12038-011-9011-7
Nayak, S.K. 2010. Probiotics and immunity: a fish perspective.
Fish & Shellfish Immunology, 29(1): 2-14. https://doi.org/
10.1016/j.fsi.2010.02.017
Nimrat, S., Khaopong, W., Sangsong, J., Boonthai, T. and
Vuthiphandchai, V. 2019. Dietary administration of Bacillus
and yeast probiotics improves the growth, survival, and microbial
community of juvenile white leg shrimp, Litopenaeus
vannamei. Journal of Applied Aquaculture, 1-17. https://doi.org/
10.1080/10454438.2019.1655517
Nyangale, E.P., Farmer, S., Keller, D., Chernoff, D. and Gibson,
G.R. 2014. Effect of prebiotics on the fecal microbiota of
elderly volunteers after dietary supplementation of Bacillus
coagulans GBI-30, 6086. Anaerobe, 30: 75-81. https://doi.org/
10.1016/j.anaerobe.2014.09.002
170
Olmos, J., Ochoa, L., Paniagua-Michel, J. and Contreras, R. 2011.

Functional feed assessment on Litopenaeus vannamei using
100% fish meal replacement by soybean meal, high levels of
complex carbohydrates and Bacillus probiotic strains. Marine
Drugs, 9. https://doi.org/10.3390/md9061119
Runsaeng, P., Kwankaew, P. and Utarabhand, P. 2018. FmLC6:
An ultimate dual-CRD C-type lectin from Fenneropenaeus
merguiensis mediated its roles in shrimp defence immunity
towards bacteria and virus. Fish & shellfish immunology, 80:
200-213. https://doi.org/10.1016/j.fsi.2018.05.043
Schubert, R.H., Buchanan, R.E. and Gibbons, N.E. 1974. Bergey’s
Manual of Determinative Bacteriology. by RE Buchanan and
NE Gibbons, p.354.
Schulz, O., Diebold, S.S., Chen, M., Näslund, T.I., Nolte, M.A.,
Alexopoulou, L., Azuma, Y.T., Flavell, R.A., Liljeström, P.
and e Sousa, C.R. 2005. Toll-like receptor 3 promotes cross-
priming to virus-infected cells. Nature, 433(7028): 887. https:/
/doi.org/10.1038/nature03326
Selim, K.M. and Reda, R.M. 2015. Improvement of immunity and
disease resistance in the Nile tilapia, Oreochromis niloticus, by
dietary supplementation with Bacillus amyloliquefaciens. Fish
& Shellfish Immunology, 44(2): 496-503. https://doi.org/
10.1016/j.fsi.2015.03.004
Shen, W.Y., Fu, L.L., Li, W.F. and Zhu, Y.R. 2010. Effect of
dietary supplementation with Bacillus subtilis on the growth,
performance, immune response and antioxidant activities of
the shrimp (Litopenaeus vannamei). Aquaculture Research,
41(11): 1691-1698. https://doi.org/10.1111/j.1365-2109.2010.
02554.x
171
Subramenium, G.A., Swetha, T.K., Iyer, P.M., Balamurugan, K.

and Pandian, S.K. 2018. 5-hydroxymethyl-2-furaldehyde from
marine bacterium Bacillus subtilis inhibits biofilm and virulence
of Candida albicans. Microbiological research, 207: 19-32. https:/
/doi.org/10.1016/j.micres.2017.11.002
Takahara, S., Hamilton, H.B., Neel, J.V., Kobara, T.Y., Ogura, Y.
and Nishimura, E.T. 1960. Hypocatalasemia: a new genetic
carrier state. The Journal of Clinical Investigation, 39(4): 610
619.
Tavares-Sánchez, O.L., Gómez-Anduro, G.A., Felipe-Ortega, X.,
Islas-Osuna, M.A., Sotelo-Mundo, R.R., Barillas-Mury, C.
and Yepiz-Plascencia, G. 2004. Catalase from the white shrimp
Penaeus (Litopenaeus vannamei): molecular cloning and protein
detection. Comparative Biochemistry and Physiology Part B:
Biochemistry and Molecular Biology, 138(4): 331-337. https://
doi.org/10.1016/j.cbpc.2004.03.005
Thitamadee, S., Prachumwat, A., Srisala, J., Jaroenlak, P., Salachan,
P.V., Sritunyalucksana, K., Flegel, T.W. and Itsathitphaisarn,
O. 2016. Review of current disease threats for cultivated
Penaeid shrimp in Asia. Aquaculture, 452: 69-87. https://
doi.org/10.1016/j.aquaculture.2015.10.028
Touraki, M., Karamanlidou, G., Karavida, P. and Chrysi, K. 2012.
Evaluation of the probiotics Bacillus subtilis and Lactobacillus
plantarum bioencapsulated in Artemia nauplii against vibriosis
in European sea bass larvae (Dicentrarchus labrax). World Journal
of Microbiology and Biotechnology, 28(6): 2425-2433. https://
doi.org/10.1007/s11274-012-1052-z
Tseng, D.Y., Ho, P.L., Huang, S.Y., Cheng, S.C., Shiu, Y.L.,
Chiu, C.S. and Liu, C.H. 2009. Enhancement of immunity
172
and disease resistance in the white shrimp, Litopenaeus

vannamei, by the probiotic, Bacillus subtilis E20. Fish & Shellfish
Immunology, 26(2): 339-344. https://doi.org/10.1016/
j.fsi.2008.12.003
Veron, H.E., Di Risio, H.D., Isla, M.I. and Torres, S. 2017. Isolation
and selection of potential probiotic lactic acid bacteria from
Opuntiaficus-indica fruits that grow in Northwest Argentina.
LWT, 84: 231-240. https://doi.org/10.1016/j.lwt.2017.05.058
Verschuere, L., Rombaut, G., Sorgeloos, P. and Verstraete, W.,
2000. Probiotic bacteria as biological control agents in
aquaculture. Microbiol. Microbiology and Molecular Biology
Reviews, 64(4): 655-671. 10.1128/MMBR.64.4.655-671.2000
Vieira, F.D.N., Jatobá, A., Mouriño, J.L.P., BuglioneNeto, C.C.,
Silva, J.S.D., Seiffert, W.Q., Soares, M. and Vinatea, L.A.
(2016). Use of probiotic-supplemented diet on a Pacific white
shrimp farm. Revista Brasileira de Zootecnia, 45(5): 203-207.
https://doi.org/10.1590/S1806-92902016000500001
Wang, Y.B. 2007. Effect of probiotics on growth performance and
digestive enzyme activity of the shrimp Penaeus vannamei.
Aquaculture, 269(1-4): 259-264. https://doi.org/10.1016/
j.aquaculture.2007.05.035
Wang, Y.C., Hu, S.Y., Chiu, C.S. and Liu, C.H. 2019. Multiple-
strain probiotics appear to be more effective in improving the
growth performance and health status of white shrimp,
Litopenaeus vannamei, than single probiotic strains. Fish &
Shellfish Immunology, 84: 1050-1058. https://doi.org/10.1016/
j.fsi.2018.11.017
Yang, C., Chowdhury, M.A., Huo, Y. and Gong, J. 2015. Phytogenic
compounds as alternatives to in-feed antibiotics: potentials
173
and challenges in application. Pathogens, 4(1): 137-156. https:/

/doi.org/10.3390/pathogens4010137
Yengkokpam, S., Debnath, D., Sahu, N.P., Pal, A.K., Jain, K.K.
and Baruah, K. 2016. Dietary protein enhances non-specific
immunity, anti-oxidative capability and resistance to Aeromonas
hydrophila in Labeo rohita fingerlings pre-exposed to short feed
deprivation stress. Fish & shellfish immunology, 59: 439-446.
https://doi.org/10.1016/j.fsi.2016.10.052
Ziaei-Nejad, S., Rezaei, M.H., Takami, G.A., Lovett, D.L.,
Mirvaghefi, A.R. and Shakouri, M. 2006. The effect of Bacillus
spp. bacteria used as probiotics on digestive enzyme activity,
survival and growth in the Indian white shrimp Fenneropenaeus
indicus. Aquaculture, 252(2-4): 516-524. https://doi.org/
10.1016/j.aquaculture.2005.07.021
Zokaeifar, H., Babaei, N., Saad, C.R., Kamarudin, M.S., Sijam, K.
and Balcazar, J.L. 2014. Administration of Bacillus subtilis
strains in the rearing water enhances the water quality, growth
performance, immune response, and resistance against Vibrio
harveyi infection in juvenile white shrimp, Litopenaeus
vannamei. Fish & Shellfish Immunology, 36(1): 68-74. https://
doi.org/10.1016/j.fsi.2013.10.007
Zokaeifar, H., Balcázar, J.L., Saad, C.R., Kamarudin, M.S., Sijam,
K., Arshad, A. and Nejat, N. 2012. Effects of Bacillus subtilis
on the growth performance, digestive enzymes, immune gene
expression and disease resistance of white shrimp, Litopenaeus
vannamei. Fish & Shellfish Immunology, 33(4): 683-689. https:/
/doi.org/10.1016/j.fsi.2012.05.027
174
EXTRA CELLULAR POLYMER SUBSTANCES (EPS) PRODUCING .....
CHAPTER 7
EXTRA CELLULAR POLYMER

SUBSTANCES (EPS) PRODUCING
BACTERIA FROM BIOFLOC OF
NILE TILAPIA CULTURE SYSTEM USING
DISTILLERY SPENT WASH AS CARBON
SOURCE
T he present study aimed to isolate and characterize the

Extracellular polymeric substance (EPS) producing bacteria
from biofloc reared Nile Tilapia ponds. Distillery spent wash
was used as a carbon source to maintain the C:N ratio at 10:1
in the fish culture ponds and screening of bacteria were done
fortnightly in 180 days culture. Out of 38 bacterial isolates, 7
isolates were found to produce EPS. Based on 16s rRNA
sequence analysis the isolates were identified as Bacillus subtilis,
B. megaterium, B. infantis, B.cereus, Pseudomonas balearica,
P.mendocina and P. alcaligenes. The highest production of EPS
was recorded in B.cereus (1.25g/L). EPS extracted from Bacillus
cereus was reported to have higher protein (89μg/ml) and B.
175
APPLIED AQUACULTURE BIO FLOC TECHNOLOGY
subtilis possessed higher carbohydrate(753.75μg/ml). Maximum

flocculating ability of 40.18% in B. cereus and higher emulsifying
activity of 63.53% was observed in B. megaterium. The EPS
extracted from B.infantis showed lower sludge volume index on
its treatment with aquaculture sludge (15.38 ml/g). Absorption
band in the range of 4000/cm to 450/cm using FTIR analysis
confirmed the presence of characteristic functional bands arising
from polysaccharides, nucleic acids and proteins. The results
indicated the presence of EPS producing bacteria in biofloc
based Nile Tilapia aquaculture systems.
Tilapia is one of the widely cultured fish globally in various
aquaculture systems (FAO, 2017). However, tilapia production
was hugely affected by emerging disease outbreaks thereby
hindering the development of aquaculture industry (Telli et al.
2014; Menaga et al. 2019). Also, to ensure long-term
sustainability, environmental impacts must be minimized and
alternative ways such as flocculation process need to be applied.
Flocculation helps to overcome the problem of aquaculture
effluent by the addition of synthetic polymers. As sludge from
aquaculture ponds is negatively charged, they can interact with
these synthetic polymers in combination with cations to
neutralize the surface charges thereby aiding the flocculation
and settling (Higgins and Novack, 1997b). However, these
synthetic polymers not only enhance the flocculation and sludge
dewatering but also when discharged into the environment affects
the soil microorganism as a major disadvantage. To overcome
these hindrances, green technology metabolites known as bio
flocculants produced by microorganisms can act similar function
as synthetic flocculants (Zaki et al. 2011). Many microorganisms
176
isolated from sludge were reported to secrete extracellular

polymeric substances. They are mainly composed of functional
proteins, polysaccharides, protein, nucleic acid and cellulose
(Kumar et al. 2004; Feng and Xu, 2008). The bacterial
extracellular polymeric substances also improve the formation of
bioflocs in activated sludge and contribute to its structural, surface
charge and settling properties (Houghton et al. 2001).
Consequently, better understanding on the characteristics of EPS
in biofloc provides advantages in undergoing wastewater
treatment process. Biofloc technology, a zero-water exchange
system, can be used to overcome the problems such as sludge
settling by stocking at a higher density with the enhanced fish
production (Hargreaves, 2013; Green et al. 2019). Therefore, the
ultimate aim of this study was to characterize the potential
flocculant-producing bacteria particularly for aquaculture
wastewater treatment. In the present study 7 bacterial species
isolated from Biofloc culture water were identified as EPS
producing bacteria. The EPS extracted from the bacteria has
been studied for various properties for its application in
flocculation and sludge settling.
METHODOLOGY
Isolation and Characterization of EPS Producing
Bacteria from Biofloc:
Nile tilapia juveniles (5.5 ±0.21g) were stocked at a density of
10/m3 in 300m2 ponds for 180 days in triplicates. Biofloc
development and maintenance in the freshwater culture ponds
were adopted as suggested by Taw(2006). Distillery spentwash
177
obtained from M/s. Rajshree Biosolutions, Coimbatore has been

used as a carbon source to maintain the C:N ratio at 10:1. The
biofloc water sample from Nile tilapia cultured ponds was
collected, serially diluted and spread plated on nutrient agar. The
plates were incubated at 37°C. Morphologically different colonies
were picked and stained using crystal violet and 20% aqueous
CuSO4 solution for initial screening of EPS producing bacteria
(Cain et al.2009). Morphological characterization was carried
out for the selected bacterial isolates according to Bergey’s manual
(Brown, 1939).
Genotypic Identification and Phylogenetic Tree

Construction of EPS Producing Bacteria
The genomic DNA was isolated using Phenol-Chloroform
method from EPS producing bacteria. The isolated DNA was
amplified for its 16s rRNA region using the Forward primer-
AGAGTTTGATCCTGGCTCAG and Reverse primer
CGGTTACCTTGTTACGACTT.The amplified DNA was
sequenced and subjected to BLAST analysis. The aligned
sequences were submitted in Genbank database to obtain the
accession number. The phylogenetic tree was constructed to find
the relationship between the EPS producing bacterial isolates.
Extraction of EPS from Bacterial Isolates

The bacterial isolates were incubated in liquid medium specific
for EPS production containing 0.2 g KH2PO4, 0.8 g K2HPO4,
0.2 g MgSO 4 .H 2 O, 0.1g CaSO 4 .2H 2 O, 2 mg FeCl 3 ,
Na2MoO4.2H2O (trace), 0.5g Yeast extract, 20 g Sucrose per
178
litre and after 48hrs of incubation the cell pellet were harvested
by centrifugation at 5000 rpm for 15 minutes. The cell pellet is
resuspended by adding 500 μl of 1mM EDTA and centrifuged
at 9000 rpm for 10 minutes. To the cell free supernatant, cold
acetone solution (1:3) was added and centrifuged to obtain the
pellet. The final pellet was dried at 60ºC for 24hrs to obtain the
capsular EPS (Mu’minah and Subair, 2015).
Characterization of EPS
Protein and carbohydrate estimation: EPS solution were prepared
by harvesting the cell pellets from the specific medium. The
pellets were resuspended in twice the volume of 0.2M cold
sulphuric acid solution followed by stirring at 4°C for 3 h. The
resulting suspension was centrifuged at 15,000 rpm for 20 min
to obtain the supernatant (EPS solution) which can be used for
further analysis. The amount of protein and carbohydrate in
EPS solution was quantified using Lowry’s method (1951) and
phenol sulphuric method (Dubois et al. 1956).
Lipid Emulsifying Test

Emulsifying activity of EPS producing bacterial isolates were
tested using the method of Yasumatsu et al. (1972). An equal
volume of olive oil and EPS solution were incubated on a rotary
shaker for 11 days. The lipid emulsifying activity was expressed
as percentage of the height of emulsified layer to the height of
whole layer.
179
Flocculation Ability
To 2 ml of EPS solution, 1 ml of 6.8 mM CaCl2 and 10 ml of
5g/l activated charcoal were added and mixed well. Control was
prepared without adding EPS solution. The mixture is kept
incubated at room temperature and the absorbance was measured
at 550 nm. Flocculation activity was calculated according to
following formula (Aziz et al. 2012).
Flocculating activity (%) = A-B/A ×100
Where A and B are the optical density values of control and
samples respectively.
Sludge Volume Index

Sludge volume index (SVI) of the EPS producing bacterial
isolates was estimated according to the method of Subramanian
et al. (2010). The sludge sample was collected and 2% of extracted
EPS (v/v) was added to this and mixed well. Sludge sample
without EPS was considered as control. The settled sludge
volume and suspended solids was measured after 30 min.
SVI was Calculated using the Formula

Sludge volume index (SVI) (ml/g) = Settled sludge volume /
Suspended solids
Fourier Transform Infra-red Analysis (FTIR): The EPS extracted
from bacterial isolates was subjected to Fourier Transform Infra
red Analysis and spectra were recorded in 4000/cm to 450/cm
range for confirmation of the functional groups in EPS arising
from polysaccharides, nucleic acids and proteins.
180

Isolation and biochemical characterization of EPS producing bacteria:
Out of 38 morphologically different colonies only 7 were
confirmed for EPS production using crystal violet and 20%
aqueous CuSO4 solution stained for initial screening of EPS
producing bacteria. The morphological and biochemical
characterization of 7 bacterial isolates were listed in the Table 1.
Phylogenetic tree for EPS producing bacteria: The accession
numbers obtained from genbank database are Bacillus infantis
(577 bp) -MH424755, Bacillus subtilis (568 bp) -MH424900,
Bacillus megaterium (577bp) - MH424904,Pseudomonas alcaligenes
(518 bp) - MH424895, Bacillus cereus (492 bp) - MH997476,
Pseudomonas balearica (736 bp) - MH997474, Pseudomonas
mendocina (669 bp) - MH997472. It is inferred from the
phylogenetic tree that there exist a close relationship between the
four bacillus species: Bacillus infantis, Bacillus cereus, Bacillus
megaterium, Bacillus subtilis and three Pseudomonas species:
Pseudomonas mendocina, Pseudomonas alcaligenes, Pseudomonas
balearica.Bacteria in general tend to produce EPS under
unfavourable environmental conditions to prevent them from
desiccation, toxic compounds, low temperatures or high osmotic
pressures and during oxygen and nitrogen level fluctuations (Hirst
et al. 2003). The EPS obtained in our study was Capsular EPS
and its tightly bound with the cell wall by non-covalent linkages
that helps in the biofloc or biofilm formation by interacting
with the negatively charged sludge solids(Higgins and Novack,
1997b).The results from our study reveals the fact that both
gram positive and gram negative bacteria can produce EPS as
181
Table 1: Morphological and biochemical characterization of bacterial isolates
182

Biochemical Pseudomonas P. P. Bacillus B. B. B.
characteristics mendocina balearica alcaligenes cereus subtilis megaterium infantis
Colony Morphology -ve rods -ve rods -ve rods +ve rods +ve rods +ve rods +ve rods
Indole -ve -ve -ve -ve -ve -ve -ve
Methyl red -ve -ve +ve +ve -ve -ve -ve
VogesProskauer’s -ve -ve -ve +ve +ve -ve +ve
Citrate utilization +ve -ve -ve -ve +ve +ve +ve
Glucose +ve +ve +ve +ve +ve +ve +ve
Adonitol +ve +ve +ve +ve +ve -ve -ve
Arabinose +ve +ve +ve +ve +ve -ve -ve
Lactose +ve +ve +ve +ve +ve -ve +ve
Sorbitol +ve +ve +ve +ve +ve -ve -ve
Mannitol +ve +ve +ve +ve +ve -ve +ve
Sucrose +ve +ve +ve +ve +ve -ve +ve
most of the microorganisms in the environment have the ability

to live within these biofilms. Biofloc helps the bacteria to form
the microbial aggregates as an essential step for the survival
(Flemming and Wingender, 2001b) in a huge bacterial
population. The anionic nature of EPS can also be augmented
by the presence of uronic acids or ketal-linked pyruvates thereby
enhancing the interactions of divalent cations such as Calcium
and Magnesium which helps in increasing the binding force in
the biofilm (Donlan, 2002; Sutherland, 2001).The identified
isolates were dominantly Bacillus sp. which agrees with the
findings of Hashim et al. (2018). Previous studies have also
reported on the presence of bioflocculating bacteria in biofloc
culture ponds of P. vannamei (Kasan et al. 2016).
Extraction of EPS from bacterial isolates: The EPS extracted
from seven bacterial isolates were listed in Table 2. The EPS
extracted from bacterial isolates of biofloc culture water varies
from 0.33-1.25g/L with the maximum production in Bacillus
cereus(1.25g/L).The maximum EPS production (3.2g/L) from
Bacillus cereus isolated from sludge water (Subramaniam et al.
2007) was also previously reported. The variable production of
EPS by different isolates was may be due to the bacterial
metabolic activity (Subramanian et al. 2010), genetic organization
of gene clusters, biosynthesis of sugar precursors and regulatory
elements (Nouha et al. 2016).
Carbohydrate and protein content in EPS: The carbohydrate
and protein content of EPS producing bacterial isolates were
listed in Table 2. The highest carbohydrate was found to be
present in EPS extracted from B. subtilis and the protein was
183
higher in the EPS of B. cereus. Total carbohydrate concentration

was higher than the total protein in all the extracted EPS from
the bacterial isolates which is in agreement with the previous
investigations of Shahnavaz et al. (2015) who also showed the
dominance of carbohydrate in EPS than protein. This increased
concentration of carbohydrate than protein plays a major role in
sludge settling by forming the bridges between the negatively
charged groups and divalent cations present in the sludge(Higgins
and Novack, 1997b).However, proteins also help in the floc
formation (Urbain et al. 1993) contributing to the binding
strength and stability, by hydrophobic interactions and polyvalent
cation bridging( Jorand et al. 1998).
Table 2. EPS extracted, protein ,carbohydrate content and sludge volume
index
Isolates EPS in Protein Carbohydrate Sludge

grams/L μg/ml)
(μ μg/ml)
(μ volume
index ml/g
Bacillus subtilis 0.92 40 753.75 27.78
B. megaterium 0.98 26 303.80 21.43
B. infantis 0.33 19 188.75 15.38
B. cereus 1.25 89 377.50 20.10
Pseudomonas balearica 0.6 59 476.25 16.67
P. mendocina 0.483 18 667.50 30.77
P. alcaligenes 0.53 29 71.25 23.08
Flocculation and Emulsifying activity of EPS: The flocculation

ability and emulsifying activity of seven EPS producing bacterial
isolates were analysed. The maximum flocculation percentage
observed in Bacillus cereus (40.18%) and this may be de due to
the fact that EPS with long polymeric chains holds more active
184
sites for binding when compared with the EPS produced by the
other bacterial isolates. Also the maximum flocculating ability
can be related to the highest production of EPS by the Bacillus
cereus. The higher flocculating ability has been previously reported
in Bacillus cereus isolated from biofloc culture ponds of Pacific
white leg shrimp (93%) by Ismail and Amin (2018). Bacillus
megaterium was found to have the highest emulsifying activity
(63.53%) which was probably due to the higher levels of uric
acid content in the extracted EPS of this specific isolate. This is
in agreement with the studies of Yun and Park (2003) as they
reported the polysaccharide produced by Bacillus sp. CP912 has
a greater potential to use as an emulsifier. Results from the
previous findings correlated a significant increase in the
emulsifying activity of EPS showed higher biodegradability and
lower solubility in water. Thus the glycol protein nature of the
EPS can be used as excellent emulsifying agents with various
medical and environmental applications (Cameotra and Makkar,
2004; Rosenberg and Ron, 1999).
Sludge volume index: The Sludge volume index of EPS
producing bacteria were listed in table 2. The EPS of B.infantis
showed lower sludge volume index when it is treated with sludge
water collected from Nile Tilapia biofloc culture ponds (15.38
ml/g).Sludge Volume Index was found to be below 150mL/g for
all the bacterial isolates which is required for a good sludge
settling (APHA, 2005).Similarly Subramanian et al. (2010)
isolated Pseudomonas sp from waste water sludge and proved the
ability of these bacterial strains in good sludge settling which is
in accordance with our study as Pseudomonas balearica has the
second lowest SVI followed by Bacillus infantis.
185
Fourier Transform Infra-red Analysis (FTIR): FTIR spectra

of the extracted EPS from bacterial isolates were obtained. The
peaks for Bacillus subtilis 3432.05/cm (Fig.1) , B.magaterium
3449.20/cm (Fig. 2), B. infantis 3438.42/cm, B.cereus 3450.06/
cm, Pseudomonas balearica 3453.52/cm, P. mendocina 3453.25 /
cm, and P. alcaligenes 3417.87/cm were obtained indicating
hydroxyl group from carbohydrate and water molecules present
in the EPS(Liang et al. 2010). The peaks for alkyl groups were
recorded at 2924.14/cm for Bacillus subtilis, 2924.45/cm for B.
megaterium, 2922.68/cm for B. infantis, 2925.05/cm for B. cereus,
2924.35/cm for Pseudomonas balearica, 2924.08/cm for P
mendocina, and 2924.58/cm for P. alcaligenes (Brian- Jaisson et
al. 2016).The peaks for carboxylic groups were recorded at
1647.67/cm for Bacillus subtilis, 1647.76/cm for B. megaterium,
1644.45/cm for B. infantis, 1647.86/cm for B. cereus, 1647.35/cm
for Pseudomonas balearica, 1644.95/cm for P mendocina, and
1645.20/cm for P. alcaligenes (Caruso et al., 2018).FTIR peaks
also proved the characteristic bands arising from the functional
groups present in the EPS which was also previously confirmed
from the studies of Brian - Jaisson et al. (2016). In the present
study EPS producing isolates were screened from the culture
ponds of Nile Tilapia. The various characteristics of the EPS
secreted by the isolates proved that it not only helps in the floc
and filament formation in biofloc culture ponds but also in sludge
settling as a mode of aquaculture waste water treatment.
The current study proved the presence of EPS producing
bacteria in the biofloc ponds providing the optimal environment
for the flocculation and sludge settlement. The identified isolates
can be mass cultured and deployed in the bioremediation of
186
Figure 1. FTIR spectra of the EPS from Bacillus subtilis
187
188
Figure 2. FTIR spectra of the EPS from Bacillus megaterium

aquaculture effluents. This study also elucidates the advantage of

adopting biofloc technology in aquaculture and more indepth
insights on the mechanism in the EPS formation and spatial
distribution will help for the broad range of applications in
aquaculture.
ACKNOWLEDGEMENT
This research work was part of the Project funded by the
Department of Biotechnology, Govt of India (Project code: DBT
507; PI: S.Felix).
REFERENCES
APHA. 2005.Standard Methods for the Examination of Water and
Wastewater. 21st ed., Washington, DC.
Aziz, A., Shadia, M., Hamed, H.A. and Mouafi, F.E.. 2012. Acidic
exopolysaccharideflocculant produced by the fungus
Mucorrouxiiusing beet-molasses.Research in Biotechnology 3(6):
1–13.
Brian-Jaisson, F., Molmeret, M., Fahs, A., Guentas-Dombrowsky,
L., Culioli, G., Blache, Y., Cérantola, S. and Ortalo-Magné,
A. 2016. Characterization and anti-biofilm activity of
extracellular polymeric substances produced by the marine
biofilm-forming bacterium Pseudoalteromonas ulvae strain
TC14. Biofouling 32(5): 547–60.
Brown, J.H. 1939. Bergey’s manual of determinative bacteriology.
Cain, D., Hanks, H., Weis, M., Bottoms, C. and Lawson, J. 2009.
Microbiology laboratory manual. Collin County Community
College District, McKinney, TX.
189
Cameotra, S.S, and Makkar, R.S. 2004. Recent applications of

biosurfactants as biological and immunological molecules.
Current opinion in microbiology 7(3): 262–66.
Caruso, C., Rizzo, C., Mangano, S., Poli, A., Di Donato, P., Finore,
I., Nicolaus, B., Di Marco, G., Michaud, L. and Giudice, A.L.
2018. Production and biotechnological potential of extracellular
polymeric substances from sponge-associated Antarctic
bacteria. Appl. Environ. Microbiol 84(4): 1624–17.
Donlan, R.M. 2002. Biofilms: microbial life on surfaces. Emerging
infectious diseases8(9): 881.
Dubois, M., Gilles, K.A., Hamilton, J.K., Rebers, P.T. and Smith,
F. 1956. Colorimetric method for determination of sugars and
related substances. Analytical chemistry28(3): 350–56.
Feng, D.L. and Xu, S.H. 2008. Characterization of bioflocculant
MBF3-3 produced by an isolated Bacillus sp. World Journal of
Microbiology and Biotechnology 24(9): 1627.
Flemming, H.C. and Wingender, J. 2001. Relevance of microbial
extracellular polymeric substances (EPSs)-Part II: Technical
aspects. Water Science and Technology 43(6): 9–16.
Food and Agriculture Organization of the United Nations (FAO).
2017. Cultured Aquatic Species Information Programme
Oreochromis niloticus (Linnaeus, 1758).
Green, B.W., Rawles, S.D., Schrader, K.K., Gaylord, T.G. and
McEntire, M.E. 2019. Effects of dietary protein content on
hybrid tilapia (Oreochromis aureus × O.niloticus) performance,
common microbial off-flavor compounds, and water quality
dynamics in an outdoor biofloc technology production system.
Aquaculture 503: 571–82.
190

Higgins, M.J. and Novak, J.T. 1997. Characterization of exocellular
protein and its role in bioflocculation. Journal of Environmental
Engineering 123(5): 479–85.
Hirst, C.N., Cyr, H. and Jordan, I.A. 2003. Distribution of
exopolymeric substances in the littoral sediments of an
oligotrophic lake. Microbial Ecology 46(1): 22-32.
Houghton, J.J., Quarmby, J. and Stephenson, T. 2001. Municipal
wastewater sludge dewaterability and the presence of microbial
extracellular polymer. Water Science and Technology 44(2-3):
373–79.
Hashim, N.F.C., Ghazali, N.A., Amin, N.M., Ismail, N. and Kasan,
N.A. 2018. Description of novel marine bioflocculant
producing bacteria isolated from biofloc of Pacific whiteleg
shrimp, Litopenaeus vannamei culture ponds. Bio. Rxiv.
402065.
Jorand, F., Boue-Bigne, F., Block, J.C. and Urbain, V. 1998.
Hydrophobic/hydrophilic properties of activated sludge
exopolymeric substances. Water Science and Technology 37(4-5):
307–15.
Kasan, N.A., Teh, C., Amin, M.F., Ghazali, N.A., Hashim, N.F.C.,
Ibrahim, Z. and Amin, N.M., 2016. Isolation of bioflocculant
producing bacteria from Penaeus vannamei ponds for the
production of extracellular polymeric substances. Aquaculture,
Aquarium, Conservation & Legislation-International Journal of
the Bioflux Society (AACL Bioflux) 9(6).
Kumar, C.G., Joo, H.S., Choi, J.W., Koo, Y.M. and Chang, C.S.
2004. Purification and characterization of an extracellular
polysaccharide from haloalkalophilic Bacillus sp. I-450.
Enzyme and Microbial Technology 34(7): 673–81.
191
Liang, Z., Li, W., Yang, S. and Du, P. 2010. Extraction and structural
characteristics of extracellular polymeric substances (EPS),
pellets in autotrophic nitrifying biofilm and activated sludge.
Chemosphere 81(5): 626–32.
Measurement of protein with the Folin phenol reagent. Journal
of Biological Chemistry 193(1): 265–75.
Menaga, M., Felix, S. and Charulatha, M. 2019. In vitro probiotic
properties of Bacillus sp isolated from biofloc reared genetically
improved farmed tilapia (Oreochromis niloticus). Indian Journal
of Animal Sciences 89(5): 588–93.
Mu’minah, B. and Subair, H. 2015. Isolation and screening bacterial
exopolysaccharide (EPS) from potato rhizosphere in highland
and the potential as a Producer Indole Acetic Acid (IAA).
Procedia Food Science 3: 74–81.
Nouha, K., R.D.T and R.Y.S. 2016. EPS producing microorganisms
from municipal wastewater activated sludge.
Rosenberg, E. and Ron, E.Z. 1999. High-and low-molecular-mass
microbial surfactants. Applied Microbiology and Biotechnology
52(2): 154–62.
Shahnavaz, B., Karrabi, M., Maroof, S. and Mashreghi, M. 2015.
Characterization and molecular identification of extracellular
polymeric substance (EPS) producing bacteria from activated
sludge. Journal of Cell and Molecular Research 7(2): 86–93.
Subramaniam, S.B., Yan, S., Tyagi, R.D. and Surampalli, R.Y. 2007.
Characterization of extracellular polymeric substances (EPS)
extracted from both sludge and pure bacterial strains isolated
from wastewater sludge for sludge dewatering. Water Research
12: 1–7.
192
Subramanian, S.B., Yan, S., Tyagi, R.D. and Surampalli, R.Y. 2010.
Extracellular polymeric substances (EPS) producing bacterial
strains of municipal wastewater sludge: isolation, molecular
identification, EPS characterization and performance for sludge
settling and dewatering. Water Research 44(7): 2253–66.
Sutherland, I.W. 2001. Biofilm exopolysaccharides: a strong and
sticky framework. Microbiology147(1): 3–9.
Telli, G.S., Ranzani-Paiva, M.J.T., Dias, D.C., Sussel, F.R.,
Ishikawa, C.M. and Tachibana, L. 2014. Dietary
administration of Bacillus subtilis on hematology and non
specific immunity of Nile tilapia Oreochromis niloticus raised at
different stocking densities. Fish & Shellfish Immunology 39:
305–11.
Urbain, V., Block, J.C. and Manem, J. 1993. Bioflocculation in
activated sludge: an analytic approach. Water Research 27(5):
829–38.
Yasumatsu, K., Sawada, K., Moritaka, S., Misaki, M., Toda, J., Wada,
T. and Ishii, K. 1972. Whipping and emulsifying properties of
soybean products. Agricultural and Biological Chemistry 36(5):
719–27.
Yun, U.J. and Park, H.D. 2003. Physical properties of an extracellular
polysaccharide produced by Bacillus sp. CP912. Letters in
Applied Microbiology 36(5): 282–87.
Zaki, S., Farag, S., Elreesh, G.A., Elkady, M., Nosier, M. and El
Abd, D. 2011. Characterization of bioflocculants produced by
bacteria isolated from crude petroleum oil. International Journal
of Environmental Science and Technology 8(4): 831–40.
193
EX-SITU PRODUCTION OF BIOFLOC IN IN-POND RACEWAYS AND .....
CHAPTER 8
EX-SITU PRODUCTION OF
BIOFLOC IN POND RACEWAYS
AND PHOTOBIOREACTOR
E cologically sound management techniques are getting

popular for the sustainable production of the aquatic
animals to meet the raising global food demand. Biofloc based
farming is one of the sustainable techniques where manipulation
of Carbon Nitrogen ratio in the culture system through external
application of carbon sources or lowering the protein level in the
feed stimulate the floc production process. Major deal of research
demonstrates that in-situ based biofloc culture enhances the
growth rate (Wasielesky et al., 2006; Crab et al., 2012) decreases
food conversion ratio and additional cost associated with it
(Burford et al., 2004), digestive enzymes (Xu and Pan et al.,
2013) and positive immunological responses (Kim et al., 2014;
Kumar et al., 2014).However, these in-situ based techniques
need additional oxygen demands for microbial and algal
respiration, in addition to the oxygen demand of culture animal
(Tacon et al., 2002; Burford et al., 2004). This added oxygen
195
demand requires additional aerators, which increases the aeration

costs compared to the regular aquaculture systems. Further,
consumption pattern and feeding efficacy of the biofloc depend
on the grazing efficacy of cultured species. Scientific community
recently started exploiting biofloc as a feed ingredient attributed
to its high nutritional profile. Moreover, in the present scenario
where fish meal, one of the major ingredients in aquaculture
feed becoming more expensive as capture fisheries is currently
overexploited or stagnated, urges the industry to investigate the
alternative sources of protein for aquaculture feeds.
Therefore, attempts on the partial or complete replacement
of fish meal with microbial based biofloc, a source of rich quality
protein and nutrients apart from minerals and other antioxidants
can form an excellent aquaculture feed ingredient. Dry biofloc
biomass can be harvested after treating nutrient and organic
rich farm effluents through C: N manipulation technique. Kuhn
et al.(2008) generated biofloc from fish farm effluent using a
sequencing batch reactor with carbon supplementation and with
a membrane biological reactor without carbon supplementation.
The quality and quantity of biofloc can be optimized by changing
the effluent used, bioreactor methodology and/or carbon source
and level. These systems have multiple advantages apart from
producing dry biofloc biomass as a potential source of protein in
fish or shrimp diets, recycling of effluents reduced the pressure
that effluent discharge on coastal water bodies, this alternative
feed offer the aquaculture industry a viable option to replace
costly fish meal and conventional feed ingredients by cost effective
biofloc produced from aquaculture waste materials.
196
The overall dynamic of BFT results from ecological

relationships (commensalism, competition and predation among
others) that represent a trophic micro network comprised of
rotifers, ciliates, heterotrophic bacteria and micro algae (Collazos
Lasso & Arisa-Castellaos;2015).The latter two groups tend to
be the most abundant within the biofloc community.
Biofloc production is largely being undertaken in culture
systems itself in an in-situ mode till now. For the first time an
attempt was made using appropriately designed production
systems to develop bio-floc through in-situ mode. They are,
a. In-pond Raceways
b. Photobioreactors
c. Sequence batch Reactors
The authors seek to present the state-of-the-art theory
concerning the various aspects of the activated sludge system
and to develop procedures for optimized cost-based design and
operation. An effort to treat the aquaculture effluent was made
by using in-pond raceways and Photobioreactor in the Advanced
Research Farm Facility, Madhavaram of Tamil Nadu Fisheries
University. The system used for treatment of effluents and its
efficiency depends on a number of factors including,
i. Bioreactor or Effluent Treatment Plant (ETP) design
ii. Seasonal or year-round ammoniacal discharges and its
operation in reactors
iii. Range of temperatures
iv. Desired aquaculture effluent concentration for ammonium
ions
197
v. Other effluents, water quality requirements

vi. Costs
The predominance of the activated sludge systems for the
production of biofloc meal has been consolidated, as cost efficient
and reliable biological removal of suspended solids, organic
material and macro nutrients viz. nitrogen and phosphorus has
been demonstrated using in-pond raceways and photobioreactor.
A steady state model is developed which will be extremely useful
for the optimization of the activated sludge from the aquaculture
effluents. This model describes the removal of organic material
in the activated sludge system and its consequences for the
principal parameters determining process performance on
effluent quality, excess sludge production and oxygen
consumption.
a. In-pond Raceways
The in-pond raceways are used for the biofloc production by
pumping in the culture water or ‘the used water’ from the
aquaculture systems. In this design, the aeration intensity is
maintained sufficiently to avoid sludge settling to ensure the
maintenance of uniform sludge suspension. They are
distinguished from other activated sludge variants by the fact
that they do not have a final settler or another mechanism to
retain the activated sludge. Therefore, in the in-pond raceways
the sludge age is always equal to the liquid retention time.
Although the absence of the final settler is an operational and
cost effective, the price in terms of effluent quality is high.
198
The in-pond raceways are larger compared to the

photobioreactors in treating the same organic load. The cost per
unit volume of in-pond raceways is lower because raceway
structure is built with an excavation along with the rudimentary
protection against erosion, so that the total cost can be kept
smaller. An advantage of the larger volume is that occasional
toxic loads may be diluted and hence their effect will be reduced.
Similarly, sudden organic and hydraulic overloads can be
accommodated more easily. The relative disadvantage of in-pond
raceways is that in the absence of a final settler the effluent in
principle has the same composition as the mixed effluent so that
biodegradable material and suspended solids will be discharged.
As a consequence, the effluent quality of in-pond raceways is
poor in terms of BOD, COD and TSS concentration.
For the ex-situ production of biofloc two raceways of 45 x
9 ft were designed and fabricated using galvanized iron pipes.
HDPE liner material of 500gsm was laid over frames. Shaded
raceway pond of 45 x 9 x 1.5ft of 17tonnes capacity can be used
for the production of biofloc meal to serve as an ingredient for
shrimp/fish feed. A total of 10 side frames has been fixed with
a GI pipe of ¾ inch and 1 ½ inch (Fig. 1A & 1B). The raceway
fabrication arch work is constructed with ½ inch GI pipes and
the distance between the pipes were maintained as 4.5 m. The
total raceway capacity is 30 tonnes and welding works for the
arch set up has been done to cover the entire raceways. The
roofing arch of the raceway tank is made and covered by the UV
protected HDPE liners to prevent the sunlight intrusion into
the raceway. A central partition known as baffle was provided to
ensure the circular flow of water (Fig. 2A & 2B). This lined
199
pond is usually shallow (0.25-0.4 m deep) because optical

absorption and self-shading by the algal and bacterial cells limits
light penetration. Usually, a relatively low cell density is achieved
using the raceway pond system (<1 g dry weight/L). The raceway
ponds are equipped with one hp paddle wheel aerator of two
numbers for the free circulation and the suspension of biofloc.
The flow of the culture water can be adjusted based on the
process flow of the biofloc production and harvest.
(A) (B)
Figure 1A & 1B. Raceway Tank Fabrication Works and Side Framing
(A) (B)
Figure 2A & 2B. A Inside view of the Biofloc production Raceway Ponds
200
A detachable harvest chamber has been designed to harvest

the biofloc produced in the raceways. The inlet of the harvest
chamber is connected with a outlet of raceways and collection of
biofloc meal is facilitated with the submersible pump. Excess
water drained out from the harvest chamber is taken back to the
raceways for further fertilization . The system is characterized by
the highly turbulent flow, thin layer of suspension (less than 1
cm), and high ratio of exposed surface area to total volume, and
thus can achieve dramatically higher volumetric yield (up to 40
g/L) than open ponds. However, the overall yield obtained from
this system is around 20–25 g/m2/day.
Protocol for Biofloc Production in In-pond raceways

● Used water from fish/shrimp ponds after proper screening
of toxic compounds and waste solids has to be pumped in
the raceway ponds
● Addition of inorganic fertilizers for the enrichment of culture
water to produce biofloc has to be undertaken
● Optimal C:N ratio of 20:1 is recommended for large scale
biofloc production
● Regular addition of carbon sources for the maintenance of
C:N ratio has to be monitored by taking TAN concentration
● Floc volume in the raceway ponds can be assessed by using
the Imhoff cone based on the settlement volume of floc in
1000 ml.
● After 10 days notable increase in the floc volume of more
than 30 ml per liter can be observed in ponds
● Harvesting of floc can be initiated once the floc volume
reaches above 50 ml/L.
201
● The culture water has to be pumped to the harvesting

chamber fitted with nylon mesh of different mesh size.
● On an average,5-8 kg of floc in wet weight can be harvested
per day from a 17 tonnes capacity raceway ponds.
● Generally, 50 micron mesh is recommended for harvesting
the biofloc from raceway ponds
● In general, one third of the wet floc can be obtained by
drying the harvested floc. Shade drying of biofloc will be the
easiest method for drying, however drying the wet floc in hot
air oven at 40°C for 48 hours is also recommended
● The cost of producing 1 kg of dry biofloc would be
approximately Rs. 25 to 30 based on the source of water
used for the biofloc production
b. Photobioreactor
Photobioreactor system is equipped with acrylic tubes arranged
in 4 rows and five columns at the length of 2m/tube a total of
20m length tubes (Fig 4 & 5) is fixed per unit which provides
the capacity of 100 litres/unit. The total length of bioreactor
extends to the length of 1.38m and height of 1.5m from the
ground sur face (Fig. 3). Technical specifications of the
Photobioreactor is given in the Table-1.
Motor Pump
One hp motor pump is connected between the bioreactor and
the acrylic pipe unit which provides the flow rate of 40-70LPM.
It comes with the specification of IP55 which is resistant against
the dust and water over the body of the motor pump. These
202
Figure 3. Outer view of the Biofloc production Raceways
1375 2655
2000
4000
Figure 4. Plan Layout of Photobioreactor (Aerial view)
203
204
Fig. 5. Plan Layout of the Photobioreactor (250 Liters Capacity)

pumps are capable of operating the bioreactor upto the height of

maximum of 20m in the acrylic tubes. Moreover, it runs culture
in the anti-gravity flow to maintain the culture to grow at the
optimum flow speed range. The proper illumination source with
LED lights are fixed to pass through the acrylic tubes for the
fast growth of the biofloc culture in the photo-bioreactor (Fig
6).
1500
4000
Figure 6. Elevation of Photobioreactor
Agitator
Agitator is installed and connected to the impeller shaft to provide
sufficient suspension of the culture and also to avoid the settlement
of the denser particles (Fig.7). One hp Tuple motor is installed
with an enclosed gear box in the agitator which can run upto the
maximum of 250 rpm which is resistant against the dust and
water over the body of the agitator.
Solenoid valve
A total of 3 solenoid valve (CO2, O2 and water chilling) is
installed to the photobioreactor unit. This valve can maintain the
pressure from the range of 0.3 to 10 bar. Solenoid valve is
205
connected to the PLC control system so that it can function and

maintain the culture automatically. Water cooling solenoid valve
is meant for the optimal maintenance of temperature whereas
CO2, and O2 valve is meant for maintaining the optimum pH
in the biofloc culture.
Table 1: Technical Specifications of Photobioreactor
250 L FERMENTER-TECHNICAL SPECIFICATION

VESSEL SPECIFICATION
1 Total Volume 150 Litrs and Tube Volume 100 Litrs
2 Working volume 200 Litrs
MATERIAL OF CONSTRUCTION
1 Media contact surface SS 304
2 Media non-contact surface SS 304
3 Insulation Ceramic wool insulation with SS 304
cladding
4 Oring/gasket Silicon/EPDM
SURFACE FINISH
1 Inner surface 240 grit mirror finish
2 Outer surface 180 grit satin finish
PORTS
1 Top plate ports Addition Port
Light Glass
Exhaust
Pressure gauge
Additional port
Agitator
2 Shell Top Sparger, Bypass and view glass assy
3 1/3rd Vessel Port Port for Dissolved Oxygen, pH &
Temperature
4 Vessel Bottom Outlet Port
5 Jacket Inlet & Outlet Drain
[Table Contd.
206
Contd. Table]
AGITATOR
1 Motor 1 HP
2 Gearbox 30-250 RPM
3 VFD 0.75 KW/1 HP
4 Impeller Ruston Turbin -3 Nos
5 Mechanical Seal 20 mm Single Mechanical Seal, Dry
Running
PIPE RACK
Pipe rack construction Pipe rack consist with following pipe
line, air line, exhaust line,clean steam
line, raw steam line & drain line.
CONTROL PANEL
Control panel Inbuilt with PID controller for speed.
Temperature and its transmitters
TEMPERATURE MEASUREMENT & CONTROL
1 Temperature Probe PT100
2 Temperature Range 0-150
3 Output 4-20 ma Accuracy +-0.1 C
4 Temperature controller Manual control valve to control
fermentation. Temperature and
sterilization process
SPEED MEASUREMENT & CONTROL
1 Drive Variable frequency drive 1 HP AC
2 Input 230V, Single phase, 50 HZ
3 Output 230V, Single Phase, 0-100 HZ
4 Display Digital indicator for speed
Rotometer
Rotometer functions to adjust the pressure (LPM) of atmospheric
air inside the bioreactor and can be managed with the operation
of control valve.
207
Figure 7. Isometric View of Photobioreactor
Illumination
Photo-bioreactor can utilize the source of both solar and the
artificial light source. Supply of light to the photobioreactor can
be maintained continuously by integrating artificial solar light
devices. A range of 8000 illuminous is provided to the bioreactor
to optimize the growth of the culture (Fig. 8A).
PLC Control
Total working function of the bioreactor can be observed in the
display and can be controlled automatically. A total of 10 plugins
are connected accordingly for various operating functions of the
photobioreactor. Data can be archived in the PLC system and
can be utilized further when required (Fig. 8B).
208
(A) (B)
Figure 8A & 8B. Illuminated Photo Bioreactor & PLC system
Housing of Photobioreactor Unit

The total spacing area of photobioreactor is 6.1×9.1 m. A total
of 12 GI pipes with a height of 3.66m and in that 0.6m is fixed
inside the ground with concrete mix to make the basement of
the roof strong. A total of 5 runners were placed in the arch.
Arch’s GI pipes have the thickness of ½ inch too. Two doors are
fixed in the photobioreactor construction one in the front side
and the other in the back side. Side GI pipes are placed at a
distance of 3m each and the front door pipes are placed with a
distance of 2.4m on the side and 1.22m at the centre. MS metal
is fixed on the sides of the photobioreactorto provide the required
support.
209
Protocol for Biofloc Production in Photobioreactor

● Nitrogen sources are mainly nitrate and ammonia obtained
from culture water and carbon source used are CO2, HCO3-
or organic carbon, like acetate or glucose.
● The air stripping technique is applied to remove total nitrogen
and total phosphorus from the aquaculture effluents before
inoculating into the photobioreactor.
● After the purification of the pollutants, pure culture of biofloc
is inoculated along with growth medium. Gas mixture is
supplied to the photobioreactor using sparger and air flow
rate and CO2 flow rate has to be adjusted on the pH of the
media.
● The culture is circulated through the tubes by an airlift pump
or other suitable low-shear mechanism. The maximum flow
rate is limited by the tolerance of the algae to hydrodynamic
stress. The flow velocity is usually 0.3–0.5 m s–1.
● Physical parameters such as pH, ORP, DO and temperature
have to be monitored throughout the culture process. A PLC
8.5 software has been used to acquire the data from the
transmitters and record the data.
● The biomass measurement can be recorded for every 12
hours and a volumetric pipette can be used to withdraw 100
ml sample from the growing media. Then the average biomass
on a daily basis can be calculated to compare the values with
the 13L reactor.
● Biofloc biomass can then be separated using vacuum filtration
equipment and the concentrated biomass can be collected
using Whatman filter paper (number 4) with a diameter of
40mm and the pore size of 20-25m.
210
● The biomass collected on the filter paper can be weighed

and dried in hotair oven at 70 to 80°C for 10 hours to dry
the biomass. The oven dried biomass can be used as an
ingredient for the fish/shrimp feed.
Use of photobioreactor and in-pond raceway for the
production of biofloc is considerably a new approach in
aquaculture. The importance of this approach lies in replacement
of conventional ingredients in fish feed as well as for the
upkeepment of environment. The designs discussed for the ex-
situ biofloc production can serve as a model which clearly brings
out the advantage of incorporation of biofloc meal in fish/shrimp
feeds. The operational experience with the new systems being
built with this configuration will allow continuous progress in
the knowledge of design criteria and parameters to be used in
the ex-situ biofloc production.
A comparison of advantages and disadvantages of In-pond
raceways and Photobioreactor is presented in the Table 2.
Table 2
Factors In-Pond Photo-

Raceways bioreactor
Capital cost Smaller Larger
Difficulty in terminating nitrification Greater Smaller
Operational costs Smaller Greater
Operational problems Smaller Greater
Process control equipment Smaller Greater
Sludge production Smaller Greater
Susceptibility to changes in BOD load Greater Smaller
Susceptibility to changes in toxic load Greater Smaller
211
References
Burford, M.A., Thompson, P.J., McIntosh, R.P., Bauman, R.H.
and Pearson, D.C. 2004. The contribution of flocculated material
to shrimp (Litopenaeus vannamei) nutrition in a high-intensity,
zero-exchange system. Aquaculture 232: 525–537.
Collazos-Lasso, L.F. and Arias-Castellanos, J.A. 2015.
Fundamentos de la tecnología biofloc (BFT). Una alternativa
para la piscicultura en Colombia. Revisión Orinoquia, 19: 77–
86.
Crab, R., Defoirdt, T., Bossier, P. and Verstraete, W. 2012. Biofloc
technology in aquaculture: Beneficial effects and future
challenges. Aquaculture, 356: 351–356.
Kumar, S., Anand, P.S.S., De, D., Sundaray, J.K., Raja, R.A., Biswas,
G., Ponniah, A.G., Ghoshal, T.K., Deo, AD, Panigrahi, A.,
and Muralidhar, M. 2014 Effects of carbohydrate
supplementation on water quality, microbial dynamics and
growth performance of giant tiger prawn (Penaeus monodon).
Aquac Int 22: 901–912
Kuhn, D.D., Boardman, G.D., Craig, S.R., Flick, G.J. and Mclean,
E. 2008. Use of microbial flocs generated from tilapia effluent
as a nutritional supplement for shrimp, Litopenaeus vannamei,
in recirculating aquaculture systems. J. World Aquacult. Soc.
39, 72–82.
Kim, S.K., Pang, Z., Seo, H.-C., Cho, Y.R., Samocha, T. and Jang,
I.K. 2014. Effect of bioflocs on growth and immune activity of
Pacific white shrimp, Litopenaeus vannamei post larvae,
Aquac.Res.45, 362-371.
Tacon, A., Cody, J.J., Conquest, L.D., Divakaran, S., Forster, I.P.,
Decamp, O.E. 2002. Effect of culture system on the nutrition
and growth performance of Pacific white shrimp, Litopenaeus
212
vannamei (Boone) fed different diets. Aquacult. Nutr. 8: 121–

137.
Wasielesky,W., Atwood, H., Stokes, A. and Browdy, C.L., 2006.
Effect of natural production in a zero exchange suspended
microbial floc based super-intensive culture system for white
shrimp Litopenaeus vannamei. Aquaculture 258: 396–403.
Xu, W.J. and Pan, L.Q. 2013 Enhancement of immune response
and antioxidant status of Litopenaeus vannamei juvenile in
biofloc-based culture tanks manipulating high C/N ratio of
feed input. Aquaculture 412: 117–124.
213

Applied Aquaculture Biofloc Technology

Uploaded by

Copyright:

Available Formats

Applied Aquaculture Biofloc Technology

Uploaded by

Document Information

Original Description:

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Applied Aquaculture Biofloc Technology

Uploaded by

Copyright:

Available Formats

APPLIED AQUACULTURE

Prof. S. Felix has 38 years of teaching and research experience in aquaculture.

NARENDRA PUBLISHING HOUSE

1. Applied Aquaculture Biofloc Technology...................................... 1

2. In-situ and Ex-situ Biofloc on Immune Response of

3. Fertilization Prototype on Biofloc Development in

4. Distillary Spent Wash as a Carbon Source in Intensive Biofloc

5. In-vivo Study of Bacillus sp Isolated from Biofloc System

6. Probiotic Potential of Bacillus Strains of Biofloc System

7. Extra Cellular Polymer Substances (EPS) Producing Bacteria

8 Ex-situ Production of Biofloc in In-Pond Raceways and

T he expansion of the aquaculture production is restricted

APPLIED AQUACULTURE BIOFLOC

A quaculture as a food-producing sector is recognized for its

maintaining an ideal water quality (Felix et al., 2015). The use

DIFFERENT TYPES OF BIOFLOC SYSTEMS

McIntosh (2001) reported the biofloc types based on the colour

In-situ and Ex-situ Culture in Biofloc Technology

food. Avnimelech (1999) found 20% reduction in feed

sequential batch reactors, these biofloc meal were used as

technology is converted into microbial protein through the external

bacterial products, nutritional factors, cytokines, lectins and plant

BIOFLOC ON PROBIOTIC EFFECT

antibacterial activity similar to organic acids and short chain

BIOFLOC ON WATER QUALITY

Invitro Probiotic Properties

using different external carbohydrate sources or by using low

Polyhydroxy Butyrate (PHB) Producing Bacteria in

Extracellular Polysaccharides (EPS) Producing Bacteria

can interact with EPS, a synthetic polymers in combination with

Craig, S., Helfrich, L.A., 2002. Understanding Fish Nutrition, Feeds

franciscana from pathogenic Vibrio campbelli. Environmental

Hargreaves, J.A., 2013. Biofloc production systems for aquaculture.1­

Pacific white shrimp Litopenaeus vannamei. Aquacult. Nutr.12,

Kuhn, D.D., Boardman, G.D., Lawrence, A.L., Marsh, L., Flick,

Naylor, R.L., Goldburg, R.J., Primavera, J.H., Kautsky, N., Beveridge,

IN-SITU AND EX-SITU BIOFLOC ON

T he present study is aimed to investigate the effect of biofloc

experiment. The immunological (Serum protein, Respiratory

(Bhera et al., 2018). The most distinct characteristic traits of this

25 to 50 percent of protein and 0.5 to 15 percent of fat on a dry-

Farm Tilapia (GIFT) strain has been developed using eight

Table 1: Proximate composition of biofloc

Nutritional Parameters Composition (%)

Organic matter (OM) = 100- Ash

Table 2: Formulation and proximate composition of the diets used in the

Ingredients (%) Control (C) In-situ (T1) Ex-situ (T2)

Ingredients (%) Control (C) In-situ (T1) Ex-situ (T2)

ratio of 10:1. The addition of carbon source to maintain the

10:1 for the development of biofloc and addition of urea for

Experimental Diets used in the Trial

Water Quality Parameters

Immunological Parameters and Antioxidant Indicators

● Weight gain (WG in g) = Final weight- Initial weight

IN-SITU AND EX-SITU BIOFLOC ON IMMUNE RESPONSE OF GIFT TILAPIA

Water quality, growth, survival, immunological parameters,

RESULTS AND CONCLUSIONS

Immunological and Antioxidant Indicators

APPLIED AQUACULTURE BIOFLOC TECHNOLOGY

Hargreaves, J.A., 2013. Biofloc production systems for aquaculture.1