www.sciencemag.

org/cgi/content/full/342/6154/118/suppl/DC1

Supplementary Material for

Fungal Small RNAs Suppress Plant Immunity by Hijacking Host RNA
Interference Pathways
Arne Weiberg, Ming Wang, Feng-Mao Lin, Hongwei Zhao, Zhihong Zhang, Isgouhi
Kaloshian, Hsien-Da Huang, Hailing Jin*

*Corresponding author. E-mail: [email protected]

Published 4 October 2013, Science 342, 118 (2013)
DOI: 10.1126/science.1239705

This PDF file includes:

Materials and Methods

Fig. S1 to S10
Tables S1 and S2
References (29–32)
Other Supplementary Material for this manuscript includes the following:
(available at www.sciencemag.org/cgi/content/full/342/6154/118/suppl/DC1)

Tables S3 and S4 as Excel files

Supplementary Material:

Material and Methods

Generate dcl1, dcl2 single and double mutants of B. cinerea

By using homologous recombination and the Agrobacterium tumefaciens-mediated
transformation system adapted from Utermark and Karlovsky (29), we generated dcl1, dcl2
and dcl1 dcl2 deletion mutants in B. cinerea strain B05.10. Transformants were selected with
70 ppm hygromycin or 100 ppm NH4-glufosinate.

Plant materials and protocols

Plant materials used in this study are: Arabidopsis thaliana ecotype Col-0, Solanum
lycopersicum (tomato) cultivar Moneymaker, and Nicotiana benthamiana, Arabidopsis
knockout mutants mpk1 mpk2 (SALK_063847xSALK_019507) (18) and wak
(SALK_089827).
The Gateway pEarley vectors (with YFP & HA tags) were used for expression of Bc-
sRNA target genes (30). Bc-sRNAs were cloned into the miRNA319a backbone vector (17)
and transferred into the Gateway vector pEarley100 (without tag) for expression.
Transient co-expression assays in N. benthamiana were performed as described in (8).
Virus-induced gene silencing (VIGS) was performed by cloning a 294-bp MPKKK4
gene fragment into the TRV2 vector (19).

Pathogen assay
Four-week-old plants were inoculated by applying a single 20 μl droplet per leaf or by
spray-inoculating the entire plant, using 2x105 spores /ml for Arabidopsis and 1x104 spores
/ml for S. lycopersicum and N. benthamiana. Disease was assessed by measuring lesion size
(ImageJ software) and/or by quantifying B. cinerea biomass using quantitative PCR with B.
cinerea-specific ITS primers (fig. S4).

Confocal microscopy
YFP-tagged protein expression in N. benthamiana was quantified using the confocal
microscopy system Leica SP2. Z-series images (10 images in a distance of 0.7μM) were
merged to gain average signal intensity. Merged images were exported as TIFF files and YFP
quantity was measured using the ImageJ software.

1
AGO immunoprecipitation (IP)
Arabidopsis AGO IP (8) was conducted with 5 g fresh leaves collected at 24, 32 and
48 h after spray inoculation with B. cinerea. Uninfected leaves mixed with at least double
amount of B. cinerea biomass as in 48 hpi samples were used as a control. AGO1 was
purified with a peptide-specific antibody. AGO2 and AGO4 IPs were conducted using native
promoter-driven transgenic epitope HA-tagged and c-MYC-tagged lines, respectively and
commercial HA and c-MYC antibodies.

sRNA RT-PCR
RNA was extracted from B. cinerea-infected plant tissue or the AGO pull-down
fraction using the Trizol method. Purified RNA was treated with DNase I and then used in
RT-PCR (31) to detect Bc-sRNAs. 35-40 cycles were used for detecting Bc-sRNAs, 22-28
cycles were used for detecting actin genes from Arabidopsis, S. lycopersicum and B. cinerea.
Primers used for reverse transcription and amplification of Bc-siRNAs are listed in Table S4.

sRNA cloning and Illumina HiSeq data analysis

sRNAs (18-28 nucleotides) were isolated by 15% PAGE and libraries were
constructed using the miRCat cloning system and deep sequencing was performed on an
Illumina HiSeq 2000. The sequence datasets of sRNA libraries from B. cinerea (GSE45320),
B. cinerea-infected Arabidopsis (GSE45323) and B. cinerea-infected S. lycopersicum
(GSE45321) are available at the NCBI database. The sRNA sequencing reads were
preprocessed with the procedure of quality control and adapter trimming by using fastx-
toolkit (http://hannonlab.cshl.edu/fastx_toolkit/index.html). Following adapter trimming,
sequences were mapped to B. cinerea B05.10, Arabidopsis (TAIR10), or S. lycopersicum
(ITAG_SL2.40) genomes and only the reads that matched perfectly to each genome were
used for further analysis. The read number for each distinct sRNA was normalized to the total
B. cinerea mapped reads in B. cinerea-infected A. thaliana and S. lycopersicum libraries. The
ratio of total B. cinerea mapped reads of A. thaliana and S. lycopersicum libraries is 2.5:1, so
we divide the normalized siRNA read number of S. lycopersicum by 2.5.
The sRNAs we selected have satisfied the following conditions: 1) it must be present
in both B. cinerea-infected A. thaliana and S. lycopersicum libraries; 2) its normalized read
number was larger than 100 in A. thaliana or S. lycopersicum libraries; 3) its normalized

2
reads must be higher than that in cultured B. cinerea libraries and 4) it has predicted targets in
both A. thaliana and S. lycopersicum.
Target gene prediction for Bc-sRNA was performed using TAPIR1.1 (32) with more
stringent requirement than described in (32). No gap or bulge within the alignment between
the sRNA and the target was allowed, and the 10th nucleotide of the sRNA must perfectly
match its target. At most one mismatch or two wobbles was allowed from position 2 to 12. A
maximum of two continuous mismatches was allowed and a score of 4.5 was used as a cut-
off. If a sRNA has predicted targets in both A. thaliana and S. lycopersicum, it was selected.
The sRNAs were grouped if their 5’ end position and 3’ end position were within 3
nucleotides on the genomic loci. We presented the selected sRNAs with targets in both A.
thaliana and S. lycopersicum in table S3.

3
Supplementary figures
Figure legends:
Fig. S1. Genomic map and read distribution of Bc-SIR3 and Bc-SIR5 loci. The genomic
regions of 60 nt up- and downstream of the Bc-sRNA of interest were included. Sequence
reads of Bc-siR3 and Bc-siR5 in B. cinerea-infected Arabidopsis (0, 24, 48, 72 hpi), B.
cinerea-infected S. lycopersicum (leaf/fruit 0, 24, 72 hpi), or in vitro culture B. cinerea sRNA
libraries (conidiospores, mycelia, total biomass) (see table S1) are shown in three individual
panels. Bc-siR3 and Bc-siR5 reads are in red. In vitro culture B. cinerea sRNA libraries did
not show a clear peak for Bc-siR3.1 or Bc-siR3.2 compared to B. cinerea-infected
Arabidopsis and S. lycopersicum libraries, indicating that those Bc-siRNAs were induced
during infection. Similarly, Bc-SIR5 showed induction upon infection.

Fig. S2. A. Target site and target site mutated versions of Bc-siRNA Arabidopsis target genes
that were used in this study. B. B. cinerea mycelium coincided with target gene suppression
of YFP-MPK2 (center), but not YFP-MPK2-m (right) in N. benthamiana at 24 hpi; YFP-
MPK2 without fungal infection was used as a control (left). Upper panel: YFP; bottom panel:
YFP/bright field overlay; scale bar: 50 μm. C. A schematic diagram of the YFP sensor
carrying a Bc-siR3.2 target site.

Fig. S3. Isolation and characterization of Bc-siRNA target mutants and Bc-siRNAox lines. A.
Isolation of a loss-of function mutant line for WAK gene. Expression of WAK was completely
knocked out in the T-DNA insertion line shown by RT-PCR. B. Induction of BIK1 expression
in response to B. cinerea infection was reduced in Bc-siR3.1ox and Bc-iR3.2ox lines, mpk1
mpk2, and wak mutant lines. Relative transcript levels of BIK1 were measured by real time
RT-PCR. Error bars indicate standard deviation (SD) of three technical replicates. Similar
results were obtained from two biological repeats.

Fig. S4. S. lycopersicum MAPKKK4 gene knockdown by TRV-induced gene silencing.

A. Expression of MAPKKK in S. lycopersicum TRV-MAPKKK4 silenced plants was
measured by qRT-PCR using actin as an internal control. Error bars indicate SD of three
technical replicates. Similar results were obtained from three biological repeats. B. TRV-
MAPKKK4 silenced plants exhibited a dwarf phenotype as compared with control plants
(TRV-RB).

4
Fig. S5. Bc-siR3.1 and Bc-siR5 were specifically loaded into Arabidopsis AGO1 during
infection, but not into AGO2 or AGO4, as revealed by AGO-IP followed by RT-PCR.
Endogenous plant sRNAs were used as internal controls for IP: At-miR398a for AGO1, At-
miR393b* for AGO2, and At-siR1003 for AGO4.

Fig. S6. The sRNAs that have no predicted plant targets (Bc-siR394, Bc-siR233, Bc-siR269)
or have predicted targets that were not down-regulated (Bc-siR9, Bc-siR24, Bc-siR67) by B.
cinerea infection are not present in the AGO-associated fractions.

Fig. S7. Arabidopsis ago1-27 is more resistant to B. cinerea infection than wild-type. A.
ago1-27 displayed reduced disease phenotype upon B. cinerea infection. B. Induction of
BIK1 in response to B. cinerea infection was increased in ago1-27.

Fig. S8. The phylogenetic tree of DCL proteins in pathogenic fungi. Schizosaccharomyces
pombe and Neurospora crassa were used as references. An oomycete pathogen Phytophthora
infestans was also included.

Fig. S9. Generation of B. cinerea dcl1, dcl2 single mutants and the dcl1 dcl2 double mutant
by homologous recombination. A. Schematic diagram of Bc-DCL1 and Bc-DCL2 knockout
strategy by homologous recombination. Black arrows indicate primers used for genotyping. B.
The dcl1, dcl2, and dcl1 dcl2 knockout strains were confirmed by RT-PCR. C. B. cinerea
dcl1, dcl2, and dcl1 dcl2 mutant strains showed gradual growth retardation and delayed
development of conidiospores: upper panel shows radial growth after 3 days, bottom panel
shows conidiation at 21 days. D. Two Bc-sRNAs, Bc-microRNA-like RNA2 (Bc-milR2) and
Bc-siR1498, were identified as Dicer-independent and were expressed in dcl1 dcl2.

Fig. S10. The biomass of the B. cinerea dcl1 dcl2 mutant strain was strongly reduced as
compared with the wild-type strain during infection of both Arabidopsis (A) and S.
lycopersicum (B), as quantified by qPCR at 72 hpi and 48 hpi, respectively.

5
Table S1. Statistical analysis of the sRNA libraries from cultured B. cinerea, B. cinerea-infected
Arabidopsis, and B. cinerea-infected S. lycopersicum.

Table S2. The predicted host targets of Bc-siR3.1, Bc-siR3.2, and Bc-siR5. Normalized read
counts are given in reads per million B. cinerea sRNAs. Reads were summed from individual
sRNA libraries for each category: cultured B. cinerea, B. cinerea-infected Arabidopsis, B.
cinerea-infected S. lycopersicum. Target gene alignment was scored as described in Materials
and Methods.

Table S3. The list of Bc-sRNAs that have predicted targets in both Arabidopsis and S.
lycopersicum. (Uploaded as an excel file). Normalized read counts are given in reads per million
B. cinerea sRNAs. Reads were summed from individual sRNA libraries for each category:
cultured B. cinerea, B. cinerea-infected Arabidopsis, B. cinerea-infected S. lycopersicum. Target
gene alignment was scored as described in Materials and Methods.

Table S4. Oligos and primers used in this study (Uploaded as an excel file).
Table  S1  
Library Total reads Total reads B. cinerea % B. cinerea reads

Arabidopsis, 0 hpi (B. cinerea) 71,793,267 68,811 0.14

Arabidopsis, 24 hpi (B. cinerea) 101,220,872 609,204 0.65

Arabidopsis, 48 hpi (B. cinerea) 59,594,013 296,764 0.53

Arabidopsis, 72 hpi (B. cinerea) 41,478,258 338,325 0.82

S. lycopersicum leaf, 0 hpi (B. cinerea) 2,630,614 623 0.02

S. lycopersicum leaf, 24 hpi (B. cinerea) 1,586,314 6,315 0.28

S. lycopersicum leaf, 72 hpi (B. cinerea) 1,580,667 5,918 0.37

S. lycopersicum fruit, 0 hpi (B. cinerea) 6,334,100 1,381 0.02

S. lycopersicum fruit, 24 hpi (B. cinerea) 6,021,895 14,908 0.25

S. lycopersicum fruit, 72 hpi (B. cinerea) 3,617,356 458,590 12.68

B. cinerea, in vitro culture, conidiospores 787,441 787,441 100.0

B. cinerea, in vitro culture, mycelia 1,716,701 1,716,701 100.0

B. cinerea, in vitro culture, total biomass 18,086,243 18,086,243 100.0

Table  S2  
!

Normalized read counts

ID Arabidopsis S.lycopersicum B.cinerea Alignment Score Predicted target gene
Bc-siR3.2 3`UGGAUGUUCUAGGUGUUACAU 3.0 At MPK2
|:| | ||||||||||||||:
target 5`AUCAAGAAGAUCCACAAUGUG
Bc-siR3.2 3`UGGAUGUUCUAGGUGUUACAU 4.5 At MPK1
|:| | |||||:||||||||
target 5`AUCAAGAAGAUUCACAAUGUU
Bc-siR3.2 202 997 33 Bc-siR3.2 3`UGGAUGUUCUAGGUGUUACAU Sl F-box
|:||| |||||||| ||||||
3.5
target 5`AUCUAGAAGAUCCAAAAUGUA
Bc-siR3.2 3`GUGGAUGUUCUAGGUGUUACA 4.5 Sl MPKKK4
||::|| ||||||||| ||||
target 5`CAUUUAAAAGAUCCACCAUGU
Bc-siR3.1 3`CGGGUGGAUGUUCUAGGUGUU 2.5 At Aminotransferase-like
:|||| ||||||||||||||
target 5`AUCCACAUACAAGAUCCACAA
Bc-siR3.1 3`CGGGUGGAUGUUCUAGGUGUU 4.0 At Microspore-specific
|:|| |:||||| ||||||||
target 5`GUCCCCUUACAACAUCCACAA
Bc-siR3.1 3`CGGGUGGAUGUUCUAGGUGUU At PRXIIF
|||:| |||||||| |||||
4.5
Bc-siR3.1 812 1231 50
target 5`GCCUAGCUACAAGAGCCACAU
Bc-siR3.1 3`CGGGUGGAUGUUCUAGGUGUU 4.25 Sl Autophagy ATG2-like
:||||:| |||||||||||:
target 5`AUCCACUUUCAAGAUCCACAG
Bc-siR3.1 3`CGGGUGGAUGUUCUAGGUGUU 4.5 Sl Vacuolar protein-sorting
|||||||:||| ||||||:|
target 5`ACCCACCUGCAACAUCCACGA
Bc-siR5 3`UUCAUAUGUAAGGCUCAGUUU At Unknown
|| | || ||||||||||||
4.0
target 5`UAGGAAACUUUCCGAGUCAAA
Bc-siR5 3`UUCAUAUGUAAGGCUCAGUUU 4.0 At Clathrin, heavy-chain
:||| |:|||||||:|||:||
target 5`GAGUUUGCAUUCCGGGUCGAA
Bc-siR5 3`UUCAUAUGUAAGGCUCAGUUU 4.25 At Cell wall-associated kinase
::||||||||||||:||||::
target 5`GGGUAUACAUUCCGGGUCAGG
Bc-siR5 1,710 1,380 303 Bc-siR5 3`UUCAUAUGUAAGGCUCAGUUU 4.5 At MADS transcription factor
:| | |||| |||||||||||
target 5`GAAUUUACAAUCCGAGUCAAA
Bc-siR5 3`UUCAUAUGUAAGGCUCAGUUU 4.0 Sl TOM34
|||||| |||||| ||||||
target 5`CAGUAUAGAUUCCGUGUCAAA
Bc-siR5 3`UUCAUAUGUAAGGCUCAGUUU 4.5 Sl Pentatricopeptide
|:||| ||||||:||| ||||
target 5`AGGUAGACAUUCUGAGGCAAA
Figure  S1  
Bc-SIR3 Bc-SIR5
B. cinerea-infected B. cinerea-infected B. cinerea B. cinerea-infected B. cinerea-infected B. cinerea
Arabidopsis S. lycopersicum in vitro culture Arabidopsis S. lycopersicum in vitro culture
sense sense

antisense antisense

Bc-siR3.1 and Bc-siR3.2 Bc-siR5

One bar represents 10 reads

Figure  S2  

B. cinerea
A B
MPK2 5`AUCAAGAAGAUCCACAAUGUG
|:| | ||||||||||||||:
YFP-MPK2 YFP-MPK2 YFP-MPK2-m
Bc-siR3.2 3`UGGAUGUUCUAGGUGUUACAU
|: | || || ||:|| ||
MPK2-m 5`AUAAAGAAAAUACAUAACGUU

MPK1 5`AUCAAGAAGAUUCACAAUGUU
|:| | |||||:||||||||
Bc-siR3.2 3`UGGAUGUUCUAGGUGUUACAU
|: | || || ||:|| ||
MPK1-m 5`AUAAAGAAAAUACAUAACGUU
WAK 5`GGGUAUACAUUCCGGGUCAGG
::||||||||||||:||||::
Bc-siR5 3`UUCAUAUGUAAGGCUCAGUUU
:| || || || |: || ::
WAK-m 5`UGGAAUUCACUCGGGCUCUGG

Bc-siR3.2 target site

TGA

pS35 YFP 3`UTR

Figure  S3  
A

SALK_089827

At5g50290 (WAK)
0.5 kb
SALK_089827
WT #1 #2
WAK

Actin

B
1.5 BIK1
Rel. mRNA level

0.5

0
Figure  S4  

A B
TRV-RB TRV-MAPKKK4
MAPKKK4
1.5
Rel. mRNA level

0.5

0
1 2 1 2 3 4
TRV-RB TRV-MAPKKK4
Figure  S5  

IP
AGO1 AGO2 AGO4
Bc-siR3.1

Bc-siR5
Figure  S6  
Total RNA AGO1-IP

infected control infected

Bc-siR394

Bc-siR233

Bc-silR269

Bc-siR9

Bc-siR24

Bc-siR67

Bc-siR3.1

Bc-siR3.2

Bc-siR5

IB:AGO1
Figure  S7   A
WT ago1-27

B
BIK1
3
Rel. mRNA level

0 WT ago1-27
Figure  S8  
Figure  S9   A B
5`flank   PtrpC::hph   3`flank   WT dcl1 dcl2 dcl1 dcl2
Bc-DCL1
Bc-DCL1
Bc-DCL2

Bc-Actin

5`flank   PtrpC::bar   3`flank  

Bc-DCL2

1 kb
In  red:  func>onal  domains  

C D
WT dcl1 dcl2 dcl1 dcl2
WT dcl1 dcl2
dcl1dcl2
Bc-milR2

Bc-siR1498
Figure  S10  

A B
Arabidopsis S. lycopersicum
1.5

B. cinerea biomass
1.5
B. cinerea biomass
1 1

0.5 0.5
* *
0 0
References and Notes
1. H. Ashida, M. Ogawa, M. Kim, S. Suzuki, T. Sanada, C. Punginelli, H. Mimuro, C. Sasakawa,
Shigella deploy multiple countermeasures against host innate immune responses. Curr.
Opin. Microbiol. 14, 16–23 (2011). doi:10.1016/j.mib.2010.08.014 Medline
2. M. Rafiqi, J. G. Ellis, V. A. Ludowici, A. R. Hardham, P. N. Dodds, Challenges and progress
towards understanding the role of effectors in plant-fungal interactions. Curr. Opin. Plant
Biol. 15, 477–482 (2012). doi:10.1016/j.pbi.2012.05.003 Medline
3. T. O. Bozkurt, S. Schornack, M. J. Banfield, S. Kamoun, Oomycetes, effectors, and all that
jazz. Curr. Opin. Plant Biol. 15, 483–492 (2012). doi:10.1016/j.pbi.2012.03.008
Medline
4. H. Hilbi, A. Haas, Secretive bacterial pathogens and the secretory pathway. Traffic 13, 1187–
1197 (2012). doi:10.1111/j.1600-0854.2012.01344.x Medline
5. S. Katiyar-Agarwal, H. Jin, Role of small RNAs in host-microbe interactions. Annu. Rev.
Phytopathol. 48, 225–246 (2010). doi:10.1146/annurev-phyto-073009-114457 Medline
6. V. Ruiz-Ferrer, O. Voinnet, Roles of plant small RNAs in biotic stress responses. Annu. Rev.
Plant Biol. 60, 485–510 (2009). doi:10.1146/annurev.arplant.043008.092111 Medline
7. B. Wessner, L. Gryadunov-Masutti, H. Tschan, N. Bachl, E. Roth, Is there a role for
microRNAs in exercise immunology? A synopsis of current literature and future
developments. Exerc. Immunol. Rev. 16, 22–39 (2010). Medline
8. X. Zhang, H. Zhao, S. Gao, W. C. Wang, S. Katiyar-Agarwal, H. D. Huang, N. Raikhel, H.
Jin, Arabidopsis Argonaute 2 regulates innate immunity via miRNA393(∗)-mediated
silencing of a Golgi-localized SNARE gene, MEMB12. Mol. Cell 42, 356–366 (2011).
doi:10.1016/j.molcel.2011.04.010 Medline
9. J. Zhou, Y. Fu, J. Xie, B. Li, D. Jiang, G. Li, J. Cheng, Identification of microRNA-like RNAs
in a plant pathogenic fungus Sclerotinia sclerotiorum by high-throughput sequencing.
Mol. Gen. Genet. 287, 275–282 (2012). doi:10.1007/s00438-012-0678-8
10. D. Qutob, B. Patrick Chapman, M. Gijzen, Transgenerational gene silencing causes gain of
virulence in a plant pathogen. Nature Comm. 4, 1349 (2013). doi:10.1038/ncomms2354
11. N. Jiang, Y. Yang, G. Janbon, J. Pan, X. Zhu, Identification and functional demonstration of
miRNAs in the fungus Cryptococcus neoformans. PLoS ONE 7, e52734 (2012).
doi:10.1371/journal.pone.0052734 Medline
12. H. C. Lee, L. Li, W. Gu, Z. Xue, S. K. Crosthwaite, A. Pertsemlidis, Z. A. Lewis, M. Freitag,
E. U. Selker, C. C. Mello, Y. Liu, Diverse pathways generate microRNA-like RNAs and
Dicer-independent small interfering RNAs in fungi. Mol. Cell 38, 803–814 (2010).
doi:10.1016/j.molcel.2010.04.005 Medline
13. C. C. Nunes, M. Gowda, J. Sailsbery, M. Xue, F. Chen, D. E. Brown, Y. Oh, T. K. Mitchell,
R. A. Dean, Diverse and tissue-enriched small RNAs in the plant pathogenic fungus,
Magnaporthe oryzae. BMC Genomics 12, 288 (2011). doi:10.1186/1471-2164-12-288
Medline

1
14. V. Raman, S. A. Simon, A. Romag, F. Demirci, S. M. Mathioni, J. Zhai, B. C. Meyers, N. M.
Donofrio, Physiological stressors and invasive plant infections alter the small RNA
transcriptome of the rice blast fungus, Magnaporthe oryzae. BMC Genomics 14, 326
(2013). doi:10.1186/1471-2164-14-326 Medline
15. J. Amselem, C. A. Cuomo, J. A. van Kan, M. Viaud, E. P. Benito, A. Couloux, P. M.
Coutinho, R. P. de Vries, P. S. Dyer, S. Fillinger, E. Fournier, L. Gout, M. Hahn, L.
Kohn, N. Lapalu, K. M. Plummer, J. M. Pradier, E. Quévillon, A. Sharon, A. Simon, A.
ten Have, B. Tudzynski, P. Tudzynski, P. Wincker, M. Andrew, V. Anthouard, R. E.
Beever, R. Beffa, I. Benoit, O. Bouzid, B. Brault, Z. Chen, M. Choquer, J. Collémare, P.
Cotton, E. G. Danchin, C. Da Silva, A. Gautier, C. Giraud, T. Giraud, C. Gonzalez, S.
Grossetete, U. Güldener, B. Henrissat, B. J. Howlett, C. Kodira, M. Kretschmer, A.
Lappartient, M. Leroch, C. Levis, E. Mauceli, C. Neuvéglise, B. Oeser, M. Pearson, J.
Poulain, N. Poussereau, H. Quesneville, C. Rascle, J. Schumacher, B. Ségurens, A.
Sexton, E. Silva, C. Sirven, D. M. Soanes, N. J. Talbot, M. Templeton, C. Yandava, O.
Yarden, Q. Zeng, J. A. Rollins, M. H. Lebrun, M. Dickman, Genomic analysis of the
necrotrophic fungal pathogens Sclerotinia sclerotiorum and Botrytis cinerea. PLoS
Genet. 7, e1002230 (2011). doi:10.1371/journal.pgen.1002230 Medline
16. P. Veronese, H. Nakagami, B. Bluhm, S. Abuqamar, X. Chen, J. Salmeron, R. A. Dietrich,
H. Hirt, T. Mengiste, The membrane-anchored BOTRYTIS-INDUCED KINASE1 plays
distinct roles in Arabidopsis resistance to necrotrophic and biotrophic pathogens. Plant
Cell 18, 257–273 (2006). doi:10.1105/tpc.105.035576 Medline
17. R. Schwab, S. Ossowski, M. Riester, N. Warthmann, D. Weigel, Highly specific gene
silencing by artificial microRNAs in Arabidopsis. Plant Cell 18, 1121–1133 (2006).
doi:10.1105/tpc.105.039834 Medline
18. D. Ortiz-Masia, M. A. Perez-Amador, J. Carbonell, M. J. Marcote, Diverse stress signals
activate the C1 subgroup MAP kinases of Arabidopsis. FEBS Lett. 581, 1834–1840
(2007). doi:10.1016/j.febslet.2007.03.075 Medline
19. Y. L. Liu, M. Schiff, S. P. Dinesh-Kumar, Virus-induced gene silencing in tomato. Plant J.
31, 777–786 (2002). doi:10.1046/j.1365-313X.2002.01394.x Medline
20. S. J. Mi, T. Cai, Y. Hu, Y. Chen, E. Hodges, F. Ni, L. Wu, S. Li, H. Zhou, C. Long, S. Chen,
G. J. Hannon, Y. Qi, Sorting of small RNAs into Arabidopsis argonaute complexes is
directed by the 5′ terminal nucleotide. Cell 133, 116–127 (2008).
doi:10.1016/j.cell.2008.02.034 Medline
21. T. A. Montgomery, M. D. Howell, J. T. Cuperus, D. Li, J. E. Hansen, A. L. Alexander, E. J.
Chapman, N. Fahlgren, E. Allen, J. C. Carrington, Specificity of ARGONAUTE7-
miR390 interaction and dual functionality in TAS3 trans-acting siRNA formation. Cell
133, 128–141 (2008). doi:10.1016/j.cell.2008.02.033 Medline
22. J. B. Morel, C. Godon, P. Mourrain, C. Béclin, S. Boutet, F. Feuerbach, F. Proux, H.
Vaucheret, Fertile hypomorphic ARGONAUTE (ago1) mutants impaired in post-
transcriptional gene silencing and virus resistance. Plant Cell 14, 629–639 (2002).
doi:10.1105/tpc.010358 Medline
23. S. D. Kale, B. Gu, D. G. Capelluto, D. Dou, E. Feldman, A. Rumore, F. D. Arredondo, R.
Hanlon, I. Fudal, T. Rouxel, C. B. Lawrence, W. Shan, B. M. Tyler, External lipid PI3P

2
 mediates entry of eukaryotic pathogen effectors into plant and animal host cells. Cell 142,
284–295 (2010). doi:10.1016/j.cell.2010.06.008 Medline
24. S. Wawra, R. Belmonte, L. Löbach, M. Saraiva, A. Willems, P. van West, Secretion, delivery
and function of oomycete effector proteins. Curr. Opin. Microbiol. 15, 685–691 (2012).
doi:10.1016/j.mib.2012.10.008 Medline
25. M. Rafiqi, P. H. Gan, M. Ravensdale, G. J. Lawrence, J. G. Ellis, D. A. Jones, A. R.
Hardham, P. N. Dodds, Internalization of flax rust avirulence proteins into flax and
tobacco cells can occur in the absence of the pathogen. Plant Cell 22, 2017–2032 (2010).
doi:10.1105/tpc.109.072983 Medline
26. S. Schornack, M. van Damme, T. O. Bozkurt, L. M. Cano, M. Smoker, M. Thines, E. Gaulin,
S. Kamoun, E. Huitema, Ancient class of translocated oomycete effectors targets the host
nucleus. Proc. Natl. Acad. Sci. U.S.A. 107, 17421–17426 (2010).
doi:10.1073/pnas.1008491107 Medline
27. S. Wawra, J. Bain, E. Durward, I. de Bruijn, K. L. Minor, A. Matena, L. Löbach, S. C.
Whisson, P. Bayer, A. J. Porter, P. R. Birch, C. J. Secombes, P. van West, Host-targeting
protein 1 (SpHtp1) from the oomycete Saprolegnia parasitica translocates specifically
into fish cells in a tyrosine-O-sulphate-dependent manner. Proc. Natl. Acad. Sci. U.S.A.
109, 2096–2101 (2012). doi:10.1073/pnas.1113775109 Medline
28. U. Ellendorff, E. F. Fradin, R. de Jonge, B. P. Thomma, RNA silencing is required for
Arabidopsis defence against Verticillium wilt disease. J. Exp. Bot. 60, 591–602 (2009).
doi:10.1093/jxb/ern306 Medline
29. U. Utermark, P. Karlovsky, Genetic transformation of filamentous fungi by Agrobacterium
tumefaciens. Protocol Exchange, published online 20 March 2008
(10.1038/nprot.2008.83).
30. K. W. Earley, J. R. Haag, O. Pontes, K. Opper, T. Juehne, K. Song, C. S. Pikaard, Gateway-
compatible vectors for plant functional genomics and proteomics. Plant J. 45, 616–629
(2006). doi:10.1111/j.1365-313X.2005.02617.x Medline
31. E. Varkonyi-Gasic, R. Wu, M. Wood, E. F. Walton, R. P. Hellens, Protocol: A highly
sensitive RT-PCR method for detection and quantification of microRNAs. Plant Methods
3, 12 (2007). doi:10.1186/1746-4811-3-12 Medline
32. E. Bonnet, Y. He, K. Billiau, Y. Van de Peer, TAPIR, a web server for the prediction of plant
microRNA targets, including target mimics. Bioinformatics 26, 1566–1568 (2010).
doi:10.1093/bioinformatics/btq233 Medline