Biology

Class: 11
Unit: 1
1. The branch of biology, which deals with the life process,
and function of processes is known as:
A. Physiology B. Pathology C. Histology D. Evolution
2. Discovered the microscopic creature under microscope in
the red blood cells of malarial patient:
A. Ronald Ross B. Laveran C. Grassy D. A.F.A king
3. Physical basis of life is:
A. Nucleotide and proteins B. Nucleus C. Cell D. Protoplasm
4. The life was evolved first:
A. On earth B. In water C. In sky D. On the hill
5. The ________ structure was first proposed by Robertson:
A. Cellulo-protein B. Star protein C. Cylo protein D. Lipo
protein
6. Opening and closing of stomata is controlled by which of
the following taking place in the guard cells?
A. Turbidity B. Turgidity C. C. Flaccidity D. Turgor Force
7. If the eyepiece of a microscope is marked 10X and the high
power objective is marked 44X, the total magnification is:
A. 100 B. 144 C. 440 D. 1044
8. Which one of the following areas of biological study could
produce evidence to prove conclusively that two organisms
belong to the same species?
A. Anatomy B. Embryology C. Genetics D. Physiology
9. _________ is a science of exception:
A. Biology B. Zoology C. Botany D. Pathology
10. The branch of biology, which deals with the continuous
adaptation of living organisms to their environment, is known
as:
A. Adaptation B. Evolution C. Similarity D. Genetics
11. Palaeobotany is study of:
A. Living plants B. Dead plants C. Fossil plants D. Fossil animas
12. The word Biology has been derived from _________
language.
A. English B. Latin C. Greek D. French
13. The name malaria is a combination of two _________
words.
A. Italian B. Latin C. English D. French
14. It is currently estimated that the age of the earth is about:
A. 1 billion years B. 4 billion years C. 1 light year D. 100 billion
years
15. An educated guess is known as ______.
A. Hypothesis B. Theory C. Statement D. Problem
 Biology
Class: 11
Unit: 2

1. If one ribose molecule were bonded to one adenine A. C12H35COOH B. (C6H10O5) n

molecule and one Phosphate molecule, we would have a C. C708H1130O224N180S4P4 D. C12H22O11
A. Ribosome B. Nucleotide C. Nucleic acid D. ATP E. ADP 18. Assuming that only 20 commonest amino acids are
2. An organic compound in which hydrogen and oxygen are present in a given organism, how many different dipeptides
present in the same ratio as in water is might theoretically be found in it?
A. Fat B. Carbohydrate C. Protein D. Nucleic acid E. All of the A. 20 B. 40 C. 100 D. 400
above 19. Why do proteins have a buffering effect in cells?
3. Deficiency of vitamin A causes A. They are non - polar B. They are amphoteric C. They
A. Rickets B. Osteomalacia C. Delay in coagulation of blood D. contain basic amino acids
Night blindness E. Anemia D. They are a major component of cell surface membranes
4. Steroids consist of _______ 6-membred carbon rings and 20. The most abundant component of a living cell is
one 5-membred carbon ring. A. Carbohydrates B. Proteins C. Lipids D. Water
A. Four B. Three C. Two D. Five E. Six 21. Which of the following are true:
5. What occurs when sucrose is broken down to A. glucose + fructose = maltose B. glucose + galactose =
monosaccharides? sucrose C. glucose + glucose = maltose
A. reducing sugars and releasing water B. condensation of D. glucose + glucose = sucrose
reducing sugars using water C. hydrolysis, releasing reducing 22. Which of the following molecules contain amino acids?
sugars and releasing water D. hydrolysis, releasing reducing A. Ascorbic acid B. Cellulose C. Collagen D. Glycogen
sugars and using water 23. The _________ structure was first proposed by Robertson:
6. The structure of a lipid contains all of the following EXCEPT: A. Cellulo-protein B. Star protein C. Cyto protein
A. A carboxyl group B. A CH2O basic structure C. A glycerol D. Lipoprotein
molecule D. A fatty acid molecule E. An OH group 24. The distinctive characteristic and functional group of fats
7. Stearin (C57 H10 O6) is an important example of: is:
A. Carbohydrates B. Proteins C. Waxes D. Acylglycerol E. A. Ketone B. Alcohol C. Peptide D. Ester
Nucleic Acids 25. Lipids are different types simple lipids include, natural
8. The above diagram represents the process of: fats, and oils and:
A. Hydrolysis B. Condensation C. Neutralization D. Metabolism A. Waxes B. Sterols C. Lipids D. Cholesterols
9. Sugar in stored in the liver as: 26. Cellulose is:
A. Starch B. Glycogen C. Maltose D. Cellulose A. Disaccharide B. Pentose Polysaccharide C. Hexane
10. Which of the following is correct: Polysaccharide D. Mucopolysaccharide
A. Glucose + fructose = maltose B. Glucose + galactose = 27. Which of the following is not made up of hexose sugar
sucrose C. Glucose + glucose = maltose D. Glucose + glucose = subunits:
sucrose A. Sucrose B. Starch C. Glycogen D. Insulin
11. Polysaccharides are synthesized in plants by the process of 28. How many carbon atoms are found in monosaccharide
A. Hydrolysis B. Oxidation C. Condensation D. Glycolysis compound?
12. Which one of the following is not immediately essential A. 1 to 5 Carbon atoms B. 3 to 6 Carbon atoms
for protein synthesis? C. 5 to 10 Carbon atoms D. 5 to 15 Carbon atoms
A. ATF B. Enzyme C. Glucose D. mRNA 29. What is general formula of Carbohydrates?
13. The bond present between carbohydrate units A. Cn H2n On B. C2n Hn On C. Cn H2n O2n D. None of these
A. Peptide bond B. Covalent bond C. Glycosidic bond 30. Polysaccharides of two types, storage polysaccharides
D. Electrostatic bond and:
14. A lipid molecule is composed of glycerol fatty acid in a A. Structural polysaccharides B. Amino polysaccharides
ratio of: C. Functional polysaccharides D. Cellulosic polysaccharides
A. 1:1 B. 1:3 C. 1:4 D. 1:2 31. The test of reducing sugars can be done by using:
15. The formula of glyceraldehyde is: A. Cu+2 ions B. Cu+ ions C. Hg+ ions D. None of the above
A. C3H6O4 B. C3H6O3 C. C6H12O6 D. C6H14O7 32. Regarding starch molecule which statement is correct?
16. In AMYLOPECTIN the linkage is: A. Amylase chain of starch is branched, amylopectin is not
A. 1.3 B. 1.6 C. 2.6 D. 6.6 branched B. Amylopectin chain is branched, amylose is not
17. Which of the following organic compounds represents a branched C. Both chains are branched
protein? D. Both chains are unbranched
33. Assuming that only 20 commonest amino acids are 1. 1. Which is true about Turpentine oil:
present in a given organism, how many different dipeptides A.it is lipid B. terpenoid C.obtained from plants D. all of these
might theoretically be found in it? 2. Lipids found in our body as:
A. 20 B. 40 C. 100 D. 400 E. 10 A. triglyceride B. phospholipid C. cholesterol D. all of these
34. Which of the following has quaternary structure; 3. What is the base of steroid?
A. Myoglobin B. Actin C. Tropomyosin D. Hemoglobin A. cholesterol B. protein C. lipids D. carbohydrates
35. In a typical nucleotide the nitrogenous base is attached to 4. What is not true about Hemoglobin?
_________ carbon of pentose sugar: A. it is globular protein B. it has secondary level of protein
A. 6 th B. 5 th C. 4 th D. 3 rd E. 1 st structure
36. Lysosomes function in: C. it is functional protein D. it is a dimmer
A. Protein synthesis B. Processing C. Intracellular digestion 5.The cytosol is not:
D. Lipid synthesis E. Carbohydrate synthesis A. plasma gel B. liquid matrix of cytoplasm C. pure organic
37. Steroids consist of _______ 6-membred carbon rings and D. organic and inorganic
one 5-membred carbon ring. 6. The second most abundant organic molecule of a cell is:
A. Four B. Three C. Two D. Five E. Six A. water B. proteins C. carbohydrates D. lipids
38. Which type of protein structure contains the three 7. During the digestion of starch:
dimensional structure? A. H2O is produced B. H2O is consumed C. CO2 produced
A. primary B. secondary C. tertiary D. quaternary D. CO2 consumed
39. Which one of the following combinations of statements is 8. The H of water produced during peptide bond formation
true of saccharides in living organisms? They provide energy comes from:
They form storage compounds They form supporting A. amino group B. carboxyl group C. α-carbon D. sometimes
structures from amino group and sometimes from carboxyl group
A. No No Yes B. No No No C. Yes No No D. Yes Yes No 9. Which one is more sweet in taste?
E. Yes Yes Yes A. glucose B. fructose C. lactose D. maltose
40. The diagram shows a molecule. H H | O N C C H | OH H C 10. The pyransoe ring of glucose in water is produced
H | H Which substance might include the above molecule? between carbon numbers:
A. Cellulose B. Serine C. Glucose D. Alanine A. 1and 2 B. 1 and 4 C. 1 and 5 D. 1 and 6
41. Listed below are some amino acids and their 11. Pick-out the odd one out:
corresponding mRNA triplets. amino acid mRNA triplet A .maltose B. galactose C. glucose D. fructose
phenylalanine UUU lysine AAG arginine CGA alanine GCA 12. Which of the following atoms is found in protein?
Which DNA sequence would be needed to produce the a. S b. F c. Mg d. P
polypeptide sequence alanine - arginine - lysine - 13. The next to simplest amino acid is:
phenylalanine? a. alanine b. lysine c. glycine d. aspartic acid
A. CGT GCT TTC AAA 14. The final product of hydrolysis of protein is:
B. CGT GCT TTC TTT a. CO2 and H2O b. Peptones c. Polypeptides d. Amino acids
C. CGU GCU UUC AAA 15. Formation of Glycogen is a type of:
D. CGU GCU UUC TTT E. GCT CGT TTC AAA a. hydration synthesis b. dehydration synthesis
42. Which of the following process is reverse of c. hydration analysis d. dehydration analysis
condensation? 16. Which one is a nucleotide?
A. Hydrolysis B. Dehydration synthesis C. Polymerization a. DNA b. NAD c. AMP d. NADP
D. Vaporization 17. dAMP is a constituent of:
43. The disease night blindness is caused by deficiency of a. tRNA b. DNA c. mRNA d .rRNA
vitamin: 18. Adenosine comprises:
A. A a. adenine and phosphate b. adenine and phospholipids
B. В c. adenine and sugar d. adenine and tyrosine
C. С 19. Which one of the following is not a pure carbohydrate?
D. D a. cellulose b. hemicellulose c. chitin d. glycogen
44. Micronutrient in abiotic components is 20. The richest source of energy is:
A. Carbon B. Hydrogen C. Potassium D. Iron E. All of the above a. glucose b. fructose c. fats d. proteins
45. Ribose and ribulose are the example of ________ class. 21. Examples of structural lipids are:
A. Triose B. Tetrose C. Pentose D. Hexose: a. phospholipids b. glycolipid c. sterols d. all of these
22. Which one is disaccharide?
a. glucose b. fructose c. galactose d. lactose
23. Which is nitrogen base?
a. choline b. ethanol amino c. serine d. all of these 47. What is unique of DNA?
24. The viscosity of protoplasm is comparable with that of: a. replication b. organic c. has n bases d. all of these
a. glycerol b. glycerine c. light machine oil d. all of these 48. Reverse of Dehydration synthesis is:
25. The property of contraction and relaxation of cytoplasm is A. hydrolysis b. oxidation c. reduction d. oxidation-reduction
attributable to special type of: 49. Phospholipids are:
a. carbohydrates b. lipids c. proteins d.nucleic acids a. polar b. non-polar c. polar on one end and non-polar on the
26. Amount of water in living cells varies from: other end d. sometimes polar and sometimes non polar
a. 75 – 89 b. 70 – 89 c. 60 – 89 d.65 – 89 50. Collagen is protein 'and:
27. Histones are: a. trimer b. dimmer c. monomer d. tripeptide
a. single protein b. different kinds of proteins c. conjugated 51. Glycerol is the backbone molecule for:
molecules d. carbohydrates a. disacchardies b. DNA c. triglycerides d. ATP
28. 3-D protems are due to: 52. All the information for the structure and functioning of a
a. primary structure b. tertiary structure c. secondary cell is stored in:
structure d. both primary and secondary structure a. DNA b. tRNA c. mRNA d. rRNA
29. Primary product of photosynthesis: 53. Basic unit of DNA is:
a. carbohydrates b. proteins c. lipids d. nucleotides a. nucleotide b. amino acid c. nucleic acid d. double helix
30. Total number of amino acids in insulin is: 54. Second most abundant compound in living organisms is:
a. 61 b. 41 c. 71 d. 51 a. protein b. lipids c. DNA d. carbohydrate
31. Amino acids of hemoglobin are arranged in dimmers, each 55. Tetroses are rare in nature and occur in:
dimer with: a. some bacteria b. few bacteria c. Bacteria d. most bacteria
a. 574 amino acids b. 287 amino acids c. 141 amino acids d. 56. Evaporation of only two ml out of one liter of water
146 amino acids lowers the temperature of the remaining 998 ml by
32. A chain containing two amino acids is known as: __________ oC.
a. dipeptide b. peptide c. aminopeptide d. diamino a. 0.01 b. 0.1 c. 1.0 d. 2.0
33. The simplest amino acid is: 57. Which of the following atoms is not found in protein?
a. alanine b. lysine c. glycine d. aspartic acid a. C b. O c. H d. P
34. The essential amino acid means: 58. Generally all the organic compounds contain the
a. formed with in the body b. enter from outside the body c. elements:
can change from one to another kind of amino acid d. 20 a. iron and oxygen b. carbon and oxygen c. carbon and
kinds of amino acids hydrogen d. carbon and nitrogen
35. The simplest fatty acid is: 59. Potential source of energy for cell activities:
a. acetic acid b. butyric acid c. palmatic acid d. oleic acid a. C – H b. H – H c. C – O – C d. C – C
36. The Nucleotide with single ring is: 60. At 25° C the concentration each of H+ and OH ions in pure
a. adenine b. guanine c. cytosine d. both a and b water is about:
37. Histone present in: a. 10 –7 ml/litre b. 10 –7 mole/litre
a. DNA b. RNA c. chromosome d. glycolipids c. 10 –7 mg/litre d. 10 –7 moles/m
38. Number of Nucleotides in A TP:
a. 1 b. 2 c. 3 d. 4
39. Most diverse macromolecules in a cell: Answers:
a. carbohydrate b. protein c. lipid d. DNA 1 D 2 D 3 A 4 B 5 C 6 C 7 B 8 A 9 B 10 C 11 A 12. A 13 A 14 D 15
40. Isoprenoid unit has no: C 16 C 17 B 18 C 19 B 20 C 21 D 22 D 23 D 24 D 25 C 26 D 27 B
a. N b. P c. O d. All of these 28 C 29 A 30 D 31 C 32 A 33 C 34. B 35 A 36 C 37 C 38 A 39 B
41. Number of Nucleotides in NADP: 40 D 41 B 42 C 43 D 44 B 45 D 46 C 47 A 48 A 49 C 50 A 51 C
a. 1 b. 2 c. 3 d. 4 52 A 53 A 54 A 55 A 56. C 57 D 58 C 59 A 60 B
42. Which one is conjugated molecule?
a. protein b. carbohydrate c. glycoprotein d. lipid
43. Amylopectin not abundant in:
a. wheat b. maize c. both a and b d. pulses
44. Fruit sugar is usually:
a. glucose b. fructose c. maltose d. lactose
45. Example of vitamin/nucleotide/coenzyme is:
a. FAD b. NAD c. NADP d. All of these
46. Base pairs in E. coli:
A. 4288 b. 14000 c. 4639221 d. Four
the bases would be adenine:
1. A chromosome with unequal length of its arms is called: a. a. 5 % b. 10 % c. 20 % d. 40 %
metacentric b. sub metacentric c. acrocentric d. telocentric 16. A synthetic mRNA molecule is made by using only two
2. What was the number of wild type flies in F2 generation of types of nucleotide, containing adenine and cytosine. How
Morgan’s experiment? many different codons could it contains?
a. 728 b. 1550 c. 3470 d. 4252 a. 6 b. 4 c. 8 d. 16
3. In Hershey and Chase experiment 32p labeled 17. A protein includes 17 of the 20 different amino acids
bacteriophages allowed to infect the bacteria. During analysis commonly occurring in proteins, what is the minimum
32p activity was detected: number of different kinds of tRNA molecules involved in the
in culture medium on the surface of bacterial cell inside the synthesis of this protein:
bacterial cell both the surface and inside of bacterial cell a. 17 b. 51 c. 20 d. 102
4. In Meselson and Stahl experiment, the DNA from sample at 18. If the nucleus of a -human motor neuron contains 6.8
20 minutes, after start of experiment (labeling) made picograms (pg) of DNA, what mass of DNA is in the nucleus of
sediments at the: an actively dividing human skin cell likely to contain at the end
a. top b. intermediate c. bottom d. top-and intermediate of interphase?
5. Sickle cell anemia is the example of _________ type of a. 3.4 pg b. 13.6 pg c. 6.8 pg d. 20.4 pg
mutation. 19. What is the action of the enzyme DNA ligase?
a. transposition b. deletion c. insertion d. base substitution a. DNA is broken up at specific sites
6. Which of the following act as a stop codon? b. DNA Fragments are joined together
a. UGG b. UGC c. UAG d. UGU c. DNA Replication occur d. DNA Transcription Occur
7. In mitochondria UGA codon act to specify _________ 20. mRNA codon for the amino acid alanine is GCC. How many
instead stop codon. alanine molecules are present in the polypeptide, containing 8
a. arginine b. valine c. glutamic acid d. trytophan amino acids coded for by the following DNA template:
8. If the amount of adenine in ONA of a bacterial cell is 36 of TCGGCCTACCGGGCCCATGCCAAT zero one two three
the total nitrogenous bases. What will be the amount of 21. During DNA replication, lagging strand is formed by:
guanine in the DNA of a cell in next generation? a. P 1 b. P II c. P III d. All of these
a. 14 % b. 28 % c. 36 % d. 64 % 22. Genetic code for Glycine is:
9. If a mRNA is synthesized with all the different codons, what a. GGU b. UAG c. UGA d. AUG
is the minimum number of amino acids in the protein that is 23. RNA Polymerases in Prokaryotes are of:
formed by mRNA: a. one type b. two type c. four type c. three type
a. 64 amino acids b. 62 amino acids 24. In RNA nucleotides are attached by:
c. 60 amino acids d. 61 A.A a. peptide bonds b. phosphodies ter bond
10. In eukaryotic mRNA molecule there are 90 nucleotide c. hydrogen bond d. covalent bond
involved in translation process. What is the number of amino 25. Most amino acids are identified by:
acid in the protein formed by this mRNA molecule? a. one codon b. more than one codons c. two codons d. three
a. 29 amino acids b. 30 amino acids codons 26. The basic unit of heredity is:
c. 45 amino acids d. 90 amino acids a. DNA b. Replication c. Codon d. Gene
11. The complementary mRNA triplet for the DNA triplet GAT 27. Okazaki fragments are formed in:
would read: a. leading strand b. lagging strand
a. CAT b. CUA c. CTG d. TAG c. transcription d. translation
12. The two-pyrimidine bases most commonly found in DNA 28. The addition of a few bases in a gene is:
are: a. point mutation b. transposition c.. deletion d. inversion
a. cytosine and thiamine b. cytosine and uracil 29. The tail of mRNA of eukaryotic cells is protected by:
c. adenine and thymine d. cytosine and thymine a. poly a b. 7 methyl gtp c. four or more u d. 7 methyl atp
14. It has been established that, in many cells, ribosomes 30. Each okazaki fragment is synthesized by DNA:
occur in chains along mRNA molecules. What is the advantage a. polymerase I b. polymerase II c. polymerase III d. primase
of this arrangement when compared with a situation in which 31. Down's syndrome is due to:
ribosomes occur singly? a. an extra X chromosome b. an extra autosome
a. a greater variety of polypeptides can be produced c. a missing X chromosome d. a missing autosome
b. fewer tRNA molecules are used in protein synthesis 32. The' replication of DNA in a semi conservative manner was
c. larger number of polypeptides can be produced practically demonstrated in 1958 by Mathew Meselson and:
d. polypeptides can be produced more rapidly a. Rosalind b. Franklin Stahl c .Maurice Wilkins d. Griffith
15. Biochemical analysis of a sample of DNA showed that 40
of the nitrogenous bases was cytosine, what percentage of d. Charles Darwin
33. The chromosome is: 51. First evidence that genes reside on the chromosomes was
a. gene b. genes + protein c. gene + protein d. DNA + genes presented by:
34. Gene action in neurospora was studied by: a. Sutton b. Morgan c. Correns d. Mendel
a. beadle and best b. baddle and tatum 52. DNA was first discovered by:
c. beadle and tatum d. banting and tatum a. Alfred Hershey b. Martha Cahse c. J.W. Watson d. Friedrich
35. The one gene one enzyme explanation of gene action was Miesche
developed by: Answers:
a. Morgans and Muller b. Beadle and Best
c. Beadle and Tatum d. Banting and Tatum 1 B 2 C 3 C 4 C 5 D 6 C 7 D 8 A 9 D 10 A 11 B 12. D 13 B 14 D 15
36. The only difference between the normal and sickle cell B 16 C 17 D 18 * 19 A 20 C 21 B 22 B 23 D 24 A 25 A 26 B 27 B
hemoglobin is that at one place in the chain of amino acids 28 D 29 B 30 A 31 A 32 C 33 B 34. B 35 C 36 B 37 C 38 D 39 D
glutamic acid, in the latter, is replaced by: 40 B 41 C 42 C 43 B 44 D 45 B 46 A 47 B 48 A 49 C 50 D 51 A 52
a. histidine b. leucine c. proline d. valine A
37. The existing of familial diseases was first proposed by:
a. Archibald Garrot b. William Bateson
c. G.W Beadle d. both a and b
38. The DNA strands open up at the place where enzyme is
attached to the template strand forming:
a. rRNA b. Transcription bubble c. mRNA d. tRNA
39. At the time of DNA replication, the primer is recognized
by:
a. DNA polymerase I b. DNA polymerase II c. DNA polymerase
III d. any of them
40. RNA Polymerases in Eukaryotes are of:
a. one type b. two type c. three type d. four type
41. The basic monomers used in DNA replication are:
a. glucose b. DNA nucleotides c. fatty acids d. amino acids
42. To make a karyotype, chromosomes are photographed
during:
a. meiosis b. interphase c. fertilization d. mitosis
43. When a mutation is limited to the substitution of one
nucleotide pair for another, it is called a:
a. translocation point b. mutation c. inversion d. deletion
44. The creation of Mutations is called:
a. mutagenesis b. evolution c. development d. mutagens
45. Which mutations have evolutionary importance?
a. in blood cell b. in germ line cells
c. in stem cells d. in somatic cells
46. During translation, peptide bond is formed in the initiation
complex of ribosome at:
a. P site b. A site c. E site d. Any of them
47. Garrod investigated that in the disease alkaptonuria, the
patient produces urine containing:
a. uric acid b. gentisic acid
c. homogentisic acid d. heterogentisic acid
48. The length of a strand of DNA from a single human
chromosome is about:
a. 5 mµ b. 5 mm c. 5 mµ d. 5 cm
49. In phosphodiester, phosphate is linked to two sugars by
means of a pair of ester bonds which are:
a. P – O – C b. C – O – C c. N – H d. C – N
50. Mendel's work was rediscovered by:
a. Karl Correns b. Walter Sutton c. Thomas Hunt Morgan