Lodish Cloning

16 Control of Gene Expression
• Creating Giant Mice

Through Gene Regulation
• General Principles
of Gene Regulation
Levels of Gene Control
Genes and Regulatory Elements
DNA-Binding Proteins
• Gene Regulation in Bacterial Cells
Operon Structure
Negative and Positive Control:
Inducible and Repressible Operons
The lac Operon of E. coli
lac Mutations
Positive Control
and Catabolite Repression
The trp Operon of E. coli
Attenuation: The Premature
Termination of Transcription
Antisense RNA in Gene Regulation
Transcriptional Control
in Bacteriophage Lambda
• Eukaryotic Gene Regulation
Chromatin Structure
and Gene Regulation
The giant transgenic mouse on the left was produced by injecting a rat Transcriptional Control
gene for growth hormone into a mouse embryo; a normal-size mouse is in Eukaryotic Cells
on the right. To ensure expression, the rat gene was linked to a DNA sequence Gene Control
that stimulates the transcription of mouse DNA whenever heavy metals are pre- Through Messenger RNA Processing
sent. Zinc was provided in the food for the transgenic mouse; some transgenic Gene Control Through RNA Stability
mice produced 800 times the normal levels of growth hormone. (Courtesy of RNA Silencing
Dr. Ralph L. Brinster, School of Veterinary Medicine, University of Pennsylvania.) Translational and Posttranslational
Control
Creating Giant Mice genic mice produced growth hormone encoded by the rat
gene. Some of the transgenic mice produced from 100 to
Through Gene Regulation 800 times the amount of growth hormone found in normal
In 1982, a group of molecular geneticists led by Richard mice, which caused them to grow rapidly into giants.
Palmiter at the University of Washington produced gigantic Inserting foreign genes into bacteria, plants, mice, and
mice that grew to almost twice the size of normal mice. even humans is now a routine procedure for molecular
Palmiter and his colleagues created these large mice through geneticists (see Chapter 18). However, simply putting a gene
genetic engineering, by injecting the rat gene for growth into a cell does not guarantee that the gene will be tran-
hormone into the nuclei of fertilized mouse embryos and scribed or produce a protein; indeed, most foreign genes are
then implanting these embryos into surrogate mouse moth- never transcribed or translated, which isn’t surprising.
ers. In a few embryos, the rat gene became incorporated Organisms have evolved complex systems to ensure that
into the mouse chromosome and, after birth, these trans- genes are expressed at the appropriate time and in the
434
Control of Gene Expression 435
appropriate amounts, and sequences other than the gene The answer is through gene regulation. Bacteria carry
itself are required to ensure transcription and translation. the genetic information for many proteins, but only a subset
In this chapter, we will learn more about these sequences of this genetic information is expressed at any time. When
and other mechanisms that control gene expression. the environment changes, new genes are expressed, and
If foreign genes are rarely expressed, why did the trans- proteins appropriate for the new environment are syn-
genic mice with the gene for rat growth hormone grow so thesized. For example, if a carbon source appears in the
big? Palmiter and his colleagues, aware of the need to pro- environment, genes encoding enzymes that take up and
vide sequences that control gene expression, linked the rat metabolize this carbon source are quickly transcribed and
gene with the mouse metallothionein I promoter sequence, translated. When this carbon source disappears, the genes
a DNA sequence normally found upstream of the mouse that encode them are shut off. This type of response, the
metallothionein I gene. When heavy metals such as zinc synthesis of an enzyme stimulated by a specific substrate, is
are present, they activate the metallothionein promoter called induction.
sequence, thereby stimulating transcription of the metal- Multicellular eukaryotic organisms face a different
lothionein I gene. By connecting the rat growth-hormone dilemma. Individual cells in a multicellular organism are
gene to this promoter, Palmiter and his colleagues provided specialized for particular tasks. The proteins produced by
a means of turning on the transcription of the gene, simply a nerve cell, for example, are quite different from those pro-
by putting extra zinc in the food for the transgenic mice. duced by a white blood cell. The problem that a eukaryotic
This chapter is about gene regulation, the mechanisms cell faces is how to specialize. Although they are quite differ-
and systems that control the expression of genes. We begin ent in shape and function, a nerve cell and a blood cell still
by discussing why gene regulation is necessary; the levels at carry the same genetic instructions.
which gene expression is controlled; and the difference A multicellular organism’s challenge is to bring about
between genes and regulatory elements. We then examine the specialization of cells that have a common set of genetic
gene regulation in bacterial cells. In the second half of the instructions. This challenge is met through gene regulation:
chapter, we turn to gene regulation in eukaryotic cells, all of an organism’s cells carry the same genetic informa-
which is often more complex than in bacterial cells. tion, but only a subset of genes are expressed in each cell
type. Genes needed for other cell types are not expressed.
General Principles Gene regulation is therefore the key to both unicellular flex-
ibility and multicellular specialization, and it is critical to
of Gene Regulation the success of all living organisms.
One of the major themes of molecular genetics is the
central dogma, which stated that genetic information flows
Concepts
from DNA to RNA to proteins (see Figure 10.17a) and pro-
vided a molecular basis for the connection between geno- In bacteria, gene regulation maintains internal
type and phenotype. Although the central dogma brought flexibility, turning genes on and off in response to
coherence to early research in molecular genetics, it failed to environmental changes. In multicellular eukaryotic
address a critical issue: How is the flow of information organisms, gene regulation brings about cellular
along the molecular pathway regulated? differentiation.
Consider E. coli, a bacterium that resides in your large
intestine. Your eating habits completely determine the
nutrients available to this bacteria: it can’t seek out nourish- Levels of Gene Control
ment when nutrients are scarce; nor can it move away when A gene may be regulated at a number of points along the
confronted with unpleasant changes. E. coli makes up for its pathway of information flow from genotype to phenotype
inability to alter the external environment by being inter- ( ◗ FIGURE 16.1). First, regulation may be through the alter-
nally flexible. For example, if glucose is present, E. coli uses it ation of gene structure. Modifications to DNA or its pack-
to generate ATP; if there’s no glucose, it utilizes lactose, aging may influence which sequences are available for
arabinonse, maltose, xylose, or any of a number of other transcription or the rate at which sequences are transcribed.
sugars. When amino acids are available, E. coli uses them to DNA methylation and changes in chromatin are two
synthesize proteins; if a particular amino acid is absent, processes that play a pivotal role in gene regulation.
E. coli produces the enzymes needed to synthesize that A second point at which a gene can be regulated is at
amino acid. Thus, E. coli responds to environmental changes the level of transcription. For the sake of cellular economy,
by rapidly altering its biochemistry. This biochemical flexi- it makes sense to limit protein production early in the
bility, however, has a high price. Producing all the enzymes transfer of information from DNA to protein, and tran-
necessary for every environmental condition would be ener- scription is an important point of gene regulation in both
getically expensive. So how does E. coli maintain biochemical bacterial and eukaryotic cells. A third potential point of
flexibility while optimizing energy efficiency? gene regulation is mRNA processing. Eukaryotic mRNA is
436 Chapter 16
Compact DNA Levels of gene control All of these factors, as well as the availability of amino acids
and sequences in mRNA, influence the rate at which pro-
teins are produced and therefore provide points at which
gene expression may be controlled.
Finally, many proteins are modified after translation
Alteration of structure (Chapter 13), and these modifications affect whether the
Relaxed DNA
proteins become active; so genes can be regulated through
processes that affect posttranscriptional modification. Gene
expression may be affected by regulatory activities at any or
all of these points.
Transcription
Concepts
Pre-mRNA
Gene expression may be controlled at any of
a number of points along the molecular pathway
from DNA to protein, including gene structure,
mRNA processing
transcription, mRNA processing, RNA stability,
translation, and posttranslational modification.
Processed mRNA
AAAAA
Genes and Regulatory Elements
RNA stability
In our consideration of gene regulation, it will be necessary
Translation
to distinguish between the DNA sequences that are tran-
scribed and the DNA sequences that regulate the expression
of other sequences. We will refer to any DNA sequence that
Protein is transcribed into an RNA molecule as a gene. According to
(inactive)
this definition, genes include DNA sequences that encode
proteins, as well as sequences that encode rRNA, tRNA,
Posttranslational modification
snRNA, and other types of RNA. Structural genes encode
proteins that are used in metabolism or biosynthesis or that
play a structural role in the cell. Regulatory genes are genes
whose products, either RNA or proteins, interact with other
Modified protein sequences and affect their transcription or translation. In
(active)
many cases, the products of regulatory genes are DNA-
binding proteins.
◗16.1 Gene expression may be controlled at We will also encounter DNA sequences that are not
transcribed at all but still play a role in regulating other
multiple levels.
nucleotide sequences. These regulatory elements affect the
expression of sequences to which they are physically linked.
extensively modified before it is translated; a 5 cap is Much of gene regulation takes place through the action of
added, the 3 end is cleaved and polyadenylated, and introns proteins produced by regulatory genes that recognize and
are removed (see Chapter 14). These modifications deter- bind to regulatory elements.
mine the stability of the mRNA, whether mRNA can be
translated, the rate of translation, and the amino acid
sequence of the protein produced. There is growing evi- Concepts
dence that a number of regulatory mechanisms in eukary- Genes are DNA sequences that are transcribed
otic cells operate at the level of mRNA processing. into RNA. Regulatory elements are DNA sequences
A fourth point for the control of gene expression is that are not transcribed but affect the expression
the regulation of RNA stability. The amount of protein of genes.
produced depends not only on the amount of mRNA syn-
thesized, but also on the rate at which the mRNA is
degraded; so RNA stability plays an important role in gene DNA-Binding Proteins
expression. A fifth point of gene regulation is at the level of Much of gene regulation is accomplished by proteins that
translation, a complex process requiring a large number of bind to DNA sequences and influence their expression.
enzymes, protein factors, and RNA molecules (Chapter 15). These regulatory proteins generally have discrete functional
(a) Helix-turn-helix (b) Zinc fingers (c) Steroid receptor
Helix Turn Helix
DNA- Turn Dimer-

binding helix binding helix Finger Zinc ions
(d) Leucine zipper (e) Helix-loop-helix (f) Homeodomain
Helix
Loop
Leucine
Zipper
DNA-binding Minor Major

helix groove groove
◗ 16.2 DNA-binding proteins can be grouped into several types on the basis of
their structure, or motif. (a) The helix-turn-helix DNA motif consists of two alpha
helices connected by a turn. (b) The zinc-finger motif consists of a loop of amino acids
containing a single zinc ion. Most proteins containing zinc fingers have several repeats of
the zinc-finger motif. Each zinc finger fits into the major groove of DNA and forms
hydrogen bonds with bases in the DNA. (c) The steroid receptor binding motif has two
alpha helices, each with a zinc ion surrounded by four cysteine residues. The two alpha
helices are perpendicular to one another: one fits into the major groove of the double
helix, whereas the other is parallel to the DNA. (d) The leucine-zipper motif consists of a
helix of leucine nucleotides and an arm of basic amino acids. DNA-binding proteins
usually have two polypeptides; the leucine nucleotides of the two polypeptides face one
another, whereas the basic amino acids bind to the DNA. (e) The helix-loop-helix binding
motif consists of two alpha helices separated by a loop of amino acids. Two polypeptide
chains with this motif join to form a functional DNA-binding protein. A highly basic set
of amino acids in one of the helices binds to the DNA. (f) The homeodomain motif
consists of three alpha helices; the third helix fits in a major groove of DNA.
parts — called domains, typically consisting of 60 to 90 DNA-binding proteins can be grouped into several dis-
amino acids — that are responsible for binding to DNA. tinct types on the basis of a characteristic structure, called
Within a domain, only a few amino acids actually make a motif, found within the binding domain. Motifs are simple
contact with the DNA. These amino acids (most commonly structures, such as alpha helices, that can fit into the major
asparagine, glutamine, glycine, lysine, and arginine) often groove of the DNA. Some common DNA-binding motifs are
form hydrogen bonds with the bases or interact with the illustrated in ◗ FIGURE 16.2 and are summarized in Table 16.1.
sugar – phosphate backbone of the DNA. Many regulatory
proteins have additional domains that can bind other mole- www.whfreeman.com/pierce Molecular images of several
cules such as other regulatory proteins. DNA-binding proteins
438 Chapter 16
Table 16.1 Common DNA-binding motifs

Motif Location Characteristics Binding Site in DNA
Helix-turn-helix Bacterial regulatory Two alpha helices Major groove

proteins; related motifs
in eukaryotic proteins
Zinc-finger Eukaryotic regulatory Loop of amino acids Major groove
and other proteins with zinc at base
Steroid receptor Eukaryotic proteins Two perpendicular alpha Major groove
helices with zinc and DNA
surrounded by four backbone
cysteine residues
Leucine-zipper Eukaryotic Helix of leucine residues and Two adjacent
transcription factors a basic arm; two leucine major grooves
residues interdigitate
Helix-loop-helix Eukaryotic proteins Two alpha helices separated Major groove
by a loop of amino acids
Homeodomain Eukaryotic regulatory Three alpha helices Major groove
proteins
Gene Regulation in Bacterial Cells enzymes carry out a series of biochemical reactions that
convert precursor molecule X into product Y. The tran-
The mechanisms of gene regulation were first investigated scription of structural genes a, b, and c is under the control
in bacterial cells, where the availability of mutants and the of a promoter, which lies upstream of the first structural
ease of laboratory manipulation made it possible to unravel gene. RNA polymerase binds to the promoter and then
the mechanisms. When the study of these mechanisms in moves downstream, transcribing the structural genes.
eukaryotic cells began, it seemed clear that bacterial and A regulator gene helps to regulate the transcription of
eukaryotic gene regulation were quite different. As more the structural genes of the operon. The regulator gene is not
and more information has accumulated about gene regula- considered part of the operon, although it affects operon
tion, however, a number of common themes have emerged, function. The regulator gene has its own promoter and is
and today many aspects of gene regulation in bacterial and transcribed into a relatively short mRNA, which is trans-
eukaryotic cells are recognized to be similar. Although we lated into a small protein. This regulator protein may bind
will look at gene regulation in these two cell types sepa- to a region of DNA called the operator and affect whether
rately, the emphasis will be on the common themes that transcription can take place. The operator usually overlaps
apply to all cells. the 3 end of the promoter and sometimes the 5 end of the
first structural gene (see Figure 16.3).
Operon Structure
One significant difference in prokaryotic and eukaryotic
Concepts
gene control lies in the organization of functionally related
genes. Many bacterial genes that have related functions are Functionally related genes in bacterial cells are
clustered and are under the control of a single promoter. frequently clustered together as a single
These genes are often transcribed together into a single transcriptional unit termed an operon. A typical
mRNA. Eukaryotic genes, in contrast, are dispersed, and operon includes several structural genes, a
typically, each is transcribed into a separate mRNA. A group promoter for the structural genes, and an operator
of bacterial structural genes that are transcribed together site where the product of a regulator gene binds.
(along with their promoter and additional sequences that
control transcription) is called an operon.
Negative and Positive Control:
The organization of a typical operon is illustrated in
◗ FIGURE 16.3. At one end of the operon is a set of structural Inducible and Repressible Operons
genes, shown in Figure 16.3 as gene a, gene b, and gene c. There are two types of transcriptional control: negative con-
These structural genes are transcribed into a single mRNA, trol, in which a regulatory protein acts as a repressor, binding
which is translated to produce enzymes A, B, and C. These to DNA and inhibiting transcription; and positive control, in
1 An operon is a group of Operon

structural genes plus sequences
that control transcription. Operator
Structural genes
Regulator
gene RNA Gene a Gene b Gene c
Promoter polymerase Promoter
2 A separate regulator gene— Transcription Transcription

with its own promoter—… 4 …that may bind to the operator
site to regulate the transcription…
mRNA mRNA
3 …encodes a regulator Translation 5 …of mRNA,… Translation

protein…
Regulator Proteins (enzymes) A B C

protein
6 …whose products
catalyze reactions in a
biochemical pathway.
Biochemical pathway
Precursor X Intermediate Product Y
products
7 In some operons, product molecules
may, in turn, bind to the regulator
◗ 16.3 An operon is a single transcriptional unit protein to either activate it or turn it off.
that includes a series of structural genes, a

promoter, and an operator.
which a regulatory protein acts as an activator, stimulating When the inducer is absent, the repressor binds to the
transcription. In the next sections, we will consider several operator, the structural genes are not transcribed, and
varieties of these two basic control mechanisms. enzymes D, E, and F (which metabolize precursor V) are
not synthesized (see Figure 16.4a). This is an adaptive
Negative inducible operons In an operon with negative mechanism: because no precursor V is available, it would be
control at the operator site, the regulatory protein is wasteful for the cell to synthesize the enzymes when they
a repressor — the binding of the regulator protein to the have no substrate to metabolize. As soon as precursor V
operator inhibits transcription. In a negative inducible becomes available, some of it binds to the repressor, render-
operon, transcription and translation of the regulator gene ing the repressor inactive and unable to bind to the opera-
produce an active repressor that readily binds to the operator site. Now RNA polymerase can bind to the promoter
tor ( ◗ FIGURE 16.4a). Because the operator site overlaps with and transcribe the structural genes. The resulting mRNA is
the promoter site, the binding of this protein to the opera- then translated into enzymes D, E, and F, which convert
tor physically blocks the binding of RNA polymerase to the substrate V into product W (see Figure 16.4b). So, an
promoter and prevents transcription. For transcription to operon with negative inducible control regulates the synthe-
take place, something must happen to prevent the binding sis of the enzymes economically: the enzymes are synthe-
of the repressor at the operator site. This type of system is sized only when their substrate (V) is available.
said to be inducible, because transcription is normally off
(inhibited) and must be turned on (induced). Negative repressible operons Some operons with neg-
Transcription is turned on when a small molecule, an ative control are repressible, meaning that transcription
inducer, binds to the repressor. ◗ FIGURE 16.4b shows that, normally takes place and must be turned off, or repressed.
when precursor V (acting as the inducer) binds to the The regulator protein in this type of operon also is a repres-
repressor, the repressor can no longer bind to the operator. sor but is synthesized in an inactive form that cannot by
Regulatory proteins frequently have two binding sites: one itself bind to the operator. Because there is no repressor
that binds to DNA and another that binds to a small mole- bound to the operator, RNA polymerase readily binds to the
cule such as an inducer. Binding of the inducer alters the promoter and transcription of the structural genes takes
shape of the repressor, preventing it from binding to DNA. place ( ◗ FIGURE 16.5a).
Proteins of this type, which change shape on binding to To turn transcription off, something must happen to
another molecule, are called allosteric proteins. make the repressor active. A small molecule called a core-
440 Chapter 16
Operon
Negative inducible operon Operator
(a) No precursor present Structural genes
Regulator Cannot
RNA
gene bind Gene d Gene e Gene f
polymerase
Promoter Promoter
Transcription No transcription
and translation
1 The regulator protein is 2 …that binds 3 …and prevents
a repressor, produced in Active to the operator… transcription of the
an active form,… regulator structural genes.
protein
(b) Precursor V (the inducer) present Operator
RNA
polymerase
Transcription Transcription
and translation and translation
4 When precursor V is Inactive D E F

present, it binds to the regulator
regulator protein and protein 5 The inactive regulator 6 …and transcription and
makes the regulator protein is unable to translation of structural
protein inactive. Active bind to the operator… genes takes place.
regulator
protein
Biochemical pathway
Precursor V Intermediate Product W
products
Conclusion: The operon is turned on (and produces
◗ 16.4
product W) only when precursor, V, is available.
Some operons are inducible.
pressor binds to the repressor and makes it capable of bind- and stimulates transcription. Theoretically, positive control
ing to the operator. In the example illustrated (see Figure could be inducible or repressible.
16.5a), the product (U) of the metabolic reaction is the In a positive inducible operon, transcription would
corepressor. As long as the level of product U is high, it is normally be turned off because the regulator protein
available to bind to and activate the repressor, preventing would be produced in an inactive form. Transcription
transcription ( ◗ FIGURE 16.5b). With the operon repressed, would take place when an inducer became attached to the
enzymes G, H, and I are not synthesized, and no more U is regulatory protein, rendering the regulator active. Logi-
produced from precursor T. However, when all of product U cally, the inducer should be the precursor of the reaction
is used up, the repressor is no longer activated by U and can- controlled by the operon so that the necessary enzymes
not bind to the operator. The inactivation of the repressor would be synthesized only when the substrate for their
allows the transcription of the structural genes and the syn- reaction was present.
thesis of enzymes G, H, and I, resulting in the conversion of A positive operon could also be repressible; transcrip-
precursor T into product U. tion would normally take place and would have to be
As with inducible operons, repressible operons are eco- repressed. In this case, the regulator protein would be pro-
nomical: the enzymes are synthesized only as needed. Note duced in a form that readily binds to DNA and stimulates
that both the inducible and the repressible systems that we transcription. Transcription would be inhibited when a sub-
have considered are forms of negative control, in which stance became attached to the activator and rendered it
the regulatory protein is a repressor. We will now consider unable to bind to the DNA so that transcription was no
positive control, in which a regulator protein stimulates longer stimulated. Here, the product (P) of the reaction
transcription. controlled by the operon would logically be the repressing
substance, because it would be economical for the cell to
Positive control With positive control, a regulatory pro- prevent the transcription of genes that allow the synthesis
tein binds to DNA (usually at a site other than the operator) of P when plenty of P is already available.
Operon
Negative repressible operon
Operator
(a) No product U present Structural genes
Regulator
RNA
gene Gene g Gene h Gene i
polymerase
Promoter Promoter
1 The regulator protein is an 2 Transcription of

Inactive regulator inactive repressor, unable the structural genes
protein (repressor) to bind to the operator. therefore takes place.
Enzymes G H I
Biochemical pathway
Precursor T Intermediate Product U
products (corepressor)
(b) Product U present Operator

RNA Cannot
polymerase bind
and translation
3 Product U binds to the 4 …making it active and able 5 …and thus preventing
Inactive regulator regulator protein,… to bind to the operator… transcription.
protein (repressor)
Active regulator Product U

protein (corepressor)
◗ 16.5 Some operons are repressible.
Putting it all together Theoretically, operons might Concepts

exhibit positive or negative control and be either inducible
There are two basic types of transcriptional
or repressible. Try sketching out all possible types —
control: negative and positive. In negative control,
negative inducible, negative repressible, positive inducible,
when a regulatory protein (repressor) binds to DNA,
and positive repressible. To do so, learn the meanings of
transcription is inhibited; in positive control, when
positive and negative control and inducible and repressible;
a regulatory protein (activator) binds to DNA,
then use logic to work out the details of whether the regu-
transcription is stimulated. Some operons are inducible;
latory protein is a repressor or an activator and whether it
transcription is normally off and must be turned on.
is produced in an active or inactive form. You can check
Other operons are repressible; transcription is
your answers against Table 16.2, where the important
normally on and must be turned off.
features of these four types of operons are summarized.
Another useful exercise is to think about the effects of
mutations at various sites in different types of operon
systems. The lac Operon of E. coli
Although it is a useful learning device to think of In 1961, François Jacob and Jacques Monod described the
operons as either positive or negative and either inducible “operon model” for the genetic control of lactose metabo-
or repressive, in reality both positive and negative con- lism in E. coli. This work and subsequent research on the
trols often exist in the same operon. genetics of lactose metabolism established the operon as
442 Chapter 16
Table 16.2 Features of inducible and repressible operons with positive and negative control
Effect of
Transcription Regulatory Action of
Type of Control Normally Regulator Protein Protein Modulator
Negative inducible Off Active repressor Inhibits Substrate makes

transcription repressor inactive
Negative repressible On Inactive repressor Inhibits Product makes
transcription repressor active
Positive inducible Off Inactive activator Stimulates Substrate makes
transcription activator active
Positive repressible On Active activator Stimulates Product makes
transcription activator inactive
the basic unit of transcriptional control in bacteria. Despite important role in regulating lactose metabolism. A third
the fact that, at the time, no methods were available for enzyme, thiogalactoside transacetylase, also is produced by
determining nucleotide sequences, Jacob and Monod the lac operon, but its function in lactose metabolism is not
deduced the structure of the operon genetically by analyzing yet known.
the interactions of mutations that interfered with the nor- The enzymes -galactosidase, permease, and transacety-
mal regulation of lactose metabolism. We will examine the lase are encoded by adjacent structural genes in the lac
effects of some of these mutations after seeing how the lac operon of E. coli. -Galactosidase is encoded by the lacZ gene,
operon regulates lactose metabolism. permease by the lacY gene, and transacetylase by the lacA gene
Lactose (a disaccharide) is one of the major carbohy- ( ◗ FIGURE 16.7a). When lactose is absent from the medium in
drates found in milk; it can be metabolized by E. coli bacte- which E. coli grows, only a few molecules of each enzyme are
ria that reside in the gut of mammals. Lactose does not produced. If lactose is added to the medium and glucose is
easily diffuse across the E. coli cell membrane and must be absent, the rate of synthesis of all three enzymes simultane-
actively transported into the cell by the enzyme permease ously increases about a thousandfold within 2 to 3 minutes.
( ◗ FIGURE 16.6). To utilize lactose as an energy source, E. coli This boost in enzyme synthesis results from transcription of
must first break it into glucose and galactose, a reaction cat- lacZ, lacY, and lacA and examplifies coordinate induction, the
alyzed by the enzyme -galactosidase. This enzyme can also simultaneous synthesis of several enzymes, stimulated by a
convert lactose into allolactose, a compound that plays an specific molecule, the inducer ( ◗ FIGURE 16.7b). Although
Extracellular
1 Permease actively
lactose
transports lactose
into the cell,… Permease Cell membrane
2 …where the enzyme

ß-galactosidase breaks it
into galactose and glucose.
β-Galactosidase
Lactose
3 ß-Galactosidase
also converts β-Galactosidase
+
lactose into the Galactose Glucose
related compound
allolactose…
β-Galactosidase
Allolactose
◗ 16.6 Lactose, a major carbohydrate 4 …and converts allolactose
found in milk, consists of 2 into galactose and glucose.
six-carbon sugars linked together.
Operon
The lac operon lac O
RNA
Absence of lactose operator Structural genes
(a) polymerase
Regulator Cannot
gene (lac I ) bind lac Z lac Y Gene
lacA i
PI lac P
and translation
1 In the absence of lactose, the regulator

Active protein (a repressor) binds to the
regulator operator and inhibits transcription.
protein
(repressor)
lacO
RNA operator
(b) Presence of lactose polymerase
Active regulator 3 …which then binds 4 The regulatory 5 …and the structural
protein to the regulatory protein, protein cannot bind genes are transcribed
making the protein inactive. to the operator,… and translated.
Inactive regulator
protein (repressor) Enzymes
β-Galactosidase Permease Transacetylase
Allolactose
Glucose
2 When lactose is present,
β-Ga Lactose Galactose
some of it is converted lactosidas
e
into allolactose,… 6 The enzymes convert lactose
into glucose and galactose.
◗ 16.7 The lac operon regulates lactose metabolism.
lactose appears to be the inducer here, allolactose is actually down the DNA molecule, transcribing the structural genes.
responsible for induction. When the repressor is bound to the operator, the binding of
In the lac operon, the lacZ, lacY, and lacA genes have RNA polymerase is blocked, and transcription is prevented.
a common promoter (lacP in Figure 16.7a) and are tran- When lactose is present, some of it is converted into allolac-
scribed together. Upstream of the promoter is a regulator tose, which binds to the repressor and causes the repressor to
gene, lacI, which has its own promoter (PI). The lacI gene is be released from the DNA. In the presence of lactose, then,
transcribed into a short mRNA that is translated into the repressor is inactivated, the binding of RNA polymerase
a repressor. Each repressor consists of four identical is no longer blocked, the transcription of lacZ, lacY, and lacA
polypeptides and has two binding sites; one site binds to takes place, and the lac enzymes are produced.
allolactose and the other binds to DNA. In the absence of Have you spotted the flaw in the explanation just given
lactose (and, therefore, allolactose), the repressor binds to for the induction of the lac enzymes? You might recall that
the lac operator site lacO (see Figure 16.7a). Jacob and permease is required to transport lactose into the cell. If the
Monod mapped the operator to a position adjacent to the lac operon is repressed and no permease is being produced,
lacZ gene; more recent nucleotide sequencing has demon- how does lactose get into the cell to inactivate the repressor
strated that the operator actually overlaps the 3 end of the and turn on transcription? Furthermore, the inducer is
promoter and the 5 end of lacZ ( ◗ FIGURE 16.8). actually allolactose, which must be produced from lactose by
Immediately upstream of the structural genes is the lac -galactosidase. If -galactosidase production is repressed,
promoter. RNA polymerase binds to the promoter and moves how can lactose metabolism be induced?
444 Chapter 16
lacZ gene
RNA polymerase lac repressor

5’ 3’
DNA 3’ TAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCAC 5’
nontemplate
strand
–35 region –10 region Transcription Operator bound
(consensus (consensus start site by lac repressor
sequence) sequence)
◗ 16.8 In the lac operon, the operator overlaps the promoter and
the 5 end of the first structural gene.
The answer is that repression never completely shuts E. coli. The cells of these strains possessed two different
down transcription of the lac operon. Even with active DNA molecules: the full bacterial chromosome and an extra
repressor bound to the operator, there is a low level of tran- piece of DNA. Jacob and Monod created these strains by
scription and a few molecules of -galactosidase, permease, allowing conjugation to take place between two bacteria
and transacetylase are synthesized. When lactose appears in (see Chapter 8). In conjugation, a small circular piece of
the medium, the permease that is present transports a small DNA (a plasmid) is transferred from one bacterium to
amount of lactose into the cell. There, the few molecules of another. The plasmid used by Jacob and Monod contained
-galactosidase that are present convert some of the lactose the lac operon; so the recipient bacterium became partly
into allolactose. The allolactose then attaches to the repres- diploid, possessing two copies of the lac operon. By using
sor and alters its shape so that the repressor no longer binds different combinations of mutations on the bacterial and
to the operator. When the operator site is clear, RNA poly- plasmid DNA, Jacob and Monod determined that parts of
merase can bind and transcribe the structural genes of the the lac operon were cis acting (able to control the expres-
lac operon. sion of genes on the same piece of DNA only) or trans
Several compounds related to allolactose also can acting (able to control the expression of genes on other
bind to the lac repressor and induce transcription of the DNA molecules).
lac operon. One such inducer is isopropylthiogalactoside
(IPTG). Although IPTG inactivates the repressor and al- Structural-gene mutations Jacob and Monod first dis-
lows the transcription of lacZ, lacY, and lacA, IPTG is not covered some mutant strains that had lost the ability to syn-
metabolized by -galactosidase; for this reason it is often thesize either -galactosidase or permease. (They did not
used in research to examine the effects of induction, inde- study in detail the effects of mutations on the transacetylase
pendent of metabolism. enzyme, so it will not be considered here.) These mutations
mapped to the lacZ or lacY structural genes and altered the
amino acid sequence of the enzymes encoded by the genes.
Concepts These mutations clearly affected the structure of the enzymes
The lac operon of E. coli controls the and not the regulation of their synthesis.
transcription of three genes in lactose metabolism: Through the use of partial diploids, Jacob and Monod
the lacZ gene, which encodes -galactosidase; the were able to establish that mutations at the lacZ and lacY
lacY gene, which encodes permease; and the lacA genes were independent and usually affected only the prod-
gene, which encodes thiogalactoside transacetylase. uct of the gene in which they occurred. Partial diploids with
The lac operon is inducible: a regulator gene lacZ lacY on the bacterial chromosome and lacZ lacY on
produces a repressor that binds to the operator site the plasmid functioned normally, producing -galactosidase
and prevents the transcription of the structural and permease in the presence of lactose. (The genotype
genes. The presence of allolactose inactivates the of a partial diploid is written by separating the genes on
repressor and allows the transcription of the lac each DNA molecule with a slash: lacZ lacY/lacZ lacY.)
operon. In this partial diploid, a single functional -galactosidase
gene (lacZ) is sufficient to produce -galactosidase; it makes
no difference whether the functional -galactosidase gene is
lac Mutations coupled to a functional (lacY) or a defective (lacY) perme-
Jacob and Monod worked out the structure and function of ase gene. The same is true of the lacY gene.
the lac operon by analyzing mutations that affected lactose
metabolism. To help define the roles of the different com- Regulator-gene mutations Jacob and Monod also isolated
ponents of the operon, they used partial diploid strains of mutations that affected the regulation of enzyme production.
(a) Absence of lactose lacO +

operator
Regulator Cannot
RNA
gene (lacI +) bind lacZ –
polymerase
PI lacP +
Active
repressor Transcription
1 The lac I + gene is trans dominant: inhibited
Mutant the repressor produced by lac I +
repressor can bind to both operators and Cannot
repress transcription in the bind lacZ +
PI absence of lactose. lacP +
lacl –
(b) Presence of lactose 2 When lactose is present, it lacO +

inactivates the repressor, and operator
Regulator functional β-galactosidase is
gene (lacI +) produced from the lac Z +gene. lacZ –
PI lacP +
Lactose Transcription
Active and translation
repressor
Inactive Nonfunctional
Mutant repressor β-Galactosidase
repressor
lacZ +
PI lacP +
lacl –
Transcription
and translation
◗ 16.9 The partial diploid lacI lacZ/lacI lacZ produces β-Galactosidase

-galactosidase only in the presence of lactose because the
lacI gene is trans dominant.
These mutations affected the production of both -galactosi- tive; on the plasmid, the lacZ gene was defective, but the
dase and permease, because genes for both enzymes are in lacI gene was functional. The fact that a lacI gene could
the same operon and are regulated coordinately. regulate a lacZ gene located on a different DNA molecule
Some of these mutations were constitutive, causing the indicated to Jacob and Monod that the lacI gene product
lac enzymes to be produced all the time, whether lactose was was able to diffuse to either the plasmid or the chromosome.
present or not, and these mutations fell into two classes: Some lacI mutations isolated by Jacob and Monod pre-
regulator and operator. Jacob and Monod mapped one class vented transcription from taking place even in the presence
to a site upstream of the structural genes; these mutations of lactose and other inducers such as IPTG. These muta-
occurred in the regulator gene and were designated lacI. tions were referred to as superrepressors (lacIs), because
The construction of partial diploids demonstrated that they produced repressors that could not be inactivated by
a lacI gene was dominant over a lacI gene; a single copy an inducer. Recall that the repressor has two binding sites,
of lacI (genotype lacI/lacI) was sufficient to bring about one for the inducer and one for DNA. The lacIs mutations
normal regulation of enzyme production. Furthermore, produced a repressor with an altered inducer-binding site,
lacI restored normal control to an operon even if the which made the inducer unable to bind to the repressor;
operon was located on a different DNA molecule, showing consequently, the repressor was always able to attach to the
that lacI was able to act in trans. A partial diploid with operator site and prevent transcription of the lac genes.
genotype lacI lacZ/lacI lacZ functioned normally, syn- Superrepressor mutations were dominant over lacI; partial
thesizing -galactosidase only when lactose was present diploids with genotype lacIs lacZ/lacI lacZ were unable
( ◗ FIGURE 16.9). In this strain, the lacI gene on the bacterial to synthesize either -galactosidase or permease, whether or
chromosome was functional, but the lacZ gene was defec- not lactose was present ( ◗ FIGURE 16.10).
446 Chapter 16
lacO +
Cannot operator
RNA
lacl s 1 The lacI s gene produces bind lacZ +
polymerase
PI a superrepressor that lacP +
does not bind lactose.
Super- 2 The lacI s gene is trans dominant:
repressor the superrepressor binds both
Active operators and prevents transcription
repressor in the presence and absence of lactose.
RNA Cannot
Inactive bind
polymerase
PI Lactose repressor
lacI +
◗ 16.10 The partial diploid lacI s IacZ /lacI lacZ fails to

produce -galactosidase in the presence and absence of lactose,
because the lacI s gene encodes a superrepressor.
Operator mutations Jacob and Monod mapped the other acting and affect only genes on the same DNA molecule.
class of constitutive mutants to a site adjacent to lacZ. These The partial diploid lacI lacP lacZ/lacI lacP lacZ
mutations occurred at the operator site, and were labeled exhibits normal synthesis of -galactosidase, whereas
lacOc (O stands for operator and c for constitutive). The lacOc the lacI lacP lacZ/lacI lacP lacZ fails to produce
mutations altered the sequence of DNA at the operator so -galactosidase whether or not lactose is present.
that the repressor protein was no longer able to bind. A par-
tial diploid with genotype lacI lacOc lacZ/lacI lacO lacZ Positive Control and Catabolite Repression
exhibited constitutive synthesis of -galactosidase, indicating E. coli and many other bacteria will metabolize glucose pref-
that lacOc was dominant over lacO. erentially in the presence of lactose and other sugars. They
Analysis of other partial diploids showed that the lacO do so because glucose enters glycolysis without further
gene was cis acting, affecting only genes on the same DNA modification and therefore requires less energy to metabo-
molecule. For example, a partial diploid with genotype lize than do other sugars. When glucose is available, genes
lacI lacO lacZ/lacI lacOc lacZ was constitutive, that participate in the metabolism of other sugars are
producing -galactosidase in the presence or absence of repressed, in a phenomenon known as catabolite repres-
lactose ( ◗ FIGURE 16.11a), but a partial diploid with sion. For example, the efficient transcription of the lac
genotype lacI lacO lacZ/lacI lacOc lacZ produced operon takes place only if lactose is present and glucose is
-galactosidase only in the presence of lactose ( ◗ FIGURE absent. But how is the expression of the lac operon influ-
16.11b). In the constitutive partial diploid (lacI lacO enced by glucose? What brings about catabolite repression?
lacZ/lacI lacOc lacZ; see Figure 16.11a), the lacOc muta- Catabolite repression results from positive control in
tion and the functional lacZ gene are present on the same response to glucose. (This regulation is in addition to the
DNA molecule; but in lacI lacO lacZ/lacI lacOc lacZ negative control brought about by the repressor binding at
(see Figure 16.11b), the lacOc mutation and the functional the operator site of the lac operon when lactose is absent.)
lacZ gene are on different molecules. The lacO mutation Positive control is accomplished through the binding of
affects only genes to which it is physically connected, as is a dimeric protein called the catabolite activator protein
true of all operator mutations. They prevent the binding of (CAP) to a site that is about 22 nucleotides long and is
a repressor protein to the operator and thereby allow RNA located within or slightly upstream of the promoter of the
polymerase to transcribe genes on the same DNA molecule. lac genes ( ◗ FIGURE 16.12). RNA polymerase does not bind
However, they cannot prevent a repressor from binding to efficiently to many promoters unless CAP is first bound to
normal operators on other DNA molecules. the DNA. Before CAP can bind to DNA, it must form
a complex with a modified nucleotide called adenosine-3,
Promoter mutations Mutations affecting lactose metab- 5-cyclic monophosphate (cyclic AMP or cAMP), which is
olism have also been isolated at the promoter site; these important in cellular signaling processes in both bacterial
mutations are designated lacP, and they interfere with and eukaryotic cells. In E. coli, the concentration of cAMP
the binding of RNA polymerase to the promoter. Because is inversely proportional to the level of available glucose.
this binding is essential for the transcription of the struc- A high concentration of glucose within the cell lowers the
tural genes, E. coli strains with lacP mutations don’t pro- amount of cAMP, and so little cAMP – CAP complex is
duce lac enzymes either in the presence or in the absence of available to bind to the DNA. Subsequently, RNA poly-
lactose. Like operator mutations, lacP mutations are cis merase has poor affinity for the lac promoter, and little
(a) Partial diploid lacI + lacO + lacZ –/ lacI + lacO c lacZ + (b) Partial diploid lacI + lacO + lacZ +/ lacI + lacO c lacZ –
Absence of lactose lacO + Absence of lactose lacO +

operator operator
Cannot Cannot
lac I + bind lacZ – lacI + bind lac Z +
PI lac P PI lacP
Active Active
repressor repressor
Binds Binds
lacZ + lacZ –
lac I + lacI +
lacO c operator lacO c operator
β-Galactosidase Nonfunctional
β-Galactosidase
Presence of lactose lacO + Presence of lactose lacO +

operator operator
Binds Binds
lac I + lacZ – lacI + lac Z +
PI lac P PI lacP
Lactose Lactose
Active Active
repressor repressor
Inactive Nonfunctional Inactive
repressor β-Galactosidase repressor
Binds Binds lacZ –

lacZ +
lac I + lacI +
lacO c operator lacO c operator
β-Galactosidase Nonfunctional
β-Galactosidase
◗ 16.11 Mutations in lacO are constitutive and cis acting.
(a) The partial diploid lacI lacO lacZ/lacI lacOc lacZ is constitutive,
producing -galactosidase in the presence and absence of lactose.
(b) The partial diploid lacI lacO lacZ/lacI lacOc lacZ is inducible
(produces -galactosidase only when lactose is present),
demonstrating that the lacO gene is cis acting.
transcription of the lac operon takes place. Low concen- CAP varies among these promoters; some operons are ac-
trations of glucose stimulate high levels of cAMP, resulting tivated by low levels of CAP, whereas others require high
in increased cAMP – CAP binding to DNA. This increase levels. CAP contains a helix-turn-helix DNA-binding mo-
enhances the binding of RNA polymerase to the promoter tif and, when it binds at the CAP site, it causes the DNA
and increases transcription of the lac genes by some helix to bend ( ◗ FIGURE 16.13). The bent helix enables
50-fold. CAP to interact directly with the RNA polymerase en-
The catabolite activator protein exerts positive con- zyme bound to the promoter and facilitate the initiation
trol in more than 20 operons of E. coli. The response to of transcription.
448 Chapter 16
When glucose is low
1 When glucose level is low, 2 CAP readily binds cAMP, and the 3 …increasing the efficiency
cAMP levels are high. CAP–cAMP complex binds DNA,… of polymerase binding.
cAMP cAMP cAMP RNA

CAP lacO
cAMP cAMP polymerase operator
cAMP cAMP
cAMP
lacI CAP lacZ lacY lac
lacAA
CAP
PI lacP
Transcription 4 The result is high rates of

and translation transcription and translation
of the structural genes…
Enzymes
β-Galactosidase Permease Transacetylase
Glucose
Lactose Galactose
5 …and the production of

When glucose is high glucose from lactose.
1 When glucose level is high, cAMP levels are 2 RNA polymerase cannot
low, and cAMP is less likely to bind to CAP. bind to DNA as efficiently;…
cAMP cAMP CAP RNA lacO

polymerase operator
CAP
3 …so transcription
is at a low rate. Little transcription
◗ 16.12 The catabolite activator protein (CAP) binds to the

promoter of the lac operon and stimulates transcription.
CAP must complex with cAMP before binding to the promoter of the
lac operon. The binding of cAMP – CAP to the promoter activates
transcription by facilitating the binding of RNA polymerase. Levels
of cAMP are inversely related to glucose: low glucose stimulates
high cAMP; high glucose stimulates low cAMP.
Concepts The trp Operon of E. coli

In spite of its name, catabolite repression is The lac operon just discussed is an inducible operon, one
a type of positive control in the lac operon. CAP, in which transcription does not normally take place and
complexed with cAMP, binds to a site near the must be turned on. Other operons are repressible; tran-
promoter and stimulates the binding of RNA scription in these operons is normally turned on and
polymerase. Cellular levels of cAMP in the cell must be repressed. The tryptophan (trp) operon in E. coli,
are controlled by glucose; a low glucose level which controls the biosynthesis of the amino acid trypto-
increases the abundance of cAMP and enhances phan, is an example of a repressible operon.
the transcription of the lac structural genes. The trp operon contains five structural genes (trpE,
trpD, trpC, trpB, and trpA), which produce components
of three enzymes (two of the enzymes consist of two
www.whfreeman.com/pierce Information on CAP control polypeptide chains). These enzymes convert chorismate
and the binding of CAP to DNA into tryptophan ( ◗ FIGURE 16.14). The first structural
DNA
gene, trpE, contains a long 5 untranslated region (5
UTR) that is transcribed but does not encode any of these
enzymes. Instead, this 5 UTR plays an important role in
another regulatory mechanism, discussed in the next sec-
tion. Upstream of the structural genes is the trp promoter.
When tryptophan levels are low, RNA polymerase binds
to the promoter and transcribes the five structural genes
into a single mRNA, which is then translated into en-
zymes that convert chorismate into tryptophan.
cAMP Some distance from the trp operon is a regulator
gene, trpR, which encodes a repressor that alone cannot
CAP
bind DNA (see Figure 16.14). Like the lac repressor, the
tryptophan repressor has two binding sites, one that
binds to DNA at the operator site and another that binds
to tryptophan (the activator). Binding with tryptophan
cAMP–CAP complex
causes a conformational change in the repressor that
makes it capable of binding to DNA at the operator site,
DNA
RNA polymerase which overlaps the promoter (see Figure 16.14). When the
CAP cAMP
operator is occupied by the tryptophan repressor, RNA
site CAP
polymerase cannot bind to the promoter and the struc-
tural genes cannot be transcribed. Thus, when cellular
Transcription levels of tryptophan are low, transcription of the trp
Promoter start site
operon takes place and more tryptophan is synthesized;
◗ 16.13 Binding of the cAMP – CAP complex to when cellular levels of tryptophan are high, transcription
DNA produces a sharp bend in DNA that activates of the trp operon is inhibited and the synthesis of more
transcription. tryptophan does not take place.
When tryptophan is low Operator

RNA polymerase Structural genes
Regulator
gene (trpR) 5’ UTR trpE trpD trpC trpB trpA
PR Promoter
1 The trp repressor 2 It cannot bind 3 …and transcription

is normally inactive. to the operator,… takes place.
Inactive regulator
protein (repressor) Enzymes
Chorismate Tryptophan
(trp repressor)
When tryptophan is high Operator
PR
and translation
1 Tryptophan binds to 2 The trp repressor then
Inactive regulator the repressor and binds to the operator and
makes it active. shuts transcription off.
protein (repressor)
◗ 16.14 The trp operon controls the biosynthesis of the amino

acid tryptophan in E. coli.
450 Chapter 16
Concepts which is found in the trp operon of E. coli. Several obser-

vations by Charles Yanofsky and his colleagues in the early
The trp operon is a repressible operon that 1970s indicated that repression at the operator site is not
controls the biosynthesis of tryptophan. In the only method of regulation in the trp operon. They iso-
a repressible operon, transcription is normally lated a series of mutants that possessed deletions in the
turned on and must be repressed. Repression is transcribed region of the operon. Some of these mutants
accomplished through the binding of tryptophan exhibited increased levels of transcription, yet control
to the repressor, which renders the repressor at the operator site was unaffected. Furthermore, they
active. The active repressor binds to the operator observed that two mRNAs of different sizes were tran-
and prevents RNA polymerase from transcribing scribed from the trp operon: a long mRNA containing
the structural genes. sequences for the structural genes and a much shorter
mRNA of only 140 nucleotides. These observations led
Yanofsky to propose that another mechanism — one that
Attenuation: The Premature Termination
caused premature termination of transcription — also reg-
of Transcription ulates transcription in the trp operon.
We’ve now seen how both positive and negative control Close examination of the trp operon reveals a region
regulate the initiation of transcription in an operon. Some of 162 nucleotides that corresponds to the long 5 UTR of
operons have an additional level of control that affects the the mRNA (mentioned earlier) transcribed from the trp
continuation of transcription rather than its initiation. In operon ( ◗ FIGURE 16.15a). The 5 UTR (also called a
attenuation, transcription begins at the start site, but ter- leader) contains four regions: region 1 is complementary
mination takes place prematurely, before the RNA poly- to region 2, region 2 is complementary to region 3, and
merase even reaches the structural genes. Attenuation oc- region 3 is complementary to region 4. These comple-
curs in a number of operons that code for enzymes mentarities allow the 5 UTR to fold into two different
participating in the biosynthesis of amino acids. secondary structures ( ◗ FIGURE 16.15b). Which secondary
We can understand the process of attenuation most structure is assumed determines whether attenuation will
easily by looking at one of the best-studied examples, occur.
(a) Trp operon

Ribosome 5’ UTR
binding site Gene e
Regions: 1 2 3 4
5’ 3’
Start codon Trp UUUUUUU Start codon

codons
(b)
1 When tryptophan is high, region 2 When tryptophan is low, region 2

Trp codons
3 pairs with region 4. This structure pairs with region 3. This structure
terminates transcription. does not terminate transcription.
12 3 1 23
UUUUUUU UUUUU
4 4
1+2 and 3+4 2+3

secondary structure secondary structure
Attenuation Antitermination
(terminates transcription)
◗ 16.15 Two different secondary structures may be formed by

the 5 UTR of the mRNA transcript of the trp operon.
One of the secondary structures contains one hairpin Transcription when tryptophan levels are high Let’s
produced by the base pairing of regions 1 and 2 and first consider what happens when intracellular levels of tryp-
another hairpin produced by the base pairing of regions tophan are high. RNA polymerase begins transcribing the
3 and 4. Notice that a string of uracil nucleotides follows the DNA, producing region 1 of the 5 UTR ( ◗ FIGURE 16.16a).
34 hairpin. Not coincidentally, the structure of a bacterial Following RNA polymerase closely, a ribosome binds to the
intrinsic terminator (Chapter 13) includes a hairpin 5 UTR (at the Shine-Dalgarno sequence, see Chapter 14)
followed by a string of uracil nucleotides; this secondary and begins to translate the coding region. Meanwhile,
structure in the 5 UTR of the trp operon is indeed a termi- RNA polymerase is transcribing region 2 ( ◗ FIGURE 16.16b).
nator and is called an attenuator. When cellular levels of Region 2 is complementary to region 1 but, because the
tryptophan are high, regions 3 and 4 of the 5 UTR base ribosome is translating region 1, the nucleotides in regions
pair, producing the attenuator structure; this base pairing 1 and 2 cannot base pair. As RNA polymerase begins to tran-
causes transcription to be terminated before the trp struc- scribe region 3, the ribosome is continuing to translate
tural genes can be transcribed. region 1 ( ◗ FIGURE 16.16c). When the ribosome reaches
The alternative secondary structure of the 5 UTR is the two UGG tryptophan codons, it doesn’t slow or stall,
produced by the base pairing of regions 2 and 3 (see Figure because tryptophan is abundant and tRNAs charged with
16.15b). This base pairing also produces a hairpin, but this tryptophan are readily available. This point is critical to
hairpin is not followed by a string of uracil nucleotides; so note: because tryptophan is abundant, translation can keep
this structure does not function as a terminator. When cel- up with transcription.
lular levels of tryptophan are low, regions 2 and 3 base pair, As it moves past region 1 to the stop codon, the ribo-
and transcription of the trp structural genes is not termi- some partly covers region 2; ( ◗ FIGURE 16.16d); meanwhile,
nated. RNA polymerase continues past the 5 UTR into the RNA polymerase completes the transcription of region 3.
coding section of the structural genes, and the enzymes that Although regions 2 and 3 are complementary, region 2 is
synthesize tryptophan are produced. Because it prevents the partly covered by the ribosome; so it can’t base pair with 3.
termination of transcription, the 23 structure is called an RNA polymerase continues to move along the DNA,
antiterminator. eventually transcribing regions 4 of the 5 UTR. Region 4 is
To summarize, the 5 UTR of the trp operon can fold complementary to region 3, and, because region 3 cannot
into one of two structures. When tryptophan is high, the base pair with region 2, it pairs with region 4. The pairing of
34 structure forms, transcription is terminated within the regions 3 and 4 (see Figure 16.16d) produces the attenua-
5 UTR, and no additional tryptophan is synthesized. When tor — a hairpin followed by a string of uracil nucleotides —
tryptophan is low, the 23 structure forms, transcription and transcription terminates just beyond region 4. The
continues through the structural genes, and tryptophan is structural genes are not transcribed, no tryptophan-
synthesized. The critical question, then, is, Why does the producing enzymes are translated, and no additional tryp-
34 structure arise when tryptophan is high and the 23 tophan is synthesized.
structure when tryptophan is low?
To answer this question, we must take a closer look Transcription when tryptophan levels are low What
at the nucleotide sequence of the 5 UTR. At the 5 end, happens when tryptophan levels are low? Once again, RNA
upstream of region 1, is a ribosome-binding site. Region polymerase begins transcribing region 1 of the 5 UTR
1 actually encodes a small protein (see Figure 16.15b). ( ◗ FIGURE 16.16e), and the ribosome binds to the 5 end of
Within the coding sequence for this protein are two UGG the 5 UTR and begins to translate region 1 while RNA poly-
codons, which specify the amino acid tryptophan; so tryp- merase continues transcribing region 2 ( ◗ FIGURE 16.16f).
tophan is required for the translation of this 5 UTR When the ribosome reaches the UGG tryptophan codons, it
sequence. The protein encoded by the 5 UTR has not stalls ( ◗ FIGURE 16.16g) because the level of tryptophan is
been isolated and is presumed to be unstable; its only ap- low, and tRNAs charged with tryptophan are scarce or even
parent function is to control attenuation. Although it was unavailable. The ribosome sits at the tryptophan codons,
stated in Chapter 14 that a 5 UTR is not translated into a awaiting the arrival of a tRNA charged with tryptophan.
protein, the 5 UTR of operons subject to attenuation are Stalling of the ribosome does not, however, hinder transcrip-
exceptions to this rule. tion; RNA polymerase continues to move along the DNA,
The formation of hairpins in the 5 UTR of the trp and transcription gets ahead of translation.
operon is controlled by the interplay of transcription and Because the ribosome is stalled at the tryptophan
translation that takes place near the 5 end of the mRNA. codons in region 1, region 2 is not covered by the ribosome
Recall that, in prokaryotic cells, transcription and transla- when region 3 has been transcribed. Therefore, nucleotides
tion are coupled: while transcription is taking place at the 3 in region 2 and region 3 base pair, forming the 23 hairpin
end of the mRNA, translation is initiated at the 5 end. The ( ◗ FIGURE 16.16h). This hairpin does not cause termination,
precise timing and interaction of these two processes in the and so transcription continues. Because region 3 is already
5 UTR determine whether attenuation occurs. paired with region 2, the 34 hairpin (the attenuator)
452 Chapter 16
When tryptophan is high mRNA RNA polymerase

(a) Trp codons
DNA
1 RNA polymerase begins transcribing
DNA, producing region 1 of the 5‘ UTR. 1 2 3 4
(b) Ribosome
2 A ribosome binds to the 5‘ end of the 1 2
5‘ UTR and begins to translate region
1, while region 2 is being transcribed.
1 2
(c)
3 The ribosome translates region 1 while
RNA polymerase transcribes region 3. 2
3
4 The ribosome does not stall at the Trp
codons, because tryptophan is abundant.
(d)
5 The leading edge of the ribosome covers
part of region 2, preventing it from pairing
with region 3. 2
6 Region 4 is transcribed and pairs with region 3.

The pairing of regions 3 and 4 produces the
attenuator that terminates transcription. 3 4
When tryptophan is low

(e)
1 RNA polymerase begins transcribing the
DNA, producing region 1 of the 5‘ UTR.
(f)
2 A ribosome attaches to the 5‘ end of the
5‘ UTR and begins to translate region 1
while region 2 is being transcribed.
(g)
Trp codons
3 The ribosome stalls at the Trp codons
in region 1 because tryptophan is low.
4 Because the ribosome is stalled, region 2

is not covered by the ribosome when
region 3 is transcribed.
(h)
5 When region 3 is transcribed, 2 3
it pairs with region 2.
6 When region 4 is transcribed, it cannot pair 4

with region 3, because region 3 is already
paired with region 2; the attenuator never
forms, and transcription continues.
◗ 16.16 The premature termination of transcription (attenuation) takes

place in the trp operon, depending on the cellular level of tryptophan.
never forms, and so attenuation does not occur. RNA poly- events in the process of attenuation are summarized in
merase continues along the DNA, past the 5 UTR, tran- Table 16.3.
scribing all the structural genes into mRNA, which is trans- Several additional points about attenuation need clari-
lated into the enzymes encoded by the trp operon. These fication. The key factor controlling attenuation is the num-
enzymes then synthesize more tryptophan. Important ber of tRNA molecules charged with tryptophan, because
Table 16.3 Events in the process of attenuation

Intracellular Position of Ribosome Secondary Termination of
Level of Ribosome Stalls When Region 3 Structure Transcription
Tryptophan at Trp Codons Is Transcribed of 5 UTR of trp Operon
High No Covers region 2 34 hairpin Yes

Low Yes Covers region 1 23 hairpin No
their availability is what determines whether the ribosome entails the early termination of transcription, not translation
stalls at the tryptophan codons. A second point concerns (although events in translation bring about the termination
the synchronization of transcription and translation, which of transcription). Attenuation often causes confusion because
is critical to attenuation. Synchronization is achieved we know that transcription must precede translation. We’re
through a pause site located in region 1 of the 5 UTR. After comfortable with the idea that transcription might affect
initiating transcription, RNA polymerase stops temporarily translation, but it’s harder to imagine that the effects of trans-
at this site, which allows time for a ribosome to bind to the lation could influence transcription, as it does in attenuation.
5 end of the mRNA so that translation can closely follow The reality is that transcription and translation are closely
transcription. A third point is that ribosomes do not tra- coupled in prokaryotic cells, and events in one process can
verse the convoluted hairpins of the 5 UTR to translate the easily affect the other.
structural genes. Ribosomes that attach to the ribosome-
binding site at the 5 end of the mRNA encounter a stop
codon at the end of region 1. Ribosomes translating the Concepts
structural genes attach to a different ribosome-binding site In attenuation, transcription is initiated but
located near the beginning of the trpE gene. terminates prematurely. When tryptophan levels
are low, the ribosome stalls at the tryptophan
Why does attenuation occur? Why do bacteria need codons and transcription continues. When
attenuation in the trp operon? Shouldn’t repression at the tryptophan levels are high, the ribosome does not
operator site prevent transcription from taking place when stall at the tryptophan codons, and the 5 UTR
tryptophan levels in the cell are high? Why does the cell adopts a secondary structure that terminates
have two types of control? Part of the answer is that repres- transcription before the structural genes can be
sion is never complete; some transcription is initiated even copied into RNA (attenuation).
when the trp repressor is active; repression reduces tran-
scription only as much as 70-fold. Attenuation can further
reduce transcription another 8- to 10-fold; so together the www.whfreeman.com/pierce More information on
two processes are capable of reducing transcription of the attenuation
trp operon more than 600-fold. Both mechanisms provide
E. coli with a much finer degree of control over tryptophan Antisense RNA in Gene Regulation
synthesis than either could achieve alone. All the regulators of gene expression that we have consid-
Another reason for the dual control is that attenuation ered so far have been proteins. Several examples of RNA
and repression respond to different signals: repression regulators have also been discovered. These small RNA mol-
responds to the cellular levels of tryptophan, whereas attenu- ecules are complementary to particular sequences on
ation responds to the number of tRNAs charged with trypto- mRNAs and are called antisense RNA. They control gene
phan. There may be times when it is advantageous for the cell expression by binding to sequences on mRNA and inhibit-
to be able to respond to these different signals. Finally, the trp ing translation.
repressor affects several operons other than the trp operon. Translational control by antisense RNA is seen in the
It’s possible that at an earlier stage in the evolution of E. coli, regulation of the ompF gene of E. coli ( ◗ FIGURE 16.17a). Two
the trp operon was controlled only by attenuation. The trp E. coli genes, ompF and ompC, produce outer-membrane
repressor may have evolved primarily to control the other proteins that function as diffusion pores, allowing bacteria
operons and only incidentally affects the trp operon. to adapt to external osmolarities (the tendency of water to
Attenuation is a complex process to grasp because you move across a membrane owing to different ion concentra-
must simultaneously visualize how two dynamic processes — tions). Under most conditions, both the ompF and the ompC
transcription and translation — interact, and it’s easy to get genes are transcribed and translated. When the osmolarity of
the two processes confused. Remember that attenuation the medium increases, a regulator gene named micF—for
454 Chapter 16
(a) Low osmolarity 1 When extracellular (b) High osmolarity 1 When extracellular
osmolarity is low,… osmolarity is high,…
ompF gene micF gene ompF gene
Transcription Transcription Transcription
mRNA Antisense mRNA

RNA
2 …the ompF gene is
transcribed and translated
2 …the micF gene is activated
Translation to produce OmpF protein. Translation
and micF RNA is produced.
3 micF RNA pairs with the 5‘

end of ompF RNA, blocking 3’ 5’
5’ 3’ 5’ 3’
the ribosome-binding site
and preventing translation.
Ribosome
4 Thus, no OmpF protein is
OmpF No translation
produced.
protein
◗ 16.17 Antisense RNA can regulate translation.
mRNA-interfering complementary RNA — is activated and particles, and the phage produces a protein that causes the
micF RNA is produced ( ◗ FIGURE 16.17b). The micF RNA, an cell to lyse. The released phage can then infect other bacterial
antisense RNA, binds to a complementary sequence in the cells. In the lysogenic cycle, phage genes that encode replica-
5 UTR of the ompF mRNA and inhibits the binding of tion enzymes and phage proteins are not immediately tran-
the ribosome. This inhibition reduces the amount of transla- scribed. Instead, the phage DNA integrates into the bacterial
tion (see Figure 16.17b), which results in fewer OmpF chromosome as a prophage. When the bacterial chromo-
proteins in the outer membrane and thus reduces the detri- some replicates, the prophage is duplicated along with the
mental movement of substances across the membrane owing bacterial genes and is passed to the daughter cells in bacterial
to the changes in osmolarity. A number of examples of anti- reproduction. The prophage may later excise from the bacte-
sense RNA controlling gene expression have now been iden- rial chromosome and enter the lytic cycle.
tified in bacteria and bacteriophages. Whether a phage enters the lytic or the lysogenic
cycle depends on the regulation of the phage genes. In the
lytic cycle, the genes that encode replication enzymes, phage
Concepts proteins, and bacterial cell lysis are transcribed; but, in the
Antisense RNA is complementary to other RNA or lysogenic cycle, these genes are repressed.
DNA sequences. In bacterial cells, it may inhibit Like bacterial genes, functionally related phage genes
translation by binding to sequences in the 5 UTR are clustered together into operons. There are four major
of mRNA and preventing the attachment of the operons in the phage chromosome ( ◗ FIGURE 16.18). The
ribosome. early right operon contains genes that are required for DNA
replication and are transcribed early in the lytic cycle. The
early left operon contains genes necessary for recombina-
tion and the integration of phage DNA into the bacterial
Transcriptional Control chromosome as a part of the lysogenic cycle. A third
in Bacteriophage Lambda operon, the late operon, contains genes that encode the pro-
Bacteriophage is a virus that infects the bacterium E. coli tein coat of the phage, produced late in the lytic cycle. The
(Chapter 8). Bacteriophage possesses a single DNA chro- fourth operon is the repressor operon, which produces the
mosome consisting of 48,502 nucleotides surrounded by a repressor responsible for maintaining the prophage DNA
protein coat. A bacteriophage infects a bacterial cell by in a dormant state. Although there are several additional
attaching to the cell wall and injecting its DNA into the cell. promoters on the chromosome that may be activated at
Inside the cell, phage undergoes either of two life cycles. special times, here the emphasis is on three general features
In the lytic cycle (see Chapter 8), phage genes are tran- of transcriptional control in bacteriophage .
scribed and translated to produce phage coat proteins and First, both positive control and negative control are seen
enzymes that synthesize from 100 to 200 copies of the phage in gene regulation. Several proteins act as repressors,
DNA. The viral components are assembled to produce phage inhibiting transcription, whereas others act as activators,
Repressor Regulator of λ this controlled transcription ensures that genes appropriate

Regulator of operon to each stage of the lytic or lysogenic cycle are expressed.
early left genes Phage DNA A third feature of gene regulation is the use of tran-
replication proteins scriptional antiterminator proteins, which bind to RNA
Regulator of polymerase and alter its structure, allowing it to ignore cer-
Genes for integrating late genes
viral DNA into tain terminators ( ◗ FIGURE 16.19a). In the absence of the
Earl
bacterial ft righy Genes for antiterminator protein, RNA polymerase stops at a termina-
le n oper t
chromosome o lysis tor located early in the operon ( ◗ FIGURE 16.19b), and so
operly
o
r
Ea proteins only some of the genes in the operon are transcribed and
n
Promoters translated.
Regulator
n
ro
genes Genes for
pe
o viral head Concepts
e
Lat proteins The entry of bacteriophage into lysis or
lysogeny is controlled by a cascade of reactions,
in which the transcription of operons is turned on
Genes for and off in a specific sequence. The expression of
viral tail proteins the operons is controlled by the affinity of
◗ 16.18 The bacteriophage chromosome

different promoters for repressor and activator
proteins and through transcriptional
contains four major operons: the early left
antiterminators.
operon, the early right operon, the late operon,
and the repressor operon.
stimulating transcription. The repressor, which plays a

Eukaryotic Gene Regulation
major role in gene regulation, can act as either an activator Many features of gene regulation are common to both
or a repressor. bacterial and eukaryotic cells. For example, in both types
A second feature is that transcription is accomplished of cells, DNA-binding proteins influence the ability of
through a cascade of reactions. As one operon is tran- RNA polymerase to initiate transcription. However, there
scribed, it produces a protein that regulates the transcrip- are also some differences, although these differences are
tion of a second operon, which produces a protein that often a matter of degree. First, eukaryotic genes are not
affects the transcription of a third operon. Thus, the oper- organized into operons and are rarely transcribed to-
ons are activated and repressed in a particular order, with gether into a single mRNA molecule; instead, each struc-
the use of several different promoters, each with an affinity tural gene typically has its own promoter and is tran-
for specific activators and repressors. As each promoter is scribed separately. Second, chromatin structure affects
activated, only the genes under its control are transcribed; gene expression in eukaryotic cells; DNA must unwind
(a) Antiterminator present (b) Antiterminator absent

RNA polymerase Terminator 1 Terminator 2 RNA polymerase Terminator 1 Terminator 2
Gene A Gene B Gene A Gene B

Promoter Promoter
Transcription 1 RNA polymerase Transcription

Antiterminator 1 RNA polymerase
reads through
stops at terminator 1.
terminator 1…
Long mRNA Short mRNA
2 A short mRNA
2 …and transcribes
is produced that
Translation a longer mRNA… Translation codes for protein A.
3 …that codes for
proteins A and B.
Protein A B Protein A
◗ 16.19 Antiterminator proteins bind to RNA polymerase and

alter its structure so that it ignores certain terminators.
456 Chapter 16
from the histone proteins before transcription can take Histone protein DNA
place. Third, although both repressors and activators
function in eukaryotic and bacterial gene regulation, acti- 1 Positively charged tails of
vators seem to be more common in eukaryotic cells. Fi- H1 nucleosomal histone
proteins probably interact
nally, the regulation of gene expression in eukaryotic cells
with the negatively charged
is characterized by a greater diversity of mechanisms that phosphates of DNA.
act at different points in the transfer of information from
DNA to protein.
Positively
Eukaryotic gene regulation is less well understood than charged tail
bacterial regulation, partly owing to the larger genomes in
eukaryotes, their greater sequence complexity, and the diffi-
culty of isolating and manipulating mutations that can be Acetylation
used in the study of gene regulation. Nevertheless, great
advances in our understanding of the regulation of eukary-
otic genes have been made in recent years, and eukaryotic
regulation continues to be one of the cutting-edge areas of
research in genetics.
H1 2 Acetylation of the tails
Chromatin Structure weakens their interaction
and Gene Regulation with DNA and may permit
some transcription factors
One type of gene control in eukaryotic cells is accom- to bind to DNA.
plished through the modification of gene structure. In the
nucleus, histone proteins associate to form octamers,
around which helical DNA tightly coils to create chro-
matin (see Figure 11.5). In a general sense, this chromatin
structure represses gene expression. For a gene to be tran- ◗ 16.20 The acetylation of histone proteins alters
scribed, transcription factors, activators, and RNA poly- chromatin structure and permits some
merase must bind to the DNA. How can these events take transcription factors to bind to DNA.
place with DNA wrapped tightly around histone proteins?
The answer is that before transcription, chromatin struc-
ture changes, and the DNA becomes more accessible to the
Histone acetylation One factor affecting chromatin
transcriptional machinery.
structure is acetylation, the addition of acetyl groups
(CH3CO) to histone proteins. Histones in the octamer
DNase I hypersensitivity Several types of changes are core of the nucleosome have two domains: (1) a globular
observed in chromatin structure when genes become tran- domain that associates with other histones and the DNA
scriptionally active. One type is an increase in the sensitivity and (2) a positively charged tail domain that probably inter-
of chromatin to degradation by DNase I, an enzyme that acts with the negatively charged phosphates on the back-
digests DNA. When tightly bound by histone proteins, DNA bone of DNA ( ◗ FIGURE 16.20).
is resistant to DNase I digestion because the enzyme cannot Acetyl groups are added to histone proteins by acteyl-
gain access to the DNA. When DNA is less tightly bound by transferase enzymes; the acetyl groups destabilize the nu-
histones, it becomes sensitive to DNase I degradation. Thus, cleosome structure, perhaps by neutralizing the positive
the ability of DNase I to digest DNA provides an indication charges on the histone tails and allowing the DNA to sepa-
of the DNA – histone association. rate from the histones. Other enzymes called deacetylases
As genes become transcriptionally active, regions strip acetyl groups from histones and restore chromatin
around the genes become highly sensitive to the action of repression. Certain transcription factors (see Chapter 13)
DNase I (see Chapter 11). These regions, called DNase I hy- and other proteins that regulate transcription either have
persensitive sites, frequently develop about 1000 nu- acteyltransferase activity or attract acteyltransferases to
cleotides upstream of the start site of transcription, suggest- the DNA.
ing that the chromatin in these regions adopts a more open Some transcription factors and other regulatory proteins
configuration during transcription. This relaxation of the are known to alter chromatin structure without acetylating
chromatin structure may allow regulatory proteins access to histone proteins. These chromatin-remodeling complexes
binding sites on the DNA. Indeed, many DNase I hypersen- bind directly to particular sites on DNA and reposition the
sitive sites correspond to known binding sites for regulatory nucleosomes, allowing transcription factors to bind to pro-
proteins. moters and initiate transcription.
DNA methylation Another change in chromatin struc- Concepts

ture associated with transcription is the methylation of
Sensitivity to DNase I digestion suggests that
cytosine bases, which yields 5-methylcytosine (see Figure
transcribed DNA assumes an open configuration
10.19). Heavily methylated DNA is associated with the
before transcription. The acetylation of histone
repression of transcription in vertebrates and plants,
proteins disrupts nucleosome structure and may
whereas transcriptionally active DNA is usually unmethy-
facilitate transcription. The activation of
lated in these organisms.
transcription is often preceded by demethylation
DNA methylation is most common on cytosine bases
of DNA; methylated sequences may attract
adjacent to guanine nucleotides on the same strand (CpG);
deacetylases, which remove acetyl groups from
so two methylated cytosines sit diagonally across from each
histone proteins, stabilizing chromatin structure
other on opposing strands:
and repressing transcription.
GC
CG
Transcriptional Control in Eukaryotic Cells
DNA regions with many CpG sequences are called CpG Transcription is an important level of control in eukaryotic
islands and are commonly found near transcription start cells, and this control requires a number of different types of
sites. While genes are not being transcribed, these CpG proteins and regulatory elements. The initiation of eukaryotic
islands are often methylated, but the methyl groups are transcription was discussed in detail in Chapter 13. Recall that
removed before the initiation of transcription. CpG meth- general transcription factors and RNA polymerase assemble
ylation is also associated with long-term gene repression, into a basal transcription apparatus, which binds to a core
such as on the inactivated X chromosome of female mam- promoter located immediately upstream of a gene. The basal
mals (see Chapter 4). transcription apparatus is capable of minimal levels of tran-
Recent evidence suggests an association between DNA scription; transcriptional activator proteins are required to
methylation and the deacetylation of histones, both of bring about normal levels of transcription. These proteins
which repress transcription. Certain proteins that bind bind to a regulatory promoter, which is located upstream of
tightly to methylated CpG sequences form complexes with the core promoter, and to enhancers, which may be located
other proteins that act as histone deacetylases. In other some distance from the gene ( ◗ FIGURE 16.21).
words, methylation appears to attract deacetylases, which
remove acetyl groups from the histone tails, stabilizing the Transcriptional activators, coactivators and repressors
nucleosome structure and repressing transcription. De- Transcriptional activator proteins stimulate transcription by
methylation of DNA would allow acetyltransferases to facilitating the assembly or action of the basal transcription
remove these acetyl groups, disrupting nucleosome struc- apparatus at the core promoter; the activators may interact
ture and permitting transcription. directly with the basal transcription apparatus or indirectly
Activator binding site

(regulatory promoter) Core promoter
DNA
TATA box Transcription

Transcription factors, RNA
start
polymerase, and transcriptional
activator proteins bind DNA
and stimulate transcription.
RNA
polymerase
DNA TATA
Transcriptional Basal transcription

activator protein apparatus
◗ 16.21 Transcriptional activator proteins bind to sites on DNA

and stimulate transcription. Most act by stimulating or stabilizing the
assembly of the basal transcription apparatus.
458 Chapter 16
through protein coactivators. Some activators and coactiva-

tors, as well as the general transcription factors, also have UASG
acteyltransferase activity and facilitate transcription further by Absence of galactose Presence of galactose
altering chromatin structure (see earlier subsection on histone Galactose
acetylation). GAL80 GAL80
Transcriptional activator proteins have two distinct
functions (see Figure 16.21). First, they are capable of bind- GAL4 GAL4
ing DNA at a specific base sequence, usually a consensus
sequence in a regulatory promoter or enhancer; for this
function, most transcriptional activator proteins contain 1 GAL80 protein 2 When galactose is
one or more of the DNA-binding motifs discussed at the binds to GAL4 present, it binds to
and prevents GAL80 and prevents
beginning of this chapter. A second function is the ability to it from binding to GAL4.
activation.
interact with other components of the transcriptional appa-
ratus and influence the rate of transcription. Most do so by
either stabilizing or stimulating the assembly of the basal
transcription apparatus.
GAL4 is a transcription activator protein that regulates
the transcription of several yeast genes in galactose metabo-
UASG UASG
lism. GAL4 contains several zinc fingers and binds to
a DNA sequence called UASG (upstream activating sequence 3 GAL4 stimulates the
for GAL4). UASG exhibits the properties of an enhancer — transcription of galactose-
a regulatory sequence that may be some distance from the metabolizing genes.
regulated gene and is independent of the gene in position
and orientation (see Chapter 13). When bound to UASG,
GAL4 stimulates the transcription of yeast genes needed for Protein
metabolizing galactose.
Transcription of Transcription of
A particular region of GAL4 binds another protein genes not stimulated genes stimulated
called GAL80, which regulates the activity of GAL4 in the
presence of galactose. When galactose is absent, GAL80 ◗ 16.22 Transcription is activated by GAL4 in
binds to GAL4 (two molecules of GAL80 bind to each mol- response to galactose. GAL4 binds to the UASG
ecule of GAL4), preventing GAL4 from activating transcrip- site and controls the transcription of genes in galactose
tion ( ◗ FIGURE 16.22). When galactose is present, however, it metabolism.
binds to GAL80, causing a conformational change in the
protein so that it can no longer bind GAL4. The GAL4 pro-
tein is then available to activate the transcription of the tor, transcription is stimulated, but, if a repressor occupies
genes whose products metabolize galactose. that site, no activation occurs. Alternatively, a repressor may
GAL4 and a number of other transcriptional activator bind to sites near an activator site and prevent the activator
proteins contain multiple amino acids with negative charges from contacting the basal transcription apparatus. A third
that form an acidic activation domain. These acidic activa- possible mechanism of repressor action is direct interfer-
tors stimulate transcription by enhancing the ability of ence with the assembly of the basal transcription apparatus,
TFIIB (see Chapter 13), one of the general transcription thereby blocking the initiation of transcription.
factors, to join the basal transcription apparatus. Without
the activator, the binding of TFIIB is a slow process; the ac-
tivator helps “recruit” TFIIB to the initiation complex, Concepts
thereby stimulating the binding of RNA polymerase and the
Transcriptional regulatory proteins in eukaryotic
initiation of transcription. Acidic activators may also en-
cells can influence the initiation of transcription
hance other steps in the assembly of the basal transcription
by affecting the stability or assembly of the basal
apparatus.
transcription apparatus. Some regulatory proteins
Some regulatory proteins in eukaryotic cells act as
are activators and stimulate transcription; others
repressors, inhibiting transcription. These repressors may
are repressors and inhibit transcription.
bind to sequences in the regulatory promoter or to distant
sequences called silencers, which, like enhancers, are posi-
tion and orientation independent. Unlike repressors in bac- Enhancers and insulators Enhancers are capable of
teria, most eukaryotic repressors do not directly block RNA affecting transcription at distant promoters. For example,
polymerase. These repressors may compete with activators an enhancer that regulates the gene encoding the alpha
for DNA binding sites: when a site is occupied by an activa- chain of the T-cell receptor is located 69,000 bp down-
◗ 16.23 An 1 Enhancer I can stimulate translation 2 Enhancer II can stimulate translation

insulator blocks of gene A but its effect on gene B Insulator of gene B but its effect on gene A
the action of an is blocked by the insulator. binding is blocked by the insulator.
enhancer on a protein
promoter when
Gene A Gene B
the insulator lies Promoter Promoter
between the
enhancer and the Transcription Enhancer I Insulator Enhancer II Transcription
promoter. start start
stream of the gene’s promoter. Furthermore, the exact posi- Coordinated gene regulation Although eukaryotic cells
tion and orientation of an enhancer relative to the promoter do not possess operons, several eukaryotic genes may be
can vary. How can an enhancer affect the initiation of tran- activated by the same stimulus. For example, many eukaryotic
scription taking place at a promoter that is tens of thou- cells respond to extreme heat and other stresses by producing
sands of base pairs away? The mechanism of action of many heat-shock proteins that help to prevent damage from such
enhancers is not known, but evidence suggest that, in some stressing agents. Heat-shock proteins are produced by approx-
cases, activator proteins bind to the enhancer and cause the imately 20 different genes. During times of environmental
DNA between the enhancer and the promoter to loop out, stress, the transcription of all the heat-shock genes is greatly
bringing the promoter and enhancer close to one another, elevated. Groups of bacterial genes are often coordinately ex-
so that the transcriptional activator proteins are able to pressed (turned on and off together) because they are physi-
directly interact with the basal transcription apparatus at cally clustered as an operon and have the same promoter, but
the core promoter.
coordinately expressed genes in eukaryotic cells are not clus-
Most enhancers are capable of stimulating any pro-
tered. How, then, is the transcription of eukaryotic genes co-
moter in their vicinities. Their effects are limited, how-
ordinately controlled if they are not organized into an operon?
ever, by insulators (also called boundary elements),
Genes that are coordinately expressed in eukaryotic cells
which are DNA sequences that block or insulate the effect
are able to respond to the same stimulus because they have
of enhancers in a position-dependent manner. If the insu-
regulatory sequences in common in their promoters or en-
lator lies between the enhancer and the promoter, it
hancers. For example, different eukaryotic heat-shock genes
blocks the action of the enhancer; but, if the insulator lies
possess a common regulatory element upstream of their start
outside the region between the two, it has no effect
sites. A transcriptional activator protein binds to this regula-
( ◗ FIGURE 16.23). Specific proteins bind to insulators and
tory element during stress and elevates transcription. Such
play a role in their blocking activity, but exactly how this
takes place is poorly understood. Some insulators also common DNA regulatory sequences are called response ele-
limit the spread of changes in chromatin structure that ments; they typically contain short consensus sequences (Table
affect transcription. 16.4) at varying distances from the gene being regulated.
A single eukaryotic gene may be regulated by several dif-
ferent response elements. The metallothionein gene protects
Concepts cells from the toxicity of heavy metals by encoding a protein
that binds to heavy metals and removes them from cells. The
Some activator proteins bind to enhancers, which
basal transcription apparatus assembles around the TATA box,
are regulatory elements that are distant from the
gene whose transcription they stimulate.
just upstream of the transcription start site for the metalloth-
Insulators are DNA sequences that block the
ionein gene, but the apparatus alone is capable of only low
action of enhancers.
rates of transcription. The presence of heavy metals stimulates
much higher rates of transcription.
Table 16.4 A few response elements found in eukaryotic cells
Response Element Responds to Consensus Sequence
Heat-shock element Heat and other stress CNNGAANNTCCNNG

Glucocorticoid response element Glucocorticoids TGGTACAAATGTTCT
Phorbol ester response element Phorbal esters TGACTCA
Serum response element Serum CCATATTAGG
Source: Adapted from B. Lewin, Genes IV (Oxford: Oxford University Press, 1994), p. 880.
460 Chapter 16
Enhancer Enhancer
GRE MRE TRE MRE TATA Metallothionein gene
+1
Transcription
start
Steroid MRE AP1 MRE RNA
receptor activator activator polymerase
protein protein protein
Transcription
Various proteins may bind to upstream factors
response elements to stimulate transcription. Basal transcription apparatus
◗ 16.24 Multiple response elements (MREs) are found in the

upstream region of the metallothionein gene. The basal transcription
apparatus binds near the TATA box. In response to heavy metals, activator
proteins bind to several MRE elements and stimulate transcription. The
TRE response element is the binding site for transcription factor AP1.
In response to glucocorticoid hormones, steroid receptors bind to the GRE
response element located approximately 250 nucleotides upstream of
the metallothionein gene and stimulate transcription.
Other response elements found upstream of the metal- The T-antigen gene of the mammalian virus SV40
lothionein gene also contribute to increasing its rate of serves as a well-studied example of alternative splicing. This
transcription. For example, several copies of a metal re- gene is capable of encoding two different proteins, the large
sponse element (MRE) are upstream of the metallothio- T and small t antigens. Which of the two proteins is pro-
nein gene ( ◗ FIGURE 16.24). Heavy metals stimulate the duced depends on which of two alternative 5 splice sites
binding of an activator protein to MREs, which elevates the is used during RNA splicing ( ◗ FIGURE 16.25). The use of
rate of transcription of the metallothionein gene. The pres- one 5 splice site produces mRNA that encodes the large T
ence of multiple copies of this response element permits
high rates of transcription to be induced by metals. Two
enhancers also are located in the upstream region of the 1 Use of the first 5‘ 2 Use of the second
metallothionein gene; one enhancer contains a response splice site produces 5’ splice site
an mRNA that Alternative 5’ produces an mRNA
element known as TRE, which stimulates transcription in encodes the that encodes the
the presence of phorbol esters. A third response element splice sites
large T antigen. small t antigen.
1 2
called GRE is located approximately 250 nucleotides
Pre-mRNA 5’ Intron 3’
upstream of the metallothionein gene and stimulates tran- A B C
scription in response to glucocorticoid hormones. 3 The SF2 protein enhances the
This example illustrates a common feature of eukary- use of the second splice site.
otic transcriptional control: a single gene may be activated
by several different response elements, found in both pro- mRNA processing
SF2
moters and enhancers. Multiple response elements allow the
same gene to be activated by different stimuli. At the same
time, the presence of the same response element in different
genes allows a single stimulus to activate multiple genes. In
n t ron
I
this way, response elements allow complex biochemical Intron

B
responses in eukaryotic cells.
mRNA mRNA
Gene Control Through Messenger 5’ 3’ 5’ 3’
A C A B C
RNA Processing
Translation Translation
Alternative splicing allows a pre-mRNA to be spliced in
multiple ways, generating different proteins in different tis-
Large T antigen Small t antigen
sues or at different times in development (see Chapter 14).
Many eukaryotic genes undergo alternative splicing, and the ◗ 16.25 Alternative splicing leads to the
regulation of splicing is probably an important means of production of the small t antigen and the large
controlling gene expression in eukaryotic cells. T antigen in the mammalian virus SV40.
XX genotype
X:A = 1.0 Female Fly

Tra-2 protein
dsx pre-mRNA Dsxprotein
Sxl gene Sxl protein tra pre-mRNA Tra protein
1 In X:A = 1.0 embryos, 2 …that causes tra pre- 3 …to produce 4 Together, Tra andTra-2 proteins 5 …which produces proteins
the activated Sxl gene mRNA to be spliced at Tra protein. direct the female-specific causing the embryo to
produces a protein… a downstream 3‘ site… splicing of dsx pre-mRNA,… develop into a female.
XY genotype
X:A = 0.5 Male Fly

No Sxl
Sxl gene tra pre-mRNA Nonfunctional dsx pre-mRNA Dsxprotein
protein
Tra protein
1 In X:A = 0.5
embryos, the 2 …and no Sxl 3 Thus tra pre-mRNA 4 …producing a 5 Without Tra, the male- 6 …produces male Dsx proteins
Sxl gene is not protein is is spliced at an nonfunctional specific splicing of dsx that cause the embryo to
activated,… produced. upstream site,… Tra protein. pre-mRNA… develop into a male.
◗16.26 Alternative splicing controls sex determination in

Drosophila.
antigen, whereas the use of the other 5 splice site (which is pre-mRNA from yet another gene called doublesex (dsx).
farther downstream) produces an mRNA encoding the This event produces a female-specific Dsx protein, which
small t antigen. causes the embryo to develop female characteristics.
A protein called splicing factor 2 (SF2) enhances the In male embryos, which have an XA ratio of 0.5 (see
production of mRNA encoding the small t antigen (see Figure 16.26), the promoter that transcribes the Sxl gene in
Figure 16.25). Splicing factor 2 has two binding domains: females is inactive; so no Sxl protein is produced. In the
one is an RNA-binding region and the other has alternat- absence of Sxl protein, Tra pre-mRNA is spliced at a differ-
ing serine and arginine amino acids. These two domains ent 3 splice site to produce a nonfunctional form of Tra
are typical of SR proteins, which often play a role in regu- protein ( ◗ FIGURE 16.27). In turn, the presence of this non-
lating splicing. Splicing factor 2 stimulates the binding of functional Tra in males causes Dsx pre-mRNAs to be
U1 snRNP to the 5 splice site, one of the earliest steps in spliced differently (see Figure 16.26), and a male-specific
RNA splicing (see Chapter 14). The precise mechanism by Dsx protein is produced. This event causes the development
which SR proteins influence the choice of splice sites is of male-specific traits.
poorly understood. One model suggests that SF2 and other In summary, the Tra, Tra-2, and Sxl proteins regulate
SR proteins bind to specific splice sites on mRNA and alternative splicing that produces male and female pheno-
stimulate the attachment of snRNPs, which then commit types in Drosophila. Exactly how these proteins regulate
the site to splicing. alternative splicing is not yet known, but it’s possible that
Another example of alternative mRNA splicing that the Sxl protein (produced only in females) may block
regulates the expression of genes controls whether a fruit fly the upstream splice site on the tra pre-mRNA. This block-
develops as male or female. Sex differentiation in Drosophila age would force the spliceosome to use the downstream
arises from a cascade of gene regulation ( ◗ FIGURE 16.26). 3 splice site, which causes the production of Tra protein
When the ratio of X chromosomes to the number of and eventually results in female traits (see Figure 16.27).
haploid sets of autosomes (the XA ratio; see Chapter 4) is
1, a female-specific promoter is activated early in devel-
opment and stimulates the transcription of the sex-lethal Concepts
(Sxl) gene. The protein encoded by Sxl regulates the splicing Eukaryotic genes may be regulated through the
of the pre-mRNA transcribed from another gene called control of mRNA processing. The selection of
transformer (tra). The splicing of tra pre-mRNA results in alternative splice sites leads to the production
the production of Tra protein. Together with another pro- of different proteins.
tein (Tra-2), Tra stimulates the female-specific splicing of
462 Chapter 16
Alternative 3’ splice sites removal of nucleotides. A second pathway begins at the

A B C D 3 end of the mRNA and removes nucleotides in the
tra pre-mRNA 5’ 3’ 3 : 5 direction. In a third pathway, the mRNA can be
Intron Intron
cleaved at internal sites.
1 In males, the 1 In females, the presence
of Sxl protein…
Messenger RNA degradation from the 5 end is most
upstream 3‘
splice site is common and begins with the removal of the 5 cap. This
used,… Sxl protein pathway is usually preceded by the shortening of the poly(A)
tail. Poly(A)-binding proteins (PABPs) normally bind to the
B
poly(A) tail and contribute to its stability-enhancing effect.
The presence of these proteins at the 3 end of the mRNA
protects the 5 cap. When the poly(A) tail has been short-
Use of downstream
3’ splice site
ened below a critical limit, the 5 cap is removed, and nucle-
ases then degrade the mRNA by removing nucleotides from
A B C D A C D
mRNA 5’ 3’ 5’ 3’ the 5 end. These observations suggest that the 5 cap and
3 poly(A) tail of eukaryotic mRNA physically interact with
Premature stop codon
2 …causes the down- each other, most likely by the poly(A) tail bending around so
stream 3‘ splice site that the PABPs make contact with the 5 cap (see Chapter
2 …resulting in the Translation to be used; the 14). Other parts of eukaryotic mRNA, including sequences
inclusion of a termination codon
premature stop is spliced out with
in the 5 UTR, the coding region, and the 3 UTR, also affect
codon in the mRNA. the intron… mRNA stability.
Poly(A) tails are added to the 3 ends of some bacterial
Nonfunctional mRNAs, but they are shorter than those typically associated
Tra protein
Tra protein with eukaryotic mRNA and have the opposite effect; they
3 No functional Tra 3 …and a functional appear to destabilize most prokaryotic mRNAs.
protein is produced. Tra protein is
produced.
Male Female Concepts

phenotype phenotype
The stability of mRNA influences gene expression
by affecting the amount of mRNA available to be
translated. The stability of mRNA is affected by
the 5 cap, the poly(A) tail, the 5 UTR, the coding
section, and the 3 UTR.
◗ 16.27 Alternative splicing of tra pre-mRNA. Two

alternative 3 splice sites are present. RNA Silencing
Recent evidence indicates that the expression of some genes
may be suppressed through RNA silencing, also known as
Gene Control Through RNA Stability RNA interference and posttranscriptional gene silencing.
The amount of a protein that is synthesized depends on the Although many of the details of this mechanism are still
amount of corresponding mRNA available for translation. poorly understood, it appears to be widespread, existing in
The amount of available mRNA, in turn, depends on both fungi, plants, and animals. It may also prove to be a power-
the rate of mRNA synthesis and the rate of mRNA degrada- ful tool for artificially regulating gene expression in geneti-
tion. Eukaryotic mRNAs are generally more stable than bac- cally engineered organisms.
terial mRNAs, which typically last only a few minutes before RNA silencing is initiated by the presence of double-
being degraded, but nonetheless there is great variability in stranded RNA, which may arise in several ways: by the tran-
the stability of eukaryotic mRNA: some persist for only scription of inverted repeats in DNA into a single RNA
a few minutes; others last for hours, days, or even months. molecule that base pairs with itself; by the simultaneous
These variations can result in large differences in the transcription of two different RNA molecules that are com-
amount of protein that is synthesized. plementary to one another and pair; or by the replication
Cellular RNA is degraded by ribonucleases, enzymes of double-stranded RNA viruses ( ◗ FIGURE 16.28a). In
that specifically break down RNA. Most eukaryotic cells Drosophila, an enzyme called Dicer cleaves and proces-
contain 10 or more types of ribonucleases, and there are ses the double-stranded RNA to produce small pieces of
several different pathways of mRNA degradation. In one single-stranded RNA that range in length from 21 to
pathway, the 5 cap is first removed, followed by 5 : 3 25 nucleotides ( ◗ FIGURE 16.28b). These small interfering
RNAs (siRNAs) then pair with complementary sequences in the nucleus, siRNAs serve as guides for the methylation of
mRNA and attract an RNA – protein complex that cleaves complementary sequences in DNA, which then affects tran-
the mRNA approximately in the middle of the bound scription. Some related RNA molecules produced through
siRNA. After cleavage, the mRNA is further degraded. In the cleavage of double-stranded RNA bind to complemen-
tary sequences in the 3 UTR of mRNA and inhibit their
translation.
(a) RNA silencing is thought to have evolved as a defense
Inverted repeat Transcription through
DNA an inverted repeat in against RNA viruses and transposable elements that move
the DNA… through an RNA intermediate (see Chapter 20). The extent to
AGTCC GGACT
which it contributes to normal gene regulation is uncertain,
but dramatic phenotypic effects result from some mutations
Transcription
that occur in the enzymes that carry out RNA silencing.
RNA
5’ UCAGG CCUGA 3’
Concepts
Folds
RNA silencing is initiated by double-stranded RNA
…produces an RNA molecule
that folds to produce double- molecules that are cleaved and processed. The
5’ UCAGG resulting small interfering RNAs bind to
3’ AGUCC
stranded RNA.
complementary sequences in mRNA and bring
about their cleavage and degradation. Small
(b)
interfering RNAs may also stimulate the
5’
1 Double-stranded 3’ 6 siRNAs may also attach methylation of complementary sequences in DNA.
RNA is cleaved to complementary
and processed sequences in DNA and
by the enzyme Dicer attract methylating Translational and Posttranslational Control
dicer… enzymes…
Ribosomes, aminoacyl tRNAs, initiation factors, and elon-
gation factors are all required for the translation of mRNA
DNA
molecules. The availability of these components affects the
2 …to produce
rate of translation and therefore influences gene expression.
small interfering Methylating
RNAs (siRNAs). The initiation of translation in some mRNAs is regulated by
enzyme
proteins that bind to the mRNA’s 5 UTR and inhibit the
mRNA
binding of ribosomes, similar to the way in which repressor
5’ 3’ proteins bind to operators and prevent the transcription of
structural genes.
3 siRNA pairs with
complementary Many eukaryotic proteins are extensively modified after
sequences on mRNA… translation by the selective cleavage and trimming of amino
acids from the ends, by acetylation, or by the addition of
RNA-protein phosphates, carboxyl groups, methyl groups, and carbohy-
complex drates to the protein). These modifications affect the trans-
port, function, and activity of the proteins and have the
capacity to affect gene expression.
Methylated
4 …and attracts an DNA
RNA-protein complex
that cleaves the Concepts
mRNA in the middle Cleavage
of the bound siRNA. The initiation of translation may be affected by
proteins that bind to specific sequences at the
5 end of mRNA. The availability of ribosomes,
7 …which methylate tRNAs, initiation and elongation factors, and other
cytosine bases in components of the translational apparatus may
5 After cleavage, the the DNA, affecting affect the rate of translation.
RNA is degraded. transcription.
Degradation
Conclusion: siRNAs produced from double-

stranded RNA molecules affect gene expression.
◗16.28 RNA silencing leads to the degradation of
mRNA and the methylation of DNA.
464 Chapter 16
8. Some eukaryotic transcriptional activator proteins

Connecting Concepts function at a distance from the gene by binding to
A Comparison of Bacterial enhancers, causing a loop in the DNA, and bringing
and Eukaryotic Gene Control the promoter and enhancer into close proximity. Some
distant-acting sequences analogous to enhancers have
Now that we have considered the major types of gene reg- been described in bacterial cells, but they appear to be
ulation, let’s review some of the similarities and differ- less common.
ences of bacterial and eukaryotic gene control.
9. The greater time lag between transcription and
1. Much of gene regulation in both bacterial and translation in eukaryotic cells than in bacterial cells
eukaryotic cells is accomplished through proteins allows mRNA stability and mRNA processing to play
that bind to specific sequences in DNA. Regulatory larger roles in eukaryotic gene regulation.
proteins come in a variety of types, but most can be
characterized according to a small set of DNA-binding
motifs.
Connecting Concepts Across Chapters
2. Regulatory proteins that affect transcription exhibit
two basic types of control: repressors inhibit transcrip- The focus of this chapter has been on how the flow of
tion (negative control); activators stimulate transcrip- information from genotype to phenotype is controlled.
tion (positive control). Both negative control and posi- We have seen that there are a number of potential points
tive control are found in bacterial and eukaryotic cells. of control in this pathway of information flow, including
3. Complex biochemical and developmental events in changes in gene structure, transcription, mRNA process-
bacterial and eukaryotic cells may require a cascade of ing, mRNA stability, translation, and posttranslational
gene regulation, in which the activation of one set of modifications.
genes stimulates the activation of another set. Gene regulation is critically important from a num-
ber of perspectives. It is essential to the survival of cells,
4. Most gene regulation in bacterial cells is at the level of
which cannot afford to simultaneously transcribe and
transcription (although it does exist at other levels).
translate all of their genes. The evolution of complex
Gene regulation in eukaryotic cells often takes place
genomes consisting of thousands of genes would not have
at multiple levels, including chromatin structure,
been possible without some mechanism to selectively con-
transcription, mRNA processing, and RNA stability.
trol gene expression. Gene regulation is also important
5. In bacterial cells, genes are often clustered in operons from a practical point of view. A number of human dis-
and are coordinately expressed by transcription into a eases are caused by the breakdown of gene regulation,
single mRNA molecule. In contrast, each eukaryotic which produces proteins at inappropriate times or places.
gene typically has its own promoter and is transcribed Gene regulation is also important to genetic engineering,
independently. Coordinate regulation in eukaryotic cells where the key to success is often not getting genes into
takes place through common response elements, present a cell, which is relatively easy, but getting them expressed
in the promoters and enhancers of the genes. Different at useful levels. For all of these reasons, there is tremen-
genes that have the same response element in common dous interest in how gene expression is controlled, and
are influenced by the same regulatory protein. understanding gene regulation is one of the frontiers of
6. Chromatin structure plays a role in eukaryotic (but not genetic research.
bacterial) gene regulation. In general, condensed Information presented in this chapter builds on the
chromatin represses gene expression; chromatin foundation of molecular genetics developed in Chapters
structure must be altered before transcription. 10 through 15. The mechanisms of gene regulation pro-
Acetylation of the histone proteins, which may be vide important links to several topics in subsequent
influenced by the degree of DNA methylation, appears chapters. Gene regulation is important to the success of
to be important in bringing about these changes in recombinant DNA, which is discussed in Chapter 18.
chromatin structure. Gene regulation also plays an important role in the ge-
7. The initiation of transcription is a relatively simple netics of development and cancer, which are discussed in
process in bacterial cells, and regulatory proteins Chapter 21.
function by blocking or stimulating the binding of RNA
polymerase to DNA. Eukaryotic transcription requires
complex machinery that includes RNA polymerase,
general transcription factors, and transcriptional
activators, which allows transcription to be influenced
by multiple factors.
CONCEPTS SUMMARY
• Gene expression may be controlled at different levels, translation by binding to these sequences, thereby preventing
including the alteration of gene structure, transcription, the attachment or progress of the ribosome.
mRNA processing, RNA stability, translation, and • Transcriptional control regulates the lytic and lysogenic cycles
posttranslational modification. Much of gene regulation is of bacteriophage . The transcription of certain operons
through the action of regulatory proteins binding to specific stimulates the transcription of some operons and represses
sequences in DNA. the transcription of others. Which operons are stimulated
• Genes in bacterial cells are typically clustered into operons — and which are repressed depends on the affinity of promoters
groups of functionally related structural genes and the for repressor and activator proteins.
sequences that control their transcription. Structural genes in • Like gene regulation in bacterial cells, much of eukaryotic
an operon are transcribed together as a single mRNA. regulation is accomplished through the binding of regulatory
• In negative control, a repressor protein binds to DNA and proteins to DNA. However, there are no operons in
inhibits transcription. In positive control, an activator protein eukaryotic cells, and gene regulation is characterized by
binds to DNA and stimulates transcription. In inducible a greater diversity of mechanisms acting at different levels.
operons, transcription is normally off and must be turned • In eukaryotic cells, chromatin structure represses gene
on; in repressible operons, transcription is normally on and expression. During transcription, chromatin structure may
must be turned off. be altered by the acetylation of histone proteins and
• The lac operon of E. coli is a negative inducible operon that demethylation.
controls the metabolism of lactose. In the absence of lactose, • The initiation of eukaryotic transcription is controlled by
a repressor binds to the operator and prevents transcription general transcription factors that assemble into the basal
of the structural genes that encode -galactosidase, permease, transcription apparatus and by transcriptional activator
and transacetylase. When lactose is present, some of it is proteins that stimulate normal levels of transcription by
converted into allolactose, which binds to the repressor and binding to regulatory promoters and enhancers.
makes it inactive, allowing the structural genes to be
transcribed and lactose to be metabolized. When all the • Some DNA sequences limit the action of enhancers by
lactose has been metabolized, the repressor once again binds blocking their action in a position-dependent manner.
to the operator and blocks transcription. • Coordinately controlled genes in eukaryotic cells respond to
• Positive control in the lac operon and other operons is the same factors because they have common response
through catabolite repression. When complexed with cAMP, elements that are stimulated by the same transcriptional
the catabolite activator protein (CAP) binds to a site in or activator.
near the promoter and stimulates the transcription of the • Gene expression in eukaryotic cells may be influenced by
structural genes. Levels of cAMP are indirectly correlated RNA processing.
with glucose; so low levels of glucose stimulate transcription • Gene expression may be regulated by changes in RNA
and high levels inhibit transcription. stability. The 5 cap, the coding sequence, the 3 UTR, and
• The trp operon of E. coli is a negative repressible operon that the poly(A) tail are important in controlling the stability
controls the biosynthesis of tryptophan. of eukaryotic mRNAs. Proteins binding to the 5 end of
• Attenuation is another level of control that allows eukaryotic mRNA may affect its translation.
transcription to be stopped before RNA polymerase has • RNA silencing takes place when double-stranded RNA is
reached the structural genes. It takes place through the close cleaved and processed to produce small interfering RNAs that
coupling of transcription and translation and depends on the bind to complementary mRNAs and bring about their
secondary structure of the 5 UTR sequence. cleavage and degradation.
• Small RNA molecules, called antisense RNA, are • Control of the posttranslational modification of proteins also
complementary to sequences in mRNA and may inhibit may play a role in gene expression.
IMPORTANT TERMS
gene regulation (p. 000) domain (p. 000) negative control (p. 000) repressible operon (p. 000)
induction (p. 000) operon (p. 000) positive control (p. 000) corepressor (p. 000)
structural gene (p. 000) regulator gene (p. 000) inducible operon (p. 000) coordinate induction (p. 000)
regulatory gene (p. 000) regulator protein (p. 000) inducer (p. 000) partial diploid (p. 000)
regulatory element (p. 000) operator (p. 000) allosteric protein (p. 000) constitutive mutation (p. 000)
466 Chapter 16
catabolite repression (p. 000) attenuator (p. 000) chromatin-remodeling SR protein (p. 000)
catabolite activator protein antiterminator (p. 000) complex (p. 000) RNA silencing (p. 000)
(CAP) (p. 000) antisense RNA (p. 000) CpG island (p. 000) small interfering RNAs
adenosine-3, 5-cyclic transcriptional antiterminator coactivator (p. 000) (siRNAs) (p. 000)
monophosphate protein (p. 000) insulator (p. 000)
(cAMP) (p. 000) DNase I hypersensitive heat-shock protein (p. 000)
attenuation (p. 000) site (p. 000) response element (p. 000)
Worked Problems
1. A regulator gene produces a repressor in an inducible operon. Constitutive mutations cause transcription to take place at all
A geneticist isolates several constitutive mutations affecting this times, whether the inducer is present or not. Constitutive muta-
operon. Where might these constitutive mutations occur? How tions might occur in the regulator gene, altering the repressor so
would the mutations cause the operon to be constitutive? that it is never able to bind to the operator. Alternatively,
constitutive mutations might occur in the operator, altering the
• Solution binding site for the repressor so that the repressor is unable to
An inducible operon is normally not being transcribed, meaning bind under any conditions.
that the repressor is active and binds to the operator, inhibiting 2. For E. coli strains with the lac genotypes, use a plus sign () to
transcription. Transcription takes place when the inducer binds indicate the synthesis of -galactosidase and permease and a
to the repressor, making it unable to bind to the operator. minus sign () to indicate no synthesis of the enzymes.
Lactose absent Lactose present

Genotype of strain -Galactosidase Permease -Galactosidase Permease

(a) lacI lacP lacO lacZ lacY
(b) lacI lacP lacOc lacZ lacY
(c) lacI lacP lacO lacZ lacY
(d) lacI lacP lacO lacZ lacY/
lacI lacP lacO lacZ lacY
• Solution

(a) lacI lacP lacO lacZ lacY
(b) lacI lacP lacOc lacZ lacY
(c) lacI lacP lacO lacZ lacY
(d) lacI lacP lacO lacZ lacY/
(a) All the genes possess normal sequences, and so the lac operon unable to bind to it, and so transcription takes place at all times.
functions normally: when lactose is absent, the regulator protein Therefore, permease will be produced in both the presence and
binds to the operator and inhibits the transcription of the the absence of lactose.
structural genes, and so -galactosidase and permease are not (c) In this strain, the promoter is mutated, and so RNA
produced. When lactose is present, some of it is converted into polymerase is unable to bind and transcription does not take
allolactose, which binds to the repressor and makes it inactive; the place. Therefore -galactosidase and permease are not produced
repressor does not bind to the operator, and so the structural genes under any conditions.
are transcribed, and -galactosidase and permease are produced. (d) This strain is a partial diploid, which consists of two copies of
(b) The structural lacZ gene is mutated; so -galactosidase will the lac operon — one on the bacterial chromosome and another
not be produced under any conditions. The lacO gene has on a plasmid. The lac operon represented in the upper part of the
a constitutive mutation, which means that the repressor is genotype has mutations in both the lacZ and lacY genes, and so it
is not capable of encoding -galactosidase or permease under any (a) When no mutations are present, enzymes 1 and 2 are
conditions. The lac operon in the lower part of the genotype has produced in the presence of Fox but not in its absence,
a defective regulator gene, but the normal regulator gene in the indicating that the operon is inducible and Fox is the inducer.
upper operon produces a diffusible repressor (trans acting) that (b) Mutation A allows the production of enzyme 2 in the
binds to the lower operon in the absence of lactose and inhibits presence of Fox, but enzyme 1 is not produced in the presence
transcription. Therefore no -galactosidase or permease is pro- or absence of Fox, and so A must have a mutation in the
duced when lactose is absent. In the presence of lactose, the structural gene for enzyme 1. With B, neither enzyme is produced
repressor cannot bind to the operator, and so the lower operon is under any conditions, and so this mutation most likely occurs in
transcribed and -galactosidase and permease are produced. the promoter and prevents RNA polymerase from binding.
3. The fox operon, which has sequences A, B, C, and D, encodes Mutation C affects only enzyme 2, which is not produced in the
enzymes 1 and 2. Mutations in sequences A, B, C, and D have the presence or absence of lactose; enzyme 1 is produced normally
following effects, where a plus sign () enzyme synthesized (only in the presence of Fox), and so mutation C most likely
and a minus sign () enzyme not synthesized. occurs in the structural gene for enzyme 2. Mutation D is
constitutive, allowing the production of enzymes 1 and 2 whether
Fox absent Fox present or not Fox is present. This mutation most likely occurs in the
regulator gene, producing a defective repressor that is unable to
Mutation Enzyme Enzyme Enzyme Enzyme bind to the operator under any conditions.
in sequence 1 2 1 2
Regulator gene D
No mutation
Promoter B
A
Structural gene for enzyme 1 A
B
Structural gene for enzyme 2 C
C
D 4. A mutation occurs in the 5 UTR of the trp operon that
reduces the ability of region 2 to pair with region 3. What would
(a) Is the fox operon inducible or repressible? be the effect of this mutation when the tryptophan level is high
(b) Indicate which sequence (A, B, C, or D) is part of the and when the tryptophan level is low?
following components of the operon:
• Solution
Regulator gene When the tryptophan level is high, regions 2 and 3 do not
Promoter normally pair, and therefore the mutation will have no effect.
Structural gene for enzyme 1 When the tryptophan level is low, however, the ribosome
Structural gene for enzyme 2 normally stalls at the Trp codons in region 1 and does not cover
region 2, and so regions 2 and 3 are free to pair, which prevents
• Solution regions 3 and 4 from pairing and forming a terminator, ending
Because the structural genes in an operon are coordinately expre- transcription. If regions 2 and 3 cannot pair, then regions 3 and
ssed, mutations that affect only one enzyme are likely to occur in 4 will pair even when tryptophan is low and attenuation will
the structural genes; mutations that affect both enzymes must always occur. Therefore, no more tryptophan will be synthesized
occur in the promoter or regulator. even in the absence of tryptophan.
The New Genetics

MINING GENOMES
MICROARRAY ANALYSIS AND THE ANALYSIS a general introduction to microarrays, you will explore the use
OF GENE EXPRESSION of microarrays in studies of gene expression. You will use SAGE
This exercise introduces the powerful technique of microarray (Serial Analysis of Gene Expression) to try to identify which
analysis, one of the most potent tools in bioinformatics. After genes are important in the development of specific diseases.
COMPREHENSION QUESTIONS
* 1. Name six different levels at which gene expression might be * 2. Draw a picture illustrating the general structure of an
controlled. operon and identify its parts.
468 Chapter 16
3. What is the difference between positive and negative 10. Briefly explain how transcriptional activator proteins and
control? What is the difference between inducible and repressors affect the level of transcription of eukaryotic
repressible operons? genes.
* 4. Briefly describe the lac operon and how it controls the 11. What is an insulator?
metabolism of lactose. 12. What is a response element? How do response elements
5. What is catabolite repression? How does it allow a bacterial bring about the coordinated expression of eukaryotic genes?
cell to use glucose in preference to other sugars? 13. Outline the role of alternative splicing in the control of sex
* 6. What is attenuation? What is the mechanism by which the differentiation in Drosophila.
attenuator forms when tryptophan levels are high and the *14. What role does RNA stability play in gene regulation? What
antiterminator forms when tryptophan levels are low? controls RNA stability in eukaryotic cells?
* 7. What is antisense RNA? How does it control gene expression? 15. Define RNA silencing. Explain how siRNAs arise and how
8. What general features of transcriptional control are found they potentially affect gene expression.
in bacteriophage ? *16. Compare and contrast bacterial and eukaryotic gene
* 9. What changes take place in chromatin structure and what regulation. How are they similar? How are they different?
role do these changes play in eukaryotic gene regulation?
APPLICATION QUESTIONS AND PROBLEMS
*17. For each of the following types of transcriptional control, * 20. A mutation prevents the catabolite activator protein (CAP)
indicate whether the protein produced by the regulator gene from binding to the promoter in the lac operon. What will
will be synthesized initially as an active repressor, inactive be the effect of this mutation on transcription of the
repressor, active activator, or inactive activator. operon?
(a) Negative control in a repressible operon 21. Under which of the following conditions would a lac
(b) Positive control in a repressible operon operon produce the greatest amount of -galactosidase?
The least? Explain your reasoning.
(c) Negative control in an inducible operon
(d) Positive control in an inducible operon Lactose present Glucose present
*18. A mutation occurs at the operator site that prevents the Condition 1 Yes No
regulator protein from binding. What effect will this Condition 2 No Yes
mutation have in the following types of operons? Condition 3 Yes Yes
(a) Regulator protein is a repressor in a repressible operon. Condition 4 No No
(b) Regulator protein is a repressor in an inducible operon.
19. The blob operon produces enzymes that convert compound 22. A mutant strain of E. coli produces -galactosidase in the
A into compound B. The operon is controlled by a presence and in the absence of lactose. Where in the operon
regulatory gene S. Normally the enzymes are synthesized might the mutation in this strain occur?
only in the absence of compound B. If gene S is mutated, * 23. For E. coli strains with the following lac genotypes, use a
the enzymes are synthesized in the presence and in the plus sign () to indicate the synthesis of -galactosidase
absence of compound B. Does gene S produce a repressor and permease and a minus sign () to indicate no synthesis
or an activator? Is this operon inducible or repressible? of the enzymes.


lacI lacP lacOc lacZ lacY
lacI lacP lacO lacZ lacY/
(continued on p. 469)
*23. (continued) Lactose absent Lactose present

lacI lacP lacOc lacZ lacY/
lacI lacP lacOc lacZ lacY/
lacI s lacP lacO lacZ lacY/
lacI s lacP lacO lacZ lacY/
24. Give all possible genotypes of a lac operon that produces

-galactosidase and permease under the following
conditions. Do not give partial diploid genotypes.

-Galactosidase Permease -Galactosidase Permease
(a)
(b)
(c)
(d)
(e)
(f)
(g)
* 25. Explain why mutations in the lacI gene are trans in their (b) Indicate which sequence (A, B, C, or D) is part of the
effects, but mutations in the lacO gene are cis in their following components of the operon:
effects.
Regulator gene
* 26. The mmm operon, which has sequences A, B, C, and D, Promoter
encodes enzymes 1 and 2. Mutations in sequences A, B, C, Structural gene for enzyme 1
and D have the following effects, where a plus sign () Structural gene for enzyme 2
enzyme synthesized and a minus sign () enzyme not
synthesized. * 27. Listed in parts a through g are some mutations that
were found in the 5 UTR region of the trp operon of
E. coli. What would the most likely effect of each of these
Mmm absent Mmm present mutations be on the transcription of the trp structural
Mutation Enzyme Enzyme Enzyme Enzyme genes?
in sequence 1 2 1 2 (a) A mutation that prevented the binding of the ribosome
No mutation to the 5 end of the mRNA 5 UTR
A (b) A mutation that changed the tryptophan codons in
B region 1 of the mRNA 5 UTR into codons for alanine
C (c) A mutation that created a stop codon early in region 1
D of the mRNA 5 UTR
(d) Deletions in region 2 of the mRNA 5 UTR
(a) Is the mmm operon inducible or repressible? (e) Deletions in region 3 of the mRNA 5 UTR
470 Chapter 16
(f) Deletions in region 4 of the mRNA 5 UTR 30. Several examples of antisense RNA regulating translation in
(g) Deletion of the string of adenine nucleotides that bacterial cells have been discovered. Molecular geneticists
follows region 4 in the 5 UTR have also used antisense RNA to artificially control
transcription in both bacterial and eukaryotic genes. If you
28. Some mutations in the trp 5 UTR region increase
wanted to inhibit the transcription of a bacterial gene with
termination by the attenuator. Where might these mutations
antisense RNA, what sequences might the antisense RNA
occur and how might they affect the attenuator?
contain?
29. Some of the mutations mentioned in Question 28 have an
interesting property. They prevent the formation of the * 31. What would be the effect of deleting the Sxl gene in a newly
antiterminator that normally takes place when the fertilized Drosophila embryo?
tryptophan level is low. In one of the mutations, the AUG 32. What would be the effect of a mutation that destroyed the
start codon for the 5 UTR peptide has been deleted. How ability of poly(A)-binding protein (PABP) to attach to a
might this mutation prevent antitermination from occurring? poly(A) tail?
CHALLENGE QUESTIONS
33. Would you expect to see attenuation in the lac operon and In recent experiments, numerous short segments of
other operons that control the metabolism of sugars? Why RNA containing only 3 UTR sequences were introduced
or why not? into U937D cells. As a result, the U937D cells began to
34. A common feature of many eukaryotic mRNAs is the synthesize the CK-B enzyme, but the total amount of CK-B
presence of a rather long 3 UTR, which often contains mRNA did not increase. Short segments of other RNA
consensus sequences. Creatine kinase B (CK-B) is an sequences did not stimulate the synthesis of CK-B; only the
enzyme important in cellular metabolism. Certain 3 UTR sequences turned on the translation of the enzyme.
cells — termed U937D cells — have lots of CK-B mRNA, On the basis of these experiments, propose a
but no CK-B enzyme is present. In these cells, the 5 end mechanism for how CK-B translation is inhibited in the
of the CK-B mRNA is bound to ribosomes, but the mRNA U937D cells. Explain how the introduction of short
is apparently not translated. Something inhibits the segments of RNA containing the 3 UTR sequences might
translation of the CK-B mRNA in these cells. remove the inhibition.
SUGGESTED READINGS
Beelman, C. A., and R. Parker. 1995. Degradation of mRNA in Gerasimova, T. I., and V. G. Corces. 2001. Chromatin insulators
eukaryotes. Cell 81:179 – 183. and boundaries: effects on transcription and nuclear
An excellent review of the importance of mRNA stability in organization. Annual Review of Genetics 35:193 – 208.
eukaryotic gene regulation and of some of the ways in which Reviews the effects of insulators and chromatin boundaries on
mRNA is degraded. the transcription of eukaryotic genes.
Bell, A. C., A. G. West, and G. Felsenfeld. Insulators and Green, P. J., O. Pines, and M. Inouye. 1986. The role of antisense
boundaries: versatile regulatory elements in the eukaryotic RNA in gene regulation. Annual Review of Biochemistry
genome. Science 291:447 – 498. 55:569 – 597.
A good introduction to research on insulators. A good review of antisense RNA and its role in gene
Bestor, T. H. 1998. Methylation meets acetylation. Nature regulation.
393:311 – 312. Hodgkin, J. 1989. Drosophila sex determination: a cascade of
A short review of research demonstrating a connection regulated splicing. Cell 56:905 – 906.
between DNA methylation and histone acetylation. A good short review of alternative splicing and how it
Bird, A. P., and A. P. Wolffe. 1999. Methylation-induced regulates sex differentiation in Drosophila.
repression: belts, braces, and chromatin. Cell 99:451 – 454. Jacob, F., and J. Monod. 1961. Genetic regulatory mechanisms
Discusses the role of methylation in gene regulation and in the synthesis of proteins. Journal of Molecular Biology
development. 3:318 – 356.
Blackwood, E. M., and J. T. Kadonaga. 1998. Going the distance: A classic paper describing Jacob and Monod’s work on the lac
a current view of enhancer action. Science 281:60 – 63. operon, as a well as a review of gene control in several
Reviews and discusses current models of enhancer action. other systems.
Matzke, M., A. J. M. Matzke, and J. M. Kooter. 2001. RNA: Tuite, M. F. 1996. Death by decapitation for mRNA. Nature
guiding gene silencing. Science 293:1080 – 1083. 382:577 – 579.
A review of RNA silencing. Discusses the interaction of the 3poly(A) tail and the 5 cap
Ng, H. H., and A. Bird. 2000. Histone deacetylases: silencers for in mRNA degradation.
hire. Trends in Biochemical Science 25:121 – 126. Tyler, J. K., and J. T. Kadonaga. 1999. The “dark side” of
Reviews how deacetylation can affect transcription in chromatin remodeling: repressive effects on transcription. Cell
eukaryotic cells. 99:443 – 446.
Pabo, C. O., and R. T. Sauer. 1992. Transcription factors: Discusses the role of chromatin-remodeling complexes in
structural families and principles. Annual Review of eukaryotic gene regulation.
Biochemistry 61:1053 – 1095. Wolffe, A. P. 1994. Transcription: in tune with histones. Cell
A review of different DNA-binding motifs. 77:13 – 16.
Ptashne, M. 1989. How gene activators work. Scientific American A review of the role of histone proteins in eukaryotic gene
260(1):41 – 47. regulation.
A discussion of some of the similarities in the ways in which Wolffe, A. P. 1997. Sinful repression. Nature 387:16 – 17.
gene activators work in prokaryotes and eukaryotes. A short review of the role of histone acetylation in eukaryotic
Ross, J. 1989. The turnover of messenger RNA. Scientific gene regulation.
American 260(4):48 – 55. Yanofsky, C. 1981. Attenuation in the control of expression of
A review of factors that control mRNA stability in eukaryotes. bacterial operons. Nature 289:751 – 758.
Struhl, K. 1995. Yeast transcriptional regulatory mechanisms. A good review of attenuation.
Annual Review of Genetics 29:651 – 674.
A good review of transcriptional control in yeast.

Lodish Cloning

Uploaded by

Copyright:

Available Formats

Lodish Cloning

Uploaded by

Document Information

Original Description:

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Lodish Cloning

Uploaded by

Copyright:

Available Formats

16 Control of Gene Expression

• Creating Giant Mice

(a) Helix-turn-helix (b) Zinc fingers (c) Steroid receptor

Helix Turn Helix

DNA- Turn Dimer-

(d) Leucine zipper (e) Helix-loop-helix (f) Homeodomain

DNA-binding Minor Major

Table 16.1 Common DNA-binding motifs

Helix-turn-helix Bacterial regulatory Two alpha helices Major groove

1 An operon is a group of Operon

2 A separate regulator gene— Transcription Transcription

3 …encodes a regulator Translation 5 …of mRNA,… Translation

Regulator Proteins (enzymes) A B C

that includes a series of structural genes, a

(b) Precursor V (the inducer) present Operator

4 When precursor V is Inactive D E F

1 The regulator protein is an 2 Transcription of

(b) Product U present Operator

Active regulator Product U

◗ 16.5 Some operons are repressible.

Putting it all together Theoretically, operons might Concepts

Negative inducible Off Active repressor Inhibits Substrate makes

2 …where the enzyme

1 In the absence of lactose, the regulator

RNA polymerase lac repressor

(a) Absence of lactose lacO +

(b) Presence of lactose 2 When lactose is present, it lacO +

◗ 16.9 The partial diploid lacI lacZ/lacI lacZ produces β-Galactosidase

◗ 16.10 The partial diploid lacI s IacZ /lacI lacZ fails to

Absence of lactose lacO + Absence of lactose lacO +

Presence of lactose lacO + Presence of lactose lacO +

Binds Binds lacZ –

When glucose is low

cAMP cAMP cAMP RNA

Transcription 4 The result is high rates of

5 …and the production of

cAMP cAMP CAP RNA lacO

◗ 16.12 The catabolite activator protein (CAP) binds to the

Concepts The trp Operon of E. coli

When tryptophan is low Operator

1 The trp repressor 2 It cannot bind 3 …and transcription

When tryptophan is high Operator

◗ 16.14 The trp operon controls the biosynthesis of the amino

Concepts which is found in the trp operon of E. coli. Several obser-

(a) Trp operon

Start codon Trp UUUUUUU Start codon

1 When tryptophan is high, region 2 When tryptophan is low, region 2

1+2 and 3+4 2+3

◗ 16.15 Two different secondary structures may be formed by

When tryptophan is high mRNA RNA polymerase

6 Region 4 is transcribed and pairs with region 3.

When tryptophan is low

4 Because the ribosome is stalled, region 2

6 When region 4 is transcribed, it cannot pair 4

◗ 16.16 The premature termination of transcription (attenuation) takes

Table 16.3 Events in the process of attenuation

High No Covers region 2 34 hairpin Yes

Transcription Transcription Transcription

mRNA Antisense mRNA

◗ 16.18 The bacteriophage chromosome

stimulating transcription. The repressor, which plays a