4-Clinical and Experimental Dermatology.pdf

See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/282218765 Association between tumour necrosis-α gene polymorphisms and acne vulgaris in a Pakistani population. Article in Clinical and Experimental Dermatology · September 2015 DOI: 10.1111/ced.12757. CITATION READS 1 41 10 authors, including: Javeria Haroon Sabir Hussain 6 PUBLICATIONS 24 CITATIONS 14 PUBLICATIONS 80 CITATIONS Quaid-i-Azam University SEE PROFILE COMSATS Institute of Information Technology SEE PROFILE Younis S Muhammad Jawad Hassan 12 PUBLICATIONS 11 CITATIONS 13 PUBLICATIONS 144 CITATIONS NYU Langone Medical Center SEE PROFILE National University of Sciences and Technol… SEE PROFILE Some of the authors of this publication are also working on these related projects: Molecular genetic Studies of Inherited Neurological Disorders View project Epidemiological prospects of complex diseases View project All content following this page was uploaded by Younis S on 28 October 2015. The user has requested enhancement of the downloaded file. All in-text references underlined in blue are added to the original document and are linked to publications on ResearchGate, letting you access and read them immediately. CED Experimental dermatology • Original article Clinical and Experimental Dermatology Association between tumour necrosis-a gene polymorphisms and acne vulgaris in a Pakistani population N. M. Aisha,1 J. Haroon,2 S. Hussain,2 C. M. Tahir,3 M. Ikramullah,1 H. Rahim,2 N. Kishwar,2 S. Younis,2 M. J. Hassan4 and Q. Javed2 1 Department of Biochemistry, University of Health Sciences, Lahore, Pakistan; 2Department of Biochemistry, Faculty of Biological Sciences, Quaid-i-Azam University, Islamabad, Pakistan; 3Department of Dermatology, WAPDA Hospital, Lahore, Pakistan; and 4Biochemistry Division, Department of Basic Health Sciences, Shifa College of Medicine, Islamabad, Pakistan doi:10.1111/ced.12757 Summary Background. The cytokine tumour necrosis factor (TNF)-a is a well-studied potent candidate mediator that is systemically involved in a variety of inflammatory diseases. Several single nucleotide polymorphisms (SNPs) of the TNF-a gene have been studied with regard the pathogenesis of acne vulgaris, but the results have been inconclusive. Aim. This case–control study investigated the association of the TNF -308 G>A and -238 G>A SNPs with acne vulgaris in a high-risk Pakistani population. Methods. In total, 160 healthy controls and 140 patients with acne were enrolled in this study. Polymorphisms were determined by PCR and restriction fragment length polymorphism analysis. Results. Our data showed that the TNF -308 G>A and TNF -238 G>A SNPs were present at a significantly higher rate in cases than in controls (P < 0.01 and P < 0.02; respectively). There was a significant difference between the G and A alleles from patients with acne and controls for -308 G>A (OR = 1.5, 95% CI = 1.07–2.19, P < 0.02) and -238 G>A (OR=1.6, 95% CI = 1.06–2.44, P = 0.02) genotype. Moreover, the severity of acne was significantly associated with TNF genotype (TNF -308 G>A: v² = 34.6, P < 0.001; TNF -238 G>AL v² = 12.9, P < 0.01). Conclusion. Our data suggest that the TNF -308 G>A and TNF -238 G>A SNPs may contribute to the pathogenesis of acne in the study population. Furthermore, patients with severe acne showed an increased frequency of mutant TNF genotypes at -308 and -238 compared with patients with less severe acne. Introduction Acne vulgaris (AV) is is a distressing condition of the pilosebaceous unit, characterized by the formation of open and closed comedones, papules, pustules, nodules and cysts.1 Genetic and environmental factors play an important role in the aetiology and pathogenesis of AV.2–5 The relationship between genetic factors and Correspondence: Dr Qamar Javed, Department of Biochemistry, Faculty of Biological Sciences, Quaid-i-Azam University, Islamabad 4530, Pakistan E-mail: [email protected] Conflict of interest: the authors declare that they have no conflicts of interest. Accepted for publication 8 April 2015 ª 2015 British Association of Dermatologists acne has been reported in different populations.3–5 Most of the genes related to acne are either key players in the innate immune system or are associated with steroid hormone metabolism. More recently, investigations have been carried out into novel risk factors and their regulatory mechanisms that may contribute to the disease pathology, in order to improve treatment strategies for acne. Propionibacterium acnes activates cytokine production from various cells, including monocytes and keratinocytes.6 Proinflammatory cytokines such as interleukin (IL)-1, IL-8 and tumour necrosis factor (TNF) contribute to the pathogenesis of acne.7,8 TNF has a pivotal role in inflammatory reactions and is a Clinical and Experimental Dermatology 1 Association between TNF-a gene polymorphisms and acne vulgaris  N. M. Aisha et al. key regulator of the innate immune system. The inflammatory response to TNF is mediated directly and through upregulation of other cytokines. These factors may influence the pathophysiology of acne, and factors affecting TNF production may manipulate the extent of the inflammatory response, which may be useful as prognostic markers for determining the clinical severity of the disease. Promoter polymorphisms have been shown to influence TNF expression.9 TNF promoter polymorphisms have been investigated in AV in various populations.8,10–12 Some studies support a link between TNF promoter polymorphisms and acne, whereas others found conflicting results regarding the association of TNF polymorphisms with acne in different ethnic groups.8,11 The aim of the current study was to investigate two TNF gene single nucleotide polymorphisms (SNPs), -308 G>A and -238 G>A, for links with susceptibility and severity of AV in a Pakistani population. dermatologists. Mild acne was defined by the presence of comedones, with no prominent inflammation and a few or no papules; moderate acne was characterized by the presence of comedones, with inflammation of papules and pustules; and severe acne was defined as the presence of inflammatory nodules, comedones, papules and pustules. The HCs were required to have no lesions or at most a few noninflammatory lesions; none of these had ever had any severe acne symptoms, and they were all healthy and without any other disease symptoms. Diagnosis of AV was based on physical examination and the Global Acne Grading System. Patients were divided into three subcategories: acne comedonica (mild acne), papulopustular acne (moderate acne), and nodulocystic acne (severe acne). The HCs had no symptoms of AV or other skin disease either at presentation or previously. Methods SNPs in the TNF gene were detected by PCR with restriction fragment length SNP analysis. The primers used are shown in Table 1. PCR was performed in a total volume of 50 lL with 300 ng of DNA (GeneAmp PCR System 9700; Applied Biosystems Inc, Foster City, CA, USA). An aliquot of 10 lL of PCR product was digested with the restriction enzymes NcoI and MspI (MBI-Fermentas/ Thermo Fisher Scientific, Waltham, MA, USA) for the -308 G>A and -238 G>A SNPs, respectively, in 2 lL of 109 Buffer G, 1 lL restriction enzyme and 7 lL nuclease-free water for 18 h at 37 °C. Genotyping of TNF SNPs was determined using a 3% agarose gel stained with 10 mg/mL ethidium bromide, visualized under ultraviolet light. The study was reviewed and approved by the institutional review board of Quaid-i-Azam University, Islamabad, Pakistan, and performed in accordance with the principles stated in the Helsinki Declaration of 1975 as revised in 1997. Informed consent was obtained from all participants of the study before sample collection. Study participants We investigated 300 subjects for case–control association of TNF SNPs with acne. Patients with AV attending the dermatology units of hospitals in Punjab, Pakistan (n = 140; mean age 22.9
6.2 years) and healthy controls (HCs) (n = 160; mean age 23.1
5.6 years) of the same ethnic origin were recruited. The patient group comprised 35.0% men and 65.0% women, while the HC group comprised 40.6% men and 59.4% women, which was not statistically different (P = 0.38; data not shown). Inclusion criteria were applied to both patients and controls in this study. Patients with acne were examined in the outpatients department of the hospitals by Tumour necrosis factor polymorphism analyses Statistical analysis All statistical tests were carried out using Minitab software (v15 Minitab Inc. State College, PA, USA) and GraphPad Instate (v3.05; GraphPad Software Inc. San Diego, CA, USA) unless otherwise stated. The genotype frequencies between the cases and controls and the prevalence of the disease were analysed by v² test, and Table 1 Primers used for PCR. Polymorphism Direction Sequence 50 ?30 Fragment size, bp -308 G>A Forward Reverse Forward Reverse AGGCAATAGGTTTTGAGGGCCAT CATCAAGGATACCCCTCACACTC AGAAGACCCCCCTCGGAACC ATCTGGAGGAAGCGGTAGTG 134 -238 G>A 2 Clinical and Experimental Dermatology 152 ª 2015 British Association of Dermatologists Association between TNF-a gene polymorphisms and acne vulgaris  N. M. Aisha et al. Table 2 Genotype and allele frequencies in patients and control subjects. Polymorphism TNF-308 G>A GG genotype GA genotype AA genotype A allele G allele TNF-238 G>A GG genotype GA genotype AA genotype A allele G allele Patients (n = 140) Controls (n = 160) P 60 55 25 105 175 (42.9) (39.2) (17.9) (37.5) (62.5) 80 70 10 90 230 (50.0) (43.7) (6.30) (28.1) (71.9) < 0.01* v² = 9.8 < 0.02† (A vs. G allele) OR = 1.5, 95% CI 1.07–2.19 86 39 15 69 211 (61.4) (27.9) (10.7) (24.6) (75.4) 110 46 4 54 266 (68.8) (28.7) (2.5) (16.9) (83.1) < 0.02* < 0.03† (A vs. G allele) OR = 1.6, 95% CI 1.06–2.44 TNF, tumour necrosis factor. Values are given as n (%). *Calculated by v² test; †calculated by Fisher exact test. the allele frequencies between patients and controls were tested by Fisher exact test (2 9 2 contingency table). Odds ratio and 95% confidence intervals were given accordingly. Results were considered significant at P < 0.05. of -308 and -238 were more prevalent in 38.8% and 51.9% of patients with nodulocystic (severe) acne (Table 2). The severity of acne was significantly associated with TNF genotypes (TNF -308 G>A: v² = 34.6, P < 0.001; TNF -238 G>A: v² = 12.9, P < 0.01) (Table 3). Results Genotype and allele frequencies for patients and controls are listed in Table 1. Genotype frequencies of control subjects were in Hardy–Weinberg equilibrium (TNF -308: v² = 1.08, P = 0.58; TNF -238 v² = 0.1, P = 0.95). There was a higher prevalence of the common genotype GG at -308 and -238 of the TNF gene in HCs (Table 2). There was a significant difference in genotype frequencies between patients with acne and controls (v² = 9.8, P < 0.01). The frequency of the AA genotype for the -308 G>A SNP was higher in patients with acne than in HCs (17.9% vs. 6.30%; P < 0.01; AA vs. GG + GA). When the two groups were compared, there was a significant difference in allelic frequencies of TNF -308 G>A between patients and HCs (OR = 1.5, 95% CI = 1.07–2.19, P < 0.02) (Table 1). There was also a significant difference in genotype frequencies of -238 G>A between the two groups (v² = 8.6, P < 0.02) (Table 2). The AA genotype of the TNF -238 G>A SNP was linked with an increased risk of developing AV (P = 0.004; AA vs. GG + GA). At -238 G>A a significant difference was found between the A and G alleles from patients with acne and HCs (OR = 1.6, 95% CI=1.06–2.44, P < 0.03) (Table 2). Patients with acne were subdivided into three groups (mild, moderate, and severe) according to the severity of acne. The mutant genotypes GA + AA ª 2015 British Association of Dermatologists Discussion AV is a mutifactorial skin disease that affects a considerable number of people globally. Studies have implicated inflammatory cytokines in the pathogenesis of acne. Of these cytokines, TNF is considered to have a key role in the disease. The TNF -308 G>A and -238 G>A SNPs are the most studied SNPs in different populations, but there have been relatively few studies on these SNPs in patients with AV. As no data are available on -308 G>A and -238 G>A SNPs in Pakistani populations with acne, we chose to investigate the association of these SNPs with acne susceptibility in our community. Table 3 Genotype distribution in sub-groups of patients with acne vulgaris (n = 140). Acne severity Polymorphism TNF -308 G>A GG (n = 60) GA+AA (n = 80) TNF -238 G>A GG (n = 86) GA+AA (n = 54) Mild Moderate Severe P v² 46 (76.7) 23 (28.8) 11 (18.3) 26 (32.4) 3 (5.0) 31 (38.8) < 0.001* 34.6 52 (60.5) 16 (29.6) 11 (12.8) 10 (18.5) 23 (26.7) 28 (51.9) < 0.01* 12.9 TNF, tumour necrosis factor. Values are given as n (%). *Calculated by v² test. Clinical and Experimental Dermatology 3 Association between TNF-a gene polymorphisms and acne vulgaris  N. M. Aisha et al. Our results suggest that the -308 G>A and -238 G>A SNPs are associated with the pathogenesis of acne in the study population. The AA genotypes of both -308 and -238 were associated with an increased risk of developing AV. The mutant A allele at -308 and -238 was found at a significantly higher rate in the patient group compared with the HC group (Table 2). Furthermore, our data showed a statistically significant, pronounced association between the variant -308 and -238 genotypes and the severity of acne (Table 3). The findings from this study indicate that the TNF promoter SNPs at -308 and -238 may contribute to the pathogenesis of acne in the study population. Our findings that the TNF promoter SNPs - 308 and -238 are a risk factor for acne is in agreement with data reporting a link between the TNF -308 G>A SNP and acne in a Turkish population.8 Another study by Szabo et al. investigated the association of five SNPs (-238, -308, -857, -863 and -1031) of the TNF gene with acne in a white population,10 and observed an increased frequency of the -308 variant genotype in female patients with acne, but found no significant link between the TNF -238 G>A SNP and the disease.10 By contrast, a lack of association was found between the TNF -308 and -238 SNPs and acne in a Polish population.11 The reported studies have revealed conflicting findings for -308 and -238 SNPs from patients with acne, therefore the data are not conclusive. This controversy may be due to differences in the origins of the studied population, variations in sample size or presence of selection bias in the study groups. A recent study by Grech et al. investigated three SNPs (-376, -308 and -238) of the TNF gene in a white population with fair skin.13 The study established that the GAG haplotype was associated with an increased risk of acne at a later age compared with the GGG haplotype, which influenced an earlier onset of the disease in male patients. Recently, Yang and colleagues published a meta-analysis on the TNF -308 G>A SNP and risk of acne, based on five case– control studies that included 728 cases and 825 control subjects,14 and found that the TNF -308 G>A SNP appeared to be associated with increased risk of AV in the investigated populations. White populations from five countries were included in this metaanalysis, but there was only one study from Asia, which was in an East Asian (Chinese) population. Thus, there is a need for more studies on patients with acne from Asian countries for a thorough understanding of the involvement of cytokines in acne. In the current study we did not investigate cytokine serum levels of the participants in relation to TNF 4 Clinical and Experimental Dermatology SNPs. However, evidence shows that the TNF -308 G>A variant genotype contributes to regulation of cytokine expression.15 Intracellular signalling pathways mediate their action via transcription factors that may affect the pathogenesis of acne. Nuclear factor (NF)-jB and activator protein-1 are activated in acne lesions,16,17 and lead to higher expression of their gene products. NF-jB activation results in a significant increase in the levels of the cytokines TNF-a and IL-1B, which have a major role in inflammation.16,17 More studies on the profiles of inflammatory cytokines and signalling pathways in relation to the disease-susceptible alleles are needed to elaborate the molecular mechanisms involved in the pathogenesis of acne. This could have useful clinical implications for the disease treatment strategies. There are some limitations to the current study; (i) the sample size was small and therefore these findings need to be replicated using larger sample sizes; (ii) cytokine association studies should be conducted on different ethnic groups, which would be useful in resolving the controversial role of cytokines in acne; (iii) TNF levels should be determined from patients with acne classified by severity of the disease; and (iv) this study reports on the TNF -308 G>A and -238 G>A SNPs from a Pakistani population, therefore these preliminary findings should be treated with caution. Conclusion We have demonstrated an association between the TNF -308 G>A and -238 G>A SNPs and the susceptibility to acne in Pakistani patients. However, the findings of present study must be evaluated in the context of the specific population, and further genetic studies with larger sample sizes should be performed in different populations to clarify the association of TNF gene variants with AV. What’s already known about this topic? • Inflammatory cytokines are implicated in the pathogenesis of acne. • Relatively few studies have been conducted on TNF SNP in patients with acne • The role of the TNF promoter SNPs -308 G>A and -238 G>A in acne pathogenesis is still uncertain. ª 2015 British Association of Dermatologists Association between TNF-a gene polymorphisms and acne vulgaris  N. M. Aisha et al. What does this study add? 9 • TNF -308 G>A and TNF -238 G>A may con- tribute to acne in a Pakistani population. • Patients with severe acne showed an increased frequency of mutant genotypes at -308 and -238 compared with those having less severe phenotypes. References 1 Koreck A, Pivarcsi A, Dobozy A, Kemeny L. The role of innate immunity in the pathogenesis of acne. Dermatology 2003; 206: 96–105. 2 Herane MI, Ando I. Acne in infancy and acne genetics. Dermatology 2003; 206: 24–8. 3 Ando I, Kukita A, Soma G, Hino H. A large number of tandem repeats in the polymorphic epithelial mucin gene is associated with severe acne. J Dermatol 1998; 25: 150–2. 4 Bataille V, Sneider H, MacGregor AJ et al. The influence of genetics and environmental factors in the pathogenesis of acne: a twin study of acne in women. J Invest Dermatol 2002; 119: 1317–22. 5 He L, Yang Z, Yu H et al. The relationship between CYP17–34T/C polymorphism and acne in Chinese subjects revealed by sequencing. Dermatology 2006; 212: 338–42. 6 Graham GM, Farrar MD, Cruse-Sawyer JE et al. Proinflammatory cytokine production by human keratinocytes stimulated with Propionibacterium acnes and P. acnes GroEL. Br J Dermatol 2004; 150: 421–8. 7 Sobjanek M, Zablotna M, Glen J et al. Polymorphism in interleukin 1A but not in interleukin 8 gene predisposes to acne vulgaris in Polish population. J Eur Acad Dermatol Venereol 2013; 27: 259–60. 8 Baz K, Erdal ME, Yazici AC et al. Association between tumor necrosis factor-alpha gene promoter polymorphism ª 2015 British Association of Dermatologists View publication stats 10 11 12 13 14 15 16 17 at position -308 and acne in Turkish patients. Arch Dermatol Res 2008; 300: 371–6. Hajeer AH, Hutchinson IV. TNF-alpha gene polymorphism: clinical and biological implications. Microsc Res Tech 2000; 50: 216–28. Szabo K, Tax G, Teodorescu-Brinzeu D et al. TNF gene polymorphisms in the pathogenesis of acne vulgaris. Arch Dermatol Res 2011; 303: 19–27. Sobjanek M, Zablotna M, Nedoszytko B et al. Lack of association between the promoter polymorphisms at positions -238 and -308 of the tumour necrosis factor alpha gene and acne vulgaris in Polish patients. J Eur Acad Dermatol Venereol 2009; 23: 331–2. Al-Shobaili HA, Salem TA, Alzolibani AA et al. Tumor necrosis factor- a -308 G/A and interleukin 10–1082 A/ G gene polymorphisms in patients with acne vulgaris. J Dermatol Sci 2012; 68: 52–5. Grech I, Giatrakos S, Damoraki G et al. Impact of TNF haplotypes in the physical course of acne vulgaris. Dermatology 2014; 228: 152–7. Yang JK, Wu WJ, Qi J et al. TNF-308 G/A polymorphism and risk of acne vulgaris: a meta-analysis. PLoS ONE 2014; 9: e87806. Wilson AG, Symons JA, McDowell TL et al. Effects of a polymorphism in the human tumor necrosis factor alpha promoter on transcriptional activation. Proc Natl Acad Sci 1997; 94: 3195–19. Kroeger KM, Carville KS, Abraham LJ. The -308 tumor necrosis factor-alpha promoter polymorphism effects transcription. Mol Immunol 1997; 34: 391–9. Kang S, Cho S, Chung JH et al. Inflammation and extracellular matrix degradation mediated by activated transcription factors nuclear factor-kappaB and activator protein-1 in inflammatory acne lesions in vivo. Am J Pathol 2005; 16: 1691–9. Clinical and Experimental Dermatology 5