Scribd Logo
Upload

Welcome to Scribd!

  • 133 views

    Human Genome Project: Vince Garcia Stephen Tamayo Nathan Tarcelo Mia Pangilinan Theresa Camille Tobillo Aveline Ylanan

    Uploaded by

    KentKawashima
    The Human Genome Project aimed to identify all human genes, determine DNA sequences, and address ethical issues. It was a 13-year public project led by the DOE and NIH starting in 1990. Key goals were to map all genes, sequence the 3 billion DNA base pairs, and develop analysis tools. Two DNA sequencing methods were used - chromosome walking to systematically sequence overlapping DNA segments, and shotgun sequencing which randomly fragments DNA for sequencing and computer reassembly. The project was completed in 2003 and advanced medicine and biology.

    Copyright:

    Attribution Non-Commercial (BY-NC)
    Download as PPT, PDF, TXT or read online from Scribd

    Human Genome Project: Vince Garcia Stephen Tamayo Nathan Tarcelo Mia Pangilinan Theresa Camille Tobillo Aveline Ylanan

    Uploaded by

    KentKawashima
    133 views13 pages
    The Human Genome Project aimed to identify all human genes, determine DNA sequences, and address ethical issues. It was a 13-year public project led by the DOE and NIH starting in 1990. Key goals were to map all genes, sequence the 3 billion DNA base pairs, and develop analysis tools. Two DNA sequencing methods were used - chromosome walking to systematically sequence overlapping DNA segments, and shotgun sequencing which randomly fragments DNA for sequencing and computer reassembly. The project was completed in 2003 and advanced medicine and biology.

    Original Title

    Human Genome Project

    Copyright

    © Attribution Non-Commercial (BY-NC)

    Available Formats

    PPT, PDF, TXT or read online from Scribd

    Did you find this document useful?

    Is this content inappropriate?

    The Human Genome Project aimed to identify all human genes, determine DNA sequences, and address ethical issues. It was a 13-year public project led by the DOE and NIH starting in 1990. Key goals were to map all genes, sequence the 3 billion DNA base pairs, and develop analysis tools. Two DNA sequencing methods were used - chromosome walking to systematically sequence overlapping DNA segments, and shotgun sequencing which randomly fragments DNA for sequencing and computer reassembly. The project was completed in 2003 and advanced medicine and biology.

    Copyright:

    Attribution Non-Commercial (BY-NC)
    Download as PPT, PDF, TXT or read online from Scribd
    Download as ppt, pdf, or txt
    133 views13 pages

    Human Genome Project: Vince Garcia Stephen Tamayo Nathan Tarcelo Mia Pangilinan Theresa Camille Tobillo Aveline Ylanan

    Uploaded by

    KentKawashima
    The Human Genome Project aimed to identify all human genes, determine DNA sequences, and address ethical issues. It was a 13-year public project led by the DOE and NIH starting in 1990. Key goals were to map all genes, sequence the 3 billion DNA base pairs, and develop analysis tools. Two DNA sequencing methods were used - chromosome walking to systematically sequence overlapping DNA segments, and shotgun sequencing which randomly fragments DNA for sequencing and computer reassembly. The project was completed in 2003 and advanced medicine and biology.

    Copyright:

    Attribution Non-Commercial (BY-NC)
    Download as PPT, PDF, TXT or read online from Scribd
    Download as ppt, pdf, or txt
    of 13

    Human Genome Project

    Vince Garcia
    Stephen Tamayo
    Nathan Tarcelo
    Mia Pangilinan
    Theresa Camille Tobillo
    Aveline Ylanan
    HGP: Primary Goals
    *from US DoE POV

    • identify all the approximately 20,000-25,000 genes


    in human DNA
    • determine the sequences of the 3 billion chemical
    base pairs that make up human DNA
    • store this information in databases
    • improve tools for data analysis
    • transfer related technologies to the private sector
    • address the ethical, legal, and social issues (ELSI)
    that may arise from the project
    HGP: Basic Details
    • Public Sector: A 13-year project
    conducted by the US Dept. Of Energy
    and the National Institutes of Health
    • Start: 1990, headed by James D. Watson
    • 2000: release of working draft
    • 2003: complete version
    • Private Sector: John Craig Venter
    (initially at Celera Genomics, now at J.
    Craig Venter Institute)
    ELSI
    • Fairness in usage – court, military,
    schools, adoption agencies
    • Confidentiality of genetic information
    • Reproductive decision-making
    • Clinical issues (regulation for accuracy,
    reliability, utility)
    • Conceptual and philosophical implications
    • Health and environmental issues (safety
    of GM foods)
    • Intellectual property rights
    The issue of patents
    • In general, raw products of nature are not patentable. DNA products usually
    become patentable when they have been isolated, purified, or modified to
    produce a unique form not found in nature.
    • "first to invent" principle: whoever made the invention first (and can prove
    it) is awarded property rights for the 20-year period
    • Celera initially filed for patents for 6,500 whole/partial genes
    • March 2000: Clinton announced genome sequence must be made available
    to everyone
    • Patents could impede the development of diagnostics and therapeutics by
    third parties because of the costs associated with using patented research
    data.
    • Researchers are rewarded for their discoveries and can use monies gained
    from patenting to further their research
    Polymerase Chain
    Reaction
    • a reaction that can characterize,
    analyze and synthesize any
    specific piece of DNA or RNA

    3 steps:
    1. Denaturation
    2. Hybridization or Annealing
    3. DNA synthesis
    PCR and HGP
    • A tiny amount of DNA can be
    amplified using the PCR to make
    sufficient quantities available for
    DNA sequencing analysis.
    • DNA sequencing requires isolating
    and duplicating the DNA segments
    for nucleotide analysis.
    2 Types of DNA
    Sequencing:

    1)chromosome
    walking
    Chromosome walking
    • used to move systematically along a
    chromosome from a known location
    • clones overlapping genomic clones that
    represent progressively longer parts of a
    particular chromosome
    • used to find adjacent genes, or parts of a
    gene which are missing in the original clone
    process
    *It is necessary to
    use DNA probes
    whose sequences
    are single-copy; if
    the probe used is a
    repeated sequence,
    several unrelated
    combinants could
    be identified.

    1) A small segment of DNA from one end of the genomic clone is used
    as a probe to isolate the clones containing this sequence, and
    adjacent sequences encoding the next portion of the gene.
    2) A restriction fragment isolated from the end of the positive clones
    is
    used to reprobe the genomic library for overlapping clones
    3) The end sequence of the second clone is used to isolate a third
    clone and so forth
    until a series of overlapping clones are isolated. This process is
    Shotgun Method
    • DNA is randomly divided into fragments either
    via sonication or narrow-gauge syringe
    • DNA fragment is loaded onto gel; Agarose with
    embedded DNA is isolated
    • Fragment is cloned and sequenced. (This
    process is done repetitively.)
    • Computer analyzes ‘reads’ and using
    overlapping sequences, puts these together.
    Strand Sequence

    Original AGCATGCTGCAGTCATGCTTA
    GGCTA
    First shotgun sequence AGCATGCTGCAGTCATGCT----
    ---
    -------------------TAGGCTA

    Second shotgun AGCATG--------------------


    sequence ------
    CTGCAGTCATGCTTAGGCTA

    Reconstruction AGCATGCTGCAGTCATGCTTA
    GGCTA
    Significance
    • Better understanding of life as a whole,
    especially the human being
    • Advances in medicine and biotechnology
    (as seen in detection of diseases via
    genetic tests)
    • New avenues in the study of evolution

    You might also like