Veterinary World, EISSN: 2231-0916 RESEARCH ARTICLE

Available at www.veterinaryworld.org/Vol.13/February-2020/8.pdf Open Access

Identification and characterization of Salmonella spp. from samples of

broiler farms in selected districts of Bangladesh
Debashish Mridha1, Md. Nasir Uddin1, Badrul Alam1, A. H. M. Taslima Akhter2, SK. Shaheenur Islam3, Md. Saiful Islam3,
Md. Shahidur Rahman Khan1 and S. M. Lutful Kabir1

1. Department of Microbiology and Hygiene, Bangladesh Agricultural University, Mymensingh 2202, Bangladesh; 2. Food
Safety Program, Food and Agricultural Organization, Institute of Public Health, Mohakhali, Dhaka 1215, Bangladesh;
3. Epidemiology Unit, Department of Livestock Services, Krishi Khamar Sarak, Farmgate, Dhaka 1215, Bangladesh.
Corresponding author: S. M. Lutful Kabir, e-mail: [email protected]
Co-authors: DM: [email protected], MNU: [email protected],
BA: [email protected], AHMTA: [email protected], SKSI: [email protected],
MSI: [email protected], MSRK: [email protected]
Received: 22-08-2019, Accepted: 02-01-2020, Published online: 13-02-2020

doi: www.doi.org/10.14202/vetworld.2020.275-283 How to cite this article: Mridha D, Uddin MN, Alam B, Akhter AHMT,
Islam SKS, Islam MS, Khan MSR, Kabir SML (2020) Identification and characterization of Salmonella spp. from samples of
broiler farms in selected districts of Bangladesh, Veterinary World, 13(2): 275-283.

Abstract
Background and Aim: Salmonella spp. are an important group of pathogens responsible for human and animal diseases.
This study aimed to estimate the prevalence and identify and characterize of Salmonella spp. isolated from broiler farms of
Gazipur, Tangail, and Dhaka districts of Bangladesh. This study also evaluated the difference of Salmonella positivity status
between two groups of farms, good practices adapted in broiler rearing at the project intervened farms, and non-project
intervened traditional farms.
Materials and Methods: A total of 352 samples including 128 cloacal swabs, 32 whole carcasses, 64 feed, 64 water, and
64 attendants’ hand rinses were collected through convenient sampling technique from 16 poultry food safety project of
Food and Agricultural Organization of United Nations Bangladesh intervened farms and other 16 non-project intervened
farms in the same location. Various cultural based techniques and biochemical methods were employed for the estimation
of prevalence, isolation, and identification of Salmonella spp. which was further evaluated by polymerase chain reaction.
Antimicrobial susceptibility test using disk diffusion methods and serogrouping by slide agglutination test was accomplished
for additional characterization.
Results: Among the samples, an overall prevalence of Salmonella spp. was 31.25% (110/352) (95% confidence interval
[CI]=26.44-36.38%). However, the prevalence of Salmonella spp. was 24.43% (43/176) (95% CI=18.28-31.47) in project
intervened farms and 38.07% (67/176) (95% CI=30.87-45.68%) in non-intervened farms. Among the 110 isolates, 31.82%
(35/110) were fitted under serogroup B, and the rest of the isolates 75 (68.18%) under serogroup D. Of 110 isolates, 82.72%,
77.27%, 81.82%, and 79.09% were susceptible to ciprofloxacin, gentamycin, norfloxacin, and streptomycin, respectively.
In addition, 81.82% and 80% isolates were resistant to erythromycin and tetracycline, respectively. Isolated Salmonella spp.
presented moderate resistance to both amoxicillin and azithromycin. Alarmingly, 80.91% (89/110) isolates were shown to
be multidrug-resistant Salmonella spp.
Conclusion: The study has presented a significant variation of the prevalence of Salmonella spp. between project
intervened and non-project intervened farms, and this indicates project intervened farms are comparatively safer than the
non-intervened farms considering public health and food safety grounds. This research outcome also has highlighted a
substantial proportion of poultry origin multidrug resistance Salmonella spp. is a potential source of public health hazards.
In this regard, proper awareness creation and motivational activities on good agriculture practices in poultry rearing and
maintaining good personal hygiene at the farmers’ level are warranted through participatory training.
Keywords: good agriculture practices, hygienic practices, multidrug resistance, poultry, Salmonella spp.
Introduction more than 2600 serotypes can prompt of human and
Salmonella spp. are commonly responsible for animal gastrointestinal infection such as gastroenteri-
various pathogenic processes in human and animal, tis, typhoid fever, paratyphoid fever, and can cause
including poultry [1]. Among the foodborne diseases of serious ailments for younger and aged people, and
caused by bacterial pathogens, Salmonella is one of even result of death [2-4]. Human consumed differ-
the most important zoonotic pathogens which have ent types of food such as food-producing animals
including poultry especially broiler and layer chicken
Copyright: Mridha, et al. Open Access. This article is distributed under meat, eggs, seafood, beef, pork, vegetables, and con-
the terms of the Creative Commons Attribution 4.0 International
License (http://creativecommons.org/licenses/by/4.0/), which taminated water are the main source of foodborne
permits unrestricted use, distribution, and reproduction in any illness in human [5,6]. It causes endemic salmonel-
medium, provided you give appropriate credit to the original
author(s) and the source, provide a link to the Creative Commons losis worldwide and reasons a colossal economic loss
license, and indicate if changes were made. The Creative Commons in livestock and poultry industry in Bangladesh [7].
Public Domain Dedication waiver (http://creativecommons.org/
publicdomain/zero/1.0/) applies to the data made available in this
Among the bacterial diseases, Salmonella infection
article, unless otherwise stated. is one of the major problems for poultry farming in
Veterinary World, EISSN: 2231-0916 275
 Available at www.veterinaryworld.org/Vol.13/February-2020/8.pdf

Bangladesh, which is considered a key threat of the difference of Salmonella positivity status between
poultry industry [8]. In Bangladesh, the occurrence two groups of farms, good practices adapted in broiler
of Salmonella infection is about 21-30% in layer rearing at the project intervened farms, and non-proj-
and about 15% in broiler which is measured as the ect intervened traditional farms.
highest prevalence among different types of poultry
Materials and Methods
disease [9,10], among which a variety of acute and
chronic diseases in poultry are included [11]. Chicks Ethical approval and informed consents
can be infected with Salmonella spp. by vertical trans- The farms were selected after consultation with
mission through infected parents or by horizontal the sub-district (Upazila) livestock office of each
transmission through hatcheries, sexing in contam- study site taking into consideration of willingness of
inated hatcheries, cloacal infection, and transporta- the farmers. No ethical approval was required; how-
tion of equipment and feed [12]. Motile Salmonella ever, during the collection of samples; verbal consent
(paratyphoid group) infection causes salmonellosis in was taken from each of the farm owner/managers.
chickens with zoonotic significance [13]. Study area and study period
It is very common of broiler farming with low or The study was conducted in three different dis-
no biosecurity practices in Bangladesh where most of tricts (Dhaka, Gazipur, and Tangail) of Bangladesh
the broiler farms have been developed near the dwell- under this study from May 2017 to December 2017
ings or close proximate to the human habitats is a sig- (Figure-1). Dhaka district is located in between
nificant hazard for public health at present time [14]. 23°22’30” and 24°22’20” north latitudes and in
In addition, poultry feces are used in the agricultural between 89°41’6” and 90°59’23” east longitudes.
field and/or as fish feed without proper treatment is Gazipur district is located in between 23°53’ and
deemed to be potentially risky practices for the public 24°20’24” north latitudes and in between 90°04’ and
health view point. Showing antimicrobials’ resistance 90°49’ east longitudes. Tangail district is located in
by pathogenic bacteria is a universal public health between 23°59’50” and 24°48’51” north latitudes and
concern throughout the world especially in develop- in between 89°48’50” and 90°51’25” east longitudes.
ing countries [3,14]. The results of imprudent use of
Farm selection, sample collection, and processing
antimicrobial agents to minimize bacterial infection
or as a growth promoter in poultry production are Sixteen (16) project intervened farm with an
the major determinants for the emergence of multi- inclusion criterion of a minimum flock size of ≥2000
drug-resistant pathogenic bacteria [3,15]. Because of that comprised 12 from Gazipur district, two from
the phenomenon of developing multidrug-resistant Dhaka, and two from Tangail district were included
Salmonella isolates, the management of Salmonella under this survey with good biosecurity and farm
infection using regular drugs is very difficult [16]. practices from May 2017 to December 2017. A similar
Considering the urgency of the above, the survey of number of farms (n=16) were included randomly from
Salmonella in food animal production together with the same study sites to match the project intervened
surveillance on antimicrobial resistance pattern was farm for comparing the best farm practices among the
very essential [17]. two groups.
Many previous Salmonella studies in country Three hundred and fifty-two (352) different
and abroad have used poultry, poultry products and samples were randomly collected through convenient
environmental samples for isolation and identifica- sampling technique from 32 broiler farms in three dif-
tion of the organism [7,18-22]. Since, lack of study ferent districts, of which, 75% (n=264) samples (96
to evaluating the Salmonella spp. from broiler farms cloacal swab, 24 whole carcasses, 48 feed, 48 water,
with the comparison between two groups of the farm, and 48 attendant hand rinse) were collected from 24
namely, project-intervened farms with best practices farms (n=12 project intervened, and n=12 project
versus non-intervened farm with traditional practices. non-intervened) of Gazipur district, 12.5% (n=44)
The farmers of the project-intervened farms were samples (16 cloacal swab, four whole carcasses, eight
trained on poultry farming in compliance with good feed, eight water, and eight attendant hand rinse) were
practices of biosecurity measures such as provision collected from four farms (n=2 project intervened,
of perimeter fencing, netting of the farm, footwear and n=2 project non-intervened) of Tangail district,
clean entry in the farm, all in all-out, and cleaning and remaining 12.5% (n=44) samples (16 cloacal
and sanitation, and judicial use antibiotics through swab, four whole carcasses, eight feed, eight water,
the Food and Agricultural Organization (FAO)-Food and eight attendant hand rinse) were collected from
Safety Program project intervention to be appropriate four farms (n=2 project intervened, and n=2 proj-
for safer poultry production considering public health ect non-intervened) of Dhaka district. Normal saline
hazard. (0.85% NaCl) was used for the collection of cloacal
This study aimed to estimate the prevalence of swabs, 0.1% peptone water was used for the collection
and identify and characterize Salmonella spp. isolated of attendants’ hand rinse water. After collection, sam-
from broiler farms of Gazipur, Tangail, and Dhaka ples were shifted to the Bacteriology and Molecular
districts of Bangladesh. This study also evaluated the Microbiology Laboratory of the Department of
Veterinary World, EISSN: 2231-0916 276
 Available at www.veterinaryworld.org/Vol.13/February-2020/8.pdf

Figure-1: Location of the broiler farms, equal number farms (n=16) both in project intervened and non-intervened
category were included from three districts of Bangladesh (as the coordinates of some farms are same, all farms are not
visualized in the map).

Microbiology and Hygiene, Bangladesh Agricultural Molecular detection of Salmonella spp.

University maintaining proper cool chain using ice- For the molecular assay, the DNA template was
box. All collected samples were processed and cul- equipped with the boiling method as described by
tures within 5-6 h of its collection time. The samples Queipo-Ortuño et al. [24]. The 16S rRNA gene-based
of 10 g of whole carcasses and 10 g of feed samples PCR was performed for the confirmation of the genus
were performed homogenate using mortar and pestle Salmonella. Primers were used for the amplification
and dissolved in 90 ml of 0.1% peptone water, respec- of the 16S rRNA gene according to the procedure
tively, for culture and further testing. described by Lin and Tsen [25] and shown in Table-1.
The reaction mixture (20 µl) was prepared by mix-
Isolation and identification of Salmonella spp. ing 10 µl master mixtures (Promega, USA), 1 µl for-
Isolation and identification of Salmonella spp. ward primer (10 pmol), 1 µl reverse primer (10 pmol)
were carried out according to the methods described (BioServe Biotechnologies Ltd., USA), 3 µl DNA
by Akbar and Anal and ISO 6579:2002(E) [3,23] template, and 5 µl deionized water. The PCR reactions
with a little modification. Separately, the processed were carried out using a thermocycler (Astec, Japan)
sample of 50 µl was taken and poured on Xylose with the following program: Initial denaturation with
Lysine Deoxycholate agar (XLD) (HiMedia, India) one cycle for 5 min at 94°C, 30 cycles each consist
and spread using glass spreader, and then incubated of denaturation with 30 s at 94°C, annealing with
at 37°C for 24 h. After incubation, cultural charac- 30 s at 50°C, extension with 30 s at 72°C, and a final
teristics were observed, on XLD agar, Salmonella extension step of 5 min at 72°C. PCR products were
presented pink colonies having a black center. The analyzed by 2% agarose (Invitrogen, USA) gel elec-
suspected colonies were then subcultured on XLD trophoresis and the bands were visualized with ultra-
agar and incubated again at 37°C for 24 h for obtain- violet (UV) light after staining with ethidium bromide
ing pure colonies. For identification of suspected (0.5 µg/ml) for 10 min in a dark place. Bands were
colonies, Gram’s stain, motility test, and different visualized and images were captured on a UV transil-
biochemical tests including sugar fermentation (dex- luminator (Biometra, Germany).
trose, sucrose, lactose, maltose, and mannitol), methyl Serogrouping of Salmonella by O-antigen test
red, Voges–Proskauer, indole, citrate, and urease tests Serogrouping of isolated Salmonella spp. was
were accomplished. The isolated colonies were then done by slide agglutination test using commercial
subjected to molecular confirmation through poly- Salmonella-specific polyvalent O (A-I) antisera,
merase chain reaction (PCR), antimicrobial suscepti- Salmonella O Group B (Factor O: 4, 5, and 27) anti-
bility test, and serogrouping. sera, and Salmonella O Group D (Factor O: 9, 46)
Veterinary World, EISSN: 2231-0916 277
 Available at www.veterinaryworld.org/Vol.13/February-2020/8.pdf

antisera kits (S & A Reagents Lab Ltd., Bangkok, Info 7 program [28] for statistical analysis. A univar-
Thailand) following the procedure described by iate logistic regression model was used to calculate
Dhakal et al. [11]. the odds ratio (OR) for evaluating the association
Antimicrobial susceptibility test of best farm practices among two groups of farms
All isolated Salmonella spp. were confirmed (project-intervened and non-project-intervened) with
on antimicrobial susceptibility test by disk diffusion p=0.05 were used to determine statistical significance.
method to determine antimicrobial profile following Proportion, percentage, and 95% confidence inter-
the method described by Bauer et al. [26] and Clinical val (CI) were calculated using an excel data analysis
and Laboratory Standards Institute (CLSI) [27]. The tool pack for estimating prevalence status in various
following eight commercially available antimicro- parameters of two groups of farms.
bial disks (HiMedia, India) were used at indicated Results
concentration (µg/disk): Amoxicillin (AMX, 30 µg), Prevalence estimation and isolation of Salmonella spp.
azithromycin (AZM, 30 µg), ciprofloxacin (CIP, A total of 352 samples were collected from 32
5 µg), erythromycin (E, 30 µg), gentamicin (GEN, broiler farms of three different districts where 50%
10 µg), norfloxacin (NOR, 10 µg), streptomycin (n=176) samples were collected from project inter-
(S, 10 µg), and tetracycline (TE, 30 µg) to determine vened farms and rest 50% (n=176) samples were
the antimicrobial susceptibility patterns. After pre- collected from non-project intervened farms. Of
paring 0.5 McFarland standards bacterial suspension 352 samples, overall prevalence of Salmonella spp.
using normal saline, a sterile cotton bud was dipped was estimated at 31.25% (110/352) (95% CI=26.44%-
into the bacterial suspension. The excess fluid of 36.38%), a prevalence of 24.43% (43/176) (95%
a swab was removed by pressing firmly against the CI=18.28-31.47) was estimated in the project inter-
inside of the tube just above the fluid level. The bud vened farms and 38.07% (67/176) (95% CI=30.87-
was streaked over the entire surface of Mueller-Hinton 45.68) prevalence in non-project intervened farms
agar (HiMedia, India) medium 3 times, rotating the (Table-2).
plate approximately 60 degrees after each application Of 128 cloacal swab samples, 46.09% (n=59)
to ensure an even distribution of the inoculums. The samples were found positive for Salmonella spp.
antimicrobial disks were placed individually using (Figure-2). Similarly, of 64 feed samples, 64 water
sterile forceps and then gently press down onto the samples, 18.75% (n=12), and 17.19% (n=11) were
agar. The plates were inverted and incubated at 37°C found positive, respectively, for Salmonella spp.
overnight. After incubation, the zone of growth inhibi- A total of 64 water samples, 64 farm attendant’s hand
tion (diameter) of each antimicrobial agent was mea- rinse water sample, 32 whole carcasses samples,
sured according to the guidelines of CLSI [27]. 17.19% (n=11), 23.44% (n=15), and 40.63% (n=13),
Data management and statistical analysis were shown positive for Salmonella spp. (Figure-2).
The data were captured and recorded in Of 32 farms, 68.75% (n=22) farms were found
Microsoft Excel® worksheet and imported into Epi positive with Salmonella spp. of which 28.15% (n=9)

Table-1: The list of primers used for the identification of Salmonella spp.

Primer Sequence (5’‑3’) Target Amplicon size (bp) Reference

Sal 16S rRNA F TGTTGTGGTTAATAACCGCA Salmonella 16S rRNA gene 574  [25]
Sal 16S rRNA R CACAAATCCATCTCTGGA

Table-2: Prevalence of Salmonella spp. in broiler farms of three districts of Bangladesh (project intervened farms,
n=176, and project non‑intervened farms, n=176).

District Category of farms Number of Number of Prevalence 95% CI

sample (n) isolates (positive)
Gazipur Project intervened 132 33 25 17.88‑33.28
Non‑project intervened 132 48 36.36 28.17‑45.18
Overall Gazipur 264 81 30.68 25.17‑36.62
Tangail Project intervened 22 7 31.82 13.86‑54.87
Non‑project intervened 22 9 40.91 20.71‑63.65
Overall Tangail 44 16 36.36 22.41‑52.23
Dhaka Project intervened 22 3 13.64 2.91‑34.91
Non‑project intervened 22 10 45.45 24.39‑67.79
Overall Dhaka 44 13 29.55 16.76‑45.20
Three districts (Gazipur, Project intervened 176 43 24.43 18.28‑31.47
Tangail, and Dhaka) Non‑project intervened 176 67 38.07 30.87‑45.68
Overall (three districts) 352 110 31.25 26.44‑36.38
CI=Confidence interval

Veterinary World, EISSN: 2231-0916 278

 Available at www.veterinaryworld.org/Vol.13/February-2020/8.pdf

farms were under project intervened category and serogroup B (O:4,5,27) and 69.77% (n=30) under
remaining 40.63% (n=13) farms under non-project serogroup D (O:9,46). In other respects 60.9% (n=67)
intervened category (Figure-2). The variation of prev- isolates were confirmed from non-project intervened
alence among two groups of farms (project intervened farms, of which 32.84% (n=22) were classified under
and non-intervened) was observed among the three serogroup B (O:4,5,27) and 67.16% (n=45) under
districts (Table-2). The non-intervened farms were serogroup D(O:9,46). More than two-third (68.18%,
found to be riskier than the project-intervened farms 75/110) isolates of two categories of farms were clas-
considering Salmonella positivity status (OR=1.9, sified under serogroup D (O:9,46) and rest of the iso-
95% CI=1.20-3.00, p=0.005) and statistically found lates (31.82%, 35/110) were under the serogroup B
significant (Table-3). (O:4,5,27)(Table-4).
Molecular detection by PCR Antimicrobial susceptibility of Salmonella spp.
Genus specific 16S rRNA gene-based PCR was Antimicrobial susceptibility test was carried out
performed for the confirmation of Salmonella iso- in 110 Salmonella isolates against eight selected anti-
lates. All Salmonella isolates gave specific amplifi- microbial agents. The results of susceptibility analysis
cation (574 bp). The results of PCR are presented in showed that 42.73%, 82.72%, 77.27%, 81.82%, and
Figure-3. 79.09% of Salmonella isolates were susceptible to
Serogrouping of Salmonella spp. amoxicillin, ciprofloxacin, gentamycin, norfloxacin,
Serogrouping of Salmonella isolates was per- and streptomycin, respectively. The resistance analy-
formed by slide agglutination test using commer- sis showed that 42.73%, 47.27%, 81.82%, and 80%
cial Salmonella specific polyvalent O (A-I) antisera, of Salmonella isolates were resistant to amoxicillin,
Salmonella O Group B (Factor O: 4, 5, 27) antisera, azithromycin, erythromycin, and tetracycline, respec-
and Salmonella O Group D (Factor O: 9, 46) anti- tively (Figure-4).
sera (S & A Reagent Lab). All isolates were posi- Antimicrobial resistance patterns of Salmonella spp.
tive to Salmonella Poly A-I antisera. Of 110 isolates, The results of antimicrobial resistance patterns
39.1% (n=43) isolates were from project intervened of Salmonella spp. are summarized in Table-5. Of 110
farms, of which 30.23% (n=13) were classified under (n=110) Salmonella spp., 9.09% (n=10) isolates were

Figure-2: Frequency of prevalence of Salmonella spp. with a standard error of the mean at different parameters of broiler
farming practices (farm=32, sample=352).

Table-3: Univariable logistic regression analysis for associating the best farm practices between two groups of broiler
farms with the likelihood of Salmonella infection in different parameters.

Parameter/sample type Farm type Positive Negative Odds ratio 95% CI p-value
Farm Project non‑intervened 13 3 3.37 0.71‑16.06 0.12
Project intervened 9 7
Cloacal swab Project non‑intervened 34 30 1.84 0.91‑3.72 0.08
Project intervened 24 39
Feed Project non‑intervened 4 24 1.17 0.26‑5.17 0.83
Project intervened 4 28
Water Project non‑intervened 7 25 1.96 0.52‑7.39 0.32
Project intervened 4 28
Attendants’ hand rinse water Project non‑intervened 22 10 0.41 0.12‑1.34 0.14
Project intervened 27 5
Whole carcass Project non‑intervened 8 8 2.2 0.53‑9.20 0.28
Project intervened 5 11
Overall Project non‑intervened 67 109 1.9 1.20‑3.00 0.005
Project intervened 43 133
CI=Confidence interval

Veterinary World, EISSN: 2231-0916 279

 Available at www.veterinaryworld.org/Vol.13/February-2020/8.pdf

resistant to one agent (TE), 6.63% (n=7) isolates were isolates were resistant against four agents (AMX-CIP-
resistant to one agent (E), 3.64% (n=4) isolates were NOR-S) (Table-5).
resistant to one agent (AMX), 1.82% (n=2) isolates In this study, multidrug-resistant Salmonella spp.
were resistant against two agents (TE-AZM), 17.27% were identified and presented resistant against two
(n=19) isolates were resistant against three agents or more antimicrobials, alarmingly, 80.91% (n=89)
(TE-E-AMX), 30 27.27% (n=30) isolates were resis- Salmonella isolates were established as multidrug-re-
tant against three agents (TE-E-AZM), 7.27% (n=8) sistant in this survey (Table-5).
isolates were resistant against three agents (TE-E-
Discussion
CIP), 4.55% (n=5) isolates were resistant against
three agents (E-AMX-GEN), 14 12.73% (n=14) iso- Despite the importance of the poultry sector in
lates were resistant against four agents (TE-E-AMX- the National Economy of Bangladesh, insufficient
AZM), 4.55 % (n=5) isolates were resistant against disease data brings bottlenecks toward understand-
four agents (TE-AMX-GEN-NOR), and 5.45% (n=6) ing the disease burden like its true prevalence, spatial
and temporal distribution, and economic impact [29].
Table-4: Summary of Salmonella spp. serogrouping. Among the different types of bacterial and viral origin
diseases in Bangladesh, Salmonella infection is cogi-
Category Isolates Number (%) of Salmonella
No. isolates tated to be one of the major problems nowadays [9,10].
In view of that, this survey was rational to determine
Poly Group B Group D
A‑I (O: 4,5,27) (O: 9,46)
the status of Salmonella spp. in broiler farming system
that will pave the way for a baseline data depository in
Project 43 100 13 (30.23) 30 (69.77)
intervened
the National Disease Control Program.
Non‑project 67 100 22 (32.84) 45 (67.16) The study estimated the overall prevalence
intervened of Salmonella spp. was 31.25% (95% CI=26.44%-
Total 110 100 35 (31.82) 75 (68.18) 36.38%), in broiler farms of poultry dense districts of
Bangladesh. The prevalence was found to be lower
in project intervened farms (24.43%, 95% CI=18.28-
31.47) than the non-project intervened traditional
farm (38.07%, 95% CI=30.87-45.68). Due to inter-
vention of good practices of biosecurity measures
such as provision of perimeter fencing, netting of
the farm, footwear clean entry in the farm, all-in all-
out practice, and cleaning and sanitation practices,
the likelihood of bacterial contamination was lessen
in project intervened farms than the non-project
intervened farms [30]. The project intervened farms
Figure-3: 16S rRNA gene-based polymerase chain reaction
of Salmonella spp. Lane 1 and 10: 100 bp DNA ladder;
were found to be protective considering Salmonella
Lane 2-8: Tested samples were positive for the 16S rRNA infection in this study (OR=1.9, 95% CI=1.20-3.00,
gene, Lane 9: negative control without DNA. p=0.005). This finding has validated the impact of

Figure-4: Proportion of antimicrobial susceptibility against eight selected antimicrobial agents is amoxicillin, azithromycin,
ciprofloxacin, erythromycin, gentamycin, norfloxacin, streptomycin, and tetracycline presented in three categories
(susceptible, intermediate, and resistant) of the pattern.

Veterinary World, EISSN: 2231-0916 280

 Available at www.veterinaryworld.org/Vol.13/February-2020/8.pdf

Table-5: Antimicrobial resistance pattern of Salmonella spp.

Isolates No. of agents Antimicrobial resistance No. (%) of No. (%) of multidrug
profile isolates resistant isolates
Salmonella spp. No. resistance demonstrated - - 89 (80.91)
1 TE 10 (9.09)
1 E 7 (6.63)
1 AMX 4 (3.64)
2 TE-AZM 2 (1.82)
3 TE-E-AMX 19 (17.27)
3 TE-E-AZM 30 (27.27)
3 TE-E-CIP 8 (7.27)
3 E-AMX-GEN 5 (4.55)
4 TE-E-AMX-AZM 14 (12.73)
4 TE-AMX-GEN-NOR 5 (4.55)
4 AMX-CIP-NOR-S 6 (5.45)
Total resistant isolates 110 (100)

good agriculture practices (GAP) on poultry rearing Salmonella-specific polyvalent O (A-I) antisera,
at the farmers’ level. Salmonella O Group B (Factor O: 4, 5, 27) antisera,
In this study, Salmonella spp. were isolated from and Salmonella O Group D (Factor O: 9, 46) antisera.
hand rinses of farm attendants as the earliest research Among the 110 isolates, 31.82% (n=35) were under
in Bangladesh. The presence of Salmonella in poultry serogroup B and 68.18% (n=75) isolates were under to
attendants’ hand rinse water (23.44%, 15/64) could serogroup D. The most prevalent serogroup identified
pose a serious impact on public health. This finding has in this study was serogroup D. This conclusion was in
partially dissenting with the studies of Paul et al. [7] agreement with the findings of Al-Mamun et al. [32].
and Akond et al. [31] as 50% and 6% poultry retailer About 30.56% (n=11) isolates were fitted to sero-
hand rinse water were found positive, respectively. In group B and 69.44% (n=25) fitted to serogroup D.
this study, feed samples were found to be contaminated The results of susceptibility test showed that
with Salmonella spp. (18.75%, 12/64). This finding isolated Salmonella spp. were highly resistant to
was reasonably supported by several authors [32,33], erythromycin (81.72%) and tetracycline (80%), and
as 28.56% Salmonella spp. described by Al-Mamun moderately resistant to amoxicillin (42.73%) and
et al. [32]. A total of 64 water samples were tested, azithromycin (47.27%). This finding is compatible
and 11 17.19% (n=11) samples were found positive. with the studies by many researchers [5,14,31,32];
This finding is compatible with the findings of sev- however, Islam et al. [18] showed that the iso-
eral researchers [32-34]. In this study, of 32 whole lated Salmonella spp. were highly sensitive and
carcasses, 40.63% (n=13) samples were positive for Ifeanyichukwu et al. [39] revealed as highly resistant
Salmonella spp. This finding has similarities with the to amoxicillin, and Akbar and Anal presented that the
studies of a few investigators [14,32]; however, Karim isolated Salmonella spp. from ready-to-eat poultry
et al. [8] showed only 20% Salmonella positivity in were highly susceptible to erythromycin [3]. On the
broiler meat. A total of 128 cloacal swab samples were other hand, most of the isolated Salmonella spp. were
collected, of which 46.09% (n=59) samples were found susceptible to ciprofloxacin (82.72%), gentamicin
positive for Salmonella spp. This finding was in con- (77.27%), norfloxacin (81.82%), and streptomycin
formity with the studies by some researchers [14,31]; (79.09%) [7,14,18,31]. On the contrary, this finding
however, Paul et al. [7] showed a very high prevalence is incompatible with the findings of several research-
(80%) in the cloacal swab. The overall prevalence of ers, among them Ifeanyichukwu et al. [39] presented
Salmonella spp. in broiler farming system was 31.25% the data where isolated Salmonella spp. were found to
and the farm level prevalence was 68.75% (Figure-4). be highly resistant to gentamycin, and Paul et al. [7]
This finding was well-matched with the studies by sev- showed the data where ciprofloxacin was susceptible
eral researchers [5,31,35]; nonetheless, Paul et al. [7] against merely 20% Salmonella isolates.
and Islam et al. [18] showed a relatively higher preva- In this investigation, of 110 Salmonella iso-
lence of Salmonella spp. from broiler farms as 53.33% lates, 56.36% (n=62) and 22.73% (n=25) isolates
and 66.67%, respectively. showed resistance against at least three and four
In this study, isolation and identification of antimicrobial agents, respectively, and two or more
Salmonella spp. were done through culturing of sam- antimicrobial agents 80.91% (n=89) isolates as mul-
ple on selective media, Gram’s stain, different bio- tidrug-resistant. The latter finding is well-matched
chemical tests, and finally confirmed by 16S rRNA with the studies by several researchers [14,32]. The
gene-based PCR. This method also used by several high proportion of multidrug resistance showed by the
researches [14,32,36-38]. isolated Salmonella spp. may be the result of the unju-
Serogrouping of Salmonella isolates was per- dicial use of different types of antimicrobial agents
formed by slide agglutination test using commercial in poultry production in Bangladesh with an aim to
Veterinary World, EISSN: 2231-0916 281
 Available at www.veterinaryworld.org/Vol.13/February-2020/8.pdf

retard the bacterial infection [14]. In addition, some References

antibiotics are being used unscrupulously in poul- 1. Freeman, B.A. (1985) Burrows Textbook of Microbiology.
try feed and water by the feed millers and farmers, 22nd ed. W. B. Saunders Company, Philadelphia. p464-472.
respectively, and these are also be the another cause 2. Zhao, X., Gao, Y., Ye, C., Yang, L., Wang, T. and Chang, W.
(2016) Prevalence and characteristics of Salmonella iso-
for showing multidrug resistance. The findings of this lated from free-range chickens in Shandong province,
study suggested that multidrug-resistant Salmonella China. Biomed. Res. Int., 2016: 8183931.
spp. isolated from broiler farms might be an important 3. Akbar, A. and Anal, A.K. (2015) Isolation of Salmonella
concern for public health. from ready-to-eat poultry meat and evaluation of its sur-
vival at low temperature, microwaving and simulated gas-
Conclusion tric fluids. J. Food Sci. Technol., 52(5): 3051-3057.
4. Li, Y., Xie, X., Xu, X., Wang, X., Chang, H., Wang, C.,
The presence of Salmonella spp. was confirmed Wang, A., He, Y., Yu, H., Wang, X. and Zeng, M. (2014)
from a wide range of samples at the broiler farming Nontyphoidal Salmonella infection in children with acute
system specifies severe public health importance. gastroenteritis: Prevalence, serotypes, and antimicrobial
This finding streamlines to GAP in poultry farming resistance in Shanghai, China. Foodborne Pathog. Dis.,
11(3): 200-206.
relating to maintaining proper farm biosecurity, all-in 5. Im, M.C., Jeong, S.J., Kwon, Y.K., Jeong, O.M., Kang, M.S.
all-out practices, withdrawal period, safe disposal of and Lee, Y.J. (2015) Prevalence and characteristics of
poultry waste and prudent use of antimicrobial agents Salmonella spp. Isolated from commercial layer farms in
along with maintaining personal hygiene are needed Korea. Poult. Sci., 94(4): 1691-1698.
6. Orji, M.U., Onuigbo, H.C. and Mbata, T.I. (2005) Isolation
to minimize the likelihood of Salmonella infection of Salmonella from poultry droppings and other envi-
in poultry and its antimicrobial-resistant, and further ronmental sources in Awka, Nigeria. Int. J. Infect. Dis.,
transmission in human as a consequence. To minimize 9(2): 86-89.
these public health threats, awareness creation and 7. Paul, P., Akther, S., Ali M.Z., Banu, H., Khan, M.S.R. and
Khatun, M.M. (2017) Isolation, identification and anti-
motivational activity on good hygienic practices and biogram study of Salmonella spp. from poultry farm envi-
GAP for poultry farmers through participatory train- ronment. Int. J. Anim. Biol., 3(2): 5-11.
ing under the “One Health” platform are very much 8. Karim, M.R., Giasuddin, M., Samad, M.A., Mahmud, M.S.,
necessitated. Islam, M.R., Rahman, M.H. and Yousuf, M.A. (2017)
Prevalence of Salmonella spp. In poultry and poultry prod-
Authors’ Contributions ucts in Dhaka, Bangladesh. Int. J. Anim. Biol., 3(4): 18-22.
9. Rahman, M.A., Rahman, M.M. Moonmoon, M., Alam, K.J.
SMLK planned and designed the study. DM, and Islam, M.Z. (2017) Prevalence of common diseases of
MNU, BA, AHMTA, and SKSI assisted in data col- broiler and layer at Gazipur district in Bangladesh. Asian J.
lection, laboratory work, data analysis, and drafting Med. Biol. Res., 3(2): 290-293.
of the manuscript. SMLK, SKSI, MSI, and MSRK 10. Al Mamun, M., Islam, K.M. and Rahman, M.M. (2019)
Occurrence of poultry diseases at Kishoregonj district of
assisted in data analysis and drafting of the manuscript. Bangladesh. MOJ Proteomics Bioinform., 8(1): 7-12.
All authors read and approved the final manuscript. 11. Dhakal, L.B., Dhakal, I.P., Yadav, S.K., Ahaduzzaman, M.
and Islam, M.Z. (2016) Prevalence and antibiotic resistance
Acknowledgments profile of Salmonella from livestock and poultry raw meat,
We appreciate the kind facilitation and valu- Nepal. Int. J. Mol. Vet. Res., 6(1): 1-22.
12. Opitz, H.M., El-Begearmi, M., Flegg, P. and Beane, D.
able suggestions from Technical Expert, Food Safety (1993) Effectiveness of five feed additives in chicks infected
Program of FAO of United Nations (FAO-UN), with Salmonella Enteritidis phage Type 13A. J. Appl. Poult.
Bangladesh, for conducting the study. We are indebted Res., 2(2): 147-153.
to sub-district (Upazila) and district livestock officers 13. Kabir, S.M.L. (2010) Avian colibacillosis and salmonello-
sis: A closer look at epidemiology, pathogenesis, diagnosis,
for their cooperation for farm selection under this control and public health concerns. Int. J. Environ. Res.
study, and also grateful to poultry farmers/attendants Public Health, 7(1): 89-114.
for their assistant to sample collection. 14. Rahman, M.A., Rahman, A.K.M., Islam, M.A. and
This study was supported by FAO-UN under Alam, M.M. (2018) Detection of multi-drug resistant
the project named “Improving Food Safety Program Salmonella from milk and meat in Bangladesh. Bangladesh
J. Vet. Med., 16(1): 115-120.
in Bangladesh” (Grant no. GCP/BGD/047/NET) in 15. Rahman, M.M., Rahman, M.M., Meher, M.M., Khan, M.S.I.
collaboration with the Department of Livestock of and Anower, A.K.M. (2016) Isolation and antibiogram
Services under the Ministry of Fisheries and Livestock, of Salmonella spp. from duck and pigeon in Dinajpur,
Bangladesh. Bangladesh. J. Adv. Vet. Anim. Res., 3(4): 386-391.
16. Mirza, S.H., Beeching, N.J. and Hart, C.A. (1996) Multi-
Competing Interests drug resistant typhoid: A global problem. J. Med. Microbiol.,
44(1996): 317-319.
The authors declare that they have no competing 17. Fernandez, A.E., Calleja, A.C., Fernández, G.C. and
interests. Capita, R. (2012) Prevalence and antimicrobial resis-
tance of Salmonella serotypes isolated from poultry in
Publisher’s Note Spain: Comparison between 1993 and 2006. Int. J. Food
Microbiol., 153(3): 281-287.
Veterinary World remains neutral with regard 18. Islam, M.J., Mahbub-E-Elahi, A.T.M., Ahmed, T. and
to jurisdictional claims in published map and institu- Hasan, M.K. (2016) Isolation and identification of
tional affiliation. Salmonella spp. from broiler and their antibiogram study in
Veterinary World, EISSN: 2231-0916 282
 Available at www.veterinaryworld.org/Vol.13/February-2020/8.pdf

Sylhet, Bangladesh. J. Appl. Biol. Biotech., 4(3): 46-51. (2017) Status of poultry industry in Bangladesh and the role
19. Al-Salauddin, A.S., Hossain, M.F., Dutta, A., Mahmud, S., of private sector for its development. Asian J. Poult. Sci.,
Islam, M.S., Saha, S. and Kabir, S.M.L. (2015) Isolation, 11(1): 1-13.
identification and antibiogram studies of Salmonella spe- 30. Ratananakorn, L. and Wilson, D. (2011) Zoning and com-
cies and Escherichia coli from boiler meat in some selected partmentalisation as risk mitigation measures: An example
areas of Bangladesh. Int. J. Basic Clin. Pharmacol., 4(5): from poultry production. Rev. Sci. Tech., 30(1): 297.
999-1003. 31. Akond, M., Shirin, M., Alam, S., Hassan, S.,
20. Sultana, M., Bilkis, R., Diba F. and Hossain, M.A. (2014) Rahman, M.M. and Hoq, M. (2013) Frequency of drug-re-
Predominance of multidrug-resistant zoonotic Salmonella sistant Salmonella spp. isolated from poultry samples in
Enteritidis genotypes in poultry of Bangladesh. J. Poult. Bangladesh. Stamford J. Microbiol., 2(1): 15-19.
Sci., 51(4): 424-434. 32. Al-Mamun, M.A., Kabir, S.M.L., Islam, M.M., Lubna, M.,
21. Jahan, F., Kabir, S.M.L. and Amin, M.M. (2013) Islam, S.S., Akhter, A.T. and Hossain, M.M. (2017)
Identification and antimicrobial resistance profiles of Molecular identification and characterization of Salmonella
Salmonella isolated from the broiler dressing plants asso- species isolated from poultry value chains of Gazipur and
ciated with their environments. Adv. Res. J. Microbiol., Tangail districts of Bangladesh. Afr. J. Microbiol. Res.,
1(1): 1-9. 11(11): 474-481.
22. Lu, Y., Wu, C.M., Wu, G.J., Zhao, H.Y., He, T., Cao, 33. Islam, M.M., Islam, M.N.,  Sharifuzzaman. and
X.Y., Dai, L., Xia, L.N., Qin, S.S. and Shen, J.Z. (2011) Fakhruzzaman, M. (2014) Isolation and identification of
Prevalence of antimicrobial resistance among Salmonella Escherichia coli and Salmonella from poultry litter and
isolates from chicken in China. Foodborne Pathog. Dis., feed. Int. J. Nat. Soc. Sci., 1(2014): 1-7.
8(1): 45-53. 34. Saha, A.K., Sufian, M.A., Hossain, M.I. and Hossain, M.M.
23. ISO. (2002) Microbiology of Food and Animal Feeding (2012) Salmonellosis in layer chickens: Pathological fea-
Stuffs-horizontal Method for the Detection of Salmonella tures and isolation of bacteria from ovaries and inner con-
spp. 4th ed. International Standard Organization, Geneva, tent of laid eggs. J. Bangladesh Agric. Univ., 10(1): 61-67.
Switzerland. 35. Mahmud, M.S., Bari, M. L. and Hossain, M.A. (2011)
24. Queipo-Ortuño, M.I., De Dios Colmenero, J., Macias, M., Prevalence of Salmonella Serovars and antimicrobial
Bravo, M.J. and Morata, P. (2008) Preparation of bacterial resistance profiles in poultry of Savar area, Bangladesh.
DNA template by boiling and effect of immunoglobulin G Foodborne Pathog. Dis., 8(10): 1111-1118.
as an inhibitor in real-time PCR for serum samples from 36. Hyeon, J.Y., Chon, J.W., Hwang, I.G., Kwak, H.S.,
patients with brucellosis. Clin. Vaccine Immunol., 15(2): Kim, M.S., Kim S.K., Choi, I.S., Song, C.S., Park, C. and
293-296. Seo, K.H. (2011) Prevalence, antibiotic resistance, and
25. Lin, C.K. and Tsen, H.Y. (1996) Use of two 16S DNA molecular characterization of Salmonella Serovars in retail
targeted oligonucleotides as PCR primers for the specific meat products. J. Food Prot., 74(1): 161-166.
detection of Salmonella in foods. J. Appl. Bacteriol., 80(6): 37. Muktaruzzaman, M., Haider, M.G., Ahmed, A.K.M.,
659-666. Alam, K.J., Rahman, M.M., Khatun, M.B., Rahman, M.H.
26. Bauer, A.W., Kirby, W.M.M., Sheris, J.C. and Truck, M. and Hossain, M.M. (2010) Validation and refinement of
(1966) Antibiotic susceptibility testing by a standardized Salmonella Pullorum (SP) colored antigen for diagnosis of
single disk method. Am. J. Clin. Pathol., 45(4): 493-496. Salmonella infections in the field. Int. J. Poult. Sci., 9(8):
27. Clinical and Laboratory Standards Institute. (2016) 801-808.
Performance Standards for Antimicrobial Susceptibility 38. Buxton, A. and Fraser, G. (1977) Animal Microbiology.
Testing. 26th ed. Clinical and Laboratory Standards Institute Blackwell Scientific Publications, Oxford, London,
supplement M100S, Wayne, PA. p1-256. Edinburg, Melbourne. p93-197.
28. Centers for Disease Control and Prevention. (2016) Epi 39. Ifeanyichukwu, I., Chika, E., Ogonna, A., Chidinma, I.,
Info™ 7. User Guide. Available on https://www.cdc. Monique, A., Ikechukwu, M., Stanley, E., Emmanuel, N.,
gov/epiinfo/support/userguide.html. Last accessed on Ngozi, A. and Agabus, N. (2016) Prevalence and anti-
09-12-2019. biogram of Salmonella species isolated from poultry prod-
29. Hamid, M.A., Rahman, M.A., Ahmed, S. and Hossain, K.M. ucts. J. Adv. Vet. Anim. Res., 3(4): 353-359.

********

Veterinary World, EISSN: 2231-0916 283