ARTICLE

Evaluation of Effect of Topical Tacrolimus Treatment on

Herpetic Stromal Keratitis in a Rat Model
Erdem Eris¸, M.D., Nurs¸en Yüksel, M.D., Dilara Pirhan, M.D., Aynur Karadenizli, M.D., Mehmet Aslan, M.D.,
Gülçin Gacar, Ph.D., Gülay Erman, B.S., Cansu Subas¸ı, M.Sc., Hüseyin Uzuner, Ph.D., Demir Kürs¸at Yıldız, M.D.,
and Erdal Karaöz, Ph.D.

+ +
Objectives: To investigate the effectiveness of topical tacrolimus that primarily involves CD4 and CD8 cells.2,3 Vessels of
treatment on herpetic stromal keratitis (HSK) in a rat model. neovascularization are more susceptible to leakage and contribute
Methods: The development of HSK was monitored for 14 days after the to blurred vision by allowing the escape of inflammatory cells.4
inoculation of rats with herpes simplex type 1 virus. Rats that developed HSK After corneal vascularization is evident, it is difficult to manage
were divided into four groups as follows: (1) topical antiviral treatment HSK lesions, and patients need to be treated with topical steroids
(control), (2) topical antiviral and 1% prednisolone acetate, (3) topical antiviral for a long period. If steroid treatment is kept short because of the
and 0.03% tacrolimus ointment, and (4) topical antiviral plus 0.1% tacrolimus side effects, then HSK recurrences occur, causing an increase in
ointment. After 14 days of treatment, the severity levels of HSK were scored the overall HSK recurrence rate.5 Thus, new alternative therapies
and compared with the levels before the treatment. The expression of CD3, are needed for the treatment of HSK.
CD4, and CD8 was evaluated by flow cytometry. The development of the Currently, much research reveals that alternatives to the steroid
disease was evaluated clinically and histologically. treatment of HSK, the use of nonsteroid anti-inflammatory drugs,
Results: Significant improvement in vascularization was observed in the
implantation of amniotic membrane, and cyclosporine A were tested. 6–11
groups with the drug treatment in addition to the antiviral agent (P,0.05),
Topical cyclosporine application was also shown to be effective in HSK
but there was no obvious difference within groups 2, 3, and 4 in the
vascularization severity. The regression of corneal edema was 8.05%6 6% treatment, and its effect is concentration dependent.10
in group 1, 25.17%614.55% in group 2 (P¼0.01), 36.40%621.69% in Tacrolimus, a potent immunosuppressive macrolide isolated
group 3 (P¼0.03), and 46.39%614.96% in group 4 (P¼0.00). A signif- from the soil fungus Streptomyces tsukubaensi, acts primarily by
icant decrease in the number of inflammatory cells in the groups with the suppressing both B-cell and T-cell activation, T helper cell–
drug treatment was evaluated by immunohistochemical staining and con- mediated responses, and the production of interleukin (IL)-2, such
firmed by flow cytometry analysis. as cyclosporine A. As a result, both drugs inhibit the acti-vation
Conclusions: Topical tacrolimus treatment caused a significant decrease in and proliferation of inflammatory cells.12,13 Both topical
corneal vascularization accompanied by a lower number of inflammatory cyclosporine A and tacrolimus have effectively been used in
cells in the experimental HSK corneal edema model. Therefore, topical
treatments of ocular surface diseases, such as superior limbic
tacrolimus has the potential to be used in the treatment of HSK.
keratoconjunctivitis, atopic keratoconjunctivitis, and penetrating
Key Words: Cornea—Herpetic stromal keratitis—Inflammation— keratoplasty.14–18 Although it is 100 times more effective than
Neovascularization—Rat. cyclosporine, no significant systemic side effect was reported for
(Eye & Contact Lens 2016;42: 163–170) the treatment by topical tacrolimus.19
To the best of our knowledge, this is the first prospective study on the
use of tacrolimus on HSK. In this study, we evaluated the effectiveness of
topical tacrolimus on HSK in a rat model. We used

H erpetic stromal keratitis (HSK) is a chronic recurrent inflam-

matory disease occurring due to infection by the herpes simplex type
immunohistochemistry (IHC), flow cytometry, and clinical approaches to
evaluate the effects of different doses of topical tacrolimus.

1 virus (HSV-1).1 Because of recurrences, the disease may cause

visual morbidity associated with a wide range of sequelae because of
corneal vascularization, irreversible stromal scarring, and lipid MATERIALS AND METHODS
keratopathy. Herpetic stromal keratitis is believed to represent a T- Animals
cell–mediated immunopathologic basis2 Seventy-two Wistar albino rats weighing 250 to 350 g and aging 6 to 8
weeks were used in this study. The animal studies were conducted in
From the Departments of Ophthalmology (E.E., N.Y., D.P., M.A.), Medical accordance with the ARVO Statement for the Use of Animals in
Microbiology (A.K., H.U.), Stem Cell (G.G., G.E., C.S., E.K.), and Pathology Ophthalmic and Vision Research, and the research was approved by the
(D.K.Y.), Faculty of Medicine, Kocaeli University, Kocaeli, Turkey.
Ethics Committee of Kocaeli University Medical Faculty.
The authors have no funding or conflicts of interest to disclose. Address
correspondence to Dilara Pirhan, M.D., Department of Oph-
thalmology, Faculty of Medicine, Kocaeli University, Kocaeli 41380, Virus Production
Turkey; e-mail: [email protected] Herpes simplex virus type 1 human strain stock was kindly
Accepted March 29, 2015. provided by Ayhan Kubar, Professor of Medical Microbiology at
DOI: 10.1097/ICL.0000000000000162 Gulhane Military Medical Academy.

Eye & Contact Lens Volume 42, Number 3, May 2016 163

Copyright @ Contact Lens Association of Opthalmologists, Inc. Unauthorized reproduction of this article is prohibited.
 E. Eris¸ et al. Eye & Contact Lens Volume 42, Number 3, May 2016

Virus stock is prepared using virus titer determined by severity of keratitis of individually scored rat was recorded. In the
perform-ing a plaque assay in Vero cells.20 Plaque-forming unit photographs, the corneas of the rat to be evaluated were divided into
(PFU) was calculated by adding serial dilutions of recovered virus 16 equal slices for scoring. The clinical lesion scores of HSK were
stock onto Vero cells grown in 24-well plates. described as 0, normal cornea; 1, mild haze; 2, moderate haze, iris
6 visible; 3, severe haze, iris not visible; 4, severe haze and corneal
We inoculated 5 mL working solution including 1 · 10 PFU of
HSV-1 onto rats’ eyes, and the HSK was diagnosed clinically.21 ulcer; and 5, corneal rupture. In the 1st and 14th day of treatment we
The causative agent was confirmed also by polymerase chain scored the edema, difference was calculated in percentages.
reac-tion (PCR) assay for the detection of HSV-1. Swab samples Angiogenic activity was scored by the number and length of
were collected for PCR, and they were sent to the laboratory with newly developed vessels. A score of 0 was assigned for no
trans-port medium (UTM; Copan Diagnostics Inc., Brescia, Italy). neovascularization, 1 was assigned to the length within 20% of
DNA isolation was performed. Polymerase chain reaction assay the radius, 2 for lengths from 20% to 40% of the radius, 3 for
for HSV-1 DNA was used for the confirmation of the causative lengths from 20% to 40% of the radius, 4 for lengths from 40% to
agent. We inoculated the viruses on rats’ eyes, and the HSK was 60% of the radius, 5 for lengths from 60% to 80% of the radius,
diag-nosed clinically; however, we needed to show the virus with and 6 for the lengths from 80% to 100% of the radius. When
micro-biological diagnostic methods. Therefore, we performed several vessels had extensive branching, we took the longest
PCR using the primers and probe as shown below. vessel as a standard score. So, we used the scale in the cornea
The primer and probe sets targeting the DNA polymerase divided into 80 parts (Fig. 1), and for each animal, we calculated
UL30 gene were used for the real-time TaqMan PCR method. the corresponding percentage, and the scale was expressed as a
The primers and probes used were as follows: percentage. These percentages were used for further comparisons.
Sense primer: 59-CATCACCGACCCGGAGAGGGAC-39
Antisense primer: 59-GGGCCAGGCGCTTGTTGGTGTA-39 Immunohistological Examination
Probe sequence: CCGCCGAACTGAGCAGACACCCGCGC The animals were killed by an overdose (150 mg/kg) of
(Dye 6-FAM). intracardiac ketamine. Enucleation was performed to the eyes of each
subject before immunohistological examination. The enucle-ated eyes
Reactions were run in 25-mL volumes containing 2 mL of sam-ple were then fixed in 4% paraformaldehyde for 30 min, and corneas
DNA. The TaqMan PCR conditions were as follows: activation was 1 were removed and were subjected to 30 additional minutes to fixation.
cycle of 95°C for 4 min and amplification and detection were 40 Paraformaldehyde-fixed tissue blocks were washed, dehydrated in
cycles of 95°C for 30 sec, 60°C for 30 sec, and 72°C for 30 sec. ethanol, and embedded into paraffin blocks. From these paraffin tissue
Positive cultures were identified as HSV-1 by PCR in both cell blocks, 6-mm-thick tissue samples were sliced and
culture and rat samples. immunohistochemically stained with CD3, CD14, or CD68 using
monoclonal antibodies. Blocking serum that we used was obtained
Rat Herpetic Stromal Keratitis Model from Santa Cruz Biotechnology (Heidelberg, Germany).
For anesthesia, a combination of ketamine hydrochloride (50
mg/kg, Ketalar; Eczacıbas¸ı, Istanbul, Turkey) and xylazine hydro-
chloride (5 mg/kg, Rompun; Bayer, Istanbul, Turkey) was used. After
instillation of 1 drop of 0.5% proparacaine hydrochloride (Alcaine;
Alcon, Puurs, Belgium), corneas were scarified in 10 maneuvers with
a 30-gauge needle until stroma was reached by horizontal and vertical
moves under microscopic magnification (Topcon OMS 75; Topcon
Medical Systems, Oakland, NJ). Five microliters of working HSV-1
stock was applied to the eyes within 10 sec, and then the eyelids were
closed and massaged for 30 secs. Fourteen days after HSV-1
inoculation, 40 rats showed disease signs, and HSK levels were
examined and evaluated.
Corneas that had HSK were divided into 4 groups of 10 animals
each. Group 1 (control group) was treated with topical 3% acyclovir
ointment (Zovirax; GlaxoSmithKline, Bridgewater, NJ) only 5 times
a day; group 2 (steroid group) was treated with 3% acyclovir
ointment 5 times a day and topical 1% prednisolone acetate drop
(Pred Forte; Allergan, Irvine, CA) twice a day; group 3 (0.03%
tacrolimus group) was treated with 3% acyclovir 5 times a day and
0.03% tacrolimus ointment (0.03% Protopic; Astellas Pharma Inc.,
Northbrook, IL) twice a day; and group 4 (0.1% tacrolimus group)
was treated with 3% acyclovir ointment 5 times a day and 0.1%
tacrolimus (0.1% Protopic; Astellas Pharma Inc.) twice a day.
On the 1st and 14th day of treatment, we evaluated and
photographed the corneas in a blinded fashion under a microscope.
The eyes were examined on these days of postinfection with a FIG. 1. Representative scale used in angiogenic activity scoring.
slitlamp biomicroscope (Kowa, Nagoya, Japan), and the clinical

164 Eye & Contact Lens Volume 42, Number 3, May 2016

Copyright @ Contact Lens Association of Opthalmologists, Inc. Unauthorized reproduction of this article is prohibited.
 Eye & Contact Lens Volume 42, Number 3, May 2016 Tacrolimus on Herpetic Stromal Keratitis

Stained samples were evaluated and imaged for the presence of 19.2566.67 in the 0.1% tacrolimus group at 14 days after corneal
inflammatory cells. To identify cellular markers, cells were sub- HSV-1 inoculation. This variation was taken into consideration
jected to IHC staining as described previously.22 when the animals were divided into the four groups.

Flow Cytometry Analysis Clinical Evaluation of Herpetic Stromal Keratitis

Randomly selected samples (five corneas per group) were At the first day of treatment, the average corneal neovasculari-
subjected to flow cytometry analyses. The corneas of rats were zation score was 45.3625.6 for group 1, 35.6619.7 for group 2,
removed and transferred into 50-mL conical tubes (BD Falcon 39.2618.1 for group 3, and 40.1617.3 for group 4. No significant
Biosciences, San Jose, CA) containing 100 units/mL of penicillin, difference was observed in the average intensity of corneal vascu-
100 mg/mL of streptomycin (P–S; Gibco Invitrogen Corporation, San larization among the groups at the onset of the treatment. However, a
Diego, CA), CaCl2- and MgCl2-free Hank’s balanced salt solution statistically meaningful improvement was observed in vascular-
(HBSS 1·; Gibco Invitrogen Corporation). The cornea samples were ization in the groups 2, 3, and 4 (P,0.05) at the 14th day (Fig. 2). At
then washed 5 to 6 times with 15 mL of HBSS containing 100 the 14th day of treatment, the average corneal neovasculariza-tion
units/mL of penicillin and 100 mg/mL of strepto-mycin, after the score was 39.8624.9 for group 1, 24.2618.2 for group 2, 29.5614.2
transfer into 100 · 20 mm sterile culture dishes. Finally, the samples for group 3, and 40.1617.3 for group 4 (Fig. 3). Thus, corneal
were transferred into clean dry petri dishes. The cornea samples were neovascularization was significantly reduced by the treat-ment with
then diced with a curve-tipped scissors to a size of 1 mm3. On the tacrolimus (P,0.05). The average corneal neovascula-rization
cornea pieces, collagenase (0.5 mg/mL prepared in RPMI and regression rate for group 1 (the control group) was 14.3%64.9%, for
supplemented with 10% FBS, 10 mg/mL of gentamicin, and 5 mg/mL group 2 it was 38.5%622.2%, for group 3 it was 34.2%614.1%, and
of HEPES) was added, and the samples were incubated at 37°C. After for group 4 it was 62.5%616.6%.
incubation for 2 hr, 20 mL of RPMI 1640 was added to the samples, The average corneal edema regression rate for group 1 (the
and the samples were centrifuged at 400g for 10 min to remove the control group) was 8.05%65%, for group 2 (steroid group) it was
supernatant. To each remaining pellet, 10 mL of CAM was added for 25.07%614.05%, for group 3 (0.03% tacrolimus group) it was
resuspension, and samples were centrifuged again at 400g for 5 min. 36.05%621.09%, and for group 4 (0.1% tacrolimus group) it was
This step was repeated twice, and the pellet, formed after final 46.09%614.06% (Fig. 4).
centrifugation, was resus-pended in 1 mL of RPMI 1640 and passed A significant decrease was observed in corneal edema in the
through a series of filters (first from a 70-mm filter and then from a 0.1% tacrolimus group when it was compared with the 0.03%
40-mm filter; BD Falcon Biosciences). After a final round of tacrolimus and steroid groups (P,0.05). The difference between
centrifugation, the supernatant was discarded, and the pellet was the 0.03% tacrolimus and steroid group was not that significant
resuspended in staining buffer and was analyzed by flow cytometry (P.0.05). When the groups 2, 3, and 4 were compared with the
instrument. control group, a significant decrease was observed in corneal
To prepare for reading in the flow cytometer, the cells were edema formation (P,0.05).
centrifuged at 500g for 5 min, the supernatant was discarded, and 0.5
mL of stain buffer was added for resuspension. The resuspended cells Immunohistological Analysis
were then aliquoted into 5-mL tubes (BD Falcon Biosciences) at the The expression of CD3, CD14, and CD68 was evaluated
portions of 100 mL per tube. To each tube, one of the follow-ing was between groups (Fig. 5). There was a significant decrease in the
added with respect to the cell markers intended to be ana-lyzed: (1) T- expression of CD3, CD14, and CD68 in groups 2, 3, and 4 when
lymphocyte cocktail (CD3, CD4, and CD8) (BD Pharmingen, San compared with the control group. Group 4 showed a dramatic
Diego, CA), (2) rat compensation set (BD Phar-mingen), (3) CD45, decrease.
and (4) control for CD45. The tubes were incu-bated for 30 min The average CD3 expression level for group 1 (the control group)
before the addition of 500 mL of staining buffer, and flow cytometry was 56.14%611.22%, for group 2 (steroid group) it was
analysis was performed with FACSCalibur (BD Biosciences, San 36.61%66.44% (P¼0.01), for group 3 (0.03% tacrolimus group) it
Jose, CA). All of the antibodies were obtained from Becton was 30.12%69.46% (P¼0.01), and for group 4 (0.1% tacrolimus
Dickinson. The data were analyzed with CellQuest software (BD group) it was 14.14%66.21% (P¼0.00). When 0.1% tacrolimus and
Biosciences), and the forward and side scatter profiles allowed us to 0.03% tacrolimus groups were compared with the steroid group, the P
gate out of debris and dead cells. values were found to be 0.00 and 0.42, respectively. The expression
level of CD68 was evaluated among the groups. There was a
Statistical Analysis meaningful decrease in the expression of CD68 only in the 0.1%
Results were given as mean6SD. Statistical analysis was per- tacrolimus group when compared with the control group. The average
formed using software SPSS version 13.0 (SPSS Inc., Chicago, CD68 expression level for group 1 (the control group) was
IL). A Mann–Whitney U test was used to evaluate the differences 45.41%66.09%, for group 2 (steroid group) it was 35.97%6 7.08%
between the controls and treated eyes, and a Kruskal–Wallis test (P¼0.69), for group 3 (0.03% tacrolimus group) it was
was used to evaluate the differences within the treatment groups. 28.42%612.21% (P¼0.09), for group 4 (0.1% tacrolimus group) it
A P value less than 0.05 was considered significant. was 15.01%68.62% (P¼0.01). When the 0.1% tacrolimus and 0.03%
tacrolimus groups were compared with the steroid group, the P values
were 0.00 and 0.42, respectively. The expression level of CD14 was
RESULTS evaluated among the groups. The average CD14 expression level for
Clinical scores were 21.8066.05 in control group, 22.0069.11 in group 1 (the control group) was 72.62%6 3.99%, for group 2 (steroid
the steroid group, 22.567.41 in the 0.03% tacrolimus group, and group) it was 35.43%66.22%

© 2015 Contact Lens Association of Ophthalmologists 165

Copyright @ Contact Lens Association of Opthalmologists, Inc. Unauthorized reproduction of this article is prohibited.
 E. Eris¸ et al. Eye & Contact Lens Volume 42, Number 3, May 2016

FIG. 2. Images from the first day of treatment (A–D) and day 14th of the treatment (E–H). The control
group (A and E), the corticosteroid group (B and F), 0.03% tacrolimus group (C and G), 0.1% tacro-
limus group (D and H).

(P¼0.00), for group 3 (0.03% tacrolimus group) it was 37.99%6 24.37%60.91% (P¼0.04), for group 3 it was 11.94%60.64%
9.34% (P¼0.00), and for group 4 (0.1% tacrolimus group) it was (P¼0.01), and for group 4 it was 1.77%60.64% (P¼0.01). When
10.32%63.83% (P¼0.00). When the 0.1% tacrolimus and 0.03% the 0.1% tacrolimus and 0.03% tacrolimus groups were compared
tacrolimus groups were compared with the steroid group, the P with the corticosteroid group, the P values were found to be 0.00
values were found to be 0.00 and 0.42, respectively. for both.
The average CD4 level for the control group was 22.40%61.22%,
Flow Cytometry Analysis for the corticosteroid group it was 10.75%61.43% (P¼0.04), for
Comparison of the percentage of cells according to the flow group 3 it was 11.66%61.82% (P¼0.01), and for group 4 it was
cytometric analysis of cells from the cornea is shown in Figure 6. 1.62%60.76% (P¼0.01). When the 0.1% tacrolimus and 0.03% ta-
Figure 7 demonstrates flow cytometric data as plots of several cells crolimus groups were compared with the corticosteroid group, the P
expressing the CD markers. The average CD3 level for the control values were found to be 0.00 and 0.35, respectively.
group was 25.52%62.25%, for the corticosteroid group it was The average CD8 level for the control group was 22.15%6 1.40%,
for the corticosteroid group it was 8.17%63.90% (P¼0.00), for group
3 it was 11.60%62.47% (P¼0.01), and for group 4 it was
2.12%61.02% (P¼0.01). When the 0.1% tacrolimus

FIG. 3. Comparison of corneal vascularization score among the

groups. When groups 2, 3, and 4 were compared with the control
group, a significant decrease was observed. There was no
significant difference among groups 2, 3, and 4 when intergroup FIG. 4. The average corneal edema regression rates. *P.0.05;
comparisons were made. *P.0.05; **P,0.05. **P,0.05.

166 Eye & Contact Lens Volume 42, Number 3, May 2016

Copyright @ Contact Lens Association of Opthalmologists, Inc. Unauthorized reproduction of this article is prohibited.
 Eye & Contact Lens Volume 42, Number 3, May 2016 Tacrolimus on Herpetic Stromal Keratitis

FIG. 5. CD3-positive cells were stained in

green with immunohisto-logical stains.
(A) The control group; (B) the
corticosteroid group; (C) the 0.03%
tacrolimus group; (D) the 0.1% tacro-
limus group. (E) An isotype control
section stained with the primary anti-
body. White arrow: corneal epithelium
migration of CD3 cells, red arrow: stromal
infiltration of CD3 cells, and white star,
vessel.

and 0.03% tacrolimus groups were compared with the corticosteroid In HSK, the CD4+ T-lymphocyte subset, T helper 1–type, is the chief
group, the P values were found to be 0.01 for both comparisons. mediator with a supplementary role for Th17 cells orchestrating the
extravasation and activation of neutrophils.24,27 The neutrophils appear to
DISCUSSION be involved in corneal injury. Also, Langerhans cells and macrophages,
secreting the proinflammatory cytokines IL-1 and tumor necrosis factor
The results of our study demonstrate that topical 0.03%
(TNF)–a, are crucial mediators.28 Tacrolimus inhibits T-cell proliferation
tacrolimus is as effective as steroid treatment in HSK model,
whereas 0.1% tacrolimus treatment was significantly more effec- and decreases T-cell–derived cytokines by blocking the function of
tive than steroid treatment. enzyme calcineurin.29 As a result, blockade leads to inhibition of the Th1-
Ocular HSV infection can result in corneal scarring and type cytokines IL-2 and interferon-g, which results in lymphocytes
vascularization of the eye, resulting blindness throughout the producing less TNF-a, hence suppres-sion of this inflammatory response.
individual’s life.23 Corneal neovascularization is a milestone in the Additionally, tacrolimus inhibits the production of a number of
pathogenesis of HSK; molecules inhibiting new vessel forma-tion proangiogenic factors, such as vascular endothelial growth factor-A,
limit the lesions’ severity.24 In this study, 0.1% tacrolimus slightly, fibroblast growth factor, epidermal growth factor, histamine, platelet-
but not significantly, improved corneal neovascularization in derived growth factor, matrix metal-loproteinases, MMP-9 and MMP-13,
comparison with the steroid and the control groups. Consistent with prostaglandin E2, IL-1, IL-6, and IL-17, and hypoxia-inducible factor that
our observations, control of neovascularization by tacrolimus has are involved in corneal neovascularization, consequently reducing the
been demonstrated previously using the experimental corneal severity of HSK.30–39
neovascularization model25 or in the retina26 using the streptozotocin- In this study, clinically significant differences were observed in
induced diabetic retinopathy model. animals treated with 0.1% tacrolimus, whereas in animals treated

© 2015 Contact Lens Association of Ophthalmologists 167

Copyright @ Contact Lens Association of Opthalmologists, Inc. Unauthorized reproduction of this article is prohibited.
 E. Eris¸ et al. Eye & Contact Lens Volume 42, Number 3, May 2016

events mediated by CD4+ T cells in the recurrent infection mouse

model of HSK. In addition, the clinical study by Yago et al.43 has also
shown that tacrolimus also inhibited expression of IL-17 or TNF-a,
and they suggest a therapeutic effect on T-cell–associated diseases.
Yoon et al.10 noted that cyclosporine and tacrolimus have a
sim-ilar effect, and cyclosporine also has different effects in
different dosages. Tacrolimus shares several immunosuppressive
properties with cyclosporine A, although it is known to be 10 to
100 times more potent in this regard. Previous studies on the use
of tacroli-mus ointment in atopic eyelid disease have also shown
good levels of response and improvement in conjunctivitis
symptoms without adverse events.14–16
The main findings of this study suggest that 0.1% tacrolimus
ophthalmic solution offers an efficient option for the treatment of
HSK, although the study group is small in number and the course of
FIG. 6. Schematic representation of flow cytometry analysis results the treatment may be considered short. Despite the small sample size
at day 14th of treatment. and randomization, unequal distribution of lesions was one of the
limitations of this study. Also, this study is short term; therefore, it is
with steroid and 0.03% tacrolimus, no clinically significant differ- unclear whether in the long run it can really replace steroids, which
ences were found. show similar efficacy in reducing inflammation. The clinical use of
Barequet et al.40 investigated the therapeutic effect of a topical steroids can develop serious side effects after continuous use in the
administration of 0.03% tacrolimus in comparison with 0.1% dexa- long run; normally, their short-term usage does not develop any
methasone in a mouse model with acute allergic conjunctivitis. Con- significant issues. Thus, further long-term studies are needed to
sistent with our study, they reported that the clinical efficacy of address the long-term safety and efficacy.
topical 0.03% tacrolimus was similar to that of 0.1% dexamethasone Topical steroids remain as a joint point for the suppression of
for acute allergic conjunctivitis. In our study, we found that steroid corneal edema and neovascularization in HSK treatment. Steroid
and 0.03% tacrolimus treatment resulted in equal improvements in therapy can lead to serious side effects in long-term use, such as
corneal edema, whereas 0.1% tacrolimus treatment seems to be most increase in intraocular pressure and cataract formation. The
effective in the management of HSK edema. improvements provided by treatment with tacrolimus ointment
Previous studies41,42 demonstrate the role of IL-17 in HSK model highlight the advantageous role of tacrolimus. In the presence of
and concluded that IL-17 may contribute to immune inflammatory all this information, tacrolimus may be used in patients failing to

FIG. 7. Flow cytometric analysis of cell-

surface markers.

168 Eye & Contact Lens Volume 42, Number 3, May 2016

Copyright @ Contact Lens Association of Opthalmologists, Inc. Unauthorized reproduction of this article is prohibited.
 Eye & Contact Lens Volume 42, Number 3, May 2016 Tacrolimus on Herpetic Stromal Keratitis

respond to steroids or with the risk of a high rate of complications 10. Yoon KC, Heo H, Kang IS, et al. Effect of topical cyclosporin A on
because of chronic use of steroids. herpetic stromal keratitis in a mouse model. Cornea 2008;27:454–460.
11. Heiligenhaus A, Steuhl KP. Treatment of HSV-1 stromal keratitis with
The interpretation of data for immunohistochemical analysis topical cyclosporin A: A pilot study. Graefes Arch Clin Exp Ophthalmol
and flow cytometry analysis revealed decreased T lymphocytes, 1999;237:435–438.
macrophages, monocytes, and leucocytes in treatment groups in 12. Alaiti S, Kang S, Fiedler VC, et al. Tacrolimus (FK506) ointment for
accordance with clinical evaluation. In addition to this finding, we atopic dermatitis: A phase I study in adults and children. J Am Acad
Dermatol 1998;38:69–76.
also report a decrease in CD8 and CD3 levels in 0.1% tacrolimus-
13. Kino T, Hatanaka H, Hashimoto M, et al. FK-506, a novel immunosup-
treated subjects. pressant isolated from a Streptomyces. I. Fermentation, isolation, and
Tacrolimus administration markedly reduced HSK lesion pro- physico-chemical and biological characteristics. J Antibiot (Tokyo) 1987;
gression and the degree of corneal neovascularization, and it was 40:1249–1255.
associated with a reduced influx of T cells and neutrophils and the 14. Kymionis GD, Klados NE, Kontadakis GA, et al. Treatment of superior
limbic keratoconjunctivitis with topical tacrolimus 0.03% ointment.
production of proinflammatory cytokines, chemokines, and proan- Cornea 2013;32:1499–1501.
giogenic molecules. Thus, tacrolimus therapy may represent a novel 15. Tzu JH, Utine CA, Stern ME, et al. Topical calcineurin inhibitors in the
approach to suppressing HSV-induced ocular immunoreaction instead treatment of steroid-dependent atopic keratoconjunctivitis. Cornea
of steroids, while also avoiding corneal scarring. 2012;31: 649–654.
16. Al-Amri AM. Long-term follow-up of tacrolimus ointment for treatment
In our study, the effect of tacrolimus on HSK was shown to be of atopic keratoconjunctivitis. Am J Ophthalmol 2014;157:280–286.
because of the suppression of cytokines, which ultimately cause a 17. Magalhaes OA, Marinho DR, Kwitko S. Topical 0.03% tacrolimus
decrease in macrophage chemotaxis. As reported by others, direct prevent-ing rejection in high-risk corneal transplantation: A cohort study.
activation of T cells can be inhibited by tacrolimus treatment. It Br J Ophthalmol 2013;97:1395–1398.
will be important to understand how the activation of T cells 18. Shimmura-Tomita M, Shimmura S, Satake Y, et al. Keratoplasty postoper-
ative treatment update. Cornea 2013;1(32 suppl):60–64.
resulting in HSK is mediated at the molecular level. 19. Dhaliwal JS, Mason BF, Kaufman SC. Long-term use of topical tacrolimus
In conclusion, 0.1% tacrolimus treatment is more effective then (FK506) in high-risk penetrating keratoplasty. Cornea 2008;27:488–493.
1% prednisolone treatment in HSK. In addition, there was no 20. Blaho JA, Morton ER, Yedowitz JC. Herpes simplex virus: Propagation,
clear-cut difference between the uses of 0.03% tacrolimus and 1% quantification, and storage. In: Current Protocols Microbiology. New
York: John Wiley & Sons, Inc, 2005; Chapter 14:Unit 14E.1.
prednisolone acetate in HSK treatment.
21. Brandt CR, Akkarawongsa R, Altmann S, et al. Evaluation of a theta-
When we compare the acyclovir only–treated group with the defensin in a murine model of herpes simplex virus type 1 keratitis. Invest
steroid plus 0.03% tacrolimus–received group, we noticed that Ophthalmol Vis Sci 2007;48:5118–5124.
there was a meaningful decrease in T lymphocyte levels. CD4- 22. Karaoz E, Aksoy A, Ayhan S, et al. Characterization of mesenchymal stem
positive T lymphocyte levels did not show a change when the cells from rat bone marrow: Ultrastructural properties, differentiation
poten-tial and immunophenotypic markers. Histochem Cell Biol
0.03% tacrolimus–received group was compared with the steroid- 2009;132:533– 546.
received group. Based on these findings, we can conclude that the 23. Farooq AV, Shukla D. Herpes simplex epithelial and stromal keratitis: An
use of 0.03% tacrolimus is as effective as the use of 1% prednis- epidemiologic update. Surv Ophthalmol 2012;57:448–462.
olone on HSK treatment without the complications seen with ste- 24. Giménez F, Suryawanshi A, Rouse BT. Pathogenesis of herpes stromal
keratitis—A focus on corneal neovascularization. Prog Retin Eye Res
roids. In the future, topical tacrolimus might be a promising
2013;33:1–9.
treatment alternative in both treating stromal keratitis and 25. Turgut B, Guler M, Akpolat N, et al. The impact of tacrolimus on vascular
prevent-ing recurrences of herpetic keratitis. endothelial growth factor in experimental corneal neovascularization. Curr
Eye Res 2011;36:34–40.
26. Su L. Tacrolimus (FK506) prevents early retinal neovascularization. Int
REFERENCES Immunopharmacol 2012;14:606–612.
1. Liesegang TJ. Epidemiology of ocular herpes simplex. Natural history in 27. Lepisto AJ, Frank GM, Hendricks RL. How herpes simplex virus type 1
Rochester, Minn, 1950 through 1982. Arch Ophthalmol 1989;107: 1160– rescinds corneal privilege. Chem Immunol Allergy 2007;92:203–212.
1165. 28. Rowe AM, St Leger AJ, Jeon S, et al. Herpes keratitis. Prog Retin Eye Res
2. Deshpande S, Zheng M, Lee S, et al. Bystander activation involving T 2013;32:88–101.
lymphocytes in herpetic stromal keratitis. J Immunol 2001;167: 2902– 29. Shihab F, Christians U, Smith L, et al. Focus on mTOR inhibitors and
2910. tacrolimus in renal transplantation: Pharmacokinetics, exposure-response
3. Hendricks RL. Immunopathogenesis of viral ocular infections. Chem Im- relationships, and clinical outcomes. Transpl Immunol 2014;31:22–32.
munol 1999;73:120–136. 30. Walgenbach KJ, Kalff JC, Sonmez-Alpan E, et al. Upregulation of basic
4. Azar DT. Corneal angiogenic privilege: Angiogenic and antiangiogenic fibroblast growth factor during chronic rejection of rat intestinal allografts
factors in corneal avascularity, vasculogenesis, and wound healing. Trans and its downregulation by FK 506. Transplant Proc 1998;30:2587.
Am Ophthalmol Soc 2006;104:264–302. 31. Lopez-Ilasaca M, Schiene C, Küllertz G, et al. Effects of FK506-binding
5. Wilhelmus KR, Gee L, Hauck WW, et al. Herpetic Eye Disease Study. A protein 12 and FK506 on autophosphorylation of epidermal growth factor
controlled trial of topical corticosteroids for herpes simplex stromal receptor. J Biol Chem 1998;273:9430–9434.
keratitis. Ophthalmology 1994;101:1883–1895. 32. Sengoku T, Kishi S, Sakuma S, et al. FK506 inhibition of histamine
6. Heiligenhaus A, Li H, Hernandez Galindo EE, et al. Management of acute release and cytokine production by mast cells and basophils. Int J
ulcerative and necrotising herpes simplex and zoster keratitis with Immunopharma-col 2000;22:189–201.
amniotic membrane transplantation. Br J Ophthalmol 2003;87:1215–1219. 33. Savikko J, Taskinen E, Von Willebrand E. Tacrolimus inhibits platelet-derived
7. Shi W, Chen M, Xie L. Amniotic membrane transplantation combined growth factor ligand and receptor induction as well as rejection changes in rat
with antiviral and steroid therapy for herpes necrotizing stromal keratitis. renal allografts during long-term follow-up. Transplant Proc 2002;34:1382.
Oph-thalmology 2007;114:1476–1481. 34. Sasakawa T, Sasakawa Y, Ohkuba Y, et al. FK506 inhibits prostaglandin
8. Heiligenhaus A, Li HF, Yang Y, et al. Transplantation of amniotic mem- E2 production from synovial cells by suppressing peripheral blood
brane in murine herpes stromal keratitis modulates matrix metalloprotei- mononu-clear cells. Int Immunopharmacol 2005;5:1291–1297.
nases in the cornea. Invest Ophthalmol Vis Sci 2005;46:4079–4085. 35. Migita K, Maeda Y, Abiru S, et al. Immunosuppressant FK506 inhibits
9. Gunduz K, Ozdemir O. Topical cyclosporin as an adjunct to topical acyclovir matrix metalloproteinase-9 induction in TNF-alpha-stimulated human
treatment in herpetic stromal keratitis. Ophthalmic Res 1997;29:405–408. hepatic stellate cells. Life Sci 2006;78:2510–2515.

© 2015 Contact Lens Association of Ophthalmologists 169

Copyright @ Contact Lens Association of Opthalmologists, Inc. Unauthorized reproduction of this article is prohibited.
 E. Eris¸ et al. Eye & Contact Lens Volume 42, Number 3, May 2016

36. Migita K, Miyashita T, Maeda Y, et al. FK506 suppresses the stimulation 40. Barequet IS, Platner E, Sade K. Topical tacrolimus for the management of
of matrix metalloproteinase 13 synthesis by interleukin-1beta in acute allergic conjunctivitis in a mouse model. Graefes Arch Clin Exp
rheumatoid synovial fibroblasts. Immunol Lett 2005;98:194–199. Ophthalmol 2013;251:1717–1721.
37. Sakuma S, Kato Y, Nishigaki F, et al. FK506 potently inhibits T cell 41. Xia L, Zhang S, Cao Z, et al. Interleukin-17 enhanced
activation induced TNF-alpha and IL-1beta production in vitro by human immunoinflammatory lesions in a mouse model of recurrent herpetic
peripheral blood mononuclear cells. Br J Pharmacol 2000;130:1655–1663. keratitis. Microbes Infect 2013;15:126–139.
38. Sakuma S, Kato Y, Nishigaki F, et al. Effects of FK506 and other immu- 42. Maertzdorf J, Osterhaus AD, Verjans GM. IL-17 expression in human
nosuppressive anti-rheumatic agents on T cell activation mediated IL-6 herpetic stromal keratitis: Modulatory effects on chemokine production by
and IgM production in vitro. Int Immunopharmacol 2001;1:749–757. corneal fibroblasts. J Immunol 2002;169:5897–5903.
39. Kong X, Lin Z, Caro J. Immunophilin-ligands FK506 and CsA inhibit 43. Yago T, Nake Y, Kawamoto M, et al. Tacrolimus potently inhibits human
HIF1a expression by a VHL- and ubiquitin-independent mechanism. osteoclastogenesis induced by IL-17 from human monocytes alone and
FEBS Lett 2006;580:6182–6186. suppresses human Th17 differentiation. Cytokine 2012;59:252–257.

170 Eye & Contact Lens Volume 42, Number 3, May 2016

Copyright @ Contact Lens Association of Opthalmologists, Inc. Unauthorized reproduction of this article is prohibited.