General Biology 2 TG

The Commission on Higher Education
in collaboration with the Philippine Normal University
DEPED
COPY
Teaching Guide
for Senior High
School
GENERAL
BIOLOGY 2
CORE SUBJECT
This Teaching Guide was collaboratively developed and reviewed by
educators from public and private schools, colleges, and universities. We
encourage teachers and other education stakeholders to email their
feedback, comments, and recommendations to the Commission on Higher
Education, K to 12 Transition Program Management Unit - Senior High School
Support Team at [email protected]. We value your feedback and
recommendations.
This Teaching Guide is a donation by CHED to DepEd. It is for reference purposes only.
Development Team
Team Leader: Ivan Marcelo A. Duka
Writers: Neil Andrew B. Bascos, Ph.D., Ma.
Genaleen Q. Diaz, Ph.D., Ian Kendrich C. Fontanilla,
Ph.D., Ma. Carmina C. Manuel, Ph.D., Sharon Rose
M. Tabugo, Ph.D., Eugenio P. Quijano Jr.
DEPED COPY
Technical Editors: Annalee S. Hadsall, Ph.D.
This Teaching Guide by the Commission on Higher Education is licensed under a Creative
Commons Attribution
NonCommercial-ShareAlike 4.0
Published by the Commission on Higher Consultants Bienvenido F. Nebres, S.J., Ph.D., Ateneo de Manila
Education, 2016 Chairperson: Patricia B. THIS PROJECT WAS DEVELOPED WITH THE PHILIPPINE NORMAL University Carmela C. Oracion, Ph.D., Ateneo de Manila
Licuanan, Ph.D. UNIVERSITY. University President: Ester B. Ogena, Ph.D. University Minella C. Alarcon, Ph.D., CHED
Commission on Higher Education VP for Academics: Ma. Antoinette C. Montealegre, Ph.D. VP Gareth Price, Sheffield Hallam University
K to 12 Transition Program Management Unit for University Relations & Advancement: Rosemarievic V. Stuart Bevins, Ph.D., Sheffield Hallam University
Office Address: 4th Floor, Commission on Higher Education, Diaz, Ph.D. Copy Reader: Caroline H. Pajaron
C.P. Garcia Ave., Diliman, Quezon City Ma. Cynthia Rose B. Bautista, Ph.D., CHED Illustrator: Ma. Daniella Louise F. Borrero Cover Artists:
Telefax: (02) 441-0927 / E-mail Address: [email protected]
Paolo Kurtis N. Tan, Renan U. Ortiz John Carlo P. Fernando, Danie Son D. Gonzalvo Share — copy and redistribute the material in any medium or format
Adapt — remix, transform, and build upon the material.
Teacher Training Officers: The licensor, CHED, cannot revoke these freedoms as long as you
Ma. Theresa C. Carlos, Mylene E. Dones follow the license terms. However, under the following terms:
Senior High School Support Team
CHED K to 12 Transition Program Management Unit Monitoring and Evaluation Officer: Attribution — You must give appropriate credit, provide a link to
the license, and indicate if changes were made. You may do so in
Program Director: Karol Mark R. Yee Robert Adrian N. Daulat
any reasonable manner, but not in any way that suggests the
Administrative Officers: licensor endorses you or your use.
Lead for Senior High School Support:
Ma. Leana Paula B. Bato, Kevin Ross D. Nera, Allison A. NonCommercial — You may not use the material for commercial
Gerson M. Abesamis
purposes.
Danao, Ayhen Loisse B. Dalena
Lead for Policy Advocacy and Communications: Averill M. ShareAlike — If you remix,
Printed in the Philippines by EC-TEC Commercial, No. 32 St. Louis transform, or build upon the material, you must distribute your
Pizarro
Compound 7, Baesa, Quezon City, [email protected] contributions under the same license as the original.
Course Development Officers: International License. This means you are free to:
Table of Contents
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ii Chapter 3: Systematics Based on Evolutionary Relationships DepEd General Biology 2
Curriculum Guide . . . . . . . . . . . . . vi Lesson 14: Systematics Based on Evolutionary Relationships: Chapter 1: Genetics Tree of Life and
Systematics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 109
DEPED COPY
L .
e .
s .
s .
o .
n .
.
1 .
: .
P .
e .
d .
i .
g .
r .
e .
e .
.
A .
n .
a .
l .
y .
s .
i .
s .
.
1 i
o
n
L
e .
s
s .
o
n .
2 .
:
.
S
e .
x
.
L
i .
n
k .
a
g .
e
.
a
n .
d
.
R
e .
c
o .
m
b .
i
n 8
a
t
L at
es io
s s
o ..
n ..
3: ..
M ..
o .
di 1
fi 3
c L
at e
s
io
s
n o
s n
4
to
:
M M
e o
l
n e
d c
u
el
l
’s a
C r
S
la
t
ss r
ic u
c
R
t L
u e
r s
e
s
o
f o
D n
N 6
A :
,
G
R
e
N
A n
, e
a t
n i
d
c
P
r E
o n
t g
e i
i
n
n
e
s
. e
. r
. i
1 n
9
g
24 .
Lesson 5: DNA Replication and Protein Synthesis . . . . . . . . . .
.
.
.
.
. .
. .
. .
. .
. .
. 3
. 0
. Lesson 15: Systematics Based on Evolutionary Relationships:
.
Taxonomy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 117 Lesson 16:
.
. Systematics Based on Evolutionary Relationships:
. Cladistics and Phylogeny . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 129 Chapter 4:

.
Compare and Contrast Processes in Plants and Animals
.
. Lesson 17: Reproduction and Development . . . . . . . . . . . . . . . . . 136
Lesson 7: Discuss the Applications of Recombinant DNA . . . . 36 Lesson 18: Nutrition . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 158 Chapter 2: Evolution
and Origin of Biodiversity Lesson 19: Gas Exchange . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 179 Lesson 8: History of Life on
Earth . . . . . . . . . . . . . . . . . . . . . . . 49 Lesson 20: Transport and Circulation . . . . . . . . . . . . . . . . . . . . . . 190 Lesson 9: Mechanisms that Produce Change in
Populations . . 70 Lesson 21: Regulation of Body Fluids . . . . . . . . . . . . . . . . . . . . . . 194
Lesson 10: Evolution and Origin of Biodiversity: Lesson 22: Immune Systems . . . . . . . . . . . . . . . . . . . . . . Control . . . . . . . . . . . . . . . . .
Patterns of Descent with Modification . . . . . . . . . . . . . . . . . . . . . Lesson 23: Chemical and Nervous 204 214
. . . . . . . . . . . . . . . 81
Lesson 11: Development of Evolutionary Thought . . . . . . . . . 87 Lesson 24: Sensory and Motor Mechanisms . . . . . . . . . . . . . . . . . 226 Lesson 12: Evidences
of Evolution . . . . . . . . . . . . . . . . . . . . . . 92 Lesson 25: Feedback Mechanisms . . . . . . . . . . . . . . . . . . . . . . . . 235 Lesson 13: Infer Evolutionary Relationships
of Organisms . . . . 102 Colored Images . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 249 Biographical Notes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
257
i
Introduction
As the Commission supports DepEd’s implementation of Senior High School (SHS), it upholds the vision and
mission of the K to 12 program, stated in Section 2 of Republic Act 10533, or the Enhanced Basic
DEPED COPY
Education Act of 2013, that “every graduate of basic education be an empowered individual, through a
program rooted on...the competence to engage in work and be productive, the ability to coexist in
fruitful harmony with local and global communities, the capability to engage in creative and critical
thinking, and the capacity and willingness to transform others and oneself.”
To accomplish this, the Commission partnered with the Philippine Normal University (PNU), the National Center
for Teacher Education, to develop Teaching Guides for Courses of SHS. Together with PNU, this
Teaching Guide was studied and reviewed by education and pedagogy experts, and was enhanced with appropriate
methodologies and strategies.
Furthermore, the Commission believes that teachers are the most important partners in attaining this
goal. Incorporated in this Teaching Guide is a framework that will guide them in creating lessons and
assessment tools, support them in facilitating activities and questions, and assist them towards deeper
content areas and competencies. Thus, the introduction of the SHS for SHS Framework.
SHS for SHS Framework High School,” is at the core of this book. The lessons, which combine high-quality
content with flexible elements to accommodate diversity of teachers and
The SHS for SHS Framework, which stands for “Saysay-Husay-Sarili for Senior
environments, promote these three fundamental concepts:
SAYSAY: MEANING HUSAY: MASTERY synthesize knowledge.

Why is this important? How will I deeply understand this? Given that SARILI: OWNERSHIP What can I do
Through this Teaching Guide, teachers will be able to developing mastery goes beyond memorization, with this? When teachers empower
facilitate an understanding of the value of the lessons, teachers should also aim for deep understanding of learners to take ownership of their learning, they
for each learner to fully engage in the content on both the subject matter where they lead learners to analyze develop independence and self direction, learning
the cognitive and affective levels. and about both the subject matter and themselves.
designed to be highly usable for teachers. It contains classroom activities and

Parts of the pedagogical notes, and is integrated with innovative pedagogies. All of these
Teaching Guide elements are presented in the following parts: 1. Introduction
This Teaching Guide is mapped and aligned to the DepEd SHS Curriculum, • Highlight key concepts and identify the essential questions
• Show the big picture
DEPED COPY
• Connect and/or review prerequisite knowledge
• Clearly communicate learning competencies and objectives
• Motivate through applications and connections to real-life
2. Motivation
• Give local examples and applications
• Engage in a game or movement activity
• Provide a hands-on/laboratory activity
• Connect to a real-life problem
3. Instruction/Delivery
• Give a demonstration/lecture/simulation/hands-on activity
• Show step-by-step solutions to sample problems
• Give applications of the theory
• Connect to a real-life problem if applicable
4. Practice
• Discuss worked-out examples
• Provide easy-medium-hard questions
• Give time for hands-on unguided classroom work and discovery
• Use formative assessment to give feedback
5. Enrichment
• Provide additional examples and applications
• Introduce extensions or generalisations of concepts
• Engage in reflection questions
• Encourage analysis through higher order thinking prompts
6. Evaluation
• Supply a diverse question bank for written work and exercises
• Provide alternative formats for student work: written homework, journal, portfolio, group/individual projects,
student-directed research project
On DepEd Functional Skills and CHED College Readiness Standards
As Higher Education Institutions (HEIs) welcome the graduates of the Senior that consist of the combination of knowledge, skills, and reflective thinking
High School program, it is of paramount importance to align Functional Skills necessary to participate and succeed - without remediation - in entry-level
set by DepEd with the College Readiness Standards stated by CHED. undergraduate courses in
On the other hand, the Commission declared the College Readiness Standards
DEPED COPY
The DepEd articulated a set of 21st century skills that should be embedded in the college.
SHS curriculum across various subjects and tracks. These skills are desired The alignment of both standards, shown below, is also presented in this Teaching
outcomes that K to 12 graduates should possess in order to proceed to either Guide - prepares Senior High School graduates to the revised college curriculum
higher education, employment, entrepreneurship, or middle-level skills which will initially be implemented by AY 2018-2019.
development.
College Readiness Standards Foundational Skills DepEd Functional Skills
Produce all forms of texts (written, oral, visual, digital) based on:
1. Solid grounding on Philippine experience and culture;
2. An understanding of the self, community, and nation; Interact meaningfully in a social setting and contribute to the fulfilment of individual and
3. Application of critical and creative thinking and doing processes; 4. Competency in shared goals, respecting the fundamental humanity of all persons and the diversity of groups
formulating ideas/arguments logically, scientifically, and creatively; and 5. Clear and communities
appreciation of one’s responsibility as a citizen of a multicultural Philippines and a diverse
world;
Systematically apply knowledge, understanding, theory, and skills for the development of
the self, local, and global communities using prior learning, inquiry, and experimentation
Work comfortably with relevant technologies and develop adaptations and innovations for
significant use in local and global communities
Communicate with local and global communities with proficiency, orally, in writing, and
through new technologies of communication
v Global awareness, media literacy, technological literacy, creativity, flexibility and adaptability,
Visual and information literacies, media literacy, critical thinking and problem solving skills, productivity and accountability
creativity, initiative and self-direction
Global awareness, multicultural literacy, collaboration and interpersonal skills, social and cross-
cultural skills, leadership and responsibility
Media literacy, multicultural literacy, global awareness, collaboration and interpersonal skills, social
Global awareness, scientific and economic literacy, curiosity, critical thinking and problem solving and cross-cultural skills, leadership and responsibility, ethical, moral, and spiritual values
skills, risk taking, flexibility and adaptability, initiative and self-direction
K to 12 BASIC EDUCATION CURRICULUM
SENIOR HIGH SCHOOL – SCIENCE, TECHNOLOGY, ENGINEERING AND MATHEMATICS (STEM) SPECIALIZED SUBJECT
Grade: Grade 11/12 Quarters: 3rd to 4th Quarter Subject Title: Biology 2 I No. of Hours: 40 hours/10 Weeks per Quarter
Subject Description: This subject is designed to enhance the understanding of the principles and concepts in the study of biology, particularly heredity and variation, and the
diversity of living organisms, their structure, function, and evolution.
CONTENT CONTENT STANDARD PERFORMANCE STANDARD LEARNING COMPETENCIES CODE
Organismal The learners The learners shall be able to: STEM_BIO11/12-

Biology demonstrate an IVa-h-1
understanding of: develop a presentation (e.g.
PY
role-playing, dramatization
1. Plant and Animal and other forms of
Organ Systems and multimedia) to show how an
their Functions organism
maintains homeostasis
through the interaction of the The learners:
various organ systems in the
body 1. compare and contrast the following processes in plants
and animals: reproduction, development, nutrition, gas
exchange, transport/circulation, regulation of body
fluids, chemical and nervous control, immune systems,
and sensory and motor mechanisms
O
2. Feedback Mechanisms STEM_BIO11/12-
IVi-j-2
2. explain how some organisms maintain steady
internal
conditions that possess various structures and
processes
C
STEM_BIO11/12-
IVi-j-3
3. describe examples of homeostasis (e.g.,
temperature
regulation, osmotic balance and glucose levels) and the

major features of feedback loops that produce such
homeostasis
D
Genetics 1. Mendel’s Laws of STEM_BIO11/12-
Inheritance IIIa-b-1
2. Sex Linkage
DEPE
3. Central Dogma of 1. predict genotypes and phenotypes of parents and
Molecular Biology
4. Recombinant DNA 1. offspring using the laws of inheritance
2. explain sex linkage and recombination STEM_BIO11/12-

make a pedigree analysis in IIIa-b-2
the learner’s family using 3. describe modifications to Mendel’s classic ratios (gene STEM_BIO11/12-
a simple genetic trait interaction) IIIa-b-3
2. make a research paper/case 4. illustrate the molecular structure of DNA, RNA, and STEM_BIO11/12-
study/poster on genetic proteins IIIa-b-4
diseases
5. diagram the steps in DNA replication and protein STEM_BIO11/12-
3. make a diagram (e.g., synthesis IIIa-b-5
pictogram, poster)
showing the evolution of 6. outline the processes involved in genetic engineering STEM_BIO11/12-
a IIIa-b-6
domesticated crop
7. discuss the applications of recombinant DNA STEM_BIO11/12-
4. differentiate the 3-Domain IIIa-b-7
Scheme from the 5-
Kingdom Scheme of
classification of living
things
K to 12 Senior High School STEM Specialized Subject – General Biology 2 December 2013 Page 1 of 3
CONTENT CONTENT STANDARD PERFORMANCE STANDARD LEARNING COMPETENCIES CODE
D
Evolution Relevance, 1. describe general features of the history of life on Earth, STEM_BIO11/12-
and Origin Mechanisms, including generally accepted dates and sequence of the IIIc-g-8
of Evidence/Bases, and geologic time scale and characteristics of major groups of
Biodiversity Theories of Evolution organisms present during these time periods
STEM_BIO11/12-
IIIc-g-9
PY
2. explain the mechanisms that produce change in
populations from generation to generation (e.g.,
artificial selection, natural selection, genetic drift,
mutation, recombination)
O
STEM_BIO11/12-
IIIc-g-10
3. show patterns of descent with modification from
common ancestors to produce the organismal diversity

observed today
C
STEM_BIO11/12-
IIIc-g-11
4. trace the development of evolutionary thought
5. explain evidences of evolution (e.g., biogeography, STEM_BIO11/12-

IIIc-g-12
fossil record, DNA/protein sequences, homology, and
embryology)
6. infer evolutionary relationships among organisms using the STEM_BIO11/12-

evidence of evolution IIIc-g-13
Systematic Basic Taxonomic Concepts 1. explain how the structural and developmental STEM_BIO11/12III
s Based and Principles, characteristics and relatedness of DNA sequences are h j-14
on Description, used in classifying living things
Evolutionar Nomenclature,
y Identification, and 2. identify the unique/distinctive characteristics of a STEM_BIO11/12III
specific taxon relative to other taxa h j-15
Relationship Classification 3. describe species diversity and cladistics, including the STEM_BIO11/12III
s types of evidence and procedures that can be used to h j-16
establish evolutionary relationships
DEPE
K to 12 Senior High School STEM Specialized Subject – General Biology 2 December 2013 Page 2 of 3 This Teaching Guide is a donation by CHED to DepEd. It is for reference purposes only.
Code Book Legend
Sample: STEM_BIO11/12IIIh-j-16
Y
LEGEND
SAMPLE
P
First Entry Learning Area and Strand/ Subject or STEM_BIO11/12
Specialization
Science, Technology, Engineering and

Mathematics
O
Grade Level
Grade 11 or 12
C
Uppercase Letter/s General Biology
Domain/Content/
Component/ Topic
D
-
E
Roman Numeral Third Quarter III
*Zero if no specific quarter
Quarter
P
Lowercase Letter/s Weeks eight to ten h-j
*Put a hyphen (-) in between letters to indicate
more than a specific week
Week
E
-
D
Arabic Number describe species diversity and cladistics, 16
including the types of evidence and
procedures that can be used to establish
Competency evolutionary relationships
K to 12 Senior High School STEM Specialized Subject – General Biology 2 December 2013 Page 3 of 3
SUGGESTED ACADEMIC TRACK – SCIENCE, TECHNOLOGY, ENGINEERING AND MATHEMATICS (STEM) STRAND SCHEDULING OF SUBJECTS*
Grade 11 Grade 12
1st Semester 2nd Semester 1st Semester 2nd Semester

21st Century Literature from the
Oral Communication in Context Reading and Writing Skills Physical Education and Health
Philippines and the World
Komunikasyon at Pananaliksik Pagbasa at Pagsusuri ng Iba’t-Ibang Contemporary Philippine Arts from

sa Wika at Kulturang Pilipino Teksto Tungo sa Pananaliksik the Regions
General Mathematics Statistics and Probability Media and Information Literacy

Y
Earth Science Disaster Readiness and Risk
Reduction
Understanding Culture,
Society and
Politics
P
Introduction to the Philosophy of Personal Development /
the Human Person / Pambungad sa Pansariling Kaunlaran
Pilosopiya ng Tao
Physical Education and
Health
O
Physical Education and Health Physical Education and Research in Daily Life 2
Empowerment Technologies (E
Health Research in Daily Life
Tech): ICT for Professional Tracks English for Academic
1
and
Professional Purposes
C
Entrepreneurship
D
Pre-Calculus Pagsulat sa Filipino sa Piling Research Project
Larangan (Akademik)
General Physics 2
Basic Calculus General Physics 1
E
General Biology 1 General Biology 2
General Chemistry 1
General Chemistry 2
Research/Capstone Project
EP
5.8 6.6 6.6 5.8
STEM
I
S
T
J
X
B
E
I
C
S
HOURS
PER DAY
D
Please note that some subjects have prerequisites. These are indicated in the Curriculum Guides and are listed below for easy referral.
SUBJECT PREREQUISITE/S
Research in Daily Life 2 Statistics and Probability
Basic Calculus Pre-Calculus
General Biology 2 General Biology 1
General Chemistry 2 General Chemistry 1
General Physics 1 Pre-Calculus, Calculus
General Physics 2 General Physics 1
K to 12 Senior High School Science, Engineering, Technology and Mathematics Strand Scheduling * 80 hours per subject This Teaching Guide is a donation by CHED to DepEd. It is for reference purposes only.
General Biology 2
Analysis
Lesson 1: Pedigree 60 MINS
Content Standard
DEPED COPY
The learners understand Mendel’s Laws of Inheritance. • identify the mode of inheritance of a particular trait given the pedigree; • predict
Performance Standard the genotypes of parents; and
The learners shall be able to: • compute the probability of occurrence of an affected offspring in a given cross.
LESSON OUTLINE Instruction Recall in Mendelian Ratios, Discussion
40
Introduction Communicating Learning Objectives and
5on Co-Dominance and Multiple Alleles
Relevant Vocabulary Practice Group Work: Non-Mendelian Traits in
• make a Pedigree Analysis in the learner’s family using a simple genetic trait. 40
Motivation Narrative 5 Humans, Plants, and Animals
Learning Competency Materials
The learners shall be able to construct pedigrees and predict genotypes based on Pen, paper, and ruler
pedigree analysis (STEM_BIO11/12-IIIa-b-1)
Resources
Specific Learning Outcomes: (1) Klug WS, Cummings MR, Spencer CA, Palladino MA.
At the end of the lesson, the learners will be able to:
2012. Essentials of genetics. 8th ed. Benjamin Cummings;
2012. 624 p.
(2) Reece JB, Urry LA, Cain ML, Wasserman SA, Minorsky PV,
Jackson RB. 2012. Campbell biology, 9th ed. The
Benjamin Cummings Publishing Co., Inc: 2012. 1464 p.
(3) Bennett RL, Steinhaus KA, Uhrich SB, O’Sullivan CK, Resta
RG, Lochner-Doyle D, Markel DS, Vincent V, Hamanishi J.
Recommendations for standardized human pedigree
nomenclature. Am J Human Genet. 1995; 56:745-752.
INTRODUCTION (5 MINS)
1. Cite the learning objectives, which are as follows:
I. identify the mode of inheritance of a particular trait given the pedigree II.
predict the genotypes of parents
III. predict the probability of having an affected offspring
2. Relevant vocabulary
I. Pedigree. Making use of diagrams showing the ancestral relationships and

DEPED COPY
2
transmission of genetic traits over several generations in a family Teacher Tip:
Tell the learners that they have to use a letter in which the uppercase and lowercase versions are easy
II. Proband. The individual in the pedigree that led to the construction of the to distinguish using cursive to avoid confusion.
pedigree. For example, a couple consults a medical geneticist because they have an
offspring who is afflicted with a disease and they want to find out the mode of
transmission of this disease. When the medical geneticist constructs the pedigree,
Ask learners to recall their lessons in classical genetics in their previous grade levels.
the offspring will be labeled as the proband. Through the pedigree, the probability
of having other affected children may be determined.
III. Law of Segregation (1st Mendelian Law). For every trait governed by a pair of
alleles, these alleles segregate or separate during gamete formation in meiosis IV.
Law of Independent Assortment (2nd Mendelian Law). A pair of alleles for one trait
will segregate or separate independently of another pair of alleles for another trait
during meiosis
V. Autosomal trait. A trait whose alleles that control it are found in the autosomes
(body chromosomes/ non-sex chromosomes)
VI. Genotype. The gene pair an individual carries for a particular trait symbolized
with a pair of letters. By convention, uppercase letter (eg. A) for a dominant allele
and lowercase letter (eg. a) for the recessive allele. Any letter in the alphabet may
be used
A. For a diploid organism with two alleles in a given gene pair, genotypes may be
written as:
i. Homozygous dominant, i.e. with two dominant alleles (DD)
ii. Heterozygous, i.e. with a dominant and recessive allele (Dd). The individual will
show the dominant phenotype.
iii. Homozygous recessive, i.e. with two recessive alleles (dd)
VII. Phenotype i. Dominant. A trait that requires at least one dominant allele for the trait to be
A. The observable trait of an individual based on its genotype. Examples: red flower, expressed, e.g. Dd
curly hair, blood types ( i.e. the blood type is the phenotype) Teacher Tip:
Note that the phenotype is determined by the genotype. In complete dominance, RR- red flower; rr-
B. For a typical Mendelian trait, phenotypes may either be: white flower; but Rr will express the red flower condition because one dominant allele is enough for
the dominant trait to be expressed in the organism.
DEPED COPY
ii. Recessive. A trait that requires two recessive alleles for the trait to be expressed
VIII.Phenocopy. A trait that is expressed due to specific environmental conditions (i.e. having hair that
is dyed of a different color) and is not due to the genotype.
IX. Identical twins. Also known as monozygotic twins, which are derived from a single
fertilization event. After the first cleavage or cell division of the zygote, the cells or
blastomeres separate and become independent blastocysts implanted in the mother’s uterus.
X. Fraternal twins. Twins that are derived from separate fertilization events (two eggs fertilized by two
sperms) within the fallopian tube, resulting in two separate zygotes; also known as dizygotic twins
REVIEW (15 MINS) phenotypic ratios by filling out a table (see table 1 at the end of this document)
1. Ask the learners to recall Mendelian Laws of Inheritance 4. In a monohybrid cross and assuming complete dominance, the ratio of the F2
st
I. Law of Segregation (1 Mendelian Law) progenies may be predicted as 3:1, i.e. 3 with the dominant trait and 1 with the
recessive trait. 5. In a dihybrid cross and assuming complete dominance, the ratio of
II. Law of Independent Assortment (2nd Mendelian Law)
the F2 progenies may be predicted as 9:3:3:1.
2. Ask the learners to define genotypes and phenotypes, dominant and recessive
Teacher Tip:
traits, homozygous and heterozygous dominants as well as homozygous recessive The learners should be able to predict correctly the Mendelian ratios without having to use a Punnett
3. Ask the learners to review the classic monohybrid Mendelian F2 genotypic and square. They should be able to solve for probabilities of occurrence of a trait by analyzing a pedigree.
INSTRUCTION (15 MINS) 4. What to expect in a human pedigree
1. Define pedigree analysis. I. For autosomal dominant trait: Two affected individuals can have a
normal offspring
2. Enumerate uses of pedigree analysis:
II. For autosomal recessive trait: Two affected individuals can NEVER
I. Describe the mode of inheritance of a trait have a normal offspring
II. Calculate the probability of occurrence an affected offspring in a given 5. Give an example of a pedigree and solve some questions
cross
3. Establish symbols for creating pedigrees

DEPED COPY
I. Male (square) vs female (circle)
II. Affected (shaded) vs unaffected (unshaded) individual III. Marriage/mating line (line connecting mates) vs. sibship line (line connecting siblings)
IV. Fraternal twins (one birthline branching out into the individual twin) vs. identical twins (same as fraternal twins but with a horizontal bar connecting the branches)
V. Generation (Roman numerals) vs. individuals in the same generation, counting left to right (designated by Hindu Arabic numerals)
VI. Proband (arrow)
Sample pedigree with symbol guides
PRACTICE (25 MINUTES)

1. Divide learners into groups of four.
2. Provide copies of four sample pedigrees. (See samples in Figure 2 at the end of this document.)
3. For each pedigree, provide questions for the group to answer I. Identify the mode of inheritance
II. Write down the genotypes of specific individuals
III. Compute for the probability of having an affected offspring 4
DEPED COPY
A. Look at the family of IV-9 and IV-10. If the trait is dominant, is
it possible for them to have an affected offspring?
(Answer: NO. If the trait is dominant, then unaffected
individuals are homozygous recessive. Two recessive individuals that they will have an affected offspring? (Answer: 1/4 or 25%
CANNOT produce a dominant offspring.) B. If the trait is recessive, is it also following the Mendelian ratio from a hybrid cross)
possible for IV-9 and IV-10 to have an unaffected offspring?
(Answer: YES. This can happen if both parents are heterozygous A. Is this trait dominant or recessive?
for the trait, which means they can each give a recessive allele to (Answer: RECESSIVE. If the trait were dominant, then individuals I-3
produce a homozygous recessive offspring.) and I-4 are both homozygous recessive, which means they CANNOT
C. Based on your answers for a) and b), is the trait dominant or recessive? have a dominant offspring.)
(Answer: RECESSIVE) B. What are the most probable genotypes of I-3 and I-4? (Answer: Dd and Dd
D. Give the genotypes of the following: in order for each parent to be able to contribute a recessive allele to
i. IV-9 (Answer: Dd) give rise to a recessive offspring.)
ii. IV-10 (Answer: Dd)
C. What are the most probable genotypes of II-4 and II-5? (Answer: Dd
iii. V-1 (Answer: DD or Dd)
and Dd. Same reason as b.)
iv. I-1 (Answer: dd)
v. I-2 (Answer: Dd) D. What is the probability that II-4 and II-5 will have another normal offspring?
E. If IV-9 and IV-10 were to have another child, what is the probability (Answer: 75%. A hybrid cross will produce 75% dominant offspring
and 25% recessive offspring.)
DEP
ED COPY
A. Is the trait dominant or recessive? (Answer: 1/2 or 50%. Following the Mendelian cross of dd x Dd,
(Answer: DOMINANT. If the trait were recessive, then individuals there is a 50% probability of producing a homozygous recessive
I-1 and I-2 are homozygous recessive, and they CANNOT produce a unaffected offspring.)
dominant affected offspring.) A. Is the trait dominant or recessive?
(Answer: DOMINANT. If the trait were recessive, then individuals I-3
B. What are the most probable genotypes of I-2 and I-3? (Answer: Dd and Dd.
and I-4 must be homozygous recessive, and they CANNOT produce a
Each parent must be heterozygous in order to give a recessive allele to
dominant offspring.)
produce a recessive unaffected offspring.) B. What are the genotypes of I-1 and I-2?
C. What is the probability that II-2 is Dd? (Answer: dd and dd. Since the trait is dominant, it follows that unaffected
(Answer: 1 or 100%. II-2, together with the homozygous recessive II- individuals are homozygous recessive.)
1, was able to produce homozygous C. What is the probability that I-1 and I-2 will have an affected offspring?
recessive unaffected offspring. This can only happen if II-2 also (Answer: 0. Homozygous recessive individuals CANNOT produce an
possesses a recessive allele, which means s/he is a heterozygote.) offspring with a dominant trait.)
D. What is the probability that II-1 and II-2 will have another normal D. What are the genotypes of I-3 and I-4?
offspring? (Answer: Dd and Dd. Each parent must have a recessive allele in order to
produce a homozygous recessive offspring.) E. What is the probability that II-6 is and 25% (1/4) dd, giving a ratio of 1:2:1. Since II-6 is already affected, then
Dd? his phenotype is dominant. Therefore, the probability of II-6 being affected
(Answer: 2/3. II-6’s parents are both heterozygotes. Following the is 0. So instead of a ratio of 1:2:1, the ratio to be considered should now be
Mendelian cross of Dd x Dd, the probabilities of just 1:2 (DD:Dd). The probability of II-6 being Dd should now be 2/3.)
occurrence of phenotypes in this cross are 25% (1/4) DD, 50% (2/4) Dd, 6
ENRICHMENT
1. As a homework, assign each learner to construct a pedigree of an authentic family using any of the following traits: I. With
(dominant) or without finger hair (recessive)
II. Normal (dominant) or hitchhiker’s thumb (recessive)
III. Widow’s peak (dominant) or straight hairline (recessive)
IV. Free (dominant) or attached earlobe (recessive)
V. Curly (dominant), wavy (heterozygous) or straight (recessive) hair

OPY
2. B. Where possible, determine the genotypes of every individual in the family
C
CROSS EXPECTED PHENOTYPE(S)
EXPECTED GENOTYPE(S)
1. DD x DD 100% DD 100% dominant
2. DD x Dd 50% DD: 50% Dd 100% dominant
D
3. DD x dd 100% dominant
100% Dd
E
4. Dd x Dd 75% dominant: 25% recessive
25% DD: 50% Dd: 25% dd
5. Dd x dd 50% Dd: 50% dd 50% dominant: 50% recessive
DEP
General Biology 2
and Recombination
Lesson 2: Sex Linkage 60 MINS
Content Standard
DEPED COPY
The learners understand inheritance of Sex Linked characters 8
Motivation Case Study 10 Instruction Discussion of Sex-Linked Traits 25
Performance Standard
The learners shall be able to Practice Group Work 20 Enrichment Narrative
LESSON OUTLINE Materials
Introduction Communicating Learning Objectives and Pen, paper, and ruler
5Resources
Relevant Vocabulary (1) Klug, W. S., M. R. Cummings, C. A. Spencer and M.A. Palladino. 2012.
th
• make a a research paper/case study/poster on transmission of a sex-linked genetic Essentials of Genetics. 8 ed. Benjamin Cummings.
disease (2) Reece, J.B., Urry, L.A., Cain, M.L., Wasserman, S.A., Minorsky, P.V., and
Jackson, R.B. 2012. Campbell Biology, (9th ed). The Benjamin Cummings
Learning Competency
Publishing Co., Inc.
The learners shall be able to explain sex related inheritance and recombination;
th
illustrate the transmission of sex-linked characters; and distinguish sex-linked traits (3) Sheridan, M. 1999. Instructor’s guide for Biology, 5 ed. By Campbell, Reece,
from other sex-related traits (STEM_BIO11/12-IIIa b-2) Mitchell. Addison Wesley Longman, Inc.
Specific Learning Outcomes

• illustrate the transmission of an X-linked and a Y-linked character; • compute the
probability of the occurrence of a sex-linked trait; and • give examples of other sex-
related traits.
INTRODUCTION (5 MINS) Relevant Vocabulary

2. State the relevant vocabulary:
Communicating Learning Objectives
1. Cite the learning objectives, which are as follows:
I. illustrate the transmission of an X-linked and a Y-linked character II. compute the
DEPED COPY
probability of the occurrence of a sex-linked trait III. give examples of other sex-
related traits
Teacher tip:
Ask the learners to review the topic on
recombination in Meiosis that they took up in BIO 1. Recombination or shuffling of genes/ alleles in chromosome pairs. In humans, pair numbers 1-22 are
Meiosis results to variation in the genome of gametes, the sperm cells and egg cells. the autosomes or body chromosomes while the last
(23rd) pair is the sex chromosome.
In any cell of the body (somatic), there are
I. Sex linked trait. The gene (pair) that determines a character (e.g. hemophilia) is
located on the sex chromosomes VII. Other sex-related traits.
II. X-linked trait. A sex-linked trait is where the gene or allele for the trait is found A. Sex-influenced trait- Any trait in a diploid organism whose expression is affected
on the X chromosome by an individual’s biological sex; a trait that occurs at a higher frequency in one sex
III. Color blindness. An X-linked recessive trait where a affected individual could over the other
not distinguish red from green color (red green color blindness) B. Sex-limited trait- Any trait in a diploid organism whose expression is limited to
IV. Hemophilia. An X-linked recessive trait where an affected individual suffers just one biological sex
from delayed blood clotting during injuries because of the absence of certain blood C.
clotting factors V. Y-linked trait. A sex-linked trait where the gene or allele for the Normal human females have two X chromosomes and normal human males have one X chromosome
and a Y chromosome; that is:
trait is found on the Y chromosome XX- female
VI. Hypertrichosis pinnae auris. A Y-linked trait where affected males have hair XY- male
growing from their external ears
MOTIVATION (10 MINS)
Case Study
Present these three cases using pictures:
Y
OP
A picture of a color blindness test chart Ask A picture or description of a woman
the learners if they could see a figure in the breastfeeding a baby
picture and ask the class to recite aloud the
DC
Ask the learners who among the men and
figure/ number. women are able to lactate or breastfeed their
A picture of a family with male young.
members
who are bald

Ask the learners if baldness occurs more in
men or women.
DEPE
Use a high resolution figure (photograph or image projected on a computer or Misconception: Common misconception is that baldness occurs only in
LCD) to ensure the accuracy of the color blindness test. Those that could see the males. Emphasize that baldness does happen in women, although the
figure are normal; those that cannot are colorblind. In most cases, the colorblind frequency is much lower and is therefore rare.
males outnumber the colorblind females, which are rare. If there are no colorblind
individuals in the class, the teacher will just have to mention as a matter of fact
that colorblind females are rare.
Be careful in conducting this test to discourage teasing of actual colorblind 10
learners. Emphasize that colorblind individuals are normal except that they
could not distinguish between red and green colors.
INSTRUCTION (25 MINS) • Hypertrichosis pinnae auris as an example of a Y-linked trait • If a male
Sex-linked traits has the allele responsible for the trait, then his Y chromosome will possess
• Give the definition of an X-linked trait that allele. Since he will pass on his Y chromosome to his sons, then all his
• Explain why X-linked traits may occur more frequently in one sex over sons will inherit the trait, and they, in turn, can pass on the allele to their
the other sons.
• In humans, males and females are represented by different sex
chromosomes
DEPED COPY
• Females have two X chromosomes in the nucleus of their
cells. colorblindness
• Males have one X chromosome and one Y chromosome in the nucleus of • Females need two copies of the recessive allele, one from each of the two
their cells. X chromosomes, for the trait to be manifested. If they only have one
• Depending on whether the trait is dominant or recessive, the expression copy of the recessive allele, they have normal color vision. However,
pattern of the trait differs in males and females • Colorblindness in humans as they are carriers for the trait in that they may pass it on to their
an example of sex-linked trait • The alleles responsible for colorblindness is offspring.
found on the X chromosome only • Males only need one recessive allele in their sole X chromosome
• The dominant allele is the normal allele; the recessive allele causes for the trait to be expressed.
• Explain what happens to the expression patterns if the trait is X-linked and dominant allele for baldness and b as the recessive
dominant. normal allele.
• Use Table 2 as guide. Sex-limited traits
• Give the definition of a Y-linked trait • Give the definition
• Explain why there is difference in expression between males and females • Explain why traits may be limited to one sex only • Hormonal or
for Y-linked traits. (Since the allele is found only in the Y chromosome, physiological differences between sexes may limit the expression of some
and since only males have Y chromosomes, then only males will express genes to one biological sex only
the trait. Females CANNOT express Y-linked traits.) • Functional mammary glands as an example of a sex limited trait.
3. Describe other sex-related traits Only females can express functional
Sex-influenced trait mammary glands that produce milk immediately after giving
• Give the definition birth.
• Explain why traits may be expressed differently between sexes • Note that baldness behaves like a dominant trait in males in that only
• Hormonal or physiological differences between the sexes cause one dominant allele is needed for baldness to be expressed. On the
differences of expression of certain genes other hand, the trait behaves like a recessive trait in women in that
• Baldness in humans as an example of a sex-influenced trait. See they need both dominant alleles to be present for baldness to be
Table 1 how baldness is hypothesized to be expressed by a single pair expressed.
of alleles, with B as the
PRACTICE (20 MINS)
1. Divide learners into groups of four.
2. Ask each group to answer a set of questions related to sex-related traits in humans. See sample
questions.
ENRICHMENT
As a homework, provide this narrative to the class:

DEPED COPY
mode of inheritance. • If only Prince Alexis was afflicted with the disease,
determine his genotype. • What could be the genotypes of the Emperor and
The last Emperor of Russia, Nicolas II, was married to Empress Alexandra, and they Empress?
had five children, Olga, Tatiana, Maria, Anastasia, and Alexis. Alexis was the only • Is it possible that each daughter could have been a carrier?
one who was afflicted with hemophilia or the royal bleeding disease; all other
members were normal. • Research on this medical condition and determine the
12 carrier. The Emperor was completely unaffected and therefore had an XY genotype. Based on the
Teacher tip: genotypes of the parents, Alexis had an XCY genotype, with the defective X chromosome carrying the
Hemophilia is an X-linked recessive trait. Empress Alexandra was most likely a carrier of the trait allele for hemophilia coming from his mother. Each daughter, in turn, had a 50% probability of being
(XCX). She was a descendant of Queen Victoria of the United Kingdom, who herself was a probable a carrier, but they could NEVER have been affected.
General Biology 2 LESSON OUTLINE

60 MINS
Lesson 3: Modification
to Mendel’s Classic
Ratios
Content Standard
The learners understand Non-Mendelian Modes of Inheritance
DEPED COPY
5
Relevant Vocabulary
Performance Standard The learners shall be able to
Motivation Narrative 5
• make a research paper/case study/poster on a non-Mendelian genetic trait

Learning Competency Humans, Plants, and Animals
The learners shall be able to describe some modifications to Mendel’s classic ratios
Materials
(gene interactions) (STEM_BIO11/12-IIIa-b-3)
Pen and Paper
Specific Learning Outcomes Resources
• describe some cases of non-Mendelian genetic traits
• distinguish Mendelian from non-Mendelian modes of inheritance; and (1) Klug, W.S., Cummings, M.R., Spencer, C.A. and Palladino, M.A.. 2012. Essentials
Instruction Recall in Mendelian Ratios, Discussion of Genetics. 8th ed. Benjamin Cummings.
40 (2) Reece, J.B., Urry, L.A., Cain, M.L., Wasserman, S.A., Minorsky, P.V., and Jackson,
on Co-Dominance and Multiple Alleles R.B. 2012. Campbell Biology, (9th ed). The Benjamin Cummings Publishing Co.,
Inc.
Practice Group Work: Non-Mendelian Traits in (3) Sheridan, M. 1999. Instructor’s guide for Biology, 5th ed. By Campbell, Reece,
40 Mitchell. Addison Wesley Longman, Inc.
DEPED COPY
1. Cite the major learning objectives, which are as follows: I.
distinguish Mendelian from non-Mendelian modes of inheritance
II. describe some cases of non-Mendelian genetic traits
MOTIVATION (5 MINS)
Narrative types of every individual in the family, including the surviving
1. Provide this narrative to the class: maternal grandfather and paternal grandmother. The results
2. A local hospital has sent word to a family of a possible mix up of some of the were as follows:
children with other families when they were born. To rule out any possible mix 2. Present the following relevant vocabulary:
up, the hospital obtained the blood
I. Co-dominance - When two contrasting alleles are present in the same
locus or trait (heterozygote genotype), then the phenotype expressed is a
Relevant Vocabulary “blend” of the two extreme phenotypes. The two genes interact and the
offspring shows the effects of both alleles.
II. Incomplete dominance - When two contrasting alleles are present in the 3. Based on the results, is there a possibility that any one of the children is not a
same locus or trait (heterozygote genotype), then both alleles are biological offspring of the couple? To answer this question, we must first
expressed in the same phenotype understand how blood types, a non Mendelian trait is inherited.
III. Multiple alleles - When there are more than two types of alleles for a
given locus or trait, this will result in more than two kinds of
phenotypes that may be expressed for that trait.
Father: Type O
Mother: Type A
1st child: Type O
2nd child: Type A
3rd child: Type B 14
Maternal grandfather: Type AB
Paternal grandmother: Type B
INSTRUCTION (40 MINS) expressed as a
distinct phenotype (a “blend” of the two extreme phenotypes). In this case, the
Recall in Mendelian Ratios, Discussion on Co-Dominance and Multiple phenotypic ratio is the same as the genotypic ratio
Alleles 1. Let the learners recall the Mendelian Ratios in STEM_BIO11/12-IIIa-b-1
Teacher Tip:
2. Discuss incomplete dominance. Define the trait. The heterozygote genotype is Review the Mendelian ratios and ensure that the learners are familiar with them before they could
proceed with the lesson.
DEPED COPY
I. Use snapdragon plants (Antirrhinum majus) as example (see figure 1).
A. RR – red flowers
B. Rr – pink flowers
C. rr – white flowers
3. Discuss co-dominance. Define the trait. The heterozygote genotype is expressed as a distinct phenotype (both extreme phenotypes are expressed at the same time).
Similar to incomplete dominance, the phenotypic ratio is the same as the genotypic (Himalayan), and c (Albino), with the following dominance hierarchy: C> C ch>Ch>
ratio. c. B. The following genotypes will have the corresponding phenotypes in coat color:
I. Use human MN blood typing as an example i. CC – Agouti
A. MM – type M ii. CCch – Agouti
B. MN – type MN iii. CCh – Agouti
C. NN – type N iv. Cc – Agouti
4. Discuss multiple alleles. Define the trait. There are more than two types of alleles, v. CchCch – Chinchilla
and the relationship of each allele with respect to others will determine the number Emphasize that incomplete dominance and co dominance are similar in that their phenotypic ratios
of phenotypes that may be expressed. follow their genotypic ratios. However, they differ in the expression of the heterozygote condition: in
co-dominance, the heterozygote expresses both extreme phenotypes; in incomplete dominance, the
I. Use coat color in rabbits as example (see figure 2) heterozygote is expressed as a “blend” of the two extreme phenotypes.
A. There are four different types of alleles in rabbits: C (Agouti), C ch (Chinchilla), Ch
vi. CchCh – Chinchilla vii. Cchc – Chinchilla viii.ChCh – Himalayan ix. Chc –
Himalayan x. Cc – Albino
DEPED COPY
Teacher Tip:
Note that in the ABO system, the O allele is
recessive to both A and B alleles while the A and B
alleles are co-dominants of one another.
C. Use ABO blood typing in humans as example

i. There are three different types of alleles A (or I A), B (or IB) and O (or i) 16
Blood types O and AB can only have OO and AB genotypes, respectively.
ii. The following genotypes will have the following blood types (phenotypes): iii. The mother must be AO in order to have an offspring that is either A or O.
AA (or IAIA) – Type A The paternal grandmother must be BO in order to have an offspring (father) who is blood type O. The
3rd child could have been the result of a mix up because the B allele is not present in either parent.
iv. AO (or IAi) – Type A
v. BB (or IBIB) – Type B Misconception
B
vi. BO (or I i) – Type B Emphasize that blood typing could only be used to exclude/disprove biological parentage, not to prove
it.
vii. AB (IAIB) – Type AB
viii.OO (ii) – Type O
5. Go back to the Motivation narrative

I. The class will now answer the question/narrative provided during the Motivation
part. The teacher will ask first the most probable genotypes of all the members of
the family as follows:
i. Father: Type O - OO
ii. Mother: Type A - AO
iii. 1st child: Type O - OO
iv. 2nd child: Type A - AO
v. 3rd child: Type B – B?
vi. Maternal grandfather: Type AB - AB
vii. Paternal grandmother: Type B – BO
viii.Possible mix-up? Yes, 3rd child.
PRACTICE (40 MINS) C. Two wavy plants will produce what possible kinds of offspring?
1. Divide learners into groups of four. Give their ratios? (ANSWER: 25% serrated: 50% wavy: 25%
smooth; this is a hybrid cross, which will give a 1:2:1 ratio)
2. Ask each group to answer a set of questions related to non Mendelian
modes of inheritance. See sample questions.
DEPED COPY
1. In cattle, coat color is inherited in a co-dominant fashion. Homozygous 3. In guinea pigs, coat color is governed by four alleles that constitute a
B1B1 produces black coat, homozygous B2B2 produces white coat, and multiple allelic series, C (black), cS (sepia), cC (cream), and c (albino)
the heterozygous B1B2 produces roan coat. Give the phenotypic ratio of with the following dominance hierarchy: C>cS>cC>c. Determine the
the offspring of the following crosses: phenotypic ratios of the progeny from the following crosses:
A. B1B1 x B1B1 (ANSWER: all black) A. Cc x CcS (ANSWER: 75% black: 25% sepia; the genotypes and their
B. B1B1 x B2B2 (ANSWER: all roan) probabilities of occurrence are: 25% CC, 25% CcS, 25% Cc, and 25%
cSc, giving a phenotypic ratio of 75% black and 25% sepia)
C. B1B2 x B1B2 (ANSWER: 25% Black: 50% Roan: 25% White)
B. CcS x cCc (ANSWER: 50% black: 50% sepia; the genotypes and their
D. B1B1 x B1B2 (ANSWER: 50% Black: 50% Roan) E. B1B2 x B2B2
probabilities of occurrence are 25% CcC, 25% Cc, 25% cScC, 25%
(ANSWER: 50% Roan: 50% White)
cSc, giving a phenotypic ratio of 50% black and 50% sepia)
2. In a hypothetical plant, a serrated leaf margined plant, when crossed with a

4. A man who is blood type B is married to a woman who is blood type A.
smooth leaf margined plant, produces offsprings with wavy leaf margin.
None of the man’s parents is blood type O. This couple has 4 children
A. Identify the mode of inheritance. (ANSWER: Incomplete dominance) with the following blood types: B, AB, AB and O. Give the genotypes of
B. Two serrated plants, when crossed, will give what type of offspring? the parents. (ANSWER: Man: BO; Woman: AO; Both parents must have
(ANSWER: Serrated plants; the trait is homozygous, therefore an O allele in order to produce and offspring with blood type O with
producing offspring with the same phenotype as the parents) genotype OO)
Incomplete dominance in snapdragons, Antirrhinum majus. The
DEPED COPY
cross involving homozygote red flowers (RR) and homozygote white
flowers (rr) will yield a heterozygote (Rr) that expresses a different
phenotype, which is pink flowers. The cross between pink-flowered individuals 18
will produce offsprings where the genotypic ratio also becomes the phenotypic
ratio (25% red: 50% pink: 25% white). (Wikipedia)
Coat color in rabbits. The trait is controlled b multiple alleles with the
following dominance hierarchy: C (Agouti) > Cch (Chinchilla) > Ch
(Himalayan) > c (Albino).
General Biology 2
Structure of DNA, RNA,
Lesson 4: Molecular
and Proteins
Instruction Discussion on the Molecular Structures
30
of DNA, RNA, and Proteins
DEPED COPY
The learners shall explain how the structures of DNA, RNA and proteins are related
to their functions (STEM_BIO11/12- IIIa-b-4)
Practice Building Models of DNA 5 Enrichment Conversion to
60 MINS mRNA Transcripts 5

• describe the building blocks of DNA, RNA and proteins; • identify the structural
and functional differences between DNA and RNA and
• explain the different levels of protein structure
Evaluation Identification of Biomolecule
Content Standard 10
The learners understand Structures and Functions of DNA, RNA and proteins Represented by Given Chain Structures
Performance Standard Materials
The learners shall be able to Recyclable materials for model construction; freely
LESSON OUTLINE downloadable molecular modeling software.
Introduction Communicating Learning Objectives 5 Motivation Group Work 5 Resources

Biochemistry textbooks; SwissPDB Viewer software (free
• build models of DNA, RNA and proteins Learning Competency download); Protein Data Bank (www.pdb.org)
INTRODUCTION (5 MINS) II. identify the structural and functional differences between DNA and RNA. III.
discuss the different levels of protein structure (primary, secondary, tertiary and
1. The learning outcomes will be presented as follows: quaternary)
I. describe building blocks of DNA, RNA and Proteins. Teacher Tip:
One dimensional and two dimensional models of DNA should be presented to the class.
DEPED COPY
IV. 4.explain how protein structural features may influence their functions
2. Ask learners if they have heard of the term “genes”. Ask them what “genes” have they inherited
from their parents.
Sample answers: genes for dimples, straight hair, etc.
MOTIVATION (5 MINS) 6. DNA is double stranded while RNA is single stranded with Uracil instead of
1. Divide the class into groups of learners. Allow each group to enumerate the most Thymine. 20
important functions of DNA and proteins that they can recall from their previous Teacher Tip:
grade levels. 2. Consolidate these answers on the board. Expected Answers:
DNA: repository of genetic information RNA: transcripts; link between the gene and the gene product
(protein)
Protein: functional products; executors of cellular functions
INSTRUCTION (30 MINS)
1. The building blocks of any nucleic acid are the nucleotides.
2. A nucleotide is composed of a phosphate group (with negative charges), a sugar
portion and an N-base.
3. The sugar in DNA is deoxyribose while the sugar in RNA is ribose. Explain the
difference through a visual aid.
4. DNA and RNA are polynucleotides. N-bases are either purines or pyrimidines.
Purine bases are Adenine (A) and Guanine (G). Pyrimidines are Cytosine (C),
Thymine (T, in DNA only) and Uracil (U, found only in RNA)
5. Specific base pairings occur in DNA. A pairs with T; G pairs with C
7. Main Functions: III. Protein: functional products of genes; executes cellular functions
I. DNA: repository of genetic information; sequence of bases encodes the blueprint Teacher Tip:
for life processes If computers and internet facilities are available, structures for these biomolecules are available as
II. RNA: information in the form of base sequence is transformed (transcribed) into molecular structure files (*.pdb) from the Protein
Data Bank (www.pdb.org).Focus on the important parts of the structure that provide the necessary
mRNA, tRNA and rRNA. DNA is the template copied into RNA by base pairing. G physical properties of DNA, RNA and proteins.
with C; A with U.
DEPED COPY
8. The four structural levels of proteins are: 1.Primary- sequence of amino acids in Phosphodiester bonds
Essential for polynucleotide chain
the polypeptide chain; 2. Secondary- when the polypeptide chains form a helix or a
elongation
pleated sheet structure; 3. Tertiary- coiling of the polypeptide, combining helices Discuss the importance of these physical features for the functions of DNA, RNA and proteins.
and sheet forms; 4. Quaternary- the association of two or more polypeptides in
space
Summary of Important Physical Properties
BIOMOLECULE Physical Property Functional Relevance
DNA Complementary Base Pairs Allows each strand to serve as a template for Emphasize that the DNA has negative charges on the outside due to the phosphate groups. Other
stabilizing factors in the DNA should be mentioned.
replication and transcription
RNA Single stranded but some bases can be complementary; hence, stranded
some portions may be double For stability
Uracil Nitrogenous base found only in RNA. PROTEIN Amino (N)Terminus Start Note:
For each classification of amino acid,give the names of each amino acid. Give the one letter symbol
of the polypeptide chain Amino (N)Terminus End of the polypeptide chain for each amino acid. The three letter code for each amino acid may also be provided.
Peptide Bond Links amino acids together

One letter symbol for each amino acid a. non-polar- aliphatic or aromatic b. polar, uncharged
Classes: c. polar, charged- acidic and basic
PRACTICE (5 MINS) Teacher Tip:
Be sure to note the antiparallel orientation of the coding and non-coding strands of DNA. Explain the
Given the following coding sequence for DNA, provide the sequence of the relative positions of the 5’ and 3’ ends.
complementary (template) sequence.

Coding sequence : 5’ ATGCATAGATTAGGATATCCCAGATAG 3’ (Answer)
DEPED COPY
Complementary sequence 3’ TACGTATCTAATCCTATAGGGTCTATC 5’
Ask the learners to build models of DNA by using recyclable materials such as popsicle sticks or pieces of
colored papers to represent the complementary bases: G with C; A with T. The DNA backbone
(phosphate, sugar) should be included.
ENRICHMENT (5 MINS)
1. Convert the given coding sequence into an mRNA transcript:
Complementary Non-coding/ Template sequence 3’ TACGTATCTAATCCTATAGGGTCTATC 5’ (Answer)
Coding sequence ~ mRNA transcript 5’ AUGCAUAGAUUAGGAUAUCCCAGAUAG 3’ 2. Translate the given mRNA transcript into a polypeptide sequence:
Coding sequence ~ mRNA transcript 5’ AUGCAUAGAUUAGGAUAUCCCAGAUAG 3’ (Answer)

Polypeptide sequence N-Met-His-Arg-Leu-Gly-Tyr-Pro-Arg-C 22
Teacher Tip:
The mRNA transcript has almost the same sequence as the coding sequence (DNA), but the thymines are replaced to Uracil.
Show the learners how to read the codon Table
Teach the learners the single letter codes for the amino acids (e.g. ryptophan ⭠ Trp ⭠ W).
Ask the learners to spell their names using the amino acid codes (e.g. N-E-I-L ⭠ Asn – Glu – Ile – Lue).
EVALUATION (10 MINS) 3. Protein
Ask learners to identify the type of biomolecule represented by a given chain Teacher Tip:
To help learners practice the generation of complementary sequences, worksheets with partially
structure: 1. DNA completed sequences may be used.
2. RNA
Example
Template sequence
3’ TAC_ _ _TCT_ _ _ CCTATAGGGTCT 5’

DEPED COPY
5’ _ _ _CAUAGAUUA_ _ _UAU_ _ _AGA 3’
Learners may be asked to identify the important structural features in these chain structures (features are
listed in the instruction/ delivery table). A similar exercise of generating non-coding sequences (DNA),
transcripts (RNA) and translated polypeptides may be done to test the learners understanding of the topic.
General Biology 2 LESSON OUTLINE

60 MINS
Lesson 5: DNA
Replication and Protein
Synthesis
Content Standard
The learners understand Central Dogma of Molecular Biology.
DEPED COPY
5
Review
Performance Standard The learners shall be able to
Motivation Inquiry 5
• identify requirements, enzymes and products in DNA Replication, transcription,

and protein synthesis.
Instruction Discussion on DNA Replication or DNA Synthesis
20
Learning Competency
The learners should be able to diagram the steps in DNA replication, transcription, and protein synthesis (STEM_BIO11/12- IIIa-b-5)

• describe the requirements, proteins and enzymes in DNA replication; • transcription and translation; and
• diagram the steps in replication, transcription and translation. 24
Practice Matching Type Game 10 Evaluation Take-home Activity 5
Materials
Paper, coloured pens
Resources
(1) Reece, J.B., Urry, L.A., Cain, M.L., Wasserman, S.A., Minorsky, P.V., and Jackson, R.B. 2012. Campbell Biology, (9 th ed). The Benjamin Cummings Publishing Co., Inc.
INTRODUCTION (5 MINS) transcription and translation
1. The learning objectives will be communicated as follows: B. Diagram the steps in replication, transcription and translation.
A. Describe the requirements, proteins and enzymes in DNA replication, C. Explain what happens to a gene sequence that undergoes transcription and
eventual To help learners practice the generation of complementary sequences, worksheets with partially
Teacher Tip: completed sequences may be used.
translation into protein
2. Ask the learners to recall the significance of Mitosis.

DEPED COPY
Mitosis is an equational cell division that produces daughter cells which are identical or clones of the
original, mother cell. This ensures that every cell of the body has the same genetic content, i.e.
chromosome number. To make this possible, cells have to duplicate their genetic material which is
primarily DNA.
MOTIVATION (5 MINS)
1. Ask learners to imagine how many cells a typical mature human contains. Tell them that they all came
from just one fertilized egg cell. A zygote goes through millions of generations of cell divisions to
become just the one person that a learner is. Even until now, cells in an individual are still dividing. Ask
learners what examples of tissues in their body are undergoing cell division. (sample answers: skin;
blood cells)
2. Also, ask learners to recall that in the previous topics on genetics, the phenotype is the outside, visible
characteristic of an organism. Any phenotype (eg. red flower) is directly determined by proteins or
enzymes functioning in a metabolic pathway. Proteins are made by “turning on” specific portions of
DNA that are called genes. Particular sequences of DNA are transcribed to become RNAs. These are
then used to produce proteins in a process called translation.
INSTRUCTION (65 MINS) Base pairing is maintained; Adenine pairs with Thymine, Guanine pairs with
1. DNA replication or DNA synthesis. DNA strands separate and serve as templates Cytosine
for the production of new DNA molecules. Teacher Tip:
A. The following are features of replication: To help learners practice the generation of complementary sequences, worksheets with partially
completed sequences may be used.
i. Semiconservative- the resulting DNA consists of one old and one new strand ii.
DEPED COPY
iii. New DNA molecules are produced in the 5’ to 3’ direction
iv. Semidiscontinuous. The leading strand is synthesized in a continuous manner (5’ to 3’) while
the lagging strand is produced discontinuously in short stretches called Okazaki fragments.
B. In lagging strand synthesis, there is a need for a primer terminus which is provided by an RNA
molecule. RNA is synthesized by a primase or RNA polymerase. The 3’OH of the RNA is where
new DNA
nucleotides are
added thus
new DNA is
built in the 5’
to 3’
direction.
C. Enzymes in
replication are as
follows: 1.
helicase; 2. gyrase;
3. SSB (single
strand binding
proteins); 4.
primase or RNA
polymerase; 4.
DNA polymerase
and 5. DNA
ligase.
26
2. Transcription or RNA synthesis. DNA is unwound and one strand is used as polymerase. Three major types of RNA are: messenger RNA (mRNA); transfer
template for the production of an RNA molecule. An RNA polymerase makes RNA RNA (tRNA) and ribosomal RNA (rRNA).
in the 5’ to 3’ direction. Specific regions in the DNA called promoters allow the Teacher Tip:
binding of transcription factors which make possible the binding of RNA To help learners practice the generation of complementary sequences, worksheets with partially
completed sequences may be used.
DEPED
COPY
3. Translation or protein synthesis. This occurs in the ribosome. Basic ingredients are the various types of
RNAs produced in transcription and some proteins or enzymes. The mRNA contains triplets of bases
called codons that specify an amino acid, eg. UUU-phe. Various tRNAs carry amino acids from the
cytoplasm to the actual site of translation in the ribosome. A tRNA has an anticodon that pair with a
codon in the mRNA. Different rRNAs combine with ribosomal proteins to make up the subunits of a
ribosome. A functional ribosome has a small and a large subunit.
In bacteria, transcription and translation may be simultaneous. In eukaryotic cells, mRNA, tRNA
and rRNA travel from the nucleus to the cytoplasm through the nuclear pores. RNAs may undergo
processing. Some unnecessary parts like introns are removed. In eukaryotic
mRNA, a 5’ cap and a 3’ poly A tail are added. Coding regions of mRNA are called exons. They
specify functional protein products.
DEPED COPY
To initiate translation, the small and the big subunits of the ribosome have
to be separated. Initiation factors (IF) make this possible. They also prevent
the premature reassociation of these subunits. The small subunit of the
ribosome binds the mRNA
and allows the entrance of a
tRNA to the P site
bearing the first amino acid.
The big subunit then binds
and together they
form an assembly ready for
the next amino acid in the A
site of the
ribosome.
A stop codon signals the and the polypeptide is

end of translation. No released.
amino acid corresponds In the elongation process of translation, amino acids are linked by peptide bond
to a stop codon. Release formation due to the action of peptidyl transferase known to be a part of the
factors halt the process ribosome subunit. The process is summarized in the diagram above.
The genetic code is the correspondence of the mRNA codons to
amino acids. An amino acid is specified by a codon with three
code letters. The genetic code is shown as above.
28
The genetic code is the correspondence of the mRNA codons to amino acids. An PRACTICE (5 MINS)
amino acid is specified by a codon with three code letters. The genetic code is
shown as follows:
Teacher Tip:
DEPED COPY
Use flash cards. Organize learners into groups and ask them to compete.
Point out the effect of the loss of the

following:
ENZYME EFFECT OF LOSS
DNA No replication
Polymerase
Helicases Decreased DNA

replication efficiency
Peptidyl No peptide bond formation

transferase
RNA No replication Ribosomes No translation
Polymerase No transcription
1. Matching Type Game: For each protein or enzyme or structure mentioned above, identify whether
such is involved in replication, transcription or translation.
2. Explain why both DNA replication and RNA transcription are disrupted by the loss of RNA
polymerase.
EVALUATION (5 MINS)
1. As an assignment, ask the learners to make their own diagram of the steps involved in DNA
replication, transcription and translation or protein synthesis. (Note: The learners may choose a variety of
medium for presenting the steps of the processes.)
General Biology 2
Engineering
Lesson 6: Genetic 60 MINS
Content Standard
The learners outline the steps in Recombinant DNA.

DEPED COPY Introduction Communicating Learning Objectives and
5
Performance Standard
Review
The learners shall be able to
• explain how genes may be modified and/or inserted in host cells/ organisms.
LESSON OUTLINE
Learning Competency 30
The learners should be able to outline the steps involved in genetic engineering Motivation Desirable Traits 5 Instruction Genetic Engineering 35 Practice
(STEM_BIO11/12-III a-b-6) Recitation 5 Enrichment Poster Making 5 Evaluation Assignment 5
Materials
Specific Learning Outcomes Recyclable materials for paper models of plasmids; scissors; tape; pens of various colors
Resources
• compare classical breeding with modern genetic engineering techniques; • Biochemistry textbooks; online videos on genetic engineering and GMOs
enumerate the steps in molecular cloning;
• describe some methods to introduce DNA into cells; and • explain the selection
and screening of transformants / genetically modified organisms (GMOs)
INTRODUCTION (5 MINS) animals. He has taken an active part in choosing desired traits of plants and animals.
Traits that were
Communicating Learning Objectives and Review
1. The learning outcomes will be presented and the overall idea on how organisms
may be modified will be discussed. Teacher Tip:
Make a quick review of the previous lesson on DNA replication and protein synthesis.
2. In order to survive, man has successfully domesticated selected plants and
D COPY
considered valuable (i.e. high fruit yield; high milk production, etc.) were sought out and
propagated. The processes involved may include classical breeding practices such as controlled
pollination of plants, and the mating of animals with desired traits. In today’s modern science,
molecular biology techniques are being employed in the insertion and expression of proteins in
different organisms for various purposes.
MOTIVATION (5 MINS)
Desirable Traits
E
Guapple (Large sized guava)
1. Ask for volunteers to enumerate plants and animals that have desirable or
enhanced traits. 2. Ask learners to explain how each of the traits was introduced or
Classical breeding
developed (i.e. classical breeding or recombinant DNA technology).
E
ENHANCED TRAIT
Human Insulin-producing bacteria Recombinant DNA Technology
MODIFYING TECHNIQUE
D
Recombinant DNA Technology
Flavr-Savr (Delayed-ripening tomatoes)
P
Kobe / Wagyu Beef (Beef with good fat
distribution)
Classical breeding Macapuno trait in coconuts Classical breeding
Teacher Tip:
Group the learners into 3’s or 4’s and allow each group to discuss examples of “enhanced” animals/
plants.
INSTRUCTION (60 MINS) I. introduction of new traits into an organism
Genetic Engineering Teacher Tip:

Pictures of common domesticated plants and animals may be shown in class.
1. Classical breeding practices focus on the mating of organisms with desirable
qualities. 2. Genetic engineering involves the use of molecular techniques to modify High cost of medicine and other agricultural products may be mentioned.
the traits of a target organism. The modification of traits may involve:
DEPED COPY
II. enhancement of a present trait by increasing the expression of the desired gene
III. enhancement of a present trait by disrupting the inhibition of the desired genes’
expression.
3. A general outline of recombinant DNA may be given as follows:
I. cutting or cleavage of DNA by restriction enzymes (REs)
II. selection of an appropriate vector or vehicle which would propagate the recombinant DNA ( eg.
circular plasmid in bacteria with a foreign gene of interest)
III. ligation (join together) of the gene of interest (eg. from animal) with the vector ( cut
bacterial plasmid)
IV. transfer of the recombinant plasmid into a host cell (that would carry out replication to make
huge copies of the recombined plasmid)
V. selection process to screen which cells actually contain the gene of interest
VI. sequencing of the gene to find out the primary structure of the protein
4. After outlining the key steps in recombinant DNA, the teacher can proceed to describe the ways in
which these plasmids may be introduced into host organisms.
Biolistics. In this technique, a “gene gun” is used to fire DNA-coated pellets on plant tissues. Cells that
survive the bombardment, and are able to take up the expression plasmid coated pellets and acquire the
ability to express the designed protein.
Plasmid insertion by Heat Shock Treatment. Heat Shock Treatment is a process used to transfer
plasmid DNA into bacteria. The target cells are pre-treated before the procedure to increase the pore
sizes of their plasma membranes. This pretreatment (usually with CaCl 2) is said to make the cells
“competent” for accepting the plasmid DNA. After the cells are made 32
competent, they are incubated with the desired plasmid at about 4°C for about 30min. The plasmids
concentrate near the cells during this time. Afterwards, a “Heat Shock” is done on the plasmid-cell
solution by incubating it at 42°C for 1 minute then back to 4°C for 2 minutes. The rapid rise and drop
of temperature is believed to increase and decrease the pore sizes in the membrane. The plasmid DNA
near the membrane surface are taken into the cells by this process. The cells that took up the plasmids
acquire new traits and are said to be
“transformed”.
Electroporation. This technique follows a similar methodology as Heat Shock

DEPED COPY
In some cases, the location of the cloning site within the plasmid is in the middle of
Treatment, but, the expansion of the membrane pores is done through an electric a gene (i.e. β-galactosidase, lacZ) that generates a (blue) colored product in the
“shock”. This method is commonly used for insertion of genes into mammalian presence of a substrate (i.e. isopropyl β-D-1 thiogalactopyranoside, or IPTG). Cells
cells. transformed with these “empty” plasmids will turn blue in the presence of IPTG.
Insertion of a gene in the cloning site disrupts the sequence of the β-galactosidase
5. Some methods to screen recombinant cells are as follows: gene and prevents the generation of the colored
Selection of plasmid DNA containing cells
A selection marker within the inserted plasmid DNA sequence allows the selection
of “transformants”. Usually, an antibiotic resistance gene (e.g. AMP ampicillin
resistance gene) is included in the plasmid DNA. This allows only “transformed”
cells to survive in the presence of the antibiotic (e.g. ampicillin). Plating the
plasmid-cell solution on antibiotic-containing media will select for these
“transformants” and only allow plasmid-containing cells to grow and propagate into
colonies.
Selection of transformed cells with the desired gene

Certain inserted genes within the plasmids provide visible proof of their presence.
These include the antibiotic resistance genes that allow for the selection of the
transformed cells within the solution. Some inserted genes also produce colored
(e.g. chromogenic proteins) or fluorescent products (e.g. GFP) that label the
colonies/cells with the inserted gene. Teacher Tip:
Agarose gel electrophoresis (AGE) allows the identification of PCR products and estimation of their of the PCR product may be approximated by the DNA fragment in the MW ladder that runs a similar
sizes. This is done by running a molecular weight (MW) ladder alongside the samples. The MW distance.
ladder is made up of DNA fragments of known size (e.g. 100bp, 200bp, 300bp, 500bp, etc). The size
product in the presence of the substrate. Cells transformed with the disrupted β-galactosidase gene will
remain “white” in the presence of IPTG. This “blue-white screening” protocol is thus able to screen for
cells that were transformed with the desired gene in the cloning site.
PCR detection of plasmid DNA

Alternatively, the presence of the desired gene in the inserted plasmids may be confirmed
DEPED COPY
using PCR amplification. PCR reactions specific for the desired gene may be done using DNA from
cells. Amplification of the expected product would confirm the presence of the gene within the samples.
PCR reactions specific for plasmid sequences will also confirm/identify the type of plasmid used for the
transformation.
Genetically Modified Organisms (GMOs) of these genetic modifications promise higher product yield for their targets. These
With the ability to insert gene sequences, comes the possibility of providing new include the Flavr-Savr Tomato and Bt-Corn.
traits for these target organisms. This has allowed the development of GMOs. Some
The Flavr-Savr (“Flavor Savor”) tomato was the first genetically modified organism 34
that was licensed for human consumption. The trait modified in this tomato is its Teacher Tip:
Note that antisense RNA strands bind to mRNAs. This prevents their expression into proteins.
ripening process. A gene for an enzyme that causes the degradation of pectin in the
cell walls (i.e. polygalacturonase) normally softens the fruit as it ripens. In Flavr
Savr tomatoes, an inhibitor (i.e. antisense RNA) disrupts the expression of this gene,
thereby delaying the softening of the fruit and extending the time it may be kept in
storage and transported to markets. Note:
Which of the techniques discussed can be used to detect if GMOs were used in a certain food product?
Bt-Corn was developed to incorporate the production of a toxin (i.e. Bt-endotoxin) Answer: Assuming that the DNA is still intact in the sample, testing for specific marker genes in
from Bacillus thuringensis in corn plants. This toxin results in the death of pests that expression plasmids can be used to detect the presence of these engineered plasmids.
feed on these plants like the corn borer larvae. The toxin has been shown to be
selective for Lepidoptera larvae and is non-toxic to humans, mammals, fish and
birds. The selective toxicity of the toxin allows its use in foodcrops. The
introduction of the toxin is believed to increase crop production due to decreased
losses from pest infestation. The same technology has been applied in the
Philippines for the development of Bt-Eggplant.
Despite the proposed benefits of GMOs, some people have raised their concerns regarding the
consumption of these modified foods. While most of the products are tested for safety, concerns are
raised for the possibility of not being able to detect hazards that are present, but are currently
undetectable by today’s current technology.
Because of these issues, manufacturers are urged to provide labels that notify consumers of
DEPED COPY
GMO presence in their products. While GMOs are believed to be safe when licensed by the food
regulatory agencies, it is believed that the consumers must be provided with enough information to
make their own choices regarding their use.
PRACTICE (5 MINS) 1. Give an assignment and allow learners to research on the pros and cons of genetic
engineering.
Recitation
2. Ask them for their opinion on the matter, and ask them to support these opinions
1. Ask the learners to differentiate the various technologies for delivering genes into
with facts learned in class. Be sure that issues of biosafety are included in the
cells. 2. Determine which technologies are most appropriate for which cell types.
discussion.
(Answers: Biolistics for plants; Electroporation for mammalian cells; Heat shock for
bacterial cells) Teacher Tip:
Biolistics may be more suitable for plants due to their thick cell walls.
ENRICHMENT (5 MINS)
Poster Making
1. Learners may be asked to make a poster on the steps and other methods involved
in recombinant DNA.
EVALUATION (5 MINS) Teacher Tip:

This may also be given as an assignment.
Assignment
General Biology 2
Lesson 7: Discuss the
Applications of Recombinant DNA
60 MINS
Content Standard
The learners demonstrate an understanding of recombinant DNA and examples of

DEPED COPY
36
products from Recombinant DNA Technology. LESSON OUTLINE
Performance Standards Introduction Communicating Learning Objectives 5 Motivation
The learners shall be able to:
Thought Experiment 5 Instruction Presentation of Recombinant DNA
• describe some techniques for the expression of desired traits in target organisms;
and 35 Practice Steps in PCR and Gene Cloning 5 Enrichment User of
• search online databases for specific traits and source organisms.
PCR and GMOs 5 Evaluation Sample Exercise 5
Learning Competency
The learners should be able to discuss the applications of Recombinant DNA Materials
Technology (STEM_BIO11/12-III a-b-7) Writing materials, recyclable materials for models of plasmids, tape, pens
Specific Learning Outcomes: Resources

At the end of the lesson, the learners will be able to: (1) Genbank, www.ncbi.nlm.nih.gov
• give examples of products from recombinant DNA technology; • illustrate the (2) Protein Data Bank, www.pdb.org
use of databases to search genes for desired traits; • describe steps in PCR to
amplify and detect a gene of interest; • identify the parts of an expression
vector;
• explain how genes may be cloned and expressed
INTRODUCTION (5 MINS) DNA (gene) ⭠ RNA (transcript) ⭠ Protein (trait)
Communicating Learning Objectives Teacher Tip:
1. The learning objectives will be presented and the processes in the Central Dogma Be sure to stress that for a gene to add a trait to an organism, the gene for the trait must be inserted
within the target organism, and the organism should have the necessary “equipment” (i.e. enzymes,
of Molecular Biology will be reviewed:
materials ) to produce the protein that results in the trait or
DEPED COPY
2. Different organisms have different traits based on their genes (DNA sequences). V. Have them identify the modified / added trait (e.g. langka-sized aratilis). VI.
For example, frogs have antimicrobial peptides on their skin. Some jellyfish have Have the learners present their work to the rest of the class, and let the class decide
proteins that allow them to glow in the dark. Mutations in hemoglobin genes lead to on the best proposal.
anemia. desired phenotype.
3. Based on the central dogma, if transcription and translation of genes lead to some
traits, then the insertion of certain genes in a given organism may provide it with
new traits. This is the basis for the development of genetically modified organisms
(GMOs).
MOTIVATION (5 MINS)
Thought Experiment
1. The learner may be given a group activity/ thought experiment for constructing a Teacher Tip:
Discuss the merits of the different proposed “designer genes” based on the following criteria:
genetically modified organism/trait in a fruit. “Designer Genes group work”
I. Arrange the learners into groups of 3 or 4. 1. Originality of the study (i.e. Has anyone done studies of this type before?)
2. Feasibility of the study (How possible is the proposed modification? Can the target organism
II. Have them identify a special trait (e.g. large fruit size) support the proposed trait? )
III. Have them identify a source organism (e.g. jackfruit / langka) 3. Potential Applications of the new organism (What benefits would the recombinant organism
provide to society?)
IV. Have them identify a target organism (e.g. aratilis)
Some examples: Flood-resistant rice Delayed ripening fruits
INSTRUCTION (35 MINS) table shows examples of modified traits using cloned genes and their applications:
Presentation of Recombinant DNA

Teacher Tip:
1. After the exercise, the learners should now be aware that there are many different Ask the learners on the significance of finding many versus few entries on a given topic in the
traits that can be introduced to organisms to change their properties. The following database.
MODIFIED TRAIT GENE FEW Low num

MODIFICATION entries in of resear
High
COPY
RECIPIENT ORGANISM the verify th
chance to
database observat
discover
Topic has novel
not been traits /
APPLICATION extensively MANY
applications
(FIELD) studied entries in the database
Insulin Production Insertion of Human Insulin in Bacteria Much

Insulin Gene Corn / Maize information is available on the topic
(Agriculture)
Production of corn
plants with increased
resistance to corn
ED
Pest Resistance Insertion of Bt-toxin
gene boxer
Bacteria (Medicine) PROS
Topic is much studied

Production of Human
CONS Difficult to discover new
DEP
Delayed Ripening Disruption of a gene for a ripening delayed ripening (i.e. export deliveries)
enzyme fruits. These fruits will
(e.g. survive longer
polygalacturonase) transport time, 38
Tomato plant Agriculture) Production of plants allowing their delivery information on the topic
with fruits that have to further locations
Chymosin Production Insertion of a gene for chymosin Web based research:
Bacteria (Industry)
Enhance large scale
DEPED COPY
production of
chymosin. This enzyme
serves as a substitute
for rennet in the
coagulation of milk.
Rennet has to be
harvested from calves.
The large scale
production of this
enzyme in bacteria
provides an abundant
supply of this
important component
for the cheese
production industry.
Search for these different traits and how they may be made useful. This involves the collection of gene sequences in accessible locations, such as databases
(e.g. Genbank (www.ncbi.nlm.nih.gov) ; Protein Data Bank (www.pdb.org)). These databases serve like libraries that may be consulted when trying to find
specific traits that belong to different organisms.
For example, one would want to find out if any work has been done on spider silks. The databases (e.g. Genbank:Nucleotide database) may be searched for
entries that contain information on “Spiders, and Silk” (Result: 93615 entries). The results may be screened for more specific studies (e.g. Malaysia, Spiders,
and Silk- Result two entries).
PCR Amplification Teacher Tip:
Once a desired trait is chosen, information must be acquired for either its detection Mention that unlike DNA replication in
or expression in a given organism.
1. Detection
Some researchers may be interested in determining if a given gene/trait is available
in a particular
DEPED COPY
organism. If no previous research provides this information, researchers may test the extension of the generated ssDNA strand through the binding of complementary
DNA of different organisms for the presence of these specific genes. A technique bases to the template strand (~72° C). The thermostability of the polymerase allows
that allows the detection of specific genes in target organisms is called PCR. it to survive the repeated cycles of denaturation, annealing and extension with little
loss of enzyme function. Each cycle of PCR doubles the amount of the target
sequence. A typical PCR experiment uses about 35 cycles of amplification. This
PCR amplification is an in-vitro method that simulates DNA replication in vivo. It
increases the original amount of the target sequence by 235 (i.e. ~34 billion) times.
utilizes a thermostable (heat-resistant) DNA polymerase that builds single stranded
DNA strands unto unwound DNA templates. PCR uses repeated cycles of
incubation at different temperatures to promote the unwinding of the DNA template Gene detection by PCR involves the design of primers that would only bind to
(~95°C); the annealing of a primer (a ~20bp oligonucleotide sequence (recall RNA sequences that are specific to a target. For example, researchers would want to find
primers in DNA replication) onto the ssDNA template strand (~54 - 60°C); and the out if gene X (e.g. the gene for insulin) is available in a target organism (e.g. a
mouse, Mus musculus). Primers may be designed by looking at the available 40
sequences for gene X in the databases (e.g. all the genes for insulin in different This Teaching Guide is a donation by CHED to DepEd. It is for reference purposes only.
vivo, PCR reactions do not use too many helper enzymes such as helicases and gyrases to help
organisms; humans, pigs, cows, etc.). The different gene X sequences must be
denature and stabilize the template DNA strands.
aligned/ compared to match areas of sequence similarity (conserved sequences) and The cyclic heating of the samples is meant to provide the physical separation of the template DNA
areas of sequence dissimilarity (non-conserved sequences). Primers designed to strands through heat denaturation of the inter-strand H-bonds.
have the same sequence as the conserved areas will be specific for binding gene X Primers may be classified as forward or reverse primers. Forward primers are
sequences in all the target organisms. Primers designed to have the same sequence complementary and bind to the reverse complementary (non-coding) sequence of
as the non-conserved areas will only be specific for the organisms which match its the gene. Reverse primers are complementary and bind to the coding sequence of
sequence. the gene.
STEPS in PCR Amplification

Teacher Tip:
Let the learners recall the antiparallel orientation of the bound primers to the template DNA. If the
template is represented from left to right in the 5’ ⭠ 3’ orientation; then the primers should bind near
the 3’ end and the primers would be
DEPED COPY represented 3’ ⭠ 5’ going left to right.

Step 0: Undenatured Template ; Temp ~ 54 °"C;
Template: double stranded (ds) DNA strand. Complementary sequences are held together by H-bonds
5’ A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3’ (Coding strand)
3’ T A CGCTACTCCTATACTGGGCTATCTATCTCCATAGATCTCTA 5’ (Non-coding strand)
Step 1: Template denaturation ; Temp ~ 95 °"C;

Template: single stranded (ss) DNA strands; DNA strands are separated; H-bonds between
complementary sequences are broken

Step 2: Primer Annealing ; Temp ~ 54 °"C (dependent on primer melting temperature);
Template: ssDNA strands. H-bonds are formed between complementary sequences on the primers
and the target sequences.
Direction of elongation CCATAGATC (Reverse Primer)

5’ GCGATGAGG 3’ Direction of elongation (Forward Primer)
Step 3: New DNA strand elongation ; Temp ~ 72 °"C; complement of the template. This is called semiconservative replication of the
The two new dsDNA strands are formed by the elongation of the generated ssDNA Teacher Tip:
nd
and the H-bonds between the complementary sequences on these new strands and Illustrate how by the 2 round of PCR the two newly synthesized DNA strands can now be used as
their templates. Each of the new dsDNA strands is made up of one old strand from templates. For the given example, new strand synthesis will again generate a 37 base pair long
product. Repeated cycles of PCR will make this product the predominant type of double stranded
the original template, and one new strand that was generated as a reverse
sequence.
New Strand 1:
DEPED COPY DNA in the solution.
5’ A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3’ (new)
(Coding strand) (old) 3’
CGCTACTCCTATACTGGGCTATCTATCTCCATAGATC-5’ (Reverse Primer) New Strand 2:
5’ GCGATGAGGATATGACCCGATAGATAGAGGTATCTAG-3’ (Forward CGCTACTCCTATACTGGGCTATCTATCTCCATAGATC – 5’ (Reverse Primer)
Primer) (new) 3’ T A (new) 42

CGCTACTCCTATACTGGGCTATCTATCTCCATAGATCTCTA 5’ (Non-coding
strand) (old)
Step 4: Repeat step 1 to 3 for N number of cycles (N is usually 35)

PCR Results
The expected product of PCR amplification will depend on the sequences / position
at which the primer sequences bind. If the forward primer starts binding at
nucleotide 3 (coming from the 5’ end) of a 43bp long gene, and the reverse primer
binds at a position complementary to nucleotide 39 of the coding strand, then a
37bp product is expected per cycle of PCR.
New Strand 1:
Nucleotide # 3
Nucleotide # 39
37 bp product
5’ A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3’
Note: Other types of organisms (e.g. Yeast, Mammalian Cells, etc.) may also be “transformed” to
(Coding strand) (old) 3’- exhibit new traits. The type of DNA constructs used for insertion of genes into these organisms will
vary (e.g. Bacmids, Cosmids, etc.)
New Strand 2:
Nucleotide # 3
Nucleotide # 39
37 bp product
5’ GCGATGAGGATATGACCCGATAGATAGAGGTATCTAG -3’ (Forward Primer) (new)
3’ T A C GCTACTCCTATACTGGGCTATCTATCTCCATAGATC TCTA 5’ (Non-coding strand) (old)
DEPED COPY
PCR Applications Certain types of bacteria are capable of this process since they are able to take genes
PCR may be used to detect the presence of a desired gene in an organism. within their cell membranes for eventual expression. The genes are normally in the
Depending on the primer design, the expected product may represent only a specific form of small, circular DNA structures called plasmids.
region of the gene or the entire gene itself. The first case is useful for detection of
the gene, or the detection of organisms with that specific gene within a sample. The The genes found in the inserted plasmid DNA sequence will be expressed as proteins
second case is useful for the amplification of the entire gene for eventual expression that provide specific traits to the transformed bacteria. The basic components of an
in other organisms. The direct amplification/copying of a full gene is part of the expression plasmid are listed in the following table. The purpose of each of these is
process for “cloning” that gene. also provided.
2. Cloning and Expression

Some genes provide economically, and industrially important products (e.g. insulin- Teacher Tip:
coding genes; genes for collagen degradation). In some cases, scientists would want The multiple cloning site (MCS) may contain sequences that may be cut by different restriction
to put these genes into organisms for the expression of their products. One example enzymes. Stress how the use of two restriction enzymes may control the orientation of the inserted
would be the insertion of an insulin coding gene from the human genome into gene in the plasmid.
Note: Forward and Reverse primers should not be complementary.
bacteria. This allows the “transformed” bacteria to now produce human insulin as a
product.
COMPONENT PURPOSE
Promoter Allows the controlled expression of the desired gene in the presence of an inducing agent (e.g.
beta- galactosidase; heat treatment (~65°"C)
Multiple Cloning Site DNA sequence or portion for the insertion of the desired gene. This section may
contain sequences that will be cut by specific restriction
endonucleases ( cuts within the molecule) If both the amplified gene
D EPED COPY
and the plasmid are cut with the same restriction enzyme, then
complementary sequences will be generated for each, allowing them
to bind together or anneal. The desired gene is inserted into the
multiple cloning site through this process.
Restriction enzymes cut at specific sequences.
EcoR1 Target Sequence:
5’ GAATTC 3’
3’ CTTAAG 5’
Digestion Reaction
Undigested: Digested dsDNA:
5’ GAATTC 3’ 5’ G AATTC3’
3’ CTTAAG 5’ 3’ CTTAA G5’
If the desired cut sites are not found in the gene that needs to be
inserted; the sequences can be added by including the target
sequences in the primers used for PCR amplification.
44
COMPONENT PURPOSE
Multiple Cloning Site PCR Primers:
5’ GCGATGAGG 3’ (Forward Primer)
3’ CCATAGATC 5’ (Reverse Primer)
DEPED COPY
Forward Primer + EcoRI target sequence:
5’ GAATTCGCGATGAGG 3’
Reverse Primer + EcoRI target sequence:
3’ CCATAGATCCTTAAG 5’
Inserted Gene Sequence Successful insertion of a gene allows the expression of its protein product.
This usually provides a specific trait to the “transformed”
bacteria. For example, if the gene for Green Fluorescent Protein is
placed within the expression plasmid, bacteria transformed with this
plasmid will produce protein (GFP) that will allow the bacterial cells /
colonies to glow green in the dark.
Antibiotic Resistance Gene which among the colony of cells actually contain the inserted gene sequence.
Provides a way to screen a population of bacteria for those that took up the plasmid. Bacterial cells whose ampicillin resistance gene have been cut will die in the
For example, if an ampicillin resistance gene is encoded in the plasmid, then only presence (agar plate) of ampicillin.
bacteria which took up the plasmid will be able to grow on media with ampicillin.
However, if the ampicillin resistance gene is cut and the gene is inserted here for
cloning, then the cell will no longer be resistant to ampicillin. This is a way to select
PRACTICE (5 MINS) vector.
3. Using pieces of paper, allow the learners to illustrate the steps in restriction
Steps in PCR and Gene Cloning
digestion and PCR
1. Let learners give other hypothetically modified or genetically engineered plants
Teacher Tip:
and animals which can be used for health, industry, agriculture and for the At this point, learners’ imagination could be stretched, but caution the learners that certain ethical
protection of the environment. 2. Ask learner to draw the parts of an expression principles should be followed and adhered to in the production of genetically modified organisms.
Animal welfare should be taken cared of and human cloning must never be conducted.
ENRICHMENT (5 MINS) Uses of PCR and GMOs
1. Discuss how PCR may be used for the detection of disease causing pathogens in a 46
DEPED COPY
population. For example, it may be used to check if a patient has a dengue virus
infection. This is done by using primers that are specific for complementary DNA
(cDNA) sequences that correspond to the dengue viruses. If PCR amplification
occurs using cDNA from a patient’s blood sample then the patient likely has dengue
viruses in his/her blood.
2. Discuss how the cloning and expression of certain genes allows for massive
production of the desired product. For example, the cloning and expression of
insulin in bacteria allows for the mass production of this necessary protein for use
by diabetic patients. Prior to insulin production in bacteria, insulin was harvested
from other animals such as pigs.
Teacher Tip:
Try using other classic restriction enzymes: Ex. Xho1; HindIII
EVALUATION (5 MINS)
Sample Exercise
1. Give learners a set of known Restriction Enzyme (RE) cut sites:
EcoRI BamH1
D E PED C OPY
5’ GAATTC 3’ 5’ GGATTC 3’
3’ CTTAGG 5’ 3’ CTTAGG 5’
DNA Sequence (69 bp long) 28 49
5’ ATGCATGGTACGTAGAGTTCCATGAATTCGCCCCTATAGGGTAGCCGAGGATCCTATGCCCGAATGTC 3’
3’ TACGTACCATGCATCTCAAGGTACTTAAGCGGGGATATCCCATCGGCTCCTAGGATACGGGCTTACAG 5’
Expected Fragment sizes:

With EcoR1 digestion : 28 bp, 41 bp
With BamH1 digestion : 20 bp, 49 bp
With both EcoR1 and BamH1: 20bp, 28bp, and 21 bp
3. Ask the learners to scan a double stranded DNA sequence to determine the presence of these cut sites. Allow them to provide the fragment sizes expected
for using different combinations of the RE on the given sequence. You may choose to give the sequence as linear or circular DNA. Discuss how the
fragment sizes will vary if the target sequence is in circular or linear DNA.
4. A similar exercise may be done to locate areas where primer sequences can bind. The expected fragment sizes for PCR amplification using different
primers can be tested
Example:
Forward Primer:
DEPED COPY
5’ CATGGTACGTAG 3’
Reverse Primer:
3’ GCTCTATACGGG 5’ Target Sequence:
4 Product Size: 62 - 4 = 48bp 62
5’ ATGCATGGTACGTAGAGTTCCATGATAGAGCCCCTATAGGGTAGCCGAGCGAGATATGCCCGAATGTC 3’ 3’
TACGTACCATGCATCTCAAGGTACTATCTCGGGGATATCCCATCGGCTCGCTCTATACGGGCTTACAG 5’
48
General Biology 2
Life on Earth
Lesson 8.1: History of 60 MINS
Content Standard
DEPED COPY
The learners demonstrate understanding of the major events in the history of life on • create a personal timeline and compare it with the geologic time scale • design a
Earth. poster tracing evolutionary changes in a crop plant (e.g., rice or corn) that occurred
through domestication
Performance Standards
The learners shall be able to Learning Competency
The learners describe general features of the history of life on Earth, including LESSON OUTLINE - DAY ONE
generally accepted dates and sequence of the geologic time scale and characteristics
(STEM_BIO11/12-IIIc-g-8) Introduction Communicating Learning Objectives 5 Motivation Discussion: How
Specific Learning Outcomes Old is the Earth? 15
Instruction Picture Timeline and Short Film 20 Enrichment GTS Introductory
• identify the dates and sequence of the periods in the geologic time scale; • identify
the major events in each major period; Worksheet 10 Evaluation My Life History: A Short Narrative 10
• describe the characteristics of the major groups of organisms present during a time Materials
period; Visual aids on the geologic time scale; 20 printed pictures of events/ structures/ organisms; computers
and internet connection
• identify types of fossils; and
• describe causes of mass extinctions. All Resources listed at the End of this Lesson
one calendar year, events such
Communicate Learning Objectives
Introduce the following objectives by asking volunteers to read them aloud: 1. I can MOTIVATION (10 MINS)
identify the dates and sequence of the geologic time scale Discussion: How Old is the Earth? 1. What is the age of the Earth?
2. I can describe the characteristic features of major groups of organisms in each
time period.
Introduction
When we study the Earth’s age, we are also studying the fossil record and ultimately, the theory of
evolution. The Earth is approximately 4.6 billion years old – a very big number ordinary humans can’t
easily relate with, especially, the specific time frame when we appeared. Comparing the Earth’s age to
our species (modern humans) first appeared. Tell them that humans did not co-exist
with dinosaurs as what movies
DEPED COPY
as the extinction of dinosaurs and the re-discovery
of the New World by Columbus would appear
relatively much easier. “Understanding the
geologic time scale reminds us of our time and
place in the universe.”
The learners may give various answers from thousands to millions of years. Some
will give answers near to 4.6 billion years. Write all the answers on the board and
let them think of what the age of the Earth is.)
2. What was the Earth like million of years ago?

Ask learners: “Have you seen the movies Ice Age and The Land Before Time? How
was the Earth presented in movies such as these?” Based from what you may have
read, describe the Earth million of years ago. The following answers may be given
by learners: (1) covered with thick blanket of ice, (2) lots of volcanoes and high
mountains, (3) large organisms roamed the land, (4) the atmosphere did not have
high oxygen content, (4) asteroids/ meteors frequently hit the surface, (5) the lands
moved a lot or the continents were a little closer to each other, (6) volcanic 50
eruptions, (7) a little bit warmer, (8) plants were bigger, (9) humans were not yet Big Ideas: (May be written on the board or manila paper and posted on the board.
around. Accept all answers and ask them what are the possible conditions on the • The Earth is 4.6 billion years old.
• Life on Earth arose around 3.5 billion years ago.
early Earth. The teacher may show a clip from any of the movies depicting ancient
• Over Earth’s vast history, both gradual and catastrophic processes have produced enormous changes.
earth conditions.)
Misconceptions:
3. When did man first appear on Earth? • Humans and dinosaurs existed on the Earth at the same time.
• Plants and animals on Earth have always existed.
Learners may give answers such as millions to thousands years ago. Ask learners to
• The Earth is too big to change.
choose the more probable dates and provide evidence for its accuracy. They may
enumerate the different hominid species but ask them the approximate time when
Teachers must correct the misconceptions learners have about the history of life on Earth.
usually depict. Man could have first appeared about 100 – 150 thousand years ago as 4. Distribute the 15 – 20 pictures to some volunteers. Ask each volunteer to post
shown by artefactual evidences in various sites. The human timeline is rather them along the
flexible and debatable every time we know a specific date, a new discovery is Teacher Tip:
announced and everything gets re dated to fit the best estimates.) It’s hard for learners to understand geologic events and the time frame where each event took place. It
will be easier if everything is connected in a 1- year time frame (calendar year). It is more relevant to
see how everything unfolds in a short time span. However, tell them that a lot of things can happen in
the span of a year.
length of the board based on what each thinks occurred first.

DEPED COPY 5. Ask the learners to take a closer look at the timeline constructed on the board. 6.
5. Let the other learners check what have been posted. They can suggest a possible Let them re-arrange (if necessary) based on what they learned from the video.
re arrangement of the pictures.
The teacher will print 15 - 20 events (preferably with pictures, if necessary) to be used for this lesson.
6. When everybody is satisfied with the lineup, tell them that they are going to watch Refer to the Sample Events List.
a short video.
The pictures should be posted on the front board that will serve as a 1-year timeline. Tell them that
they will view the Earth’s history in this time frame. To make it more interesting, attach the 12 months
of the year. Ask interesting questions, such as,“Who would like to have a birthday party with
dinosaurs?”
INSTRUCTION (20 MINS) Unlocking of Terms:
1. Watch a short clip • EON- largest division of the geologic time scale; spans hundreds to thousands of million of years
I. Geologic Time Scale (https://www.youtube.com/watch?v=nofyRleo3Vc ) II. ago (mya)
• ERA- division in an Era that span time periods of tens to hundreds of millions of years • PERIOD- a
“Four Ways to Understand the Earth’s Age.” (https://www.youtube.com/watch? division of geologic history that spans no more than one hundred million years • EPOCH- the smallest
division of the geologic time scale characterized by distinctive
v=tkxWmh tFGs&spfreload=10
organisms
2. Tell everyone to listen and watch attentively.
Tip:
3. Use the following questions to guide the learners as they watch the video. I. What The teacher may also ask the learners to plot their birthdates side-by-side with the geologic events.
are the four ways mentioned in the film? Ask:
II. Why is it hard to create a timeline of events chronicling Earth’s history? III. In which timeframe were you born? What specific events happened the day you were born, using the
geologic time scale.
What are the divisions of the geologic time scale?
4. Share in class what you have learned from the video. Alternate Video:
Geologic Time Scale: Major Eons, Eras, Periods and Epochs- https://www.youtube.com/watch?
v=nofyRleo3Vc
ENRICHMENT (10 MINS) 1. Answer the following in your journal.
I. The Earth has an incredibly long history. How does understanding of geologic Teacher Tip:
time and the significant geologic events of the past impact your understanding of Journaling is a good technique to help some passive learners to jot down their thoughts first then share
whatever they have written with a partner.
humans’ unique responsibility and place on earth?
II. How does understanding the past help us understand the present? Volunteers may be tapped in advance. The best output will be posted in the room.
DEPED COPY
III. Calculate how many generations of humans it would take for us to exist now (assume an average life
span of 80 years) (What must we humans do to ensure we are able to exist this long for many
generations?
2. Form a dyad and discuss your answers.
EVALUATION (5 MINS) 52
Alternate Activity:
1. Answer the Worksheet on Geologic Time Scale. Submit next meeting. 2. My Life
Time Machine:
History: Create a timeline of events that happened to you since you were born up to 1. Look around your community. Make a narrative on how the place looked like several years ago and
the present time. Choose only 20 events that you think are the most important. Be how it will be several years (maybe after 50 years) from now.
ready to present your timeline next meeting.
Going Further:
ASSIGNMENT: (5 MINS) If time and space permits, the following activity can be done.
1. Make a table in your notebook of the geologic time scale (GTS) and include the Understanding Geologic Time
following details; (From: http://www.jsg.utexas.edu/glow/files/ Understanding-Geologic-Time-6-8.pdf)
I. Major divisions of the GTS
II. Major events and characteristic organisms
General Biology 2
Life on Earth
Content Standard
DEPED COPY
The learners demonstrate understanding of the major events in the history of life on the major events in each major period;
Earth. • describe the characteristics of the major groups of organisms present during a time
Performance Standards period;
The learners shall be able to • identify types of fossils; and
• create a personal timeline and compare it with the geologic time scale • design a • describe causes of mass extinctions
poster tracing evolutionary changes in a crop plant (e.g., rice or corn) that occurred LESSON OUTLINE - DAY TWO
through domestication
Introduction Communicating Learning Objectives 5 Motivation Discussion: How
Learning Competency
Old is the Earth? 5 Instruction Lecture of the Geologic Time Scale 20
The learners describe general features of the history of life on Earth, including
generally accepted dates and sequence of the geologic time scale and characteristics Enrichment The Anthropocene 20 Evaluation Quiz 10
(STEM_BIO11/12-IIIc-g-8)
Materials
Specific Learning Outcomes Visual aids on the geologic time scale; 20 printed pictures of events/ structures/ organisms; computers
At the end of the lesson, the learners will be able to: and internet connection
• identify the dates and sequence of the periods in the geologic time scale; • identify All Resources listed at the End of this Lesson
INTRODUCTION (5 MINS) Explosion
Communicating Learning Objectives Teacher Tip:

This lesson will present formally the lesson on GTS. The
The lesson for today will cover the following topics: 1. Major learners will understand better the highlights of each time
events in the Geologic Time Scale (GTS) 2. Cambrian frame in the GTS.
MOTIVATION (5 MINS)
Discussion: How Old is the Earth? Discussion: How Old is the Earth?
DEPED COPY
Ask the following questions: 1. How old is the Earth?
2. What is the biggest time frame in the GTS? 54

Teacher Tip:
3. What is the smallest time frame in the GTS? The Geologic Time Record is a tabular representation of the major divisions of the Earth’s history.
The time intervals are divided and described from the longest to the shortest as EONS, ERAS,
PERIODS and EPOCHS.
INSTRUCTION (20 MINS) Each period has an approximated time frame and characterized by distinctive features (events and
organisms).
Lecture of the Geologic Time Scale
1. Present a lecture discussion on the Geologic Time Scale
2. The following outline can guide the teacher in the discussion:
I. The Geological Time Scale (GTS)
A. Four eras - Precambrian; Paleozoic; Mesozoic; Cenozoic
B. Periods under the Paleozoic era - Cambrian, Ordovician, Silurian, Devonian,
Carboniferous, Permian
C. Periods under the Mesozoic era - Triassic, Jurassic, Cretaceous D. Periods under
the Cenozoic era - Tertiary and Quaternary
II. Age in millions of years of each time period
III. Major events in the history of life
The Geologic time is divided into four large segments called Eons:
Hadean, Archean, Proterozoic and Phanerozoic. The Phanerozoic is
divided into Eras: Paleozoic, Mesozoic, and Cenozoic. Extinction
events and appearance of new life forms characterized the
divisions among Eras. Smaller divisions, called Periods,
characterized by a single type of rock system, make up each Era.
Some Periods are further divided into smaller time frame called
DEPED COPY
Epochs. (From: http://goo.gl/ITmoty)
There is a mnemonics (memory device) to remember the Periods in

exact order (from the earliest to the recent); jumps between periods
and epochs.
Pregnant Plentiful
Camels Early
Often Oiling
Sit Might
Down Prevent
Carefully. Partial
Perhaps Rheumatism!
Their
Joints
Creak?
The teacher can also discuss CAMBRIAN EXPLOSION.

CAMBRIAN EXPLOSION is the belief that there was a sudden,
apparent explosion of diversity in life forms about 545 million years
ago. The explosion created the complexity of multi-celled organisms
in a relatively short time frame of 5 to 10 million years. This explosion
also created most of the major extant animal groups today.
SOURCE: http://d32ogoqmya1dw8.cloudfront.net/images/NAGTWorkshops/time/
visualizations_teachtips/variable_time_geologic_time.jpg
The start of the Cambrian was characterized by the breaking up of supercontinent lesson.
• http://goo.gl/Xfu2dz
Gondwana into smaller land masses opening up new environmental niches where • http://goo.gl/YMUvFL
organisms can colonize and specialize. • http://goo.gl/yRa5c7
• http://goo.gl/45c27A
** The following PowerPoint presentations might help in organizing your discussion on this
• http://goo.gl/CoumSB
ENRICHMENT (20 MINS)

DEPED COPY B. Plants
C. Prokaryotes
The Anthropocene D. Eukaryotes
1. Present to the learners a new proposed Epoch, the Anthropocene. I. What are the E. Humans
evidences that suggest that we are entering/ have entered a new epoch?
II. How do scientists decide if a new finding should be validated? 2. This can
be discussed in a small group of 5 learners.
EVALUATION (10 MINS)

1. Geologically speaking with reference to the entire history of the earth, the
dinosaurs went extinct…
A. Shortly after the formation of Earth
B. In the first billion years of Earth’s history
C. In the most recent 2% of the history of Earth
D. Before the first fish formed
2. Relative to the percent of time dominating the surface of Earth which
organisms have the longest reign?
A. Dinosaurs
56 3. The Earth is ________ years old.
Teacher Tip:
A. 6,000
Ask the learners to research if there are evidences to support that the “explosion” is as sudden and
spontaneous as it is used to describe the fossil record. B. 46,000,000
C. 4,600,000,000
This is also a good time to discuss how new findings can affect an existing body of knowledge.
D. There is no way to know
Let the learners read the following articles about a proposed new epoch, the Anthropocene.
• Human impact has pushed Earth into the Anthropocene - http://goo.gl/ fxggQf (04/13/16) 4. 100,000 years in the geologic history of Earth would be considered
• What Is Anthropocene and Are We in It? - http://goo.gl/mq7I9V (04/13/16) • Welcome to the A. Immensely long
Anthropocene - http://www.anthropocene.info (04/13/16)
B. A drop in the bucket
C. Half of Earth's history
D. An extremely significant amount of time
5. Understanding geologic time is significant because it helps us A. Understand 6. Which organism first dominated Earth? A. Dinosaurs
humans’ impact on our environment B. Understand the evolution of organisms over B. Insects
time C. Understand the possibility for life on other planets D. Understand the C. Plants
process of evolution D. Fish
E. All of the above E. Bacteria
ASSIGNMENT
DEPED COPY Answer Key:
1. What are fossils? How are they formed? measure the age of fossils?
2. List down the types of fossils and given examples. 3. How do we 4. What are mass extinctions? How many mass extinctions events happened in
the GTS? 5. B
Answer with discussion must be given by the teacher. 6. E
1. C
2. C
Teacher Tip:
3. C
See to it that everyone has a clear understanding of the geologic time scale. There is no need to
4. B
remember all the events in each period.
General Biology 2
Life on Earth
Content Standard
DEPED COPY
The learners demonstrate understanding of the major events in the history of life on Performance Standards
Earth. The learners shall be able to
• create a personal timeline and compare it with the geologic time scale; and • 58
design a poster tracing evolutionary changes in a crop plant (e.g., rice or corn) that LESSON OUTLINE - DAY THREE
occurred through domestication
Introduction Communicating Learning Objectives 5 Motivation Questions on
Learning Competency
The learners describe general features of the history of life on Earth, including Dinosaurs 5 Instruction Types of Fossils 50
generally accepted dates and sequence of the geologic time scale and characteristics Materials
(STEM_BIO11/12-IIIc-g-8) Visual aids on the geologic time scale; 20 printed pictures of events/ structures/ organisms; computers
Resources
(1) Freeman, S. Biological Science. 3rd ed. 2008. California: Pearson Benjamin Cummings. pp. 503-
• identify the dates and sequence of the periods in the geologic time scale; • identify 525.
the major events in each major period; (2) Reece, JB, LA Urry, ML Cain, S Wasserman, PV Minorsky, RB Jackson. Campbell Biology. 9 th ed.
2014. Illinois: Pearson Education Inc. pp. 480-499.
• describe the characteristics of the major groups of organisms present during a time
(3) Russell PJ, SL Wolfe, PE Hertz, C Starr, B Mc Millan. Biology: the Dynamic Science. 2008.
period;
California: Brooks/Cole CENGAGE Learning. pp. 419-439.
Additional Resources listed at the End of this Lesson
• describe causes of mass extinctions.
INTRODUCTION (5 MINS) Teacher Tip:
An alternative could be to show a clip from the movie Jurassic Park or Jurassic World.
The lesson for today will cover the following topic: 1. The types of fossils
2. Ways fossils are formed and how fossils’ ages are determined 3. Mass
extinctions- causes and frequency in the GTS The following sites provide information about Fossils:
• http://teacher.scholastic.com/scholasticnews/
MOTIVATION (5 MINS)
DEPED COPY magazines/scienceworld/assets/SW
1. Where did scientists discover the first dinosaurs? activities such as animal burrows, nests and dinosaur footprints or even the ripples
2. Who coined the term dinosaurs? created on a prehistoric shore.
3. How did the discovery of dinosaurs make scientists become more interested in the
geologic record? In exceptional preservation, fine details such as original color and individual muscle
4. How can fossils be used as evidence for the evolution of living forms? fibers are retained, features often visible in electron microscopes. This is referred to
as the “Medusa effect.” (From: http://www.bbc.co.uk/nature/fossils/Lagerstätte)
POWERPOINT-FOSSILS.ppt - (Downloaded 04/15/16)
INSTRUCTION (50 MINS) • http://www.enchantedlearning.com/subjects/ dinosaurs/dinofossils/Fossiltypes.html - (Downloaded
1. The teacher will post on the board examples of fossils and let the learners identify 04/15/16)
the type. FOSSILS are evidences of organisms that lived in the past. They can be • http://www.livescience.com/37781-how-do fossils-form-rocks.html - (Downloaded 04/15/16)
• http://www.bbc.co.uk/nature/fossils - (Downloaded 04/15/16)
actual remains like bones, teeth, shells, leaves, seeds, spores or traces of past
• http://www.whatisafossil.net - (Downloaded 04/15/16)
TYPES OF DESCRIPTION EXAMPLES

FOSSILS
Molds Impression made in a substrate = negative image of an Shells

organism
Casts When a mold is filled in Bones and teeth
Petrified Organic material is converted into stone Petrified trees;
Y
Coal balls (fossilized plants and their tissues, in round
ball shape)
Original Remains Preserved wholly (frozen in ice, trapped in tar pits, dried/
dessicated inside caves in arid regions or encased in amber/
fossilized resin)
OP Woolly mammoth;
Amber from the Baltic Sea region
Carbon Film Carbon impression in sedimentary rocks Leaf impression on the rock
C
Trace / Ichnofossils Trackways, toothmarks, gizzard rocks, coprolites
(fossilized dungs), burrows and nests
Record the movements and behaviors of the organism
1. Unaltered preservation - Small organism or part trapped in amber, hardened plant

sap 2. Permineralization/ Petrification - The organic contents of bone and wood are
replaced with silica, calcite or pyrite, forming a rock-like fossil
DEPED
3. Replacement - hard parts are dissolved and replaced by other minerals, like
THE SIX WAYS OF FOSSILIZATION calcite, silica, pyrite, or iron
4. Carbonization or Coalification - The other elements are removed and only the
carbon remained 60
Teacher Tips:
5. Recrystalization - Hard parts are converted to more stable minerals or small The teacher may also mention that more than 90 percent of all organisms that have ever lived on Earth
crystals turn into larger crystals are extinct (http://goo.gl/K83SA). This is due to mass extinctions events that wiped out organisms in
6. Authigenic preservation - Molds and casts are formed after most of the organism the past. The following sites offer explanations on these mass extinction events.
have been destroyed or dissolved
• Big 5 Mass Extinction Events - http:// www.bbc.co.uk/nature/extinction_events - (Downloaded
04/16/16)
• The Great Dying - http://science.nasa.gov/ science-news/science-at-nasa/
2002/28jan_extinction/ - (Downloaded 04/16/16)
• Mass Extinctions - http://
science.nationalgeographic.com/science/ prehistoric-world/mass-extinction -
(Downloaded 04/16/16)
DATING FOSSILS
Knowing the age of a fossil can help a scientist establish its position in the geologic time scale and find its
relationship with the other fossils. There are two ways to measure the age of a fossil: relative dating and
absolute dating.
1. RELATIVE DATING
I. Based upon the study of layer of rocks

DEPED COPY
II. Does not tell the exact age: only compare fossils as older or younger, depends on their position in
rock layer
III. Fossils in the uppermost rock layer/ strata are younger while those in the lowermost
deposition are oldest
How Relative Age is Determined

I. Law of Superposition: if a layer of rock is undisturbed, the fossils found on upper layers are younger
than those found in lower layers of rocks
II. However, because the Earth is active, rocks move and may disturb the layer making this process
not highly accurate
Rules of Relative Dating
(From: http://staff.harrisonburg.k12.va.us/~esutliff/forms/Relative_Dating_1334236393.ppt )
A. LAW OF SUPERPOSITION: Sedimentary layers are deposited in a specific time- youngest rocks on
top, oldest rocks at the bottom
B. LAW OF ORIGINAL HORIZONTALITY: Deposition of rocks happen horizontally- tilting,

folding or breaking happened recently
C. LAW OF CROSS-CUTTING RELATIONSHIPS: If an igneous intrusion or a fault cuts
through existing rocks, the intrusion/fault is YOUNGER than the rock it cuts through
Try this exercise on radioactive dating:

Carbon-14 Dating: http://www.starhop.com/library/pdf/studyguide/high/
brsp-15carbondating.pdf
DEPED COPY INDEX FOSSILS (guide fossils/ indicator fossils/ zone fossils): fossils from short-lived
organisms that lived in many places; used to define and identify geologic periods
2. ABSOLUTE DATING
• Determines the actual age of the fossil
• Through radiometric dating, using radioactive isotopes carbon-14 and potassium-40 • Considers the
half-life or the time it takes for half of the atoms of the radioactive element to decay
• The decay products of radioactive isotopes are stable atoms.
Take a look at the table below. A living organism has carbon-14. For the amount of Carbon in the
organism’s body to become half, it will take about 5,700 years; which is the half-life of carbon-14. Fill up
the remaining data in the table. What is the limit in using carbon-14 as a measure to determine a fossil’s
age?
62
General Biology 2
Life on Earth
Content Standard
DEPED COPY
The learners demonstrate understanding of the major events in the history of life on poster tracing evolutionary changes in a crop plant (e.g., rice or corn) that occurred
Earth. through domestication
Performance Standard Learning Competency
The learners shall be able to The learners describe general features of the history of life on Earth, including
• create a personal timeline and compare it with the geologic time scale • design a generally accepted dates and sequence of the geologic time scale and characteristics
(STEM_BIO11/12-IIIc-g-8) Practice Creation of Fossils 50 Wrap Up Clean Up 10
Specific Learning Outcomes Materials
At the end of the lesson, the learners will be able to: Visual aids on the geologic time scale; 20 printed pictures of events/ structures/ organisms; computers
• identify the dates and sequence of the periods in the geologic time scale • identify
Resources
the major events in each major period
• describe the characteristics of the major groups of organisms present during a time 525.
period (2) Reece, JB, LA Urry, ML Cain, S Wasserman, PV Minorsky, RB Jackson. Campbell Biology. 9 th ed.
• identify types of fossils and 2014. Illinois: Pearson Education Inc. pp. 480-499.
• describe causes of mass extinctions California: Brooks/Cole CENGAGE Learning. pp. 419-439.
LESSON OUTLINE - DAY FOUR
Additional Resources listed at the End of this Lesson
PRACTICE (50 MINS) it is
1. The learners are going to make fossils from a natural and man-made object. 2. Teacher Tip:
Making fossil is a fun way to get involved in science. There are a lot of online sites to guide you on
There are two methods used to create fossils. how to create cheap replicas of fossils.
A. Imprint
The activity can be a little messy, so instruct the learners to use newspapers or this can be done in an
I. Choose the object you want to make a fossil of. Any natural object (shells, leaves,
open area.
animal bone) will do as long as it fits in the container. If you choose leaves, be sure
not dry.
DEPED COPY
II. Coat the object with petroleum jelly. This will keep the object from sticking to the shells, branches, or bones work best. Just make sure you have enough clay and
plaster when you try to remove it. Coat it thoroughly. plaster to cover it. IV. Knead the modeling clay until it is soft and pliable. This will
III. Mix plaster and water in a bowl. Follow the directions on the plaster of Paris be what your object rests and forms an impression in. It needs to be kneaded until it
packaging. Mix them together thoroughly and let the concoction sit for a few can cover the area of your object.
minutes without stirring. You should need about 2x more water than plaster, but you V. Coat the object with petroleum jelly. Firmly yet slowly press it into the modeling
can adjust the ratio as you see fit.
clay to 64
IV. Press the object into the plaster of Paris. Be careful not to push too hard! Now
The following materials are needed for this activity. 1. A small natural object (shell, bone, leaf) 2. Any
your part is done; all it has to do is dry. Set it aside and check it the next day; drying small toy
will take at least one day. 3. Clay
V. Remove the object. After you've waited 24 hours, pop your natural item out of the 4. Petroleum jelly
5. Plaster of Paris
plaster of Paris. It's just like a shell that was enveloped in soil for thousands of years. 6. Disposable dish
It was disintegrated and this image was left behind.
B. 3-D Object (Cast)
Teacher Tip:
I. Choose the object you want to make a fossil of. Any natural object (shells, leaves, Given that this can be messy, tell learners to work on top of old newspapers. Tell them not to throw
animal bone) will do as long as it fits in the container. If you choose leaves, be sure plastic of Paris in the sink or drainage in order for
it is not dry. them not to get clogged with the dried up materials. Provide a container for them to put all waste
materials.
II. Combine the plaster of Paris with water. Use 1 part plaster of Paris to 2 parts
water and mix well in a paper cup with a plastic spoon. Let it sit while you work It will take 1 - 2 days to completely dry and harden the fossil model.
with the clay. III. Choose an object as the template of your fossil. Generally, leaves,
Give incentives/ small tokens to those who made the best fossils.
make an impression. The petroleum jelly prevents it from sticking to the clay, so be
generous. Remove the object carefully to create a mold in the shape of the item you used.
VI. Fill the impression left by your object with plaster of Paris. Smooth the plaster to the level of
the clay to form a flat surface. Place your clay and plaster mold on a
newspaper, paper towel, or other disposable surface and allow it to harden. You'll
DEPED COPY
need to wait at least overnight, but 2 or 3 days is preferable and safer.
VII. Peel the clay off the hardened plaster to free the fossil. The shape of your object should
be recreated in the plaster, details intact.
WRAP UP (10 MINS)

1. Tell the learners to clean up and put all the output in one corner of the room for them to dry up.
2. Tell them to label their works with masking tape.
General Biology 2
Lesson 8.5: History of Life on Earth
60 MINS
Content Standard
The learners demonstrate understanding of the major events in the history of life on 66
DEPED COPY
Earth. LESSON OUTLINE - DAY FIVE
Performance Standards Evaluation Summative Assessment 60
The learners shall be able to
Materials
• create a personal timeline and compare it with the geologic time scale; and • Visual aids on the geologic time scale; 20 printed pictures of events/ structures/ organisms; computers
design a poster tracing evolutionary changes in a crop plant (e.g., rice or corn) that and internet connection
occurred through domestication Resources
Learning Competency
525.
The learners describe general features of the history of life on Earth, including
(2) Reece, JB, LA Urry, ML Cain, S Wasserman, PV Minorsky, RB Jackson. Campbell Biology. 9 th ed.
generally accepted dates and sequence of the geologic time scale and characteristics
2014. Illinois: Pearson Education Inc. pp. 480-499.
(STEM_BIO11/12-IIIc-g-8)
Specific Learning Outcomes California: Brooks/Cole CENGAGE Learning. pp. 419-439.
At the end of the lesson, the learners will be able to: Additional Resources listed at the End of this Lesson
• identify the dates and sequence of the periods in the geologic time scale; • identify
the major events in each major period;
• describe the characteristics of the major groups of organisms present during a time
period;
• describe causes of mass extinctions.
SUMMATIVE ASSESSMENT largest division of the geologic time scale is the A. Eon
1. Geologic Time Scale Practice B. Era
Go to this site and try the quiz. (There is no need to memorize the smaller divisions C. Period
of the geologic time scale.) http:// D. Epoch
www.geosci.ipfw.edu/gildner/TimeScalePractice.html
3. The layers in sedimentary rocks are also called A. eras
2. The Mesozoic Era was the Age of Reptiles while the current Cenozoic Era
B. epochs
is the Age of
C. strata
A. Mammals
D. gaps
(Downloaded 04/16/16) 2. Geologic Time Scale Events B. Birds
C. Humans
D. Technology
B. Mesozoic
C. Cenozoic
DEPED COPY
D. Holozoic
5. During which era were the first land plants formed? A. Cambrian
B. Pre-Cambrian
C. Paleozoic
4. The movie “Jurassic Park” got its title from which era? D. Mesozoic
A. Paleozoic
6. The era of middle life, a time of many changes on Earth A. Paleozoic
Go to this site and try the quiz. http://www.glencoe.com/qe/
B. Mesozoic
scienceOLC.php?qi=6024 (Downloaded 04/16/16)
C. Cenozoic
D. Holozoic
3. Practice Quiz for the Nature of Fossils
Go to this site and try the quiz. http://anthro.palomar.edu/time/ 7. What is the longest part of Earth’s history where trace fossils appeared.
quizzes/timquiz1.htm (Downloaded 04/16/16) A. Pre-Cambrian
B. Paloezoic
MULTIPLE CHOICE. Choose the letter of the correct answer. 1. The C. Mesozoic
D. Cenozoic
8. The geologic time scale is subdivided into 4 groups. List them from the A. Eons, periods, epochs, eras
largest to the smallest. B. Eras, eons, periods, epochs
C. Epochs, periods, eras, eons 2. Animals that are extinct are still alive today.
D. Eons, eras, periods, epochs 3. Scientists do not know for sure what happened to the dinosaurs. 4. A mold is
TRUE OR FALSE. Write True if the statement is correct and False if it is not. a cast filled in with sediments.
1. Fossils give clues about the past.
DEPED COPY 5. Soft body parts cannot be fossilized.
9. The end of this era was believed to be caused by a comet or asteroid 68

colliding with Earth, causing a huge cloud of dust and smoke to rise into
the atmosphere, blocking out the sun. A. Paleozoic
B. Holozoic
C. Mesozoic
D. Cenozoic
10. Which geologic event occurred during the Mesozoic era? A.

Pangaea formed
B. Asteroids killed the dinosaurs
C. The Rocky Mountains formed
D. The Pleistocene Ice Age began
6. Paleontology is the study of fossils.
7. A wooly mammoth’s footprint is a trace fossil.
8. Distinctive fossils used to determine the ages of rocks are called scale fossils.
9. Saber - toothed tiger is more likely preserved in amber. 10. Fossils
are most likely found in sedimentary rocks.
RESOURCES:
NOTES:
1. The Geologic Time Scale: http://www.uky.edu/KGS/education/geologictimescale.pdf (Retrieved 07/08/15) 2. What Is
a Fossil: http://www.discoveringfossils.co.uk/whatisafossil.htm (Retrieved 04/16/16) 3. BBC- Fossils:
http://www.bbc.co.uk/nature/fossils (Retrieved 04/16/16)
4. How Fossils Form: http://www.enchantedlearning.com/subjects/dinosaurs/dinofossils/Fossilhow.html
(Retrieved 04/16/16) VIDEOS:
DEPED COPY
1. Evolution (1971 animation)- https://www.youtube.com/watch?v=T1_vnsdgxII (viewed 07/08/15) 2.
Geologic Time Scale
3. The Geologic Time Scale: https://www.youtube.com/watch?v=r10oh1NHKv4&spfreload=10 (viewed 07/08/15) 4. The Geologic Time
Scale: https://www.youtube.com/watch?v=nofyRleo3Vc (viewed 07/24/15) 5. Four Ways to Understand the Earth’s Age:
https://www.youtube.com/watch?v=tkxWmh-tFGs&spfreload=10 (viewed 07/08/15) 6. The History of Earth: https://www.youtube.com/watch?
v=RQm6N60bneo (viewed 07/08/15)
FURTHER: Advance learners can explore these sites beyond class.

1. Deep Time: A History of the Earth – Interactive Infographic: http://deeptime.info (viewed 07/09/15) 2. National Museum of Natural
History – Geologic Time: http://www.nmnh.si.edu/paleo/geotime/index.htm (viewed 07/09/15) 3. Abiogenesis:
https://www.youtube.com/watch?v=W3ceg--uQKM (viewed 07/08/15)
4. http://mitep.mtu.edu/include/documents/2013/presentations/What_is_the_Geologic_Time_Scale_DWagner.pdf 5.
http://ed.ted.com/lessons/the-earth-s-age-in-measurements-you-can-understand-joshua-m-sneideman#review 6.
http://www.stratigraphy.org/index.php/ics-chart-timescale
7. http://deeptime.info
8. http://www.nmnh.si.edu/paleo/geotime/index.htm
9. http://www.enchantedlearning.com/subjects/dinosaurs/dinofossils/Fossiltypes.html
Other possible sources of quiz items on fossils: (Downloaded 04/16/16)

1. https://mrssmiths4thportfolio.wikispaces.com/file/view/fossil+quiz.pdf
2. http://www.marcom.com.au/SGuides/ZZVECS/6VCSQS06.pdf
3. https://www.nps.gov/blca/learn/education/upload/fossils-2.pdf
4. http://www.biorules.org/Biology/articles/hist_life/Chap12PracTest.pdf
5. http://scioly.org/wiki/images/4/44/2015CT_FOSS1_TESTKEY.pdf
General Biology 2
genotype frequencies and derive the Hardy-Weinberg equation
Lesson 9.1: Mechanisms
that Produce Change
in Populations (1 of 2)
DEPED COPY
100 MINS
Content Standard
The learner will be able to understand the Hardy- Weinberg Principle and use its
equation to test whether a gene (or a population in a larger scale) is in equilibrium
or it is changing.
Learning Competency
The learners shall be able to explain the mechanisms that produce change in 70
populations from generation to generation (STEM_BIO11/12-IIIc-g-9) LESSON OUTLINE
Specific Learning Outcomes Introduction Definition of Terms 10 Motivation Observation 5 Instruction
Lecture on Hardy-Weinberg Principle 60 Practice Word Problem 10 Enrichment
• explain that genetic variation is the prerequisite and should therefore be present for
any genetic process to cause change in populations from generation to generation; Group Work 15 Evaluation Assignment 20
• state the Hardy-Weinberg Principle;
Attachment Teaching Hardy-Weinberg in the Classroom
• enumerate the conditions that should be present for a gene or in a larger scale, a
population, to attain Hardy-Weinberg equilibrium; and • calculate gene and Materials
Pictures; chocolate and milk coated fish-shaped pretzels available in most supermarkets; paper, pen,
and calculator 2014. Illinois: Pearson Education Inc. pp. 480-499.
Resources California: Brooks/Cole CENGAGE Learning. pp. 419-439.
rd
(1) Freeman, S. Biological Science. 3 ed. 2008. California: Pearson Benjamin Cummings. pp. 503-
525. Additional Resources at the End of this Lesson
(2) Reece, JB, LA Urry, ML Cain, S Wasserman, PV Minorsky, RB Jackson. Campbell Biology. 9 th ed.

General Biology 2 TG

Uploaded by

Copyright:

Available Formats

General Biology 2 TG

Uploaded by

Document Information

Original Description:

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

General Biology 2 TG

Uploaded by

Copyright:

Available Formats

The Commission on Higher Education

in collaboration with the Philippine Normal University

. Cladistics and Phylogeny . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 129 Chapter 4:

SAYSAY: MEANING HUSAY: MASTERY synthesize knowledge.

designed to be highly usable for teachers. It contains classroom activities and

On DepEd Functional Skills and CHED College Readiness Standards

College Readiness Standards Foundational Skills DepEd Functional Skills

Organismal The learners The learners shall be able to: STEM_BIO11/12-

2. explain how some organisms maintain steady

3. describe examples of homeostasis (e.g.,

regulation, osmotic balance and glucose levels) and the

2. explain sex linkage and recombination STEM_BIO11/12-

3. show patterns of descent with modification from

common ancestors to produce the organismal diversity

4. trace the development of evolutionary thought

5. explain evidences of evolution (e.g., biogeography, STEM_BIO11/12-

6. infer evolutionary relationships among organisms using the STEM_BIO11/12-

Code Book Legend

Science, Technology, Engineering and

1st Semester 2nd Semester 1st Semester 2nd Semester

Komunikasyon at Pananaliksik Pagbasa at Pagsusuri ng Iba’t-Ibang Contemporary Philippine Arts from

General Mathematics Statistics and Probability Media and Information Literacy

Research in Daily Life 2 Statistics and Probability

Basic Calculus Pre-Calculus

General Biology 2 General Biology 1

General Chemistry 2 General Chemistry 1

General Physics 1 Pre-Calculus, Calculus

General Physics 2 General Physics 1

I. Pedigree. Making use of diagrams showing the ancestral relationships and

3. Establish symbols for creating pedigrees

Sample pedigree with symbol guides

PRACTICE (25 MINUTES)

V. Curly (dominant), wavy (heterozygous) or straight (recessive) hair

1. DD x DD 100% DD 100% dominant

2. DD x Dd 50% DD: 50% Dd 100% dominant

25% DD: 50% Dd: 25% dd

5. Dd x dd 50% Dd: 50% dd 50% dominant: 50% recessive

Specific Learning Outcomes

INTRODUCTION (5 MINS) Relevant Vocabulary

who are bald

As a homework, provide this narrative to the class:

General Biology 2 LESSON OUTLINE

• make a research paper/case study/poster on a non-Mendelian genetic trait

C. Use ABO blood typing in humans as example

5. Go back to the Motivation narrative

2. In a hypothetical plant, a serrated leaf margined plant, when crossed with a

Practice Building Models of DNA 5 Enrichment Conversion to

60 MINS mRNA Transcripts 5

Specific Learning Outcomes

Introduction Communicating Learning Objectives 5 Motivation Group Work 5 Resources

Summary of Important Physical Properties

BIOMOLECULE Physical Property Functional Relevance

Peptide Bond Links amino acids together

complementary (template) sequence.

Coding sequence ~ mRNA transcript 5’ AUGCAUAGAUUAGGAUAUCCCAGAUAG 3’ (Answer)

Show the learners how to read the codon Table

3’ TAC_ _ _TCT_ _ _ CCTATAGGGTCT 5’

General Biology 2 LESSON OUTLINE