Gts Qp File (Xii Neet 2023-24 Batch) - Final

VELAMMAL KNOWLEDGE PARK
PONNERI
T
(NEET MODEL - QP NO. 1 to 39)
QUESTION PAPER FILE 2023-24

(BATCH: NEET 2022-24)
*****
IIT/NEET – ACADEMY
XII- NEET GT - 1
Date : 12.12.2023 (NEET MODEL) Time : 3hrs
STD : XII -NEET CODE- A Max. Marks : 720
INSTRUCTIONS TO THE CANDIDATES
It is mandatory to use BALL POINT PEN to dark appropriate circle in the
answer sheet.
Marks should be dark and should completely fill the circle.
The question paper consists of three parts (Physics, Chemistry , Botany &
Zoology). Each part contains 45 questions.
Part – A (Physics) : Contains 45 Questions. Each question has four
choices (1), (2), (3) and (4) out of which ONLY ONE IS CORRECT.
Part – B (Chemistry) : Contains 45 Questions. Each question has four
choices (1), (2), (3) and (4) out of which ONLY ONE IS CORRECT
Part – C (Botany&Zoology) : Contains 90 Questions. Each question has four
Marking Scheme : For each question in every part you will be awarded
4 Marks if you darken the bubble corresponding to the correct and zero mark
if no bubbles are darkened, minus (–1) will be awarded for incorrect answer.
******** WISH YOU ALL THE BEST ********
SUBJECT PAPER SETTER

PHYSICS Mr.VENKAT
CHEMISTRY Dr.RB/Mr.PHANI
BOTANY Mr.RAMANA
ZOOLOGY Dr.S.BASHA
GT - 1 CODE- A XII _NEET MODEL-12.12.2023
PHYSICS
b  x2
1. The dimensions of a  b in the relation E = , where E is the energy, x is the
at
displacement and t is time are
1) ML2T 2) M 1 L2T 3) ML2T 2 4) MLT 2
2. Assertion (A) :- The gravitational force on a particle inside a spherical shell due
to outside praticals is zero.
Reason (R) :- Inside shell the gravitational potential is zero
1) Both (A) and (R) are correct but (R) is not the correct explanation of (A)
2) (A) is correct but (R) is not correct
3) (A) is incorrect but (R) is correct
4) Both (A) and (R) are correct but (R) is the correct explanation of (A)
3. A particle undergoes simple harmonic motion having time period T. The time
taken in 3/8th oscillation from mean position.
3 5 5 7
1) T 2) T 3) T 4) T
8 8 12 12
4. When current in a coil changes from 5 A to 2 A in 0.1 s, average voltage of 50 V
is produced. The self - inductance of the coil is :
1) 6 H 2) 0.67 H 3) 3 H 4) 1.67 H
5. The work function of aluminium is 4.2 eV. If two photons each of energy 3.5 eV
strike an electron of aluminium, then emission of electron will
1) Depend upon the density of the surface 2) Possible
3) Not possible 4) None of these
6. Two wires A and B of the same material, having radii in the ratio 1 : 2 and carry
currents in the ratio 4 : 1. The ratio of drift speed of electrons in A and B is
1) 16 : 1 2) 1 : 16 3) 1 : 4 4) 4 : 1
7. A bullet of mass 5 g, travelling with a speed of 210 m/s, strikes a fixed wooden
target. One half of its kinetics energy is converted into heat in the bullet while
the other half is converted into heat in the wood. The rise of temperature of the
bullet if the specific heat of its material is 0.030 cal/(g – ºC) (1 cal = 4.2 × 107
ergs) close to:
1) 87.5ºC 2) 75.5ºC 3) 119.2ºC 4) 38.4ºC
8. Assertion (A) :- Torque on a body can be zero even if there is a net force on it.
Reason (R) :- A rotating fan always need angular acceleration for its motion.
1) Both (A) and (R) are correct 2) (A) is correct but (R) is not correct
3) (A) is incorrect but (R) is correct 4) Both (A) and (R) are wrong
9. ABC is an equilateral triangle. Charges +q are placed
at each corner as shown in fig. The electric field
intensity at centre O will be
1 q 1 q
1) 2)
4 0 r 4 0 r 2
1 3q
3) 4) zero
4 0 r2
10. A metallic bar is heated from 0o C to 100o C . The coeficient of linear expansion is
105 K 1 . What will be the percentage increase in length?
1) 0.01% 2) 0.1% 3) 1% 4) 10%
11. A rough vertical board has an acceleration a along the horizontal so that a block
of mass M pressing against it does not fall. The
coefficient of friction between block and the board is
a g
1)  2) 
g a
a g
3)  4) 
g a
VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

12. Plates of area A are arranged as shown. The distance between each plate is d,
the net capacitance is
0 A 7 0 A
1) 2)
d d
6 0 A 5 0 A
3) 4)
d 3d
13. A plane wave of wavelength 6250 Å is incident normally on a slit of width

2 102 cm . The width of the principal maximum on a screen distant 50 cm will
be
1) 312.5 103 cm 2) 312.5 106 m 3) 312.5 103 m 4) 312.5 106 cm
14. The heat radiated per unit area in 1 hour by a furnace whose temperature is

3000K is   5.7 108 Wm2 K 4 
1) 1.7  1010 J 2) 1.7  1014 J 3) 1.7 104 J
4) 1.7  1020 J
2 1
15. Two isolated conducting spheres S1 and S2 of radius R and R have 12C
3 3
and -3C charges, respectively, are at a large distance from each other. They
are now connected by a conducting wire. A long time after this is done the
charges on S1 and S2 are respectively :
1) 4.5 C on both 2) +4.5 C and -4.5 C
3) 3 C and 6 C 4) 6 C and 3 C
16. A gun fires two bullets at 60º and 30º with horizontal. The bullets strike at some
horizontal distance. The ratio of maximum height for the two bullets is in the
ratio of
1) 2 : 1 2) 3 : 1 3) 4 : 1 4) 1 : 1
17. In the circuit shown in figure, match the following two columns. In Column II,
quantities are given in SI units
Column – I Column – II
a) Value of resistance R p) 60
b) Potential difference across capacitor q) 20
c) Potential difference across inductor r) 30
d) Applied potential difference s) None of the above
1) (a) → p (b) → q (c) → r (d) → s 2) (a) → q (b) → p (c) → r (d) → s
3) (a) → r (b) → q (c) → p (d) → s 4) (a) → s (b) → r (c) → q (d) → p
18. Electric field inside a copper wire of length 10 metres, resistance 2 ohm
connected to a 10 volt battery is
1) 1 Vm 1 2) 0.5 Vm1 3) 10 Vm 1 4) 5 Vm 1
19. A large number of liquid drops each of radius r coalesce to from a single drop of
radius R. The energy released in the process is converted into kinetic energy of
the big drop so formed. The speed of the big drop is (given, surface tension of
liquid T, density ())
T 1 1  2T  1 1  4T  1 1  6T  1 1 
1)    2)    3)  4) 
 r R  r R   r R    r R 
20. The path difference between the two waves :
 2 x   2 x 
y1  a1 sin   t   and y2  a2 sin   t     will be
     
2 2    2  
1)  2)    3)  4)   
   2 2   2

o
21. A prism ABC of angle 30 has its face AC silvered. A
ray of light incident at an angle of 45o at the face AB
retraces its path after refraction at face AB and
reflection at face AC. The refractive index of the
material of the prism is
3
1) 1.5 2)
2
4
3) 2 4)
3
22. A body of mass 10 kg and velocity 10 m/s collides with a stationary body of
mass 5 kg. After collision both bodies stick to each other, velocity of the bodies
after collision will be
3 18 9 20
1) m/s 2) m/s 3) m/s 4) m/s
10 3 20 3
23. Two particles of mass m1 and m2 (m1 > m2) attract each other with a force
inversely proportional to the square of the distance between them. If the
particles are initially held at rest and then released, the centre of mass will
1) move towards m1 2) move towards m2
3) remain at rest 4) Nothing can be said
24. The r.m.s. velocity of oxygen molecule at 16ºC is 474 m/sec. The r.m.s. velocity
in m/s of hydrogen molecule at 127ºC nearly
1) 160 2) 18 3) 2230 4) 27390
25. The oscillating electric and magnetic field vectors of electromagnetic wave are
oriented along
1) the same direction and in phase
2) the same direction but have a phase difference of 90º
3) mutually perpendicular directions and are in same phase
4) mutually perpendicular directions but has a phase difference of 90º
26. A half-wave rectifier is used to convert ‘n’ Hz ac into dc, then the number of
pulses per sec present in the rectified voltage is
n
1) n 2) 3) 2n 4) 4n
2
27. A uniform rod of mass m, length l , area of crosssection A has Young’s modulus
Y. If it is hanged vertically, elongation under its own weight will be
mgl 2mgl mgl mgY
1) 2) 3) 4)
2 AY AY AY Al
28. If two soap bubbles of different radii are connected by a tube. Then
1) air flows from the smaller bubble to the bigger bubble
2) air flows from bigger bubble to the smaller bubble till the sizes are
interchanged
3) air flows from the bigger bubble to the smaller bubble till the sizes become
equal
4) there is no flow of air
29. The position of final image formed by the given lens combination from the third
lens will be at a distance? If f1 = +10 cm, f2 = -10 cm, f3 = +30 cm.
1) 15 cm 2) infinity 3) 45 cm 4) 30 cm
30. For the velocity time graph shown in the figure below the distance covered by
the body in the last two seconds of its motion is
what fraction of the total distance travelled by it
in all the seven seconds?
1 1
1) 2)
2 4
2 1
3) 4)
3 3

31. A 25 cm long solenoid has radius 2 cm and 500 total number of turns. It carries
a current of 15 A. If it is equivalent to a magnet of the same size and its
magnetization (H) is :
1) 30000 πAm1 2) 3 πAm1 3) 30000 Am 1 4) 300 Am1
32. A stone is thrown with a velocity u making an angle  with the horizontal. The
horizontal distance covered by its fall to ground is maximum when the angle  is
equal to
1) 0º 2) 30º 3) 45º 4) 90º
33. The figure shows the path of a positively charged particle 1 through a
rectangular region of uniform electric field as shown in the figure. What is the
direction of electric field and the direction of particles 2, 3 and 4 ?
1) Top, down, top, down 2) Top, down, down, top

3) Down, top, top, down 4) Down, top, down, down
34. A circular disc A of radius r is made from an iron plate of thickness t and
another circular disc B of radius 4r is made from an iron plate of thickness t/4.
The relation between the moments of inertia IA and IB is
1) IA > IB 2) IA = IB
3) IA < IB 4) depends on the actual value of t and r
35. The threshold frequency for a photosensitive metal is 3.3 1014 Hz . If light of
frequency 8.2 1014 Hz is incident on this metal, the cut-off voltage for the
photoelectric emission is nearly.
1) 2V 2) 3V 3) 5V 4) 1V
36. A light ray falls on a rectangular class slab as shown. The
index of refraction of the glass, if total internal reflection is to
occur at the vertical face, is
1) 3/ 2 2)
 3 1
2
3)
 2 1  4) 5 / 2
2
37. During an adiabatic compression, 830J of work is done on 2 moles of a diatomic
ideal gas to reduce its volume by 50%. The change in its temperature is nearly :
R = 8.3 JK 1mol1 
1) 40K 2) 33K 3) 20K 4) 14K
38. When the rms voltages VL, VC and VR are measured respectively across the
inductor L, the capacitor C and the resistor R in a series LCR circuit connected
to an AC source, it is found that the ratio VL : VC : VR = 1 : 2 : 3. If the rms
voltage of the AC sources is 100 V, the VR is close to:
1) 50 V 2) 70 V 3) 90 V 4) 100 V

39. The gravitational field in a region is given by g  5 N iˆ  12 N ˆj . The change
kg kg
in the gravitational potential energy of a particle of mass 1 kg when it is taken
from the origin to a point (7m, -3m) is :
1) 71J 2) 13 58J 3) -71J 4) 1J
40. A galvanometer coil has a resistance of 15 and gives full scale deflection for a
current of 4 mA. To convert it to an ammeter of range 0 to 6 A
1) 10 m resistance is to be connected in parallel to the galvanometer
2) 10 m resistance is to be connected in series with the galvanometer
3) 0.1  resistance is to be connected in parallel to the galvanometer
4) 0.1 resistance is to be connected in series with the galvanometer

41. A block of mass m is kept on a platform which starts from rest with constant
acceleration g/2 upward, as shown in fig. work done by normal reaction on
block in time t is:
mg 2 t 2 mg 2t 2
1)  2)
8 8
3mg 2t 2
3) 0 4)
8
42. A uniform thin rope of length 12 m and mass 6 kg hangs vertically from a rigid
support and a block of mass 2 kg is attached to its free end. A transverse short
wave-train of wavelength 6 cm is produced at the lower end of the rope. What is
the wavelength of the wavetrain (in cm) when it reaches the top of the rope?
1) 3 2) 6 3) 12 4) 9
43. A sonometer wire resonates with a given tuning fork forming standing waves
with five antinodes between the two bridges when a mass of 9kg is suspended
from the wire. When this mass is replaced by a mass M, the wire resonates
with the same tuning fork forming three antinoides for the same positions of the
bridges. The value of M is
1) 25 kg 2) 5 kg 3) 12.5 kg 4) 1/25 kg
44. An incompressible liquid flows through a horizontal tube as shown in the figure.
Then, the velocity 'v' is :
1) 6 m/s 2) 3 m/s 3) 2 m/s 4) 1 m/s

45. Ratio of the wavelengths of first line of Lyman series and first line of Balmer
series is
1) 1 : 3 2) 27 : 5 3) 5 : 27 4) 4 : 9
CHEMISTRY
46. Incorrect match among the following is :
List – I (Name according to IUPAC) List – II (IUPAC symbol)
1) Unnilpentium Db
2) Unniltrium Nh
3) Ununpentium Mc
4) Ununseptium Ts
47. For a reaction, the graph drawn between conc. of product (x) on y-axis and time
on x-axis gives a straight line with +ve slope and passing through origin. Slope
of the straight line is 0.02 mol.lit 1.min 1 . If initial concentration of the reactant is
1.6 mol/lit then half life of the reaction is _________ minutes.
1) 34.65 2) 40 3) 31.25 4) 71.97
48. Among the following species, identify the isostructural pairs,
 
NF3 , NO3 , BF3 , H 3O , NH 3
1)  NF3 , NO3  and  BF3 , H 3O  2)  NF3 , NH 3  and  NO3 , BF3 
3)  NF3 , BF3  and  NO3 , BF3  4)  NF3 , H 3O   and  NH3 , BF3 
49. Among the following statements.
A) Number of electrons present in Mn2 ion with magnetic quantum number, m
= 0 is 11.
B) The radius of 2nd orbit of Be3 ion is same as that of first orbit of H-atom.
C) In H-spectrum, from Lyman series to Pfund series, wavelength of spectral
lines increases.
1) All A, B and C are correct 2) Only A and B are correct
3) Only A and C are correct 4) Only B and C are correct

50. N2 and O2 are converted into monocations N 2 and O2 respectively. Which of

the follwong statements is wrong?

1) In N2 , N  N bond weakens 2) In O2 , O  O bond order increases
3) In O2 , paramagnetism decreases 4) N 2 becomes diamagnetic
Assertion (A): Both  NiCl4  and  Ni  CO  4  are paramagnetic in nature.
2
51.
Reason (R) : In both  NiCl4  and  Ni  CO  4  the central metal ion/atom under
2
goes sp3 hybridisation.

1) Both assertion and reason are correct, and reason is the correct explanation
of the assertion
2) Both assertion and reason are correct, but reason is not the correct
explanation of the assertion
3) Assertion is correct, but reason is wrong
4) Assertion is wrong, but reason is correct
52. The tendency of BF3, BCl3 and BBr3 to behave as Lewis acid decreases in the
sequence.
1) BCl3>BF3>BBr3 2) BBr3>BCl3>BF3 3) BBr3>BF3>BCl3 4) BF3>BCl3>BBr3
53. Which of the following shows lower vapour pressure?
1) 1.8 molal aq. sucrose 2) 1.2 molal aq. KCl
3) 1.0 molal aq. AlCl3 4) 0.8 molal aq. BaCl2
54. Which of the following organic compounds will give blood red colour when ferric
chloride solution is added to the Lassaigne’s extract?
1) Urea 2) Aniline 3) Thiourea 4) 2-Mercaptoethanol
55. For a given reaction, the H and S are +330 kJ and 126 J.mol1.k 1 respectively.
Then the reaction is spontaneous at _________K.
1) 2619 2) 2732 3) 2526 4) 2289
56. Arrange the following in increasing order of stability.
H H H CH3
. . . .
(I) (II) (III) (IV)
1) III<I<IV<II 2) II<IV<I<III 3) II<I<IV<III 4) I<IV<II<III

57. Which of the following contains more number of hydrogen atoms?
1) 0.1g mol of sucrose 2) 0.2g mol of methane
3) 0.4g mol of water 4) 0.3g mol of ethane
58. The correct IUPAC name for the compound
is
1) 4-ethyl-3-propylhex-1-ene 2) 3-ethyl-4-ethenylheptane
3) 3-ethyl-4-propylhex-5-ene 4) 3-(1-ethylpropyl)hex-1-ene
59. 5 amp current is passed through aqueous CuSO4 solution using copper
electrodes for 60 minutes. Then at anode.
1) 0.502 lit of O2 is liberated at STP
2) 1.044 lit of O2 liberates at STP
3) 0.0932 g.mol of copper dissolves into electrolyte
4) 2.089 lit of H2 liberates at STP

60. In a set of reactions, ethylbenzene yielded a product D. D would be
61. 90% of a given reaction is completed in 26 minutes and 99% of same reaction is
completed in 52 minutes. Then the order of the reaction is _________
1) 1 2) 0 3) 2 4) 3
62. Which of the folliowng is more reactive towards HCl?
1) HC  CH 2) CH2 = CH2 3) CH3 – C  CH 4) CH3 – CH = CH2
63. In basic medium KMnO4 oxidises KI as KIO3. Then the number of moles of KI
oxidised by 0.8 mole of KMnO4 in basic medium is
1) 1.6 2) 0.8 3) 0.4 4) 2.0
64. An unknown alkyl halide (A) reacts with alcoholic KOH to produce C4H8 which
on reductive ozonolysis gives one mole of propanone and one mole of
formaldehyde. The structure of A is
CH 3
CH 3  CH  CH  CH 3
1) CH 3  C  CH 3 2)
Br Br
Br
CH 3  CH 2  CH  CH 3
3) 4) BrCH2  CH2  CH2  CH2 Br
Br
65. Assertion (A): Mn3 is good oxidizing agent while Cr 2 is good reducing agent
even though both possess d 4 configuration.
Reason (R) : Mn2 is stable due to stable 3d 5 half filled configuration while Cr 3
is stable due to stable t2g half filled configuration.
of the assertion
3) Assertion is correct, but reason is false
4) Both assertion and reason are false
66. The order of reactivity of the following alcohols with halogen acids is
1) (I)>(II)>(III) 2) (III)>(II)>(I) 3) (II)>(I)>(III) 4) (I)>(III)>(II)

67. The Ksp values of two salts AB and XY2 are 4 10 and 4 1012 respectively.
12
Then
1) Both AB and XY2 are equally soluble in water
2) XY2 is more soluble in water than AB
3) AB is more soluble in water than XY2
4) Solubilities of AB and XY2 cannot be compared
68. Decreasing order of boiling points among ethanol, butna-1-ol btuan-2-ol and
methanol is
1) methanol > ethanol > butan-2-ol > butan-1-ol
2) butan-2-ol > butan-1-ol > ethanol > methanol
3) ethanol > methanol > butan-1-ol > butan-2-ol
4) butan-1-ol > butan-2-ol > ethanol > methanol

o
69. The emf of following Galvanic cell at 25 C is ______volt.
Mg  s  Mg 2  0.01M  Cl   0.01M  Cl2  g ,1 atm  , Pt
Given : oMg 2 / Mg  2.36V , Cl
o
  1.36V
2 / Cl
1) 3.72 2) 3.78 3) 3.54 4) 3.90

70. Which one of the following is correct decreasing order of acidity?
1) Water > Alcohol > Phenol > Acetic acid
2) Acetic acid > Phenol > o-Nitrophenol > Alcohol
3) Chloroacetic acid > Phenol > Water > Alcohol > 1-Alkyne
4) p-Nitrophenol > Chloroacetic acid > Water > 1-alkyne
71. In which of the following the oxidation state of underlined atom is given wrong?
1) CrO5   6 2) H NO4  5 3) H 2 SO5 
 8 4) K O2  1/ 2
O O
72. on aldol condensation followed by heating gives
CH3
O
(major product).
O O O O
1) 2) 3) 4)
O O O
73. For a hypothetical reaction, O
2 A  s   3B  g  
 4C  g   26 Kcal
Formation of ‘C’ is favoured by
1) High T & High P 2) Low T & Low P 3) Low T & High P 4) High T & Low P
74. End product of the following sequence of reactions is
CO2 / H 3O  H
CH  CH 
CH 3 MgBr
   
HgSO4 / H 2 SO4
 
Ag 2 O

 
75. Which of the following is used as peptizing agent in the conversion of freshly
precipitated Fe(OH)3 as colloidal solution?
1) Na2SO4 2) CaCl2 3) H2S 4) FeCl3
76. Two isomeric compounds A and B have the formula C3H6Cl2. With aq. KOH
solution A gives propional-dehyde and B gives acetone. Then A and B are
1) CH3 – CCl2 – CH3 and CH3 – CH2 – CHCl2
2) CH3 – CHCl – CHCl2 and CH3 – CH2 – CHCl2
3) CH3 – CH2 – CHCl2 and CH3 – CCl2 – CH3
4) CH3 – CHCl – CHCl2 and CH3 – CCl2 – CH3
77. If an -particle and proton are accelerated by same potential, then their
wavelengths ratio respectively is _______
1) 2 : 1 2) 1 : 2 3) 1: 2 4) 1: 2 2
78. Which of the following statements about primary amines is false?
1) Alkyl amines are stronger bases than aryl amines
2) Alkyl amines react with nitrous acid to produce alcohols
3) Aryl amines react with nitrous acid to produce phenols directly
4) Methyl amines are stronger bases than ammonia
79. [Co(en)2Cl2]Br can show
1) Geometrical isomerism 2) Optical isomerism
3) Ionisation isomerism 4) All the above

80. What form of glutamic acid would you expect to predominate in a strongly basic
solution?

H 3 N  CH  COOH H 2 N  CH  COO 
1) 2)
CH 2CH 2COOH CH 2CH 2COO 

H 3 N  CH  COO 
3) 4) All of these
CH 2CH 2COOH
81. The freezing point of aq.solution of urea is 4.464o C . Considering 80%
dissociation, the freezing point of same molal BaCl2 aqueous solution is _______
o
C.
[Given : F.P. of H 2O  0o C & Kf of H 2O  1.86 K.mol1.Kg ]
1) -13.392 2) -11.6 3) -8.035 4) -9.685
82. In the given conformation C2 is rotated about C2 – C3 bond anticlockwise by an
angle of 120o then the conformation obtained is
1) fully eclipsed conformation 2) partially eclipsed conformation

3) Gauche conformation 4) staggered conformation
83. The heats of combustion of carbon and carbon monoxide are -94.0 and
-67.3 k.cal/mol respectively. Then the heat of formation of carbon monoxide is
_____ k.cal/mol.
1) -161.3 2) +161.3 3) -26.7 4) +67.3
84. Wrong statement among the following is
1) PbF4 exist, where as PbI4 does not exist
2) SiF62 exist, where as SiCl62 does not exist
3) CCl4 and SnF4 are mainly covalent molecules
2
4) In GeCl6  and  Sn  OH 6  hybridization of central atom is sp3d 2
2
85. 100 ml 0.4M CH3COOH is treated with 100 ml 0.1M NaOH. The the pH of
resulting solution is ______. (Given pKa of CH3COOH = 4.78)
1) 2.129 2) 2.652 3) 4.303 4) 5.257
86. Number of stereo isomers possible for 2,3-dibromo-4-chloropentane are
1) 8 2) 7 3) 6 4) 5
87. In which of the following, the CO bond length is relatively low?
1) [Ni(CO)4] 2) [Fe(CO)5] 3) [Cr(CO)6] 4) Same in all complexes
A) 15th gorup elements have lower –ve electron gain enthalpy values when
compared to 16th gorup elements of a given period.
B) From H2O to H2Po, reducing capability increases as thermal stability
decreases.
C) From HF to HI, pKa increases.
89. To the given salt solution, sufficient amount of NH4Cl is added and then NH4OH
is added. Then which of the following cation, if present in given salt solution
will be precipitated as metal hydroxide?
1) Cu 2 2) Al 3 3) Zn 2 4) Mg 2
90. To the given salt conc.H2SO4 is added, no specific gas is liberated. But upon
heating reddish brown gas is liberated. Then the salt contains ________ anion.
1) Br  2) I  3) NO3 4) SO42

BIOLOGY
91. Dikaryotic phase in Ascomycetes and Basidiomycetes represents ______ and
_____ respectively.
1) Diploid, Diploid 2) Haploid, Haploid
3) Haploid, Diploid 4) Diploid, Haploid
92. Read the given statements that describe certain infectious particle.
a) It was discovered by T.O. Diener and was found to be smaller than viruses.
b) It causes potato spindle tuber disease.
c) It is a free RNA particle which lacks the protein coat.
d) It has low molecular weight and RNA as genetic material.
The above statements refers to_________
1) Virus 2) Viroid 3) Prion 4) Bacteria
93. Read the following statements.
a) Microsporophylls and megasporophylls are formed on same plant in Pinus.
b) Microsporophylls and megasporophylls are formed on different plants in
cycas.
c) The female gametophyte is haploid in Gymnosperms.
d) Sporophyte depends on gametophyte in cycas.
1) Both ‘a’ and ‘b’ are false statements 2) Both ‘c’ and ‘d’ are fasle statements
3) All are true statements 4) Only a, b, c are true statements
94. Match following lists.
List – I List – II
A) Lycopsida I) Adiantum
B) Psilopsida II) Equisetum
C) Sphenopsida III) Psilotum
D) Pteropsida IV) Lycopodium
Codes :
A B C D A B C D
1) IV II III I 2) IV III I II
3) IV III II I 4) III I II IV
95. A twig of pisum sativum has 10 flowers. The total number of stamens in all
flowers is ________
1) 90 2) 10 3) 100 4) 80
96. Match the following :
A) Pappus I) Tissues that forms new cells
B) Meristem II) Whorl of bracts around the inflorescence
C) Bracteole III) Persistant calyx of Asteraceae
D) Involucre IV) Leaf like structure that forms a flower in
its axil
V) Structure on the pedicel of flower
Codes :
A B C D A B C D
1) II I III IV 2) III I V II
3) III V I IV 4) I II III V
97. Select the incorrect pair out of the following :
1) Monadelphous - Hibiscus
2) Diadelphous - Cucurbita
3) Polyadelphous - Citrus
4) Syngenesious - Helianthus
98. Identify correct match.
Vacular bundle Plant
1) Open - Root of maize
2) Conjoint - Stem of sunflower
3) Radial - Stem of maize
4) Closed - Root of sunflower

99. Which of the following statements is wrong with respect to stomatal apparatus
of grass Leaves?
1) Guard cells regulate the stomatal movements
2) Guard cells are dumb bell shaped
3) Few epidermal cells become subsidiary cells
4) The outer walls of guard cells (away form stoma) are thick and inner walls
(towards the stoma) are thin
100. Which of the following statements is incorrect for centrioles?
1) Both the centrioles in a centrosome lie perpendicular to each other
2) Central proteinaceous hub is missing in a centriole
3) Each centriole has an organisation lke that of a cartwheel
4) Centrosome usually contains two cylindrical centrioles
101. Read the given statements.
a) Flat membranous sacs in stroma of chloroplasts
b) In folding in mitochondria.
c) Disc shaped sacs in Golgi apparatus
Select the correct option as per the codes given above.
Cristae Cisternae Thylakoids
1) c a b
2) a b c
3) b c a
4) c b a
102. Mitotic anaphase differs from metaphase, so Anaphase possess.
1) Same number of chromosomes and half the number of chromatids
2) Half the number of chromosomes and same number of chromatids
3) Double the number of chromosomes and same number of chromatids
4) Same number of chromosomes and same number of chromatids
103. Assertion : DNA synthesis occurs in G1 an G2 periods of cell cycle.
Reason : During G1 and G2 phase the DNA contents become double.
1) Both (A) and (R) are true and (R) is the correct explanation of (A)
2) Both (A) and (R) are true and (R) is not the correct explanation of (A)
3) (A) is true, but (R) is false
4) Both (A) and (R) are false
104. Assertion : The primary acceptor of CO2 in C3 cycle is five carbon compound.
Reason : First carboxylation product in calvin cycle is a C4 acid.
105. In the light reaction, the light energy is absorbed by pigments present in the
_____ and finally funneled to _______
1) Reaction centre and reaction centre 2) Antenna and chlorophyll b
3) Antenna complex and reaction centre 4) PSII to PSI in ‘Z’ scheme
106. Select the incorrect statement from the following.
1) In all living organisms oxidative decarboxytion of pyruvic acid occurs in
mitochondrial matrix
2) Carbon dioxide is released during Krebs cycle
3) Substrate level phosphorylation also occurs during Krebs cycle
4) Krebs cycle serves as a common oxidative pathway for carbohydrates, fats
and proteins
a) Yeasts poison themselves to death when the concentration of alcohol reaches
to about 13 percent
b) Ubiquinone also receives reducing equivalents via FADH2 (complex II) that is
generated during oxidation of succinate in the citric acid cycle
c) Oxidation of one molecule of NADH gives rise to three molecules of ATP
d) Complex IV refers to cytochrome ‘c’ oxidase complex containing cytochromes
a and a3 and two copper centers
1) Only a, b are true statements 2) Only b, c are true statements
3) Only a, b, d are true statements 4) All are true statements

108. Initially the length of two tendrils A and B of a plant are 4 cm and 8 cm
respectively. After one day they become 6 cm and 10 cm respectively.
Which of the following statements about their growth rates should be true?
1) Absolute growth rate of ‘B’ is less than that of A
2) Relative growth rate of both ‘A’ and ‘B’ are same
3) Absolute growth rate of ‘A’ is less than that of ‘B’
4) Relative growth rate of ‘A’ is more than that of ‘B’
109. Which hormone is used to induce parthenocarpy in tomatoes?
1) Cytokinins 2) Gibberellins 3) Auxins 4) Ethylene
110. State True(T) or False(F) and select the correct option.
A : To determine the genotype of a tall plant, Mendel conducted test cross.
B : In tests cross, an organism showing a dominant phenotype is crossed with
the recessive parent.
A B
1) F T
2) F F
3) T T
4) T F
111. Find the incorrect match w.r.t. pea plant.
Character Dominant Recessive
1) Stem height Tall Dwarf
2) Flower position Terminal Axial
3) Flower colour Violet White
4) Pod shape Inflated Constricted
112. There are three genes a, b, c percentage of crossing over between ‘a’ and ‘b’ is
20%, ‘b’ and ‘c’ is 28% and ‘a’ and ‘c’ is 8%. What is sequence of genes on
chromosome?
1) b, a, c 2) a, b, c 3) a, c, b 4) c, b, a
113. Assertion : Incomplete dominance is a deviation from law of dominance.
Reason : In incomplete dominance, F1 generation did not resemble either of the
two parents and was in between the two.
114. Which RNA brings the aminoacids and reads Genetic code?
1) mRNA 2) tRNA 3) rRNA 4) snRNA
115. If the sequence of the coding strand in transcription unit is
51ACGACGTGGAC31. What will be the sequence of RNA transcribed?
1) 51ACGACGTGGAG31 2) 51ACGACGUGGAC31
3) 51UGCUGCACCUG31 4) 51UGCUGCACCTG51
116. The first codon to be present in all eukaryotic organisms and the ‘amino acid’ it
codes for it respectively are
1) AUG, methionine 2) GGG, alanine
3) UUU, phenylalanine 4) GGG, Glycine
117. Read the following statements and choose correct option.
a) rRNA provides template for protein synthesis and possess codons.
b) Unwinding of DNA double helix during transcription is done by RNA
polymerase.
c) UTRs are required for efficient translation process.
1) Only a, b are correct 2) Only b, c are correct
3) Statements a and c are incorrect 4) Statements a, b and c are correct
118. In E.coli, rho-factor is required for
1) Initiation of transcription at specific site
2) Initiation of transcription at many sites
3) Termination of transcription at specific site
4) Termination of translation at many sites
119. Which of the following is used as best genetic vector in plants?
1) Bacillus thuriengenesis 2) Agrobacterium tumifaciens
3) E.coli 4) Bacteriophage
120. Which of the following is not required in PCR?
1) DNA primer 2) DNA template 3) RNA primer 4) Taq polymerase

A) Asexual reproduction preserves the genetic information, while sexual
reproduction permits variation.
B) Traditional hybridization procedure used in plants leads to multiplication of
undesirable genes along with desired genes.
C) The technique of genetic engineering helps to introduce desirable genes
without introducing undesirable genes into target organisms.
Choose the correct option.
1) Only A and B are correct 2) Only B and C are correct
3) Statements A and C are incorrect 4) Statemetns A, B and C are correct
122. Choose the correct option w.r.t. Agarose gel electrophoresis.
A) This technique is used to separate DNA fragments.
B) Most widely used matrix is agarose which is a natural polymer extracted
from sea weeds.
C) The seperated bands of DNA are cut out from the agarose gel and extracted
from the gel piece. This step is known as elution.
D) The stained DNA fragments are visible after exposure to X-rays.
1) Only C and D are true 2) Only A and B are true
3) Oly D is false 4) Only A and C are true
123. Statement –I : If both male and female flowers are present on the same plant
such as castor and maize (monoecious), it prevents autogamy but not
geitonogamy.
Statement –II : In several species such as papaya, male and female flowers are
present on different plants, this condition prevents both autogamy and
geitonogamy.
1) Both statements I & II are correct
2) Statement I is correct while statement II is incorrect
3) Statement II is correct while statement I is incorrect
4) Both statements I & II are incorrect
124. Apomixis is observed in ______ and ______ respectively.
1) Citrus and Mango 2) Grasses and Fabaceae
3) Asteraceae and Grasses 4) Fabaceae and solanacese
125. Primary endosperm nucleus (PEN) is formed by the fusion of
1) 2 polar nuclei + 1 synergid cell 2) 1 polar nucleus + 1 antipodal
3) 2 polar nuclei + 1 male gamete
4) 2 antipodal cell nuclei + 1 male gamete nucleus
126. Identify true statement from the following :
1) All solids that settle down in primary treatment are called as activated sludge
2) Wine and beer are produced without distillation of the fermented broth
3) Antigens are used to treate deadly diseases like leprosy and diphtheria
4) Baculoviruses are symbiotic organism used to attack insects and arthropods
127. Read following statements w.r.t. Anemophilous flowers.
a) The pollengrains are light and non-sticky.
b) They possess well exposed stamens.
c) Contains feathery stigma.
d) Flowers contain single ovule in ovary and numerous flowers packed into
inflorescence.
1) Only statements ‘a’ and ‘b’ are correct 2) Only statements ‘c’ and ‘d’ correct
3) All statements are correct 4) Only statements a, b, c are
incorrect
128. Cyclosporin A and is used for
1) removal of blood clots 2) lowering of blood cholesterol level
3) immune suppression 4) lowering blood sugar level
129. Observe the following diagram related to genotype of Drosophila. What is the
phenotype of the organism?
1) It is female with yellow body and red eyes

2) It is female with yellow body and white eyes
3) It is male with yellow body and red eyes
4) It is male with brown body and red eyes

130. Pickup the incorrect statement.
1) In diatoms, the cellwalls form two thin overlapping shells, which fit together
as in a soap box
2) Fungi show a great diversity in morphology and habitat
3) Claviceps is used extensively in biochemical and genetic work
4) Mycoplasma is the smallest living cell that can survive without oxygen
131. The bonds representing the labels ‘A’ and ‘B’ respectively are
1) hydrogen bond; peptide bond 2) glycosidic bond; peptide bond

3) hydrogen bond; N-glycosidic bond 4) hydrogen bond; hydrogen bond
132. Choose the incorrect match with respect to photosynthesis.
1) Thylakoids of chloroplast – light reaction of photosynthesis
2) Reaction center of photosystemI – P680
3) Cornelius Van Niel – experiments on purple and green bacteria
4) Chlorophyll b – component of light harvesting complex of photosystems
133. What is the ratio between the number of CO2 invovled, ATP needed and NADPH
required, respectively, for successful completion of six turns of calvin cycle?
1) 1 : 2 : 3 2) 1 : 3 : 2 3) 2 : 3 : 1 4) 3 : 1 : 2
134. The reactions of Kreb’s cycle takes palce
1) In cytoplasm 2) In endoplamic reticulum
3) In matrix of mitochondria 4) On the surface of mitochondria
135. Which of the following plants doesnot show plasticity?
1) Coriander 2) Buttercup 3) Maize 4) Cotton
136. Read the following and pick correct statements.
I) All skeletal muscles are voluntary, but all voluntary muscles are not skeletal.
II) All involuntary muscles are visceral muscles but all visceral muscles are not
involuntary
III) All cardiac muscles are involuntary, but all involuntary muscles are not
cardiac.
1) I, II incorrect, III – correct 2) I, III are correct, II- incorrect
3) III –incorrect, I, II are correct 4) I, III are incorrect, II - correct
137. The enlarged end of penis called the glans penis is covered by a loose fold of
skin called _____
1) Prostate 2) Fimbriae 3) Urethral meatus 4) Foreskin
138. Corpus luteum helps in
1) Maintenance of the endometrium 2) Implantation of fertilized ovum
3) Maintenance of pregnancy 4) All the above
139. Which cells in the embryo differentiates into ecto, endo and mesoderm?
1) Trophoblast cells 2) Inner cell mass
3) Blastomeres 4) Cells of corona radiata
140. Statement-I: If a host fish species become extinct, its unique assemblage of
parasites also meets the same fate.
Statement-II: In a co-evolved plant-pollinator mutualism extinction of one
invariably leads to the extinction of the other.
1) Both Statement I and II are correct
2) Statement I is correct statement II is incorrect
3) Statement I is incorrect and statement II is correct
4) Both statement I and II are incorrect

141. Nearly ______% of O2 is transported in soluble form and ____% of CO2 is
transported in carbamino - haemoglobin form in the blood.
1) 20 - 25, 7 2) 3, 20 – 25 3) 7, 20 - 25 4) 20 - 25, 3
142. What is the partial pressure of O2 in blood transported by pulmonary vein?
1) 159 mm Hg 2) 104 mm Hg 3) 40 mm Hg 4) 95 mm Hg
143. Which is not involved in inspiration mechanism? (normal condition)
1) Diaphragm 2) External intercostal muscles
3) Internal intercostal muscles 4) Both 1 & 2
144. Which of the following is/are usually used along with barriers to increase their
contraceptive efficiency?
1) Spermicidal creams 2) Spermicidal jellies
3) Spermicidal foams 4) All the above
145. Match column I with column II and choose the correct option.
Column – I Column - II
(A) Multiload 375 (I) Oral pill
(B) Lippes loop (II) Hormonal IUD
(C) LNG - 20 (III) Copper releasing IUD
(D) Saheli (IV) Non-medicated IUD
1) A - III, B - IV, C - II, D - I 2) A - III, B - I, C - IV, D - II
3) A - III, B - II, C - IV, D - I 4) A - IV, B - II, C - I, D - III
146. Identify the incorrect statement.
1) One of the best methods for infertile couples looking for parenthood is legal
adoption of orphan
2) In artificial insemination the semen collected from the husband is artificially
introduced into fallopian tubes
3) Inability to conceive even after 2 years of unprotected sexual cohabitation is
infertility
4) Invitro fertilisation + embryo transfer = test tube baby
(A) GFR (I) 1/5th of cardiac output
(B) Blood filtration by kidneys (II) 1200 mOsmolL-1
per min
(C) Concentration gradient of (III) 1 to 1.5 litres per day
medullary interstitium
(D) Urination per day (IV) 25 - 30 gm
(V) 180 litres per day
.
1) A - V, B - I, C - II, D - IV 2) A - IV, B - II, C - III, D - I

3) A - V, B - I, C - II, D - III 4) A - III, B - V, C - IV, D – II
148. Find out the correct group of ureotelic animals from the following.
1) Bony fishes, land snails and birds 2) Reptiles, birds and mammals
3) Mammals, marine fishes and terrestrial amphibians
4) Aquatic amphibians, insects and bony fishes
149. Which of the following hormones are produced by neurosecretory cells of
hypothalamus?
1) Somatostatin and gonadotrophin 2) GnRH and oxytocin
3) Vasopressin and prolactin 4) TSH and ACTH
150. Thymosins help in
1) Promoting antibodies production 2) Differentiation of T-lymphocytes
3) Decreasing the production of RBCs 4) Both 1 and 2
151. PTH, insulin and glucagon hormones are similar in their
1) Chemical nature 2) Production site
3) Function 4) Target tissues or organs
152. The disease that spreads by the sputum of an infected person.
1) Amoebiosis 2) Malaria 3) Pneumonia 4) Filariasis

153. Match the following w.r.t type of sex determination with its example.
(A) XX - XO (I) Drosophila
(B) XX - XY (II) Grasshopper
(C) ZW - ZZ (III) Birds
1) A - II, B - I, C - III 2) A - III, B - I, C - II
3) A - I, B - II, C - III 4) A - I, B - III, C - II `
154. Which among the following belong to acquired immunity?
i) Non-specific defence ii) Pathogen specific
iii) Characterised by memory iv) Anamnestic response
1) i, ii, iii 2) i, iii, iv 3) ii, iii, iv 4) i, iv
155. Statement I: RNA of HIV replicates to form viral DNA within the cytoplasm of
infected macrophage.
Statement II: HIV can enter into TH cells, replicate and produce progeny
viruses.
156. Choose the incorrect matching pair.
1) Cannabinoids - effect on cardiovascular system
2) Coca alkaloid - has potent stimulating action on CNS
3) Coke and crack - slow down body functions
4) Cocaine - produce a sense of euphoria
157. In India, ecologically unique and biodiversity rich regions are legally protected
as
1) Biosphere reserves 2) National parks
3) Wildlife sanctuaries 4) All of these
158. Read the following statements. Pick correct option.
A) Human blood does not include the enzymes proteases and nucleases
B) The precursor of pro-vitamin A, called beta-carotene is present in golden rice
C) Cry proteins are toxins
D) ADA is important for the normal functioning of immune system.
1) A, B, C, D are correct 2) AB only correct
3) C, D only correct 4) A, B, C, D are incorrect
A. Scapula is located between the second and seventh ribs in the ventral part of
thorax.
B. Trachea bifurcates at the level of 12th vertebra.
C) Kidneys are situated between the levels of 12th thorascic vertebrae and 22nd
vertebra
Pick the correct option.
1) A, B, C are correct 2) A, B, C incorrect
3) A incorrect, B, C correct 4) A, B correct, C incorrect
160. In cockroach, the hardened plates called sclerites that are joined to each other
by
1) Pronotum 2) Tentorium 3) Chitin 4) Arthrodial membrane
161. An inverted pyramid of biomass is expected for
1) Tropical rain forest 2) Grassland
3) Desert 4) Open ocean
162. Lungs are respiratory structures in
1) Hyla 2) Pristis 3) Lamprey 4) Balanoglossus
163. Select the incorrect match.
1) Obelia : sea fan 2) Pennatula : sea pen
3) Sepia : cuttle fish 4) Ancylostoma : hook worm
164. Mesoglea is present in
1) Scypha 2) Physalia 3) Echinus 4) Salpa
165. Which type of symmetry is observed in adult Antedon?
1) Asymmetry 2) Radial symmetry
3) Bilateral symmetry 4) Biradial symmetry

166. The opening between the right atrium and the right ventricle is guarded by
1) Tricuspid valve 2) Bicuspid valve
3) Mitral valve 4) Semilunar valve
167. The effect of parasympathetic neural signals on the heart
1) Increases the rate of heart beat 2) Increases ventricular contraction
3) Decreases the rate of heart beat 4) Increases cardiac output
168. Pick the correct statements.
i) Colour blindness is sex - linked dominant disease
ii) Thalassemia is an autosomal recessive blood disease
iii) Phenylketonuria is an inborn error of metabolism inherited as sex linked
recessive trait
iv) Sickle cell anaemia is a qualitative problem of synthesizing an incorrectly
functioning globin, and inherited as autosomal recessive trait.
1) i, ii and iii are correct 2) ii and iv are correct
3) ii, iii and iv are correct 4) ii and iii are correct
169. Limbic lobe or limbic system, a complex structure is formed by
1) Inner parts of cerebral hemispheres 2) Amygdala
3) Hippocampus 4) All of these
170. Assertion(A): Cartilagenous joints permits limited movements.
Reason (R) : Skull bones fuse with the help of dense fibrous connetive tissues
in the form of sutures.
1) Both A & R are correct and R is the correct explanation of A.
2) Both A & R are correct but R is not the correct explanation of A.
3) A is correct but R is incorrect. 4) Both A and R are incorrect.
171. Each bar in the energy pyramid indicates ____
1) The amount of energy present at each trophic level in a given time
2) The amount of energy present only at lower trophic level annually per unit
area
3) The amount of energy present in food chain
4) The amount of biomass present in a food web
172. Statement-I: Darwin variations are small and directionless.
Statement II: Mutations are random and directional.
173. Find the correct option from the following w.r.t counter current mechanism.
1) The flow of filtrate in the descending limb of loop of Henle and blood in the
ascending limb of vasa recta are in same direction
2) The flow of filtrate in both limbs of vasa recta is in opposite direction
3) The flow of filtrate in PCT and DCT is in a counter current pattern
4) The concentration gradient in the medullary interstitium is maintained by
counter current mechanism
174. Assertion (A) : The number of trophic levels in the grazing food chain is
restricted.
Reason (R) : The transfer of energy follows 10 percent low.
(A) Cardiac arrest (I) Heart not pumping blood effectively
(B) Heart failure (II) Heart muscle is suddenly damage
(C) Heart attack (III) Acute chest pain
(D) Angina pectoris (IV) Heart stops beating
1) A - II, B - III, C - I, D - IV 2) A - IV, B - I, C - II, D - III
3) A - III, B - I, C - IV, D - II 4) A - IV, B - II, C - I, D - III

176. Choose the incorrect statement.
1) Down’s syndrome results in the gain of extra copy of chromosome 21
2) Turner’s syndrome results due to addition of an X chromosome in human
females
3) Klinefelter’s syndrome results in the gain of an additional copy of X
chromosome (i.e., trisomy karyotype 47, XXY)
4) Chromosomal disorders are caused due to absence (or) excess or abnormal
arrangement of one (or) more chromosomes
177. The colonization of tropical pacific islands by humans is said to have led to the
extinction of
1) More than 2,000 species of native reptiles
2) Less than 2,000 species of native birds
3) Less than 2,000 species of native reptiles
4) More than 2,000 species of native birds
178. The fossil of the modern day horse is
1) Eohippus 2) Pteropus 3) Camelus 4) Equus
179. Study the following statement w.r.t the muscles with intercalated discs and
select the incorrect statement.
1) Assembled in a branching pattern 2) Striated and involuntary
3) Found also in many visceral organs 4) Found only in the heart
180. The junction between a motor neuron and the sarcolemma of the muscle fibre is
called
1) Motor unit 2) Motor - end plate
3) Neuromuscular junction 4) Both 2 and 3
*******

: ANSWER KEY:
STD: XII – NEET GT - 1 DATE : 12-12-2023
CODE- A SUB: PHYSICS
S.NO. Key S.NO. Key S.NO. Key S.NO. Key S.NO. Key
1 2 11 4 21 3 31 3 41 4
2 2 12 4 22 4 32 3 42 3
3 3 13 1 23 3 33 1 43 1
4 4 14 1 24 3 34 3 44 3
5 3 15 4 25 3 35 1 45 3
6 1 16 2 26 1 36 1
7 1 17 2 27 1 37 3
8 2 18 1 28 1 38 3
9 4 19 4 29 4 39 4
10 2 20 3 30 2 40 1
SUB:CHEMISTRY
Q.No Key Q. No Key Q. No Key Q.No Key Q.No Key
46 2 56 3 66 2 76 3 86 1
47 2 57 1 67 2 77 4 87 3
48 2 58 1 68 4 78 3 88 2
49 1 59 3 69 4 79 4 89 2
50 4 60 4 70 3 80 2 90 3
51 4 61 1 71 3 81 2
52 2 62 4 72 1 82 3
53 3 63 3 73 2 83 3
54 3 64 1 74 2 84 3
55 2 65 1 75 4 85 3
SUB : BOTANY
Q.No Key Q.No Key Q.No Key Q.No Key Q.No Key
91 2 101 3 111 2 121 4 131 3
92 2 102 3 112 1 122 3 132 2
93 4 103 4 113 1 123 1 133 2
94 3 104 3 114 2 124 3 134 3
95 3 105 3 115 2 125 3 135 3
96 2 106 1 116 1 126 2
97 2 107 4 117 2 127 3
98 2 108 4 118 3 128 3
99 4 109 3 119 2 129 1
100 2 110 3 120 3 130 3
Topic: SUB : ZOOLOGY
136 1 146 2 156 3 166 1 176 2
137 4 147 3 157 4 167 3 177 4
138 4 148 3 158 1 168 2 178 1
139 2 149 2 159 3 169 4 179 3
140 1 150 4 160 4 170 2 180 4
141 2 151 1 161 4 171 1
142 4 152 3 162 1 172 4
143 3 153 1 163 1 173 4
144 4 154 3 164 2 174 2
145 1 155 1 165 2 175 2

XII- NEET GT - 2
answer sheet.

PHYSICS Mr.SRIKANTH
CHEMISTRY Mr.VENKATESWARULU
BOTANY Mr.SATHYA
ZOOLOGY Mr.VENU
PHYSICS
1. Units of electric flux are
N  m2 N
1) 2) 2 3) volt-m 4) volt-m3
C 2
C m 2
2. If the direction of the initial velocity of a charged particle is neither along nor
perpendicular to that of the magnetic field, then the orbit will be
1) a straight line 2) an ellipse 3) a circle 4) a helix
3. The mass of an iron rod is 80 gm and its magnetic moment is 10 Am2 . If the
density of iron is 8 gm/c.c. Then the value of intensity of magnetization will be
1) 106 A/m 2) 104 A/m 3) 102 A/m 4) 10 A/m
4. Assertion : Two bodies of unequal masses m1 and m2 are dropped from the
same height. If the resistance offered by air to the motion of both bodies is the
same, the bodies will reach the earth at the same time.
Reason : For equal air resistance, acceleration of fall of masses m1 and m2 will
be different.
1) Both ‘A’ and ‘R’ are true and ‘R’ is a the correct explanation of ‘A’
2) Both ‘A’ and ‘R’ are true and ‘R’ is not the correct explanation of ‘A’
3) ‘A’ is true and ‘R’ is false
4) ‘A’ is false and ‘R’ is true
5. A beaker containing water is kept on a spring scale. The mass
of water and beaker is 5kg. A block of mass 2kg and specific
gravity 10 is suspended by means of thread from a spring
balance as shown. The readings of scales S1 and S2 are
respectively. Take g = 10 ms 2 
1) 52N and 20N

2) 50N and 18N
3) 52N and 18N
4) 52N and 22N
6. The separation between successive fringes in a double slit arrangement is x. If
the whole arrangement is dipped under water, what will be the new fringe
4
separation? (The wavelength of light being used is 5000 Å, w  )
3
1) 1.5x 2) x 3) 0.75x 4) 2x
7. A spring of spring constant 5 10 N/m is stretched initially by 5cm from the
3
unstretched position. The work required to further stretch the spring by

another 5cm is
1) 6.25 N-m 2) 12.50 N-m 3) 18.75 N-m 4) 25.00 N-m
A) Fluid flow d) Temperature difference
B) Heat flow e) Pressure difference
C) Charge flow f) Potential difference
1) a-e, b-d, c-f 2) a-d, b-e, c-f 3) a-f, b-e, c-d 4) a-e, b-f, c-d
9. A simple pendulam of length l and mass m is initial at its lowest position. It is
given the minimum horizontal speed necessary to move in a circular path about
the point of suspension. The tension in the string at the lowest position of the
bob is
1) 3 mg 2) 4 mg 3) 5 mg 4) 6 mg
 
10. If E and B are the electric and magnetic field vectors of electromagnetic waves
then the direction of propagation of electromagnetic waves is along the direction
of
     
1) E 2) B 3) E  B 4) B  E
11. 1 cm on the main scale of a vernier callipers is divided into 10 equal parts. If 10
divisions of vernier coincide with 8 small divisions of main scale, then the least
count of the callipers is
1) 0.01 cm 2) 0.02 cm 3) 0.05 cm 4) 0.005 cm

12. Three identical particles with velocities v0iˆ, 3v0 ˆj and 5v0 kˆ collide successively
with each other in such a way that they form a single particle. The velocity
vector of resultant particle is
v

1) 0 iˆ  ˆj  kˆ
3
 v

2) 0 iˆ  ˆj  kˆ
3
v

3) 0 iˆ  3 ˆj  kˆ
3
v

4) 0 iˆ  3 ˆj  5kˆ
3
 
 
13. Work done when a force F  iˆ  2 ˆj  3kˆ N acting on a particle takes it from the
  
point r1  iˆ  ˆj  kˆ to the point r2  iˆ  ˆj  2kˆ is 
1) -3J 2) -1J 3) Zero 4) 2J
14. When a current carrying coil is situated in a uniform magnetic field with its
magnetic moment antiparallel to the field
(i) Torque on it is maximum
(ii) Torque on it is minimum
(iii) PE of loop is maximum
(iv) PE of loop is minimum
1) only i and ii are true 2) only ii and iii are true
3) only iii and iv are true 4) only, i, ii and iii are true
15. Particles of masses m, 2m, 3m,…, nm are placed on the same line at distances
L, 2L, 3L,….,nL from O. The distance of centre of mass from O is
1)
 2n  1 L
2)
L
3)
n n2  1 L  4)

 2n  1 L
4  2n  1 2 3
16. The value of current in the following diagrams is (diode assumed to be ideal one)
1) 0.1 amp 2) 0.01 amp 3) 1 amp 4) zero

17. Two bodies are thrown with the same initial velocity at angles  and  90o   
respectively with the horizontal, then their maximum heights are in the ratio
1) 1 : 1 2) sin  : cos 3) sin 2  : cos2  4) cos  : sin 
18. The effective capacity of the following capacitors is ________
1) a-g, b-f, c-e, d-i 2) a-g, b-h, c-e, d-i 3) a-i, b-h, c-e, d-g 4) a-g, b-e, c-h, d-i
19. Statement (A) : Negative charges always move from a higher potential to lower
potential point.
Statement (B) : Electric potential is vector
1) A is true but B is false 2) B is true but A is false
3) Both A and B false 4) Both A and R are true
20. The viscous force F on a sphere of radius a moving in a medium with velocity v
is given by F  6  av . The dimensions of  are
1)  ML3  2)  MLT 2  3)  ML1  4)  ML1T 1 
1
21. A current of A is flowing in a long straight conductor. The line integral of
4
magnetic induction around a closed path enclosing the current carrying
conductor is
1) 4 107 Wb/m 2) 107 Wb/m 3) 16 2 107 Wb/m 4) Zero

235
22. A nucleus x splits into two nuclei having the mass numbers in the ratio 2 : 1.
The ratio of the radii of those two nuclei is
1) 2 : 1 2) 1 : 2 3) 21/ 3 :1 4) 1: 21/ 3
23. Three equal weights A, B and C of mass 2kg each are hanging on a
string passing over a fixed frictionless pulley as shown in the figure.
The tension in the string connecting weights B and C is approximately.
1) Zero
2) 13N
3) 3.3N
4) 19.6N
24. In a given circuit as shown the two input wave forms A and B are applied
simultaneously. The resultant wave form at Y is
25. A galvanometer of coil resistance 100  is connected to a shunt of resistance 10

. The current through the galvanometer is i1, the current through the shunt is
i2 and the total current into the combination is i3, then the ratio i1 : i2 : i3 is
1) 1 : 10 : 11 2) 10 : 1 : 11 3) 11 : 10 : 1 4) 10 : 11 : 1
26. When the number of turns in the two circular coils closely wound are doubled
(in both), their mutual inductance becomes
1) four times 2) two times 3) remains same 4) sixteen times
27. The force required to just move a body up the inclined plane is double the force
required to just prevent the body from sliding down the plane. The coefficient of
friction is . If  is the angle of inclined of the plane, then tan  is equal to
1)  2) 3 3) 2 4) 0.5
28. The current i in an induction coil varies with time t according to the graph
shown in the figure. Which of the following graphs shows the induced emf () in
the coil with time?
29. In the series L-C-R circuit, the voltmeter and ammeter readings are
1) V=100V, I=2A 2) V=100V, I=5A 3) V=50V, I=2A 4) V=50V, I=1A

30. Assertion : Resonance frequency will decrease in L-C-R series circuit if a
dielectric slab is inserted in between the plates of the capacitor.
Reason : By doing so, capacity of capacitor will increase.
31. A fully charged capacitor has a capacitance C. It is discharged through a small
coil of resistance wire embedded in a thermally insulated block of specific heat
capacity s and mass m. If the temperature of the block is raised by T, the
potential difference V across the capacitance is
2mC T mC T msT 2msT
1) 2) 3) 4)
s s C C
32. A conducting rod of length L and mass m is moving down a smooth inclined
plane of inclination  with constant speed v. A current I is flowing in the
conductor perpendicular to the paper inwards. A vertically upward magnetic
field b exists in space there. The magnitude of magnetic field B is
mg
1) sin 
IL
mg
2) cos 
IL
mg
3) tan 
IL
mg
4) sec 
IL
33. Assertion : If pressure is increased, bulk modulus of gases will increase.
Reason : With increase in pressure, temperature of gas also increases.
34. A liquid will not wet the surface of a solid if the angle of contact is
1) 0 o 2) 45o 3) 60o 4)  90o
35. The magnetic induction field strength at a distance 0.3m on the axial line of a
short bar magnet of moment 3.6 Am2 is
1) 4.5 104 T 2) 9 104 T 3) 9 105 T 4) 2.6 105 T
36. If the electron in hydrogen orbit jumps from third orbit to second orbit, the
wavelength of the emitted radiation is given by
R 5 36 5R
1)   2)   3)   4)  
6 R 5R 36
37. Moment of inertia of a uniform rod of length L and mass M, about an axis
passing through L/4 from one end and perpendicular to its length is
7 7 11 ML2
1) ML2 2) ML2 3) ML2 4)
36 48 48 12
38. The effective resistance between A and B in the given circuit is
1) 20 2) 7 3) 3 4) 6
39. According to Einstein’s photoelectric equation, the plot of the maximum kinetic
energy of the emitted photoelectrons from a metal versus frequency of the
incident radiation gives a straight line whose slope
1) depends on the nature of metal used
2) depends on the intensity of radiation
3) depends on both intensity of radiation and the nature of metal used
4) is the same for all metals and independent of the intensity of radiation

40. A wheel of moment of inertia I and radius R is rotating about its axis at an
angular speed 0. It picks up a stationary particle of mass M at its edge. Find
the new angular speed of the wheel.
I 0 I 0 2I 0
1) 2) 0 3) 4)
I  MR 2
I  2 MR 2
I  MR2
41. A ray of light passes from vacuum into a medium of refractive index n. If the
angle of incidence is twice the angle of refraction, then the angle of incidence is
1) cos1  n / 2  2) sin 1  n / 2  3) 2 cos 1  n / 2  4) 2sin 1  n / 2 
42. A block of mass m hangs from three springs having same spring
constant k. If the mass is slightly displaced downwards, the time
period of oscillation will be
m 3m
1) 2 2) 2
3k 2k
2m 3k
3) 2 4) 2
3k m
43. The given equi-convex lens is broken into four parts and rearranged as shown.
If the initial focal length is f, then after rearrangement the equivalent focal
length is
1) f 2) f/2 3) f/4 4) 4f
44. In a metre-bridge experiment, when the resistances in the gaps are
interchanged, the balance-point did not shift at all. The ratio of resistances
must be
1) Very large 2) Very small 3) Equal to unity 4) Zero
45. Assuming the earth to have a constant density, point out which of the following
curves show the variation of acceleration due to gravity from the centre of earth
to the points far away from the surface of earth
CHEMISTRY
46. A solution is prepared by adding 2g of a substance A to 18g of water, then the
mass percent of the solute is
1) 10% 2) 20% 3) 80% 4) 90%
47. What is the molarity of a solution of ethanol in water in which the mole fraction
of ethanol is 0.04 ( assume the density of water to be one)
1) 0.231 2) 2.31 3) 1.21 4) 0.121
48. The uncertainty in the position of an electron moving with a velocity of 3 x 104
cm/sec which is accurate upto 0.011%, will be
1) 1.92 cm 2) 7.68 cm 3) 0.175 cm 4) 3.84 cm
49. The first orbit radius for the hydrogen atom is approximately 0.53 A0 , The
radius for the first excited state orbit of hydrogen atom is ______ A0
1) 2.12 2) 1.06 3) 0.13 4) 4.77
50. Which of the following structure is the most stable for ClF3 molecule?

Choose the correct option

1) Only II 2) Only I 3) both II & III 4) All
51. Consider the following statements
I) Bond enthalpy increases as bond order increases
II) Bond length decreases as bond order increases
III) There is no effect of electronegativity on bond energy.
Select the correct statements.
1) I & II 2) II & III 3) I & III 4) I, II & III
52. The  f H for CO2(g), CO(g) and H2O(g) are – 393.5, – 110.5 and – 241.8 kJ/mole
o
respectively. The standard enthalpy change (in kJ) for the reaction.
CO2(g) + H2(g) 
 CO(g) + H2O(g) is
1) 524.1 2) 41.2 3) – 262.5 4) – 41. 2
53. An ideal gas expands in volume from 1 x 10-3 m3 to 1 x 10-2 m3 at 300 K against
a constant pressure of 1 x 105 Nm-2. The work done is
1) 270 kJ 2) – 900 kJ 3) – 900 J 4) 900 kJ
54. The vapour pressure of water at 23 C is 19.8 mm, 0.1 mole of glucose is
o
dissolved in 178.2 gr of water. What is the vapour pressure (in mm) of the
resultant solution at same temperature.
1) 19 2) 19.4 3) 19.602 4) 19.202
55. A 0.2 molal solution of KCl freezes at – 0.68oC. If Kf for H2O is 1.86 the degree
of dissociation of KCl is
1) 85% 2) 65% 3) 83% 4) 90%

56. Three reactions involving H 2 PO4 are given below
 H3O  H2 PO4
i) H3 PO4  H2O 

 HPO42  H3O
ii) H2 PO4  H2O 
 
 H3 PO4  O2
iii) H 2 PO4  OH 
In which of the above does H 2 PO4 acts as an acid?
1) (ii) only 2) (i) and (ii) 3) (iii) only 4) (i) only
57. The pKb of weak acid HA is 4.5. The pOH of an aqueous buffer solution of HA in
which 50% of the acid is ionized is
1) 9.5 2) 4.5 3) 8.5 4) 12.5
58. Match Column I with Column II:
(A) For the equilibrium (p) Forward shift

NH 4 I  s   NH 3 g   HI  g 
If pressure is increased at
equilibrium.
(B) For the equilibrium. (q) No change
N 2 g   3H 2 g   2 NH 3 g 
If volume is increased at
equilibrium.
(C) For the equilibrium (r) Backward reaction
H 2O g   CO g   H 2 g   CO2 g 
Inert gas is added at constant
pressure at equilibrium.
(D) For the equilibrium (s) More N2 and H2 is
PCl5 g   PCl3 g   Cl2 g  more PCl5 is formed.
.
added at equilibrium.
(A) (B) (C) (D) (A) (B) (C) (D)
.
1) p q r s 2) r s q p
3) s p q r 4) q s r p

59. The values of x and y in the following redox reaction
xCl2  6OH  
ClO3  yCl   3H2O
are
1 x = 5, y = 3 2) x = 2, y = 4 3) x = 3, y = 5 4) x = 4, y = 2
60. A silver cup is plated with silver by passing 965 coulombs of electricity. The
amount of Ag deposited is (Atomic weight of Ag = 108).
1) 107.87 g 2) 9.89 g 3) 1.0002 g 4) 1.08 g
61. Match the items of Column I and Column II on the basis of data given below
EFo / F   2.87 V ; ELio  / Li  3.05 V ; E Alo 3 / Al  1.66 V ; ECo
o
2
/ Co
 0.27 V , EZn
o
2
/ Zn
 0.76 V
2
(A) F2 (P) Strongest reducing agent
(B) Li (Q) Can reduce Zn2+ as Zn
(C) Al (R) Can not reduce Al3+ as Al
(D) .
Co (S) Strongest oxidizing agent
(A) (B) (C) (D) (A) (B) (C) (D)
.
1) S P Q R 2) P R S Q
3) Q P S R 4) R S P Q
62. For a reaction A + B → C + 2 D, experimental results were collected for three
trials and the data obtained are given below
Trial [A] M [B] M Initial Rate M/s
1 0.40 0.20 5.5  104
2 0.80 0.20 5.5  104
3 0.40 0.40 2.2  103
The correct rate law of the reaction is
1) rate  k  A  B  2) rate  k  A B  3) rate  k  A B  4) rate  k  A B 
o 2 2 o
63. Half life of a first order reaction is 4 sec and initial concentration of the reactant
is 0.12 M. The concentration of the reactant left after 16 sec is
1) 0.0075 M 2) 0.06 M 3) 0.03 M 4) 0.015 M
64. The correct order of first ionization potential values of Be, B, Li, C atom is
1) Be Be > B > C
65. Which of the following 13 group elements has positive E o 3  , value
th
 M / M 
 
1) Al 2) Tl 3) Ga 4) In
66. The correct order of negative electron gain enthalpy for elements belongs to VIA
group in Modern periodic table.
1) O > S > Se > Te 2) S > O > Se > Te
3) S > Se > Te > O 4) S > Se > O > Te
67. Assertion(A) : Transition metals shows variable valency.
Reason (R) : Transition metals have a large energy difference between the ns2
and (n – 1)d electrons
1) Both Assertion and Reason are true and the Reason is the correct
explanation of the Assertion
2) Both Assertion and Reason are true, but the Reason is not correct
3) Assertion is true, but Reason is false
4) Assertion is false and Reason is true
68. When 1 mole of CrCl3.6H2O is treated with excess of AgNO3, 430.5 g of AgCl is
obtained. The formula of the complex is ( MW of AgCl = 143.5gmol-1)
1) CrCl3  H 2O 3  .3H 2O 2) CrCl2  H 2O 4  Cl.2 H 2O
3) CrCl  H 2O 5  Cl2 .H 2O 4) Cr  H 2O 6  Cl3
69. The value of spin only magnetic momentum for an octahedral complex is 2.84
BM. Then the correct electronic configuration of central metal ion might be
1) d4 ( in weak ligand field)
2) d4 (in strong ligand field)
3) d3 ( in weak as well as in strong field )
4) d5 ( in strong field ligand )

70. In which of the following pairs both the complexes show optical isomerism?
3
1) Cis  Cr  C2O4  2 Cl2  , Cis  Co  NH 3 4 Cl2 
2)  PtCl2  en   ,  NiCl2 Br2 
2
3) Co  NO3 3  NH 3 3  , Cis  Pt  en 2 Cl2 

4) Co  en 3  Cl3 , Cis  Co  en 2 Cl2  Cl
71. In Lassaigne’s test when both N and S are present blood red colour obtained is
due to the formation of
1) Ferric Ferrocyanide 2) Ferric Sulphocyanide
3) Ferric cyanide 4) Sodium Ferrocyanide
72. IUPAC name of
1) 5 – ethyl Cyclohexene, 2,3,3 – trimethyl cyclohexene

2) 3 – ethyl, 5,5,6 – trimethyl cyclohexene
3) 4-ethyl-1,6,6-trimethyl-cyclo-hexene
4) 5 – ethyl – 1,1,2 – trimethyl cyclohexene
73.
( E  is an electrophile ) major product will be
1) E C  O  CH3

O
2) C  O  CH3

E O
3)
4)
74. Which of the following is free radical substitution reaction?
1)

2) CH3  CH  CH2  Cl2  CH 2Cl  CH  CH 2
CH 3  CH  CH 3  HCl   CH 3  CH  CH 3
3) |
Cl
4) CH 3CHO 
( i ) CH 3 MgBr
( ii ) H O
 CH 3CH  OH  CH 3
3

75. The major product obtained on treatment of CH3CH2CH(F)CH3 with CH3O-
/CH3OH
1) CH3CH2CH(OCH3)CH3 2) CH3CH = CHCH3
3) CH3CH2CH=CH2 4) CH3CH2CH2CH2OCH3
76. The major product P in the following reaction is CH 3  CH  CH 2 
HI
Peroxide

CH 2  CH  CH 2 CH 3  CH  CH 3
1) | 2)
|
I I
CH 2  CH 2
3) CH 3CH 2CH 2 I 4) | |
I I
77. In the following sequence of reactions, the alkene affords the compound ‘B;
CH 3CH  CHCH 3 
O3
  A 
H 2O
Zn
 B
The compound (B) is
1) CH3CH2CHO 2) CH3COCH3 3) CH3CH2COCH3 4) CH3CHO
78. The reaction of toluene with Cl2 in presence of FeCl3 gives ‘X’ and reaction in
presence of light gives ‘Y’. Thus, ‘X’ and ‘Y’ respectively are :
1) X = Benzal chloride, Y = ortho Chlorotoluene
2) X = meta Chlorotoluene, Y = para Chlorotoluene
3) X = ortho and para Chlorotoluene, Y = Benzylchloride
4) X = Benzyl chloride, Y = meta – Chlrotoluene
H 3O 
79. In the following sequence of reactions CH 3  Br  KCN
 A 
 B 
LiAlH 4
ether
 C , the
end product (C) is
1) acetone 2) methane 3) acetaldehyde 4) ethyl alcohol
80. The final product obtained in the reaction
81. In the following sequence of reaction :

P  red   I 2 H  / H 2O
CH 3CH 2OH    A Mg
dry ether
 B 
HCHO
 C  D
the compound D is :
1) Butanal 2) n-butyl alcohol
3) n-propyl alcohol 4) propanal
82. Correct order of rate of dehydration of the following alcohols:
1) I < II < III < IV 2) II < III < IV < I 3) I < III < IV < II 4) None of these
83. In the given reaction, A, B respectively are
1) A = RR′C(OH)(COOH), B = NH3 2) A = RR′CH2CN, B = NaOH

3) A = RR′C(CN)(OH), B = LiAlH4 4) A = RR′C(CN)(OH), B = H3O+
84. Among the following the strongest acid is
1) CH3COOH 2) CH2ClCH2COOH 3) CH2ClCOOH 4) CH3CH2COOH

85. Assertion : Acetanilide gives mono substituted product in electrophilic aromatic
substitution reaction.
Reason : Due to cross conjugation + M effect of – NHCOCH3 will decrease.
86. In the following sequence
the product ‘C’ is

1) benzonitrile 2) benzaldehyde 3) benzoic acid 4) benzylamine
87. Which of the following indicates the presence of 5 – OH groups in glucose
1) Penta-acetyl derivate of glucose 2) Cyanohydrin formation of glucose
3) Reaction with fehling’s solution 4) Reaction with Tollen’s reagent
88. In which of the following compounds, nitrogen present can not be estimated by
Kjeldahl’s method

1) CH3NO2 2) C5H5N ( Pyridine) 3) Ph N  NCl  4) All the above
89. Aqueous solution of which of the following salt will given white precipitate with
dil.HCl and yellow colour precipitate with KI solution.
1) AgNO3 2) Pb(NO3)2 3) Hg(NO3)2 4) MnSO4
90. Correct matching for the following is :
(A) Salt solution + Aq.BaCl2 → White ppt (P) Br 
(B) dry salt + conc.H2SO4 → reddish brown (Q) I
vapours
(C) Salt solution + FeSO4 solution + (R) SO42
conc.H2SO4 → Brown ring is formed
(D) dry salt + conc.H2SO4 → violet coloured (S) NO3
.
vapours
(A) (B) (C) (D) (A) (B) (C) (D)
1) P Q R S 2) P Q S R
3) R P Q S 4) R P S Q
BOTANY
91. How many molecule of NADH+ H+ and FADH2 are respectively produced during
the complete oxidation of one molecule of pyruvic acid in mitochondria?
1) 3 and 1 2) 2 and 2 3) 8 and 2 4) 4 and 1
92. In C4 plants, photorespiration does not occur because
1) Regeneration of PEP occurs continuously
2) PEPcase occurs in mesophyll cytosol
3) Of the concentration of CO2 at the enzyme site
4) C4 plants show double carboxylation in bundle sheath cells
93. Lactic acid fermentation
1) Shows slow oxidation of NADH to NAD+
2) Occurs with the help of hetero-fermentative Lactobacillus lacti
3) Always releases CO2 4) Is not hazardous
94. Complex IV of mitochondria involved in ETS is associated with all except
1) Cytochrome c oxidase 2) Cytochrome a & a3
3) Ctyochrome bc1 4) Two copper centres

95. Mark the wrong statement w.r.t interkinesis
1) Chromosomes number is exactly half to the meiocyte
2) It is short lived
3) Duplication of DNA takes place 4) Centrioles pair replicate in animal cells
96. Dissolution of the synaptonemal complex is the beginning of
1) Diplotene 2) Pachytene 3) Diakinesis 4) Leptotene
97. 70S ribosomes are not present in
1) Cytoplasm of prokaryotic cells 2) Matrix of mitochondria
3) Cytoplasm of eukaryotic cells 4) Stroma of chloroplast
98. In animal cells, lipid-like steroidal hormones are synthesized in
1) SER 2) RER 3) Golgi complex 4) Peroxisomes
99. Nuclear membrane
1) Is not interrupted by pores
2) Forms barrier between nucleolus and chromatin
3) Is made of lipids and proteins
4) Bears granular structure on its inner side of the inner membrane
100. A group of organisms that freely float passively in water current and its cell
walls form two thin overlapping shells which fit together as a soap box refers to
1) Dinoglagellates 2) Diatoms 3) Amoeboid protozons 4) Blue green algae
101. Tetradynamous stamens and cruciform corolla are the characteristic features of
1) Potato family 2) Brassicaceae 3) Lily family 4) Fabaceae
102. Match the following columns and select the correct option.
(A) Epiphyllous (I) Stamens attached to the petals
(B) Apocarpous (II) Stamens attached to the perinath
(C) Monoadelphous (III) Carpels are free
(D) Epipetalous (IV) Stamens are united in a single bundle
.
(A) (B) (C) (D) (A) (B) (C) (D)

1) IV III II I 2) II III IV I
3) IV I III II 4) II IV III I
103. Find out the wrong statements w.r.t fungi.

1) Basidiocarp of mushroom is underground and edible
2) Ascocarp of Morels and Truffles are edible
3) Saccharomyces is a unicellular fungus and used in brewing and baking
industries
4) Karyogamy is delayed in Aspergillus and Neurospora
104. A corolla which is made up of a posterior standard (vexillum), two lateral wings
and two anterior ones forming a keel is characteristic feature of
1) Lupine 2) Brinjal 3) Tulip 4) Oat
105. Vascular bundles in dicotyledons are considered as open because
1) Vessels are with perforations
2) Cambium is present between xylem and phloem
3) Xylem is surrounded by phloem
4) A bundle sheath is absent over each bundle
106. Radial vascular bundle with diarch to hexarch condition is present in
1) Root of mango 2) Root of maize 3) Stem of china rose 4) Stem of sugarcane

107. Examine the figure given below and select the correct cells/nuclei that involves
in double fertilization.
1) A and B 2) B and C 3) B and D 4) B and E

108. Choose the incorrect statement w.r.t gaseous hormone, ethylene
1) Induces horizontal growth of seedlings
2) One of the most widely used hormone in agriculture
3) Promotes germination in peanut seeds but inhibits sprouting of potato tubers
4) Promotes senescence and abscission in plant organs
109. During which phase(s) of cell cycle, of amount of DNA and number of
chromosomes respectively in a cell remain at 8C level & 4n if the initial amount
of DNA and number of chromosomes are denoted as 4C & 4n, respectively?
1) G2 and metaphase 2) G1 and S 3) G1 and G2 4) G2 only
110. Which of the following statements is true regarding C4 plants?
1) Phosphoenol pyruvate is found in bundle sheath cells only
2) A specific arrangement of non-green cells are present around vascular bundle
3) Small and less number of chloroplasts are present in bundle sheath cells
4) They are adopted to low temperature and low light intensities
111. Consider the following floral features.
A. Persistent calyx B. Axile placentation
C. Fruit pod or capsule D. Head inflorescence E. Epipetalous
Which of the given characteristics are found in asteraceae?
1) A, B, D and E 2) A, D and E 3) A,C,D and E 4) B,D and E
112. Smallest self replicating infectious RNA particles which are devoid of protein
coat are
1) Viroids 2) PPLOs 3) Prions 4) Virions
113. A few epidermal cells, in the vicinity of the guard cells become specialized in
their shape and size, are known as
1) Subsidiary cells 2) Complementary cells
3) Bulliform cells 4) Passage cells
114. Sapwood differs from heartwood in
1) Possessing lignified elements 2) In being involved in conduction of water
3) Being darker in colour 4) Presence of redifferentiated tissue
115. Group of enzymes that catalyse removal of groups from substrates by
mechanisms other than hydrolysis leaving double bonds are called
1) Oxidoreductases 2) Transferases 3) Lyases 4) Hydrolases
1) Tertiary structure is absolutely essential for biological activity of many
proteins.
2) In RNA, the bond between the phosphate group and pentose sugar is a
glycosidic bond
3) Backbone of DNA is made up of sugar phosphate chains
4) Cellulose is unbranced polysaccharide without complex helices

117. Select the incorrect statement about Michaelis Menten constant, Km.
1) In competitive inhibition, Km increases but Vmax remains the same
2) Km is inversely proportional to substrate affinity
3) The catalytic efficiency of two different enzymes can be compared by their Km
value
4) In the presence of a non-competitive inhibitor, Km increases and maximal
velocity (Vmax) decreases
118. If there are 9 chromosomes in the antipodal cell of a monocot plant, what
would be the number of chromosomes present in following structures?
A. Synergid B. PEC C. Coleorhiza
1) A-9, B-27, C-18 2) A-27, B-27, C-9 3) A-18,B-27,C-18 4) A-18, B-27, C-9
119. Megaspore mother cell differentiates from
1) Nucellus in the chalazal region 2) Primary parietal cell in chalazal region
3) Nucellus in the micropylar region 4) Itegumentary cell in micropylar region
120. Which of the following prevents inbreeding depression?
1) Synchronisation in pollen release and stigma receptivity
2) The anther and stigma placed at same positions
3) Presence of self-incompatibility 4) Presence of bisexual flowers
121. Proportion of recombinant phenotypes in F2 offsprings if Mendelian dihybrid
corss is
6 3 9 10
1) 2) 3) 4)
16 16 16 16
122. A molecule that can act as a genetic material should
1) Provide scope for rapid changes 2) Unable to generate its replica
3) Function as a catalyst
4) Not change with different stages of life cycle
123. An E.coli having a heavy DNA molecule labelled with 15N is allowed to grow in a
medium with normal 14NH4Cl. Which of the following is correct for DNA
molecules that were extracted from the culture after 40 minutes?
1) Equal amount of light and heavy DNA
2) Same density as that of parent DNA
3) Lower density than parental types
4) Intermediate density of each molecule of DNA
124. Find out the correctly matched pair:
1) Translation unit - UTR
2) Splicing - Represents dominance of RNA world
3) Monocistronic - Mostly in bacteria
4) Origin of replication - Several thousands in bacteria
125. Trichoderma polysporum is used for commercial and industrial production of
a/an
1) Immunosuppressive agent 2) Blood cholesterol lowering agent
3) Clot buster agent 4) Fruit juice clearing agents
126. What type of viruses are produced after the death of E.coli, if a T2 phage having
radioactive sulfur infects bacteria growing on normal nutrient medium?
1) Radioactive capsid and non-radioactive DNA
2) No S35 protein coat but radioactive sulfur in DNA
3) Non-radioactive capsid as well as genome
4) Radioactive ‘phosphorus’ and ‘sulfur’ in DNA as well as in capsid
127. During sewage treatement, major part of activated sludge is pumped into sludge
digesters. Here
1) Anaerobic fungi digest the bacteria in the sludge
2) Obligate aerobes produce a mixture of gases lie CH4, CO & H2S
3) Vigorous growth of anaerobic microbes allow development of flocs
4) Anaerobic bacteria digest the aerobic eukaryotes and prokaryotes in the
sludge

128. Select the wrongly matched pair (w.r.t biocontrol agents)
1) Ladybrid beetle - Bollworms
2) Bacillus thuringiensis - Butterfly caterpillars
3) Trichoderma - Plant pathogens
4) Dragonflies - Mosquitoes
129. How many types of RNA polymerases are required for transcription of different
r-RNAs present in 80S type ribosomes?
1) Two 2) Three 3) Four 4) One
130. Which one is true for majority of baculoviruses used as biological control
agents?
1) They have been shown to have negative impacts to non-target insects like
cotton bollworm
2) These are excellent candidates for narrow spectrum herbicidal applications
3) Beneficial insects are being conserved
4) They are species specific predators and are unable to harm the useful insects
131. A process of transcription and post-transcription is shown in the following
figure. Find out the structures marked as (A), (B) and (C).
1) (A) Intervening sequence

(B) 3’ methyl guanosine cap
(C) Poly (A) tail
2) (A) Introns
(B) 7-ethyl guanosine
(C) 200-300 adenylate residue
3) (A) Exons
(B) Ethyl guanosine triphosphate
(C) Protect 5’ end by RNase
4) (A) Introns
(B) Methyl guanosine triphosphate at 5’ end
(C) Adenylate residue at 3’ end
132. Choose the correct statement in context of EcoRI enzyme
1) Sequence recognized is
5’-G A G T T C – 3’
3’-C T C A A G-5’
2) Palindrome sequence yields blunt ends on digestion
3) E in EcoRI codes for Entamoeba
4) Phosphodiester bond between 5’G and A are digested by this enzyme

133. Identify A,B and C in the given diagram of pBR322 with correct function and
select the correct option
1) A – Controls copy number of plasmid

B – Selectable marker
C – Sal I – Insertional inactivation will lead to susceptibility to tetracycline
2) A – Ori-initiation of replication
B – Selectable marker
C – lac Z-helps in blue white selection
3) A – Sal I-Recombinant DNA has to be inserted upstream of this restriction
site only
B – Rop – Codes for proteins which are essential for plasmid replication
C – Ori-initiation of replication
4) A – Ori-initiation of replication
B – Bam HI – insertional inactivation of tetR gene will be observed in
Recombinants
C – Rop – Codes for protiens which are essential for plasmid replication
134. During DNA fingerprinting, the separation of DNA fragments is done with the
help of
1) Centrifugation 2) Electrophoresis in agarose gel
3) Blotting 4) VNTR probes
135. Griffith injected a combination of live R-type and heat killed S-type
Streptococcus pneumonia in mice. During this experiment
1) R-type bacteria developed a rough sugar coat, called capsule
2) Non-virulent bacteria picked up the capsule from dead bacteria
3) Living non-pathogenic cells had changed to virulent form
4) Non-capsulated bacteria had somehow been transformed by the living
capsulated cells
136. Find out correct statement from the following:
1) The taxonomic categories are distinct biological entities and are merely
morphological aggregates.
2) Felis, Panthera are belonging to one taxon.
3) Class – Monocotyledonae includes order poales.
4) Human beings belong to the species Homo which is grouped in the genus
sapiens.
137. Dogs, cats, mammals, wheat, rice, plants, animals etc., are convenient
categories we used to study organisms. The scientific term for those categories
is ________.
1) Taxonomy 2) Taxa 3) Systematics 4) Biodiversity
138. Bilateral symmetry, true coelom, internal fertilization exhibited by ______.
1) Euspongia 2) Carcharodon 3) Saccoglossus 4) Ancyclostoma
139. Find out incorrect comparison of chordates & non-chordates from the following:
Chordata Non-chordata
1) Central nervous system is dorsal, Central nervous system is ventral,
hollow and double solid and single.
2) Pharynx is perforated by gill slits Gill slits are absent
3) Post-anal tail is present Post-anal tail is absent
4) Heart is ventral Heart is dorsal ( if present )

140. The animal given below exhibits all the following characteristics except.
a) Have no external ear openings.

b) Internal fertilization
c) Do not have 4-chambered heart like Alligators.
d) Poikilothermic animal
Choose the answer:
1) Both a & b 2) Both b & d 3) Both a & c 4) Only c
141. In which non-human model organism, DNA sequence have also been
sequenced?
1) HIV 2) Honey bee 3) Caenorhabditis 4) Tobacco plant
142. Mosaic vision in cockroach is due to __________.
1) Single ommatidium in eye.
2) Several images of an object received by ommatidia of eye.
3) High resolution of several images of an object received by ommatidium of eye
4) Its nocturnal habit
143. Among the following which one is similar in both frog and human.
1) Hepatic portal system 2) Renal portal system
3) Heart chambers 4) Ureters
144. Statement I: Alike human, frog drinks water and also absorb it through the
skin in pond ecosystem.
Statement II: Forebrain includes olfactory lobes, paired cerebral hemispheres
and paired diencephalon (in frog).
1) Statement-I and Statement-II are true 2) Statement-I and Statement-II are
false
3) Statement-I is true, but Statement-II is false
4) Statement-I is false, but Statement-II is true
145. Read the following statements w.r.t human respiratory system and answer (T/F)
A) Among vertebrates fishes use gills for their respiration.
B) The trachea & terminal bronchioles are supported by incomplete
cartilaginous rings.
C) Conducting part also humidifies the expired air.
D) The anatomical setup of lungs in thorax is such that any change in the
volume of the thoracic cavity will be reflected in the abdominal cavity.
(A) (B) (C) (D) (A) (B) (C) (D)
1) T F T F 2) F F T T
3) F T F T 4) T F F F
146. Frequent glaciations were subjected to ________ in the past?
1) Tropical latitudes 2) Polar regions
3) Equators 4) Temperate regions
147. Read the following statements:
A) Humans derive countless direct economic benefits from nature-food,
construction material and medicinal products etc.,
B) There are intangible benefits from nature that we derive is - watching spring
flowers in full bloom.
C) Chanda & Bastar areas of Sarguja are sacred grooves.
D) Biodiversity knows some political boundaries, therefore its conservation is a
collective responsibility of all nations.
How many are not true statements w.r.t. biodiversity conservation.
1) Four 2) Three 3) Two 4) One
148. Find out correct match from the following respiratory disorders & their
causative reason.
1) Asthma – inflammation of bronchi & bronchioles
2) Emphysema – cigarette smoking & alcohol consumption.
3) Occupational respiratory disorder – long exposure to dust coming from house
hold things.
4) Fibrosis – proliferation of nerve fibres.

149. Statement I: Applications of DNA – fingerprinting in population growth and
density is also achieved.
Statement II: About 0.1% of base sequence among humans is different.
3) Both Statement-I and Statement-II are true
4) Both Statement-I and Statement-II are false
150. If you were to count the number of insects feeding on a big tree what kind of
pyramid would you get?
1) 2) 3) 4) All the above
151. Observe the given figure below
Find out A & B and they are depicted in __(C)____

A B C
1) Lungs Tissues Double circulation
2) Gills Tissues Double circulation
3) Gills Tissues Single circulation
4) Skin Tissues Single circulation
152. Assertion (A): During each cardiac cycle two prominent sounds are produced.
Reason (R): These two heart sounds are associated with the closure of the
valves present in the veins.
153. Read the following and choose the option:
(i) Arteries carry blood from the heart to body parts and veins bring blood from
the body parts to the heart.
(ii) The blood vessel which carries blood from the heart to body parts contain
wider lumen.
1) (i) is correct, (ii) is wrong 2) Both (i) & (ii) are correct
3) (ii) is correct, (i) is wrong 4) Both (i) & (ii) are wrong
154. Assertion (A): In aquatic ecosystem, GFC is the major conduit for energy flow.
Reason (R): Some of the organisms of DFC are prey to the GFC animals.
3) Assertion is true, but Reason is false 4) Assertion is false and Reason is true
155. The statement incorrect about the standard ECG is ______.
1) To obtain standard ECG, a patient is connected to the machine with three
electrical leads.
2) Each peak in the ECG is corresponds to a specific electrical activity of the
heart.
3) Ventricular contraction starts shortly after “R” and marks the end of the
systole.
4) Any deviation from the shape of ECG indicates a possible abnormality.

156. Assertion (A): Glomerular filtration takes place at medulla region of kidney.
Reason (R): Through filtration membrane almost all the constituents of the
plasma except the proteins pass onto the lumen of Bowman’s capsule.
1) Both assertion and reason are true, but the reason is not correct explanation
of the Assertion
2) Both assertion and reason are true and the reason is the correct explanation
of the Assertion
3) Assertion is true, but reason is false
4) Assertion is false and reason is true
157. For the given case, the population density is measured by ________.
1) Relative density 2) Actual counting

3) Indirect counting 4) Percent cover
158. Gause’s competitive exclusion principle states that
1) Competing species is experimentally removed by inferior species.
2) Two closely related species competing for the same resources cannot co-exist
indefinitely.
3) Two competing species avoid competition by choosing different foraging
patterns.
4) In general, herbivores and plants appear to be more adversely affected by
competition than carnivores.
159. During the concentration of urine by the human kidneys, NaCl is returned to
the medullary interstitium by the ________.
1) Descending limb of the loop of Henle.
2) Ascending limb of the vasa recta.
3) Descending limb of the vasa recta.
4) Collecting duct at deep medulla.
160. Which of the following immune system components does not correctly match its
respective role?
1) Secondary lymphoid organs - provide the sites for differentiation of
lymphocytes into antigen – sensitive
lymphocytes.
2) IgA - protect the infant
3) Tears - prevent microbial growth
4) Natural killer cells - destroys microbes
161. Describe urine in relationship to glomerular filtration, tubular reabsorption and
tubular secretion.
1) Glomerular filtration + tubular reabsorption + tubular secretion
2) Glomerular filtration + Tubular reabsorption - tubular secretion
3) Glomerular filtration - tubular reabsorption + tubular secretion
4) Glomerular filtration - tubular reabsorption - tubular secretion
162. For articulation of head of humerus a depression found in scapula is called
_______
1) Acetabulum 2) Occipital condyle
3) Glenoid cavity 4) Suture
163. Tetany is the rapid spasm in muscles due to ______.
1) High Ca+2 in body fluid 2) low Na+2 in body fluid
3) Low Mg+2 is body fluid 4) Low Ca+2 in body fluid
164. Read the following A to D statements and select the option that contains both
correct statements
A) Each sarcomere has a central ‘A’ band and two half-‘I’-bands
B) Actin & Myosin are polymerized proteins.
C) The active sites for actin on resting myosin filament are masked by a protein
– tropomyosin
D) Myosin head contains ATP-ase and has tropomyosin binding sites.
1) A and C 2) B and C 3) C and D 4) A and B

165. Applications of biotechnology in production of pest resistant plant includes -
For the above given flow chart, identify B & D.

1) B – Nematode specific genes , D – Agrobacterium vector
2) B – Agrobacterium vector, D – Initiation of RNAi
3) B – Nematode specific genes, D – initiation of RNAi
4) B – Cry II Ab, D – Control the cotton ball worms.
166. The drug which is extracted from the given below plant is generally intaken by
___A___ and ___B___ .
A B
1) Snorting & smoking Stimulant
2) Snorting & injection Slows down body functions
3) Inhalation & oral ingestion Slows down body functions
4) Intravenous injection Potent stimulating agent of CNS
167. Unmyelinated nerve fibre is _____
1) Not enclosed by a Schwann cell and hence axon is not enclosed by a myelin
sheath.
2) Enclosed by a Schwann cell that does not form a myelin sheath around the
axon.
3) Not enclosed by a Schwann cell but axon is enclosed by a myelin sheath
formed by neuron itself.
4) Not found in the autonomous and somatic neural systems.
168. Which of the following is not true for cerebrum?
1) Forms major part of the brain.
2) The cerebrum is horizontally divided into two halves
3) The layer of cells which covers the cerebral hemispheres is called cerebral
cortex.
4) The cerebrum wraps around a structure called thalamus.
(Hormone) (Function)
(A) ANF (I) Regulates blood calcium levels
(B) MSH (II) Decreases blood pressure
(C) GIP (III) Pigmentation
(D)
.
TCT (IV) Inhibits gastric secretion
(A) (B) (C) (D) (A) (B) (C) (D)
1) IV I II III 2) II I IV III
3) II III I IV 4) II III IV I
170. A steroid hormone responsible for balance of water and electrolytes in our body
is _____.
1) ADH 2) PTH 3) Testosterone 4) Aldosterone

171. Number of mammary lobes present in human female is ________.
1) 10 – 15 2) 15 – 20 3) 30 – 40 4) 50 – 60
172. Read the following statements and Answer ( T/F) :
A) FSH regulate spermatogenesis.
B) Some of the spermatogonia called primary spermatocytes periodically
undergo meiosis.
C) Epididymis located along the posterior surface of each testis, that leads to
vasa efferentia.
D) Cyclic menstruation is an indicator of normal reproductive phase.
(A) (B) (C) (D) (A) (B) (C) (D)
1) F T T T 2) T T F T
3) T F T F 4) F F T T
173. In the later phase of pregnancy, ________ is secreted by the ovary in human
female.
1) hPL 2) hCG 3) Progestogens 4) Relaxin
174. (i) Inhibits ovulation (ii) Inhibits implantation
(iii) Alter the quality of cervical mucus
(iv) Very less side effects (v) Well accepted by females
The above features are correct for which of the following contraceptive method?
1) Vaults 2) IUDs 3) Oral pills 4) Implants
175. Inability to conceive (or) produce children even ____ of unprotected sexual
cohabitation is called infertility.
1) Within 2 months 2) After 12 months
3) After 24 months 4) After 5 years
176. Find out the correct pedigree for Myotonic dystrophy from the following.
177. Statement I : Arborescent lycopods evolved during Permian period.

Statement II : Extincted Therapsids are ancestors for present mammals.
false
178. According to the theory of Darwin about Natural selection, the below one is
correct.
1) Variations are random & direction less
2) The rate of appearance of new forms is linked to the life cycle and life span.
3) When natural resources are unlimited, populations are stable in size.
4) Use and disuse of organs.
179. He was more man-like, hairy and walked like gorilla and chimpanzee, existed 15
mya.
1) Dryopithecus 2) Australopithecines
3) Homo habilis 4) Ramapithecus
180. Statement I : Fever, severe joint pain, muscle pain, headache & rash are
featured in malaria.
Statement II : Under certain conditions, c-onc genes present in normal cells
are activated and transformed to oncogenic.
false
*******

: ANSWER KEY:
1 3 11 2 21 2 31 4 41 3
2 4 12 4 22 3 32 3 42 2
3 1 13 2 23 2 33 3 43 2
4 4 14 2 24 1 34 4 44 3
5 3 15 4 25 1 35 4 45 3
6 3 16 4 26 1 36 3
7 3 17 3 27 2 37 2
8 1 18 1 28 3 38 4
9 4 19 3 29 1 39 4
10 3 20 4 30 1 40 1
SUB:CHEMISTRY
46 1 56 1 66 3 76 2 86 3
47 2 57 2 67 3 77 4 87 1
48 3 58 2 68 4 78 3 88 4
49 1 59 3 69 2 79 4 89 2
50 2 60 4 70 4 80 3 90 4
51 1 61 1 71 2 81 3
52 2 62 1 72 3 82 1
53 3 63 1 73 4 83 3
54 3 64 3 74 2 84 3
55 3 65 2 75 3 85 1
SUB : BOTANY
91 4 101 2 111 2 121 1 131 4
92 3 102 2 112 1 122 4 132 4
93 1 103 1 113 1 123 3 133 4
94 3 104 1 114 2 124 2 134 2
95 3 105 2 115 3 125 1 135 3
96 1 106 1&2 116 2 126 3
97 3 107 3 117 4 127 4
98 1 108 3 118 1 128 1
99 3 109 1 119 3 129 1
100 2 110 2 120 3 130 3
136 3 146 4 156 4 166 2 176 2
137 2 147 3 157 4 167 2 177 1
138 2 148 1 158 2 168 2 178 2
139 1 149 2 159 2 169 4 179 4
140 4 150 3 160 1 170 4 180 4
141 3 151 3 161 3 171 3
142 2 152 3 162 3 172 2
143 1 153 1 163 4 173 4
144 2 154 1 164 4 174 3
145 4 155 3 165 2 175 3

XII- NEET GT - 3
answer sheet.

PHYSICS Mr.Ch.Ramesh
CHEMISTRY Mr.SUBEDAR
BOTANY Mr.RAMESH
ZOOLOGY Mrs.PRABHAVATHI
PHYSICS
1. In a screw gauge, the number of divisions on circular scale is 50. If the screw
moves 1mm ahead in two revolutions of the circular head, the least count is
1) 0.1mm 2) 0.01mm 3) 0.1cm 4) 0.001mm
2. A force F is applied onto a square plate of side L. If the percentage error in
determining L is 2% and that in F is 4%, the permissible percentage error in
determining the pressure is
1) 2% 2) 4% 3) 6% 4) 8%
3. The velocity of water waves may depend on their wavelength  , the density of
water  and the acceleration due to gravity g. The method of dimensional
analysis gives the relation between these quantities as
1) V 2  K  1 g 1  1 2) V 2  K  g 3) V 2  K  g 4) V 2  K  3 g 1  1
4. Statement – I : If equal amount of heat is added to equal masses of diferent
substances, the resulting temperature change is also equal.
Statement – II : Every substance requires a unique value of heat to change its
temperature per unit mass, per degee centigrade (or per kelvin)
1) Statement-I and Statement-II are true and Statement-II is the correct
explanation of Statement-I
2) Statement-I and Statement-II are true, but Statement-II is not the correct
5. A constant force acts on a particle and its displacement y (in cm) is released to t
(in s) by the equation t  y  2  3 . What is the displacement of the particle
when its velocity is zero?
1) 4.5cm 2) 3 cm 3) 2cm 4) 5.5cm
6. A body moving in a circular path is subjected to a tangential acceleration of
2ms-2. Find the acceleration of the body when its velocity is 2ms-1. Given: The
radius of the circular path is 1m.
1) 5ms 2 2) 5 5ms 2 3) 3 5ms 2 4) 2 5ms 2
   
7. Two vectors A and B have equal magnitudes. The magnitude of A  B is ‘n’  
   
 
times the magnitude of A  B . The angle between A and B is
 n2  1   n  1 1  n  1 
2
 n  1
1) cos 1  2  2) cos 1  3) sin  2  4) sin 1 
 n  1  n  1   n  1  n  1 
8. From a balloon moving upwards with a velocity of 12ms-1, a packet is released
when it is at a height of 65m from the ground. The time taken by it to reach the
ground is (g=10ms-2)
1) 5s 2) 8s 3) 4s 4) 7s

9. A body is projected from the ground with a velocity  
v  3iˆ  10 ˆj ms 1 . The
maximum height attained and the range of the body, respectively, are
(given g = 10ms-2)
1) 5m and 6m 2) 3m and 10m 3) 6m and 5m 4) 3m and 5m
10, A particle of mass ‘m’ is moving in a straight line with momentum p. Starting at
time t = 0, a force F = kt acts in the same direction on the moving particle
during time interval T so that its momentum changes from p to 3p. Here k is a
constant. The value of T is
k p 2k 2p
1) 2 2) 2 3) 4)
p k p k
11. Two blocks of masses 1kg and 2kg kept on a smooth horizontal surface are
accelerated by a horizontal force of 10N. If the acceleration of both blocks is
same then the spring force is
10 7 2 1
1) N 2) N 3) N 4) N
3 3 3 3

12. A metal ball of mass 2kg moving with speed of 36kmh-1 has a head-on collision
with a stationary ball of mass 3kg. If after collision, both balls move as a single
mass, then the loss in kinetic energy due to collision is
1) 100 J 2) 140 J 3) 40 J 4) 60 J
13. Statement – I : The capacity of a conductor, under given circumstance,
remains constant irrespective of the charge present on it.
Statement – II : Capacity depends on size and shape of conductor and also on
the medium.
14. Four point masses each of value m are placed at the corners of square (ABCD of
side l. The moment of inertia of this system about an aixs passing through A
and parallel to BD is
1) ml 2 2) 2ml 2 3) 3ml 2 4) 3ml 2

15. Imagine a new planet having the same density as that of Earth but it is 3 times
bigger than the Earth in size. If the acceleration due to gravity on the surface of
Earth is g and that on the surface of the new planet is g ' , then
1) g '  3g 2) g '  g / 9 3) g '  9 g 4) g '  27 g
16. When a tension F is applied, the elongation produced in uniform wire of length
l, radius r is e. When tension 2F is applied, the elongation produced in another
uniform wire of length 2l and radius 2r made of same material is
1) 0.5e 2) 1.0e 3) 1.5e 4) 2.0e
17. The depth to which a rubber ball be taken in deep sea so that its volume
decreased by 0.1%. (The bulk modulus of rubber is 9.8 108 N / m2 and the density
of sea water is 103kg/m3) is
1) 10m 2) 50m 3) 100m 4) 200m
18. A cylindrical metal rod of length L0 is shaped into a ring with a small gap as
shown. On heating the system.
1) Only x decreases, r and d increases

2) x and r increase, d decreases
3) x, r and d increase
4) Data insufficient to arrive at a conclusion

19. Radius of a conductor increases uniformly from left end to right end as shown
in the following figure.
Material of the conductor is isotropic and its curved surface is thermally

isolated from surroundings. Its ends are maintained at temperatures
T1 and T2(T1>T2): If, in steady state, heat flow rate is equal to H, then which of
the following graphs is correct?
20. A sample of an ideal gas is taken through a cycle as shown in the figure. It
absorbs 50J of energy during the process AB, no heat during BC, rejects 70J
during CA. 40J of work is done on the gas during BC. Internal energy of gas at
A is 1500J, the internal energy at C would be
1) 1590 J 2) 1630J 3) 1540J 4) 1570J

21. The displacement –time graph of a particle executing SHM is shown in the figue.
Which of the following statement is true?
3T
1) The force is zero at t  2) The acceleration is minimum at t  T
4
T
3) The velocity is minimum at t 
4
T
4) The P.E. is equal to K.E. of oscillation at t 
2
22. The frequency of fundamental note in an orgn pipe is 240Hz. On blowing air,
frequencies 720Hz and 1200HZ are heard. This indicates that the organ pipe is
1) Close at both ends 2) Close at one end
3) Open at both ends 4) Having holes like flute
23. A simple pendulum has a time period of ‘T’ in air. The bob of the simple
pendulum is completely immersed in a liquid of viscosity zero. The density of
1
liquid is th of the material of bob. If the bob is inside the liquid all the time, its
4
period of oscillation in this liquid is
4T 2T 2T 4T
1) 2) 3) 4)
15 15 3 3

24. Seven point charges, each of charge q, are placed at the seven corners of a cube
of side a (one corner is empty). Find the magnitude of electric field at the centre
of the cube.
1 q 1 q 1 7q
1) Zero 2) 3) 4)
4 0 a 2
3 0 a 2
4 0 a 2
 
25. A uniform electric field E  E0 iˆ  ˆj exists in the region. The potential difference
(VQ – VP) between point P(0, 0) and Q(a, 0) is
1)  E0 a 2) E0 2a 3)  E0 a 4)  E0 2a
26. Assertion (A) : The focal length of the mirror is f and distance of the object from
the focus is u. The magnification of the mirror is f/u.
Size of image
Reason (R) : Magnification 
Size of object
1) Both A & R are correct and R is correct explanation of A.
2) Both A & R are correct but R is not correct explanation of A.
3) A is correct but R is incorrect.
4) A is incorrect but R is correct
27. What is the current through the resistor R in the circuit shown in the figure?
The emf of each cell is  m and internal resistance is r.
m m 2 m 2 m
1) 2) 3) 4)
2R  r 2r  R R  2r 2R  r
28. In the given circuit, the resistnace of voltmeter is 400 and its reading is 20V.
Find the value of emf of battery.
1) 130/3V 2) 65V 3) 40V 4) 33.6V

29. A cylindrical conductor of radius R carries a current I. The value of magnetic
field at a point which is R/4 distance inside from the surface is 10T. Find the
value of magnetic field at point which is 4R distance outside from the surface
4 8 40 80
1) T 2) T 3) T 4) T
3 3 3 3
30. An infinitely long, straight conducotor AB is fixed and a current is passed
through it. Another movable straight wire CD of finite length and carrying
current is held perpendicular to it and released. Neglect the weight of the wire.
1) The rod CD moves upwards parallel to itself.

2) The rod CD moves downwards parallel to itself.
3) The rod CD moves upwards and turns clockwise at the same time
4) The rod CD moves upwards and turns anticlockwise at the same time.
31. A bar magnet has a magnetic moment of 2.5 JT-1 and is placed in a magnetic
field of 0.2T. Work done in turning the magnet from parallel to antiparallel
position relative to field direction is
1) 0.5 J 2) 1 J 3) 2J 4) 0J

32. A transformer with efficiency 80% works a 4kW and 100V. If the secondary
voltage is 200V, then the primary and secondary currents, respectively, are:
1) 40A, 16A 2) 16A, 40A 3) 20A, 40A 4) 40A, 20A
33. A plane-electromagnetic wave of wave intensity 6Wm-2 strikes a small mirror
area 40cm2, held perpendicular to the approaching wave. The momentum
transferred by the wave to the mirror each second is
1) 6.4107 kgms 2 2) 4.8 108 kgms 2 3) 3.2 109 kgms 2 4) 1.6 1010 kgms 2
34. A ball is dropped from a height of 20m above the surface of water in a lake. The
refractive index of water is 4/3. A fish inside the lake, in the line of fall of the
ball, is looking at the ball. At an instant, when the ball is 12.8m above the water
surface, the fish sees the speed of ball as (Take g = 10ms-2)
1) 9ms-1 2) 12 ms-1 3) 16ms-1 4) 21.33ms-1
35. A point object O is placed in front of a glass rod having spherical end of radius
of curvature 30cm. The image would be formed at
1) 30cm left 2) Infinity 3) 1cm to the right 4) 18cm to the left

36. In the far field diffraction pattern of a single slit under polychromatic
illumination, the first minimum with the wavelength 1 is found to be
coincident with the third maximum at  2 . Therefore.
1) 31  0.32 2) 31  2 3) 1  3.52 4) 0.31  32
37. A proton has kinetic energy E = 100keV which is equal to that of a photon. The
wavelength of photon is  2 and that of proton is 1 . The ratio of 1 / 2 is
proportional to
1) E 2 2) E 1/ 2 3) E 1 4) E 1/ 2
38. In Bohr model of hydrogen atom, linear momentum  Pn  of the electron depends
on the principal quantum number (n) as
1 1
1) Pn  2) Pn  n 3) Pn  n 2 4) Pn  2
n n
39. Here, Mp denotes the mass of a proton and Mn that of a neutron. A given
nucleus, of binding energy B, contains Z protons and N neutrons. The mass
M (N, Z) of the nucleus is given by (c is velocity of light)
1) M(N, Z) = NMn + ZMp+Bc2 2) M(N, Z) = NMn + ZMp-B/c2
3) M(N, Z) = NMn + ZMp+B/c 2 4) M(N, Z) = NMn + ZMp-Bc2
40. The diode shown in the circuit in the given figure has a constant potential drop
of 0.5V at all currents and a maximum power rating of 100 mW. What should
be the value of the resistnace R connected in series with the diode for obtaining
the maximum current?
1) 2 2) 3 3) 4 4) 5
41. The logic gate equivalent to the given logic circuit is
1) OR 2) AND 3) NOR 4) NAND

42. A conductor ABOCD moves along its bisector with a velocity of 1ms-1 through a
perpendicular magnetic field of 1Wb m-2, as shown in the figure. If all the four
sides are of 1 m length each, then the induced emf between points A and D is
1) 0 2) 1.41V 3) 0.71V 4) 1V
43. In a region of space, the electric field is in the x-direction and proportional to x,
that is , E  E0 xiˆ . Consider an imaginary cubical volume of edge a, with its edges
parallel to the axes of coordinates. The charge inside this cube is
1 1
1) Zero 2)  0 E0 a 3 3) E0 a 3 4)  0 E0 a 2
0 6
44. Two nuclei have their mass numbers in the ratio of 1 : 3. The ratio of their
nuclear densities would be
1
1) 1 : 3 2) 3 : 1 3) :1 4) 1 : 1
3
45. Assertion (A) : If momentum of a body increases by 50%, its kinetic energy will
increase by125%.
Reason (R) : Kinetic energy is proportional to square of velocity,
3) A is correct but R is incorrect. 4) A is incorrect but R is correct
CHEMISTRY
46. The electronegativity difference between N and F is greater than that of between
N and H, yet the dipole moment of NH3 (1.5 D) is larger than that of NF3 (0.2 D).
This is because
1) In NH3 as well as NF3 the atomic dipole and bond dipole are in opposite
directions
2) In NH3 the atomic dipole and bond dipole are in the opposite directions
whereas in NF3 these are in the same direction
3) In NH3 as well as in NF3 the atomic dipole and bond dipole are in same
direction
4) In NH3 the atomic dipole and bond dipole are in the same direction whereas
in NF3 these are in opposite directions
47. The stoichiometric coefficient of S in the following reaction
H 2 S  HNO3  NO  S  H 2O
is balanced (in acidic medium) :
1) 1 2) 2 3) 3 4) 4
48. Which of the following are correct here?
I) Stability in decreasing order N 2  N 2  N 22
II) Stability in decreasing order H 2  H 2  H 2
III) Number of Lone pair of electrons on central atoms in decreasing order
Cl2O>XeF2>XeO3
IV) cis but 2-ene> trans but 2-ene (dipole moment in decreasing order)
1) I, II 2) II, III 3) I, IV only 4) I, II, IV
49. Which of the following has lowest weight?
1) 6.023 1022 molecules of glucose 2) 18ml of water at 4o C
3) 11200ml of CH4 at STP 4) 5.6 litre of CO2 at STP
50. Wrong match among the following:
1) Li < Na < K < Rb Metallic nature
2) Li<Be<B<C Non-metallic nature
3) F2>Cl2>Br2>I2 Reducing power
.
4) Cl>F> S>O Negative electron gain enthalpy
.

51. The shortest wavelength of H-atom in the Lyman series is 1 . The longest
wavelength in the Balmer series of He  is
5 361 271 9
1) 1 2) 3) 4) 1
9 5 5 5
52. What would happend when a solution of potassium chromate is treated with an
excess of dilute nitric acid?
1) Cr2 O72  and H2O are formed 2) Cr3+ and Cr2 O72  are formed
2
3) CrO42 is reduced to Cr+3 4) Cr2O7 is reduced to CrO42
53. Which of the following shows higher vapour pressure at a given temperature?
1) 0.5molal aq.NaCl 2) 0.5molal aq.AlCl3
3) 0.5molal aq.Urea 4) 0.5molal aq.CaCl2
54. Which of the following pairs of isomers and types of isomerism are correctly
matched?
I) Co  NH 3 5  NO2   Cl2 and Co  NH 3 5  ONO   Cl2 - linkage isomerism
II) Cu  NH 3 4   PtCl4  and  Pt  NH 3 4  CuCl4  -co-ordination isomerism
III)  Pt  NH 3 4 Cl2  Br2 and  Pt  NH 3 4 Br2  Cl2 -ionisation isomerism
Select the correct answer using the codes given below:
1) I and II 2) II and III 3) I and III 4) I, II and III
55. The difference between heats of reaction at constant pressure and constant
volume for the reaction, 2C6 H 6  l   15O2  g  
12CO2  g   6 H 2O  l  at 25o C in kJ
is
1) +7.43 2) +3.72 3) -7.43 4) -3.72
56. In which of the following compounds colour is due to charge transfer

phenomenon.
1) KMnO4 2) K2Cr2O7 3) K2MnO4 4) Both 1 and 2
57. H2S, a toxic gas with rotten egg like smell, is used for the qualitative analysis. If
the solubility of H2S in water at STP is 0.195m. Calculate Henry law constant?
1) 289 bar 2) 386 bar 3) 192 bar 4) 465 bar
58. Which of the following has longest C-O bond length (Free C-O bond length in
CO is 1.12A0 )
 2
1) Ni  CO 4 2) Co  CO 4  3)  Fe  CO  4 

4)  Mn  CO 6 
59. For the reaction,
3  2 Fe  s   NH 3  g 
Fe2 N  s   H 2  g  
2
1) KC  K P  RT  2) KC  K P  RT  3) KC  K P  RT  4) KC  K P  RT 
1/ 2 3/ 2 1/ 2
60. The IUPAC name of the compound is
1)6-oxo-2-methyl hex-3-enamide 2) 6-keto-2-methyl hexanamide

3) 2-carbamoylhexanal 4) 2-carbamoylhex-3-enal
31
61. Given Ksp for Cr(OH)3 is 6 10 then determine OH   . (Neglect the
contribution of OH  ions from H2O)
1/ 4 1/ 4
 18   6 
1)   10 31  M 2) 18 1031  M 3)  6  1031  M
1/ 4 1/ 4
4)   10 31  M
 27   27 
62. Which of the given compounds can exhibit tautomerism?
1) 1 and 2 only 2) 2 and 3 only 3) 1 and 3 only 4) 1, 2 and 3

63. At 500 K, the half life period of a gaseous reaction at an initial pressure of 80
kPa is 350 s. When the pressure is 40 kPa, the half life period is 175 sec; the
order of the reaction is :
1) zero 2) one 3) two 4) three
64. A hydrocarbon C6H10 does not react with ammonical solution of Cu+ ions; it
adsorbs 2 mol of hydrogen on catalytichydrogenation to give 2-methylpentane.
The hydrocarbon adds one molecule of water on treatment with Hg2+/H2SO4.
The structure of given compounds is:
65. The rate constant of a reaction is given by, ln K  sec 1   14.34  1.25 104  / T . What
will be the energy of activation?
1) 24.83Kcal/mole 2) 12.42Kcal/mole 3) 49.96 Kcal/mole 4) None
66. In the reaction with HCl, an alkene reacts in accordance with the
Markownikoff’s rule to give a product 1-chloro 1-methyl cyclohexane the
possible alkene is ?
67. Statement I : Specific conductance decreases with dilution while molar

conductance increases.
Statement II : On dilution, number of ions per 1 ml solution decreases but
total number of ions present in solution increases.
1) If both statements are CORRECT, and statement II is the CORRECT
explanation of statement I
2) If both statements are CORRECT, and statement II is NOT the CORRECT
explanation of statement I
3) If statement I is CORRECT, but statement II is INCORRECT
4) If statement I is INCORRECT, but statement II is CRRECT
68. Which of the following order represents the increasing order of reactivity
towards Br  under SN 1 conditions?
I)Vinyl chloride II) Methyl chloride III) Ethyl chloride IV) Allyl chloride
1) IV < III < II < I 2) I< II < III < IV 3) II < I < III < IV 4) II < I < IV < III
69. The standard reduction potentials in acidic conditions are 0.77V and 0.53V,
respectively, for Fe3 Fe 2 and I 3 I  couples. The equilibrium constant for the
 2 Fe2  I 3 , is (2.303 RT/F = 0.06)
reaction : 2 Fe3  3I  
1) 2 108 2) 108 3) 104 4) 108
70. Assertion (A) : para-dichloro benzene has higher melting point than ortho-
dichloro-benzene.
Reason (R) : Melting point increases with increasing symmetry in the molecule.

71. The enthalpies of neutralisation of HClO4 and Cl3C – COOH are -13.7 kcal/g-
equivalent and -13.7 kcal/g-equivalent respectively.
When 40gm of solid NaOH is added to a mix of 1 gm mol. HClO4 and 1g mol.
Cl3C – COOH, sodium perchlorate and sodium trichloroacetate are formed in
molar ratio of 3 : 1. Then.
(HClO4 + Cl3Cl – COOH) and H for the reaction of NaOH with mix. Is -13.7 kcal
1) H for the reaction of NaOH with the mix is 6.45 kcal
2) H for the reaction of NaOH with the mix is 13.8 kcal
3) After reaction the total no. of moles of acid remained are
0.5(HClO4 & Cl3C – COOH)
4) After reaction the total wt. of acid remained is 147.75 gm.
72. An alcohol C5H11OH, on dehydration, gives an alkene, which on oxidation with
acidified KMnO4 at high temperature yields a mixture of a ketone and an acid.
The alcohol is
73. In the Kjeldahl’s method for estimation of nitrogen present in a soil sample,
ammonia evolved from 0.75 g of compound neutralised 10 mL of 1 M H2SO4.
The percentage of nitrogen in the soil is:
1) 37.33 2) 45.33 3) 35.33 4) 43.3
74. In the reaction product P is :
75. Ka for HCN is 5 1010 at 25o C . For maintaining a constant p H of 9, the volume
of 5M KCN solution required to added to 10mL of 2M HCN solution is
1) 4 mL 2) 7.95 mL 3) 9.3 mL 4) 2 mL
76. Given are cyclohexanol, (I), acetic acid (2) 4-nitrophenol, (3) and phenol (4). In
these, the order of decreasing acidic character will be
1) 3 > 4 > 2 > 1 2) 3 > 2 > 4 > 1 3) 2 > 3 > 1 > 4 4) 2 >3 > 4 >1
77. To the salt solution NH4Cl and NH4OH are added sufficiently. No ppt is formed.
Then H2S gas is passed where black ppt, soluble in aqua-regia is formed. Then
the cation of the given salt is
1) Zn2 2) Mn2 3) Ni 2 4) Mg 2
78. Which of the following compounds is most reactive towards nucleophilic
addition reactions?
79. The reagent that can selectively precipitate only S 2 from a mixture of S 2 and
SO42 in aqueous solution is
1) CuCl2 2) BaCl2 3) Pb(OOCCH3)2 4) Na2[Fe(CN)5NO]

80. Which of the following product(s) is formed when the compound
81. Determine the empirical formula of an oxide of iron which has 69.9% iron and
30.1% oxygen by mass [AW of Fe = 56]
1) FeO 2) Fe2O3 3) Fe3O4 4) Fe3O2
82. In order to prepare a 1 amine from an alkyl halide with simultaneous addition
0
of one CH2 group in the carbon chain, the reagent used as source of nitrogen is
______
1) Sodium amide, NaNH2 2) Sodium azide, NaN3
3) Potassium cyanide, KCN 4) Potassium phthalimide, C6H4(CO)2N-K+
83. On heating a mixture of NaCl, K2Cr2O7 and conc.H2SO4 which of the following is
formed?
1) CrO2Cl 2) CrO2Cl2 3) CrOCl2 4) NaClO2
84. Hoffmann Bromamide Degradation reaction is shown by _____
1) ArNH2 2) ArCONH2 3) ArNO2 4) ArCH2NH2
85. In a given sample of hydrogen gas electrons are excited to 6th orbit and returned
to ground state. Then the electronic transition (n2  n1) with least wave length
corresponds to
1) 6  5 2) 2  1 3) 5  2 4) 6  1
86. In Disaccharides, if the reducing groups of monosaccharides i.e. aldehydic or
ketonic groups are bonded, these are non-reducing sugars. Which of the
following disaccharide is a non-reducing sugar?
87. 80 mL of KMnO4 solution oxidizes completely 2.52g of H2C2O4.2H2O present in a

solution, in acidic medium. The molarity of the given KMnO4 solution is
1) 0.5M 2) 0.1M 3) 5M 4) 1M

88. Three structures are given below in which two glucose units are linked. Which
of these linkages between glucose units are between C1 and C4 and which
linkages are between C1 and C6?
1) (1) is between C1 and C4, (2) and (3) are between C1 and C6
2) (1) and (2) are between C1 and C4, (3) is between C1 and C6
3) (1) and (3) are between C1 and C4. (2) is between C1 and C6
4) (1) and (3) are between C1 and C6, (2) is between C1 and C4
89. Which one of the following orders is not in accordance with the property stated
agains it?
1) F > Cl > Br >I ; electronegativity
2) F2 > Cl2 > Br2 > I2 ; bond dissociation energy
3) F2 > Cl2 > Br2 > I2 ; oxidizing power
4) HI > HBr > HCl > HF ; acidic property in water
90. The noble gas which is least abundant is
1) Rn 2) Ar 3) Kr 4) Xe
BIOLOGY
91. The genetic material of causal agent of PSTD is different from genetic material of
casual agent of Tobacco mosaic disease as former
1) Has ssRNA
2) Is composed of deoxyribose sugar
3) Has genetic material of low molecular weight
4) Both 1 and 3
92. Alternaria
A) Asexually reproduces by conidia .
B) Lacks sex organs but shows sexual reproduction
C) Produces ascospores
Choose the correct one(s)
1) A and B 2) A only 3) B and C 4) A and C
1) Indigofera – Medicine 2) Sida – Medicine
3) Candytuft – Ornamental 4) Lupine-ornamental
94. Which of the following is an incorrect match
1) Perigynous flower - Plum, rose and peach
2) Monoadelphous - Pea
3) Epigynous flower - Guava, cucumber and ray florets of sunflower
4) Polyadelphous - Citrus
95. Match the following:
(I) Anthers fused (A) Ray floret
(II) Panicle (B) Rice
(III) Epicalyx (C) Cotton
(IV) Four free petals (D) Disc floret
(V) Incomplete flower (E) Mustard
(I) (II) (III) (IV) (V) (I) (II) (III) (IV) (V)
1) A B C D E 2) D B C E A
3) A E C B D 4) D C B A E

96. Identify the correct statement for the given stage
1) Chromosomes at anaphase
2) All the chromosomes are aligned on a single equatorial plate
3) The centromeres of the chromosomes are arranged in two rows at the equator
4) Transition to metaphase
97. Statement-I : A male gamete moves towards micropylar end and fuses with
synergid cells to form triploid primary endosperm nucleus
Statement II : Embryo develops at chalazal end of the embryo sac
1) Only S-I is correct 2) Only S-II is correct
3) Both S-I and S-II are correct 4) Both S-I and S-II are incorrect
98. Select the incorrect match from the following
1) Sunflower-Alternate phyllotaxy 2) Australian acacia- expanded lamina
3) Alstonia- Whorled phyllotaxy 4) Venus-fly trap- Leaf modification
99. Assertion (A) : Carotenoids are also called shield pigments
Reason (R) : Carotenoids protect plants from excessive heat and prevent photo-
oxidation of Chlorophyll-a pigments
1) Both A & R are correct and R is the correct explanation of A
2) Both A & R are correct but R is not the correct explanation of A
3) Both A & R are false 4) A is true and R is false
100. Suberin layer is found in
1) Conjuctive tissue 2) Pericycle 3) Hypodermis 4) Endodermis
101. In dicot stem
1) Vascular bundles are conjoint, open and arranged in a ring
2) Xylem is endarch 3) Collenchymatous hypodermis
4) All are correct
102. During which of the following steps in the complete oxidation of glucose,
substrate level phosphorylation occurs?
1) Glyceraldehyde-3-phosphate to 1, 3 biphosphoglyceric acid
2) Succinyl-CoA to succinic acid
3) Succinic acid to fumaric acid 4) Citric acid to isocitric acid
103. Consider the following physiological effects of a particular plant growth
regulator and identify it
A. In plant propagation, it initiates rooting in stem cutting
B. It helps to prevent early stage fruit or leaf drop
C. Its application on tomatoes can induce parthenocarpy
1) Cytokinin 2) Gibberellins 3) Auxin 4) Ethylene
104. Widening of tree trunk is mostly due to the activity of
1) Phelloderm 2) Vascular cambial ring
3) Primary xylem 4) Secondary phloem
COLUMN-I COLUMN-II
A) Lysosome I. Has cis and trans faces
B) Golgi apparatus II. Not included in endomembrane system
C) Peroxisome III. Rich in hydrolytic enzymes
D) Vacuole IV. Contains excretory products
1) A-IV, B-I, C-III, D-II 2) A-III, B-IV, C-I, D-II
3) A-III, B-I, C-II, D-IV 4) A-IV, B-II, C-I, D-III

106. In a given section of an embryo of grass, select the mark which correctly label
the scutellum
1) D 2) B 3) A 4) C
107. Select the cyanobacteria which can fix atmospheric nitrogen in aquatic and
terrestrial environment
1) Azospirillum 2) Glomus 3) Azotobacter 4) Anabaena
108. In which among the following plant groups some members show the events
precursor to the seed habit?
1) Bryophyta 2) Gymnosperm 3) Angiosperm 4) Pteridophyta
109. Zygotene is important because of
1) Formation of synaptonemal complex along the length of homologous
chromosome
2) Crossing over
3) Chiasmata formation
4) Initiation of condensation and coiling of chromatin fibre
110. Find the incorrect match w.r.t respiratory substrates and their RQ.
1) Tripalmitin- 0.7 2) Proteins- 0.9
3) Carbohydrates -1 4) Oxalic acid -0.6
111. Statement-I : Bacterial structure is very simple but their behaviour is very
complex
Statement-II : Bacteria as a group show most extensive metabolic diversity
1) Only S-I is correct 2) Only S-II is correct
112. Read the following statements and state them as a true (T) or false (F)
A. In angiosperms, the egg cell is the final product of sexual reproduction
B. Root cap enclosed in an undifferentiated sheath is called coleoptile
C. The wall of ovary develops into pericarp
D. In false fruit, thalamus may also contribute in the fruit formation
1) A-T,B-T,C-F,D-T 2) A-T,B-F,C-T,D-F
3) A-F,B-F,C-T,D-T 4) A-F,B-T,C-T,D-F
113. How many reductional divisions are required for the production of 1000 male
gametes starting from the pollen mother cell.
1) 250 2) 500 3) 125 4) 100
114. Number of oxidation reactions occur in cytosol during the oxidation of one
glucose molecule.
1) 1 2) 2 3) 3 4) 4
COLUMN-I COLUMN-II
I) Cliestogamy A. Orchids
II) Reduced second cotyledon of monocot seed B. Viola
III) Coleorrhiza C. Scutellum
IV) Smallest seeds D. Epiblast
E. Present around the radicle
of monocot
1) I-B, II-D, III-E, IV-A 2) I-D, II-B, III-A, IV-E
3) I-A, II-E, III-B, IV-D 4) I-B, II-A, III-E, IV-E

116. Match the following group I and II
Group-I Group-II
A. Amyloplast I. Carbohydrates
B. Elaioplast II. Xanthophyll
C. Aleuroplast III. Protein
D. Chromoplast IV. Fat
E. Chloroplast V. Chlorophyll
1) A-I, B-II, C-IV, D-II, E-V 2) A-I, B-IV, C-III, D-II, E-V
3) A-IV, B-I, C-III, D-II, E-V 4) A-III, B-IV, C-I, D-II, E-V
117. Sister chromatids are separate during
1) Anaphase-II 2) Anaphase 3) Telophase-I 4) Both 1 and 2
118. The protons for reduction of NADP+ are taken from
1) Stroma 2) Lumen of thylakoid 3) Cytoplasm 4) Matrix
119. First cell of male gametophyte and female gametophyte in angiospermic plants
respectively.
1) Megaspore & microspore
2) Microspore and megaspore
3) Pollen mother cell & megaspore mother cell
4) Megaspore mothercell & pollen mother cell
120. A flower has 16 ovules in their ovary, find the minimum number of pollengrains
required to fertilize them
1) 32 2) 48 3) 16 4) 8
121. Which of the following posses vascular tissues but lack seeds?
1) Mosses 2) Volvox 3) Ferns 4) Liverworts
122. The percentage of ab gametes produced by AaBb parent will be
1) 25 2) 12.5 3) 50 4) 75
123. A test cross is carried out to
1) Determine the genotype of a dominant phenotype at F2
2) Predict whether two traits are linked
3) Asses the number of alleles of a gene
4) Determine whether two species or varieties will breed successfully
124. How many complexes are involved during the e- transport of E.T.S. if one
molecule of NADH+ H+ of mitochondria undergo oxidation ?
1) 4 2) 5 3) 2 4) 3
125. How many amino acids will be coded by the mRNA sequence -
5’CCCUCAUAGUCAUAC3’ if a adenosine residue is inserted after 12th
nucleotide?
1) 5 amino acids 2) 6 amino acids 3) 2 amino acids 4) 3 amino acids
126. Select the correct match.
1) Valine – UUU 2) Glycine – AGU
3) Tryptophon-UGG 4) Alanine - UUC
127. Choose correct option w.r.t. origin of cork cambium in dicot stem and root
1) Completely primary in both
2) Completely secondary in both
3) Partially primary and partly secondary in both
4) Primary in stem and secondary in root
128. In Hershey and Chase experiment, the protein of T2 phage was made radioactive
by using
1) S32 2) P31 3) S35 4) P32
129. Which one of the following generally act as on antagonist to gibberellins
1) Ethylene 2) ABA 3) IAA 4) Zeatin
130. The offspring of AAbb × aaBB is crossed with, aabb. The genotypic ratio of
progeny will be
1) 9:3:3:1 2) 1:2:1 3) 1:1:1:1 4) 1:1
131. Find the wrong matched pair
1) Roquefort cheese - Ripened by a fungus
2) Swiss cheese - Has large holes that are produced by a fungus
3) Pencillin - Obtained from a mould
4) Ethanol - Produced by yeast
132. It is not a secondary metabolite
1) Abrin 2) Codeine 3) Concanavalin-A 4) Lecithin

133. Algae with floridean starch as reserved food material is also characterized by
1) Presence of chlorophyll b 2) Stacked thylakoids
3) Nonsulphated phycocolloids 4) Nonflagellate of spores and gametes
134. Plants which are not differentiated into roots, stems and leaves are
1) Algae 2) Gymnosperms 3) Pteridophytes 4) Angiosperms
135. All enzymes are proteins except
1) RuBisCo 2) DNA polymerase 3) RNA polymerase 4) Ribozyme
136. What percentage of the earth’s land area is covered by all biodiversity hotspots
put together?
(1) Around 6% (2) More than 10% (3) Less than 2% (4) More than 15%
137. Match the following by choosing the correct option:
a. Family i. tuberosum
b. Kingdom ii. Polymoniales
c. Order iii. Solanum
d. Species iv. Plantae
e. Genus v. Solanaceae
Options
1) i – d, ii – c, iii – e, iv – b, v – a 2) i – e, ii – d, iii – b, iv – a, v – c
3) i – d, ii – e, iii – b, iv – a, v – c 4) i – e, ii – c, iii – b, iv – a, v – d
138. Which of the following are monoecious?
Ascaris, Wuchereria, Fasciola, Nereis, Pheretima, Hirudinaria, Taenia
1) 5 2) 2 3) 3 4) 4
139. The cold blooded animal with a four chambered heart is _______
1) Pavo 2) Salpa 3) Crocodile 4) Myxine
140. Assertion (A): Digestive system of platyhelminthes is incomplete.
Reason(R): They have single opening to outside of the body, serve as both
mouth as well as anus.
3) A is correct and R is incorrect 4) Both A and R are incorrect
141. Select the correct statement.
1) Glucagon is a hypoglycemic hormone.
2) Insulin acts on pancreatic cells and adipocytes.
3) Insulin is a hyperglycemic hormone.
4) Glucocorticoids stimulate gluconeogenesis.
142. Flippers of Penguins and Dolphins are examples of
1) Convergent evolution 2) Industrial melanism
3) Natural selection 4) Adaptive radiation
143. Decreased level of which hormone can play a significant role in osteoporosis?
1) Aldosterone 2) Progesterone 3) Thymosin 4) Estrogen
144. In which of the following interactions both partners are adversely affected?
(1) Predation (2) Parasitism (3) Mutualism (4) Competition
145. Use of bioresources by multinational companies and other organisations without
authorisation from the concerned country and its people is called
1) Bio-fortification 2) Biopiracy 3) Bioexploitation 4) Biodegradation
146. A ‘new’ variety of rice was patented by a foreign company, though such varieties
have been present in India for a long time. This is related to
1) Co-667 2) Sharbati Sona 3) Basmati 4) Sona masuri
147. EC (expiratory capacity) is equal to
1) ERV + TV 2) IRV+ TV 3) VC + RV 4) ERV + TV + IRV
148. Assertion: Frogs are beneficial to humans
Reason: Frogs eat insect and protect our crops
(1) Both the assertion and the reason are true and the reason is a correct
explanation of the assertion.
(2)Both the assertion and reason are true but the reason is not a correct
(3) Assertion is true but the reason is false. (4)Assertion and reason are false.
149. Respiratory control centres lies in
1) Pons 2) Medulla oblongata 3) Both (1) and (2) 4) Cerebellum

150. Which of the following is correct statement about leucocytes?
1) They are non nucleated.
2) They are approximately in an average of 60000–80000 mm-3 of blood cells in
numbers.
3) Two main types are found they are granulocytes and agranulocytes.
4) Monocytes are most abundant WBCs.
151. Apex of heart is
1) Upper and tilted toward left 2) Lower and tilted towards left
3) Upper and tilted towards right 4) Lower and tilted towards right
152. Each tropic level has a certain mass of living material at a particular time called
(1) Standing state (2) Standing crop (3) Ecological pyramid (4) GPP
153. Select the total number of excretory organs from the following found in various
animals:
Protonephridia, SA node, nephridia, Hepatic Caecae, , Malpighian tubules,
green glands, kidney, ommatidia.
1) 4 2) 5 3) 6 4) 7
154. Select the correct matching of the type of the joint with the example in human
skeletal system.
Type of joint Example
1) Cartilaginous joint - Between frontal and parietal bones in cranium
2) Pivot joint- Between third and fourth cervical vertebrae
3) Hinge joint - Between humerus and pectoral girdle
4) Gliding joint- Between carpals
155. Stimulation of a muscle fibre by a motor neuron occurs at
1) The neuromuscular junction 2) The transverse tubules
3) The myofibril 4) The sarcoplasmic reticulum
156. Which of the following animals does not undergo indirect development?
1) Earthworm 2) Ctenoplana 3) Starfish 4) Rana
157. The nerve centres which control the body temperature and the urge for eating
are contained in
1) Hypothalamus 2) Pons 3) Cerebellum 4) Thalamus
158. Find out the correct statement from the following:
I) Hormones interact with membrane bound receptors normally do not enter
the target cells.
II) Iodothyronines have membrane bound receptors.
III) Hormones which interact with intracellular receptors mostly regulate gene
expression.
IV) Steroid hormones generate second messengers.
1) I and II only 2) II and III only 3) I and III only 4) II and IV only
159. Of the following statements, which one is true for Mons Pubis?
1) It is the region of pubic hair growth found in females as well as males.
2) It is a cushion of proteins covered by skin and pubic hair.
3) It is a cushion of fats covered by skin and pubic hair.
4) It is a part of female internal genitalia.
160. Relaxin is secreted by
1) Ovary 2) Uterus 3) Cervix 4) Oviduct
161. Which of the following is not a copper releasing IUD?
1) CU T 2) Multiload 375 3) Cu 7 4) Progestasert
162. Which one of the following is the most widely accepted method of contraception
for females in India at present?
1) Tubectomy 2) IUDs (Intrauterine Devices) 3)Diaphragms 4) Cervical caps
163. The following features belong to Down’s syndrome?
A) Furrowed tongue
B) Palm is broad with characteristic palm crease
C) Physical, psychomotor and mental development is retarded
D) Tall stature with small round head
1)3 2) 2 3) 4 4) 1

164. Mother and father of a person with ‘0’ blood group have ‘A’ and ‘B’ blood group,
respectively. What would be the genotype of both mother and father?
1) Mother is homozygous for ‘A’ blood group and father is heterozygous for ‘B’.
2) Mother is heterozygous for ‘A’ blood group and father is homozygous for ‘B’.
3) Both mother and father are heterozygous for ‘A’ and ‘B’ blood group,
respectively.
4) Both mother and father are homozygous for ‘A’ and ‘B’ blood group,
respectively.
165. Select the false statements.
(A) Dryopithecus was more man-like.
(B) Ramapithecus was more Man-like.
(C) Dryopithecus and Ramapithecus both were hairy and walked like gorillas and
chimpanzees.
(D) Australopithecines lived in the East African grasslands probably 3–4 mya.
1) B only 2) B and C only 3)A and D only 4) A only
166. The factors affecting genetic equilibrium are the following except
1) Gene flow 2) Mutation 3) Somatic variation 4) Genetic recombination
167. Malarial parasites require two hosts. They are
1) Humans, female Anopheles mosquito 2) Humans, Aedes aegypti
3) Snail, female Anopheles mosquito 4) Cattle, Aedes aegypti
168. Foetus receives ________ from mother through the placenta during pregnancy.
1) Antigens 2) Antibodies 3) T-cells 4) B-cells
169. If regular dose of drugs/alcohol is abruptly discontinued it causes ________.
1) Hallucinations 2) Withdrawal syndrome
3) Diversion to criminal activities 4) Fever and Cough
170. Identify the vertebrate group of animals characterized by crop and gizzard in its
digestive system
1) Amphibia 2) Reptilia 3) Osteichthyes 4) Aves
171. Which one of these animals is not a homeotherm?
1) Macropus 2) Chelone 3) Psittacula 4) Camelus
172. According to Darwin which competition is a potent force in organic evolution?
1) Inter-specific 2) Intra-specific 3) intergenic 4) intragenetic
173. Match the columns:
(I) Fragmentation (A) Precipitation of water soluble nutrients as
unavailable salt
(II) Leaching (B) Break down of detritus into smaller particles
(III) Catabolism (C) Break down of humus into inorganic nutrients
(IV) Mineralisation (D) Degradation of detritus by bacterial and fungal
enzymes
1) I–B, II–A, III–D, IV--C 2) I–B, II–C, III–A,IV—D
3) I–C, II–B, III–A,IV--D 4) I–C, II–A, III–D,IV--B
174. Secondary spermatocytes give rise to
1) Diploid spermatids 2) Haploid sperm
3) Diploid sperm 4) Haploid spermatid
175. Match Column-I (Place) with Column-II (Number of bird species).
Column–I Column –II
I. Colombia A. 1200
II. New York B. 1300
III. India C. 1400
IV. Amazonian rain forest D. 105
1) A:III, B:IV, C:II, D:I 2) A:II, B:I, C:IV, D:III
3) A:II, B:IV, C:III, D:I 4) A:III, B:IV, C:I, D:II
176. Amensalism is an association between two species where
(1) One species is harmed and other is benefitted.
(2) One species is harmed and other is unaffected.
(3) One species is benefitted and other is unaffected.
(4) Both the species are harmed

177. What would be the heart rate of a person if the cardiac output is 5 L, blood
volume in the ventricles at the end of diastole is 100 mL and at the end of
ventricular systole is 50 mL?
1) 125 beats per minute 2) 50 beats per minute
178. Match the following organisms with their respective characteristics :
(a) Pila (i) Flame cells
(b) Bombyx (ii) Comb plates
(c) Pleurobrachia (iii) Radula
(d) Taenia (iv) Malpighian tubules
Select the correct option from the following :
(a) (b) (c) (d) (a) (b) (c) (d)
1) (iii) (ii) (iv) (i) 2) (iii) (ii) (i) (iv)
3) (iii) (iv) (ii) (i) 4) (ii) (iv) (iii) (i)
179. Variations caused by mutation, as proposed by Hugo de Vries are

1) Small and directionless 2) Random and directional
3) Random and directionless 4) Small and directional
180. If both parents are carriers for sickle-cell anaemia, which is an autosomal
recessive disorder, what are the chances of pregnancy resulting in an affected
child?
1) No chance 2) 50% 3) 25% 4) 100%
*******

: ANSWER KEY:
1 2 11 1 21 1 31 2 41 1
2 4 12 4 22 2 32 1 42 2
3 2 13 1 23 3 33 4 43 2
4 4 14 3 24 3 34 3 44 4
5 3 15 1 25 1 35 1 45 1
6 4 16 2 26 4 36 3
7 1 17 3 27 4 37 2
8 1 18 3 28 1 38 1
9 1 19 2 29 2 39 2
10 2 20 1 30 3 40 4
SUB:CHEMISTRY
46 4 56 4 66 4 76 4 86 2
47 3 57 1 67 1 77 3 87 2
48 3 58 3 68 2 78 1 88 3
49 3 59 1 69 2 79 1 89 2
50 3 60 1 70 1 80 2 90 1
51 4 61 2 71 4 81 2
52 1 62 1 72 2 82 3
53 3 63 1 73 1 83 2
54 4 64 2 74 3 84 2
55 3 65 1 75 4 85 4
SUB : BOTANY
91 3 101 4 111 3 121 3 131 2
92 2 102 2 112 3 122 1 132 4
93 1 103 3 113 3 123 1 133 4
94 2 104 2 114 2 124 4 134 1
95 2 105 3 115 1 125 3 135 4
96 4 106 3 116 2 126 3
97 4 107 4 117 4 127 2
98 2 108 4 118 1 128 3
99 1 109 1 119 2 129 2
100 4 110 4 120 3 130 3
136 3 146 3 156 1 166 3 176 2
137 1 147 1 157 1 167 1 177 4
138 4 148 1 158 3 168 2 178 3
139 3 149 3 159 3 169 2 179 3
140 1 150 3 160 1 170 4 180 3
141 4 151 2 161 4 171 2
142 1 152 2 162 2 172 1
143 4 153 2 163 1 173 1
144 4 154 4 164 3 174 4
145 2 155 1 165 3 175 4

XII- NEET GT - 4
answer sheet.

PHYSICS Mr.BKR
CHEMISTRY Mr.GOVARDHANREDDY
BOTANY Mr.M.BASHA
ZOOLOGY Mrs.SUNDARI
PHYSICS
   z 
1. Pressure depends on distance as, P  exp   , where  ,  are constants, z
  k 
is distance, k is Boltzmann’s constant and  is temperature. The dimensions
of  are
1) M o LoT o 2) M 1 L1T 1 3) M o L2T o 4) M 1 LT
1 2
2. A ball is dropped vertically from a height d above the ground in his the ground
and bounces up vertically to a height d/2. Neglecting subsequent motion and
air resistances, its velocity v varies with the height h above the ground as
3. A boat which has a speed of 5 km/hr in still water crosses a river of width 1 km
along the shortest possible path in 15 minute. The velocity of the river in
km/hr is
1) 1 2) 3 3) 4 4) 41
4. The pulleys and strings shown in the figure are smooth and of negligible mass.
For the system to remain in equilibrium, the angle  should be
1) 0o 2) 30o 3) 45o 4) 60 o
5. Two blocks A and B of masses 2m and m, respectively are connected by a
massless and inextensible string. The whole system is suspended by a
massless spring as shown in the figure. The magnitude of acceleration of A and
B, immediately after the string is cut between A and B, are respectively
1) g, g/2 2) g/2, g 3) g,g 4) g/2, g/2

6. A particle of mass m is moving in a circular path of constant radius r such that
its centripetal acceleration ac is varying with time ‘t’ as ac  k 2 rt 2 where ‘k’ is a
constant. The power delivered to the particle by the force acting on it is
1) 2 mk r t
2 2 2 2
2) mk r t 3)
 
mk 4 r 2t 5
4) zero
2
7. A spring of force constant k is cut into two pieces such that one piece is double
the length of the other. Then the long piece will have a force constant of
1) (2/3)k 2) (3/2)k 3) 3k 4) 6k
8. A wind-powered generator converts wind energy into electrical energy. Assume
that the generator converts a fixed fraction of the wind energy intercepted by its
blades into electrical energy. For wind speed v, the electrical power output will
be proportional to
1) v 2) v2 3) v3 4) v4

9. An isolated particle of mass m is moving in horizontal plane (x-y) along the x-
axis ( at a certain height) above the ground. It suddenly explodes into two
fragments of masses m/4 and 3m/4. An instant later, the smaller fragment is
at y = + 15 cm. The larger fragment at this instant is at
1) y = - 5 cm 2) y = + 20 cm 3) y = + 5 cm 4) y = - 20 cm
10. A thin circular ring of mass M and radius r is rotating about its axis with a
constant angular velocity ω. Two objects each of mass m, are attached gently to
the opposite ends of a diameter of the ring. The wheel now rotates with an
angular velocity.
M   M  2m  M   M  2m 
1) 2) 3) 4)
 M  m  M  2m   M  2m  M
11. A thin wire of length L and uniform linear mass density  is bent into a circular
loop with centre at O as shown. The moment of inertia of the loop about the
axis XX’ is
1)  L3 / 8 2 2)  L3 /16 2 3) 5 L3 /16 2 4) 3 L3 / 8 2
12. If the radius of the earth were to shrink by one percent, its mass remaining the
same, the acceleration due to gravity on the earth’s surface would
1) decrease 2) remain uncharged
3) increase 4) none of these
13. A simple pendulum has a time period T1 where on the earth’s surface, and T2
when taken to a height R about the earth’s surface, where R is the radius of the
earth. The value of T2 / T1.
1) 1 2) 2 3) 4 4) 2
14. A large open tank has two holes in the wall, One is a square hole of side L at the
depth y from the top and the other is a circular hole of radius R at a depth 4y
from the top. When the tank is completely filled with water, the quantities of
water flowing out per second from both holes are the same. Then R is equal to
L L
1) 2)  L 3) L 4)
2 2
15. The below graph shows the extension ( ∆l ) of a wire of length 1 m suspended
from the top of a root at one end and with a load W connected to the other end.
If the cross-sectional area of the wire is 10-6m2, calculate the Young’s modulus
of the material of the wire. ∆l ( x 10-4 m)
1) 2  1011 N / m 2 2) 2  10 11 N / m 2 3) 3  1012 N / m 2 4) 2  10 13 N / m 2

16. Three rods of identical cross-sectional area and made from the same metal form
the sides of an isosceles triangle ABC, right-angled at B. The points A and B are
maintained at temperatures T and   2 T respectively. In the steady state, the
temperature of the point C it TC. Assuming that only heat conduction takes
place, TC/T is
3 3 3 4
1) 2) 3) 4)
2 1 2 1 3 2 1  2 1

17. A cylinder radius R, made of a material of thermal conductivity K1, it is sounded
by a cylindrical shell of inner radius R and outer radius 2R made of a material
of thermal conductivity K2. The two ends of the combined system are
maintained at two different temperatures. There is no loss of heat across the
cylindrical surface and the system is in steady state. The effective thermal
conductivity of the system is
1) K1 + K2 2) K1K2 (K1+K2) 3) (K1+3K2)/4 4) (3K1 + K2)/4
18. The ratio of the speed of sound in nitrogen gas to that in helium gas, at 300 K is
1)  2 / 7  2) 1/ 7  3)  3 / 5 4)  6  / 5
19. A monoatomic ideal gas, initially at temperature T1, is enclosed in a cylinder
fitted with a frictionless piston. The gas is allowed to expand adiabatically to a
temperature T2 by releasing the piston suddenly. If L1 and L2 are the lengths of
the gas column before and after expansion respectively, then T1/T2 is given by
7/3 2/3
L  L L L 
1)  1  2) 1 3) 2 4)  2 
 L2  L2 L1  L1 
20. If 1 g of steam is mixed with 1g of ice, then resultant temperature of the mixture
is
1) 100oC 2) 230oC 3) 270oC 4) 50oC
21. Two bodies M and N of equal masses are suspended from two separate massless
spring of spring constants k1 and k2 respectively. If the two bodies oscillate
vertically such that their maximum velocities are equal, the ratio of the
amplitude of vibration of M to that of N is
k k1 k k2
1) 1 2) 3) 2 4)
k2 k2 k1 k1
22. A simple pendulum has time period T1. The point of suspension is now moved
upward according to the relation y=Kt2,(K=1m/s2) where y is the vertical
T2
displacement. The time period now becomes T2. The ratio of 12 is (g = 10
T2
m/s2).
1) 5/6 2) 6/5 3) 1 4) 4/5
23. Consider the following statements and select the incorrect statement(s):-
I. If work is done on a body against some force, then kinetic energy must be
change.
II. No work done on earth by sun when it revolves around the sun in a perfectly
circular orbit
III. K.E. can never be negative
1) I only 2) II only 3) I and II 4) I, II and III
24. Two vibrating strings of the same material but lengths L and 2L have radii 2r
and r respectively. They are stretched under the same tension. Both the
strings vibrate in their fundamental modes, the one of the length L with
frequency f1 and the other with frequency f2. The ratio f1/f2 is given by
1) 2 2) 4 3) 8 4) 1
25. If the magnitude of sum of two vectors is equal to the magnitude of difference of
the two vectors, the angle between these vectors is
1) 45o 2) 180o 3) 0o 4) 90o
26. A 2μF capacitor is charged as shown in figure. The percentage of its stored
energy dissipated after the switch S is turned to position 2 is
1) 0% 2) 20% 3) 75% 4) 80%

27. A convex lens makes a real image 16 cm long on a screen. When the lens is
shifted to a new position without disturbing the object then again 4 cm tall real
image is obtained on screen. Then the length of object is
1
1) cm 2) 8 cm 3) 12 cm 4) 20 cm
4
28. The current i in the circuit ( see fig) is
1) (1/45) ampere 2) (1/15) ampere 3) (1/10) ampere 4) (1/5) ampere

29. The internal resistance of a 2.1 V cell which gives a current of 0.2 A through a
resistance of 10 Ω is
1) 0.8 Ω 2) 1.0 Ω 3) 0.2 Ω 4) 0.5 Ω
30. Circular loop of a wire and a long straight wire carry currents Ic and Ie
respectively as shown in figure. Assuming that these are placed in the same
plane, the magnetic fields will be zero and the center O of the loop, when
separation H is
Ie R IR I I
1) 2) c 3) c 4) e
I c I e Ie R Ic R
31. A conducting circular loop of radius r carries a constant current i. It is placed
in a uniform magnetic field Bo such that Bo is perpendicular to the plane of
the loop. The magnetic force acting on the loop is
1) irBo 2) 2 irBo 3) zero 4)  irBo
32. A particle of charge q and mass m moves in a circular orbit of radius r with
angular speed ω. The ratio of the magnitude of its magnetic moment to that of
its angular momentum depends on
1) ω and q 2) ω, q and m 3) q and m 4) ω and m
33. A thin circular ring of area A is held perpendicular to a uniform magnetic field
of induction B. A small cut is made in the ring and a galvanometer is connected
across the ends such that the total resistance of the circuit is R. When the ring
is suddenly squeezed to zero area, charge following through the galvanometer is
BR AB B2 A
1) 2) 3) ABR 4)
A R R2
34. A thin semicircular conducting ring of radius R is falling with its plane vertical
in horizontal magnetic induction B . At the position MNQ the speed of the ring is
v, and the potential difference developed across the ring is
1) zero 2) BvR2/2 and M is at higher potential

3)  RBv and Q is at higher potential 4) 2RBv and Q is at higher potential

35. When an AC source of emf   Eo sin 100t  is connected across a circuit, the
phase difference between the emf  and the current i in the circuit is observed
to be  / 4 , as shown in the diagram. If the circuit consists possibly only of R-C
or R-L or L-C in series, find the relationship between the two elements.
1) R  1 k , C  10  F 2) R  1 k , C  1  F
3) R  1 k , L  10  F 4) R  1 k , L  1  F
36. A glass prism of refractive index 1.5 is immersed in water ( refractive index 4/3).
A light beam incident normally on the face AB is totally reflected to reach on the
face AC if
8 2 8 8
1) sin   2)  sin   3) sin   4) none of these
9 3 9 9
37. A plane E.M. wave propagating in x-direction has wavelength 10 mm. The
V
electric field is in the y direction and its maximum magnitude is 30 . Write
m
suitable equation for magnetic field as a function of ‘x’ and ‘t’. ( Wave is in
vacuum)
1) By  107 sin  6  1010 t  200 x  2) Bx  107 sin  6  1010 t  200 x 
3) Bz  30 sin  6  1010 t  200 x  4) Bz  107 sin  6  1010 t  200 x 
38. Match column I (Physical Variable) with column II (Expressions). (n = number of
gas molecules present per unit volume, k = Boltzmann constant, T = absolute
temperature, m = mass of the particle)
Column I Column II
A. Most probable velocity 1. nkT
B. Energy per degree of freedom 2.  3kT / m 
C. Pressure 3.  2kT / m 
D. R.M.S velocity 4. kT/2
1) A – 3, B – 4, C – 1, D – 2 2) A – 1, B – 2, C – 3, D - 4
3) A – 4, B – 3, C – 1, D – 2 4) A – 3, B – 4, C – 2, D - 1
39. In Young’s double slit experiment, the separation between the slits is halved
and the distance between the slits and the screen is doubled. The fringe width
is
1) unchanged 2) halved 3) doubled 4) quadrupled
40. Twi coherent monochromatic light beams of intensities I and 4I are superposed.
The maximum and minimum possible intensities in the resulting beam are
1) 5I and I 2) 5I and 3I 3) 9I and I 4) 9I and 3I

41. The maximum kinetic energy of photoelectrons emitted from a surface when
photons of energy 6 eV fall on it is 4 eV. The stopping potential in Volts is
1) 2 2) 4 3) 6 4) 10
42. The wavelength of the first spectral line in the Balmer series of hydrogen atom is
o
6561 A . The wavelength of the second spectral line in the Balmer series of
singly-ionized Helium atom is
o o o o
1) 1215 A 2) 1640 A 3) 2430 A 4) 4687 A
43. Assertion (A) : An induced current has a direction such that the magnetic field
due to the current opposes the change in the magnetic flux that induces the
current.
Reason (R) : Above statement is in accordance with conservation of energy.
44. The circuit shown in the figure contains two diode each with a forward
resistance of 50 ohm and with infinite backward resistance. If the battery
voltage is 6V, the current through the 100 ohm resistance ( in ampere ) is
1) zero 2) 0.02 3) 0.03 4) 0.036

45. Which of the following statements is not true?
1) The resistance of intrinsic semiconductor decreases with increase of
temperature
2) Doping pure Si and trivalent impurities gives p-type semiconductors.
3) The majority carries in n-type semiconductors are holes.
4) A p-n junction can act as a semiconductor diode.
CHEMISTRY
46. How many mole of Zn(FeS2) can be made from 2 mole zinc, 3 mole iron and 5
mole Sulphur?
1) 2 mole 2) 3 mole 3) 4 mole 4) 5 mole
47. The correct IUPAC name of the following compound is:
1) 1-Bromo-1-ethyl-2-fluoro-2-iodo-1-nitroethane
2) 3-Bromo-4-fluoro-4-iodo-3-nitrobutane
3) 2-Bromo-1-fluoro-1-iodo-2-nitrobutane
4) 1-Fluoro-1-iodo-2-bromo-2-ethyl-2-nitroethane
48. The first ionisation potential of Na is 5.1 eV. The value of electron gain enthalpy
of Na+ will be:
1) –2.55 eV 2) –5.1 eV 3) –10.2 eV 4) +2.55 eV
49. Mole fraction of ethanol in ethanol water mixture is 0.25. Hence percentage
concentration of ethanol by weight of mixture is:
1) 25% 2) 75% 3) 46% 4) 54%

50. Find the number of total structurally isomeric 3° amides with molecular formula
C5H11NO:
1) 2 2) 3 3) 4 4) 5
51. The solubility product of a salt having general formula MX2, in water is 4 × 10–
12. The concentration of M2+ ions in the saturated aqueous solution of the salt
(In terms of solubility) is:

1) 2.0 × 10–6M 2) 1.0 × 10–4M 3) 1.6 × 10–4M 4) 4.0 × 10–10M
52. Which of the following alkyl halide is not suitable for Williamson ether synthesis
method?
CH 3
1) CH2 = CH - Cl 2) Cl 3) CH 3  C  Cl 4) All the above
CH 3
53. Which of the following amine does’t gives isocyanide test?
NH2 CH2 – NH2
1) CH3CH2NH2 2) 3) 4) CH3 – NH – CH2CH3
NH–CO–CH3
(1) Nitration
54. (2) H2O
major product. Major product is
NHCOCH3 NHCOCH3 NHCOCH3 NH2

NO2
1) 2) 3) 4)
NO2
NO2 NO2
55. To the given salt solution dilute HCl is added and H2S gas is passed. No specific
precipitate is formed but when H2S gas passed in the presence of NH4OH
solution then white coloured precipitate is formed. Then the cation present in
the given salt solution is
1) Ni 2 2) Zn2 3) Cu 2 4) Pb 2
56. Match the following columns.
1) Ammonical AgNO3 a) Detect (or) confirm the position of double
bonds
2) I2/NaOH b) Presence of strongly acidic groups
3) NaHCO3 c) Presence acetylinic groups (or) –CHO group
4) Ozonolysis d) Presence of CH3 – CH(OH) –
Codes :
1 2 3 4 1 2 3 4
1) a b c d 2) d c b a
3) c d b a 4) a c b d
57. Five moles of a gas is put through a series of changes as shown graphically in a
cyclic process the A → B, B → C and C → A respectively are:
1) Isochoric, Isobaric, Isothermal 2) Isobaric, Isochoric, Isothermal

3) Isothermal, Isobaric, Isochoric 4) Isochoric, Isothermal, Isobaric
58. Rate of formation of SO3 in the following reaction 2SO2 + O2 → 2SO3 is 100g
min–1. Hence rate of disappearance of O2 is:
1) 50 g min–1 2) 40 g min–1 3) 200 g min–1 4) 20 g min–1

59. The bond dissociation energies of gaseous H2, Cl2 and HCl are 104, 58 and
103 kcal mol–1 respectively. The enthalpy of formation for HCl gas will be:
1) – 44.0 kcal 2) – 22.0 kcal 3) 22.0 kcal 4) 44.0 kcal
60. The mass of glucose that should be dissolved in 100 g of water in order to
produce same lowering of vapour pressure as is produced by dissolving 1 g of
urea (mol. mass = 60) in 50 g of water is:
1) 1g 2) 2g 3) 6g 4) 12g
61. Out of the given two isomers which property for second is greater than first:
1) Dipole moment 2) Boiling point 3) Solubility in H2O 4) Melting point

62. D-Fructose (C6H12O6) has IUPAC name (3L,4D,5D)1,3,4,5,6-
Pentahydroxyhexan-2-one. Its last asymmetric carbon atom (C-5) has D-
configuration. The correct stereochemical formula of D-Fructose is:
63. The actinoids exhibit more number of oxidation states in general than the
lanthanoids. This is because:
1) The actinoids are more reactive than the lanthanoids.
2) The 5f orbitals extend further from the nucleus than the 4f orbitals.
3) The 5f orbitals are more buried than the 4f orbitals towards nucleus
4) There is a similarity between 4f and 5f orbitals in their angular part of the
wave function
64. The data for the reaction, A + B → C is:
1) r = k [B]3 2) r = k [A]3 3) r = k [A] [B]4 4) r = k [A]2 [B]2

65.
66. The correct order of the thermal stability of hydrogen halides (H – X) is:
1) HI > HBr > HCl > HF 2) HF > HCl > HBr > HI
3) HCl < HF < HBr < HI 4) HI > HCl < HF < HBr
67. What will be the major product of the following reaction?

68. Which of the following is not correctly matched?
1) NO2 - Monodentate as well as ambidentate ligand
2) Ethylenediamine – Bidentate ligand with same donorsites
3) SCN  - Monodentate as well as ambidentate ligand
4) (CO) – Monodentate weak field ligand
69. Given : EFe o
3
/ Fe
 0.036V, EFe
o
2
/ Fe
 0.439V .
The value of standard electrode potential for the following change.
Fe3  e  
 Fe2  will be :
1) 0.385V 2) 0.770V 3) -0.270V 4) -0.072V
70. Give correct sequences of reaction for following conversion:
71.
72. Which of the following is given in wrong order?

1) F  Cl  Br  I  IP1
2) I   Br   Cl   F   Ionic radius
3) F  Cl  Br  I  Negative electron gain enthalpy
4) Cl2  Br2  F2  I 2  Bond dissociation enthalpy
73. Which of the following is not present in DNA?
1) Adenine 2) Guanine 3) Thymine 4) Uracil
74. Acetaldehyde and benzaldehyde can be distinguished by
1) 2,4-D.N.P.H 2) Tollen’s reagent 3) Fehlings test 4) All of these
75. In which of the following complex ion, the metal ion will have t26g , eg0
configuration according to CFT?
3 4 2
1)  FeF6  2)  Fe  CN 6  3)  Fe  CN 6  4)  Fe  H 2O  6 
3
 
76. Which one of the following sets of monosaccharides forms sucrose?
1) -D-galactopyranose & -D-glycopyranose
2) -D-glucopyranose & -D-fructofuranose
3) -D-glucopyranose & -D-fructofuranose
4) -D-glucopyranose & -D-fructopyranose
77. In Arrhenius plot, intercept is equal to
E
1)  a 2) ln A 3) ln K 4) log10 a
R
78. What is correct order of bond length of Cl–O bond?
1) ClO4  ClO3  ClO2  ClO  2) ClO   ClO2  ClO3  ClO4
3) ClO3  ClO2  ClO4  ClO  4) ClO2  ClO3  ClO4  ClO 

79.
80. The emf of the following cell at 25o C is ________volt.

Zn  s  / Zn 2  0.01M  // Au 3  0.01M  / Au  s 
0
given EZn 2
/ Zn
 0.76V , E Au
0
3
/ Au
 1.4V .
1) 2.16 2) -2.16 3) 2.14 4) 2.18
81. Which of the following set of quantum numbers is impossible?
1 1
1) n  4, l  1, m  0, s   2) n  3, l  0, m  0, s  
2 2
1 1
3) n  3, l  1, m  2, s   4) n  2, l  1, m  1, s  
2 2
82. Which of the following statement is incorrect?
1) NF3 molecule has a planar geometry
2) I 3 and XeF2 are isostructural
3) AlN has more lattice enthalpy than Al2O3
4) Dipolemoment of H2O is more than that of HF
83. The solubility of CaF2 is 2 104 moles/lit. Its Ksp will be
1) 32 1012 2) 16 1012 3) 4 1012 4) 8 1012
84. Which of the following can not be oxidised to give carboxylic acid?
85. 0.2g of an organic compound was analysed by Kjeldahl’s method. The ammonia
evolved was absorbed in 60ml N/5 H2SO4. Unused acid required 40ml of N/10
NaOH for complete neuralisation. The percentage of nitrogen in the compound
is
1) 46% 2) 65% 3) 56% 4) 80%
86. How many coulombs of electricity are required for the oxidation of 1 mole H2O
to O2?
1) 1.93 105 C 2) 93 105 C 3) 19.3 105 C 4) 13.9 104 C
87. In the reaction :
Which of the following compounds will be formed?
88. In which of the following reactions, the equilibrium remains unaffected on

addition of small amount of argon at constant volume?

1) H 2  g   I 2  g   2HI  g 

2) PCl5  g   PCl3  g   Cl2  g 

3) N 2  g   3H 2  g   2 NH3  g 
4) The equilibrium will remain unaffected in all the three cases

89. Mark the correct increasing order of reactivity of the following compounds with
HBr/HCl.
1) A < B < C 2) B < A < C 3) B < C < A 4) C < B < A
90.
BIOLOGY
91. Select the wrong statement w.r.t kingdom: Monera:
1) Both the structure and behaviour of bacteria are simple.
2) Mycoplasma do not survive without oxygen.
3) Bacilli form spores during favourable conditions. 4) All of the above.
92. Select the correct pair.
1) Ray floret – A5 2) Disc floret – A5
3) Chinarose – G1 4) Sunflower G
93. Centrioles are duplicated in animal cells during:
1) G1- phase 2) S- phase 3) G2- phase 4) M- phase
94. White spots disease on the leaves of mustard is caused by:
1) Albugo 2) Aspergillus 3) Agaricus 4) Alternaria
95. Cypsella fruit is product of
1) Half superior ovary 2) Superior ovary
3) Inferior ovary 4) Multiovulate ovary
96. Select the incorrect statement of the following:
1) Desmids are chief producers in the oceans.
2) Dinoflagellates are used in the filtration of oils and syrups.
3) Euglenoids have two equal size flagella. 4) All of the above.
97. Viroids differ from Prions in --------------------:
1) RNA without capsid coat 2) Abnormally folded proteins
3) Being infectious to animals 4) Causing mad cow disease
98. Which of the following is correct w.r.t imperfect fungi?
1) Possess aseptate and coenocytic mycelium
2) Reproduce sexually by oospores
3) Include truffles and morels 4) Reproduce asexually by conidia
99. Which of the following organisms were not classified in the five-kingdom
classification system by R.H. Whittaker:
(a) Chlorella and Chlamydomonas (b) Amoeba and Paramecium
(c) Lichens and Prions (d) Viruses and Viroids
1) Both (a) and (b) 2) Only (b) 3) Both (c) and (d) 4) (a), (b), (c) and (d)
100. The correct floral formula of Brassicaceae is

101. In cymose inflorescence __________:
1) The peduncle has unlimited growth
2) The main axis terminates with a flower
3) The flowers are borne in acropetal order 4) All of these
102. Dicot root differs from monocot root in:
1) Having radial vascular bundles 2) Having exarch xylem
3) Showing secondary growth 4) Having root hair
103. Identify the following phases (A), (B), and (C) of meiosis:
1) A= Prophase-I, B= Metaphase-II, C= Metaphase- I

2) A= Metaphase-II, B= Metaphase- I, C= Prophase-II
3) A= Metaphase-II, B= Prophase-I, C= Metaphase- I
4) A= Metaphase-I, B= Telophase-I, C= Anaphase-I
104. Phloem parenchyma does not store:
1) Food 2) Tannins 3) Mucilage 4) Latex
105. The paramount importance of algae is:
1) Primary producers of energy-rich compounds
2) Producers of hydrophilic colloids
3) Used as food by space travellers 4) Used to produce iodine
106. Assertion (A): Chlorophyll- a is the chief pigment of photosynthesis in plants.
Reason (R): Chlorophyll- a shows peaks at blue and red wavelengths in the
action spectrum and absorption spectrum.
1) Both (A) and (R) are false.
2) Both (A) and (R) are true and (R) correctly explains (A).
3) (A) is true but (R) is false.
4) Both (A) and (R) are true and (R) does not correctly explain (A).
107. If the sequence of coding strand of DNA is 5`GGCCTTAATGGCG3`, what will be
the sequence of mRNA formed from its template strand?
1)5`CCGGAAUUACCGC3` 2) 3`GGGGAATTACGCC5’
3) 3’GGCCAAUUACCGC5` 4) 5’GGCCUUAAUGGCG3`
108. Which of the following is incorrect w.r.t bundle sheath cells in C4- plants?
(A) Several layers of cells surrounding vascular bundles
(B) Intercellular spaces are present
(C) Do not permit gaseous exchange
(D) CO2 concentration is increased due to decarboxylation of C3- acid.
1) A and B 2) B and C 3) B and D 4) A and D
109. Assertion (A): Respiration is an amphibolic pathway.
Reason (R): Carbohydrates, proteins, and lipids are not only degraded also
synthesized in respiratory pathway.
1) (A) is true and (R) is false.
2) Both (A) and (R) are true and (R) does not correctly explain (A).

110. Select the correct match of the following:
COLUMN – I COLUMN - II
(I) Ladybird A) Nitrogen fixer in paddy fields
(II) Cyanobacteria B) Mycobiont in Mycorrhiza
(III) Rhizobium C) Controls Aphids
(IV) Glomus D) Symbiotic nitrogen fixer
1) I- D, II- A, III- B, IV- C 2) I- B, II- A, III- D, IV- C
3) I- C, II- A, III- D, IV- B 4) I- C, II- D, III- B, IV- A
111. Which one of the following statement is incorrect in relation to
photorespiration?
1) It is a characteristic of C3 plants.
2) The RuBP binds with O2 to form one molecule of phosphoglycerate and
phosphoglycolate.
3) There is synthesis of ATP or NADPH.
4) It occurs in daytime.
(I) IAA A) Adenine
(II) Zeatin B) Indole compound
(III) GA3 C) Ethephon
(IV) Ehtylene D) Terpenes
113. Lac- operon is a:
1) Regulation of enzyme synthesis by its product.
2) Regulation of enzyme synthesis by its substrate.
3) Regulation of enzymes of lactose biosynthesis. 4) All of the above
114. The percentage of hybrid DNA (N15 -N14) in E. coli in Meselson and Stahl
experiment after 60min. of DNA replication is:
1) 25% 2) 50% 3) 75% 4) 100%
115. S- I: Cholesterol is a 27-carbon lipid.
S- II: Lysine is an aromatic aminoacid.
1) S- I is true & S- II is false 2) S- I is false & S- II is true
3) Both S-I & S-II are true 4) Both S- I & S- II are false
116. Early seed production in conifers is promoted by:
1) ABA 2) GA 3) 2, 4- D 4) Kinetin
117. All of the following are characteristics of insect-pollinated flowers, except:
1) Colourful, fragrant 2) Sticky pollen grains
3) Floral rewards 4) Long ribbon-like pollen grains
118. In the EMP- pathway or glycolysis, two redox equivalents are removed from:
1) 3- PGA 2) G-3P 3) Pyruvate 4) 1,3 –BPGA
119. Which of the following processes take place in the matrix of mitochondria?
(a) Formation of acetyl CoA (b) Citric acid cycle
(c) ETS (d) Glycolysis
1) Only- (a) 2) Only- (c) 3) Both (b) and (d) 4) Both (a) and (b)
120. The residual, persistent nucellus is found in the seeds of:
1) Arhar 2) Beet 3) Coconut 4) Maize
121. S- I: Mendel’s law of independent assortment applies to the genes located on the
same chromosome.
S- II: The AB blood groups of humans show co-dominance.
1) S- I is true & S- II is false 2) S- I is false & S- II is true
3) Both S-I & S-II are true 4) Both S- I & S- II are false

(I) Ribozyme A) Methyl GTP
(II) UTR B) Ochoa enzyme
(III) Polynucleotide phosphorylase C) Methionine
(IV) Initiator tRNA D) 23S rRNA

123. Select the incorrect statements of the following:
(A) The DNA polymerases can initiate DNA replication on their own.
(B) All reference point while defining a transcription unit is made with coding
strand.
(C) Inheritance of a character is not affected by the regulatory sequences of a
structural gene.
(D) RNA polymerase catalyses the opening of DNA helix during transcription.
1) A and C 2) B and C 3) A and B 4) A and D
124. Which of the following enzyme contains haem as the prosthetic group?
1) Carboxy peptidase 2) Peroxidase 3) Catalase 4) Both 2 and 3
125. Arrange the following in descending order based on their number.
a) Number of carbons in   KGA b) Microsporangia in typical anther
c) Carbons in palmitic acid
d) Number of round and yellow seeds in dihybrid cross
1) b, a, d, c 2) a, b, c, d 3) c, a, b, d 4) c, d, a, b
126. The BOD of sewage was significantly reduced in ---------------------- tank of STP:
1) Anaerobic sludge digester 2) Primary settling tank
3) Aeration tank 4) Activated sludge tank
127. Bacterial transformation was inhibited by ------------- enzyme during the
experiment which proved DNA as Griffith’s transforming principle:
1) Protease 2) RNase 3) DNase 4) All of these
128. Which of the following groups of plants have underground stems
1) Potato, Ginger, Turmeric, Euphorbia, Zaminkhand
2) Potato, Ginger, Turmeric, Zaminkhand, Colocassia
3) Potato, Citrus, Opuntia, Zaminkhand, Colocassia
4) Potato, Cucumber, Water melon, Zaminkhand, Colocassia
129. Assertion (A): Proteins show lateral movements within a bilayer.
Reason (R): Lipids show quasi-fluid nature in a bilayer.
1) (A) and (R) are true and (R) correctly explains (A).
2) (A) and (R) are true and (R) does not correctly explain (A).
3) (A) is true and (R) is false. 4) Both (A) and (R) are false.
130. Select the correct statement of the following:
1) Growth is determinate in the leaves, flowers, and fruits of plants.
2) A single root apical meristem in maize increases in size up to 3,50,000 times.
3) In plants, growth and differentiation are not open forms.
4) All of these.
131. RNA is the genetic material in:
1) φ X-174 2) E. coli 3) QB- bacteriophage 4) All of these
132. Which of the following forms a barrier between the materials present inside the
nucleus and that of cytoplasm?
1) Periplasmic space 2) Intermembrane space
3) Perimitochondrial space 4) Perinuclear space

133. Cells are much thickened at corners due to the deposition of cellulose,
hemicellulose, and pectin. This is the characteristic of:
1) Parenchyma 2) Collenchyma 3) Sclereids 4) Bast fibres
134. When a snapdragon plant bearing pink flowers was selfed, 39 plants had red
flowers and 39 plants had white flowers. How many plants will have pink
flowers in this experiment?
1) 39 2) 69 3) 78 4) 138
135. Mendel’s law of independent assortment is related to the orientation of
chromosomes at:
1) Anaphase of mitosis 2) Metaphase-I of Meiosis-I
3) Anaphase-I of meiosis-I 4) Anaphase-II of meiosis- II
136. Glucagon acts mainly on the ____, Insulin acts mainly on_________
1) Adipocytes, Hepatocytes only 2) Adipocytes, Adipocytes only
3) Hepatocytes, Adipocytes only 4) Hepatocytes, hepatocytes and adipocytes
137. Glucocorticoids stimulate all except
1) Proteolysis 2) Lipolysis
3) Glycogenolysis 4) Gluconeogenesis
138. A pregnant female delivers a baby who suffers from stunted growth, mental
retardation, low intelligence quotient and abnormal skin. This is the result of
1) Cancer of the thyroid gland 2) Over secretion of pars distalis
3) Deficiency of iodine in diet 4) Low secretion of growth hormone
139. Assertion (A): cAMP serves as the second messenger for protein hormones.
Reason (R): Cortisol is a steroid hormone.
3) A is correct and R is incorrect. 4) Both A and R are incorrect
140. The cerebral cortex is referred to as
1) White matter – axon 2) White matter - cell bodies
3) Grey matter – myelinated axon 4) Grey matter – cell bodies
141. During the transmission of nerve impulse through a nerve fibre, the potential on
the inner side of the plasma membrane has which type of electric charge?
1) First positive, then negative and continue to be negative
2) First negative, then positive and continue to be positive
3) First negative, then positive and again back to negative
4) First positive, then negative and again back to positive
142. Which one of the following statements is true:
1) Head of the humerus bone articulates with acetabulum of pectoral girdle.
2) Femur bone articulates with acetabulum of pelvic girdle.
3) Head of humerus bone articulates with glenoid cavity of pelvic girdle
4) Thigh bone articulates with glenoid cavity of pectoral girdle.
143. Which of the following leads to muscle relaxation?
1) Hydrolysis of ATP into ADP 2) Release of calcium from ER
3) Release of calcium from troponin
4) Formation of cross – linkages between actin and myosin
144. Match the column I and II.
(A) Amoeboid movement (P) Movement of our limbs
(B) Ciliary movement (Q) Spermatozoa
(C) Muscular movement (R) Trachea
(D)
.
Flagellar movement (S) Macrophages and leucocytes
.
(A) (B) (C) (D) (A) (B) (C) (D)

1) R P Q S 2) S R P Q
3) P R Q S 4) Q P R S

145. Which of the following would help in prevention of diuresis?
1) Reabsorption of sodium and water from renal tubules due to ADH.
2) Hyposecretion of aldosterone.
3) Decrease in secretion of renin by JG cells.
4) More water reabsorption due to ANF.
146. Match the following columns
(A) Glycosuria (I) Accumulation of uric acid in joints
(B) Renal calculi (II) Inflammation of glomeruli
(C) Glomerulonephritis (III) Mass of crystallized salts with in the kidney
(D).
Gout (IV) Presence of glucose in urine
.
(A) (B) (C) (D) (A) (B) (C) (D)

1) I III II IV 2) III II IV I
3) IV III II I 4) IV II III I
147. Podocytes are
1) Endothelial cells of the glomerulus
2) Endothelial cells of the Bowman’s capsule
3) Epithelial cells of the Bowman’s capsule
4) Epithelial cells of the glomerulus
148. Agranulocytes responsible for immune response of the body are
1) Basophils 2) Neutrophils 3) Eosinophils 4) Lymphocytes
149. Identify the correct statement
I. Arteries are blood vessels that carry blood away from the heart
II. Aorta is the main artery leaving the heart
III. Pulmonary artery is the only artery that carries oxygen to the lungs.
1) I & III 2) I & II 3) II & III 4) All are correct
150. Assertion (A): The solubility of CO2 is 20-25 times higher than that of O2.
Reason (R): The total thickness of the respiratory membrane is much less than
a millimeter.
151. The partial pressure of oxygen in the alveoli of the lungs is
1) Equal to that in the blood 2) More than that in the blood
3) Less than that in the blood 4) Less than that of carbon dioxide in alvedi
152. Consider the following statements.
I. Thoracic chamber which contain lungs is anatomically a sound-tight
chamber.
II. Change in the volume of thoracic cavity does not affect the pulmonary cavity.
Select the correct option.
1) I is true, II is false 2) Both I and II are true
3) I is false, II is true 4) Both I and II are false
153. Select the incorrect statement from the following statements.
1) Sensory papillae are organs of touch in frogs.
2) Nasal epithelium in frogs is cellular aggegration around nerve endings.
3) Compound eyes of frog are highly developed.
4) External ears are not found in frogs.
154. Which of the following statements are correct?
I. Producers constitute the first trophic level of a detritus food chain.
II. Productivity of an aquatic ecosystem is less than that of a terrestrial
ecosystem.
III. A given species may occupy more than one trophic level in the same
ecosystem at the same time.
1) I and III 2) I and II 3) Both II and III 4) Only II

155. Read the following four features (A-D)
I. Gill–slits are covered by ‘’operculum’’
II. The skin is tough, containing minute placoid scales.
III. In male, pelvic fins bear claspers
IV. Air bladder is present which regulates buoyancy.
Out of these how many features are not exhibited by cartilaginous fishes?
1) Three 2) Two 3) One 4) Four
156. Fertilisation is internal in
1) Bufo, Clarias, Pavo 2) Neophron, chameleon, Scoliodon
3) Rana tigrina, Psittacula, Scoliodon
4) Hippocampus, Rana tigrina, Testudo
157. Pneumatic bones are expected to be found in
1) Calotes 2) Betta 3) Columba 4) Rana
158. Which of the following statements is incorrect?
1) Female cockroach possesses sixteen ovarioles in the ovaries.
2) Cockroach exhibits mosaic vision with less sensitivity and more resolution.
3) A mushroom shaped gland is present in the 6th and 7th abdominal segments
of male cockroach.
4) A pair of spermatheca is present in the 6th segment of female cockroach.
(I) Family (P) melongena
(II) Kingdom (Q) Polymoniales
(III) Order (R) Datura
(IV) Species (S) Plantae
(V) Genus (T) Solanaceae
1) T S Q P R 2) T Q S P R
3) P Q R S T 4) P Q S R T
160. Approximate number of species of mammals in Amazon forest
1) 900 2) 600 3) 427 4) 300
161. Read the following statements about male reproductive system and choose the
incorrect statements from the given options.
I. It is located in the pelvis region
II. The testes are situated outside the abdominal cavity within a pouch called
scrotum
III. Each testis has about 350 testicular tubules.
IV. Penis, the male external genitalia is made up of special tissue to facilitate
insemination.
1) I and III 2) III and IV 3) I and IV 4) Only III
162. Assertion (A) : Graafian follicle ruptures and release secondary oocyte (ovum).
Reason (R) : Rapid secretion of LH leads to its maximum level during the mid
cycle called LH surge.
163. In which stage primary oocyte completes its first meiotic division?
1) Primary follicle 2) Secondary follicle
3) Tertiary follicle 4) Graafian follicle
164. Evolutionary changes through natural selection takes place at the
1) Organism level 2) Population level 3) Ecosystem level 4) Biosphere level

A. In India, family planning program was initiated in 1982.
B. Reproductive and Child Health Care (RCH) program is an improved version of
family planning programs.
1) A is true, B is false 2) Both A and B are true
3) A is false, B is true 4) Both A and B are false
166. Multiload 375 helps to prevent pregnancy by
1) Releasing copper ions which suppress sperm motility
2) Releasing progestogens which make cervix hostile for sperms
3) Inhibiting ovulation and menstrual cycle
4) Preventing the entry of sperms into the cervix.
167. Match the following columns
.
. Column – I Column - II
(A) XX-XO method of sex determination (I) Turner’s syndrome
(B) XX-XY method of sex determination (II) Female heterogametic
(C) Karyotype – 45 (III) Grasshopper
(D) ZW-ZZ method of sex determination (IV) Female homogametic
(A) (B) (C) (D) (A) (B) (C) (D)
1) IV II I III 2) II IV I III
3) I IV II III 4) III IV I II
168. Statement – I: Polyploidy condition occurs due to failure of cytokinesis after
telophase stage of cell division.
Statement – II: Polyploidy condition transmitted from male parent to female
offspring only.
1) Both statements-I and II are true
4) Both statements-I and II are false
169. Select the incorrect statement
1) In sequence annotation, whole set of genome is sequenced.
2) For sequencing, a small portion of DNA is isolated from the cell
3) Commonly used vectors in HGP were YAC and BAC.
4) The fragments of human genome were sequenced using automated DNA
sequencer.
170. Satellite DNA in human genome
A. Does not code for proteins B. Found in excessive amount
C. Shows high degress of polymorphism
Which of the following option is most appropriate?
1) A and B are correct 2) Only B is correct
3) A, B, C are correct 4) A and C are correct
171. Given below is the diagrammatic representation of Miller’s experiment. Which of
the following options correctly describe all the labels?
1) A - Spark, B – Electrodes, C – Condenser, D – Gases

2) A - Electrodes, B – Spark, C – Gases, D – Condenser
3) A - Condenser, B – Spark, C – Gases, D – Electrodes
4) A - Spark, B – Condenser, C – Gases, D – Electrodes

172. Consider the following statements about fossils:
A. Rock sediments of different ages contain fossils of life forms that died during
the formation of that particular layer of sediment.
B. Fossil records are based on the sequence of occurrence of fossils in various
strata of sedimentary rocks.
1) Both A and B are true 2) A is true and B is false
3) Both A and B is false 4) A is false but B is true.
173. Threat of extinction of gymnosperm species in the world at present.
1) 29 per cent 2) 30 per cent 3) 32 per cent 4) 31 per cent
174. Match the placental mammals given in column I to their corresponding
Australian marsupials given in column II
(I) Flying squirrel A) Tasmanian tiger cat
(II) Bobcat B) Tasmanian wolf
(III) Wolf C) Spotted cuscus
(IV) Lemur D) Flying phalanger
(I) (II) (III) (IV) (I) (II) (III) (IV)

1) A D B C 2) D A B C
3) D B A C 4) D A C B
175. Morphine is extracted from
1) Leaves of Cannabis sativa 2) Latex of Papaver somniferum
3) Fruits of Erythroxylum coca 4) Flowers of Datura
176. Which of the following statement is correct?
1) Pyramid of number in grassland ecosystem is upright.
2) Pyramid of number in aquatic ecosystem is inverted.
3) Pyramid of biomass in terrestrial ecosystem is inverted.
4) Pyramid of biomass in aquatic ecosystem is upright.
177. Computed tomography uses ‘A’ to generate a three dimensional image of the
internals of an object. Here ‘A’ is
1) X-rays 2) γ -rays 3) α -rays 4) UV rays
178. The side-effects of the use of anabolic steroids in males include
1) Breast enlargement 2) Decreased sperm production
3) Reduction of size of the testicles 4) All of these
179. Which of the following can be thought for increasing food production by using
biotechnology in agriculture.
I.Agrochemical based agriculture II. Organic agriculture
III. Genetically engineered crop based agriculture
IV. Conventional methods based agriculture
1) I and IV 2) I, II and III 3) II and IV 4) II, III and IV
180. The Mycorrhizae are
1) Commensalism between fungi and algae
2) Mutualism between fungi and algae
3) Mutualism between fungi and roots of higher plants
4) Mutualism between legumes and Rhizobium
*******

: ANSWER KEY :
1 3 11 4 21 4 31 3 41 2
2 1 12 3 22 2 32 3 42 1
3 2 13 4 23 1 33 2 43 1
4 3 14 1 24 4 34 4 44 2
5 2 15 1 25 4 35 add 45 3
6 2 16 2 26 4 36 1
7 2 17 3 27 2 37 4
8 3 18 3 28 3 38 1
9 1 19 4 29 4 39 4
10 3 20 1 30 1 40 3
SUB:CHEMISTRY
46 1 56 3 66 2 76 2 86 1
47 3 57 1 67 3 77 2 87 3
48 2 58 4 68 4 78 2 88 4
49 3 59 2 69 2 79 2 89 3
50 4 60 3 70 3 80 4 90 1
51 2 61 4 71 1 81 3
52 4 62 4 72 3 82 1
53 4 63 2 73 4 83 1
54 4 64 2 74 3 84 4
55 2 65 2 75 3 85 3
SUB : BOTANY
91 4 101 2 111 3 121 2 131 3
92 2 102 3 112 2 122 1 132 4
93 2 103 3 113 2 123 1 133 2
94 1 104 2 114 1 124 4 134 3
95 3 105 1 115 1 125 4 135 2
96 4 106 2 116 2 126 3 136
97 1 107 4 117 4 127 3 137
98 4 108 3 118 2 128 2 138
99 3 109 3 119 4 129 1 139
100 3 110 3 120 2 130 1 140
136 4 146 3 156 2 166 1 176 1
137 3 147 3 157 3 167 4 177 1
138 3 148 4 158 2 168 2 178 4
139 2 149 2 159 1 169 2 179 2
140 4 150 1 160 3 170 3 180 3
141 3 151 2 161 4 171 2
142 2 152 4 162 1 172 1
143 3 153 3 163 3 173 4
144 2 154 3 164 2 174 2
145 1 155 2 165 3 175 2

XII- NEET GT - 5
answer sheet.

PHYSICS Mr.G.NAGARAJ
CHEMISTRY Mr.VENKATESWARARAO
BOTANY Mr.M.BASHA
ZOOLOGY Mr.SOMESWARA RAO
PHYSICS
1. Susceptibility is large and positive for
1) para magnetic 2) diamagnetic 3) ferro magnetic 4) electromagnetic
2. A body of mass 0.4 kg moving initially with a constant speed of 10 ms-1 to north
is subjected to a constant force of 8 N directed towards south. At t = 0 if it is at
x =0, then its position at t = 5 s is
1) -200m 2) zero 3) +500m 4) -250m
3. A child sits stationary at one end of a trolley of mass 60 kg and length 5m
moving with a constant velocity 5 ms-1. He gets up on the trolley and moves
towards the other end with 1 ms-1 velocity. The velocity of center of mass of
(trolley + child) system will be
1) 1.25 ms-1 2) 5 ms-1 3) 16 ms-1 4) Zero
4. The 100 g bob of a pendulum of length 0.8 m is released from a position where
string is horizontal. The speed aquired by the bob when the string becomes
vertical is (g = 10ms–2)
1) 4 m/s 2) 8 m/s 3) 2 m/s 4) 10 m/s
5. A capillary tube when placed vertically in a liquid, the capillary rise is 2 cm.
Angle of contact between the material of the capillary tube and liquid is 300. If
the same capillary tube is inclined at angle 600 with vertical, the length of liquid
in the capillary tube will be (sufficient length of tube is available outside the
liquid in each case)
4
1) 2 cm 2) cm 3) 4 cm 4) 3cm
3
6. Which of the following is wrong ?
a) Average kinetic energy of a molecule of an ideal gas is independent of
temperature of the gas.
b) A molecule confined to move in a plane has only two translational
degrees of
freedom
1) Both a and b 2) Neither a nor b 3) only a 4) only b
7. A meter scale is balanced on a knife edge at its center. When two coins of mass
5g each are placed at 12 cm and 20 cm mark, the scale is balanced at 40 cm.
The mass of the meter scale is
1) 16g 2) 24g 3) 48g 4) 33g
8. A hoop of radius 1.5 m has mass of 50 kg. It rolls along a horizontal surface
with
speed of center of mass 25 cms-1. Work done to stop it is
1) 3.125J 2) 6.25J 3) 12.5J 4) zero
9. A water falls is 84m high. If half of the initial potential energy of the falling
water
gets converted to heat, the rise in temperature of water will be (g=9.8 ms-2)
1) 0.098o C 2) 9.8o C 3) 411o C 4) 0.411o C

10. Match the thermodynamic processes taking place in a system with the correct
conditions. In the table : Q is the heat supplied, W is the work done and U
is change in internal energy of the system.
Process Condition
I) Adiabatic A) W = 0
II) Isothermal B) Q = 0
III) Isochoric C) U0, W0, Q0
IV) Isobari D) U = 0
1) I-A, II-B, III-D, IV-D 2) I-B, II-A, III-D, IV-C
3) I-A, II-A, III-B, IV-C 4) I-B, II-D, III-A, IV-C
11. Two billiard balls each of mass 0.05 kg moving in opposite directions with speed
6ms-1. They undergo head on elastic collision. The impulse imparted to
each ball
due to the other is
1) Zero 2) 0.6 kgms1 3) 1.2 kgms 1 4) 0.3 kgms 1

12. An aeroplane is in a level flight at constant speed and its wings have an area of
20m2. If the speed of the air is 60 m/s over the lower surface and 90 m/s over
its upper surface of wing, then mass of aeroplane is:
(Density of air = 1 kg/m3, g = 10ms–2)
1) 3000 kg 2) 9000 kg 3) 4000 kg 4) 4500 kg
13. Time period of oscillation of a simple pendulum on the surface of the earth, at
depth ‘d’ below the surface and at a height d above the surface are T1, T2 and T3
respectively then (d<<Rearth).
1) T1 > T2 > T3 2) T1 < T2 > T3 3) T2 > T1 < T3 4) T1 < T2 < T3
14. A body of mass 2kg is projected at 600 with horizontal on level ground. At a
point in its path its velocity is 5 ms-1 and makes 370 with horizontal. The kinetic
energy of projection of the body is (sin 370 = 0.6)
1) 1J 2) 128J 3) 64J 4) 4J
15. A body falls freely from some height (h<<Rearth) under gravity. When it has lost a
gravitational potential energy U, its speed becomes v . Its mass is
2U 2
2U U2 Ug
1) 2) 2 3) 4) 2
v v 2g v
16. The ratio of the wavelengths of a photon and that of an electron of same energy
E will be [m is mass of electron]
2m E 2m EC
1) 2) 3) C 4)
E 2m E 2m
17. The time taken by light to reach the earth from the Sun is 8 minutes 20 s.If the
whole universe and atmosphere is hypothetically filled up with a liquid so that
the time taken by the light to reach the earth from the sun is 12 minutes 30 s
then the refractive index of the liquid will be
1) 1 2) 1.5 3) 2 4) 2.5
18. Two polaroids P1 & P2 are arranged in a line such that their pass axes are at
angle of 30°with each other. If unpolarised light of intensity I0 is incident on
polaroid P1 then intensity of light passing out from polaroid P2 will be
3I I I I
1) 0 2) 0 3) 0 4) 0
8 4 2 8

19. When light of wavelength falls on a metal plate, electrons are liberated with
2

maximum kinetic energy K, when light of wavelength falls on the same plate,
3
maximum KE of electrons is found to be 2K. Threshold wave length is
3
1)  2) 2 3) 4) 3
6
20. When tuning forks A and B are sounded together 5 beats per second are heard.
Frequency of A is 250 Hz. On loading A with wax 2 beats per second are
produced with B. The frequency of B is
1) 255 Hz 2) 320 Hz 3) 245 Hz 4) 420 Hz
21. A pair of adjacent coils has a mutual inductance of 5 H. If the current in one
coil changes from 0 to 20 A in 0.8 s, what is the change of flux linkage with the
other coil?
1) 30 Wb 2) 50 Wb 3) 100 Wb 4) 60 Wb
22. Choose the best possible graph between mobility () and relaxation time ().

23. Two blocks of masses 5kg and 3 kg are connected by a light string as shown. If
the
coefficient of friction between block and surface is 0.1 and system is
released from
rest then , the tension in the string is (take g = 10 ms–2)
1) 30N 2) 20.625N 3) 12.875N 4) 5N
24. A galvanometer is converted into an ammeter by connecting a

1) high resistance in series to it 2) high resistance in parallel to it
3) small resistance in parallel to it 4) small resistance in series to it
25. Two thin long straight wires are arranged parallel to each other with a
separation of 1m. Current in one of the wires is 2A. Null point is found to be at
a distance 2m from it and 3m from the other conductor, in the plane of the
conductors, but outside the conductors. The force exerted by each conductor
per unit length on the other in Nm-1 is
1) 1.2 10 6 , repulsive 2) 4  106 , repulsive
3) 4  105 , repulsive 4) 12  10 6 , repulsive
26. Output ‘W’ is given by
 
1) x. y  z
2)  x  y  .z
3)  x. y  .z
4) Both 2 and 3
27. Assertion (A) : Non-polar materials do not have any permanent dipolemoment
Reason (R) : When a non-polar materials is placed in an electric field. The
centre of the positive charge coincides with the centre of the negative charge.
4) Both A and R are incorrect.
28. Two similar plano-convex lenses are combined together in three different ways
as shown in the adjoining figure. The ratio of the focal lengths in three cases
will be
1) 2 : 2 : 1 2) 1 : 1 : 1 3) 1 : 2 : 2 4) 2 : 1 : 1
29. In an oscillating LC circuit, the total stored energy is U and the maximum
charge on the capacitor is Q. when the charge on the capacitor is Q/2, the
energy stored in the inductor is :
U U 3U 3U
1) 2) 3) 4)
2 4 2 4
30. If E and B denote electric and magnetic fields respectively, which of the
following is dimensionless?
2
E 0
1)  0 0
E
B
 2)  0 0 
E
B
B
3) 0 0  
E
4) 
0 B

31. Thirteen resistors each of resistance R are connected in the circuit as shown in
figure. Net resistance between A and B is :
4R 2R
1) 2R 2) 3) 4) R
3 3
32. A particle of charge ‘q’ is moving in a uniform transverse magnetic field of
induction B with speed ‘v’. The power exerted by the magnetic field on the
charged particle is
1
1) Zero 2) qv 2 B 3) qv 2 B 4) 2qv 2 B
2
33. A body of mass ‘m’ is tied to a string and revolved in a vertical circle of radius R.
It has critical speed at its highest point, then match the following
Set – I (position) Set – II (speed (V) or tension (T))
a) Lowest point e) T = 6 mg
b) Highest point f) T = 3 mg
c) When string is horizontal g) V  Rg
d) When string makes 60 o with h) V  4Rg
downward vertical
1) a-e, b-g, c-f, d-h 2) a-h, b-g, c-f, d-e
3) a-e, b-g, c-h, d-f 4) a-g, b-a, c-f, d-h
34. If the speed of a vehicle increases by 2 ms 1 , its kinetic energy is doubled, then
original speed of the vehicle is
1) 
2  1 ms 1  
2) 2 2  1 ms1  
3) 2 2  1 ms 1 4) 2 2  1 ms 1
35. A woman pushes a trunk on a railway platform which has rough surface. She
applies force of 80 N over a distance of 10m. There after she gets tired and
progressively reduces force to 50 N for a further distance of 5m. The total work
done by the two forces is
1) 1750 J 2) 1125 J 3) 1450 J 4) 725 J
36. A satellite of mass ‘m’ is revolving around a planet.
Statement-I : If its total energy is E then its potential energy is E/2.
Statement-II : If its total energy is E then its kinetic energy is 2E.
1) Both I & II are right 2) Both I & II are wrong
3) I is right & II is wrong 4) I is wrong & II is right
37. There are two holes O1 and O2 in a tank of height H. The water emerging from
O1 and O2 strikes the ground at the same points, as shown in figure. Then
1) H = h1 + h2 2) H = h1 – h2 3) H  h1h2 4) None of these

38. Utencils used for cooking should have
1) High permeability and High coercivity
2) High thermal conductivity and High specific heat
3) High thermal conductivity and low specific heat
4) Low temperature coefficient of resistivity and High resistivity
39. A regular hexagon of side 10cm has a charge 5nC at each of its vertices. The
potential at the centre of the hexagon is
1) Zero 2) 270V 3) 2700V 4) 27V

40. 1 Bohr magneton is
eh 4 me eh eh
1) 2) 3) 4)
 me eh 4 me 2 me
41. Final image of object forms on object. If focal length of lens is 30cm, then radius
of curvature of mirror is
1) 30 cm 2) 60 cm
3) 15 cm 4) This situation is not possible
42. A steel wire of length 0.72m has a mass of 5g. If it is stretched horizontally
between two rigid supports, the time taken by a transverse pulse to travel from
one end to another end of wire is 3 milli second, then find the tension in the
wire.
1) 400 N 2) 200 N 3) 800 N 4) 1200 N
43. Equivalent capacitance between A and B as shown in the circuit will be
1) 1F 2) 5F 3) 4F 4) 3F

3 25 2
44. A particle moves in a projectile given by y  x  x . Find the angle at which
4 16
particle is projected.
1) cos 1   2) sin 1   3) cos 1   4) tan 1  
4 4 3 3
5 5 5 5
45. An electric dipole is formed due to two particles fixed at the ends of a light rigid
rod of length l. The mass of each particle is m and charges are –q and +q. The
system is suspended by a torsionless thread in an electric field of intensity E
such that the dipole axis is parallel to the field if it is slightly displaced, the
period of angular motion is
1 2qE ml ml 1 ml
1) 2) 2 3) 2 4)
2 ml qE 2qE 2 4qE
CHEMISTRY
46. Based on spectrochemical series, which of the following is stronger field ligand?
1) SCN− 2) CO 3) OH− 4) C2O42
47. Match the following
(A) Mg  NH 4  PO4 (I) Violet
(B) Na4  Fe  CN 5 NOS  (II) Prussian blue
(C) K 3  Fe  CNS 6  (III) White
(D) Fe4  Fe  CN 6  (IV) Blood red
3
. The correct combination of the compound (complex) of column – I and

column – II is
(A) (B) (C) (D) (A) (B) (C) (D)
1) III I II IV 2) III I IV II
3) III IV I II 4) III II IV I

48. Which of the following does not participate in HVZ reaction?
1) CH 3COOH 2) CH 3CH 2COOH 3) CH 3CHClCOOH 4)  CH 3 3 CCOOH
49. Ethyne is not the product in
1) CaC2 
H 2O
 2) CH 2 Br  CH 2 Br 
Zn / C2 H5OH


a ) alc . KOH /  a ) alc . KOH / 
3) CH 3CHBr2 
b ) NaNH 2 / 
 4) CH 2 Br  CH 2 Br 
b ) NaNH 2 / 

50. For the given elements : Ne, F, Cl, Ar
Which of the following pair of elements has highest difference of
electronegativity?
1) Ne – Cl 2) Ne – F 3) Ne – He 4) Ne – Ar
KI  95% / H 3 PO4 H 3O 
51. CH 3CH 2 OH   A  B 
CH 3COOAg
 C  D . If C 
B2 H 6 / H 2 O
( or ) LiAlH 4
 D , then the
compound ‘C’ is
1) CH 3COOC2 H 5 2) CH 3CHO 3) CH 3COOH 4) C2 H 5OH
52. Which of the following pair of ions cannot be separated by H2S in the presence
of dilute HCl?
1) Cu 2  , Pb 2  2) Al 3 , Hg 2  3) Zn 2 , Cu 2 4) Ni 2 , Cu 2
53. All the following polynuclear hydrocarbons formed by incomplete combustion of
tobacco, coal and petroleum damage human DNA and cause cancer. Identify
9,10 – dimethyl – 1,2 – benzanthracene from the following
54. In which of the following, P Ka value is very high
55. Assertion : H 2 PO2 acts as Bronsted base only but H 2 PO3 acts as both Bronsted
Acid as well as Bronsted base.
Reason : H 3 PO2 is a mono basic acid while H3PO3 is a dibasic acid.
56. The K sp value of AgCl at 25o C is 4.0 1010 M 2 . Then its solubility is low in
1) 0.02 M aq.NaCl 2) 0.015 M aq.CaCl2
3) 0.01 M aq.AgNO3 4) Pure water

57. The volume of water to be added to 10 ml of 10M HCl solution to make it a
decimolar solution.
1) 10 ml 2) 990 ml 3) 99 ml 4) 90 ml
58. Ideal conditions for the solubility of a gas in a liquid is
1) Low temperature, Low pressure 2) Low temperature, High pressure
3) High temperature, High pressure 4) High temperature, Low pressure
59. Identify P and Q products in given reaction
H OH 
KI  MnO4  P  Mn 2 ; KI  MnO4   IO3  Q
1) IO3  MnO4 respectively 2) I  , Mn 2 respectively
3) IO3 , Mn2 respectively 4) I 2 , MnO2 respectively
60. Se2Cl2 on disproportion gives
1) SeCl2 and Se 2) SeCl2 only 3) SeCl2 and Se 4) SeCl4 and Se
61. The IUPAC name of [Co(NH3)5ONO] ion is +2
1) Pentaamminenitrito-O cobalt (III) ion

2) Pentaamminenitrito-N cobalt(III) ion
3) Pentaamminenitrocobalt (IV) ion
4) Pentaamminenitritocobalt (IV) ion
62. Which is/are true statements
A. F   Cl   Br   I  
 Basic strength
B. HI > HBr > HCl > HF 
 Ka
C. M-F > M-Cl > M-Br >M-I 
 Ionic character.
D. F   Cl   Br   I    enthalpy of hydration.
1) A,B,C 2) B,C,D 3) A, C & D 4) All the above
63. The increasing order of the rate of HCN addition to compounds I to IV is
I) HCHO II) CH 3COCH 3 III) phCOCH 3 IV) phCOph
1) III<IV<II<I 2) I<II<III<II 2) IV<II<III<I 4) IV<III<II<I
64. On passing CrO2Cl2 in water and then (CH3COO)2Pb, the precipitate formed is
1) PbCrO4 ( Yellow ) 2) PbCl2 ( White )
3) CrCl3 ( Green ) 4) CrO3 ( Orange )
65. Nessler’s reagent is used to detect the presence of
1) CrO42 2) PO43 3) MnO4 4) NH 4

66. A  CH 3 NH 2 , B   CH 3 2 NH , C   CH 3 3 N , D  N H 3
Correct basic strength in aqueous solution is
1) D > A > B > C 2) B > A > C > D 3) B > D > C > A 4) C > B > D > A
67. CH 3  CH  CH 2  HBr 
 A (major product). The isomer of compound ‘A’ is
CH 3  CH  CH 3 CH 3  CH 2  CH 2
1) | 2) |
Br Br
CH 3  C  CH 2
3) CH 3  CH 2  CH 3 4) |
Br
68. A hypothetical reaction, A2  B2  2 AB follows the following mechanism.
A2  A  A.......... fast; A  B2  AB  B.......... slow A  B 
 AB …….. fast.
The order of reaction is
1) 2 2) 0 3) 1 4) 3/2
69. Assertion : In 13 group elements, Aluminium is stronger reducing agent.
th
Reason : The oxide of Aluminium, Al2O3 is amphoteric in nature.

70. Which among the following does not undergo hydrolysis?
1) CCl4 2) SiCl4 3) GeCl4 4) SnCl4
71. The species having maximum bond angle is
1) CH4 2) NH3 3) H2O 4) H2S

72. Consider the following reactions:
OH
SOCl2 Mg D2 O
A B C (Major)
The major product “C” is
OD D
OD D
1) 2) 3) 4)
73. The presence of primary alcoholic group in glucose can be explained by
1) Oxidation to gluconic acid with Br2 water.
2) glucose reduces tollen’s reagent
3) glucose reaction with HI
4) oxidation to saccharic acid with conc.HNO3
74. The resistance of 0.05 mol.Lit-1 NaOH solution of 1cm in diameter and 50cm in
length is 5.55 x 103 Ohm. Its conductivity is ___________ Ohm-1.cm-1.
1) 0.785 2) 87.135 3) 0.0115 4) 229.6
75. Among the following statements
A) Degenerate orbitals differ in their orientation.
B) The two electrons present in an orbital differ in the spin quantum number.
C) In N – Shell, the revolving electron makes 16 waves.
1) All A,B & C are correct 2) Only A & C are correct
3) Only B & C are correct 4) Only A & B are correct
76. An organic compound contains 80% by weight of carbon and the rest is
hydrogen. The molecular formula of that hydrocarbon is
1) CH4 2) C2H6 3) C3H8 4) C2H4
77. 0.252 g of MO3 is reduced by 6 mg of Hydrogen completely. Then the equivalent
weight of metal, M is _________.
1) 204 2) 25.2 3) 34 4) 42
78. In the following the correct bond order sequence is :
1) O22  O2  O2  O2 2) O2  O2  O22  O2
3) O2  O2  O2  O22 4) O2  O2  O22  O2
79. What will be standard e.m.f of the cell,
2 Ag   Cu   Cu 2  2 Ag ,
o
Given : E Ag 
/ Ag
 0.8 V ; ECu
o
2
/ Cu
 0.3V
1) 0.6 V 2) 0.5 V 3) 1.1 V 4) 1.3 V
o
80. The ratio of energies of two photons of wavelength 2000 and 4000 A is
respectively
1) 1 : 4 2) 2 : 1 3) 4 : 1 4) 1 : 2
81. Identify incorrect statements
A) Ethoxide ion  C2 H 5O   is a nucleophile
B) Bromonium ion  Br   is an electrophile
C) CH 3  C  N contains both electrophilic and nucleophilic centres
* 
D) Methyl free radical C H 3  is diamagnetic
 
1) D only 2) A only 3) B only 4) C only
82. An organic compound C3H6O does not give a precipitate with 2,4 – dinitro phenyl
hydrazine and does not react with sodium metal. It could be
1) CH3CH2CHO 2) CH3COCH3 3) CH2=CH–O–CH3 4) CH2=CH-CH2OH
83. The ortho and para isomers of nitrophenol can be separated by steam distillation
because
1) o-Nitrophenol is more water soluble than p-nitrophenol
2) o-Nitrophenol is less volatile than p-Nitrophenol
3) o-Nitrophenol is steam volatile
4) o-Nitrophenol has intermolecular H-bonding.

84. C2 H 5OH  
Conc . H 2 SO4
413 K
 A  
Conc . HI ( excess )

 B 
C2 H 5ONa
C
Formation of ‘A’ from C2H5OH and formation of ‘C’ from ‘B’ involve the same
mechanism. The mechanism is
1) S N 2 2) E1 3) E2 4) S N 1
85. Bartlett prepared Xe[PtF6], the first noble gas compound in laboratory based on
the observation of
1) O2 and Xe have comparable sizes
2) both O2 and Xe are gases
3) O2 and Xe have comparable ionization energies
4) O2 and Xe have comparable electro-negativities
86. Identify the incorrect combination from the following
1) - IUPAC name is 3 – ethyl – 1,1 – dimethyl cyclohexane.

2) C20H42 – Molecular formula of Icosane
3) - IUPAC name is 3-methyl-5-ethyl heptane

4) CH  C  CH  CH  CH  CH 2 IUPAC name is Hexa - 1,3 – dien -5- yne
87. The correct basic strength of hydroxides of lanthanide ions will be :
1) La 3  Lu 3  Ce3  Eu 3 2) Ce3  Lu 3  La 3  Eu 3
3) Lu 3  Ce3  Eu 3  La 3 4) La 3  Ce3  Eu 3  Lu 3
88.
, A,B are respectively

1) CH3COCH3, CH3CHO 2) CH3COCH2CH3,CH3CHO
3) CH3COCH3, CH3CH2OH 4) CH3CH2COCH3, CH3CH2OH
89. Number of Faradays of electricity required to reduce 1 mol of IO4 as I  is
1) 6 2) 8 3) 7 4) 4
90. For the equilibrium,
 CaO  s   CO2  g  .
CaCO3  s  
Partial pressure of CO2 at equilibrium is 20 atm. KP for the reaction is
1) 20 atm 2) 100 atm 3) 0.01 atm 4) 0.001 atm
BIOLOGY
91. Which of the following has abundant reserve food materials in the ovule?
1) Integuments 2) Hilum 3) Nucellus 4) Funicle
92. Match the column-I with column-II and choose the correct option
Column I Column II
(a) False fruit (i) Black pepper
(b) Perisperm (ii) Banana
(c) Parthenocarpic fruit (iii) Castor
(d) Albuminous seed (iv) Strawberry
1) a-iv, b-i, c-ii, d-iii 2) a-ii, b-iv, c-iii, d-i
3) a-iv, b-iii, c-i, d-ii 4) a-iii, b-ii, c-i, d-iv
93. Which type of linkage/bond is formed when two nucleotides are linked to form a
dinucleotide?
1) N-glycoside linkage 2) Peptide bond
3) Phosphodiester linkage 4) Hydrogen bond
94. Flower with 4 sepals, 4 petals, 6 stamens two outer short, four inner long, one
chambered ovary later becoming two chambered belongs to the family.
1) Compositae 2) Graminae 3) Fabaceae 4) Cruciferae

95. State true (T) or false (F) for the given statements and choose the correct option.
a. The lac operon consists of two regulatory genes and four structural genes.
b. The y gene codes for permease, which increases permeability of the cell to  -
galactosides?
1) a-T, b-T 2) a-T, b-F 3) a-F, b-T 4) a-F, b-F
96. Select the incorrect statement.
1) A translational unit in mRNA is the sequence of RNA that is flanked by the
start codon (AUG) and the stop codon and codes for a polypeptide.
2) An mRNA has some additional sequences that are not translated and are
referred as untranslated regions (UTR)
3) The UTRs are present only at 5'-end
4) Regulation of lac operon by repressor is referred as negative regulation
97. A: The DNA-dependent DNA polymerases catalyse polymerization only in one
direction, that is 5' →3' .
B: The DNA-dependent RNA polymerase catalyses the polymerization only in
one direction, that is 3'→ 5' .
Choose the correct option for the given statements
1) Only statement A is correct 2) Only statement B is correct
3) Both the statements are correct 4) Both the statements are incorrect
98. All of the following are correct w.r.t. the spring wood, except
1) Lighter in colour 2) Has a higher density
3) Vessels have wider lumen 4) Is also called early wood
99. Which of the following is incorrect w.r.t. anatomy of the monocotyledonous
stem?
1) The ‘ring’ arrangement of vascular bundles is a characteristic of monocot
stem
2) Phloem parenchyma is generally absent
3) Vascular bundles are conjoint and closed
4) Monocot stem has a sclerenchymatous hypodermis
100. Gonyaulax is an example of
1) Chrysophytes 2) Euglenoids 3) Dinoflagellates 4) Slime moulds
101. Find out wrong statement regarding bryophytes
1) The plant body of bryophytes is more differentiated than that of algae
2) The sporophyte of bryophyte is haploid
3) The sex organs in bryophytes are multicellular
4) The male sex organs is called antheridium
102. Match the classes of pteridophytes with their example given below and choose
the correct option
(a) Lycopsida (i) Equisetum
(b) Psilopsida (ii) Dryopteris
(c) Pteropsida (iii) Selaginella
(d) Sphenopsida (iv) Psilotum
1) a-ii, b-iii, c-iv, d-i 2) a-iii, b-iv, c-ii, d-i
3) a-iii, b-i, c-ii, d-iv 4) a-ii, b-i, c-iv, d-iii
103. The stroma lamellae membrane lacks
(a) PS I (b) PS II (c) NADP reductase enzyme
The correct ones are
1) (a) and (b) only 2) (b) and (c) only
3) (a) and (c) only 4) All (a), (b) and (c)
104. Select the incorrect statement w.r.t. C4 plants
1) They are adapted to dry tropical conditions
2) They have a special type of leaf anatomy
3) They perform a process called photorespiration
4) They tolerate higher temperatures
105. State true (T) or false (F) w.r.t. the Calvin cycle and choose the correct option.
A: Reduction is the most crucial step of the Calvin cycle.
B: Reduction involves utilization of 2 molecules of ATP for phosphorylation and
two of NADPH for reduction per CO2 molecule fixed.
C: The fixation of six molecules of CO2 and 6 turns of the cycle are required for
the formation of one molecule of glucose.
1) A-T, B-T, C-T 2) A-F, B-F, C-F 3) A-T, B-F, C-T 4) A-F, B-T, C-T

106. Select the mismatched pair about PGRs
1) Cytokinins - Used to prepare weed-free lawns
2) Ethylene - Causes sprouting of potato tubers
3) Abscisic acid - Inhibits seed germination
4) Gibberellins - Promotes bolting in beet
107. During the tricarboxylic acid cycle (TCA), a molecule of GTP is synthesized
during conversion of
1)  -Ketoglutaric acid to succinyl-CoA 2) Succinic acid to fumaric acid
3) Succinyl CoA to succinic acid 4) Malic acid to oxaloacetic acid
108. In a pea plants, yellow seeds are dominant to green. If a heterozygous yellow
seeded plant is crossed with a green seeded plant, what ratio of green and
yellow seeded plants would you except progeny.
1) 3 : 1 2) 1 : 2 3) 1 : 1 4) 9 : 1
109. Select the incorrect match
1) Aspergillus niger – Acetic acid 2) Lactobacillus – Lactic acid
3) Saccharomyces cerevisiae – Ethanol 4) Clostridium butylicum – Butyric acid
110. Which of the following is a member of Phaeophyceae?
1) Volvox 2) Porphyra 3) Laminaria 4) Chara
111. Select the mismatch from the following options
1) Form bloom in polluted water bodies – Cyanobacteria
2) Presence of cell wall – Mycoplasma
3) Help in making curd – Heterotrophic bacteria 4) Heterocysts – Anabaena
112. Which of the following is an example of opposite phyllotaxy?
1) Alstonia 2) Mustard 3) Guava 4) China rose
113. Select the incorrectly matched pair regarding placentation and the examples
Placentation Examples
1) Axile Chine rose and tomato
2) Basal Sunflower and marigold
3) Free central Mustard and Argemone
4) Marginal Pea
114. Which of the following is correct sequence of different phases of prophase I of
meiosis?
(a) Zygotene (b) Pachytene (c) Leptotene
(d) Diplotene (e) Diakinesis
1) a → b → c → e → d 2) b → a → d → c → e
3) c → b → a → d → e 4) c → a → b → d → e
115. All of the following are correct w.r.t. anaphase of mitosis, except
1) Chromatids move to opposite poles 2) Centromeres split
3) Chromatids separate
4) Chromosomes move to spindle equator
116. Select the incorrect match w.r.t. examples of classes of fungi
1) Phycomycetes – Alternaria, Colletotrichum
2) Basidiomycetes – Ustilago, Puccinia
3) Deuteromycetes – Trichoderma, Alternaria
4) Ascomycetes – Neurospora, Calviceps
117. Read the following Assertion and Reason and select correct option
Assertion (A): Golgi bodies are the site of synthesis of glycoproteins and
glycolipids.
Reason (R): SER is site of synthesis of steroidal hormones in animal cells.
1) If both assertion and reason are true and the reason is the correct
2) If both assertion and reason are true but reason is not the correct
3) If assertion is true but reason is false
4) It the assertion is false and reason true.
118. Select a polymer of fructose
1) Glycogen 2) Cellulose 3) Starch 4) Inulin

119. Identify the following compound and select the correct option
1) Adenine 2) Adenosine 3) Uracil 4) Uridine

120. The process of translation begins when
1) tRNA binds with amino acid 2) There is inactivation of amino acids
3) The small subunit of ribosome encounters mRNA
4) The large subunit of ribosome binds with mRNA
121. Read the following Assertion and Reason and choose the correct option.
Assertion (A): Larger and more numerous nucleoli are present in cells actively
carrying out protein synthesis.
Reason (R): Nucleolus are a site of active ribosomal RNA synthesis.
1) If both assertion and reason are true and the reason is the correct
2) If both assertion and reason are true but reason is not the correct
3) If assertion is true but reason is false
4) It the assertion is false and reason true.
122. Choose the odd statement w.r.t. enzymes
1) Enzymes lower the activation energy and make the transition of substrate to
product easy.
2) Succinic dehydrogenase enzyme is inhibited by a non competitive inhibitor
called malonate.
3) Isomerases catalyses interconversion of optical, geometric and positional
isomers.
4) The formation of enzyme substrate complex is a transient phenomenon
123. Match the following columns and select the correct option
Column I Column II
a. Cyclosporin A i) Lactobacillus
b. Streptokinase (ii) Monascus Purpureus
c. Statin (iii) Trichoderma polysporum
d. Lactic acid (iv) Streptococcus
1) a-iii, b-iv, c-i, d-ii 2) a-iii, b-iv, c-ii, d-i
3) a-iv, b-iii, c-ii, d-i 4) a-iv, b-ii, c-iii, d-i
124. The separated bands of DNA are cut from the agarose gel and extracted from
the gel piece by a step known as
1) Spooling 2) Elution 3) Transformation 4) Cloning
125. Single seeded fruits are produced from the ovaries of
1) Asteraceae 2) Poaceae 3) Mangifera 4) All of these
126. Which of the following spores are mitospores produced during favourable
conditions in fungi? a. Sporangiospores b. Zoospores c. Conidia
1) Only a 2) All a, b and c 3) Only c 4) Only b
127. Due to the apical dominance
1) The lateral buds do not grow 2) Apical buds do not grow
3) Bushy growth of plants take place
4) Lateral buds start developing into branches
128. Presence of conjuctive tissue is the characteristic feature of
1) Monocot leaf 2) Dicot stem 3) Dicot root 4) Monocot stem
129. Which of the following is not a fermented product of bacteria?
1) Dosa 2) Idli 3) Bread 4) Swiss cheese
130. “Ramachandran plot” is used to confirm the structure of
1) Sucrose 2) DNA 3) Collagen 4) Cholesterol
131. The starch synthesis regarding the grain size in garden pea show A for Bb
genotype. Here A is
1) Codominance 2) Dominance
3) Incomplete dominance 4) Multiple allelism

132. CO2 is not released during
(a) Glycolysis (b) Link reaction (c) Kreb’s cycle
(d) ETS (e) Alcoholic fermentation (f) Lactic acid fermentation
1) ‘d’ and ‘f’ only 2) b, c, e only 3) a, d, f only 4) a, f only
133. The process by which multiple copies of the gene (or DNA) of interest are
synthesized in-vitro requires all, except
1) DNA polymerase 2) Primers 3) DNA templates 4) Stirrer
134. Mark the incorrect match w.r.t. electron transport system in mitochondria
1) NADH dehydrogenase – Complex I 2) Cytochrome bc1 - Complex III
3) Succinate dehydrogenase – Complex II 4) Cytochrome c oxidase – Complex V
135. What will be the amount of DNA in meiosis II product if meiocyte is containing
20 pg DNA in G1 phase?
1) 10 pg 2) 5 pg 3) 20 pg 4) 15 pg
136. How many of the following structures contain 46 chromosomes?
Spermatozoa, secondary oocyte, spermatogonia, oogonia, primary oocyte
1) 2 2) 3 3) 4 4) 1
137. One of the following is not a vasoconstrictor:
1) ADH 2) ANF 3) Aldosterone 4) Angiotensin – II
138. Amongst the animal groups given below, which one appears to be more
vulnerable to extinction?
1) Insects 2) Mammals 3) Amphibians 4) Reptiles
139. Humification leads to accumulation of a dark coloured amorphous substance
called humus. That is
1) Undergoing decomposition at extremely fast.
2) High resistant to microbial action
3) Degraded by some microbes and release of organic nutrients
4) Degraded by detritivores into smaller organic particles
140. Which of the following is true about in thrombokinase?
1) It activates heparin
2) It activates fibrin to from as fibrinogen.
3) It activates prothrombin into thrombin
4) It promotes formation of hydrogen bonds in the place of covalent bonds
among fibrin threads.
141. The difference between PO2 of alveolar air and PO2 of blood of pulmonary vein is
about
1) 45 mm Hg 2) 40 mm Hg 3) 64 mm Hg 4) 9 mm Hg
142. Statement I: Strength of ventricular contraction is increased by sympathetic
division of Autonomic nervous system.
Statement II: Cardiac output is increased by catecholamines.
143. Match Column I with Column II and choose the correct answer from the codes
given below.
(A) Physical barrier (I) MALT
(B) Cellular barrier (II) Lysozyme enzyme
(C) Physiological barrier (III) Interferons
(D) Secondary lymphoid organ (IV) Skin and mucus
.
(V) Macrophages
(A) (B) (C) (D) (A) (B) (C) (D)
1) IV V II I 2) I II III IV
3) III IV III I 4) III II I IV
144. The interaction between Sea anemone and Clown fish that lives among stinging
tentacles of Sea anemone is example of
1) Commensalism 2) Mutualism 3) Parasitism 4) predation
145. Which of the following hormonal combination is associated with normal
lactation.
1) Prolactin + oxytocin 2) Estrogen + progesterone
3) hCG + LH 4) Oxytocin + relaxin

146. Choose the right one among the statements given below
1) IUDs are generally inserted by the user herself
2) IUDs increase phagocytosis reaction in the uterus
3) IUDs suppress gametogenesis
4) IUDs once inserted need not be replaced.
147. Choose the incorrect statement from the following
1) In Birds and mammals internal fertilization takes place.
2) Colostrum contain antibody A
3) Polyspermy in mammals is prevented by the chemical changes in Corana
radiata.
4) Progesteron level high during post ovulatory phase of menstrual cycle.
148. In a certain taxon of insects some have 17 chromosomes and the others have 18
chromomes.
1) Male grasshopper and female respectively
2) All male grasshoppers
3) All female grasshoppers
4) Male human and female human respectively
149. The affected individual with trisomy of 21 shows all the following features
except.
1) Congenital heart disease 2) Partially open mouth
3) Gynecomastia 4) Many loops on fingers tips
150. Which of the following are the reasons for Rheumatoid arthritis? Choose the
correct option.
(i) The ability to differentiable pathogens or foreign molecules from self cells
increase.
(ii) Body attacks self cells
(iii) More antibodies are produced in the body
(iv) The ability to differentiable pathogens or foreign molecules from self cells is
lost.
1) (i) and (ii) 2) (ii) and (iv) 3) (iii) and (iv) 4) (i) and (iii)
151. A person with sickle cell anemia is
1) More prone to malaria 2) More prone to typhoid
3) Less prone to malaria 4) Less prone to typhoid
152. Match the animals given in Column I with their location in Column II.
(A) Dodo (I) Africa
(B) Quagga (II) Russia
(C) Thylacine (III) Maurtitus
(D) Steller Sea Cow (IV) Australia
Choose the correct match from the following:
.
(A) (B) (C) (D) (A) (B) (C) (D)

1) I III II IV 2) IV III I II
153. Statement I : Evolution is not a direct process in the sense of determinism.
Statement II : Evolution is based on chance events that occur in nature.
154. Natural cannabinoids are obtained from the
1) latex of Papaver sominiferum 2) Inflorescences of Cannabis sativa
3) Flowers of Datura 4) Fruits of Erythroxyl coca
155. Consider the following statements on ecological pyramids and pick out the
correct statements.
A) Pyramid of energy can never be inverted because when energy flows from a
particular trophic level to the next tropic level some energy is always last as
heat at each step.
B) All ecosystems the pyramids of number and of biomass are upright.
C) The pyramid biomass of sea is generally inverted because the biomass of
fishes far exceeds that of phytoplankton.
1) Only A 2) A and B only 3) A and C only 4) All A,B,C

156. In a skeletal myofibril myosins are found in
1) A – band 2) I – band 3) Z – line 4) Krause membrane
157. Choose the viviparous tetrapods.
1) Alligator and Aptenodytes 2) Scoliodon and macropus
3) Platypus and Equus 4) Macropus and Equus
158. Peptide hormone that bind with membrane receptor is
1) Adrenaline 2) Aldosterone 3) FSH 4) Thyroxine
159. Which of the following is not related to thyroxine.
1) It maintains water and electrolyte balance
2) It support the process of RBC formation.
3) It regulates metabolism of proteins.
4) It not regulate basal metabolic rate.
160. Choose the incorrect match.
1) Spongilla – Bipolar neurons 2) Taenia - Flame cells
3) Ascaris – Pseudocoelom 4) Locusta – open type circulation
161. Regarding respiratory volumes and capacities FRC is equal to
1) IC + ERV 2) ERV + RV 3) IRV + TV 4) IRV + ERV
162. The function of our visceral organs is controlled by
1) Sympathetic and somatic neural system
2) Sympathetic and parasympathetic neural system
3) Central and somatic nervous system
4) None of the above
163. Which one of the following statement is incorrect?
1) Heart muscles are striated and involuntary
2) The muscles of hands and legs are striated and voluntary.
3) The muscle located in the inner wall of alimentary canal are striated and
involuntary.
4) Muscle located in the reproductive tracts are unstriated and involuntary.
164. Which of the following is correct match of bones?
Bone Position Number
(1) Scapula Pelvic girdle 2
(2) True ribs Axial skeleton 14
(3) Vertebral column Appendicular skeleton 26
(4) Mandible Cranium 2
165. What will be the stroke volume of a person with 6000 mL of cardiac output and
0.8 sec for each cardiac cycle.
1) 100 ml 2) 60 ml 3) 70 ml 4) 80 ml
166. Match the following Column – I with Column – II.
(A) Radula (I) Pila
(B) Comb plates (II) Ctenoplana
(C) Parapodia (III) Nereis
.
(D) Ostia (IV) Sycon
(A) (B) (C) (D) (A) (B) (C) (D)
1) I II III IV 2) I II IV III
3) IV III II I 4) III IV I II
167. Read the following diagram and choose the correct statements.
I) In part ‘A’, the water reabsorption takes place.

II) In part ‘B’, the water and electrolytes reabsorption takes place.
III) In part ‘C’, the water reabsorption takes place
IV) In part ‘D’, the water is reabsorbed but electrolytes are not reabsorbed.
1) I and II 2) I and III 3) III and IV 4) I and IV

168. Which one of the following is the correct statement for respiration in humans?
1) Cigarette smoking may lead to inflammation of bronchi.
2) Neural signals from pneumotaxic centre in pons region of brain can increase
the duration of inspiration.
3) Workers in grinding or stone breaking industries with long exposure may
suffer from lung fibrosis.
4) About 90% of CO2 is carried by hemoglobin as carbamino hemoglobin
169. Person with blood group AB is considered as universal recipient because he has
1) Both A and B antigen on RBC but no antibodies in the plasma
2) Both A and B antibodies in the plasma
3) No antigen on RBC and no antibody in the plasma.
4) Both antigen A and B in the plasma but no antibodies.
170. In mammals which blood vessel would normally carry largest amount of urea.
1) Renal vein 2) Dorsal aorta 3) Hepatic vein 4) Hepatic portal vein
171. The following graph represents the concentration of the four hormones present
in the blood plasma of an woman during her menstrual cycle. Identify the
hormones.
A B C D
1) FSH Progesterone LH Oestrogen
2) LH Progesterone FSH Oestrogen
3) FSH Oestrogen LH Progesterone
4) LH Oestrogen FSH Progesterone
172. Following is the diagrammatic representation of the operation of natural
selection on different traits. Which of the following options correctly identified
all the three graphs A,B and C.
A B C
1) Directional stabilizing Disruptive
2) Stabilizing Directional Distruptive
3) Disruptive Stabilizing Directional
4) Directional Disruptive Stabilizing

173. Statement I : Erythropoietin is produced from the JG cells of kidney in
response to high blood volume.
Statement II : Erythropoietin decrease the erythropoiesis.
1) Both Statement I and Statement II are wrong.
2) Statement I is true and Statement II is wrong.
3) Both Statement I and Statement II are correct
4) Statement I is wrong Statement II is correct.
174. Which was the last human chromosome to be completely sequenced?
1) Chromosome 1 2) Chromosome 11
3) Chromosome 21 4) Chromosome X
175. Choose the component related to Frog
3) Sinus venosus, conus arteriosus 4) All
176. If the Bidder’s canal of Frog is blocked, it fails to
1) transport sperms into urinogenital duct
2) transport of urine into urinogenital duct
3) transport of sperms as well as urine into urinogital duct
4) transport of digested food into liver
177. Which of the following pairs wrong?
1) Uricotelic – Birds 2) Ureotelic – Aquatic insects
3) Ammnotelic – Tadpole larva 4) Ureotelic - Elephant
178. Which one of the following characterics is common both in humans and adult
frogs.
1) Internal fertilization 2) Nucleated RBC
3) Ureotelic mode of excretion 4) Four chambered heart
179. Identify the correct statement.
1) ‘F’ actin a polymer of G’ actin molecules.
2) Heavy meromyosin form tail
3) Light meromyosin form head
4) Each light meromyosin has two binding sites
180. In a population in Hardy – Weinberg equilibrium, 49%. Individuals show
recessive trait what is percentage of hetero zygotes in that population.
1) 9% 2) 42% 3) 48% 4) 36%
*******

: ANSWER KEY:
1 3 11 2 21 3 31 3 41 1
2 1 12 4 22 3 32 1 42 1
3 2 13 4 23 2 33 1 43 2
4 1 14 3 24 3 34 3 44 1
5 3 15 2 25 1 35 2 45 3
6 3 16 3 26 4 36 2
7 2 17 2 27 3 37 1
8 1 18 1 28 2 38 3
9 1 19 1 29 4 39 3
10 4 20 3 30 1 40 3
SUB:CHEMISTRY
46 2 56 2 66 2 76 2 86 3
47 2 57 2 67 2 77 3 87 4
48 4 58 2 68 4 78 3 88 1
49 2 59 4 69 2 79 2 89 2
50 2 60 4 70 1 80 2 90 1
51 3 61 1 71 1 81 1
52 1 62 1 72 3 82 3
53 1 63 4 73 4 83 3
54 4 64 1 74 3 84 1
55 1 65 4 75 4 85 3
SUB : BOTANY
91 3 101 2 111 2 121 1 131 3
92 1 102 2 112 3 122 2 132 3
93 3 103 2 113 3 123 2 133 4
94 4 104 3 114 4 124 2 134 4
95 3 105 4 115 4 125 4 135 1
96 3 106 1 116 1 126 2
97 1 107 3 117 2 127 1
98 2 108 3 118 4 128 3
99 1 109 1 119 3 129 3
100 3 110 3 120 3 130 3
136 2 146 2 156 1 166 1 176 1
137 2 147 3 157 4 167 2 177 2
138 3 148 1 158 3 168 3 178 3
139 2 149 3 159 4 169 1 179 1
140 3 150 2 160 1 170 3 180 2
141 4 151 3 161 2 171 3
142 1 152 4 162 2 172 2
143 1 153 1 163 3 173 1
144 1 154 2 164 2 174 1
145 1 155 3 165 4 175 4

XII- NEET GT - 6
Date: 18.12.2023 (NEET MODEL) Time: 3hrs
STD: XII -NEET CODE- A Max. Marks: 720
answer sheet.

PHYSICS Mr.PRASAD SHARMA
Mr.RAJU
CHEMISTRY
Mr.LAKSHMIPRASAD
BOTANY Mr.MURALI
ZOOLOGY Mr.PRABHAKAR
PHYSICS
1. If unit of length and force are increased 4 times. The unit of energy :
1) is increased 4 times 2) is increased 16 times
3) is increased 8 times 4) remain unchanged
2. A uniform rectilinear wire of homogeneous composition has a mass (0.3± 0.003)
gram, radius (0.5± 0.005)mm and length(0.6± 0.006) cm. Maximum percentage
error in the measurement of density is
1) 4 2) 3 3) 2 4)1
3. (𝑃 +𝑄 )is a unit vector along the X-axis. If 𝑃=(𝚤̂ − 𝚥̂ + 𝑘), then 𝑄⃗ is
⃗ ⃗ ⃗
1) (𝚤̂ + 𝚥̂ + 𝑘) 2) (𝚥̂ − 𝑘) 3) (𝚤̂ + 𝚥̂ − 𝑘) 4) (𝚥̂ + 𝑘)
4. Speed of two identical cars are u and 4u at a specific instant. The ratio of the
respective distances in which the two cars are stopped from that instant is
1) 1 : 1 2) 1 : 4 3) 1 : 8 4) 1 : 16
5. A vehicle of mass m is moving on a rough horizontal road with momentum P. If
the coefficient of friction between the tyres and the road be , then the stopping
distance is :
P P2 P P2
1) 2) 3) 4)
2  mg 2  mg 2 m2 g 2 m2 g
6. A particle of moving eastwards with a velocity 5 ms-1, changes its direction
northwards in 10 seconds and moves with same magnitude of velocity. The
average acceleration is
1
1) Zero 2) ms 2 towards N-E
2
1 1
3) ms 2 towards S-E 4) ms 2 towards N - W
2 2
7. The length of second’s hand in a watch is 1cm. The change in velocity of its tip
in 15 seconds is :
   2
1) Zero 2) cm/s 3) cm/s 4) cm/s
30 2 30 30
8. As shown in figure, a block tied by a string, rests on a rough wedge, fixed in a
lift. The lift goes upwards, keeping the block always in contact. Match the
following accordingly
COLUMN I COLUMN II
a) Work done by normal reaction is p) positive
b) Work done by gravity is q) negative
c) Work done by frictional force is r) zero
d) Work done by tension in the string is s) Infinite
1) (a→ p), (b→r), (c→ s), (d→ q) 2) (a→ p), (b→ q), (c→ r), (d→p)
3) (a→ s), (b→ p), (c→ r), (d→ q) 4) (a→ q), (b→ p), (c→ r), (d→ s)
9. Two identical particles moving in different directions with the same speed ‘v’,
undergo perfectly inelastic collision. After the collision, if each of them lose 50 %
of speed ‘v’, then angle between their velocity vectors, before collision, will be
1) 1200 2) 150 3) 200 4) 450

10. The ray diagram could be correct
1) if 1 = 2 = g 2) if 1 > g > 2
3) if 1 = g and 2 > g 4) 1 > g , g = 2
11. As shown in figure, a rectilinear thin rod ‘AP’ of length 5.0

m, slides down along the wall of a room. Assuming all the
surfaces to be smooth, at an instant, if the end ‘A’ being
on the floor, 3.0m from the wall, slides horizontally at
2.0ms-1, then instantaneous speed of the other end of the
rod along the wall is
1) 10 ms-1 2) 1.5 ms-1
3) 5 ms -1 4) 0.5 ms-1
12. A satellite is moving round the earth. In order to escape it, its velocity must be
increased by :
1) 20% 2) 41.4% 3) 1.41% 4) Not possible
13. A force (3i + 4j)N is applied to a point whose radius vector relative to origin O is
equal to (2i+j)m. The magnitude of moment arm of the force relative to point O
is :
1) 5m 2) 3m 3) 5m 4) 1m
14. As shown below,a non-conducting circular ring of mass ‘m’
is given a charge ‘q’. If it is rotated about its axis at an
angular speed ‘𝜔’,then ratio of its magnetic moment to its
angular momentum is a constant, equal to (𝑥) × , where
‘x’ is equal to
1) 2)
√
3) 4)
15. As shown below, an open pipe of sufficient length ‘L’ is
dipped in water vertically downwards at a constant speed ‘v’.
Assuming speed of sound in air is ‘vs’, at an instant, if length
of the tube above water is ‘l’, then rate at which fundamental
frequency of the pipe changes, will be
1) 2)
3) 4)
16. Two identical cars A and B are moving at 36 kmph. A goes on a bridge, convex
upward and ‘B’ on concave upward. If the radius of curvature of bridge is 20m,
the ratio of normal forces exerted on the cars when they are at the middle of
bridges  g  10ms 2 
1) 1 : 3 2) 1 : 2 3) 2 : 3 4) 1 : 5
17. In the figure shown, when a system is taken from state
‘a’ to state ‘b’ along the path ‘acb’, it is found that a
quantity of heat (Q=200 J) is absorbed by the system
and a work(W=80 J) is done by it. If work done on the
system along the curved path ‘ba’ is 52.0 J, then heat
absorbed by the system is
1) −172 J 2) 40 J
3) 72 J 4) 14 J
18. Two point charges Q and -3Q are placed at some distance apart the electric field
at the location of Q is E then at the locality 3Q, it is
1) –E 2) E/3 3) -3E 4) –E/3

19. The average translational kinetic energy of O2(molar mass : 32) molecules at a
particular temperature is 0.048 eV. The average translational kinetic energy of
N2 (molar mass : 28) molecules at the same temperature is
1) 0.0015 eV 2) 0.048 eV 3) 0.003 eV 4) 0.768 eV
20. Mobility of electrons and holes in a sample of intrinsic germanium at room
temperature are 0.36 m2V-1s-1 and 0.17 m2V-1s-1. If electron and hole densities
are equal to 2.5×1019 m-3, then electrical conductivity of germanium will be
(nearly)
1) 3  105 Sm-1 2) 3  105 Sm-1 3) 3  1010 Sm-1 4) 3 Sm-1
21. The voltage between the plates of a parallel plate condenser of capacity 2.0 F is
charging at a rate of 10 Vs 1 . The displacement current
1) 2 mA 2) 2 A 3) 20 A 4) 2A
22. Two identical rods of a metal are welded in series then 20 cal of heat flows
through them in 4 min. If the rods are welded in parallel then the same amount
of heat will flow in
1) 1 min 2) 2 min 3) 4 min 4) 16 min
23. If the work done in blowing a soap bubble of volume ‘v’ is w, then the work done
in blowing a soap bubble of volume ‘2v’ is
1) 4W 2) 8W 3) 21/ 3 W 4) 41/ 3 W
24. Assuming (Avogadro number NA=6.023 × 1023 ), (atomic mass of 𝑈 =235
a.m.u), (1 a.m.u=931.5 MeV), (Energy released per fission=200 MeV),
(1eV=1.6×10-19 J), if 0.1% mass is converted into energy, then amount of energy
released due to fission of 1.0 gram of 𝑈 is approximately equal to
1) 56.5 GJ 2) 83.2 kJ 3) 96.0 J 4) 83.2 MJ
25. In the network shown below, effective resistance between the terminal ‘A’ and ‘B’
is
1) 10 Ω
2) Ω
3) 6 Ω
4) 8 Ω
26. Three identical electrical bulbs ‘A’, B’ and ‘C’ are

connected as shown, across a cell of e.m.f ‘V’. If ‘P’ is the
power of the each bulb at operating voltage ‘V’. Then the
total power of the network is (S is opend)
1) 3P 2) P
3) 4) None of these
27. As shown in figure, a rectilinear rod ‘AB’ of

homogeneous composition is supported by two friends
‘P’ and ‘Q’ of the same height, nearer to the ends ‘A’ and
‘B’ respectively. Assuming AB=L and (g=10ms-2), if ‘P’
and ‘Q’ support at and from ends ‘A’ and ‘B’
respectively, then their normal reactions 𝑁 : 𝑁 will be
1) 3:4 2) 8:5 3) 5:4 4) 5:8
28. The shunt resistance needed for a galvanometer of 500 to decrease its
sensitivity by 100 tiems is
1) 5.05 2) 50.5 3) 0.505 4) 505
29. Pressure versus temperature graph of an ideal gas at
constant volume ‘V’ is as shown by the straight line ‘A’. If
the mass of the gas is doubled with its volume halved, then
the corresponding pressure versus time graph will be
represented by the
1) Line ‘A’
2) Line ‘B’
3) Line ‘C’
4) All the above

30. Two wires of equal diameters, of resistivities 1 and  2 and lengths l1 and l2,
respectively, are joined in series. The equivalent resistivity of the combination is
 l  2l2  l   2l1  l   2l2  l   2l2
1) 1 1 2) 1 2 3) 1 2 4) 1 1
l1  l2 l1  l2 l1  l2 l1  l2
31. A bar magnet of magnetic moment 2.0 Am2 is free to rotate about a vertical axis
passing perpendicularly through its centre. The magnet is released from rest
from east-west position. If BH=25𝜇T in S→N direction, then kinetic energy gained
as it aligns in N-S direction is
1) 50pJ 2) 50 nJ 3) 50 mJ 4)50 𝜇J
32. Conditions of diffraction is (terms are asusal)
b2 b2
1) 1 2)  1 3) b  0 4) None of these
l l
33. ASSERTION: In YDSE, if a thin glass plate is introduced in front of the upper
slit, then the fringe pattern shifts in the upward direction.
REASON: In YDSE if the slit widths are unequal, the minima will be completely
dark and maxima completely bright.
4) A is incorrect but R is correct.
34. Wires 1 and 2 carring currents i1 and i2 respectively
are inclined at an angle  to each other. What is the
force on a small element dl of wire 2 at a distance of
r from wire 1 (as shown in figure) due to the
magnetic field of wire l.
 
1) 0 i1i2 dl tan  2) 0 i1i2 dl sin 
2 r 2 r
0 
3) i1i2 dl cos  4) 0 i1i2 dl sin 
2 r 4 r
35. A parallel plate capacitor is charged to 60𝜇𝐶, on posiive plate a charge 20C is
given. Then charge on the capacitor is
1) 0 C 2) -20 C 3) 70 C 4) 20 C
36. As shown in figure, a rectilinear thin uniform rod of length ‘l’
and mass ‘m’ is hinged at the point ‘A’. If it is just released
from the horizontal position AB, torque due to weight about
‘A’ is (where M is mass of the rod, L is length)
1) MgL
2) 2MgL
MgL
3)
2
4) Zero
37. Potential energy of a particle of mass 1.0 kg in motion along the X-axis is given
by U=4(1− Cos 2x) J, where ‘x’ is in metre. Time period of small oscillations is
1) √2 𝜋 second 2) 2𝜋 second 3) second 4) 𝜋 second
38. As shown below, a circular loop of radius (R=20 cm) is
placed in a uniform magnetic field B=2.0 tesla in XY plane.
If the loop carries a current i=1.0 A, then magnitude of the
torque acting on the loop will be
1) 0.25 Nm
2) 2 Nm
3) 4 Nm
4) 6 Nm
39. Three capacitors (C1=3 𝜇F) , (C2=4 𝜇F) and (C3=2 𝜇F)
are connected as shown in the simple network,
such that the point ‘B’ is grounded.If the point ‘A’ is
given a potential of +12.0 V, then potential at the
point ‘P’ will be
1) 0 V 2) 4.0 V
3) 3.5 V 4) 20 V

40. Ionization potential of hydrogen atom is 13.6 V. Hydrogen atoms in the ground
state are excited by monochromatic radiation of energy 12.1 eV. According to
Bohr’s theory, number of spectral lines emitted by hydrogen atom is
1) Four 2) two 3) Five 4) Three
41. The following figure shows a logic gate circuit with two input points ‘A’ and ‘B’
and the output point ‘Y’. If the voltage waveforms of ‘A’, ‘B’ and ‘Y’ are as shown,
then logic gate related to the output, will be
1) NOT 2) NAND 3) AND 4) OR

42. A coil of inductance 0.4 mH is connected to a capacitor of capacitance 400pF.
The circuit is tuned at wavelength ‘𝜆’, where ‘𝜆’ is approximately equal to
1) 10-4 m 2) 10-12 m 3) 10-16 m 4) 750 m
43. A cube of wood supporting a 200g just floats in water. When the mass is
removed, the cube rises by 2 cm. What is the side of the cube?
1) 10 cm 2) 20 cm 3) 30 cm 4) 40 cm
44. A wire length ‘L’ meter carries a current ‘I’ ampere, is bent in the form of a
circle. The magnitude of its magnetic moment in MKS system unit is
2IL2 IL2 IL2
1) 4 IL2 2) 3) 4)
  4
45. A vessel of depth 2d cm is half filled with a liquid of refractive index 1 , another
half filled with 2 . The apparent depth of the vessel seen perpendicularly is
    1 1   1 1   1 
1) d  1 2  2) d    3) 2d    4) 2d  
 1   2   1  2   1  2   12 
CHEMISTRY
46. The correct order of stability of +1 oxidation state is :
1) Al<Ga<In<Tl 2) Al<In<Ga<Tl 3) Al<Tl<In<Ga 4) In<Al<Ga<Tl
47. The number of atoms in 0.25 mole of a tetra-atomic gas is (NA = Avogadro
number).
1) 4NA 2) 2NA 3) NA 4) 3NA
48. There is largest difference of energy between the molecular orbital of dioxygen in
1)  2 px and  2 py 2)  2 py and  2*py 3)  2 px and  2*ps 4)  2 s and  2*px
49. Statement –1 : Mass, volume and pressure are extensive properties.
Statement –2 : Extensive properties depend upon the amount of the substance.
1) Statement-1 is true, Statement-2 is true, Statement-2 is a correct explanation
for Statement-1
2) Statement-1 is true, Statement-2 is true, Statement-2 is NOT a correct
explanation for Statement-1
3) Statement-1 is true, Statement-2 is false
4) Statement-1 is false, Statement-2 is true
50. DNA & RNA contain four bases each. Which of the following bases is not
present in RNA?
1) Adenine 2) Thymine 3) Uracil 4) Cytosine
51. If water vapour is assumed to be a perfect gas, molar enthalpy change for
vapourisation of 1 mol of water at 1 bar and 100o C is 41 kJ mol 1 . Calculate the
internal energy change, when 1 mole of water is vapourised at a bar pressure
and 100o C .
1) 37.9 J/mol 2) 3.79 kJ/mol 3) 44 kJ/mol 4) 37.9 kJ/mol

52. Which of the following does not give the lassaign’s test for Nitrogen?
1) Diazonium compounds 2) Urea
3) Nitrobenzene 4) Aniline
53. For which of the following option m = 0 for all orbitals?
1) 2s, 2px, 3dxy 2) 3s, 2pz, 3d z2 3) 2s, 2p z , 3d x 2  y 2 4) 3s, 3px, 3dyz
54. What is the correct order of negative electron gain enthalpy of group 16
element?
1) O > S > Se > Te > Po 2) S > Se > Te > Po > O
3) O < S < Se < Te < Po 4) O = S = Se = Te = Po
55. What is the potential energy of an electron present in N-shell of the Be3 ion?
1) -3.4eV 2) -6.8eV 3) -13.6eV 4) -27.2eV
56. The carbanion which is most stable is
57. The vapour pressures of pure liquids A and B are 400 and 600 mm Hg,
respectively at 298K. On mixing the two liquids, the sum of their initial
volumes is equal to the volume of the final mixture. The mole fraction of liquid
B is 0.5 in the mixture. The vapour pressure of the final solution, the mole
fractions of components A and B in vapour phase, respectively are :
1) 500mm Hg, 0.4, 0.6 2) 500mm Hg, 0.5, 0.6
3) 450mm Hg, 0.5, 0.5 4) 450mm Hg, 0.4, 0.6
Cl
58. The IUPAC name of CH 2  CH  CH  CHO , is
OH NO2
1) 2-chloro-3-nitro-3-formyl propan-1-ol
2) 2-chloro-3-formyl-3-nitropropan-1-ol
3) 3-chloro-4-hydroxy-2-nitro butanal
4) 2-chloro-3-nitro-4-oxobutan-1-ol
59. A vessel at 1000K contains CO2 with a pressure of 0.5 atm. Some of the CO2 is
converted into CO on the addition of graphite. If the total pressure at
equilibrium is 0.8 atm, the value of Kp is
1) 1.8 atm 2) 3 atm 3) 0.3 atm 4) 0.18 atm
60.
61. A 10% solution (by mass) of sucrose in water has a freezing point of 269.15K.
Calculate the freezing point of 10% glucose in water if the freezing point of pure
water is 273.15K. (Given : molar mass of sucrose  342 g mol , Molar mass of
glucose  180 g mol 1 )
1) 275.53K 2) 265.53K 3) 271.32K 4) 282.43K
62. Both methane and ethane can be obtained from
1) CH3CH2MgBr 2) CH3COOH 3) CH2 = CH2 4) CH3OH

63. Consider the statements S1 and S2 :
S1: Conductivity always increases with decrease in the concentration of
electrolyte.
S2: Molar conductivity always increases with decrease in the concentration of
electrolyte. The correct option among the following is
1) Both S1 and S2 are wrong 2) Both S1 and S2 are correct
3) S1 is wrong and S2 is correct 4) S1 is correct and S2 is wrong
64. Butyne-1 and butyne-2 are distinguished with
1) Na 2) Ammonical cuprous chloride
3) Ammonical silver nitrate 4) All of these
65. 20 mL of 0.1M H2SO4 soluiton is added to 30 mL of 0.2M NH4OH solution. The
pH of the resultant mixture is [pKb of NH4OH = 4.7]
1) 9.4 2) 9.0 3) 5.0 4) 5.2
66. Which of the following diagrams not indicate the formation of  bonds?
67. From molten AlCl3, 2.7g of Al is deposited at cathode. Same quantity of

electricity deposits _____________wt of Mg from molten MgCl2
1) 2.4 g 2) 3.6 g 3) 1.2 g 4) 4.8 g
68. Which of the following is more reactive towards SN1 reaction?
69. The formation of purple colour with Na2[Fe(CN)5NO] indicates the presence of
1) Nitrogen 2) Sulphur 3) Halogen 4) Both “N” and “S”
70. Which reaction gives elimination as a major product?
71. Which of the following is not correct?

1) Mohr’s salt solution is not required to heat before titrating it with KMnO4
2) The reaction between Mohr’s salt and KMnO4 in cold is quite vigorous
3) On heating, ferrous sulphate present in mohr’s salt gets oxidised by air to
ferric sulphate
4) On heating to 60  70o C , Mohr’s salt solution gives more accurate results
when titrated against KMnO4 solution
72. Among the following ethers, which one will produce methyl alcohol as major
product on treatment with hot concentrated HI?
73. The solubility product (Ksp) of AgCl is 1.8  1010 . Precipitation of AgCl will occur
only when equal volumes of solutions of
1) 10 4 M Ag + and 104 M Cl are mixed 2) 10 7 M Ag + and 107 M Cl are mixed
3) 10 5 M Ag + and 105 M Cl are mixed 4) 10 10 M Ag + and 10 10 M Cl are mixed

74. Identify the major products P, Q and R in the following sequence of reactions :
75. To a given dry salt, conc. H2SO4 is added. A colourless gas with pungent smell is
evolved. It gives white dense fumes with the glass rod dipped in ammonia. Then
the anion of the salt might be
1) Cl  2) NO3 3) Br  4) SO42 
76. Following compounds are given,
Which of the above compound(s), on being warmed with iodine solution and
NaOH, will give iodoform?
1) (i), (iii) and (iv) 2) Only (ii) 3) (i), (ii) and (iii) 4) (i) and (ii)
77. III group basic radicals (Al or Fe ) are precipitated as
3+ 3+
1) Phosphates 2) Hydroxides 3) Chlorides 4) Sulphides

78. Reaction by which benzaldehyde cannot be prepared.

79. Consider figure and mark the correct option.
1) Activation energy of forward reaction is E1 + E2 and product is less stable

than reactant
2) Activation energy of forward reaction is E1 + E2 and product is more stable
than reactant
3) Activation energy of both forward and backward reaction is E1 + E2 and
reactant is more stable than product
4) Activation energy of backward reaction is E1 and product is more stable than
reactant
80.
1) o-bromoaniline 2) m-bromoaniline
3) p-bromoaniline 4) sym-tribromobenzene
81. For a given first order reaction, the rate of reaction is found to be
1.386  102 mol.lit 1.min 1 when the concentration of the reactant is 0.6M. Then the
half life of the reaction is ________ min.
1) 23.1 2) 46.2 3) 30 4) 24
82. Aniline is stronger base than ________
M
83. A solution of 10 ml of FeSO4 was titrated with KMnO4 solution in acidic
10
medium, the amount of KMnO4 used will be
1) 10ml of 0.02M 2) 10ml of 0.1M 3) 5ml of 0.1M 4) 10ml of 0.5M
84. Formic acid and formaldehyde can be distinguished with _______
1) Fehling’s solution 2) Tollen’s reagent

3) KMnO4 / H 4) Sodium bicarbonate
85. What is electronic arrangement of metal atom/ion in octahedral complex with
d 4 configuration, if 0 < pairing energy?
4 0
1) t2g eg 2) eg4t20g 3 1
3) t2g eg 4) eg2t22g
86. Which of the following is an essential amino acid?
1) Glycine 2) Alanine 3) Leucine 4) Proline

87. Match List-I with List-II :
List – I (Complex) List – II (Hybridization)
A) Ni  CO 4 I) sp 3
2
B)  Ni  CN 4  II) sp 3 d 2
C) Co  CN 6 
3 III) d 2 sp 3
D) CoF6  IV)
3
dsp 2
Choose the correct answer from the options given below.
1) (A)-IV, (B)-I, (C)-III, (D)-II 2) (A)-I, (B)-IV, (C)-III, (D)-II
3) (A)-I, (B)-IV, (C)-II, (D)-III 4) (A)-IV, (B)-I, (C)-II, (D)-III
Assertion:  FeF6  is a low spin complex.
3
88.
Reason: Low spin complexes have lesser number of unpaired electrons.
of the assertion
2) Both assertion and reason are correct, but reason is not a correct explanation
of the assertion
3) Assertion is correct, but reason is incorrect
4) Assertion is incorrect but Reason is correct
89. The magnetic moment of M 2+ is 3.87 BM. The species is
1) Mn 2+ 2) V 2+ 3) Ti 2+ 4) Cr 2+
90. If 0.5 mol of BaCl2 is mixed with 0.2 mol of Na3PO4, the maximum number of
moles of Ba3(PO4)2 that can be formed is :
1) 0.70 2) 0.50 3) 0.20 4) 0.10
BIOLOGY
91. Which of the following group members possess cell wall with stiff cellulose
plates on their outer surface?
1) Chrysophytes 2) Euglenoids 3) Dinoflagellates 4) Slime moulds
92. Match the following.
Column-I Column-II
a. Agar (i) Brown algae
b. SCP (ii) Red algae
c. Algin (iii) Chlorella
d. Carrageen (iv) Gelidium
1) a(iv), b(ii), c(iii), d(i) 2) a(iv), b(iii), c(i), d(ii)
3) a(iii), b(i), c(ii), d(iv) 4) a(iii), b(ii), c(i), d(iv)
93. Which of the following are different in RNAand DNA?
1) Purines and Pyrimidines 2) Phosphate and sugar
3) Sugar and purines 4) Sugar and pyrimidines
94. Refer the given figure of nucleosome and select the option that correctly
identifies the parts A, B and C.
A B C
1) Histone octamer DNA H1 histone
2) DNA Histone octamer H1 histone
3) Histone octamer H1 histone DNA
4) DNA H1 histone Histone octamer
95. Nutritive structure of ovule is
1) Nucellus 2) Integument 3) Chalaza 4) Tapetum

96. Match Column-I with Column-II and select the correct option from the codes
given below.
1) A - (iii), B - (i), C - (iv), D - (v), E - (ii) 2) A - (iii), B - (iv), C - (i), D -(v), E - (ii)
3) A - (iii), B - (iv), C - (v), D - (i), E - (ii) 4) A - (ii), B - (iv), C - (i), D - (v), E - (iii)
97. Match the following column I & II.
(A) Percentage of sulphur in earth (I) 0.03
crust
(B) Percentage of mg in human (II) 0.3
body
(C) Percentage of proteins in (III) 0.1
cellular mass
(D) Glut-4 (IV) 10-15
(E) Collagen (V) Glucose transport
.
(VI) Inter cellular ground substance
.
(A) (B) (C) (D) (E) (A) (B) (C) (D) (E)
1) I II IV V VI 2) I III IV V VI
3) II I IV V VI 4) III II I V IV
98. Select the correct statement belongs to Joseph Priestley.
1) Evolution of O2 from H2O, but not CO2
2) Sunlight is essential to the plant process
3) Glucose is usually stored as starch
4) Role of air in the growth of green plants
99. Which of the following cell components lack membrane?
A. Centriole B. Flagella C. Ribosome D. Microbodies
E.Vacuoles F. Lysosomes
1) A & B 2) D & E 3) A & C 4) D & F
100. The puffed-up appearance of dough is due to the production of
1) Oxygen gas 2) CO2 gas 3) Ethyl alcohol 4) Pyruvic acid
101. Study the following statements
A) Infectious agents which possess only proteins but not nucelic acid
B) These agents cause scrapie disease of sheep
C) These agents cause mad cow disease
A, B & C related to
1) Viruses 2) Viroids 3) Prions 4) Lichens
102. Statement – I: The promoter and terminator flank the structural gene in a
transcription unit.
Statement – II: A gene is defined as the functional unit of inheritance.
103. A. Both DNA and RNA are able to mutate.
B. RNA being unstable, mutates at a faster rate
C. RNA contains 21OH group at every nucleotide, hence reactive.
D. The presence of thymine at place of uracil confers additional stability to DNA.
1) All are correct 2) All are incorrect
3) Only A, B, and D are correct 4) Only D is correct

104. Characteristic (s) of most DNA is / are
A. A pairs with T by 2 hydrogen bonds.
B. Two chains have antiparallel polarity
C. 10 base pairs in each turn D. The pitch of the helix is 3.4 nm
1) A, C only 2) A, B, C, D 3) B, C, D only 4) A, B, C only
105. Statement – I: RuBisCo is the most abundant enzyme in the world.
Statement – II: The single chlorophyll a molecule forms the reaction centre.
106. Find the correct sequential order in light reaction.
I.Water splitting II. Light Absorption
III. The formation of ATP and NADPH IV. O2 release
1) I, II, III & IV 2) IV, II, III & I 3) II, I, IV & III 4) IV, III, II & I
107. Endosperm is completely consumed in all of the following plants except:
1) Pea 2) Castor 3) Beans 4) Groundnut
108. Which of the following is functionally cross-pollination and genetically
selfpollination?
1) Autogamy 2) Geitonogamy 3) Xenogany 4) Syngamy
109. ATP is utilized in the following stage of calvin cycle.
1) Carboxylation and reduction phase
2) Carboxylation and regeneration phase
3) Reduction phase only 4) Reduction and regeneration phase
110. Statement – I: In C3 plants some O2 does bind to RuBisCo, hence CO2 fixiation
is increased.
Statement – II: In the photorespiratory pathway, there is neither synthesis of
sugars, nor of ATP.
111. In the following system of classification a few characters only considered and
equal weightages given to the vegetative and sexual characters
1) Natural 2) Artificial 3) Numerical 4) Phylogenitic
112. Choose the correct combination of labelling the carbohydrate molecule involved
in the Calvin Cycle.
1) A – RuBP, B – Triose phosphate, C – PGA

2) A – PGA, B – RuBP, C – Triose phosphate
3) A – RuBP, B – 3-PGA, C – Triose phosphate
4) A – Triose phosphate, B – PGA, C – RuBP
Column – I (Pigment) Column – II (In chromatogram)
(A) Chlorophyll a (I) Bright or blue green
(B) Chlorophyll b (II) Yellow
(C) Xanthophylls (III) Yellow Green
(D)
.
Carotenoids (IV) Yellow to yellow-orange
.
(A) (B) (C) (D) (A) (B) (C) (D)

1) I II III IV 2) I III II IV
3) II I III IV 4) III II I IV

114. Select the correct sequence of electron transfer in Z-scheme of light reaction:
1) e - Acceptor  Cytochorome b6-f  PSII  NADP+  PSI  e – Acceptor
2) PSII  e– Acceptor  Cytochorome b6-f  PSI  e - Acceptor  NADP+
3) Cytochorome b6-f  PSI  e - Acceptor  PSII  e -Acceptor  NADP+
4) e -Acceptor  PSI  PSII  e -Acceptor  Cytochorome b6-f  NADP+
115. Correct floral formulae of china rose.
116. Monohybrid test cross phenotypic ratio

1) 3:1 2) 1:2:1 3) 1:1 4) 1:1:1:1
117. Which type of fruit is present in Cruciferae_________
1) Berry or nuts 2) Siliqua or lomentum
3) Capsule 4) Cypsela
118. Which of the following are not a group of brown algae?
1) Sargassum and Fucus 2) Ectocarpus. Dictyota
3) Dictyota, Laminaria 4) Spirogyra, Polysiphonia
119. Aestivation of petals in the flower of cotton is correctly shown in
120. In haplontic life cycle, meiosis occurs in

1) Spore mother cell 2) Gamete
3) Zygote 4) Gamete mother cell
121. How many seeds have RrYy genotype in the F2 generation of dihybrid cross?
1) 4 2) 3 3) 1 4) 9
122. RNA polymerase III in eukaryotes helps in synthesis of
1) 5srRNA 2) snRNA 3) t RNA 4) All of these
Column – I (Family) Column – II (Common name)
A) Graminae I) Sunflower family
B) Cruciferae II) Grass family
C) Compositae III) Cotton family
D) Malvaceae IV) Musturd family
Codes:
A B C D A B C D
1) II IV III I 2) II IV I III
3) IV II I III 4) III IV II I
124. The following component of enzyme is associated with the apoenzyme only at
the time of catalysis
1) Prosthetic group 2) Apoenzyme
3) Co-enzyme 4) Metal ion cofactor
125. Statement –I: Pulvinous leaf base present in some fabaceae members.
Statement –II: Sheathing leaf base present in grasses.
1) Both statements-I & II are correct
2) Both statements-I & II are incorrect
3) Statement-I is correct and statement-II is incorrect
4) Statement I is incorrect but Statement II is correct
126. The leaves in gymnosperms are well adapted to with-stand extremes of
1) Temperature 2) Light 3) Wind 4) More than one option is correct
127. Double fertilization occurs in
1) Sunflower, Cycas, Pinus 2) Wolfia, Eucalyptus, Sunflower
3) Ginkgo, Pinus, Wolfia 4) Eucalyptus, Wolfia, Cycas
128. Ray florets of sunflower do not have
1) Inferior ovary 2) Basal placentation
3) United petals 4) Androecium

129. Caryopsis (fruit wall completely fused with seed coat) present in _______
1) Rice 2) Sunflower 3) Thespesia 4) Tridax
130. How many of the following members are basic food of mankind ______
(a) Rice (b) Wheat (c) Barley (d) Corn
(e) Bajra (f) Bambusa (g) Tridax (h) Lemon grass
1) Five 2) Six 3) Seven 4) All of these
131. Arrange the stages of embryogeny in a dicotyledonous embryos in correct order
1) Zygote - proembryo, globular - heart shaped - mature embryo
2) Zygote - globular, proembryo - heart shaped - mature embryo
3) Zygote – heart shaped - globular - proembryo - mature embryo
4) Zygote - mature embryo - globular – heart shaped - proembryo
132. Mis match of the following
1) DNA ligase – Join foreign DNA to plasmid to form r-DNA
2) Origin of replication – Specific DNA sequence which is responsible for
initiating replication
3) Sticky ends – Single stranded clipped ends prevent the pasting of pieces of
DNA
4) Plasmids – Small ringlets of DNA and replicate independently
133. Find the following pair of organisms containing two flagella, In one organism
two long flagella arranged at right angles with each other and other contains
one long and one short flagellum.
1) Euglena &Paramoecium 2) Trypanosoma& Euglena
3) Alternaria& Euglena 4) Gonyaulax& Euglena
134. Choose the true statement for monocotyledonous root.
i) The innermost layer of the cortex is called endodermis which consist of single
layer of barrel-shaped cells without any intercellular spaces.
ii) Initiation of lateral roots and vascular cambium during the secondary
growth takes place from pericycle
iii) Pith is large and well developed.
iv) The parenchymatous cells which lie between the xylem and the phloem are
called medullary rays
v) There are usually more than six (polyarch) xylem bundles.
1) i, ii and v 2) i, iii and v 3) I, iv and v 4) iv and v
135. Find true statement
1) Chloroplast contains enzymes required for the synthesis of carbohydrates
and proteins.
2) DNA and Ribosomes present in the chloroplast and Mitochondria.
3) ATP synthesis occurs in both chloroplast and Mitochondria.
4) All
136. Select the correctly written scientific name of Mango which was first described
by Carolus Linnaeus.
1) Mangifera Indica Linn 2) Mangifera indica Linn
3) Mangifera indica 4) Mangifera Indica
137. Match Column – I with Column – II for housefly classification and select the
correct option using the codes given below
A. Family (i) Diptera
B. Order (ii) Arthropoda
C. Class (iii) Musciday
D. Phylum (iv) Insecta
Choose the correct answer from the option given below

1) A-i B-i C-iii D-ii
2) A-iii B-ii C-iv D-i
3) A-iv B-iii C-ii D-i
4) A-iv B-ii C-i D-iii
138. Bilaterally symmetrical and acoelomate animals are exemplified by
1) Platyhelminthes 2) Aschelminthes
3) Annelida 4) Ctenophora

139. Match List – I with List – II
A. Metamerism (i) Coelenterata
B. Canal system (ii) Ctenophora
C. Comb plates (iii) Annelida
D. Cnidoblasts (iv) Porifera
1) A-iii B-iv C-i D-ii
2) A-iii B-iv C-ii D-i
3) A-iv B-i C-ii D-iii
4) A-iv B-iii C-i D-ii
140. Assertion (A): All vertebrates are chordates but all chordates are not
vertebrates
Reason (R): Notochord is replaced by vertebral column in the adult vertebrates
In the light of the above statements, choose the correct answer from the options
given below.
1) (A) is not correct but (R) is correct
2) Both (A) and (R) are correct and (R) is the correct explanation of (A)
3) Both (A) and (R) are correct and (R) is not the correct explanation of (A)
A. Proventriculus (i) Dorsal side of the frog’s heart
B. Elongated muscular tube (ii) having connection with ventricle
C. Conus arteriosus (iii) Grinds food particles
D. Sinus venosus (iv) Heart of Cockroach
1) A-iii B-i C-ii D-iv
2) A-iii B-iv C-ii D-i
3) A-i B-ii C-iii D-iv
4) A-ii B-i C-iv D-iii
142. Which of the following statements wrongly represents the nature of visceral
muscle?
1) They are involuntary muscles
2) They do not assist in the transport of food through the digestive tract
3) These muscles are present in the wall of blood vessels
4) These muscle have no striations
143. A healthy adult human has on an average ______of RBCs in blood.
1) 6000 – 8000mm-3 2) 1,50,000 – 3,50,000mm-3
3) 2 - 2.5 millions mm -3 4) 5 – 5.5 millions mm-3
144. What would be the heart rate of a person if the cardiac output is 5L, blood
volume in the ventricles at the end of diastole is 100 ml and at the end of the
ventricular systole is 50 ml?
145. Nitrogenous waste is excreted in the form of pellet or paste by
1) Ornithorhyncus 2) Salamandra 3) Hippocampus 4) Pavo
146. Select the correct events that occur during inspiration
i) Contraction of diaphragm
ii) Contraction of external inter-costal muscles
iii) Pulmonary volume decreases
iv) Intra pulmonary pressure increases
1) iii and iv only 2) i, ii and iv only 3) only iv only 4) i and ii only

147. Tidal Volume and Expiratory Reserve Volume of an athlete is 500 mL and 1000
mL, respectively. What will be his Expiratory Capacity if the Residual Volume is
1200 mL?
1) 1500 mL 2) 1700 mL 3) 2200 mL 4) 2700 Ml
148. Identify the wrong statement with reference to transport of oxygen
1) Partial pressure of CO2 can interfere with O2 binding with haemoglobin
2) Higher H+ conc. in alveoli favours the formation of oxyhaemoglobin
3) Low pCO2 in alveoli favours the formation of oxyhaemoglobin
4) Binding of oxygen with haemoglobin is mainly related to partial pressure of
O2
149. Statement I: The coagulum is formed of network of threads called thrombins
Statement II: Spleen is the graveyard of erythrocytes.
given below.
3) Both Statement I and Statement II are incorrect
4) Statement I is correct but Statement II is incorrect
150. Match Column – I with Column – II
A. Eosinophils i. Immune response
B. Basophils ii. Phagocytosis
C. Neutrophils iii. Release histamine
D. Lymphocytes iv. Resist infections
(A) (B) (C) (D)
1) (iv) (i) (ii) (iii)
2) (i) (ii) (iv) (iii)
3) (ii) (i) (iii) (iv)
4) (iv) (iii) (ii) (i)
151. Which of the following is associated with decrease in cardiac output?
1) Parasympathetic neural signals 2) Pneumotaxic centre
3) Adrenal medullary hormones 4) Sympathetic nerves
152. Select the correct statement:
1) Angiotensin II is a powerful vasodilator
2) Counter current pattern of blood flow is not observed in vasa recta
3) Reduction in Glomerular Filtration Rate activates JG cells to release renin
4) Atrial Natriuretic Factor increases the blood pressure.
153. The increase in osmolarity from outer to inner medullary interstitium is
maintained due to
i) Close proximity between Henle’s loop and vasa recta
ii) Counter current mechanism
iii) Selective secretion of HCO and hydrogen ions in PCT
iv) Higher blood pressure in glomerular capillaries
1) (iii) and (iv) 2) (i), (ii) and (iii) 3) (i) and (ii) 4) Only (ii)
A. Scapula (i) Cartilaginous joints
B. Cranium (ii) Flat bone
C. Sternum (iii) Fibrous joints
D. Vertebral column (iv) Triangular flat bone
1) A-ii B-iii C-iv D-i
2) A-iii B-ii C-iv D-i
3) A-iv B-iii C-ii D-i
4) A-i B-iii C-ii D-iv
155. Chronic autoimmune disorder affecting neuromuscular junction leading to
fatigue, weakening and paralysis of skeletal muscle is called as:
1) Muscular dystrophy 2) Myasthenia gravis 3) Gout 4) Arthritis
156. Which of the following is the contractile protein of a muscle.
1) Tropomyosin 2) Troponin 3) Myosin 4) All of these

157. Assertion (A): Osteoporosis is characterised by decreased bone mass and
increased chances of fractures.
Reason (R): Due to increased levels of estrogen
158. Select the incorrect statement regarding synapses
1) The membranes of pre and post synaptic neurons are in close proximity in an
electrical synapse
2) Electrical current can flow directly from one neuron into the other across the
synapses.
3) chemicalsynapses use neurotransmitters
4) Impulse transmission across a chemical synapse is always faster than that
across an electrical synapse.
159. Hormones stored and released from neurohypophysis are
1) Oxytocin and Vasopressin
2) Follicle stimulating hormone and Leutinizing hormone
3) Prolactin and Vasopressin
4) Thyroid stimulating hormone and oxytocin
A. Pituitary gland i. Graves’ disease
B. Thyroid gland ii. Diabetes mellitus
C. Adrenal gland iii. Diabetes insipidus
D. Pancreas iv. Addision’s disease
(A) (B) (C) (D)
1) (i) (ii) (iii) (iv)
2) (iii) (i) (iv) (ii)
3) (ii) (i) (iv) (iii)
4) (iv) (iii) (i) (ii)
161. Erythropoietin hormone which stimulates R.B.C. formation is produced by
1) The cells of dorsal adenohypophysis 2) The cells of bone marrow
3) Juxtaglomerular cells of the kidney 4) Alpha cells of pancreas
162. Which of the following statements are true for spermatogenesis but do not true
for Oogensis?
A. It results in the formation of haploid gametes
B. From one primary spermatocyte four sperms formed
C. It is initiated at puberty
Choose the most appropriate answer from the options given below
1) B, C 2) A, C 3) A, B 4) A, B, C
163. Which of the following hormone levels will cause release of ovum (ovulation)
from the graffian follicle
1) High concentration of Progesterone 2) Low concentration of LH
3) Low concentration of FSH 4) High concentration of LH
164. Which of these is not an important component of initiation of parturition in
humans?
1) Origin of signals from fully developed foetus and placenta.
2) Release of Oxytocin 3) Release of Prolactin
4) Increase in estrogen and progesterone ratio
165. Select the option including all sexually transmitted diseases
1) Gonorrhoea, Malaria, Genital herpes 2) AIDS, Malaria, Filaria
3) Cancer, AIDS, Syphilis
4) Gonorrhoea, Syphilis, Genital herpes
166. In which of the following techniques, the embryos are transferred to assit those
females who cannot conceive?
1) GIFT and ZIFT 2) ICSI and GIFT 3) GIFT and ICSI 4) ZIFT and IUT

1) Male fruit fly is heterogametic
2) In male grasshoppers 50% of sperms have no sex-chromosome
3) In domesticated fowls, sex of progeny depends on the type of sperm rather
than egg
4) Humans males have one of their sex-chromosome much shorter than the
other
168. Which of the following occurs due to the presence of autosome linked dominant
trait?
1) Thalassemia 2) Sickle cell anaemia
3) Myotonic dystrophy 4) Haemophilia
169. A disease caused by non segregation of chromatids during cell cycle.
1) Down’s syndrome 2) Klinefelter’s syndrome
3) Turner’s syndrome 4) Sickle cell anemia
170. Which of the following refer to correct example(s) of organisms which have
evolved due to changes in environment brought about by anthropogenic action?
i) Darwin’s Finches of Galapagos islands
ii) Herbicide resistant weeds
iii) Drug resistant eukaryotes
1) (i) and (iii) 2) (ii), (iii) only 3) Only (i) 4) Only (ii)
171. The phenomenon of evolution of different species in a given geographical area
starting from a point and spreading to other habitats is called
1) Co-evolution 2) Natural selection 3) Adaptive 4) Saltation
A. Filariasis (i) Haemophilus influenzae
B. Amoebiasis (ii) Trichophyton
C. Pneumonia (iii) Wuchereria bancrofti
D. Ringworm (iv) Entamoeba histolytica
1) A-iii B-iv C-i D-ii
2) A-i B-ii C-iv D-iii
3) A-ii B-iii C-i D-iv
4) A-iv B-i C-iii D-ii
173. Statement I: Autoimmune disorder is a condition where body defense
mechanism recognizes its own cells as foreign bodies.
Statement II: Rheumatoid arthritis is a condition where body does not attack
self cells.
given below.
174. Drug called ‘Heroine’ is synthesised by
1) Methylation of morphine 2) Acetylation of morphine
3) Glycosylation of morphine 4) Nitration of morphine
175. Transposons can be used during which one of the following?
1) Gene sequencing 2) Polymerase chain Reaction
3) Gene silencing 4) Autoradiography
176. The adenosine deaminase deficiency results into
1) Parkinson’s disease 2) Digestive disorder
3) Addison’s disease 4) Dysfunction of Immune system
177. The laws and rules to prevent unauthorised exploitation of bio-resources are
termed as
1) Bioethics 2) Bioengineering 3) Biopiracy 4) Biopatenting

A. Bt cotton (i) Gene therapy
B. Adenosine deaminase deficiency (ii) Cellular defence
C. RNAi (iii) Detection of HIV infection
D. PCR (iv) Bacillus thuringiensis
A B C D A B C D
1) IV I II III 2) III II I IV
3) II III IV I 4) I II III IV
179. Which one of the following statements cannot be connected to predation?
1) It is necessitated by nature to maintain the ecological balance
2) It helps in maintaining species diversity in a community
3) It might lead to extinction of a species if predator is too efficient
4) Both the interacting species are negatively impacted.
180. Statement I: Decomposition is a process in which the detritus is degraded into
simple substances by microbes.
Statement II: Decomposition is faster if the detritus is rich in lignin and chitin.
given below.
*******

: ANSWER KEY:
Q.NO. Key Q.NO. Key Q.NO. Key Q.NO. Key Q.NO. Key
1 2 11 2 21 3 31 4 41 2
2 1 12 2 22 1 32 1 42 4
3 2 13 1 23 4 33 3 43 1
4 4 14 4 24 4 34 3 44 4
5 4 15 1 25 2 35 3 45 2
6 4 16 1 26 3 36 3
7 4 17 1 27 3 37 3
8 2 18 2 28 1 38 1
9 1 19 2 29 2 39 2
10 3 20 4 30 1 40 4
SUB: CHEMISTRY
46 1 56 1 66 2 76 3 86 3
47 3 57 1 67 2 77 2 87 2
48 4 58 3 68 2 78 2 88 4
49 4 59 1 69 2 79 1 89 2
50 2 60 3 70 4 80 4 90 4
51 4 61 2 71 4 81 3
52 1 62 2 72 1 82 3
53 2 63 3 73 1 83 1
54 2 64 4 74 4 84 4
55 4 65 2 75 1 85 3
SUB: BOTANY
91 3 101 3 111 2 121 1 131 1
92 2 102 1 112 3 122 4 132 3
93 4 103 1 113 2 123 2 133 4
94 1 104 2 114 2 124 3 134 2
95 1 105 1 115 2 125 1 135 4
96 2 106 3 116 3 126 4
97 2 107 2 117 2 127 2
98 4 108 2 118 4 128 4
99 3 109 4 119 2 129 1
100 2 110 3 120 3 130 1
SUB: ZOOLOGY
136 2 146 4 156 3 166 4 176 4
137 1 147 1 157 2 167 3 177 4
138 1 148 2 158 4 168 3 178 1
139 2 149 1 159 1 169 ADD 179 4
140 2 150 4 160 2 170 2 180 4
141 2 151 1 161 3 171 3
142 2 152 3 162 4 172 1
143 4 153 3 163 4 173 4
144 4 154 3 164 3 174 2
145 4 155 2 165 4 175 3

XII- NEET GT - 7
answer sheet.

PHYSICS Mr.HARIKUMAR
Dr.RB.RB
CHEMISTRY
Mr.PHANI
BOTANY Mrs.SREEDEVI
ZOOLOGY Mr.BRAHMAIAH
PHYSICS
1. If force [F], acceleration [A] and time [T] are choosen as the fundamental
physical quantities. Find the dimensions of energy.
1) [F] [A-1][T] 2) [F] [A][T] 3) ) [F] [A][T2] 4) ) [F] [A][T-1]
2. The displacement-time graphs of two moving particles make angles of 300 and
450 with the x-axis as shown in the figure. The ratio of their respective velocity
is
1) 3 :1 2) 1:1 3) 1: 2 4) 1: 3
3. The x and y coordinates of the particle at any time are x  5t  2t 2 and y  10t
respectively, where x and y are in metres and t in seconds. The acceleration of
the particle at t = 2 s is
1) 5ms2 2) 4ms2 3) 8ms2 4) 0
4. Two racing cars of masses m1 and m2 are moving in circles of radii r1 and r2
respectively. Their speeds are such that each makes a complete circle in the
same time t. The ratio of the angular speeds of the first to the second car is
1) r1 : r2 2) m1 : m2 3) 1 : 1 4) m1m2 : r1r2
5. The force F acting on a particle of mass m is indicated by the force time graph
as shown. The change in momentum of the particle over the time interval from
zero to 8s is
1) 24 N s 2) 20 N s 3) 12 N s 4) 6 N s
6. Three blocks with masses m, 2m and 3m are connected by strings, as shown in
the figure. After an upward force F is applied on block m, the masses move
upward at constant speed v. What is the net force on the block of mass 2m?
(g is the acceleration due to gravity)
1) 3mg 2) 6mg 3) Zero 4) 2mg

7. A body initially at rest and sliding along a frictionless track from a height h (as
shown in the figure) just completes a vertical circle of diameter AB = D. The
height h is equal to
3 7 5
1) D 2) D 3) D 4) D
2 5 4
8. A position dependent force,
F  7  2x  3x 2  N acts on a small body of mass 2kg and displaces it from x = 0
to x = 5 m. The work done in joule is
1) 135 2) 270 3) 35 4) 70
9. A moving block having mass m, collides with another stationary block having
mass 4m. The lighter block comes to rest after collision. When the initial
velocity of the lighter block is v, then the value of coefficient of restitution (e) will
be
1) 0.5 2) 0.25 3) 0.8 4) 0.4
10. Two objects of mass 10kg and 20kg respectively are connected to the two ends
of a rigid rod of length 10m with negligible mass. The distance of the center of
mass of the system from the 10kg mass is
10 20
1) m 2) m 3) 10m 4) 5 m
3 3
11. Four identical thin rods each of mass M and length l, from a square frame.
Moment of inertia of this frame about an axis through the centre of the square
and perpendicular to its plane is
2 13 2 1 4
1) Ml2 2) Ml 3) Ml2 4) Ml2
3 3 3 3
12. Starting from the centre of the earth having radius R, the variation of g
(acceleration due to gravity) is shown by
13. The ratio of escape velocity at earth (ve) to the escape velocity at a planet (vp)
whose radius and mean density are twice as that of earth is
1) 1 : 4 2) 1: 2 3) 1: 2 4) 1: 2 2
14. A ray of light from a denser medium strikes a rarer medium. The reflected and
refracted rays make an angle of 900 with each other. The angles of reflection and
refraction are r and r1. The crictical angle would be
1) sin 1  tan r  2) tan 1  sin r  
3) sin 1 tan r1  
4) tan 1 sin r1 
15. A rectangular film of liquid is extended from (4cm x 2cm) to (5cm x 4cm). if the
work done is 3104 J , the value of the surface tension of the liquid is
1) 0.250 N m1 2) 0.125 N m1 3) 0.2 Nm1 4) 0.8 Nm1
16. A copper rod of 88cm and an aluminium rod of unknown length have their
increase in length independent of increase in temperature. The length of
aluminium rod is αCu  1.7105 K1 , α Al  2.2105 K1 
1) 68 cm 2) 6.8 cm 3) 113.9 cm 4) 88 cm

17. Two rods A and B of different materials are welded together as shown in figure.
Their thermal conductivities are K1 and K2. The thermal conductivity of the
composite rod will be
3 K1  K 2  K  K2
1) 2) K 1  K 2 3) 2  K1  K 2  4) 1
2 2
18. In a circuit, the value of the alternating current is measured by hot wire
ammeter as 10 ampere. Its peak value will be
1) 10A 2) 20 A 3) 14.14 A 4) 7.07 A
19. Thermodynamic processes are indicated in the following diagram.
Match the following

Column I Column II
P. Process I A. Adiabatic
Q. Process II B. Isobaric
R. Process III C. Isochoric
S. Process IV D. Isothermal
1) P  C, Q  A, R  D, S  B 2) P  C, Q  D, R  S, S  A
3) P  D, Q  B, R  A, S  C 4) P  A, Q  C, R  D, S  B
20. A proton enters a magnetic field of flux density 1.5 T with a velocity of
20 107 ms 1 at an angle of 300 with the field. The force on the proton is
e p  1.6 1019 C 
1) 2.4 1010 N 2) 2.4 1011 N 3) 3.4 105 N 4) 3 104 N
21. A particle executes linear simple harmonic motion with an amplitude of 3cm.
When the particle is at 2cm from the mean position, the magnitude of its
velocity is equal to that of its acceleration. Then its time period in seconds is
5 4π 2π 5
1) 2) 3) 4)
2π 5 5 π
22. A spring is stretched by 5cm by a force 10 N. The time period of the oscillations
when a mass of 2kg is suspended by it is
1) 0.628 s 2) 0.0628 s 3) 6.28 s 4) 3.14 s
23. The phase difference between two waves, represented by
y1  106 sin[100t   x / 50  0.5]m
y 2  106 cos[100t   x / 50]m
Where x is expressed in meters and t is expressed in seconds, is approximately
1) 1.07 radians 2) 2.07 radians 3) 0.5 radians 4) 1.5 radians

24. The fundamental frequency in an open organ pipe is equal to the third
harmonic of a closed organ pipe. If the length of the closed organ pipe is 20cm,
the length of the open organ pipe is
1) 13.2 cm 2) 8 cm 3) 12.5 cm 4) 16cm
25. A charge q is placed at the centre of the line joining two equal charges Q. The
system of the three charges will be in equilibrium if q is equal to
1) –Q/4 2) Q/4 3) –Q/2 4) Q/2
26. A hollow metal sphere of radius R is uniformly charged. The electric field due to
to the sphere at a distance r from the centre.
1) Decrease as r increases for r < R and for r > R
2) Increase as r increases for r < R and for r > R
3) Zero as r increases for r < R, decreases as r increases for r > R
4) Zero as r increases for r > R, increases as r increases for r > R
27. The electric potential V at any point (x,y,z), all in metres in space is given by
V  4x 2 volt. The electric field at the point (1, 0, 2) in volt/meter, is
1) 8 along negative X-axis 2) 8 along positive X-axis
3) 16 along negative X-axis 4) 16 along positive X-axis
28. The equivalent capacitance of the combination shown in the figure is
1) 3C/2 2) 3C 3) 2C 4) C/2
29. A wire of resistance 4  is stretched to twice its original length. The resistance
of stretched wire would be
1) 8  2) 16  3) 2  4) 4 
30. Current through 3  resistor is 0.8 ampere, then potential drop through 4 
resistor is
1) 9.6 V 2) 2.6 V 3) 4.8 V 4) 1.2 V

31. A straight conductor carrying current i splits into two parts as shown in the
figure. The radius of the circular loop is R. The total magnetic field at the centre
P of the loop is
μ 0i
1) Zero 2) 3μ 0i / 32R,outward 2) 3μ 0i / 32R,inward 4) ,inward
2R

32. A copper disc of radius 0.1 m is rotated about its natural axis with 10 rps in a
uniform magnetic field of 0.1 T with its plane perpendicular to the field. The emf
induced across the radius of the disc is
1)  10V 2) 2 10V 3)  102 V 4) 2 102 V
33. A bar magnet of magnetic moment M is cut into two parts of equal length. The
magnetic moment of each part will be
1) M 2) 2M 3) Zero 4) 0.5 M
34. The magnetic susceptibility is negative for
1) Ferromagnetic material only
2) Paramagnetic and ferromagnetic materials
3) Diamagnetic material only 4) Paramagnetic material only
35. A long straight wire is carrying a current of 25A, a rectangular coil of length
25cm and breadth 10cm, carrying a current of 15A, is placed 2cm from the
wire. The force on the coil is
1) 7.8 104 N towards the wire 2) 7.8 104 N away from the wire
3) 9.4 104 N towards the wire 4) 9.4 104 N away from the wire
36. If the degree of freedom of a gas are f, then the ratio of two specific heats C p / Cv
is given by
2 2 1 1
1)  1 2) 1  3) 1  4) 1 
f f f f
37. Density of a liquid ‘A’ is 0.5g/c.c and that of liqid ‘B’ is 0.6 g/c.c. Heat capacity
of 8 litres of ‘A’ is equal to that of 10 litres of ‘B’. Then their specific heats ratio
is
1) 4: 5 2) 3 : 2 3) 2 : 3 4) 1 : 1
38. Out of the following options which one can be used to produce a propagating
electromagnetic wave?
1) A chargeless particle 2) An accelerating charge
3) A charge moving at constant velocity 4) A stationary charge
39. Two identicals glass μ g  3/ 2 equiconvex lenses of focal length f each are kept
in contact. The space between the two lenses is filled with water μ W  4 / 3 . The
focal length of the combination is
1) f/3 2) f 3) 4f/3 4) 3f/4
40. Assertion:- Steel is more elastic than rubber.
Reason:- Under given deforming force, steel is deformed less than rubber.
of the assertion
of the assertion
41. In a Young’s double slit experiment if there is no initial phase difference
between the light from the two slits, a point on the screen corresponding to the
fifth minimum has path difference.
λ λ λ λ
1) 5 2) 10 3) 9 4) 11
2 2 2 2

42. As the intensity of incident light increases
1) Kinetic energy of emitted photoelectrons increases
2) Photoelectric current decreases
3) Photoelectric current increases
4) Kinetic energy of emitted photoelectrons decreases
43. The total energy of an electron in an atom in an orbit is -3.4 eV. Its kinetic and
potential energies are respectively,
1) 3.4 eV, 3.4 eV 2) -3.4 eV, -3.4 eV 3) -3.4 eV, -6.8 eV 4) 3.4 eV, -6.8 eV
44. A certain mass of Hydrogen is changed to Helium by the process of fusion. The
mass defect in fusion reaction is 0.02866 u. The energy liberated for u is (given
1 u = 931 MeV)
1) 6.675 MeV 2) 13.35 MeV 3) 2.67 MeV 4) 26.7 MeV
45. The given circuit has two ideal diodes connected as shown in the figure. The
current flowing through the resistance R1 will be
1) 2.5 A 2) 10.0 A 3) 1.43 A 4) 3.13 A

CHEMISTRY
46. For a reaction,
2A  product,
in 20 minutes time, the concentration of ‘A’ decreased from 0.8M to 0.4M. Then
the rate of reaction is ________ M.min 1
1) 0.02 2) 0.01 3) 0.04 4) 0.05
47. Correct representation of 3-methylpent-3-en-2-ol is
48. Among the following statements,

A) In a photoelectric effect experiment, the threshold energy of metal depends
upon energy of incident radiation.
B) Degenerate orbitals differ in their orientation.
C) Electron revolving in 1st orbit of He ion will make more number of
revolutions per second than that of electron in first orbit of H-atom.
49. In which of the following, the order is not strictly according to the property
written against it?
1) B < Al > Ga < In < Tl (Atomic radii)
2) B > Al > Ga > In > Tl (Ionisation enthalpy)
3) C > Si > Ge > Sn < Pb (Ionisation enthalpy)
4) C > Si = Ge = Sn < Pb (Electro negativity)
50. The correct matching for the following is :
(Pair of coordination compounds) (Respective isomerism)
A) Co  NH 3  Cl  SO4 and Co  NH 3  SO4  Cl P) Linkage isomerism
 5   5 
B)  Pt  NH 3 4  CuCl4  and Cu  NH3  4   PtCl4  Q) Hydrate isomerism
C) Co  NH 3 5  NO2   Cl2 and Co  NH 3 5  ONO   Cl2 R) Ionisation isomerism
D) Cr  H 2O 6  Cl3 and Cr  H 2O 5 Cl  Cl2 .H 2O S) Coordination isomerism
1) AR, BP, CS, DQ 2) AR, BS, CQ, DP
3) AR, BS, CP, DQ 4) AQ, BS, CP, DR

51. The energy required to convert all the atoms of magnesium to magnesium ions
present in 24 mg of magnesium vapours is (First and second ionization
enthalpies of Mg are 737.76 and 1450.73 kJ mol1 respectively)
1) 2.19 kJ 2) 102 kJ 3) 92 kJ 4) 9.2 kJ
52. Assertion (A): As temperture increases, solubility of a gas in a liquid decreases.
Reason (R) : Solubility of a gas in a liquid is an exothermic process and as
temperture increases KH of gas increases.
of the assertion
53. Match the following and choose the correct option.
P) BCl3 i) Linear
Q) XeO4 ii) Planar triangular
R) SF6 iii) Tetrahedral
S) 
I3 iv) Octahedral
v) Square planar
P Q R S P Q R S
1) ii iii iv i 2) v iii ii i
3) ii v iv i 4) v iv iii ii
54. From the following bond energy data,
C – C  347 kJ/mol
C = C  612 kJ/mol
C – Cl  331 kJ/mol
C – H  414 kJ/mol
Cl – Cl  243 kJ/mol
The enthalpy of following reaction is __________ kJ.
H 2C  CH 2  Cl2  ClCH 2  CH 2Cl
1) -684 2) -154 3) +89 4) +177
55. Mark the incorrect statement in the following :
1) The bond order in the species O2 , O2 and O2 decreases as O2  O2  O2
2) The bond energy in a diatomic molecule always increase when an electron is
lost
3) Electrons in antibonding M.O. contribute to repulsion between two nuclei
4) With increase in bond order, bond length decreases and bond strength
increases
56. The number of P – P bonds present in 12.4g of white phosphorus is ________
[At wt of ‘P’ = 31 g/mol]
1) 6.023 1022 2) 1.506 1022 3) 3.0115 1022 4) 3.6138 1023
57. The incorrect statement concerning the structures A, B and C is
1) A, B and C are resonance structures 2) A, B and A, C are tautomers

3) B and C are geometrical isomers 4) B and C are diastereomers
58. The limiting molar conductivities of HCOO and H  are 54.6 S.cm2 .mol1 and
349.6 S.cm2 .mol1 respectively. The molar conductivity of 0.025 mol.lit 1 HCOOH is
46.1 S.cm2 .mol1 . Then the dissociation constant of HCOOH is ______
1) 3.67 104 2) 3.25 104 3) 4.28 104 4) 4.62 105
59. Arrange the following alkyl bromides in decreasing order of rates of SN2
displacement reaction.
I) CH 3  CH  CH 3   CH 2  CH 2 Br II) CH 3CH 2CH  CH 3  CH 2 Br
III) CH 3  CH  Br   CH 2CH 2CH 3 IV) CH 3  CH 2  C  Br   CH  CH 2
1) II > III > I > IV 2) I > II > IV > III 3) I > II > III > IV 4) I > IV > III > II

60. Which of the following can change the magnitude of rate constant of a given
reaction?
1) changing the concentration of reactants 2) time of reaction
3) only temperature 4) temperature as well as catalyst
61. Identify the correct order of reactivity towards electrophilic substitution
reactions of the following compounds.
1) II > III > I > IV 2) I > II > IV > III 3) I > II > III > IV 4) I > IV > III > II
62. Which of the following is used as stabilizer in the preparation of colloidal
graphite by mechanical dispersion?
1) Tannin 2) Gum Arabic 3) Lamp black 4) CdS
63. Which among the following compounds are aromatic in nature?
1) II, IV, VI only 2) II, III, V only 3) II, IV, V only 4) I, II, IV only
64. The correct combination is

(Titration) (Suitable indicator)
A) HCl Vs NaOH P) Methyl orange
B) HCl Vs NH4OH Q) Methyl red or phenophthalein
C) CH3COOH Vs NaOH R) KMnO4 (self indicator)
D) KMnO4 Vs H2C2O4 S) Phenophthalein
1) AQ, BP, CS, DR 2) AQ, BS, CP, DR
3) AS, BP, CQ, DR 4) AQ, BP, CQ, DP
65. Addition of HBr (1mole) respectively on; CHC–CH2–CH=CH2 and CHC–
CH=CH2 separately gives
CH  C  CH 2  CHBr  CH 3 and CH 2  C  CH  CH 2
1)
Br
CH  C  CH 2  CHBr  CH 2 and CH 2  C  CH  CH 2
2)
Br Br
CH  C  CH 2  CH  CH 3 and CH  C  C  CH 2
3)
Br Br
4) CH2Br – CH2CH2 – CH2Br and CH2Br – CH2CH2CH3
66. Which of the following is neither oxidation nor reduction?
1) NO2  NO3 2) MnO4   MnO42 3) S 2O82  SO42  4) Cr2O72  
 CrO42
67. Match the List I with List II and select the correct answer using the code given
below the lists :
P) Propyne, Propene 1) Neutral FeCl3 solution
Q) Benzene, Ethene 2) Tollens’ reagent
R) Benzene, Hexane 3) Baeyer’s reagent
S) Benzene, Phenol 4) Sooty flame test
Codes :
P Q R S P Q R S
1) 3 1 2 4 2) 2 3 4 1
3) 4 3 1 2 4) 3 2 4 1

68. Whch of the following is wrong?
1) Ce4 is a good oxidizing agent become Ce
o
4
/ Ce3
is higher +ve
2) Eu 2  Z  63 is colourless but paramagnetic in nature
3) Zr and Hf have almost same atomic radii due to lanthanoid contraction
4) In 3d-seires manganese has the highest heat of atomization
69. The correct order of increasing reactivity of C – X bond towards nucleophile in
the following compounds is
1) I < II < IV < III 2) II < III < I < IV 3) IV < III < I < II 4) III < II < I < IV
70. MX is a salt of weak acid, HX  K a  106  and weak base, MOH  Kb  108  . Then
which of the following is wrong regarding the salt solution of MX?
1) MX undergoes both cationic and anionic hydrolysis
2) pH of given 1M aqueous solution of MX salt is 6
3) 0.01M aq.solution of MX has higher pH than 0.1M aq.solution of MX
4) Both (1) and (2)
71. A compound ‘A’ having the molecular formula C5H12O on oxidation gives a
compound ‘B’ with molecular formula C5H10O. Compound ‘B’ gave a 2, 4-DNP
derivative but did not give the haloform test. The structure of the compound ‘A’
is
1) CH3COCH2CH2CH3 2) CH3CHOHCH2CH2CH3
3) CH3CH2COCH2CH3 4) CH3CH2CHOHCH2CH3
72. Assertion (A): In wrist watches, button cell (or) mercury cell is used.
Reason (R) : The cell potential of mercury cell remains constant during its life
as overall reaction taking place in cell does not involve any ion.
of the assertion
73. In the reaction
CH 3CHCH 3  alc.
KOH
 A HBr

Peroxide
 B 
CH 3ONa
 C , C is
Br
1) diethyl ether 2) 1-methoxy propane
3) isopropyl alcohol 4) propylene glycol
74. If the molecular weight of a metal phosphate, M3(PO4)2 is 262 g/mol, then the
equivalent weight of metal ‘M’ is _______
1) 27 2) 9 3) 24 4) 12
75. In a set of reactions m-bromobenzoic acid gave a product S. Identify the
product S. COOH
SOCl2 NH3 NaOH

Q  R S
Br2
Br
P
CONH2 SO2NH2 COOH NH2
1) 2) 3) 4)
Br Br Br Br

76. The rate of a reaction quadruples when the temperature is changed from 300K
to 320K. Then the activation energy of the reaction is _______ kJ/mol.
1) 55.336 2) 24.028 3) 48.056 4) 69.345
77. In Cannizzaro reaction given below
:OH 
2 PhCHO   PhCH 2OH  PhCOO 
the slowest step is
1) the attack of : OH  at the carboxyl group
2) the transfer of hydride to the carbonyl group
3) the abstraction of proton from the carboxylic group
4) the deprotonation of PhCH2OH
78. For a reversible reaction,
 2C  g   3D  g 
A  g   3 B  g  
initially A and B are taken in one mole each in a 1 lit container. At equilibrium
the concentrations of B and C are found to be same. Then the equilibrium
constant (Kc) is ________ mol.lit 1 .
1) 0.675 2) 0.525 3) 0.45 4) 0.825
79. Aniline in a set of the following reactions gives a coloured product ‘Y’.
The structure of ‘Y’ would be
80. Assertion (A): Group II cations  Cu 2 or Pb2  are precipitated as metal sulphides
by passing H2S gas through salt solution after the addition of HCl, while gorup
 
IV cations Zn2 or Mn2 can not be precipitated in presence of HCl with H2S.
Reason (R) : Ksp values of group II metal sulphides are higher in magnitude
than that of group IV metal sulphides.
of the assertion
81. Match List I with List II and select the correct answer using the codes given
below the lists :
I) Anti beri-beri factor A) Vitamin C
II) Pancreas B) Glycerides
III) Palm oil C) Vitamin B1
IV) L(+)-Ascorbic acid D) Insulin
Codes :
1) I-C, II-D, III-B, IV-A 2) I-C, II-D, III-A, IV-B
3) I-A, II-B, III-D, IV-C 4) I-C, II-B, III-C, IV-D
82. 100 ml of 0.02M H2SO4 and 100ml of 0.04M NaOH are mixed. Then the pH of
resulting solution is ______
1) <7 2) >7 3) 0 4) 7
83. The acid produced (A) in the sequence given below is
H 3O 
C2 H 5 I 
alc.
KOH
 X  
Br2 (Ex)
CCl4
 Y 
KCN
excess
 Z  A
1) Succinic acid 2) Malonic acid 3) Oxalic acid 4) Maleic acid

84. Which of the following has zero nodal planes and 4 radial nodes?
1) 6 Pz 2) 6d z 2 3) 5S 4) 7dxy
85. Which of the following compound does not respond to lessaign’s test for
nitrogen?
1) N2H4 2) N3H 3) PhN2Cl  4) All the above
86. At 27o C , 10 mole of an ideal gas expanded reversibly and isothermally from 10
lit volume to 60 lit volume. Then the change in the entropy of the system is
_____ J.K 1.mol1 .
1) Zero 2) 148.98 3) 64.69 4) 191.47
87. Which of the following compound can exist as a meso compound?
1) CH3CH(OH)CH(Br)CH3 2) CH3CH(Cl)CH(Cl)CH3
3) Butan-2-ol 4) Both 1, 2
88. The EAN of central metal ion in the compelx [Co(en)3]Cl3 is _______
1) 35 2) 37 3) 36 4) 30
89. Which of the following is undergoing disproportionation upon hydrolysis?
1) XeF2 2) XeF4 3) XeF6 4) XeO2F2
90. The weight of CaCl2 required to get one litre of an aqueous solution of CaCl2 at
27o C showing 36.5 atm of osmotic pressure is _______g.
[For CaCl2, consider i = 2.47]
1) 66.6 2) 44.4 3) 55.5 4) 78.9
BIOLOGY
91. Vascular bundles are conjoint and open in
1) Dicot root 2) Monocot root 3) Dicot stem 4) Monocot stem
92. In rosette plants, bolting is promoted by the hormone that
1) Is used to increase the size of apple
2) Delays the senescence of intact leaves and other plant parts.
3) Promotes abscission of flowers and fruits
4) Inhibits seed germination
93. DNA replication is continuous
1) On the template with polarity 3   5
2) On the template with polarity 5  3
3) On both the templates 4) On none of the template
94. Some amino acids are coded by more than one codon. It reflects which of the
given features of genetic code?
1) Commaless 2) Degeneracy 3) non-overlapping 4) Universality
95. The physical process w.r.t treatment of waste water involves
A) Removal of floating debris B) formation of Flocs in aeration tank
C) Digestion of bacteria and fungi present in sludge by anaerobic sludge digester
D) Removal of soil and small pebbles.
The correct option is
1) A and B 2) B and C 3) C and D 4) A and D
96. Mark the incorrect statement for the members of algae which have mannitol and
laminarin as stored food?
1) They are brown algae
2) They contain chlorophyll a,c and fucoxanthinin
3) They have cellulose, pectin and polysulphate esters
4) Their zoospores have 2 unequal and lateral flagella
97. If a pea plant produces 1616 plants in F2 generation of dihybrid cross for seed
colour and shape. How many of them have parental genotype?
1) 202 2) 101 3) 404 4) 1010
98. Sporic meiosis and Zygotic meiosis are respectively seen in
1) Funnaria and spirogyra 2) Fucus and Dryopteris
3) Ulothrix and Funaria 4) Chara and Fucus
99. Which hormone promotes female flowers, in Cucumber?
1) ABA 2) H2C = CH2 3) Auxin 4) Cytokinin

100. Identify the correct ones with regard to Golgi apparatus.
I. Convex side is called as cis or forming face
II. Concave side is called trans or maturing face
III. Cisternae of Golgi modify proteins.
IV. Materials enters through trans face and are released through cis face.
1) I – II – III 2) II – III – IV 3) I – II – IV 4) I – III - IV

101. Select the incorrect match from the following:
Molecule Number of ‘C’ atoms in
each molecule
1) Oxalo succinic acid Five
2) Succinyl CoA Four
3) Citric acid Six
4) Acetyle CoA Two
102. Regarding aestivation in corolla, choose the add one out.
1) Lady’s finger 2) Cotton 3) Calotropis 4) Hibiscus
103. Pollination in papaya can be
1) Both geitanogamy or xenogamy 2) Only xenogamy
3) Xenogamy and autogamy 4) only geitonogamy
104. Casparian strips in endodermis are formed by the deposition of material
1) pectin 2) suberin 3) lignin 4) Cutin
105. The step of aerobic respiration that shows neither utilization of O2 nor evolution
of CO2 is
1) Glycolysis 2) Oxidative decarboxylation 3) Kreb’s cycle 4) ETS
106. Chemosynthetic bacteria
1) Are photo autotrophs 2) Oxidase certain inorganic substances
3) Use light energy for ATP production 4) Have no role in recycling of nutrients
107. In a dihybrid cross ( AaBb x AaBb) what is the probability of offspring to have a
pure homozygous condition for both the traits?
1) 4/16 2) 8/16 3) 2/16 4) 10/16
108. The anticodons present on tRNA for methionine during protein synthesis is
1) AUG 2) ACC 3) UAC 4) CUG
109. The bonds which are present in nucleic acids but not in proteins are
1) Sulphide bonds 2) Hydrogen bonds
3) Covalent bonds 4) Phosphodiester bonds
110. Statement A: Restriction enzymes are obtained from prokaryotes.
Statement B : The first type II restriction endonuclease to be discovered was Hind
II.
1) Both statements are correct 2) Both statements are incorrect
3) Only A is correct 4) Only B is correct
111. Nutritionally most fungi are
1) Saprophytes only 2) Symbionts only
3) Parasites only 4) Saprophytes or parasites
112. Symptoms not seen in plants due to viruses is
1) Mosaic formation 2) leaf rolling and curling
3) Yellowing, vein clearing 4) root knot
(A) Natural system of (I) Evolutionary relationship
classification between organisms
(B) Phylogenetic system of (II) Based on Androecium
classification characters & morphology
(C) Artificial system of (III) Natural affinities among
.
classification organisms
(A) (B) (C) (A) (B) (C)
.
1) I II III 2) III I II
3) II III I 4) III II I
114. The types of roots present in mustard plant is
1) Tap root 2) Adventitious root
3) Fibrous root 4) Stilt roots

115. The central cell after triple fusion becomes
1) PEC 2) PEN 3) Embryo 4) both 1 & 2
116. Identify the structure of adneylic acid from the following.
1) A 2) C 3) D 4) B
117. Sugars are attached to pyrimidines by:
1) Hydrogen bond 2) N-glycosidic bond
3) Ester bond 4) Phosphodiester bond
118. Which vitamin is synthesized by LAB?
1) Vitamin B2 2) Vitamin B6 3) Vitamin B5 4) Vitamin B12
119. The ratio between hydrogen bonds and phosphodiester bonds broken in each
palindromic sequence of a DNA when treated with EcoRI.
1) 4: 1 2) 1 : 2 3) 2 : 3 4) 1 : 4
120. The highest elemental composition of living matter respectively are
1) Hydrogen, oxygen 2) Oxygen, Nitrogen
3) Oxygen, Carbon 4) Nitrogen, Sodium
121. During cell cycle, synthesis of RNA and protein takes place in
1) S-phase only 2) M-phase 3) G1 and G2 phase 4) G1 phase only
122. Assertion: In C4 plants chloroplasts of bundle sheath cells are granal.
Reason: Bundle sheath cells are rich in Rubisco.
3) Assertion is true, but Reason is false 4) Assertion is false and Reason is
true
123. Pollen pistil interaction is
1) Chemically mediated process 2) dynamic process
3) Genetically controlled process 4) more than one option is correct
124. If a hybrid resembles neither of the parent or it is intermediate between the two
parents, it is an example for
1) Complete dominance 2) Incomplete dominance
3) Co-dominance 4) No-dominance
125. Statement I: The alleles of different genes get sorted into gametes independent
of each other.
Statement II: Independent assortment is not applicable for monohybrid cross
3) Only Statement-I is true 4) Only Statement-II is true
126. Evidence of semi-conservative mode of replication in Vicia faba root tip was
given by
1) Meselson and stahl 2) Taylor
3) Hershey and chase 4) Watson and Crick

(Genetic material) (Codes for)
(A) i-gene (I) Beta-galactosidase
(B) Z-gene (II) Repressor
(C) Y – gene (III) RNA polymerase
(D) a - gene (IV) Permease
.
(V) Transacetylase
(A) (B) (C) (D) (A) (B) (C) (D)
1) II IV I III 2) IV II III V
3) I II III IV 4) II I IV V
128. Gene expression is regulated by the following conditions:
I) Environmental II) Physiological III) Metabolical
1) I and II only 2) II only 3) II and III only 4) I, II and III
129. An effluent refers to
1) Solid wastes 2) Liquid wastes 3) Both 1 and 2 4) Organic matter only
130. Match the following list of bioactive substances and their roles:
(A) Statin (I) Removal of oil stains
(B) Cyclosporin A (II) Removal of clots from blood
vessels
(C) Streptokinase (III) Lowering of blood cholesterol
(D) .
Lipase (IV) Immuno suppressive agent
(A) (B) (C) (D) (A) (B) (C) (D)
.
1) II III I IV 2) IV II I III
3) IV I II III 4) III IV II I
131. In the plasmid PBR322 “rop” codes for
1) Replication of plasmid 2) Replication of ori
3) Proteins involved in replication of plasmid
4) Proteins for replication of host genome
132. Recognise the figure and find suitable matching
1) Both ‘a’ and ‘b’ are included in kingdom Protista

2) ‘a’ is heterotrophic while ‘b’ is both autotrophic and heterotrophic
3) Both ‘a’ and ‘b’ are motile 4) All of the above
133. Number of glucose molecules required to produced 38 ATP molecules under
anaerobic conditions by yeast cell is
1) 2 2) 4 3) 19 4) 25
134. What is the relative growth rate when a leaf has increased its area from 50 cm2
to 70 cm2 ?
1) 100% 2) 10% 3) 40% 4) 20%
135. How many chromosomes will the cell have at ‘G1’ after ‘S’ and ‘M’(mitosis) phase
respectively if it has 14 chromosomes in a diploid cell?
1) 14, 4, 7 2) 14, 14, 14 3) 7, 7, 7 4) 7, 14, 14
136. Identify the correct one
1) Unique feature of mammals is the presence of mammary glands and the
skin of mammals is unique in possessing hair.
2) Tetrapod agnathans are amphibians and reptiles
3) Class Aves is grouped under tetrapoda
4) More than one option is correct
137. Find out the incorrect one w.r.t. normal respiratory volumes and capacities
1) IC = TV + IRV 2) TLC = VC + RV
3) FRC = IC + VC 4) VC = TV + IRV + ERV

I) Smooth muscle fibres are exhibt striations
II) Blood is a fluid connective tissue containing enucleated WBC, nucleated RBC
and platelets
III) Cardiac muscles are exhibit striations.
Identify the incorrect statement/s w.r.t.
1) I only 2) I, II and III 3) III only 4) I and II
139. Find out the correct one
1) The lumen of vein is narrower than the lumen of artery
2) In the pulmonary circulation only deoxygenated blood is circulated
3) Tunica media is thin in veins comparatively with the tunica media of arteries.
4) All of the above
140. Which of the following is expected in a man if a fall in glomerular blood
pressure?
1) Activation of JG cells to release renin
2) Conversion of angiotensinogen to angiotensin I
3) Release of ANF causing vasoconstriction 4) Both 1 & 2
141. Kidneys in man are situated between the level of
1) Last thoracic and third lumbar vertebra
2) 19th vertebra and 22nd vertebra of vertebral column (order of vertebra)
3) Both 1 & 2 4) Last lumbar to third sacral vertebra
142. Breakbone fever is caused by
1) Dengue virus 2) Rhino virus 3) HIV 4) Hepatitis-B virus
143. Study the following hormones
a) Thymosin b) PTH c) GnRH d) Cortisol
e) GH f) Estrogen
Which steroidal hormones among the above interact with the intracellular
receptors during their mechanism of action?
1) c,e,f 2) d, f 3) a,b & c 4) c & d
144. Statement – I : Classes comprising animals like fishes, amphibia, reptiles,
birds and mammals constitute the same phylum
Statement – II : Order carnivora that includes animals like monkey, gorilla,
gibbon.
1) Both the statements I & II are wrong
2) Statement I is correct but statement II is wrong
3) Both the statements I & II are correct
4) Statement II is correct but statement I is wrong
145. Among population interactions like predation, parasitism, commensalism,
amensalism, how many interactions have (+) sign in one of their interacting
species
1) 4 2) 1 only 3) 3 4) No one
146. Which of the following favours decomposition ?
1) Water insoluble substances like sugar 2) Lignin & Chitin
3) Warm and moist environment 4) Low temperature
147. Which of the following is not related to in-situ conservation?
1) Sacred groves 2) Zoological parks 3) Seed banks 4) Both 2 & 3
148. Carrying capacity of a population is determined by
1) Birth rate 2) Death rate
3) Limiting resources 4) Reproductive ability
I) Thalassemia differs from sickle – cell anaemia because Thalassemia is
qualitative problem
II) Change in the chromosome number is Aneuploidy
III) In HbS peptide valine in the 6th position is replaced by Glutamic acid
Identify the correct statement/s
1) I & II 2) II only 3) I & III 4) I, II & III

List – I (Diseases) List – II ( Caused by)
A) Pneumonia I) P.vivax
B) Ring worms II) H. influenza
C) Typhoid III) Epidermophyton
D) Common cold IV) P. somniferum
V) S. typhi
VI) Rhino virus
1) A – II, B – I, C – V, D – VI 2) A – II, B – III, C – V, D – VI
3) A – II, B – III, C – VI, D – V 4) A – II, B – III, C – I, D – VI
151. Which of the following is incorrect one?
1) Polymorphism in DNA sequence is the basic of genetic mapping of human
genome as well as DNA finger printing
2) DNA finger printing involves identifying differences in some specific regions
in DNA sequence called as repetitive DNA
3) DNA finger printing is never used in paternity testing in case of disputes
4) Satellite DNA is classified into many categories, such as micro-satellites,mini-
satellites etc.
152. Identify the technique/s that serve the purpose of early diagnosis
1) Recombinant DNA technology 2) PCR
3) ELISA 4) All of these
153. Assertion(A): Fibrins are formed by conversion of inactive fibrinogens in the
plasma by the enzyme thrombin.
Reason(R): Thrombins are formed from another inactive substance present in
the plasma called prothrombin by the thrombokinase
1) Both A & R are correct, R is the correct explanation of A
2) Both A & R are correct but R is not the correct explanation of A
3) A is correct, R is incorrect 4) A is incorrect, R is correct
154. Who showed that increased diversity contributed to higher productivity in his
experiments?
1) Paul Ehrlich 2) David Tilman 3) Alexander Von Humboldt 4) Robert May
155. Which of the following chromosomes in man are having most genes and fewest
genes respectively?
1) Chromosome X and Y 2) Chromosome 1 and Y-chromosome
3) Chromosome 12 and X -chromosome 4) Chromosome 10 and X-
chromosome
Column I(Animal) Column II ( Feature)
A) Canis I) Operculum
B) Catla II) Pinna
C) Columba III) Claspers
D) Carcharodon IV) Pneumatic bones
1) A-I, B-II, C-III, D-IV 2) A-II, B-I, C-IV, D-III
3) A-II, B-I, C-III, D-IV 4) A-I, B-IV, C-III, D-II
157. Example for fibrous joints.
1) The adjustant vertebrae 2) Sutures
3) Between atlas and axis 4) Between the carpals
158. Magur is
1) Tetrapod belongs to the division Agnathostomata
2) Non-tetrapod and bear fins
3) Tetrapod and belongs to the superclass Pisces
4) Non-tetrapod and belongs to the division Agnatha
159. The most feared property of malignant tumor is
1) Metagenesis 2) Metastasis
3) Having contact inhibition 4) Metamorphosis
1) The pyramid of biomass in sea is always upright
2) Pyramid of energy is always upright
3) In an aquatic ecosystem DFC is the major conduit for energy flow
4) Plants capture 20 – 30 % of PAR

161. Statement I : A comparision of the volume of the filtrate formed per day (18
litres per day)
Statement II : Simple cuboidal epithelium found in PCT of nephrons in
kidney
1) Both the Statements I & II are correct
2) Both the Statements I & II are incorrect
3) Statement I only correct 4) Statement II only correct
162. α – 1 antitrypsin is used to treat
1) Most common Mendelian disorder like cystic fibrosis
2) An inborn error of metabolism that is inherited as the autosomal recessive
trait
3) Chronic respiratory disorder caused due to smoking in which alveolar walls
are damaged
4) All the above
163. Which accessory sex gland in human being is unpaired ?
1) Bulbourethral glands 2) Seminal vesicles
3) Mammary glands 4) Prostate gland
164. Secondary oocyte in female human being contains (in general)
1) 1 Y chromosome 2) 3 X chromosomes
3) 1 X chromosome 4) XY chromosomes
165. Given below are two statements; one is labelled as Assertion (A) and the other is
labelled as Reason(R).
Assertion (A) : The first menstruation begins at puberty is called menarche.
Reason (R) : Lack of menstruation is always indicative of pregnancy.
Choose the most appropriate answer from the options given below :
1) Both (A) and (R) are correct but (R) is not the correct explanation of (A).
4) Both (A) and (R) are correct and (R) is the correct explanation of (A).
166. Identify the incorrect one
1) Adrenal medullary hormones can also increase the cardiac output
2) An increase in blood pressure can increase the glomerular blood flow and
there by GFR
3) Ameboid movement of human spermatozoa helps in swimming
4) Hyoid bone is ‘U’ shaped
167. Which of the following option is incorrect ?
1) Saheli – Once a week pill 2) Surgical methods- Sterilisation
3) CuT – IUD 4) MTP – Assisted reproductive technology
168. Which is not a natural method of contraception ?
1) Coitus interruptus 2) Periodic abstinence
3) Vasectomy 4) Lactational ammenorrhoea
169. Which of the following appeared during ice age between 75,000 to 10,000 years
ago?
1) Homo erectus 2) Homo habilis
3) Modern Homo sapiens 4) Neanderthal man
170. Which is the correct match ?
1) Eye of octopus & mammals = Analogy
2) Sweet potato & potato = Homology
3) Wings of butter fly and birds = Homology
4) Vertebrate brains = Analogy
171. Statement-1 : The brain capacity of homohabitis is 900CC
Statement-2 : The brain capacity of homoerectes is 650 -800CC
1) Both statement are correct
2) Statement-1 is correct, Statement-2 is incorrect
3) Statement-1 is incorrect, Statement-2 is correct
4) Both Statement are incorrect
172. Which of the following statements is incorrect with respect to the evolution?
1) Evolutionary biology is the study of history of life forms on earth.
2) Geological history of earth closely correlates with biological history of earth.
3) Homology explains divergent evolution
4) Analogy indicates towards common ancestry

1) Each F actin is a monomer of C actins
2) Each Myosin filament is a polymerized protein
3) The light bands contain myosin (thick flaments)
4) Z line which bisects ‘H’ zone
174. What will be the pO2 and pCO2 in the atmospheric air when compared to those
in the alveolar air ?
1) pO2 lesser, pCO2 higher 2) pO2 higher, pCO2 lesser
3) pO2 higher, pCO2 higher 4) pO2 lesser, pCO2 lesser
175. Identify the mismatch
1) Myasthenia gravis – Auto immune disorder
2) Arthritis – inflammation of joints
3) Myotonic dystrophy – Autosomal recessive trait
4) Gout – inflammation of joints due to accumulation of uric acid crystals
176. Identify the correct match
1) Gregarious pest : King crab 2) Vector : Prawn
3) Silkworm : Bombyx 4) Living fossil : Culex
177. Study the following w.r.t human brain
a) Cerebrum b) Thalamus c) Hypothalamus
d) Pons e) Cerebellum
Which of the following are present in the forebrain of man ?
1) a & e 2) a, b & d 3) a, b & c 4) a, b, c, d & e
178. Which of the following steroid hormone stimulates the RBC production ?
1) TCT 2) PTH 3) Cortisol 4) Insulin
179. Which of the following cause most serious and fatal malignant malaria ?
1) P.vivax 2) P.malaria 3) P.falciparum 4) All of these
180. Identify the incorrect match
1) Physical barrier : skin
2) Physiological barrier : Mucous coating tracts
3) Cellular barrier : WBC (certain types of Leukocytes)
4) Cytokine barrier : Interferons
*******

: ANSWER KEY:
1 3 11 4 21 2 31 1 41 3
2 4 12 2 22 1 32 3 42 3
3 2 13 4 23 1 33 4 43 4
4 3 14 1 24 1 34 3 44 4
5 3 15 2 25 1 35 1 45 1
6 3 16 1 26 3 36 1
7 4 17 4 27 1 37 2
8 1 18 3 28 3 38 2
9 2 19 1 29 2 39 4
10 2 20 2 30 3 40 1
SUB:CHEMISTRY
46 2 56 4 66 4 76 1 86 2
47 1 57 1 67 2 77 2 87 2
48 4 58 1 68 4 78 1 88 3
49 2 59 3 69 1 79 1 89 2
50 3 60 4 70 3 80 3 90 1
51 1 61 4 71 4 81 1
52 1 62 1 72 1 82 4
53 1 63 4 73 2 83 1
54 2 64 1 74 4 84 3
55 2 65 1 75 4 85 4
SUB : BOTANY
91 3 101 1 111 4 121 3 131 3
92 1 102 3 112 4 122 4 132 4
93 1 103 2 113 2 123 4 133 3
94 2 104 2 114 1 124 2 134 3
95 4 105 1 115 1 125 1 135 2
96 3 106 2 116 3 126 2
97 1 107 1 117 2 127 4
98 1 108 3 118 4 128 4
99 2 109 4 119 1 129 2
100 1 110 1 120 3 130 4
136 4 146 3 156 2 166 3 176 3
137 3 147 4 157 2 167 4 177 3
138 4 148 3 158 3 168 3 178 3
139 3 149 2 159 2 169 3 179 3
140 4 150 2 160 2 170 1 180 2
141 3 151 3 161 4 171 4
142 1 152 4 162 3 172 4
143 2 153 2 163 4 173 2
144 2 154 2 164 3 174 2
145 3 155 2 165 2 175 3

XII- NEET GT - 8
answer sheet.

PHYSICS Mr.APPARAO
CHEMISTRY Mr.ESR/Mr.NAGABABU
BOTANY Mr.GOWRISANKAR
Mr.SURENDER
ZOOLOGY
RAJKUMAR
PHYSICS
1. The current flow through the resistance in the given circuit is nearly
1) 2 mA 2) 3.2 mA 3) 2.9 mA 4) 3 mA
2. A uniform but time-varying magnetic field B(t) exists in
a circular region of radius a and is directed into the
palne of the paper, as shown. The magnitude of the
induced electric field at point P at a distance r from the
centre of the circular region
1
1) is zero 2) Decreases as
r
1
3) Increases as r 4) Decreases as 2
r
3. 64 small drops each of radius 1mm and having a potential of “V” coalesce to
form a bigger drop. Find the potential to the bigger drop.
1) 16V 2) 4V 3) 64V 4) 8V
4. The truth table given below is for
A B Y
1 1 0
1 0 1
0 1 1
0 0 1
1) NAND 2) AND gate 3) XOR gate 4) NOT gate
5. A ray of light is incident at an angle of 60 on one face of a prism of angle 30o .
o
The emergent ray of light makes an angle of 30o with incident ray. The angle
made by the emergent ray with second face of prism will be :
1) 30o 2) 90o 3) 0o 4) 45o
6. A steel rail of length 5m and area of cross-section 40 cm 2 is prevented from
expanding along its length while the temperutre rises by 10 o C . If coefficient of
linear expansion and Young’s modulus of steel are 1.2  10 5 K 1 and 2  1011 Nm 2
respectively, the force developed in the rail is approximately :
1) 2  107 N 2) 1 105 N 3) 2  109 N 4) 3  105 N
7. Heavy water is used as moderator in a nuclear reactor. The function of the
moderator is
1) to control the energy released in the reactor
2) to absorb neutrons and stop chain reaction
3) to cool the reactor faster
4) to slow down the neutrons to thermal energies
8. The focal lengths of the objective and eye-lens of a microscope are 1 cm and 5
cm respectively. If the magnifying power for the relaxed eye is 45, then the
length fo the tube is
1) 30 cm 2) 25 cm 3) 15 cm 4) 12 cm
9. A 10 resistance is connected across 220V – 50Hz sinusoidal AC supply. The
time taken by the current to change from its maximum value to the rms value is
1) 2.5 ms 2) 1.5 ms 3) 3.0 ms 4) 4.5 ms
10. A small block of mass ‘m’ is kept on a rough inclined surface of inclination ‘’
fixed on a lift. The lift moves up with a uniform velocity ‘v’ and the block
doesnot slide on the incline. The work done by the force of friction on the block
in time ‘t’ will be (g = acceleration to gravity)
1) Zero 2) mgvt cos 2  3) mgvt sin 2  4) mgvt sin 
11. An electron is moving through a field. It is moving

(i) opposite an electric field
(ii) perpendicular to a magnetic field as shown. For each situation the de-
Broglie wave length of electron
1) Increasing, increasing 2) Increasing, decreasing

3) Decreasing, same 4) Increasing, same
12. The amplitude of magnetic field at a region carried by an electromagnetic wave
is 0.1T. The intensity of wave is
1) 4n Wm 2 2) 1.2 Wm 2 3) 4 Wm 2 4) 1.2 Wm 2
13. How much energy must a gamma ray photon have, if it is to materialize into a
pair of electron and positron with each particle having a K.E. of 1 MeV?
1) 2 MeV 2) 3.02 MeV 3) 1.0 MeV 4) 0.51 MeV
14. A block of weight 100N is lying on a rough horizontal surface. If coefficient of
1
friction is . The least possible force that can move the block in N is
3
100
1) 2) 100 3 3) 50 3 4) 50
3
15. The figure shows the position time(x-t) graph of one-dimensional motion of a
body of mass 0.4kg. The magnitude of each impulse is
1) 0.4Ns 2) 0.8Ns 3) 1.6Ns 4) 0.2Ns

16. An electron jumps from the 4th orbit to the 2nd orbit of hydrogen atom. The
frequency in Hz of the emitted radiation will be
3 3 9 3
1)  105 2) 1010 3) 1015 4) 1020
16 16 16 4
17. A pipe open at both ends produces a note of frequency f1. When the pipe is kept
3 f
with th of its length it water, it produced a note of frequency f2. The ratio 1
4 f2
is
3 4 1
1) 2) 3) 4) 2
4 3 2
18. A magnetic field strength (H) 3  103 A/m produces a magnetic field on Induction
(B) of 12 telsa in an iron rod. The relative permeability of iron is
1) 105 2) 10 4 3) 103 4) 10 2
19. If a copper wire is stretched to increase its length by 0.1%. The percentage of
increase in its resistnce will be
1) 0.2% 2) 2% 3) 1% 4) 0.1%
20. Which of the following group have different dimensions?
1) Potential difference, EMF, voltage 2) Pressure, stress, young’s modulus
3) Heat, energy, work-done 4) Dipole moment, electric flux, electric
field
21. A proton and an -particle are accelerated through a potential difference of
100V. The ratio of the wavelength associated with the proton to that associated
with an -particle is
1
1) 2 :1 2) 2 : 1 3) 2 2 :1 4) :1
2 2
22. If current is decreasing at a rate of 1000 As 1 , p.d. between A and B is ____

1) 5V 2) 6V 3) 7V 4) 8V
23. A spherical conducting shell of inner radius r1 and outer radius r2 has a charge
Q. A charge q is placed at the centre of the shell. What is the surface charge
density on the inner and outer surfaces of the shell.
q Q  q Q Q  q q Q  q  q Q  q
1)  , 2)  , 3) , 4) , 
4 r12 4 r22 4 r12 4 r22 4 r12 4 r22 4 r12 4 r22
24. A long straight wire in the horizontal plane carries a current of 50A in north to
south direction. Give the magnitude and direction of B at a point 2.5m east of
the wire :
1) 4  106 T upwards 2) 4  106 T down
3) 4  106 T east 4) 4  106 T west
25. N fundamental charges each of charge ‘q’ are to be distributed as two point
charges separated by a fixed distance, then the maximum to minimum force
bears a ratio (N is even and greater than 2)
 N  1
2
4N 2 N2 2N 2
1) 2) 3) 4)
4N 2  N  1 4  N  1  N  1
26. The x and y coordinates of the projectile project from the surface of a planet at
any time are y  5t  2t 2 and x  10t respectively, where x and y are in metres and
t in seconds. The horizontal range of the projectile.
1) 25m 2) 10m 3) 15m 4) 5m
27. A thin fiexible wire of length L is connected to two adjacent fixed points and
carries a current I in the clockwise direction, as shown in the figure. When the
system is put in a uniform magnetic field of strength B going into the plane of
the paper, the wire takes the shape of a circle. The tension in the wire is
IBl IBl IBl

1) IBL 2) 3) 4)
 2 4
28. The period of revolution of planet A around the sun is eight times that of B.
Then the distance of A from the sun is greater than that of B is _____ times.
(rA = -times rB)
1) 2 2) 3 3) 4 4) 5
29. The acceleration ‘a’ of the vertical U-tube is
g
1) g 2) 3) 2g 4) 0
2
30. The concentration of electrons in a semiconductor is 3  1013 / cm 3 and hole
concentration is 5  1014 / cm 3 . The semiconductor is
1) n-type 2) p-type 3) intrinsic 4) insulator
31. When an polarized light of intensity I0 is incident on a polarizing sheet, the
intensity of the light which does not get transmitted is
1 1
1) zero 2) I0 3) l0 4) l0
2 4

32. A pendulum beating seconds at one place  g = 985 cm/sec 2  is taken to another
place  g = 981 cm/sec 2  . If it is to beat seconds at another place, its length is to
be decreases by
1) 0.1 cm 2) 0.2 cm 3) 0.4 cm 4) 0.5 cm
33. About 5% of the power of a 100W light bulb is converted to visible radiation.
What is the average intensity of visible radiation at a distance 1m from the bulb.
1) 0.4 w/m2 2) 0.04 w/m2 3) 0.004 w/m2 4) 1.25 w/m2
34. Statement(A) : The metal detector works on the principle of resonance in ac
circuits.
Statement(B) : In a pure inductive circuit, the current lags behind the e.m.f. by
/2.
1) both A and B are true 2) A is false and B is true
3) A is true and B is false 4) both A and B are false
35. The width of forbidden gap in silicon crystal is 1.1eV. When the crystal is
converted in to a N-type semiconductor the distance of Fermi level from
conduction band is
1) Greater than 0.55 eV 2) Equal to 0.55 eV
3) Lesser than 0.55 eV 4) Equal to 1.1 eV
36. Two stones are projected from the top of a tower in opposite directins, with the
same velocity V but at 30o & 60o with horizontal respectively. The relative
velocity of first stone relative to second stone is
2V V
1) 2V 2) 2V 3) 4)
3 2
37. All the bulbs shown in the figure are identical and are rated to fuse if the
voltage across the bulb exceeds 200V. The bulb(s) which will fuse in the circuit
on closing the switch is
1) B1 2) B2 3) B3 4) no bulb will fuse

38. A wire of length ‘l’ is bent into a circular loop of radius R and carries a curernt I.
The magnetic field at the centre of the loop is ‘B’. The same wire is now bent
into a double loop. If both loops carry the same current I and it is in the same
direction, the magnetic field at the centre of the double loop will be
1) Zero 2) 2B 3) 4B 4) 8B
39. Which graph represents the uniform acceleration?
S S S S
1) 2) 3) 4)
t t t t
40. Velocity-time graph of a particle moving in a straight line is as shown in figure.
Mass of the particle is 2kg. Work done by all the forces acting on the particle in
time interval between t = 0 to t = 10s is
1) 300J 2) -300J 3) 400J 4) -400J

41. White light is used in double slit experiment. The minimum order of the violet
fringe ( = 400nm) which overlaps with a red fringe ( = 700nm) is
1) 4 2) 7 3) 8 4) 14

42. Mass remaining constant if the earth suddenly contracts to one third of its
present radius the length of the day would be shortened by
8 64
1) hours 2) 2 hours 3) 8 hours 4) hours
3 3
43. The temperature of 5 moles of a gas at constant volume is changed from 100o C
to 120o C . The change in internal energy is 80J. The total heat capacity of the
gas at constant volume will be in Joule/Kelvin is
1) 8 2) 4 3) 0.8 4) 0.4
44. The molecules of a given mass of a gas have r.m.s velocity of 200 ms 1 at 27 o C
and 1.0 105 Nm 2 pressure. When the temperature and pressure of the gas are
respectively, 127 o C and 0.05  105 Nm 2 , the r.m.s. velocity of its molecules in ms 1
is
100 2 100 400
1) 2) 3) 100 2 4)
3 3 3
45. The effective capacity of the following capacitors is all capacitors are identical.
A) C P) 3C
C
A C C B
C
B) C Q) C/2
C
A B
C
C) C C R) C
C
A B
C C
D) C S) 2C
A C B
C
Codes :
A B C D A B C D
1) R S Q P 2) P Q R S
3) S R Q P 4) Q P R S
CHEMISTRY
46. The IUPAC symbol of an element with atomic number 105 is
1) Uup 2) Unp 3) Uuu 4) Upp
47. When 22.4 litres of H2 (g) is mixed with 11.2 litres of Cl2(g), each at S.T.P., the
moles of HCl(g) formed is equal to:
1) 1 mole of HCl (g) 2) 2 moles HCl(g)
3) 0.5 moles of HCl (g) 4) 1.5 moles of HCl(g)
48. The correct order for the mentioned property is
1) F   O 2   S 2   Br  - Ionic radii
2) Li > Na > K - Electropositive character
3) N > P > Sb > As - Electron affinity
4) Sn > Ge > Si > C - Non-metallic character
49. The maximum number of molecules is present in
1) 15 L of H2 gas at STP 2) 5 L of N2 gas at STP
3) 0.5 g of H2 gas 4) 10 g of O2 gas

50. A and B are
1) Chain isomers 2) Position isomers 3) Functinal isomers 4) Tautomers

51. The number of moels of KMnO4 reduced by one mole of KI in alkaline medium is
1) One 2) Two 3) Five 4) One fifth
52. Reductive ozonolysis of 2-methylpropene gives
1) Acetone and Ethanal 2) Ethanal and Ethanol
3) Methanal and Acetone 4) Methanal and Ethanal
53. The frequency of radiation emitted when the electron falls from n = 4 to n = 1 in
a hydrogen atom will be (Given ionization energy of H  2.181018 J atom1 and
h  6.6251034 Js )
1) 1.541015 s1 2) 1.031015 s1 3) 3.081015 s1 4) 2.001015 s1
54. Which among the following is incorrect statement?
1) Cellulose is composed of only -D-glucose units
2) Carbohydrates are stred in animal body as glycogen
3) Amylopectin is a polymer of -D-glucose units
4) Amylose linear chain is formed by C1-C4 glycosidic linkage
55. What is the maximum number of orbitals that can be identified with the
following quantum numbers?
n = 3, l = 1, m1 = 0
1) 1 2) 2 3) 3 4) 4
56. The compound possessing maximum covalent character among the following is
1) LiCl 2) NaCl 3) CsCl 4) KCl
57. Consider the following processes:
H kJ / mol
1/ 2 A  B +150
3B  2C  D -125
E  A  2D +350
For B  D  E  2C, H will be :
1) 525 kJ/mol 2) -175 kJ/mol 3) -325 kJ/mol 4) 325 kJ/mol
58. Antibonding  *2 px molecular orbital is represented by
59. For the reaction:

X 2 O 4 l  2XO 2 g 
U  2.1k cal, S  20 cal K 1 at 300 K
Hence G is:-
1) 2.7 k cal 2) -2.7 k cal 3) 9.3 k cal 4) -9.3 k cal
60. The hybridisation state of central atom in SF6 is
1) sp 3 d 2 2) sp 3 d 3 3) dsp 2 4) sp 3
61. The dissociation constants for acetic acid and HCN are 1.5105 and 4.5101
respectively. The equilum constant for the equilibrium.
CN  CH 3COOH  HCN  CH 3 COO would be
1) 3105 2) 3104 3) 3104 4) 3105
62.
1) C6H5Cl 2) C6H3Cl3 3) C6Cl6 4) C6H6Cl6

63. The hydrogen ion concentration of a 108 M HCl aqueous solution at
298 K K w  1014  is
1) 11108 M 2) 9.525108 M 3) 1.0108 M 4) 1.0 106 M
64. IUPAC name of neopentyl bromide is
1) 1-Bromo-4,4-dimethylpentane 2) 1-Bromo-3-methylbutane
3) 1-Bromo-2,2-dimethylpropane 4) 2-Bromo-2-methylbutane
65. The solubility product of Agl at 25 C is 1.0 1016 mol2 L2 . The solubility of Agl in
0
10-4N solution of KI at 250C is approximately (in mol L-1)

1) 1.0 108 2) 1.0 1016 3) 1.0 1012 4) 1.0 1010
66. On treating phenol with chloroform in presence of sodium hydroxide the
intermediate formed is
67. The value of vapour pressure of a solution at 450C with benzene to octane in
molar ratio 3 : 2 is:
[At 450C vapour pressure of benzene is 280 mm Hg and that of octane is 420
mm Hg. Assume ideal solution]
1) 350 mm of Hg 2) 160 mm of Hg 3) 168 mm of Hg 4) 336 mm of Hg
68. Best reagent for converting an alcohol into corresponding chloride is
1) HCl/ZnCl2 2) PCl3 3) PCl5 4) SOCl2
69. A solution of urea (mol. Mass 56 g mol-1) boils at 100.180C at the atmospheric
pressure. If Kf and Kb for water are 1.86 and 0.512 K kg mol-1 respectively, the
above solution will freeze at [Given: B.P & F.P of H2O = 1000C & 00C]
1) 0.6540 C 2) 0.6540 C 3) 6.540 C 4) 65.40 C
70. The stability order of +2 oxidation state among Si, Ge, Sn and Pb is
1) Pb<Sn<Ge<Si 2) Sn<Pb<Ge<Si 3) Si<Ge<Sn<Pb 4) Ge<Si<Sn<Pb
71. EquivlentconductancesNaCl, HCl and CH3COONa at infinite dilution are
126.45, 426.16 and 91 ohm-1 cm2 respectively. The equivalent conductance of
CH3COOH at infinite dilution would be
1) 101.38ohm1 cm 2 2) 253.62 ohm1 cm 2 3) 390.71ohm1 cm 2 4) 678.90 ohm1 cm 2
72. Swart’s reaction is used for the preparation of
1) CH3 – Cl 2) CH3 – Br 3) CH3 – I 4) CH3 – F
73. Standard free energies of formation (in kJ/mol) at 298 K are –237.2, –394.4 and
–8.2 for H 2O l ,CO2 g  and pentane (g), respectively. The value of E 0cell for the
pentane-oxygen fuel cell is:
1) 1.968 V 2) 2.0968 V 3) 1.0968 V 4) 0.0968 V
74. Which of following ether cannot be produced by Willamson synthesis?
75. The rate of a first order reaction is 0.04 mol l-1s-1 at 10 seconds and 0.03 mol l-
1s-1 at 20 seconds after initiation of the reaction. The half-life period of the
reaction is
1) 24.1 s 2) 34.1 s 3) 44.1 s 4) 54.1 s
76. The ortho and para isomers of nitrophenol can be separated by steam
distillation because
1) o-Nitrophenol is more water soluble than p-Nitrophenol
2) o-Nitrophenol is less volatile than p-Nitrophenol
3) o-Nitrophenol is steam volatile
4) o-Nitrophenol has intermolecular H-bonding

77. In a zero-order reaction for every 10 rise of temperature, the rate is doubled. If
0
the temperature is increased from 100C and 1000C, the rate of the reaction will
become:
1) 256 times 2) 512 times 3) 64 times 4) 128 times
78. Number of optically active products formed in following reaction is
(i) OH 
C6 H 5CHO  HCN 
(ii) H +

1) 1 2) 3 3) 4 4) 2
79. Which is the correct order of increasing energy of the listed orbitals?
1) 3s 4s 3p 3d 2) 4s 3s 3p 3d 4) 3s 3p 3d 4s 4) 3s 3p 4s 3d
80. CH3CH 2COOH 
(i) Br2 / Red P
(ii) H2O
 A . Major product A is
O Br
1) 2) CH 3CH 2CH 2 Br 3) 4)
CH 3CH 2  C  Br CH 3CH  COOH
Br  CH 2  CH 2  COOH
81. Cobalt (III) chloride forms several octahedral complexes with ammonia. Which of
the following will not give test of chloride ions with silver nitrate at 250C?
1) CoCl3 .4NH3 2) CoCl3 .5NH 3 3) CoCl3 .6NH3 4) CoCl3 .3NH3
82. Most acidic compound among the following is
83. Which of the following will give maximum number of isomers?

2 2
1)  Ni C 2 O 4 en 2  2)  Ni en  NH3 4 

3) Cr SCN 2  NH3 4  4) Co  NH 3 4 Cl2 
84. When benzamide is treated with Br2 in presence of aqueous KOH then the end
product formed is
85. Of the following complex ions, which is diamagnetic in nature?

2
1)  NiCl 4  2)  Ni CN 4  3) CuCl 4  4) CoF6 
2 2 3
86. Consider the following reactions

Cu  573 K 
a. CH 3CH 2OH  A
b. CH 3  CH  OH   C2 H5 
 
Cu 573 K
B
products A and B respectively are
1) Aldehyde and ketone 2) Ketone and aldehyde
3) Alkene and ketone 4) Aldehyde and alkene
Column I Column II
1. Li A. Brick red
2. Ba B. Apple green
3. Ca C. Crimson Red
4. Mg D. No flame colour
1 2 3 4 1 2 3 4
1) A B C D 2) C B A D
3) C D B A 4) A C B D

88. When benzyl amine is treated with chloroform in presence of ethalolic
potassium hydroxide solution then the product formed is
89. Which of the following is not precipitated either by HCl or followed by passing
H2S gas?
1) Ag+ 2) Cu+2 3) Pb+2 4) Mg+2
90. A solution on treatment with NH3 turns blue, contains
1) Cu+2 2) Ni+2 3) CO+2 4) Mn+2
BIOLOGY
91. The sole members of kingdom monera
1) Lack cell walls
2) Are structurally Simple but complex in behavior
3) Have true nucleus 4) Are photosynthelic due to presence of chloroplast
92. ......(A)...... is used extensively in biochemical and genetic work & it produces
spores ......(B)...... select the correct option to fill the blanks (i) and (ii)
A B
(1) Alternaria Exogenously
(2) Aspergillus Exogenously or Endogenously
(3) Neurospora Exogenously or Endogenously
(4) Penicillium Endogenously
93. Which of the following is correct statements?
1) Spores germinate to produce dorsiventral thallus in mosses.
2) Spores germinate to give raise to protonema in ferns.
3) Gemmae are non-green, unicellular structures of liver worts.
4) Mosses along with lichens are the first organisms to colonise rocks.
94. Gymnosperms are more advanced than pteridophytes, which of the following
feature of gymnosperms, justify this statement?
1) Motile male gametes 2) Non-motile female gamete
3) Presence of vascular tissues 4) Presence of seeds
95. Which of the following is incorrect about A,B, C and D?
1) Tap roots of carrot, turnip and adventitious root of sweet potato get swollen
and store food
2) Pneumatophores help to get oxygen for respiration
3) Pneumatophores are found in the plants that grow in sandy soil
4) A, B and C are underground roots but D grows vertically upwards
96. Choose the incorrect match.
1) Zygomorphic flowers (Bilateral symmetry)— pea, gulmohur, bean, cassia
2) Asymmetric (irregular flower)—canna
3) Inferior ovary—pea
4) Superior ovary/Hypogynous flower— mustard, china rose and brinjal

97. Identify the types of aestivation shown in the following diagram.
1) A-Valvate, B-Twisted, C-Imbricate, DVexillary

2) A-Vexillary, B-Valvate, C-Twisted, DImbricate
3) A-Imbricate, B-Vexillary, C-Valvate, DTwisted
4) A-Twisted, B-Imbricate, C-Vexillary, DValvate
98. Choose the correct description of the flower depicted in the floral diagram given
below.
1) Valvate sepals; imbricate petals; free stamens; unilocular ovary with axile
placenta
2) Valvate sepals; twisted petals; free stamens; unilocular ovary with marginal
placenta
3) Valvate sepals; vexillary petals; diadephous; unilocular ovary with marginal
placentation
4) Valvate sepal; imbricate petals, epipetalous stamens; unilocular ovary with
marginal placenta
99. (I) Occur as layers or patches
(II) Cell wall—Unevenly thickened due to pectocellulosic deposition
(III) Cells—Spherical, oval or polygonal
(IV) Often has chloroplast
(V) Living mechanical tissue
(VI) Occurs in hypodermis of young dicot stem and petiole
The characteristics are shown by which of the following tissues?
1) Paranchyma 2) Collenchyma 3) Scelerenhyma 4) Vascular tissue
100. What type of vascular bundles are A, B and C respectively?
1) Radial; close collateral conjoint; open collateral cojoint

2) Close collateral conjoint,; open collateral conjoint; radial
3) Open collateral conjoint; Close collateral conjoint; radial
4) Bicollateral; concentric; radial
101. Tonoplast is permeable membrane, which is found in.
1) Mitochondria 2) Cytoplasm 3) Vacuole 4) Nucleus
102. Which among the following statement is incorrect.
1) Majority of the chloroplasts of the green plants are found in the mesophyll
cells of the leaves
2) The chloroplasts is double membrane bound and the inner chloroplast
membrane is relatively more permeable
3) Chlorophyll pigments are present in the thylakoids
4) Thylakoids are arranged in stacks like the piles of coins called grana
103. Which of the following is not a significance of mitosis.
1) It brings about reproduction in unicellular organisms
2) It is essential for growth and development in multicellular organisms
3) It increases genetic variability in the population
4) It produces new cells for healing the wounds.

104. How many bivalents are possible if a diploid cell undergoing meiosis has 36
chromosomes?
1) 36 2) 18 3) 9 4) 27
105. What is not true about cell cycle.
a. During G1 phase the cell is metabolically active and continuously grow and
no change in its DNA content.
b. In synthesis or S phase, amount of DNA per cell doubles but no change in
number of chromosomes.
c. During G2 phase, a cell contains double the amount (4C) of DNA present in
the original diploid cell (2C)
d. In S-phase a cell doubles the original diploid (2n) chromosome number.
1) c and d 2) b and c 3) d only 4) b, c and d.
106. Which one of the following categories of organisms do not evolve oxygen during
photosynthesis?
1) Red algae 2) Photosynthetic green sulphur bacteria
3) C4 plants with Kranz anatomy 4) Blue green algae
107. Final electron acceptor in the Z-scheme of light reaction-
1) oxygen 2) NADPH 3) NADP+ 4) ferredoxin
108. The chloroplast stroma lamella membrane:
1) Lack PS II as well as NADP reductase enzyme.
2) Lack PS II but have NADP reductase enzyme.
3) Lack NADP reductase enzyme but have PS II.
4) Have PS II as well as NADP reductase enzyme.
109. Which of the following fermentation method can occur in animal skeletal
muscles?
1) lactic acid fermentation 2) alcohol fermentation
3) mixed acid fermentation 4) propionic fermentation
110. In Krebs cycle substrate level phosphorylation takes place during :
1) Conversion of succinic acid to malic acid.
2) Conversion of succinic acid to fumaric acid.
3) Conversion of succinic acid to succinyl Co-A
4) Conversion of suuccinyl Co-A to succinic acid.
111. Statement-I : R.Q. is the ratio of the volume of CO2 taken in and volume of
oxygen evolved in respiration.
Statement-II : R.Q. depends upon the type of respiratory substrate used during
respiration.
3) Both Statement-I and II are true
4) Both Statement-I and II are false
112. ''Foolish seedling'' disease of rice lead to the discovery of :
1) GA 2) ABA 3) 2, 4-D 4) IAA
113. Which one of the following pairs, is not correctly matched :
1) Abscisic acid - Stomatal closure 2) Gibberellic acid - Leaf fall
3) Cytokinin - Cell division 4) IAA – natural auxins
114. How many CO2 molecules are released in mitochondrial matrix, if two molecules
of glucose oxidized aerobically?
1) 4 2) 12 3) 2 4) 6
115. Read the given statements and select the correct option.
(i) Right end of a polysaccharide chain is called reducing end while left end is
called non reducing end.
(ii) Starch can hold iodine molecules in its helical secondary structure but
cellulose being nonhelical, cannot hold iodine.
(iii) Cellulose and glycogen are branched molecules.
(iv) Starch and glycogen are the reserve food materials of plants and animals,
respectively.
1) Statements (i), (ii) and (iv) are correct.
2) Statements (ii) and (iii) are correct.
3) Only statement (iv) is correct.
4) All statements are correct.

116. The characteristic features of angiospermic microsporangium is/are :
a) It is generally surrounded by four wall layers
b) Outer three wall layers involve in the function of protection and also help in
dehiscence of anther to release the pollen
c) The inner most wall layer that helps in nourishing the developing pollen
grains-is tapetum.
d) Cell of tapetum are multinucleated
Select the correct option:
1) a, c and d are correct 2) c and d are correct
3) a, b, c and d all are correct 4) Only b, c and d are correct
117. Which of the following sequence is correct for microsporogenesis?
1) Microspore tetrad(2n) ⎯⎯⎯⎯ Microspore(n)
2) Microspore mother cell (2n) ⎯⎯⎯⎯ Microspore tetrad (n)
3) Microspore tetrad (n) ⎯⎯⎯⎯ Microspore (2n)
4) Microspore tetrad (2n) ⎯⎯⎯⎯ Microspore (2n)
118. Match the Column–I with Column–II:
Column-I Column-II
A. Funicle I Mass of cells within ovule with more food
B. Hilum II. Basal part of ovule
C. Integument III. One or two protective layers of ovule
D. Chalaza IV. Region where body of ovule fuses with thefunicle
E. Nucellus V. Stalk of ovule
1) A–I, B–II, C–III, D–IV, E–V 2) A–V, B–IV, C–III, D–II, E–I
3) A–IV, B–II, C–I, D–III, E–V 4) A–I, B–III, C–V, D–II, E–IV
119. Unisexuality of flowers of dioecious plant prevents:
1) Geitonogamy, but not xenogamy 2) Autogamy and geitonogamy
3) Autogamy, But not geitonogamy 4) Both geitonogamy and xenogamy
120. Identify the correct match from the column-I, II and III
Column-I Column-II Column-III

(A) Product of Syngamy (i) Pollen grain (a) Male
gametophyte
(B) Product of triple fusion (ii) Zygote (b) Embryosac
C) Product of Microsporogenesis (iii) PEN in PEC
(c) Embryo
(D) Product of megasporogenesis (iv) Megaspore
(d) Endosperm
1) (A) – iii – d, (B) – ii – c, (C) – i – a, (D) – iv – b
2) (A) – ii – c, (B) – iii – d, (C) – i – a, (D) – iv – b
3) (A) – ii – c, (B) – iii – d, (C) – iv – b, (D) – i – a
4) (A) – iii – d, (B) – ii – c, (C) – iv – b, (D) – i – a
121. Select one word for the statement.
a. If F1 resembled both the parents
b. If F1 did not resemble either of the two parents and was in between the two
c. If F1 resembled either of the two parents.
1) c-dominance, b-co-dominance, a`-incomplete dominance
2) a-dominance, c-co-dominance, b-incomplete dominance
3) b-dominance, a-co-dominance, c-incomplete dominance
4) c-dominance, a-co-dominance, b-incomplete dominance
122. The phenotype of an individual may be affected if the modified allele produces :
(a) No enzyme at all (b) The normal/less efficient enzyme
(c) A non-functional enzyme
1) Only (a) is correct 2) (a) and (c) are correct
3) (b) and (c) are correct 4) Only (c) is correct
123. When a pink flowered Antirrhinum plant is test crossed, then phenotypic ratio
on resulting progenies is :
1) 1 Red : 1 White 2) 3 Red : 1 White
3) 2 Pink : 1 White 4) 1 Pink : 1 White
124. Both phenotypic and genotypic ratio of F2 are same in :
1) co-dominance 2) Incomplete dominance
3) Mendelian monohybrid test cross 4) More than one option is correct

125. Test cross is a cross between.

1) Hybrid × Dominant parent (Rr × RR)
2) Hybrid × Recessive parent (Rr × rr)
3) Hybrid × Hybrid (Rr × Rr) 4) All the above
126. Which is not a conclusion of Frederick Griffith :
1) R-strain Pneumococcus are transformed by heat killed S-strain
Pneumococcus.
2) Transforming factor is transferred from heat killed S-strain to R-strain.
3) Transforming factor is DNA.
4) In the presence of heat killed S-strain, R- strain synthesise a smooth
polysaccharide coat and become virulent.
127. Which of the following is not a property of genetic material :
1) It should be able to generate its replica.
2) It should be stable chemically and structurally.
3) It should provide the scope for fast changes (mutation) that are required for
evolution.
4) It should be able to express.
128. The main enzyme of DNA replication is :
1) DNA dependent RNA polymerase. 2) RNA dependent DNA polymerase.
3) DNA dependent DNA polymerase. 4) RNA dependent RNA polymerase.
129. E.coli cells which are growing in normal medium with glucose, if they are
transfered to medium containing only lactose as the sugar then which one of
the following changes takes place –
1) The lac operon is repressed. 2) The lac operon is induced.
3) E.coli cells stop dividing. 4) All operon are induced.
130. The poly A tail of mRNA consist of multiple adenine units in the form of
1) Adenosine triphosphate 2) Adenosine monophosphate
3) Adenosine diphosphate 4) Adenylate residues
131. Mark the wrong statement.
1) Puffed up appearance of dough is due to CO2 released by alcoholic
fermentation of food
2) Toddy is prepared by fermenting sap of palm by microbes
3) Microbes are also used to ferment fish and bamboo shoots to make foods
4) Cheese are ripened by some specific multicellular bacteria only
132. Sewage naturally contains all these, except
1) Municipal waste water 2) Organic matter
3) Heterotrophic multicellular organisms 4) Aerobic chemoautotrophs
133. Which enzyme is not related correctly with its functions :
Column-I Column-II
(1) Taq polymerase I Synthesis of DNA
(2) Chitinase II. Obtaining DNA by lysis of bacterial cell
(3) Exonucleases III. Remove nucleotides from the ends of DNA
(4) DNA ligase IV. Joining of DNA fragments
134. Which elements are used to make micro-particles for gene gun method of
transformation ?
1) Palladium 2) Gold 3) Tungsten 4) Either (2) or (3)
135. How many DNA molecules will be produced from one DNA molecule after 6 PCR
cycles ?
1) 10 2) 15 3) 32 4) 64
136. Correct sequence of hormone secretion from beginning of menstrual cycle is
1) FSH, progesterone, estrogen 2) Estrogen, FSH, progesterone
3) FSH, estrogen, progesterone 4) estrogen, progesterone, FSH
137. Association of oxyhaemoglobin can be promoted by
1) High pO2 2) High pCO2 3) High body temperature 4) Low pO2
138. Which is not correct –
1) Parturition is induced by neuroendocrine mechanism
2) Limbs and digit develop in foetus at the end of second month
3) Chorionic villi involve in development of placenta
4) Inner cell mass differentiation starts before implantation

139. Human testes are positioned in an external sac rather than in the abdominal
cavity
1) To shorten the distance that semen must travel during ejaculation
2) To shorten the distance that sperm must swim during insemination
3) So that the testes can be kept away from the urinary bladder
4) So that the testes can be kept cooler than the body’s interior temperature
140. In vitro fertilisation is a technique that involves transfer of which one of the
following into the fallopian tube?
1) Either zygote or early embryo upto 8 cell stage
2) Embryo only upto 8 cell stage
3) Embryo of 32 cell stage 4) Zygote only
141. Select the total number of hormones secreted by pars distalis from the following
GnRH, GHIH, FSH, ADH, ACTH, PTH, PRL
1) 2 2) 3 3) 4 4) 5
142. All sons of a couple are colour blind because
1) Mother is homozygous colour blind
2) Mother is heterozygous and father normal
3) Mother is heterozygous and father colour blind
4) Mother is normal and father colour blind
143. If a genetic disease is transferred from a phenotypically normal but carrier
female to only some of the male progeny, the disease is
1) Autosomal dominant 2) Autosomal recessive
3) Sex–linked dominant 4) Sex–linked recessive
144. Assertion (A): Benign tumor remains confined to their original location and
donot spread to other parts.
Reason (R): Benign tumor show the property of metastasis
Choose the appropriate option:
1) (A) is correct but (R) is not correct 2) (A) is not correct but (R) is correct
4) Both (A) and (R) are correct and (R) is not the correct explanation of (A)
145. Statement I: Water vascular system help in locomotion, capture and transport
of food and respiration.
Statement II: Hemichordates have well developed notochord
Choose the appropriate option:
1) Statement I is correct but statement II is incorrect
2) Statement I is incorrect but statement II is correct
3) Both statement I and II are correct
146. Statement (I): Population of India crossed 1 billion in may 2000.
Statement (II) It is the result of rapid decline in death rate, MMR and IMR.
Choose the correct statement.
147. The semilunar valves of pulmonary artery and aorta are forced open due to
1) Decreased ventricular pressure 2) Increased atrial pressure
3) Increased ventricular pressure 4) Decreased atrial pressure
148. Which of the following statement is incorrect w.r.t. Rh grouping?
1) Nearly 80% of humans are Rh positive
2) Rh antibodies from the Rh-negative mother can leak into the blood of the Rh-
positive foetus and destroy the foetal RBCs
3) Erythroblastosis foetalis can be avoided by administering anti-Rh antibodies
to the mother immediately after the delivery
4) Erythroblastosis is a special case of WBC incompatability
149. Which of the following statemetns are incorrect?
A) ANF causes vasodilation
B) A fall in Glomerular blood flow can activate the epithelial cells of PCT
C) ADH causes diuresis
1) A and C 2) C only 3) B and C 4) B only

150. Read the following statements and choose the correct option?
a) Ammonia diffuses across gill surfaces as ammonium ions
b) Kidneys play a significant role in the excretion of ammonia
c) Land snails are uricotelic
d) Ammonia can be removed with minimum loss of water
(a) (b) (c) (d) (a) (b) (c) (d)
1) F F T T 2) F T T F
3) T T F F 4) T F T F
151. Read the following statements carefully
a) Neurotransmitters bind to their specific receptors present on post-synaptic
membrane
b) Binding of neurotransmitters open ion channels in post-synaptic membrane
c) Entry of ions in post-synaptic neuron always generates excitatory post-
synaptic potential
d) Entry of ions in post-synaptic neuron always generates inhibitory post-
synaptic potential
Choose the option with all correct statements
1) a and b 2) b and c 3) c and d 4) a and d
152. Statement I: First mammals on earth were like shrews.
Statement II: Dryopithecus were more ape-like and Ramapithecus were more
man-like primate.
Choose the correct option:
153. How many diseases given in the box are transmitted by inhalation of
droplets/aerosols released by an infected person?
Common cold, Pneumonia, Malaria,Typhoid, Amoebiasis, Hepatitis-B
1) 4 2) 3 3) 2 4) 5
154. Techniques like radiography (use of X-rays), CT scanning and MRI are very useful
to detect
1) Autoimmune disorders 2) Disease caused by viral infections
3) Disease caused by bacterial infections 4) Cancers of internal organs
155. Select the correct statement from the below given statements.
1) Cocaine is given to patients after surgery, as it stimulates recovery.
2) Barbiturates can cause hallucinations
3) Morphine is often given to patients who have undergone surgery as a pain
killer.
4) Chewing tobacco lowers blood pressure and heart rate
156. Choose the incorrect combination in the below given options –
1) Elephantiasis – Wuchereria
2) Amoebic dysentery – Entamoeba histolytica
3) Malaria – Plasmodium
4) Pneumonia – Salmonella typhi
157. Assertion (A): In Myasthenia gravis, weakening of skeletal muscles occurred.
Reason (R): Oxalates found within the kidney called Renal calculi.
158. Which of the following is not observed during contraction of a muscle fibre?
1) A band retain the length 2) Shortening of sarcomere
3) I band gets reduced 4) H zone retains the length

159. Match the column-I with column-II and select the correct option.
Column-I Column-II
(a) Gout (i) decreased levels of estrogen
(b) Osteoporosis (ii) low Ca++ ions in the blood
(c) Tetany (iii) accumulation of uric acid crystals in joints
(d) Muscular dystrophy (iv) auto immune disorder
(v) genetic disorder
1) (a)-(ii), (b)-(i), (c)-(iii), (d)-(iv) 2) (a)-(iii), (b)-(i), (c)-(ii), (d)-(v)
3) (a)-(iv), (b)-(v), (c)-(i), (d)-(ii) 4) (a)-(i), (b)-(ii), (c)-(iii), (d)-(iv)
160. Which of the given factors favours the dissociation of CO2 from
carbaminohaemoglobin?
1) High pCO2, low pO2 - In tissue 2) Low pCO2, high pO2 - In alveoli
3) Low pO2, high pCO2 - In alveoli 4) High pO2, high pCO2 - In alveoli
161. Blood carries the CO2 in three forms. The correct percentages of CO2 in these
forms as carbamino hemoglobin, bicarbonates, dissolved form in plasma
respectively.
1) 20–25%, 70%, 7% 2) 70% , 20-25%, 7%
3) 20-25%, 7%, 70% 4) 7% , 20-25% , 70%
162. Read the given statements that define functions of a particular hormone
I. Regulate the development, maturation and functions of epididymis, vas
deferens, seminal vesicle, prostate gland, urethra, etc.
II. Stimulate muscular growth, growth of facial and axillary hairs,
aggressiveness, low pitch of voice, etc.
III. Stimulates spermatogenesis
IV.Leydig’s cell/ interstitial cells (present in the intertubular space) secrete this
hormone under the influence of LH
Which of the following hormone is referred here?
1) FSH 2) Progesterone 3) Androgen 4) Melatonin
163. Which of the following is/are true for phylum ctenophora?
Statement A: Sexes are separate in ctenophora
Statement B: Fertilisation is external
Statement C: Development is indirect
1) All statements are correct 2) Only statement A is incorrect
3) Statements B and C are incorrect 4) Only statement B is correct
164. Which one’s have open circulatory system?
A. Hagfish B. Cockroach C. Earthworm D. Prawn
E. Locust F. Snail
1) B, D, F only 2) A, B, D, F 3) C, D, E 4) B, D, E, F
165. 100 spermatogonia give rise to
1) 100 primary spermatocytes, 400 secondary spermatocytes, 600 spermatids,
400 spermatozoa
800 spermatozoa
400 spermatozoa
800 spermatozoa
166. Association areas in Brain
1) Sensory areas found in deeper part of cerebral cortex
2) Motor areas found in surface layer of grey matter of cerebrum
3) Neither clearly sensory nor motor, found in grey matter of cerebrum
4) Hypothalamic neurons which secrete hormones
1) All vertebrates are chordates but all chordates are not vertebrates
2) All diploblastic animals are acoelomate but all acoelomate are not
diploblastic.
3) All triploblastic animals are eucoelomates but all eucoelomates are not
triploblastic
4) All insects are arthropods but all arthropods are not insects

168. Read the given statements and select the option that correctly classifies them as
true(T) or false(F)
A. Human skeleton has 206 bones in an adult
B. There are usually 12 pairs of ribs in man
C. Sternum is present on the dorsal side of the human body
D. Myasthenia gravis refers to progressive degeneration of smooth muscles
mostly due to autoimmune disorder
A B C D A B C D
1) T T F T 2) F F T T
3) F T F F 4) T T F F
169. Which one of the following aspects of evolution is shown by Darwin’s finches?
1) Biogeographic evidence 2) Industrial melanism
3) Convergent evolution 4) Embryological competition
(i) Renal vein takes blood away from kidney.
(ii) Urine gets diluted in ascending limb of loop of Henle.
(iii) Podocytes occur in inner wall of Bowman's capsule.
(iv) Ultrafiltrate/nephric filtrate is plasma minus proteins.
1) (i) and (ii) only 2) (iii) and (iv)only 3) (i) and (iii) only 4) (i), (ii), (iii) and (iv)
171. Biodiversity hotspots
1) Have low degree of endemism.
2) Were initially twenty five in number.
3) Can be exemplified by Khasi and Jaintia hills in Madhya Pradesh.
4) Are ex-situ conservation strategies for organisms.
172. The amount of stored organic matter in plant tissue after respiratory (metabolic)
utilisation per unit time and area is called
1) GPP 2) NPP 3) Respiration 4) Secondary productivity
173. Among the non-infectious diseases, which of the following is the most common
fatal disease of human beings?
1) AIDS 2) Cancer 3) Cystic fibrosis 4) Cholera
174. A: Turner’s syndrome is caused due to absence of any one of the X and Y Sex
chromosome
B: Turner’s syndrome is an example of Aneuploidy.
1) Both statement A and B are correct.
2) Statement A is correct but statement B is incorrect.
3) Statement A is incorrect but statement B is correct.
4) Both statement A and B are incorrect.
175. The correct sequence of taxonomical categories is
1) Class → Phylum → Order → Family → Genus → Species
2) Phylum → Class → Order → Family → Genus → Species
3) Phylum → Order → Class → Family → Genus → Species
4) Class → Phylum → Order → Family → Species → Genus
176. The IUCN red list (2004) documented the extinction of how many species?
1) 284 2) 379 3) 784 4) 359
177. Chordae tendinae in the heart are
1) Connection between the pulmonary trunk and the aorta during embryonic
state.
2) Thin fibres of the ventricular nodal tissue.
3) Connection between the cuspid valves and the papillary muscles of ventricles.
4) Myocardial fibres
178. Which of the following is not characteristic feature of phylum Aschelminthes?
1) Bilaterally symmetrical, triploblastic animals.
2) Pseudocoelomate animals.
3) Incomplete alimentary canal 4) They are dioecious.
179. Depolarisation of neural membranes is caused due to
1) Rapid influx of Na+ ions 2) Rapid influx of K+ions
3) Rapid efflux of Na+ions 4) Rapid influx of Chloride ions
180. Identify the extinct species due to invasions of Alien species
1) Stellar’s sea cow 2) Cichlid fish
3) Passenger piegeon 4) All
*******

: ANSWER KEY:
1 1 11 3 21 3 31 1 41 2
2 2 12 2 22 2 32 3 42 4
3 1 13 2 23 1 33 1 43 2
4 1 14 4 24 1 34 1 44 4
5 2 15 2 25 3 35 3 45 1
6 2 16 3 26 1 36 2
7 4 17 3 27 3 37 4
8 3 18 2 28 3 38 3
9 1 19 1 29 2 39 3
10 3 20 4 30 2 40 1
SUB:CHEMISTRY
46 2 56 1 66 2 76 3 86 1
47 1 57 2 67 4 77 2 87 2
48 1 58 3 68 4 78 4 88 3
49 1 59 2 69 2 79 4 89 4
50 2 60 1 70 3 80 3 90 1
51 2 61 1 71 3 81 4
52 3 62 4 72 4 82 2
53 3 63 1 73 3 83 3
54 3 64 3 74 3 84 2
55 1 65 3 75 1 85 2
SUB : BOTANY
91 2 101 3 111 2 121 4 131 4
92 3 102 2 112 1 122 2 132 4
93 4 103 3 113 2 123 4 133 2
94 4 104 2 114 2 124 4 134 4
95 3 105 3 115 1 125 2 135 4
96 3 106 2 116 3 126 3
97 1 107 3 117 2 127 3
98 3 108 1 118 2 128 3
99 2 109 1 119 1&2 129 2
100 1 110 4 120 2 130 4
136 3 146 2 156 4 166 3 176 3
137 1 147 3 157 2 167 3 177 3
138 4 148 4 158 4 168 4 178 3
139 4 149 3 159 2 169 1 179 1
140 1 150 4 160 2 170 4 180 2
141 2 151 1 161 1 171 2
142 1 152 3 162 3 172 2
143 4 153 3 163 2 173 2
144 1 154 4 164 4 174 3
145 1 155 3 165 3 175 2

XII- NEET GT - 9
answer sheet.

PHYSICS Mr.VENKAT
CHEMISTRY Mr.GANESH/Mr.SAIDULU
BOTANY Mr.RAMESH
ZOOLOGY Dr.BASHA
PHYSICS
1. A body kept on a smooth inclined plane having inclination 1 in s will remain
stationary relative to inclined plane if the body is given a horizontal acceleration
equal to
g gs g s 2 1
1) 2) 3) 4) g s 2 1
s 1
2
s 1
2 s
2. Two sides of a triangle are given by iˆ  ˆj  kˆ and iˆ  2 ˆj  3kˆ , then area of triangle
is
1) 26 2) 26 / 2 3) 46 4) 26
3. A drunker takes a step of 1m in 1s. He takes 5 steps forward and 3 steps
backward and so on. The time taken by him to fall in a pit 13m away from the
start is
1) 26 s 2) 60 s 3) 37 s 4) 20 s
4. Two masses A and B of 15kg and 10kg are connected with a string passing over
a frictionless pulley fixed at the corner of a table (as shown in figure). The
coefficient of friction between the table and block is 0.4. The minimum mass of
C, that may be placed on A to prevent it from moving is:
1) 10 kg 2) 5 kg 3) Zero 4) 15 kg
5. A capacitor connected to a 10V battery collects a charge 40C with air as
dielectric and 100C with oil as dielectric. The dielectric constant of oil is
1) 2 2) 2.5 3) 4 4) 10
hc

6. In the formula F  A.e x , where h is Planck’s constant, and c is speed of light.
The dimensional formula for x is
1)  M0 L0 T0  2)  M1L3T2  3)  M0 L1T 0  4)  M1L2T2 
7. A grass hopper can jump a maximum horizontal distance of 0.3m. If it spends
negligible time on ground, its horizontal component of velocity is (g=10ms-2)
3 3 1 1 2 1
1) ms 1 2) ms 3) ms 1 4) ms
2 2 2 3
8. A container filled with a liquid of density 2ρ is as shown in figure. The velocity
of efflux through orifice is nearly ( ρ density of water, g = 10 ms-2)
1) 14.1 m/s 2) 28 m/s 3) 10 m/s 4) 20 m/s

9. The length of sonometer wire is 0.75 m and its material density is 9103 kg / m3 .
It can bear maximum stress of 8.1108 N m2 without exceeding elastic limit.
Fundamental frequency that can be produced in the wire is
1) 200 Hz 2) 230 Hz 3) 400 Hz 4) 900 Hz

10. A person can swim in still water at 5m/s. He moves in a river of velocity 3 m/s.
First down the stream next same distance up the stream the ratio of times
taken are
1) 1 : 1 2) 1 :2 3) 1 : 4 4) 4 : 1
11. When hydrogen atom is in its first excited level, its radius is
1) Four times, its ground state radius 2) Twice, its ground state radius
3) Same as its ground state radius 4) Half of its ground state radius
12. When the tension on a wire is 4N its length is l1 . When two tension on the wire
is 5 N its length is l2 . Find its natural length.
1) 5l1  4l2 2) 4l1  5l2 3) 10l1  8l2 4) 8l1  10l2
13. The barrier potential of p-n junction depends on
I. Type of semiconductor material II. Amount of doping
III. Temperature
Which one of the following is correct?
1) I and II only 2) II only 3) II and III only 4) I, II and III
14. A geostationary satellite is orbiting the earth at a height of 6R above the surface
of the earth. The time period of another satellite at a height of 2.5 R from the
surface of the earth is
1) 6 hr 2) 8hr 3) 12hr 4) 6 2hr
15. A disc of mass 100g and radius 10cm has a projection on its circumference. The
mass of projection is negligible. A 20g bit of putty moving tangential to the disc
with a velocity of 5ms-1 strikes the projection and sticks to it. The angular
velocity of disc is
1) 14.28rads-1 2) 17.3rads-1 3) 12.4rads-1 4) 9.82rads-1
16. A pendulum is swinging in an elevator. Its period will be greatest when the
elevator is
1) Moving upwards at constant speed 2) Moving upward with acceleration
3) Moving downwards at constant speed 4) Accelerating downwards
17. Match the following diagrams with the correct statement.
(A) (I) m|<1|
(B) (II) m|>1|
(C) (III) Real image
(D) (IV) At infinite
(A) (B) (C) (D) (A) (B) (C) (D)

1) II I III IV 2) III II IV I
3) I III IV II 4) I III II IV
18. Glass has refractive index 'μ ' with respect to air and the critical angle for a ray
of light going from glass to air is 'θ ' . If a ray of light is incident from air on the
glass with angle of incidence 'θ ' , corresponding angle of refraction is
 1  1 1
1) sin 1  
 μ 
 
2) sin 1 μ 3) sin1  2 
 μ 
4) sin1  
 μ 

19. Assertion (A): The air bubble shines in water.
Reason (R): Air bubble in water shines due to refraction of light.
3) A is correct and R is incorrect. 4) A is incorrect and R is correct
20. A rectangular loop with a sliding connector of length l = 1.0m is situated in a
uniform magnetic field B=2T perpendicular to the plane of loop. Resistance of
conector is r  2 two resistances of 6 and 3 are connected as shown in
figure. The external force required to keep the connector moving with a constant
velocity v  2m / s is
1) 6N 2) 4N 3) 2N 4) 1N
21. A point object O is placed in front of a glass rod having spherical end of radius
of curvature 30cm. The image would be formed at
1) 30cm left 2) Infinity 3) 1cm to the right 4) 18cm to the left

22. A simple telescope, consisting of an objective of focal length 60cm and a single
eye lens of focal length 5cm is focused on a distant object is such a way that
parallel rays comes out from the eye lens. If the object subtends an angle 20 at
the objective, the angular width of the image
1) 100 2) 240 3) 500 4) 1/ 60
23. Yellow light is used in single slit diffraction experiment with slit width 0.6mm. If
yellow light is replaced by blue then the pattern will reveal.
1) That the central maxima is narrower 2) No diffraction pattern
3) That the central maxima is wider
4) Width of central maxima remains same
24. On the perpendicular bisector of an electric dipole, the electric intensity E and
potential V are
1) E = 0, V = 0 2) E  0,V  0 3) E  0,V  0 4) E  0,V  0
25. The ratio of electron and hole currents in a semi conductor is 7/5 and the ratio
of drift velocityes of electrons and holes is 7/4, then the ratio of concentrations
of electrons and holes will be
1) 5/4 2) 4/7 3) 5/8 4) 4/5
26. Assertion (A): Though the same current flows through the line wires and the
filament of the bulb but heat produced in the filament is much higher than that
in lines wires.
Reason (R): The filament of bulbs is made of a material of high resistance and
low melting point.
27. A point source of power 16π W is emitting sound waves. The intensity at a
distance 100m from source will be
1) 4104 W / m2 2) 2104 W / m2 3) 9102 W / m2 4) 8103 W / m2

28. In a Young’s double slit experiment setup, if the distance between the slit plane
and screen is doubled and the distance between the slits is halved, then the
distance between first maxima and third minima on same side of the central
maxima.
1) Will remain unchanged
2) Will become four times of initial value
3) Will becomes two times of initial value
4) Will become half of initial value
29. The angle of prism is equal to 600 and the refractive index is 2 . The angle of
incidence for the condition of minimum deviation will be
1) 450 2) 600 3) 300 4) 900
30. The electric field at a distance 3R from centre of uniformly charged spherical
R
shell of radius R is E. The electric field at a distance from the centre will be
4
E E
1) 2) 3) 3E 4) Zero
2 4
31. The photoelectric threshold wavelength for silver is λ 0 . The energy of the
electron ejected from the surface of silver by an incident wavelength λ  λ  λ 0 
will be:
h  λ 0  λ   λ  λ 
4) hc  0
hc
1) hc λ 0  λ    
c  λλ 0   λλ0 
2) 3)
λ0  λ
32. From the figure photoelectric effect we may infer correctly that:
1) Na and Al both have the same threshold frequency.

2) Maximum kinetic energy for both the metals depend linearly on the
frequency.
3) The stopping potential are same for Na and Al for the same frequency.
4) Al is a better photo sensitive material than Na.
33. The de-Brogile wavelength of an electron is the same as that of a 50 keV X-ray
photon. The ratio of the energy of the photon to the kinetic energy of the
electron is (the energy equivalent of electron mass is 0.5 MeV)
1) 1 : 50 2) 1 : 20 3) 20 : 1 4) 50 : 1
34. An electron is moving in an orbit of a hydrogen atom from which there can be a
maximum of six transition. An electron is moving in an orbit of another
hydrogen atom from which there can be a maximum of three transition. The
ratio of the velcoities of the electron in these two orbits is:
1 2 5 3
1) 2) 3) 4)
2 1 4 4
35. The ground state energy of hydrogen atom is -13.6 eV. When its electron is in
the first exicted state, its excitation energy is
1) 3.4 eV 2) 6.8 eV 3) 10.2 eV 4) Zero
36. A cricketer can throw a ball to a maximum horizontal distance of d. How

maximum high above the ball can?
1) d/2 2) d 3) 2d 4) d/4

37. In an oscillatioin of L-C circuit, the maximum charge on the capacitor is Q. The
charge on the capacitor, when the energy is stored equally between the electric
magnetic field is
Q Q Q Q
1) 2) 3) 4)
2 2 3 3
38. The resistance of a gavonmeter is 999 . By connecting 1 shunt is resistance it
measures 10mA. The current that is passing through the galvanometer is
1) 10 A 2) 1 A 3) 100 A 4) 0.1 A
39. Assertion (A): Angular speed, linear speed as kinetic energy change with time
but angular momentum about the sun remains constant for a planet orbiting
the sun.
Reason (R): Angular momentum about the sun is constant as no external
torque acts on the planet.
 
40. If a current I given by I 0 sin  t   flows in an ac circuit across which an ac
 2
potential of V  V0 sin t has been applied, then the power consumption P in the
circuit it will be
VI VI
1) P  0 0 2) P  2V0 I 0 3) P  0 0 4) P = 0
2 2
41. A ring of radius ‘r’ is uniformly charged with a charge ‘q’. If the ring is rotated
about its own axis with an angular frequency '  ' then the magnetic induction
field at the centre is
0
 q    r    q   
1)   2) 0   3) 0   4) 0  
4
 r  4  q  4  r  4  qr 
42. Two thin metal strips, one of brass and the other of iron are fastened together
parallel to each other, a distance 2mm apart to form a bimetallic strip. If the
strips are of equal length at 00C. The radius of the arc formed by the bimetallic
strip when heated to 800C is (coefficient of linear expansion of brass =
19 106 / 0 C and iron = 12 106 / 0 C )
1) 1.50m 2) 3.57m 3) 5.57m 4) 0.57m
43. A soap bubble of radius 1.0cm is formed inside another soap bubble of radius
2.0 cm. The radius of an another soap bubble of which has the same pressure
difference as that between the inside of the smaller and outside of large soap
bubble, in meters is
1) 6.67103 2) 3.34103 3) 2.23103 4) 4.5103
44. Tangential and angular acceleration of a particle are 10 m/s2 and 5 rad/s2
respectively. What is the distance from rotational axis?
1) 0.5 m 2) 1 m 3) 2 m 4) 4 m
45. Satement (A): The heat supplied to a system is always equal to the increase in
its internal energy.
Statement (B): When a system change from one state to another, some heat
may be is absorbed by it.
1) Both A & B are correct 2) Both A & B are incorrect
3) A is correct and B is incorrect. 4) A is incorrect and B is correct

CHEMISTRY
46. The kinetic energy of an electron in excited hydrogen atom is 3.4 eV. Then
according to Bohr’s theory the angular momentum of their electron in JS is
1) 2.111034 2) 3 1034 3) 2 1034 4) 0.5 1034
47. The formation of the oxide ion, Og2 from oxygen atom requires first an
exothermic and then an endothermic step as shown below
O g   e  
 Og ; H 1  141 KJ mol1
Og  e  
 Og2 ; H 1  780 KJ mol 1
Thus process of formation of O 2 in gas phase is unfavourable even though O 2
is isoelectronic with Neon. It is due to the fact that.
1) Oxygen is more electronegative
2) Addition of electron in oxygen results in larger size of the atom
3) Electron repulsion outweighs the stability gained by achieving noble gas
configuration
4) O ion has comparatively smaller size than oxygen atom
48. If the shortest wave length of H – atom in Lyman series is x, the longest wave
length in Balmer Series of He+ is
9x 36 x x 5x
1) 2) 3) 4)
5 5 4 9
  2
49. Decreasing order of stability of O2 , O2 , O2 and O2 is
1) O22  O2  O2  O2 2) O2  O2  O22  O2
3) O2  O22  O2  O2 4) O2  O2  O2  O22
 2 NH 3  g 
N 2  g   3H 2  g  
KP/KC is equal to
1) RT 2) (RT)-2 3) (RT)2 4) (RT)-1
51. Which of the following pairs of ions are isoelectronic and isosttrutural?
1) SO32  , NO3 2) ClO3 , SO32  3) CO32  , SO32  4) ClO3 , CO32 
52. Which of the following is a suitable indicator for the titration of CH3COOH and
NH4OH?
1) Methyl orange 2) Methyl red
3) Phenophthalein 4) No indicator gives satisfactory results.
53. Structure of the compound whose IUPAC name is 3-ethyl-2-hydroxy-4-
methylhex-3-en-5-ynoic acid is
54. What is [H+] in mol/lit of a solution that is 0.2 M CH3COONa and 0.1 M
CH3COOH? Ka for CH3COOH is 1.8 105
1) 3.5 104 2) 1.1105 3) 1.8 107 4) 9.0 106
55. Kjeldahl’s method cannot be used for the estimation of nitrogen in
1) Pyridine 2) Nitro compounds
3) Azo compounds 4) All the three above
56. If 60% of a first order reaction was completed in 60 min 50% of the same
reaction would be completed in approximately  log 4  0.60, log 5  0.69 
1) 45 min 2) 60 min 3) 40 min 4) 70 min
57. Find the total number of stereo isomers for the following compound.
CH3CH(OH)CH = CH – CH3
1) 2 2) 3 3) 5 4) 9
58. The following statements are correct
i) A plot of log kp versus 1/T is linear with negative slope.
 P 
ii) A plot of log[x] versus time is linear for a first order reaction, x 
iii) 99.9% of a first order reaction completes 10 times of the time required for
75% completion of the reaction.
iv) For a zero order reaction, 100% of reaction completes in two half lives.
1) (i) only 2) (ii) only 3) (i) and (ii) 4) (i), (ii), (iv)

59. The non-aromatic compound among the following
60. Reaction of aniline with acetylchloride in the presence of NaOH gives

1) acetanilide 2) p – Chloroaniline
3) a red dye 4) aniline hydrochloride
61. The stability order of carbocations is

+ +
+ +
(A) (B) (C) (D)
1) D > A > B > C 2) D > B > A > C 3) B > C > A > D 4) D > A > C > B
62. In a 0.2 molal aqueous solution of a weak acid HX the degree of ionization is
0.3. Taking kf of water 1.85. The freezing point of the solution will be nearest
to
1) 0.360o C 2) 0.260o C 3) 0.481o C 4) 0.481o C
63. A single compound of the structure
is obtainable from ozonolysis of which of the following cyclic compounds?
64. On mixing 10 ml of acetone with 40 ml of chloroform, the total volume of the

solution is
1) < 50 ml 2) > 50 ml 3) = 50 ml 4) cannot be predicted
65. H  / Hg 2
CH 3  C  CH   X  major 
CH 3  C  CH 
B2 H 6 / THF
H O / OH 
 Y  major 
2 2
relation between X and Y

1) Chain isomers 2) Optical isomers
3) Functional isomers 4) Position isomers
66. If 0.01 M solution of an electrolyte has a resistance of 40 ohms in a cell

constant of 0.4 cm-1, then its molar conductance in ohm-1cm-1mol-1 is
1) 102 2) 104 3) 103 4) 10
67. For an electrophilic substitution reaction, the presence of a halogen atom in the
benzene ring ………
(A) deactivates the ring by inductive effect.
(B) deactivates the ring by resonance.
(C) Direct electrophile into ortho and para positions
(D) directs the incoming electrophile to meta position by increasing the charge
density relative to ortho and para position.
1) A, B, C only 2) A, C, D only 3) A, D only 4) A, C only
68. A metal M forms the sulphate M2(SO4)3. A 0.596 gram sample of the sulphate
reacts with excess BaCl2 to give 1.220 gram BaSO4. What is the atomic weight
of M?
( Atomic weight of S = 32, Ba = 137.3)
1) 26.9 2) 69.7 3) 55.8 4) 23
69. Increasing order of rate of reaction with HNO3/H2SO4 is
1) iii < ii < i 2) ii < iii < i 3) i < iii < ii 4) i < ii < iii

70. In a compound C,H,N atoms are present in 9 : 1 : 3.5 by weight. Molecule
weight of compound is 108, molecular formula of compound is
1) C2H6N2 2) C3H4N 3) C6H8N2 4) C9H12N3
71.
72. Assertion (A) : At constant temperature, whatever the heat absorbed by the
system is used in doing the work.
Reason (R) : Internal energy change is zero in isothermal process.
73. Identify Z in the reaction
74. From the following bond energies

H – H = 431.37 kJ/mol, C = C is 606.10 kJ/mol, C – C is 336.49 kJ/mol,
C – H is 410.50 kJ/mol. Enthalpy for the reaction
H H H H
| | | |
C  C  H  H 
 H  C  C  H will be
| | | |
H H H H
1) – 243.6 kJ / mol 2) – 120 kJ / mol
3) 553 kJ / mol 4) 1523.6 kJ /mol
75. Among the following the one that gives positive iodoform test upon reaction with
I2 and NaOH
1) PhCHOHCH3 2) CH3CH2CH(OH)CH2CH3
3) C6H5CH2CH2OH 4) CH3CH(CH3)CH2OH
76. Which species are oxidized and reduced in the reaction ?
 Fe3  CO2  Mn2
FeC2O4  KMnO4 
1) Oxidised : Fe, C; Reduced : Mn 2) Oxidized : Fe : Reduced : Mn
3) Reduced Fe, Mn; Oxidised : C 4) Reduced : C : Oxidised : Mn, Fe
77. Match the following lists :
List – I List - II
A) Grignard reagent 1) H2/Pd – BaSO4
B) Clemmensen reduction 2) N2H4, KOH/Glycol
C) Rosenmund reduction 3) CH3MgX
D) Wolff-Kishner reduction 4) Zn – Hg|conc.HCl
5) H2 | Ni
Codes :
A B C D A B C D
1) 3 4 2 1 2) 3 4 1 2
3) 2 1 4 5 4) 5 3 2 1

78. Which of the following does not correctly represent the correct order of the
property indicated against it?
1) Ti < V < Cr < Mn increasing number of oxidation states
2) Ti+3 < V+3 < Cr+3 < Mn+3 increasing magnetic moment
3) Ti < V < Cr < Mn increasing melting points
4) Ti < V < Mn < Cr increasing 2nd ionization enthalpy

HNO3  H 2 SO4 Fe  HCl CHCl3  Alc . KOH
79. X   Y    Z   P 
H 2O / H
 Z  HCOOH
what is “Y” in the above reaction?
1) C6H6 2) C6H5NO2 3) C6H5NH2 4) C6H5NC
80. Consider the following complex [Co(NH3)5CO3]ClO4. The coordination number,
oxidation number, number of d-electrons and number of unpaired d-electrons
on the metal are respectively
1) 6,3,6,0 2) 7,2,7,1 3) 7,1,6,4 4) 6,2,7,3
81. For the following reaction
82. Select the true statement from the following for metal carbonyls?
1)   back bonding strengthens M – C bond order as well as CO bond order
2)   back bonding weakens M – C bond order as well as CO bond order
3)   back bonding weakens M – C bond order strengthens CO bond order
4)   back bonding strengthens M – C bond order weakens CO bond order
83. Among the following amines, the strongest Bronsted base is _______
84. Melting point of B, Al, Ga and Tl decreasing in the order

1) B>Al>Tl>Ga 2) B=Al>Tl=Ga 3) B>Al>Tl=Ga 4) Tl>Ga>Al>B
85. In the following reactions, the major product is
86. Which of the following statements is wrong?

1) Among halogens, radius ratio between iodine and fluorine maximum.
2) Leaving F – F bond, all halogens have stronger x – x bond than x – x’ bond in
interhalogens
3) BrF3 has trigonal planar structure.
4) Interhalogen compounds are more reactive than halogen compounds

87. Match the following lists :
List – I (Color) List – II (Product)
A) Prussian blue 1)  Fe  CN 5 NOS 
4
B) Violet 2) Fe4  Fe  CN 6 
3
C) Blood red 3)  Fe  SCN  

2
D) Colour less 4) AgCl

5) Na4  Fe  CN 6 
The correct math is
A B C D A B C D
1) 4 1 3 2 2) 3 1 2 4
3) 1 2 3 4 4) 2 1 3 4
88. 0.05 mole of an octahedral complex CoCl3.xNH3 on reacting with excess
aqueous AgNO3 gives 14.35g of AgCl ppt [MW of AgCl = 143.5g/mol]. Assuming
all NH3 molecules are ligands, the value of x is
1) 5 2) 4 3) 6 4) 2
89. If NaOH is added to an aqueous solution of Zinc ions, a white precipitate
appears and on adding excess.NaOH the precipitate dissolves. In the resulting
solution zinc exist in the
1) Cationic part 2) Anionic part
3) Both cationic and anionic part 4) None of these
90. Alums can be represented by general formula M 2 SO4 .M 21  SO4 3 .24 H 2O in which
1) M is bivalent metal and M′ is trivalent metal
2) M is trivalent metal and M′ is monovalent metal
3) M is monovalent and M′ is trivalent metal
4) M and M′ both are bivalent metals
BIOLOGY
91. Arrange the following in ascending order based on their number?
A. No of bundles of stamens in pea flower
B. No.of centromeres per chromosome.
C. No.of cells in egg apparatus.
D. No.of seeds in watermelon
E. No.of microsporangia per typical angiospermic anther.
1) D, E, C, B, A 2) A, B, C, D, E 3) B, A, C, E, D 4) A, B, C, E, D
92. Caryopsis is applicable to
1) Rice 2) Chinarose 3) Wheat 4) Both 1 and 3
93. Conidial, septate, mycelial fungi are
1) Algal fungi and imperfect fungi 2) Sac fungi and imperfect fungi
3) Sac fungi and club fungi 4) Algal fungi and club fungi
94. Match the following column I and Column II and identify the correct match from
options given under
Options:
1) a-ii, b-iv, c-iii, d-i 2) a-iii, b-ii, c-i, d-iv
3) a-iv, b-i, c-ii, d-iii 4) a-i, b-iii, c-iv, d-ii
95. Epicalyx is the characterstic feature of
1) Mustard 2) Barley 3) Cotton 4) Pea
96. The flowering plant with highly reduced sporophyte and gametophytes is
1) Opuntia 2) Wolfia 3) Canary grass 4) Carrot grass

97. Wrongly matched of the following is
1) Prop roots – Adventitious roots 2) Sheathy leaf base - Grasses
3) Potato – Modified root 4) Flower – modified shoot
98. Pentamerous, zygomorphic flowers with ten microsporophylls and one
megasporophyll can be assigned to
1) Brassicaceae 2) Fabaceae 3) Solanaceae 4) Lilliaceae
99. Pick out the correct statement from the following
1) Tracheids are universal conducting elements present in all trachaeophytes
2) Seive tubes are lignified conducting elements without nucleus
3) Secondary phloem is the major tissue in woody dicot stem
4) Secondary cortex is collenchymatous in woody stem
100. Vascular bundles are conjoint and closed in
1) Dicot stem and monocot stem 2) Dicot root and monocot root
3) Monocot stem and leaves 4) Monocot root and leaves
101. Periderm does not include
1) Secondary phloem 2) Phelloderm 3) Phellogen 4) Phellem
102. Which of the following is not a function of Golgi complex?
1) Digestion materials 2) Packaging of materials
3) Cell plate formation in plant cells
4) Formation of glycoproteins & glycolipids
103. “Cell organelles within other cell organelles” is applicable to
1) Basal body in flagellum 2) Nucleolus in Nucleus
3) ‘70’s ribosomes in eukaryotic cell 4) ‘80’s ribosomes in eukaryotic cell
104. In tea plantations and hedge making, gardeners trim the plants regularly so
that they remain bushy. Scientific explanation behind this is
1) removal of apical dominance 2) growth of lateral buds
3) suppression of lateral buds 4) both 1 and 2
105. Which of the following not occurs in Anaphase-I but occurs in Anaphase-II
1) Condensation of chromosomes 2) Poleward movement of chromosomes
3) Shortening of spindle fibres 4) Splitting of centromere
106. Match the following and identify the correct match from the options given under
1) i-b, ii-c, iii-a, iv-d 2) i-b, ii-d, iii-c, iv-a

3) i-a, ii-b, iii-d, iv-c 4) i-c, ii-a, iii-b, iv-d
107. A virus differs from a bacterium as its contains
1) A cell wall 2) Cytosol 3) DNA as genetic material
4) DNA or RNA as genetic material with no ribosome
108. Wrongly matched w.r.t type of genetic material
1) T.M.V – ssRNA 2) QB Bacteriophage – ds DNA
3) T – even Bacteriophage – dsDNA 4) E.Coli – dsDNA
109. Which of the following are products of re - differentiation?
A) Medulla B) Secondary xylem C) Primary phloem D) Secondary phloem
1) A,B 2) C,D 3) A,C 4) B,D

110. What is the yield of ATP for the complete oxidation of one molecule of Acetyl
Co.A in Krebs cycle?
1) 12 2) 11 3) 9 4) 1

111. Match the following columns and identify the correct match
1) i-b, ii-c, iii-a, iv-d 2) i-b, ii-d, iii-c, iv-a

3) i-d, ii-a, iii-b, iv-c 4) i-c, ii-b, iii-d, iv-a
112. Branched rhizoids and leafy gametophytes are the characteristic of
1) Liverworts 2) Mosses 3) Ferns 4) Conifers
113. Match the columns I, II and III and choose the correct combination from the
options given
1) a-2-K, b-3-N, c-1-L, d-4-M 2) a-3-K, b-1-L, c-2-M, d-4-N

3) a-3-N, b-4-K, c-2-M, d-1-L 4) a-4-K, b-2-M, c-1-L, d-3-N
114. How many male gametes and female gametes are produced by each male and
female gametophytes respectively in flowering plants?
1) One, One 2) Two, Two 3) One, Two 4) Two, One
115. Pick out the correct statement from following
1) Monosporic embryo sac contains seven genomes
2) Autogamy is obligatory in chasmogamous flowers of commilina
3) Pollen pistil interaction begins with pollination and ends with entry of pollen
tube into ovary
4) Both autogamy and geitenogamy are not possible in papaya
116. Which of the following are membrane bound cell organelles?
1) Ribosomes 2) Nucleosomes 3) Mesosomes 4) Microbodies
117. A plant of F1-generation with genotype “AABbCC”. On selfing of this plant what
is the genotypic ratio in F2-generation:
1) 3 : 1 2) 1 : 2 : 1
3) 9 : 3 : 3 : 1 4) 27 : 9 : 9 : 9 : 3 : 3 : 3 : 1
118. Mendelian dihybrid cross does not explain
1) Law of dominance 2) Law of segregation
3) Law of independent assortment 4) Linkage
119. How many photosynthetic cell types does the leaf that fix CO2 in C4 plants & C3
plants respectively are?
1) One & Three 2) Three & One 3) One & Two 4) Two & One
120. In medelian dihybrid crosses, the probability of parental phenotypes in F2
progeny is
1) 2/16 2) 6/16 3) 9/16 4) 10/16

121. Which of the following is wrong w.r.t DNA polymerase?
1) It shows high efficiency and accuracy
2) It is DNA polymerase during DNA replication
3) It is RNA dependent DNA polymerase during transcription
4) It can-not initiate polymerisation of nucleotides by it’s own
122. Statement-I: Aminoacylation of tRNA occurs during translation.
Statement-II: Initiation of polypeptide chain begins with the encountering of
small subunit of ribosome with mRNA
3) S-I is correct but S-II is wrong 4) S-I is wrong but S-II is correct
123. The repressor of lac operon is inactivated by the binding of
1) Glucose 2) Galactose 3) Galactosidase 4) Allolactose
124. The correct sequence of following events w.r.t action of restriction enzymes?
(i) Cutting of strands of DNA (ii) Binding to recognition site
(iii) Finding of recognition sequence (iv) Inspection of length of DNA sequence
1) i,ii,iii,iv 2) iv,iii,ii,I 3) ii,iii,iv,i 4) iv,i,iii,ii
125. In the process of rDNA technology, the fragmentation of DNA is immediately
followed by
1) Ligation 2) Transformation
3) Isolation of desired DNA fragment 4) Culturing of host cells
126. Statement-I: All Fungi have cell wall.
Statement-II: All protists have cell wall.
3) S-I is correct but S-II is incorrect 4) S-I is wrong but S-II is correct
127. Assertion (A): All enzymes are nitrogenous hetero polymers with catalytic
activity.
Reason (R): Almost all enzymes are proteins and some are nucleic acids
(ribozymes).
1) Both A and B are correct, R is the correct explanation to A.
2) Both A and B are correct, R is not the correct explanation to A.
3) A is correct but R is wrong 4) Both A and R are wrong
1) Orchids – Non endospermic seeds 2) Beans – Endospermic dicot seeds
3) Black pepper – Perispermic seeds 4) Mango – polyembryonic seeds
129. The main function of the stem is
1) Conduction of water, minerals & photosynthates
2) Storage of food, support, protection and vegetative propagation
3) Spreading out branches bearing leaves, flowers and fruits
4) All of the above
130. How many ATP’s are require for synthesis of one sucrose molecules in
mesophylls of maize plant
1) 40 2) 60 3) 30 4) 24
131. Polymerase chain reaction does not require
1) ECOR-I 2) Oligonucleotide primers 3) DNA polymerase 4) Nucelotides
132. Identify the recognisition sites of two selectable markers of P BR322 plasmid
A. EcoRI B. BamHI C. Sal I D. PVU II E. PVU I F. Cla I
G. Hind III H. Pst I
1) A,C,D,G 2) B,C,E,H 3) D,E,F,G 4) A,B,C,D
133. Respiratory quotient (R.Q) is
1) Volume of O2 evolved/Volume of CO2 consumed
2) Volume of CO2 evolved/Volume of O2 consumed
3) Volume of O2 consumed/Volume of CO2 evolved
4) Volume of CO2 consumed/Volume of O2 evolved

134. Assertion (A): Matured sieve elements are non-totipotent cells
Reason (R): Matured sieve elements are dead cells
1) Both A and B are true, R is the correct explanation to A
2) Both A and B are true but R is the correct explanation to A
3) A is true but R is false 4) Both A and R are false
1) LAB – Probiotic 2) Brewing- Bread making
3) Flocs – Aerobes 4) Glomus – Fungal biofertilizer
136. Identify correct statement regarding to a particular type of immunity
1) Cellular barriers – Polymorphonuclear leucocytes and monocytes
2) Active immunity – Anti-tetanus and anti- snake bite injections
3) Physical barriers - Saliva in mouth and tears in eyes
4) Physiological barriers – Mucus coating of epithelium lining the urinogenital
tract and the HCL in stomach
137. Consider the statements given below regarding contraception and answer as
directed thereafter:
(A) Medical Termination of Pregnancy (MTP) during first trimester is generally
safe.
(B) Generally, chances of conception are nil until mother breast- feeds the infant
up to two years.
(C) Intrauterine devices like copper T are effective contraceptives.
(D) IUDs and Barrier method can be employed as an emergency contraceptives.
Which two of the above statements are correct?
1) A, C 2) A, B 3) B, C 4) C,D
138. Assertion: The possibility of a female becoming haemophilic is extremely rare.
Reason: Mother of such a female has to be at least carrier and the father should
be haemophilic (unviable in the later stage of life).
1) Assertion and reason both are true and the reason is correct explanation of
assertion.
2) Assertion and reason both are true but reason is not correct explanation of
assertion.
3) Assertion is true but reason is wrong.
4) Assertion and reason both are wrong.
139. What will be the cardiac output of a person if both ventricles of heart totally
pump 200 ml blood during one cardiac cycle and the rate of heart beat is
77/ minute?
1) 15400 ml/minute 2) 5040 ml/minute
3) 6000 ml/minute 4) 7700 ml/minute
I) VNTR (a) 1.4 million locations
II) SNPs (b) Vectors
III) BAC,YAC (c) Mini satellites
IV) ESTs (d) Identify all the genes that are expressed as RNA
1) I-a, II-b, III-c, IV-d 2) I-c, II-a, III-b, IV-d
3) I-a, II-c, III-b, IV-d 4) I-c, II-a, III-d, IV-b
141. Statement I: In human beings, insulin is synthesized as pro hormones.
Statement II: Pro insulin possess peptide chains in the order of A-B-C
sequence.
3) Both statement A and B are correct
4) Both statement A and B are incorrect
142. Which of the following hormones will be detected in a sample of blood taken
from hypophyseal portal vein?
1) GnRH, GH, TSH 2) GnRH, somatostatin.
3) GnRH, FSH, GH 4) FSH, prolactin, GnRH
143. Choose the incorrect statement about sickle-cell anaemia:
1) It is an autosomal recessive disease.
2) Individuals with genotype HbA HbS appear apparently unaffected.
3) The disease/defect is caused by substitution of valine by glutamic acid at 6th
position of beta chain.
4) The disease is controlled by a single pair of allele.

144. Choose the incorrect match w.r.t. blood corpuscles in a healthy male.
Cells Number Function
1) Thrombocytes 1.5 – 3.5 lakhs/mm 3 Blood clotting
2) Monocytes 6 – 8% of all Phagocytosis
leucocytes
3) Lymphocytes 20 – 25% of all WBCs Immune responses of the
body
4) Eosinophils 0.5 – 1% of all Release heparin, histamine
leucocytes and serotonin
145. Spermiogenesis is the process of formation of ‘A’ from ‘B’. Choose the option
that fills the blank correctly.
1) A – Spermatozoa, B – Spermatid.
2) A – Primary spermatocyte, B – Secondary spermatocyte.
3) A – Spermatogonia, B – Primary spermatocyte.
4) A – Secondary spermatocyte, B – Spermatid.
146. Statement I: AIDS is not a congenital disease.
Statement II: The transmission of HIV infection generally occurs from a
infected mother to her child.
147. Consider the following statements-
A. Catecholomines stimulate the breakdown of glycogen into glucose.
B. Glucocorticoids produces Anti-inflammatory reactions.
C. Erythropoietin stimulates RBC production whereas cortisol inhibit RBC
production.
D. Insulin results in hyperglycemia whereas Glucogon causes hypoglycemia.
The incorrect statements among the above are:
1) A and B 2) B and C 3) C and D 4) A and D
148. Which of the following represents the correct combination without any
exception?
Characteristics Class
1) Mouth terminal; moist skin without scales; two Amphibia
pairs of limbs; eyes with eye lids
2) Bony endoskeleton; gills with operculum; skin Osteichthyes
with placoid scales; internal fertilisation
3) Body covered by cornified skin; external ear Reptilla
openings absent; three –chambered heart;
internal fertilisation
4) Body covered with feathers; bony endoskeleton; Aves
oviparous; direct development
149. In frog, urinary bladder is located
1) Dorsal to rectum 2) Ventral to rectum
3) Ventral to stomach 4) Dorsal to stomach
150. Observe the below given diagrammatic representations of the operation of
natural selection
In the above A and B more individuals acquire

1) A – other than mean character value, B – mean character value
2) A – mean character value, B – peripheral character value
3) A – other than mean character value, B – peripheral character value
4) A – mean character value, B – other than mean character value

151. α-1 antitrypsin is used to treat which disease
1) Phenylketonuria 2) Cystic fibrosis
3) Emphysema 4) Asthma
152. In which of the following interactions both partners are adversely affected?
1) Sea anemone and clown fish
2) Flamingoes and resident fishes in South American lakes
3) Fig tree and pollinator wasp 4) Epiphytic orchid on a mango branch
153. Verhulst – Pearl logistic growth is expressed as
KN
1) dN / dt  r 2) dN / dt  rN  
 K 
3) r  b  d 4) S  cA2
154. Below given figure shows a diagrammatic view of ribs and rib case, select the
correct identification of A, B, C and D
1) A – vertebral column, which attaches to sternum

2) B – False ribs, they do not attach to sternum
3) C – True ribs, they attach directly to sternum
4) D – Sternum, to which true ribs attach with the help of hyaline cartilage
correct statements:
A) Pyramids of energy can never be inverted, because when energy flows from a
particular trophic level to the next trophic level, some energy is always lost as
heat at each step
B) In all ecosystems, the pyramids of number and of biomass are upright
C) The pyramid of biomass of sea is generally inverted because the biomass of
fishes far exceeds that of phytoplankton
1) Only A 2) A and B only 3) A and C only 4) All A,B and c
156. Convergent evolution is explained by
1) Vertebrate hearts
2) Thorn and Tendrils of Bougainvillea and Cucurbita
3) Eye of octopus and Mammals 4) Vertebrate brains
157. Statement – I: Induced abortions are considered relatively safe during the first
trimester i.e., upto 12 weeks of pregnancy.
Statement – II: The Medical Termination of Pregnancy (Amendement) Act, 2017
was enacted by the government of India with the intension of reducing the
illegal abortions.
1) Both Statement I and Statement II are wrong
2) Both Statement I and Statement II are true
3) Statement I is correct, statement II is wrong
4) Statement I is wrong, Statement II is correct
158. Choose the correct set of statements related to human skeleton
a) Acromion of sternum articulates with clavicle.
b) Dicondylic skull articulates with atlas
c) True ribs articulate dorsally with sternum through hyaline cartilage
d) Pubic symphysis contains fibrous cartilage
e) Hyoid is a 'U' shaped bone at the base of buccal cavity
1) a, b, d 2) b, d, e 3) all except a 4) c, d, e
159. The process of breakdown of detritus by detritivores such as earthworms is
1) Catabolism 2) Leaching 3) Fragmentation 4) Mineralisation

160. The birth canal forms from
1) Cervical canal and vagina 2) Vagina and uterus
3) Uterus and cervical canal 4) Ampulla and uterus
161. A hormone secreted from hypothalamus is
1) TSH 2) ADH 3) ANF 4) FSH
162. Cichlid fish is native of
1) Amazon river 2) Central Asian lakes
3) East African lakes 4) Australia
163. According to the IUCN (2004), the total number of plant and animal species
described so far is
1) Slightly more than 1.5 million 2) 1.5 million
3) 2.5 million 4) 3.5 million
164. A biologist studied the population of rats in a barn. He found that the average
natality was 250, average mortality 240, immigration 20 and emigration 30. The
net increase in population is
1) 05 2) Zero 3) 10 4) 15
165. Select the correct match from following
1) Amphibians - Lay thick shelled eggs
2) Coelacanth - First to invade land
3) Calotes - Evolved into first amphibians
4) Ichthyosaurs - Fish like reptile
166. How many of the organisms given below exhibit branchial respiration?
Snail, Shark, Whale, Catla, Saw Fish, Dolphin, Seal
1) 6 2) 7 3) 4 4) 5
167. Read the following statements and choose the option which represents them
correctly as true/false.
A. Snakes shed their scales as skin cast
B. Ostrich and vulture are flightless birds
C. Eyes have eyelids in amphibians
Select the correct option
1) T T F 2) T F T 3) F F T 4) T F F
168. Identify the vector-borne viral diseases among the following and choose the
correct option
A) Dengue B) Plague C) Filariasis D) Chikungunya
E) Diphtheria
1) A, D 2) A, B, D 3) A, C, D 4) A, D, E
169. Arrange the sequence of different hormones for their role during gametogenesis.
A) Gonadotropin (LH) stimulates synthesis and secretion of Androgen
B) Increase of GnRH
C) Androgen stimulates spermatogenesis
D) Gonadotropin (FSH) helps in the process of spermiogenesis
E) Gonadotropins from anterior pituitary gland.
Choose the correct answer from the options given below:
1) (E), (A), (D), (B), (C) 2) (C), (A), (D), (E), (B)
3) (B), (E), (A), (C), (D) 4) (D), (B), (A), (C), (E)
170. The ratio of residual volume to functional residual capacity in a healthy human
is about
1) 1:1 2) 1:5 3) 1:3 4) 1:2
171. Hypothyroidism during pregnancy causes defective development and
maturation of the growing baby leading to
a. Cretinism b. Stunted growth
c. Mental retardation d. Low I.Q
e. Abnormal skin f. Deaf mutism
1) a, b, d & f only 2) b, c, d & e only
3) a, c, d, e & f only 4) a, b, c, d, e and f
172. Statement – I: Male and female grasshopper have same number of autosomes.
Statement – II: The type of sex determination in grasshopper is XO type.
1. Both the statements – I and II are correct
2. Both the statements – I and II are incorrect
3. Statement – I is only correct
4. Statement – I is incorrect whereas statement – II is correct.

173. Assertion (A): The problem of predation is more severe for plants.
Reason (R): Unlike animals, plants cannot run away from their predators.
In the light of above statements, choose the correct option.
1. Both A and R are correct. R is the correct explanation to A
2. Both A and R are correct. R is the not correct explanation to A
3. A is correct but R is incorrect 4. Both A and R are false
174. The centre primarily responsible for the regulation of respiratory activity is
_______ and is located in_______.
1. Rhythm centre, Medulla oblongata
2. Pneumotaxic centre, Pons.
3. Respiratory rhythm centre, Pons
4. Pneumotaxic centre, Medulla, hind brain.
175. Match the contents of Column – I with Column – II
A. P-Wave I. Depolarization of ventricles
B. QRS – complex II. End of systole
C. T- Wave III. Depolarization of Atria
D. End of T- wave IV. Repolarization of ventricles
1. A – IV, B – I, C – III, D – II 2. A – I, B – IV, C – III, D – II
3. A – IV, B – III, C – I, D – II 4. A – III, B – I, C – IV, D – II
176. Within a neuron, the Nissl bodies are observed in:
1. Dendrites and Cell body 2. Cell body and axon
3. Axon and Dendron 4. Dendrites, Axon and Cell body
177. Besides vasa recta, the U-shaped part of nephron ‘ P ’ plays a very significant
role in production of concentrated urine in case of mammals. Identify ‘ P ’ and
choose the correct option.
1) PCT 2) DCT 3) CD 4) Loop of Henle
178. A special method of early diagnosis of diseases like HIV is based on gene
amplification principle. Select the correct name of the method used in
amplification of genes
1) PCR 2) ELISA 3) Widal test 4) Autoradiography
179. Identify the given animal and select the correct option w.r.t it.
1) Shows convergent evolution with marsupial rat

2) It is placental mammal
3) Shows adaptive radiation with Darwin’s finches
4) It evolved from an ancestral stock but remained with
in Australian island continent.
180. Choose the incorrect match with respect to the taxa and its example.
1) Canidae – Dog 2) Solanum – Brinjal
3) Felidae – Tiger 4) Panthera – Cat
*******

: ANSWER KEY:
1 1 11 1 21 1 31 4 41 1
2 2 12 1 22 2 32 2 42 2
3 3 13 4 23 1 33 3 43 1
4 1 14 4 24 3 34 4 44 3
5 2 15 1 25 4 35 3 45 4
6 2 16 4 26 3 36 4
7 2 17 4 27 1 37 2
8 1 18 3 28 2 38 1
9 1 19 3 29 1 39 1
10 3 20 3 30 4 40 4
SUB:CHEMISTRY
46 1 56 1 66 3 76 1 86 3
47 3 57 4 67 4 77 2 87 4
48 1 58 4 68 1 78 3 88 1
49 4 59 1 69 4 79 2 89 2
50 2 60 1 70 3 80 1 90 3
51 2 61 1 71 2 81 1
52 4 62 4 72 1 82 4
53 2 63 4 73 2 83 4
54 4 64 1 74 2 84 1
55 4 65 3 75 1 85 1
SUB : BOTANY
91 3 101 1 111 2 121 3 131 1
92 4 102 1 112 2 122 1 132 2
93 2 103 3 113 4 123 4 133 2
94 1 104 4 114 4 124 2 134 3
95 3 105 4 115 4 125 3 135 2
96 2 106 2 116 4 126 3 136
97 3 107 4 117 2 127 1 137
98 2 108 2 118 4 128 2 138
99 1 109 4 119 4 129 3 139
100 3 110 1 120 4 130 4 140
136 1 146 2 156 3 166 3 176 1
137 1 147 3 157 2 167 2 177 4
138 1 148 4 158 2 168 1 178 1
139 4 149 2 159 3 169 3 179 4
140 2 150 4 160 1 170 4 180 4
141 1 151 3 161 2 171 4
142 2 152 2 162 3 172 1
143 3 153 2 163 1 173 1
144 4 154 4 164 2 174 1
145 1 155 3 165 4 175 4

XII- NEET GT - 10
answer sheet.

PHYSICS Mr.Ch.RAMESH
CHEMISTRY Mr.PHANI/Dr.RB
BOTANY Mr.RAMESH
ZOOLOGY Mrs.SUNDARI
PHYSICS
1. Two bodies of masses 3 kg and 4 kg are suspended at the ends of massless string
passing over a frictionless pulley. The acceleration of the system is ( g= 9.8 m/s2)
1) 4.9 m/s2 2) 2.45 m/s2 3) 1.4 m/s2 4) 9.5 m/s2
2. A given object takes n times as much time to slide down a 45o rough inclined as
it takes to slide down a perfectly smooth 45o incline. The coefficient of kinetic
friction between the object and the incline is given by
 1  1  1  1
1)  1  2  2) 3) 1  2  4)
 n  1 n 2
 n  1  n2
(A) Planck constant (I) h
p
(B) Stopping potential (II) E-Khigh
(C) Work-function (III) V0=Khigh/e
(D) De-Broglie wavelength (IV) E
.
v
.
(A) (B) (C) (D) (A) (B) (C) (D)

3) II IV III I 4) III I II IV
4. A ball rolls off the top of a staircase with a horizontal velocity u ms-1. If the steps
are h metre high and w metre wide the ball will hit the edge of the nth step if:
gw 2 2hu 2 2u 2 2hw2u 2
1) n  2) n  3) n  2 4) n 
2 hu 2 gw2 gw h g
5. The height y and the distance x along the horizontal plane of a projectile on a
certain planet (with no surrounding atmosphere) are given by y = (8t-5t2) metre
and x= 6t metre, where t is in seconds. The velocity of projection is:
1) 8 m/s 2) 6 m/s
3) 10 m/s 4) not obtained from the data
6. A particle is moving along a circular path of radius 6 m with a uniform speed of
8 ms-1. The average acceleration when the particle completes one half of the
revolution is
16 2 32 2 64 2
1) ms 2) ms 3) ms 4) None of these
3 3 3
7. The potential difference across a resistor is measured to be V =  8  0.5  V and the
current through it is measured to be I   2  0.2  A , then the value of the resistance
R is
1) 4 16.25% 2) 4  6.25% 3) 4 10% 4) 4  8%
8. A simple pendulum has length l and the mass of the bob is m. the bob is given a
charge q coulmb. The pendulum is suspended between the vertical plates of a
charged parallel plate capacitor. If E is the electric field strength between the
plates, the time period of the pendulum is given by
1] 2π 2] 2π 3] 2π 4] 2π
9. Charge q2 of mass m revolves around a stationary charge q1 in a circular orbit of

radius r. The orbital periodic time of q2 would be
/ / / /
1] 2] 3] 4]
10. An electric dipole with dipole moment 4 × 10 C − m is aligned at 30 with the
direction of a uniform electric field of magnitude 5 × 10 N/C. What is the
magnitude of the torque acting on the dipole?
1] 10-2 Nm 2] 10-3 Nm 3] 10-4 Nm 4] 10-5 Nm

11. A point charge +10μC is at a distance 5 cm directly above the centre of a square
of side 10 cm, as shown in figure. What is the magnitude of the electric flux
through the square?
1] 0 2] 1.8 × 3] 1.8 × 4] 1.8 ×

12. An object 1 cm tall is placed in front of a mirror at a distance of 4 cm. In order to
produce an upright image of 3 cm height, one needs a
1) convex mirror of radius of curvature 12 cm
2) concave mirror of radius of curvature 12 cm
3) concave mirror of radius of curvature 4 cm
4) plane mirror of height 12 cm
13. An object is placed at 20 cm from a convex mirror of focal length 10 cm. The
image formed by the mirror is
1) real and at 20 cm from the mirror 2) virtual and at 20 cm from the mirror
3) virtual and at (20/3) cm from the mirror
4) real and at (20/3) cm from the mirror
14. Assertion (A) : The conductivity of an intrinsic semiconductor depends on its
temperature.
Reason (R) : The conductivity of an intrinsic semiconductor is slightly higher
than that of a lightly doped p-type semiconductor.
π
15. If two waves represented by y = 4 sin ωt and y = 3 sin ωt + interfere at a point,
the amplitude of the resulting wave will be about
1) 7 2) 6 3) 5 4) 3.5
16. The magnetic induction at the centre of a solenoid is B. If the length of the
solenoid is reduced to half and the same wire is wound in two layers the new
magnetic induction is
1) B 2) 2B 3) B/2 4) 4B
17. Two long parallel wires are separated by a distance of 8 cm carry electric currents
of 3A and 5A. The distance of null point from the conductor carrying larger
current when currents are flowing in the same direction is.
1) 3cm 2) 5cm 3) 12cm 4) 20cm
18. A long straight vertical conductor carries a current of 8A in the upward direction.
What the magnitude of the resultant magnetic induction at a point in the
horizontal plane at a distance of 4 cm from the conductor towards South? (The
horizontal component of earth’s magnetic induction = 4 x 10-5 T)
1) 2√2 x10-5T 2) 4√2x10-5T 3) 4x10-5T 4) 2x10-5T
19. A wire of length ‘L’ meters carrying a current ‘i’ amperes is bent in the form of a
circle. The magnitude of its magnetic moment is
1) 2) 3) 4)
20. Given 50 F, 50 C and 50 K arrange them in increasing order of temperature
o o
1)50oF, 50oC & 50 K 2) 50 K, 50oC & 50oF

3) 50 K, 50 F & 50 C
o o 4) 50oC , 50oF & 50 K
21. When an ideal diatomic gas is heated at constant pressure, the fraction of heat
energy supplied which is used in doing work to maintain pressure constant is
1) 5/7 2) 7/2 3) 2/7 4) 2/5
22. For adiabatic expansion of a monatomic perfect gas the volume increases by
2.4%. What is the percentage deceases in pressure
1) 2.4% 2) 4.0 % 3) 4.8% 4) 7.1%

23. Two soap bubbles in vacuum of radius 3 cm and 4 cm coalesce to form a single
bubble under Isothermal conditions. Then the radius of the bigger bubble is
12
1) 7 cm 2) cm 3) 12 cm 4) 5 cm
7
24. A block of material has a density 1 and floats three fourth submerged in a liquid
of unknown density 2 is
3 3 5 4
1) 1 2) 1 3) 1 4) 1
4 5 6 3
25. What is the rms velocity of monoatomic gas molecules having pressure 1
kilopascal and density 4.8 kg/m3
1) 3.6 m/s 2) 8.9 m/s 3) zero 4) 25 m/s
26. Which of the following option is correct for an ideal capacitor connected to a
sinusoidal voltage source over a complete cycle?
1) Neither the average power nor the average current is zero
2) Average voltage is zero but the average power is non zero
3) Both the average power and average current is zero
4) Average power is zero, but the average current is non zero
27. The average intensity of electromagnetic wave is (where symbols have their usual
meanings)
1) ϵ E c 2) c 3) ϵ E c 4) Both (1) & (2)
28. Figure shows a circuit that contains four identical resistors with resistance R =
2.0  , two identical inductors with inductance L = 2.0 mH and an ideal battery
with emf E = 9 V. The current ‘i’ just after the switch ‘S’ is closed will be:
1) 2.25 A 2) 3.0 A 3) 3.37 A 4) 9 A

29. The band diagrams of three semiconductors are given in the figure. From left to
right they are respectively.
(C-conduction band, V- valency band, Ef – Fermi level)

1) n–intrinsic–p 2) p–intrinsic–n
3) intrinsic–p–n 4) intrinsic–n–p
30. A coil of inductance 2H having negligible resistance is connected to a source of
supply whose voltage is given by V = 3t volt. (where t is in second). If the voltage
is applied when t = 0, then the energy stored in the coil after 4s is______.
1) 144 J 2) 44 J 3) 100 J 4) 441 J
235
31. If one microgram of 92 U is completely destroyed in an atom bomb, how much
energy will be released?
1) 9 x 106J 2) 9 x 107J 3) 9 x 108J 4) 9 x 105J
32. Statement – I : In Young’s double slit experiment, at centre line of screen, a
bright fringe is obtained.
Statement – II : Path difference between two waves is given by S2P-S1P which is
zero at centre line.

33. Statement – I : The unit of average speed is same as that of velocity.
Statement – II : The average speed tells us in what direction an object is moving.
34. A copper wire and an aluminium wire have lengths in the ratio 3 : 2, diameters
in the ratio 2 : 3 and forces applied in the ratio 4 : 5. Find the ratio of the increase
in length of the two wires. (YCu = 1.1 x 1011 Nm- 2 YA1=0.70x1011 Nm- 2)
1) 110 : 189 2) 180 : 110 3) 189 : 110 4) 80 : 11
35. Two sound waves (expressed in CGS units) given by
2 2
y1  0.3sin  vt  x  and y2  0.4sin  vt  x    interfere. The resultant amplitude
 
at a place where phase difference is  / 2 will be
1
1) 0.7 cm 2) 0.1 cm 3) 0.5 cm 4) 7 cm
10
36. When a tuning fork A of unknown frequency is sounded with another tuning fork
B of frequency 256 Hz, then 3 beats per second are observed. After that A is
loaded with wax and sounded, then again 3 beats per second are observed. The
frequency of the tuning fork A is
1) 250 Hz 2) 253 Hz 3) 259 Hz 4) 262 Hz
37. A body is executing S.H.M. When its displacement from the mean position is 4
cm and 5 cm, the corresponding velocity of the body is 10 cm/sec and 8 cm/sec.
Then the time period of the body is
1) 2 sec 2)  / 2sec v 3)  sec 4) 3 / 2sec
 
38.   
An object has a displacement from position vector r1  2iˆ  3 ˆj m to r2  4iˆ  6 ˆj m

 
under a force F  3x 2iˆ  2 yjˆ N , then work done by the force is
1) 24 J 2) 33 J 3) 83 J 4) 45 J
39. Let the potential energy of a hydrogen atom in the ground state be zero. Then its
total energy in the first excited state will be
1) 10.2eV 2) 13.6eV 3) 23.8eV 4) 27.2eV
40. A body of mass m moving at a constant velocity v hit another body of the same
mass moving with a velocity v/2 but in the opposite direction and sticks to it.
The common velocity after collision is
1) v 2) v/4 3) 2v 4) v/2
41. Assertion (A) : As we go up the surface of the earth, we feel light weighed than
on the surface of the earth.
Reason (R) : The acceleration due to gravity decreases on going up above the
surface of the earth.
42. If radius of the 13 Al 27 nucleus is taken to be RAl , then the radius of 53 Te125 nucleus
is nearly.
1/3 1/3
 53  5 3  13 
1)   RAl 2) RAl 3) RAl 4)   RAl
 13  3 5  53 
7 4
43. If the binding energy per nucleon 3 Li and 2 He nuclei are 5.60 MeV and 7.06
MeV respectively, then in the reaction P  37 Li  2 42 He energy of proton must be
1) 28.24 MeV 2) 17.28 MeV 3) 1.46 MeV 4) 39.2 MeV

44. The current ‘I’ in the circuit given aside is
1) 0.1 A 2) 0.2 A 3) 1.0 A 4) 2. 0 A

45. The figure below shows current in a part of electric circuit. The current i is
1) 1.7 amp 2) 3.7 amp 3) 1.3 amp 4) 1 amp
CHEMISTRY
46. Assertion (A) : Actinoids show more range of oxidation states than lanthanoids
Reason (R) : 5f, 6d and 7s orbitals have comparable energies and 5f orbitals are
not much buried towards nucleus like 4f – orbitals.
47. Which of the following reagents/ reactions will convert 'A' to 'B'?
1) PCC oxidation
2) Ozonolysis
3) BH3 , H 2O2 / OH  followed by PCC oxidation
4) HBr, hydrolysis followed by oxidation by K 2Cr2O7
48. In acidic medium K2Cr2O7 oxidises KNO2 as KNO3. Number of moles of K2Cr2O7
required to oxidise 0.8 mole of KNO2 in acidic medium is _____
1) 0.133 2) 0.166 3) 0.266 4) 0.4
49. The conversion of propan-1-ol to n-butylamine involves the sequential addition
of reagents. The correct sequential order of reagents is
1) (i) SOCl2 (ii) KCN , (iii) Na  Hg  / C2 H 5OH
2) (i) HCl (ii) H 2 / Ni ,(iii) Na(Hg)/ C2 H5OH
3) (i) SOCl2 (ii) KCN, (iii) CH 3 NH 2
4) (i) HCl (ii) CH 3 NH 2
50. Which of the following is wrong?
1) HF has higher pKa than HCl
2) H2O has higher boiling point than H2S
3) F2 is more reactive non-metal due to its lower bond dissociation energy and
higher enthalpy of hydration of F 
4) NH3 is stronger reducing agent than BiH3
51. The IUPAC name of ethylidene chloride is :-
1) 1-Chloroethene 2) 1-Chloroethyne
3) 1,2-Dichloroethane 4) 1,1-Dichloroethane
52. The correct order of pH of 0.1M aqueous solutions of KCl(I) CuSO4(II) and
CH3COONa(III) is
1) I > II > III 2) I > III > II 3) III > I > II 4) II > I > III

53. Identify the incorrect statement
1) Noble gases being monoatomic have no interatomic forces except weak
dispersion forces and therefore, they are liquefied at very low temperatures
2) Bromine and iodine are only sparingly soluble in water but are insoluble in
organic solvents such as chloroform, carbon tetrachloride, carbon disulphide and
hydrocarbons to give coloured solutions
3) The large difference between the melting and boiling points of oxygen and
sulphur may be explained on the basis of their atomicity
4) In the case of nitrogen, all oxidation states from +1 to +4 tend to
disproportionate in acid solution.
54. Which of the following cannot change either position of equilibrium or magnitude
of equilibrium constant?
1) Temperature 2) Catalyst 3) Concentration 4) Pressure
55. Halogenation of which one of the following will yield m-substituted product with
respect to methyl group as a major product ?
1) 2) 3) 4)
56. 0.4 mole of a weak base (MOH) is treated with 0.6 mole of HCl present in a
solution where 18kJ of heat is evolved. Then the heat of dissociation of MOH is
______ KJ/mole. (Given: Enthalpy of neutralization of NaOH and HCl is -57.3KJ)
1) 12.3 2) -27.3 3) 27.3 4) 4.3
57. In which one of the following arrangements the given sequence is not strictly
according to the properties indicated against it
1) CO2  SiO2  SnO2  PbO2  increasing oxidising power
2) HF  HCl  HBr  HI  increasing acidic strength
3) H 2O  H 2 S  H 2 Se  H 2Te  increasing pKa value
4) NH 3  PH 3  AsH3  SbH 3  increasing reducing power
58. Which of the following is wrong for a zero order reaction?
[P] [R]
1) Rate
2) 3)
time time time
t1/2
4) Where A0 is initial concentration of reactant.
A0
59. Which one of the following is a water soluble vitamin, that is not excreted easily?
1) Vitamin B2 2) Vitamin B1 3) Vitamin B6 4) Vitamin B12
60. An organic compound contains 40% carbon, 6.66% hydrogen and the rest is
oxygen. Vapour density of the compound is 30. Then the molecular formula of
the compound is _____
1) CH3CHO 2) CH3CH2OH 3) HCOOH 4) HCOOCH3
61. The decreasing order of bond angles in BF3 , NH3 , PF3 and I 3 is :
1) I 3  BF3  NH 3  PF3 2) BF3  I 3  PF3  NH 3
3) BF3  NH 3  PF3  I 3 4) I 3  NH 3  PF3  BF3
62. Which of the following is the correct set of quantum numbers for the valence
electron or rubidium?
1) 4, 0, 0, +1/2 2) 6, 0, 0, +1/2 3) 5, 0, 0, +1/2 4) 5, 1, -1, +1/2

63. Arrange the following conformational isomers of n-butane in order of their
increasing potential energy :
1) II < III < IV < I 2) I < IV < III < II 3) II < IV < III < I 4) I < III < IV < II
64. Which of the following solution shows higher freezing point ?
[Consider complete dissociation of given electrolytes]
1) 0.6 molal aq. NaCl 2) 0.5 molal aq.Al2(SO4)3
3) 1.5 molalr aq.urea 4) 0.4 molal aq.AlCl3
65. Which of the following alkyl halides is least reactive towards S N 1 reaction ?
1) CH 2  CH  CH 2  Cl 2) CH3  CH 2  Cl
Cl
3) 4) |
CH 3  CH  CH 3
66. Considering all NH3 molecules act as ligands, which of the following octahedral
complex shows higher molar conductivity? (Assume equimolar solutions)
1) CoCl3.6NH3 2) CoCl3.5NH3 3) CoCl3.4NH3 4) CoCl3.3NH3
67. Anisole on cleavage with HI gives :
1) 2)
3) 4)
68. The pH of saturated solution of M(OH)2 is 12.301. Then the Ksp of M(OH)2 is _____
1) 3.2  105 2) 4  106 3) 1.6 105 4) 2  106
69. Arrange the following carbocations in decreasing order of stability.
1) B > A > C 2) A > B > C 3) C > B > A 4) C > A > B

70. Against a constant external pressure of 3 atm, an ideal gas expanded from 10 lit
to 15 lit volume. During this process system absorbed 900J energy from
surroundings. Then the change in internal energy of the system is ______J.
1) 619.5 2) -619.5 3) 2419.5 4) -2419.5
3
71. The pair, in which ions are isoelectronic with Al is:

1) Br and Be2 2) Cl  and Li  3) S 2 and K  4) O 2  and Mg 2
72. In which of the following complexes, central metal ion/atom undergoes SP3
hybridisation but resulting in diamagnetic complex?
1)  NiCl4  4)  PtCl4 
2
3)  Ni  CO  4 
2
2)  Ni  CN  4 
2

73. The intermediate X, in the given reaction is
1) 2) 3) 4)
74. The standard emf of hydrogen oxygen fuel cell is 1.23V. The standard heat of
combustion of hydrogen is -286KJ/mol. Then the efficiency of the cell is _____
1) 83% 2) 78% 3) 72% 4) 90%
75. Match List-I with List-II
List I List-II
A. [ PtCl4 ]2
(i) sp3d
B. BrF5 (ii) d 2 sp3
C. PCl5 (iii) dsp 2
D. [Co  NH 3 6 ]3 (iv) sp3d 2
1) A-ii, B-iv, C-i, D-iii 2) A-iii, B-iv, C-i, D-ii
3) A-iii, B-i, C-iv, D-ii 4) A-ii, B-i, C-iv, D-iii
76. The correct matching for the following is
[Specific property] [Respective element]
(A) d-block metal with highest (P) Eu
melting point
(B) Lanthanoid with the (Q) Ce
highest melting point
(C) Lanthanoid with least –ve (R) W
0
EM 3 / M value
(D) Lanthanoid with the (S) Sm
.
highest atomic radius
.
(A) (B) (C) (D) (A) (B) (C) (D)

1) R S P P 2) R S P Q
3) R S Q P 4) R P S Q
77. Which of the following alkane cannot be made in good yield by Wurtz reaction ?
1) 2,3-Dimethylbutane 2) n-Heptane
3) n-Butane 4) n-Hexane
78. Which of the following electronic transition (n2→n1) of H-atom results in Balmer
series with highest possible wavelength?
1) 2 → 1 2) 8 → 2 3) 15 → 2 4) 3 → 2
79. Identify the incorrect match. Name IUPAC official name
A. Unnilunium i. Mendelevium
B. Unniltrium ii. Lawrencium
C. Unnilhexium iii. Seaborgium
D. Unununnium iv. Darmstadtium
1) A - i 2) B - ii 3) C - iii 4) D – iv
80. The molality of given aqueous solution of urea is 1.2m. Its boiling point will be
_____K. (Given : B.P. of pure water = 373.15K]
1) 373.77 2) 373.62 3)373.52 4) 373.88
81. Arrange the following in the decreasing order of their covalent character:
(A) LiCl (B) NaCl (c) KCl (d) CsCl
Choose the most appropriate answer from the options given below
1) (A)>(C)>(B)>(D) 2) (B)>(A)>(C)>(D) 3) (A)>(B)>(C)>(D) 4) (A)>(B)>(D)>(C)

82. If the octahedral complexes of Co are given is follows,
3+
[Co(NH3)X]3+; [Co(en)Y]3+ and [Co(EDTA)Z]- then X, Y and Z are respectively.

1) 6, 6, 6 2) 6, 6, 1 3) 6, 2, 1 4) 6, 3, 1
83. Assertion : in 13th group elements the relative stability of +1 oxidation state
progressively increases for heavier elements: Al  Ga  ln  TI .
Reason: Down the group, due to poor shielding effect of intervening d and f
orbitals, the increased effective nuclear charge holds ns electrons tightly
(responsible for inert pair effect) and thereby, restricting their participation in
bonding.
1) Both Assertion and reason are true and reason is the correct explanation of
assertion .
2) Both Assertion and reason are true but reason is not the correct explanation
of assertion .
3) Assertion is true, but reason is false.
4) Assertion is false, but reason is true.
84. The weight of Mohr’s salt [MW = 392g/mol] present in a solution that can be
oxidised by 3.16g of KMnO4[MW =158g/mol] in acidic medium is _____
1) 3.92 g 2) 7.84 g 3)39.2 g 4) 19.6 g
85. Consider the following reaction sequence
CH 3  C  CH 
HgSO4
dil . H 2 SO4
 X 
tautomerism
 Z 
( i ) CH 3MgBr
( ii ) H O 

Y
3
The number of (C – H)  -bonds in ‘Y’ is

1) 10 2) 12 3) 11 4) 9
SO2Cl2  g  
 SO2  g   Cl2  g 
Following data is recorded experimentally.
Expt. Time in sec Total pressure in atm
1 0 0.5
2 100 0.6
Half life of the rection is _________ min.
1) 5.17 2) 6.2 3) 3.1 4) 4.68
87. CH 3  CH 2Cl  alcoholic KOH
 A  B 
Br2 Zn

C
1) Acetylene 2) Ethane 3) Ethene 4) Methane
1) N > P > As > Sb > Bi → IP1 2) O > S > Se > Te > Po →Electronegativity
3) Cl > Br > F > I → -ve electron gain enthalpy
4) Ne < Ar < Kr < Xe < Rn → M.P.
89. Ethanoic acid can’t be obtained by which of the following reaction?
(i) C2 H 5Cl  ( i ) KCN
( iii ) H O  / 

3
(ii) CH 3Cl  ( i ) AgCN

( ii ) H3O  / 

(iii) CH 3CH  CH 2 
KMnO / H
heat

(iv) CH 3 Br ( i ) Mg
( ii ) CO2

( iii ) H 3O 
1) (iii) and (iv) 2) (i) and (ii) 3) (ii) and (iii) 4) (i) and (iv)
90. To a given simple salt, conc. H2SO4 is added. Violet vapours are evolved. These
violet vapours produced blue colour with starch solution. Then the salt may
contain.
1) Cl  2) CH 3COO  3) Br  4) I 
BIOLOGY
91. Terminalisation of chiasmata occur during
1) Pachytene 2) Leptotene 3) Diakinesis 4) Zygotene
92. Assimilatory power required to fix one molecule of CO2 in Calvin cycle is
1) 1 ATP + 1 NADPH + H+ 2) 2 ATP + 3 NADPH + H+
3) 2 ATP + 1 NADPH + H+ 4) 3 ATP + 2 NADPH + H+
93. Regulatory gene in lac operon is
1) z- gene 2) y- gene 3) i-gene 4) a- gene

94. In a secondary growth of dicot root, vascular cambium develops from
1) Partly from cells of endodermis and partly from cells of conjunctive tissue
2) By dedifferentiation of cells of pericycle only
3) By dedifferentiation of cells of endodermis only
4) Partly from cells of pericycle and partly from cells of conjunctive tissue
(A) COOH (I) Cystine
|
H  C  NH 2
|
CH 2  OH
(B) COOH (II) Glycine
|
H  C  NH 2
|
CH 3
(C) COOH (III) Alanine
|
H  C  NH 2
|
H
(D) (IV) Serine
(A) (B) (C) (D) (A) (B) (C) (D)

1) IV III II I 2) I II III IV
3) II III I IV 4) III IV II I
96. Match column I and column II with respect to transcription and post
transcriptional processing of mRNA
(A) Capping (I) Binding of RNA polymerase to promoter
(B) Tailing (II) Removal of introns and joining of exons
(C) Splicing (III) Addition of methyl guanosine triphosphate
at 5' end of hnRNA
(D) Initiation (IV) Addition of adenylate residues to the 3' end
.
of hnRNA
.
(A) (B) (C) (D) (A) (B) (C) (D)

1) III IV I II 2) IV III II I
3) III I IV II 4) III IV II I
(Plant) (Character)
(A) Chlamydomonas (I) Monoecious sporophophyte
(B) Pinus (II) Heterosporous pteridophyte
(C) Selaginella (III) Zoospores
(D)
.
Sphagnum (IV) Monoecious gametophyte
.
(A) (B) (C) (D) (A) (B) (C) (D)

1) I II III IV 2) IV III I II
3) III I II IV 4) IV III II I
98. Statement – I : DNA polymerases catalyse polymerisation only in one direction,
that is 5'  3'
Statement – II : During replication of DNA, Okazaki fragments are formed on the
leading strand
1) Both statement I and statements II are correct
2) Both Statement I and statement II are incorrect
4) Statement I is incorrect but statements II is correct

99. Number of ATPs liberated in one turn of TCA cycle by substrate level
phosphorylation reaction
1) Two 2) Three 3) One 4) Four
100. Assertion (A): When a restriction endonuclease enzyme made a staggered cut in
DNA, overhanging stretches or sticky ends are formed.
Reason (R) : Some restriction enzymes cut the strand of DNA a little away from
the centre of palindromic site
1) Both A and R are correct and R is the correct explanation of A
2) Both A and R are correct but R is not the correct explanation of A
3) A is correct but R is not correct
4) A is no correct but R is correct
101. In general the egg apparatus of embryo sac in angiosperm consists of
1) One egg cell, two synergids, three antipodal cells, two polar nuclei
2) One egg cell, two synergids, three polar nuclei
3) One egg cell, two synergids
4) One egg cell, two synergids, two antipodal cells
102. Match List – I with List- II :
List - I List – II
a) Imbricate i) Calotropis
b) Valvate ii) Cassia
c) Vexillary iii) Cotton
d) Twisted iv) Bean
Choose the correct answer from the options given below
1) a-ii, b-i, c-iii, d-iv 2) a-ii, b-i, c-iv, d-iii
3) a-ii, b-iv, c-iii, d-i 4) a-i, b-iii, c-iv, d-ii
103. Bacillus thuringiensis is a species of bacteria used to control
1) Aphids 2) Mosquitoes 3) Butterfly caterpiller 4) Fungal pathogen
(I) A(9)+1 (A) Lilium
(II) A2+4 (B) Pea
(III) G 2 (C) Radish
(IV) Lodicules (D) Disc floret
(V) G 2 (E) Wheat
(F) Chinarose
1) C D E A B 2) D E C B F
3) B C F E D 4) B C A E D
105. Two carbon compound formed in photorespiration process in C3 plant

1) Phosphoglyceric acid 2) Phosphoglycolate
3) Oxalo acetic acid 4) Pyruvic acid
106. In animal cells the duplicated centrioles move towards opposite poles in
1) Prophase 2) Metaphase 3) Anaphase 4) Telophase
a) Polynucleotide phosphorylase i) S. Ochoa
b) Adopter molecule ii) tRNA
c) Code is a combination of bases iii) G. Gamow (Triplet codon)
d) Cell free system for protein synthesis iv) M. Nirenberg
1) a-i, b-ii, c-iii, d-iv 2) a-ii, b-iv, c-i, d-iii
3) a-ii, b-i, c-iv, d-iii 4) a-i, b-ii, c-iv, d-iii
108. Positional information of amino acids in a polypeptide chain is described as
1) Primary structure 2) Secondary structure
3) Tertiary structure 4) Quaternary structure

109. Read the following statements and identify the characters related to the alga
shown in the diagram.
a) They posses chlorophyll a, c carotenoids and xanthophylls.

b) The vegetative cells have a cellulosic wall usually covered on the outside by a
gelatinous coating of algin
c) The plant body is usually attached to the substratum by a holdfast and has
stipe and leaf like frond
d) They are usually grass green due to the dominance of pigments chlorophyll a
and b Choose the correct answer from the options given below
1) a and b only 2) a, b and c only 3) a, c and d only 4) d only
110. Identify the correct statements regarding chemiosmotic hypothesis
a) Cytochrome b6/f acts as proton pump
b) CF0 forms a transmembrane channel that carries out facilitated diffusion of
protons across the membrane
c) Conformational change in the CF1 particle of the ATP synthase leads to ATP
formation
d) Energy is not used to pump protons across a membrane, to create a gradient
or a high concentration of protons with in the thylakoid lumen.
e) ATP synthesis occurs due to breakdown of proton concentration gradient
established between lumen and stroma.
1) a, b, d and e 2) a, b and d 3) b, c and d 4) a, b, c and e
111. What is the percentage of recombinants in the F2 generation of dihybrid cross?
1) 18.25 2) 37.5 3) 12.5 4) 6.25
112. Statement - I : Amino acids have a property of ionizable nature of -NH2 and -
COOH groups hence have different structures at different pH.
Statement – II : Amino acids valine and glycine are acidic amino acids
1) Both statement I and statement II are correct
2) Both statement I and statement II are incorrect
113. Assertion (A) : Statins produced by Monascus purpureus have been
commercialised as blood cholesterol lowering agents
Reason (R) : Statins competitively inhibit the enzymes responsible for synthesis
of cholesterol
3) A is correct but R is not correct 4) A is not Correct but R is correct
114. The so called red tide is due to the characteristic red colour imparted by
dinoflagellates belonging to genus
1) Aspergillus 2) Gonyaulax 3) Gymnodynium 4) Agaricus
(A) Puccinia (I) Basidiomycetes
(B) Colletorichum (II) Deuteromycetes
(C) Albugo (III) Phycomycetes
(D)
.
Neurospora (IV) Ascomycetes
.
(A) (B) (C) (D) (A) (B) (C) (D)

1) II I III IV 2) III II I IV
3) I II III IV 4) IV II III I

116. A phytohormone that was first isolated from human urine is
1) Cytokinin 2) Auxin 3) Gibberellic acid 4) Abscisic acid
117. Statement A : Bt toxin is produced by Bacillus thuringiensis bacteria during
particular phase of their growth.
Statement B : Protoxins are converted into an active form of toxin due to alkaline
pH of gut of insect larvae which solubilise the crystals
1) Both statement A and statement B are correct
2) Statement A is correct but statement B is incorrect
3) Both statement A and statement B are incorrect
4) Statement A is incorrect but statement B is correct
118. Select the incorrect statement about diatoms
1) They are aquatic
2) Diatomaceous earth formed by the deposition of the cell walls of diatoms
3) They are microscopic
4) They are good indicators of water pollution as they live only in polluted water
119. Which of the following are non – motile mitospores ?
1) Ascospores 2) Zoospores 3) Conidia 4) Basidiospores
120. The correct order of embryogeny (embryo development) in dicotyledonous plants
is
1) Zygote  Globular embryo Heart shaped embryo proembryo
2) proembryo  Globular embryo Heart shaped embryo  Zygote
3) Zygote proembryoHeart shaped embryo Globular embryo Mature
embryo
4) Zygote proembryo Globular embryo Heart shaped embryo  Mature
embryo
121. The length of the ds-DNA is 102A0, in which the percentage of Adenine is 15 find
the total number of H-bonds in that DNA?
1) 81 2) 102 3) 51 4) 93
122. What will be the recombination frequency of genes and A and B if number of
recombinants obtained are two and total offsprings are four?
1) 50 % 2) 25 % 3) 10 % 4) 75 %
123. The structural RNA which also catalyses the peptide bond formation in bacteria
is
1) snRNA 2) 23S rRNA 3) 28S rRNA 4) 18S rRNA
124. The codon AUG codes for Methionine. What would be the base sequence on anti-
codon loop of tRNA that would be aminoacylated with this amino acid?
1) 3’ A U G 5’ 2) 5’ U A C 3’ 3) 3’ G U A 5’ 4) 5’ C A U 3’
125. The stem of which plant has supporting roots coming out of the lower nodes?
1) Rhizophora 2) Sweet potato 3) Sugarcane 4) Turnip
126. Select the incorrect statement from the following :
1) Tendrils helps to the plant to climb and it develops from axillary buds
2) Arid region plant, like Euphorbia modify their leaves into flattened structures
having spines
3) Thorns protect from browsing animals
4) Underground stems of potato act as organs of perennation to tide over
unfavourable conditions for growth
127. Which meristem occurs in grasses and regenerates parts removed by the grazing
herbivores?
1) Apical meristem 2) Secondary meristem
3) Lateral meristem 4) Intercalary meristem
128. No organelles, like the ones in eukaryotes, are found in prokaryotic cell, except
1) Vacuoles 2) Glogi body 3) Ribosomes 4) Lysosomes
129. Select the incorrect statement for inclusion bodies
1) Not surrounded by any unit membrane 2) Contain enzymes within vesicles
3) Gas vacuole is a type of inclusion body 4) They lie free in cytoplasm
130. A small bristle like structure sprouting out of the cell and they are known to help
to attach bacteria to rocks in stream is
1) Pili 2) Cilia 3) Flagella 4) Fimbriae
131. During glycolysis one glucose molecule, how many molecules of ATP are
consumed and released respectively ?
1) 4 and 2 2) 2 and 3 3) 3 and 4 4) 2 and 4

132. Read the following statements :
a. Complex post fertilization changes
b. Cell wall is covered on the outside by a coating algin
c. Reproduce asexually by non-motile spores sexually by non-moitile gametes.
d. Contain pyrenoids in the chloroplast.
Select the pair of incorrect statements w.r.t membrane of Rhodophyceae.
1) a and c 2) b and c 3) b and d 4) a and b
133. Which of the following is not an example of moss?
1) Marchantia 2) Funaria 3) Polytrichum 4) Sphagnum
134. 20 Chromosomes and 30 pg of DNA is present in a meristematic cell. What will
be the number of chromosomes and amount of DNA present in this cell just after
G2 phase of cell cycle?
1) 40 and 30 pg 2) 10 and 60 pg 3) 30 and 80 pg 4) 20 and 60 pg
135. DNA, RNA and ribosomes can be observed in the following cell organelles.
a) ER b) Golgi c) Chloroplast d) Mitochondria
e) Lysosomes f) Vacuoles
1) a, b, c 2) c, d 3) e, f 4) d, e, f
136. Find the odd one (w.r.t. taxonomic categories)
1) Muscidae 2) Primata 3) Sapindales 4) Poales
137. The processes that are basic to taxanomy
1) Characterisation, Classification, Identification and Nomenclature
2) Characterisation, Identification, Classification and Nomenclature
3) Characterisation, Nomenclature, Identification and Classification
4) Characterisation, Classification, Nomenclature and Identification
138. Following organism is triploblastic, bilaterally symmetrical and marine, and
respires through gills
1) Echinus 2) Hirudinaria 3) Balanoglossus 4) Physalia
139. The given figure shows some characteristic features marked as chordates.
Identify the correct labeling A, B, C and D.
1) A-Notochord; B-Post-anal part; C-Gill slits; D-Nerve cord

2) A-Nerve cord; B-Notochord; C-Post-anal part; D-Gill slits
3) A-Notochord; B-Nerve cord; C-Gill slits; D-Post-anal part
4) A-Gill slits; B-Post-anal part; C-Nerve cord; D-Notochord
140. Assertion : Sponges have a water transport or canal system.
Reason : In canal system water enters through osculum into the spongocoel from
where it goes out through the ostia.
1) Assertion and Reason both are true and the reason is correct explanation of
Assertion
2) Assertion and Reason both are true but reason is not correct explanation of
Assertion
3) Assertion is true but Reason is wrong
4) Assertion and Reason both are wrong
141. Phallic gland in cockroach are related to
1) Male excretory system 2) Male reproductive system
3) Female excretory system 4) Female reproductive system
142. Which statement regarding anal cerci and anal style in cockroach is correct?
1) Anal ceri are absent but anal styles are present in male
2) Anal ceri are absent and anal styles are present in female
3) Anal styles are absent and anal cerci are present in male
4) Anal styles are absent and anal cerci are present in female
143. Which one of the following is not a characteristic feature of frog?
1) The skin is moist and slimy
2) Each of the fore limbs and hind limbs end with five digits
3) Hepatic portal and renal portal systems are present
4) Skin, buccal cavity and lungs are the respiratory organs

144. Statement-I : Inspiratory Reserve Volume (IRV) averages 1000 ml to 1100 ml
while expiratory Reserve Volume (ERV) averages 2500 to 3000 ml.
Statement-II : Total Lung Capacity (TLC) includes ERV, TV and IRV.
1) Both statements are correct
2) Statement I is correct & statement II is incorrect
3) Statement I is incorrect & II is correct
4) Both statements are incorrect
145. Assertion : Process of exchange of O2 from the atmosphere with CO2 produced
by the cells is called breathing.
Reason : Respiration includes breakdown of glucose.
1) Assertion and Reason both are true and the reason is correct explanation of
Assertion
2) Assertion and Reason both are true but reason is not correct explanation of
Assertion
3) Assertion is true but Reason is wrong
4) Assertion and Reason both are wrong
146. Which circulation provides nutrients and oxygen to cardiac muscle tissue?
1) Pulmonary circulation 2) Systemic circulation
3) Lymphatic circulation 4) Coronary circulation
147. Tunica externa is composed of
1) Endothelium 2) Connective tissue
3) Smooth muscles 4) Glycoproteins
148. Juxta-glomerular apparatus is formed by cellular modification in the
1) Afferent arteriole and DCT 2) Efferent arteriole and PCT
3) Afferent arteriole and PCT 4) Efferent arteriole and DCT
149. The given figure shows the longitudinal section of kidney with few structures
labeled as I, II, III & IV. Identify renal vein in the given figure.
1) I 2) II 3) III 4) IV
150. Concentration of sodium chloride ions is lowest
1) Near the cortex 2) Deep in medulla
3) In the interstitial fluid 4) In the middle of Henle’s loop
151. Which of the following is not the bone of cranium?
1) Occipital bone 2) Zygomatic bone 3) Ethmoid bone 4) Sphenoid bone
152. Which of the following statements about the mechanism of muscle contraction
are correct?
A. Acetylcholine is released when the neural signal reaches the motor end plate.
B. Muscle contraction is initiated with a signal send by CNS via sensory neuron.
C. During muscle contraction, isotropic bands get elongated.
D. Repeated contractions of the muscles can lead to lactic acid accumulation.
1) A and D 2) A and C 3) B and C 4) A, B and D
153. Which of the following terms is not correctly matched with its feature?
1) Efferent neurons – Carries signals from CNS to the effector
2) Axon terminal – Possess neurotransmitter containing vesicle
3) Limbic system – Along with the hypothalamus, it is involved in the regulation
of sexual behavior, expression of emotional reactions and motivation
4) Association areas – Present in cerebellum and responsible for functions like
intersensory associations, memory and communication

154. Statement-I : Sodium-potassium pump transport 2Na  outwords for 3K  into
the cell.
Statement-II : The electrical potential difference across the resting plasma
membrane is called action potential.
155. Which of the following is responsible for secretion of water and bicarbonate ions
from exocrine part of pancreas?
1) Gastrin 2) Cholecystokinin 3) Secretin 4) Duocrinin
156. Blood pressure is controlled by
1) Thymus 2) Pineal gland 3) Corpus luteum 4) Adrenal gland
157. Which of the given statement is false?
1) Androgen play a role in the process of spermatogenesis
2) Androgens act on the central neural system and influence the male sexual
behavior
3) Androgens stimulate high pitch of voice in males
4) Androgens shows anabolic effect
158. Seminal plasma in human males is rich in
1) Glucose and calcium 2) DNA and testosterone
3) Ribose and potassium 4) Fructose and calcium
159. The clitoris is
1) Represented by hymen
2) A male secondary sex organ
3) A tiny finger like structure that lies at the upper junction of the two labia
minora
4) A tiny finger like structure present below the urethral opening in female
160. Which of the following is not true?
1) In females oogenesis is initiated during the embryonic development stage
2) In females only mitotic divisions occur in foetal stage
3) By the time of birth a female child has primary oocytes
4) Oogonia are not added after birth
161. The diaphragm, cervical cap and vaults are
1) Disposable contraceptive devices 2) Reusable contraceptives
3) IUDs 4) Implants
162. Which of the following factor induces the lactational amenorrhea?
1) Increased level of estrogen 2) Decrased level of oxytocin
3) Increased level of prolactin 4) Increased level of progesterone
163. Which one of the following is an incorrect statement regarding mutations?
1) Deletion and insertion of base pairs cause frameshift mutations
2) Cancer cells commonly show chromosomal aberrations
3) UV and gamma rays are mutagens
4) Change in a single base pair of DNA does not cause mutation
164. The ratio between carrier, disease free & diseased individual on marriage between
two carriers of sickle cell anaemia will be
1) 0 : 2 : 1 2) 0 : 1 : 1 3) 1 : 2 : 1 4) 2 : 1 : 1
165. Statement-I : Phenylketonuria affected individual lacks an enzyme that converts
the amino acid phenylalanine into tyrosine.
Statement-II : Accumulation of urea in brain results in mental retardation.
166. Find an incorrect statement with respect to results of HGP.
1) Dystrophin gene, is the largest gene of human genome
2) Chromosome Y has minimum 231 genes
3) SNPs are identified at about 2.4 million locations
4) The functions are unknown for over 50% of discovered genes
167. In DNA fingerprinting, hybridised DNA fragments are detected by
1) Adding chilled ethanol 2) Adding agarose gel
3) Adding H2O2 4) Autoradiography

168. Animal husbandry and plant breeding programmes are the examples of
1) Reverse evolution 2) Artifical selection
3) Mutation 4) Natural selection
169. Which of the following factor does not affect Hardy-Weinberg’s equilibrium?
1) Gene migration 2) Natural selection
3) Genetic drift 4) Replication of genetic material
170. Giraffe’s neck and forelimbs get elongated during the course of evolution due to :
1) Inheritance of acquired character 2) Natural selection
3) Geographical isolation 4) Convergent evolution
171. The use of antihistamine, adrenalin and steroids quickly reduce the symptoms of
1) Fungal disease 2) Viral disease 3) Allergy 4) Helminthes disease
172. Statement-I : Humoral immune response is responsible for the graft rejection.
Statement-II : Colostrum has abundant IgM antibodies.
173. Somaclones are produced by
1) Micropropagation 2) Mutation
3) Polyploidy 4) Hybridisation
174. Match Column-I with Column-II and select the correct answer from the codes
given below.
Column-I Column-II
A) Biopiracy (i) Effort to fix the non-functional gene
B) Biopatent (ii) Gene silencing
C) Gene therapy (iii) Exploitation of biological materials
D) RNAi (iv) Right granted for biological entities
1) A-(iv), B-(ii), C-(i), D-(iii) 2) A-(ii), B-(iv), C-(i), D-(iii)
3) A-(iii), B-(iv), C-(i), D-(ii) 4) A-(iii), B-(iv), C-(ii), D-(i)
175. Which of the following is incorrect w.r.t. competition?
1) Resources need not be limiting for competition to occur
2) Competitive species may evolve mechanism that promote their co-existance
3) Connel’s field experiment is an example of competitive release
4) Only closely related species can show competition
176. Which of the following would necessarily decrease the density of a population in
a given habitat?
1) Natality > mortality 2) Immigration > emigration
3) Mortality and emigration 4) Natality and immigration
177. If 10 joules of energy is available at the producer level, then amount of energy
present at the level of secondary consumers is
1) 10 J 2) 1 J 3) 0.1 J 4) 0.01 J
178. Choose odd one with respect to trophic level
1) Zooplanktons 2) Cow 3) Grasshooper 4) Phytoplanktons
179. Which one of the following is not observed in biodiversity hotspots?
1) Lesser inter-specific competition 2) Species richness
3) Endemism 4) Accelrated species loss
180. Mark the correct matched pair.
1) Ex-situ conservation – seed banks 2) Earth summit – Johannesburg
3) In-situ conservation – Cryopreservation 4) Equador – Temperate forest
******

: ANSWER KEY :
1 3 11 4 21 3 31 2 41 1
2 1 12 2 22 2 32 1 42 2
3 1 13 3 23 4 33 3 43 2
4 2 14 3 24 4 34 3 44 1
5 3 15 2 25 4 35 3 45 1
6 3 16 2 26 3 36 3
7 1 17 2 27 4 37 3
8 4 18 2 28 1 38 3
9 4 19 2 29 1 39 3
10 3 20 3 30 1 40 2
SUB:CHEMISTRY
46 1 56 1 66 1 76 1 86 1
47 3 57 3 67 4 77 2 87 3
48 3 58 4 68 2 78 4 88 3
49 1 59 4 69 1 79 4 89 2
50 4 60 4 70 2 80 1 90 4
51 4 61 1 71 4 81 3
52 3 62 3 72 3 82 4
53 2 63 4 73 3 83 1
54 2 64 1 74 1 84 3
55 3 65 2 75 2 85 4
SUB : BOTANY
91 3 101 3 111 2 121 1 131 4
92 4 102 2 112 3 122 1 132 3
93 3 103 3 113 1 123 2 133 1
94 4 104 3 114 2 124 4 134 4
95 1 105 2 115 3 125 3 135 2
96 4 106 1 116 2 126 2
97 3 107 1 117 1 127 4
98 3 108 1 118 4 128 3
99 3 109 2 119 3 129 2
100 1 110 4 120 4 130 4
136 1 146 4 156 4 166 3 176 3
137 2 147 2 157 3 167 4 177 3
138 3 148 1 158 4 168 2 178 4
139 2 149 2 159 3 169 4 179 1
140 3 150 1 160 2 170 1 180 1
141 2 151 2 161 2 171 3
142 4 152 1 162 3 172 4
143 2 153 4 163 4 173 1
144 4 154 4 164 4 174 3
145 2 155 3 165 2 175 4

XII- NEET GT - 11
answer sheet.

PHYSICS Mr.BKR
Mr.SRINIVASARAO
CHEMISTRY
Mr.PURANACHANDRA RAO
BOTANY Mr.RAMANA
ZOOLOGY Mr.PRABHAKAR
PHYSICS
1. Statement I : A sphere of mass m moving with speed u undergoes a perfectly
elastic head on collision with another sphere of heavier mass M at rest ( M >> m
), then direction of velocity of sphere of mass m is reversed due to collision [ no
external force acts on system of two spheres]
Statement II : During a collision of spheres of unequal masses, the heavier mass
exerts more force on lighter mass in comparison to the force which lighter mass
exerts on heavier mass.
2. A puck of mass m = 50.0 g is attached to a taut cord passing through a small
hole in a frictionless, horizontal surface ( Fig.). The puck is initially orbiting with
speed vi = 1.50 m/s in a circle of radius ri = 0.30 m. The cord is then slowly
pulled from below, decreasing the radius of the circle to r = 0.10 m. The puck’s
speed at the small radius is
1) 2.25 m/s 2) 5.50 m/s 3) 4.50 m/s 4) 6.0 m/s

3. The hour hand of a clock is 6 cm long. The magnitude of the displacement of the
tip of hour hand between 1:00 pm to 9:00 pm is :
1) 6 cm 2) 6 3 cm 3) 4 cm 4) 3 3 cm
4. A chain of mass M and length L is placed on a rough table in such a way that its
one fourth part is hanging from the table. What should be the minimum value of
μ so that chain does not slip.
1 2 1 3
1) 2) 3) 4)
3 3 4 4
5. Force v/s position graph of a body is given find work done from x = 3m to x = 8m.
1) 10 J 2) 6 J 3) 16 J 4) 20 J
6. A silicon diode has a threshold voltage of 0.7 V. If an input voltage given by
2sin(t) is supplied to a half wave rectifier circuit using this diode, the rectified
output has a peak value of
1) 2 V 2) 1.4 V 3) 1.3 V 4) 0.7 V
7. A particle moves in a circle of radius 10 cm with constant speed and time period
 second. Find acceleration of the particle (m/s2).
1) 2 2) 4 3) 0.4 4) 
8. A wire of length l   6  0.06  cm and r   0.5  0.005  cm has m   0.3  0.003 gm
maximum percentage error in density is:-
1) 4 2) 2 3) 1 4) 6.8

9. A Vernier of a circular scale is divided in to 30 divisions, which coincides with 29
main scale divisions. If each main scale divisions is 1/ 2  , the least count of the
o
instrument is
1) 0.1 2) 1 3) 10 4) 30
10. A body is moving in x-y plane starting from origin whose velocity is given as

v  aiˆ  bxjˆ . The equation of trajectory of body is :
bx3 bx 2 bx 2bx 2
1) y  2) y  3) y  4) y 
2a 2a 2a a
11. The position – time graphs for two cars A and B moving on same track is shown
in figure. The magnitude of their relative velocity is :-
1) 0 2) 5 m/s 3) 3 m/s 4) 3.5 m/s

  
12. A force F  2 iˆ  3 kˆ acts on a particle at r  0.5 ˆj  2 kˆ . The torque  acting on the
particle relative to a point with co-ordinates  2.0 m,0,  3.0 m  is
 
1) 3.0 iˆ  4.5 ˆj  kˆ N  m  
2) 3 iˆ  6 ˆj  kˆ N  m
3)  20 iˆ  4.0 ˆj  kˆ  N  m 4)  1.5 iˆ  4.0 ˆj  kˆ  N  m
13. A particle moves on a straight line with a uniform velocity. The angular
momentum of the particle is :
(i) always zero
(ii) zero about a point on the straight line
(iii) zero about a point away from the straight line
(iv) constant always about a given point not on the line
1) (i,ii) 2) (ii,iii) 3) (i,iv) 4) (ii,iv)
14. Two rods each having length l and mass m joined together at point B as shown
in figure. Then find out moment of inertia about axis passing through B and
perpendicular to the plane of page as shown in figure.
ml 2 ml 2 ml 2 2ml 2
1) 17 2) 3) 4)
12 6 12 3
15. A small spherical solid ball is dropped in a viscous liquid. Its motion in the liquid
is best described in the figure drawn by :-
1) curve A 2) curve B 3) curve C 4) curve D

16. If the masses of all molecules of a gas are halved for given volume and their speeds
doubled, then the ratio of initial and final pressures would be:
1) 2 : 1 2) 1 : 2 3) 4 : 1 4) 1 : 4

17. An anisotropic material has coefficients of linear thermal expansion 1 ,  2 and  3
along x,y and z-axis respectively. Coefficient of cubical expansion of its material
will be equal to :
  2  3
1) 1   2   3 2) 1  2 2  3 3 3) 31  2 2   3 4) 1
3
18. Solar radiation emitted by the sun resembles that emitted by a black body at a
temperature of 6000 K. Maximum intensity is emitted at a wavelength of about
o
4800 A . If the sun was cooled down from 6000 K to 3000 K, then the peak
intensity would occur at a wavelength of:
o o o o
1) 4800 A 2) 9600 A 3) 2400 A 4) 19200 A
19. Find the amount of work done to increase the temperature of one mole of ideal
gas by 30oC, if it if expanding under the condition V  T 2 / 3 ( R = 8.31 J/mol-K)
1) 16.62 J 2) 166.2 J 3) 1662 J 4) 1.662 J
 
20. The equation of motion of a particle started at t = 0 is given by x  5sin  20t  
 3
where x is in centimeter and t in second. When does the particle comes to rest?
   
1) sec 2) sec 3) sec 4) sec
40 120 30 10
21. A steel wire 0.72 m long has a mass of 5 x 10-3 kg. If the wire is under tension of
60 N, then the speed of transverse waves on the wire will be
1) 85 m/s 2) 83 m/s 3) 93 m/s 4) 100 m/s
22. A person brings a mass of 1 kg from infinity to a point A. Initially the mass was
at rest but it moves at a speed of 2 m/s as it reaches A. The work done by the
person on the mass is – 3 J. The potential at A is –
1) – 5 J/kg 2) – 3 J/kg 3) – 2 J/kg 4) – 6 J/kg
o
23. When 4 g of water at 80 C is added to 20 g of copper at 20oC the final temperature
of mixture becomes 60oC. If specific heat capacity of water is 1 cal/goC, then
specific heat capacity of copper ( in cal/goC) would be:
1) 0.3 2) 0.05 3) 0.4 4) 0.1
24. Four moles of hydrogen, two moles of helium and one mole of water vapour form
an ideal gas mixture. What is the molar specific heat at constant pressure of
mixtutre?
16 7R 23R
1) R 2) 3) R 4)
7 16 7
25. Assertion (A) : In series L – C – R circuit, voltage will lead the current function
for frequency greater than the resonance frequency.
Reason (R) : At resonance frequency, phase difference between current function
and voltage function is zero.
26. An electromagnetic wave of frequency 3 MHz passes from vacuum into a dielectric
medium with relative permittivity  r  4.0 and relative permeability r  1 then
1) Wavelength is doubled and frequency remains same.
2) Wavelength is doubled and frequency becomes half
3) Wave length is halved and frequency remains unchanged
4) Wavelength and frequency both remain unchanged.

27.  
The electric field intensity at all the points in space is given by E  3iˆ  ˆj V / m .
The nature of equipotential lines in x – y plane is given by:

28. A bulb of 40 W, 220 V is connected in parallel with another bulb of 100 W, 220 V
and then connected to a source of 440 V. The result will be :
1) Both bulbs will get fused 2) Bulb of 40 watt will get fused
3) Bulb of 100 watt will get fused 4) None of the bulbs will get fused
29. The Galvanometer G reads zero. If the battery A has negligible internal resistance
the value of resistance ‘X’ will be :-
1) 200 Ω 2) 50 Ω 3) 500 Ω 4) 100 Ω

30. If a bar magnet is dropped vertically into a, long copper tube then its final
acceleration will be :
1) a = g 2) a > g 3) a < g 4) a = 0
31. In which of the following cases magnetic field vector at the centre C is found to
be same.
1) a and b 2) a and c 3) b and c 4) a,c and d

32. A current carrying closed loop is placed in uniform magnetic field working
perpendicular to the plane of the loop. If force on the side AB is 10 N then force
on the side BC is nearly
1) 20 N 2) 14 N 3) 10 N 4) 5 N
33. In a hydrogen atom, an electron of mass m and charge e revolves in an orbit of
radius r making n revolutions per second. If the mass of hydrogen nucleus is M,
the magnetic moment associates with the orbital motion of electron is
 ner 2 m  ner 2  ner 2 m
1) 2)  ner 2 3) 4)
M m m M
34. The intrinsic conductivity of germanium at 27 is 2.13 mhom and mobilities of
o -1
electrons and holes are 0.38 and 0.18 m2V-1s-1 respectively. The density of charge
carriers is
1) 2.37 x 1019 m-3 2) 3.28 x 1018 m-3
3) 7.83 x 1017 m-3 4) 8.47 x 1020 m-3

35. A transformer has a efficiency of 80%. It is connected to a power input of 5 kW
at 200V. If the secondary voltage is 250V, the primary and secondary currents
are respectively:
1) 25A, 20 A 2) 20 A, 16A 3) 25 A, 16A 4) 40 A, 25 A
36. A fish looking up through the water sees the outside would contained in a circular
4
horizon. If the refractive index of water is and the fish is 12 cm below the
3
surface, the radius of this circle in cm is
1) 36 5 2) 4 5 3) 36 7 4) 36 / 7
37. An object is placed at a distance of 40 cm in front of a concave mirror of focal
length 20 cm. The image produced is
1) real, inverted and smaller in size 2) real, inverted and of same size
3) real and erect 4) virtual and inverted
38. The power of a biconvex lens is 10 dioptre and the radius of curvature of each
surface is
10 cm. Then the refractive index of the material of the lens is
3 4 9 5
1) 2) 3) 4)
2 3 8 3
39. In young’s double – slit experiment, the intensity of light at a point on the screen
where the path difference  is I.  being the wavelength of light used. The

intensity at a point where the path difference is will be
4
I I
1) 2) 3) I 4) zero
4 2
40. When unpolarised light is incident on a plane glass plate at Brewster’s angle, then
which of the following statements is correct?
1) Reflected and refracted rays are completely polarized with their planes of
polarization parallel to each other.
2) Reflected and refracted rats are completely polarized with their planes of
polarization perpendicular to each other.
3) Reflected light is plane polarized but transmitted light is partially polarized.
4) Reflected light is partially polarized but refracted light is plane polarized.
41. The correct match between the entries in Column I(type of em wave) and Column
II (corresponding wave length of em wave) are
(A) Microwave (I) 100 m
(B) Gamma rays (II) 10-15 m
(C) A.M. radio waves (III) 10-10 m
(D) X – rays (IV) 10-3 m
. .
(A) (B) (C) (D) (A) (B) (C) (D)

1) II I IV III 2) IV II I III
3) III II I IV 4) I III IV II
42. The maximum kinetic energy of the electrons hitting a target so as to produce
o
X-ray of wavelength 1 A is
1) 1.24 keV 2) 12.4 keV 3) 124 keV 4) None of these
43. Electrons in a certain energy level n = n1 can emit 3 spectral lines. When they
are in another energy level, n = n2. They can emit 6 spectral lines. The orbital
speed of the electrons in the two orbits are in the ratio of
1) 4 : 3 2) 3 : 4 3) 2 : 1 4) 1 : 2
44. In the Rutherford experiment,   particles are scattered from a nucleus as
shown. Out of the four paths, which path is not possible?
1) D 2) B 3) C 4) A

7
45. The mass of a 3 Li nucleus is 0.042 u less than the sum of the masses of all its
nucleons. The binding energy per nucleon of 37 Li nucleus is nearly
( 1 amu c2 = 931.5 MeV )
1) 46 MeV 2) 5.6 MeV 3) 3.9 MeV 4) 23 MeV
CHEMISTRY
46. The electron in an excited hydrogen atom undergoes transition from higher orbit
to lower orbit of radius 211.6 pm. This transition is associated with
1) Lyman series 2) Balmer series 3) Paschen series 4) Brackett series
47. Which of the following is the correct order for atomic/ionic radii?
1) N  Be  B 2) Mg 2   Li   N 3 3) Na  Li  K 4) Fe 3  Fe 2  Fe 4 
48. KMnO4 oxidises S2O32  ion as SO42  ion in basic medium. The number of moles of
S2O32  oxidized by 1.6 mole of KMnO4 is
1) 0.3 2) 0.6 3) 1.2 4) 1.6
49. Which of the following is the correct order for bond angle?
1) SO3  CH 4  NH 3  H 2O 2) CH 4  NH 3  SO3  H 2O
3) NH 3  H 2O  SO3  CH 4 4) H 2O  SO3  CH 4  NH 3
50. No. of protons, electrons & neutrons in 1327
Al 3 ion
1) 13,10,10 2) 13,10,14 3) 14,10,13 4) 10,13,14
51. In Kjeldahl's method for estimation of nitrogen, CuSO4 acts as
1) hydrolysis agent 2) reducing agent 3) catalyt 4) oxidising agent
52. The specific conductance of salt of 0.01 M concentration is 1.06 x 10-4 mho.cm-1.
Molar conductance of same solution in mho.cm2.mol-1 is
1) 106.1 2) 10.61 3) 1.061 4) 1.061 x 10-4
53. Which of the following is steam volatile?
1) p-nitrophenol 2) o-nitrophenol 3) m-nitrophenol 4) all of these
54. Which of the following is not optically active ?
3 3  
1) Co  en 3  2) Cr  ox 3  3) cis  CoCl2  en 2  4) trans  CoCl2  en  2 
55. The species having bond order different from CO is :
1) N2 2) CN  3) NO  4) NO 
56. Choose the wrong statement
1) Degree of dissociation of an electrolyte increases with dilution
2) Electrical conductance of a metallic conductor decreases with increase in
temperature
3) Electrical conductance of a metallic conductor increases with increase in
temperature
4) Electrical conductance of an electrolytic conductor increases with increase in
temperature
57. Give the correct relation between the two given compound.
CH 3
CH 3
CH 3  C  CH 3 and
CH 3  CH  CH 2  CH 3
CH 3
1) functional isomers 2) metamers
3) chain isomers 4) position isomers
58. For a reaction 2A → 3B, if the rate of formation of B is x mol/L, the rate of
consumption of A is
3x 2x
1) x 2) 3) 4) 3x
2 3
59. Arrange the following carbanions in decreasing order of stability :
1) iv>ii>iii>i 2) i>ii>iii>iv 3) i>iii>ii>iv 4) ii>iv>iii>i

60. All of the following can undergo disproportionation except
1) MnO4 2) MnO42 3) Cu  4) Cl2
61. Number of chiral centers present in openchain form and cyclic form of glucose
respectively are
1) 4, 4 2) 5, 5 3) 4, 5 4) 5, 4
62. Which of the following pairs of compounds illustrate the law of multiple
proportions?
A) MgO, Na2O B) SnO, SnO2 C) H2O, H2O2 D) H2S, SO2
1) A & D 2) B & D 3) A & C 4) B & C
  2
Hg OAc , H O
63. B   
BH 3 / THF
CH 2   A
H 2O2 / O H NaBH 4 , O H
A, B respectively are :
1) CH2OH and 2) CH2OH both

OH
CH3
3) both 4) and CH2OH
OH OH
64. Which one of the following acts as only Lewis acid?

1) H2SO4 2) AlCl3 3) H2O 4) OH 
65. In the following reaction,
3H 3C  C  CH 
red hot iron tube
873 K
A
the number of sigma () bonds present in the product A, is _____
1) 18 2) 21 3) 9 4) 24
66. Choose incorrect statement from the following
1) K2MnO4 is green coloured
2) K2Cr2O7 is taken as primary standard in volumetric analysis
3) CrO is basic, Cr2O3 is amphoteric while CrO3 is acidic
4) K2CrO4 is orange coloured
67. The compound formed as a result of oxidation of ethyl benzene by KMnO4 is
1) benzoic acid 2) acetophenone 3) benzophenone 4) benzyl alcohol
68. Two particles ‘A’ and ‘B’ have their de Broglie wavelength ratio as 3 : 2
respectively. If the mass ratio of A to B is 2 : 3, then the ratio of the velocities of
A to B will be
1) 1 : 1 2) 9 : 4 3) 4 : 9 4) 1 : 3
69. The Wurtz-fittig reaction involves
1) one molecule of each aryl-halide and alkyl-halide
2) two molecules of aryl halides
3) two molecules of aralkyl-halides
4) one molecule of each of aryl-halide and phenol
70. Hydrolysis of ‘X’ is an example of disproportionation. ‘X’ is
1) XeF6 2) XeF2 3) XeF4 4) XeOF4
71. Find the number of possible products (only structural isomers) in the given
reaction.
1) 2 2) 5 3) 4 4) 3
72. Wrong match is
1) CuSO4 – Cationic hydrolysis 2) Na2B4O7 – Anionic hydrolysis
3) NaNO3 – No hydrolysis
4) NH4Cl – Both cationic and anionic hydrolysis

73. The increasing order of the pKa values of the following compounds is
1) C<B<A<D 2) B<C<A<D 3) B<C<D<A 4) D<A<C<B

74. At 0 C , ice and water are in equilibrium, H 2O s  ⇌ H 2Ol  , H  6 kJ mol 1 .
o
The
value of  S and  G for conversion of ice into liquid water at 0o C are
1) 2.19 JK 1 mol 1 and 0 2) 0.219 JK 1 mol 1 and 0
3) 21.9 JK 1 mol 1 and 0 4) 0.0219 JK 1 mol 1 and 0
75.
Find out structure of Y :

NHCOCH3 NHCOCH3 NHCOCH3 NO2
NO2
1) 2) 3) 4)
NO2
NO2
76. The freezing point of an aqueous solution of 0.1m Hg2Cl2 will be: ( If Hg2Cl2 is
80% ionized in the solution to Hg 22 and Cl  ) _______ oC.
1) 0.26 2) 2.6 3) 4.6 4) 0.484
77. Assertion (A): KCN reacts with methyl chloride to give methyl isocyanide.
Reason (R): CN  is an ambident nucleophile.
1) Both A and R are true and R is the correct explanation of A.
2) Both A and R are true but R is not the correct explanation of A.
3) A is true but R is false.
4) A is false but R is true.
78. Mole fraction of toluene in the vapour which is in equilibrium with a solution
containing benzene and toluene having 2 moles each is when vapour pressure of
pure benzene and toluene are 120 torr and 80 torr respectively
1) 0.5 2) 0.25 3) 0.4 4) 0.6
79. X  Y 
dil.NaOH 
   CH 3  C  C2 H 5   C  CH 3  CHO
X, Y can be
1) Butanone-2 and propanal 2) Propanone-2 and butanal
3) Butanone-2 and butanal 4) Propanone-2 and propanal
80. t99.9% of a first order reaction is 100 minutes. Rate constant of the reaction is
1) 0.693 minutes 2) 2.303 minutes 3) 0.0693 minutes 4) 23.03 minutes
81. The order of boiling points of alkanes, amines, alcohols and carboxylic acids of
comparable molar mass follows the order :
1) alkanes < amines < carboxylic acids < alcohols
2) alkanes < alcohols < amines < carboxylic acids
3) amines < alkanes < alcohols < carboxylic acids
4) alkanes < amines < alcohols < carboxylic acids
82. Identify correct statements : As the temperature increases
A) Rate of reaction increases
B) Number of activated molecules increases
C) Collision frequency increases
1) A only 2) A and C only 3) A, B and C 4) B only
83. The correct order of basic strength of CH3NH2(I), (CH3)2NH(II), (CH3)3N(III), NH3(IV)
in gaseous phase is :
1) I<II<III<IV 2) IV<I<II<III 3) IV<III<II<I 4) IV<III<I<II
84. Emf of the cell Al  s  / Al 10 M  || Ag 10 M  / Ag at 298 K is  Ecell
3 3  1 o
 2.46 V 
1) 2.46 V 2) 2.4 V 3) 2.52 V 4) 2.37 V

85. Assertion (A): Solubility of alcohols decreases with an increase in size of
alkyl/aryl groups.
Reason (R): Alcohols can form inter molecular hydrogen bonding with water.
1) Both A and R are true and R is the correct explanation of A.
2) Both A and R are true but R is not the correct explanation of A.
3) A is true but R is false.
4) A is false but R is true.
86. Polar molecule among the following is
1) XeO3 2) XeF2 3) XeF4 4) XeO4
87. Which of the following is a basic amino acid?
1) Serine 2) Alanine 3) Lysine 4) Tyrosine
88. Molar mass is maximum for
1) Phosphorus 2) Sulphur 3) Copper 4) Ozone
89. Which of the following order is INCORRECT against property indicated?
1) HCOOH > PhCOOH > CH3COOH – “Ka” value
2) CH3CHO > PhCHO > PhCOPh – rate of nucleophilic addition
3) CH3CH2CH2Cl > CH3CH(CH3)CH2CH2Cl > CH3CH2CH(CH3)CH2Cl – SN2 order
4) (CH3)3CCl < CH3CH(Cl)CH2CH3 < CH3CH2CH2CH2Cl – SN1 order
90. The energies of activation for forward and reverse reaction for A + B ⇄ 2 AB are
2 2
180 kJmol-1 and 200 kJ mol-1 respectively. The presence of catalyst lowers the
activation energy of both ( forward and reverse) reaction by 100 kJ mol-1. The
enthalpy change of the reaction ( A2 + B2 → 2AB) in the presence of catalyst will
be ( in kJ mol-1 )
1) 300 2)120 3) 280 4) – 20
BIOLOGY
91. Choose mis-match from the following:
(1) Cytokinins - Delay of leaf senescence (2) Gibberebllins - Promotes bolting
(3) Auxins - Helps to overcome apical dominance
(4) Ethylene - promotes root growth and root hair formation
92. Select the correct match:
(1) Bisexual flower — Maize (2) Actinomorphic flower — Pea
(3) Zygomorphic flower — Datura (4) Asymmetric flower — Canna
93. Both gametophyte and sporophytic generations are generally independent in the
plant group namely
(1)Bryophyta (2) Pteridophyta (3) Gymnosperms (4) Angiosperms
94. The genotype ratio for codominance is
(1) 1:2:1 (2) 1:1 (3) 3:1 (4) 2:1
95. Match the column
Column - I Column – II
A) Mendel i) Oat
B) Darwin ii) Garden pea
C) Priestley iii) Mint
D) F.W. Went iv) Canary grass
(1) A — ii, B — iv, C —iii, D —i (2) A — iv, B — iii, C —ii, D —i
(3) A — i, B — ii, C —iii, D — iv (4) A — iii, B — ii, C —i, D — iv
96. A gene whose expression helps to identify transformed cell is known as
(1) Vector (2) Plasmid (3) Structural gene (4) Selectable marker
97. Untranslated regions are present on mRNA at
1) Before AUG at 5' and after UAA at 3'
2) After AUG at 5' and before UAA at 3'
3) Before UAA at 5' and after AUG at 3'
4) Before AUG at 5' and before UAA at 3'

98. (i) Cell wall of dinoflagellates ¡s embedded with silica.
(ii) Chrysophytes (Diatoms) are found ¡n both fresh water and marine water
habitat.
(iii) In slime moulds fruiting bodies differentiate from plasmodium during
unfavourable conditions.
(iv) Fungi are cosmopolitan and prefer to grow in warm and humid conditions.
Select the option with combination of correct statements.
(1) i, ii, iii, iv (2) ii, iii, iv (3) iii & iv (4) i, ii & iii
99. Match the column
A) Transcription unit ¡) mRNA
B) Translation unit ii) rRNA
C) Adaptor molecule iii) tRNA
D) Ribozyme iv) DNA
(1) A-ii,B-iv,C-iii,D-i (2) A-iv, B-i, C-iii, D-ii
(3) A-ii,B-i,C-iii,D-iv (4) A-iii,B-i,C-iv,D-ii
100. Calvin cycle occurs in
(1) In C4 plants only (2) In C3 plants only
(3) In CAM plants only (4) In all photosynthetic plants
101. Among the following the strongest oxidant is
(1) P680+ (2) H2O (3) P700+ (4) P700
102. Identify the incorrect statement wrt glycolysis pathway?
(1) Four ATP molecules ae directly synthesized
(2) Two ATP molecules are utilized
(3) Acetyl Co.A is the end product.
(4) Two redox equivalents are removed from PGAL
103. S—G+S’ →S+S’—G.
Enzyme catalysing the above reaction belongs to the class namely
(1) Lyases (2) Hydrolases (3) Transferases (4) Ligases
104. If the total amount of adenine and thymine in a double-stranded DNA is 45%, the
amount of guanine in this DNA will be
(1) 22.5% (2) 27.5% (3) 45% (4) 55%
105. Which of the following enzyme tool is not necessary in construction of rDNA
molecule ?
(1) Restriction endonuclease (2) DNA ligase
(3) DNase (4) DNA polymerase
106. Match the column and select the correct option.
Column - I Column – Il
A) DNA ligase i) Molecular scissors
B) Restriction enzyme ii) Molecular glue
C) DNA Polymerase III iii) dsDNA
D) Vector iv) Synthesis of DNA
(1) A — ii, B — i, C —iv, D — iii (2) A — iv, B - iii, C —ii, D — i
(3) A — i, B — iv, C —iii, D — ii (4) A — iii, B — ii, C —i, D — iv
107. If there are 999 bases in an RNA that codes for a protein with 333 amino acids
and the base at position 901 is deleted .How many codons will be altered ?
(1) 11 (2) 33 (3) 333 (4) 1
108. BOD of waste water is reduced by
(1) Methanogens only (2) Aerobic bacteria
(3) Anerobic bacteria only (4) Green sulphur bacteria

Column - A Column – B
A) Primary CO2 acceptor of C3 cycle i) OAA
B) Primary CO2 acceptor of C4 cycle ii) 3-PGA
C) Primary CO2 fixation product of C3 cycle iii) PEP
D) Primary CO2 fixation product of C4 cycle iv) RuBP
(1)A—iv,B—iii,C—i,D—ii (2)A— iv,B — iii,C — ii,D — i
(3)A—iii,B—iv,C—i,D—ii (4)A— iii,B — iv,C — ii,D — i
110. Phloem of Pinus (Gymosperm) have
(1) Sieve cells and companion cells
(2) Sieve cells and Albuminous cells
(3) Sieve cells and Tracheids
(4) Sieve tube elements and Albuminous cells
111. Select incorrect combinantion
Organism Scientific name Commericial product
(1) Fungi Trichoderma Cyclosporin A
(2) Fungi Saccharomyces Ethanol
(3) Fungi Monascus purpureus Statins
(4) Bacteria Streptobacillus Strepto kinase
112. Origin of ascospores and basidiospores is :-

(1) Exogenous; exogenous respectively
(2) Endogenous; endogenous respectively
(3) Exogenous; endogenous respectively
(4) Endogenous; exogenous respectively
113. Choose the correct options with respect to given diagram :
(1) Paramoecium → Protozoans, presence of thousand of cilia

(2) Gonyaulax → Dinoflagellates, one longitudinal flagella
(3) Nostoc → Cynobacteria, can fix N2
(4) Euglena → Euglenoids, have two flagella, a short and a long one.
114. Select false statement :-
(1) The viruses are non-cellular organisms, which are characterised by having an
inert crystalline structure outside the living cell
(2) Mycoplasma are organism those completely lack a cell wall and can survive
without oxygen
(3) Bacteriophages are generally double stranded DNA viruses
(4) Plant virus are usually single stranded DNA viruses
115. Which of the following is not related to bark ?
(1) Wood (2) Secondary phloem (3) Phellem (4) Phelloderm
116. In meiosis I, a bivalent has :
(1) Four chromatids and four centromeres
(2) Two chromatids and one centromere
(3) Two chromatids and four centromere
(4) Four chromatids and two centromeres

117. Assertion (A) : Sister chromatids remain associated at their centromere in
anaphase-I
Reason (R) : Spindle fibres get attached to the kinetochores.
(1) Both (A) and (R) are correct but (R) is not the correct explanation of (A).
(2) (A) is correct but (R) is not correct.
(3) (A) is not correct but (R) is correct
(4) Both (A) and (R) are correct and (R) is the correct explanation of (A)
118. Consider the situation where photosynthesis is going on at a steady pace in a
typical experiment with a light on, and carbon dioxide is being combined with
ribulose- biosphosphate (RuBP) to produce 3-phosphoglycerate (3PGA). Then
suddenly the source of carbon dioxide is eliminated. What changes in the
concentrations of 3PG and RuBP would occur?
1) 3PGA levels rise, RuBP levels fall. 2) 3PGA levels fall, RuBP levels rise.
3) 3PGA levels rise, RuBP levels rise. 4) 3PGA levels fall, RuBP levels fall.
119. The figure below shows the three steps (A, B, C) of Hatch and Slack pathway.
Select the option giving correct identification with what it represents:-
(1) C = This step is essential otherwise C3 acid will destroy the chlorophyll of
mesophyll cell
(2) A = This step leads to the fixation of CO2 by Calvin cycle in bundle sheath cell
(3) B = This step is catalysed by the enzyme which has both carboxylase and
oxygenase activity
(4) A = This step releases a compound which can bind the O2 to prevent
photorespiration
120. Statement-I :- Proton gradient on either side of membrane is driving force for
ATP synthesis in the chloroplast and mitochondria
Statement-II :- Thylakoid membrane of chloroplast and inner membrane of
mitochondria are quite permeable to protons.
(1) Both Statement-I and statement-II are incorrect
(2) Statement-I is correct and statement-II is incorrect
(3) Statement-I is incorrect and statement-II is correct
(4) Both Statement-I and statement-II are correct
121. Column-I Column-II
(I) IAA (A) Terpenes
(II) GA (B) Indole compounds
(III) ABA (C) Adenine derivatives
(IV) C2H4 (D) Gases
(V) Kinetin (E) Carotenoid derivatives
The correct match is :
(1) I-B, II-A, III-E, IV-D, V-C (2) I-B, II-A, III-C, IV-D, V-E
(3) I-E, II-D, III-A, IV-B, V-C (4) I-A, II-E, III-B, IV-D, V-C
122. A recent record of 2000 years old viable seed discovered during the archeological
excavation at King Herod’s palace near the dead sea, belongs to the species
(1) Lupinus arcticus (2) Orobanche (3) Orchid (4) Phoenix dactylifera

123. Only non motile spores are formed in which set of organisms :
(1) Polysiphonia, Laminaria (2) Gelidium, Ectocarpus
(3) Gracilaria, Ulothrix (4) Gracilaria, Gelidium
124. Statement-I :- Selaginella and Salvinia show seed habit and form seeds.
Statement-II :- Both of them are heterosporous.
(1) Both Statement-I and statement-II are incorrect
(2) Statement-I is correct and statement-II is incorrect
(3) Statement-I is incorrect and statement-II is correct
(4) Both Statement-I and statement-II are correct
125. Water containing cavity in vascular bundle are found in :
(1) Dicot stem (2) Monocot stem (3) Dicot root (4) Monocot root
126. In meiosis, division of centromere occurs during
(1) Interphase (2) Anaphase-I (3) Anaphase-II (4) Metaphase-I
127. Consider the following four statements (a-d) and select the option which includes
all the correct ones only :-
(a) Zinc is a cofactor for the proteolytic enzyme carboxylase
(b) Nicotinamide adenine dinucleotide is a coenzyme
(c) Haem act as prosthetic group of the enzyme that catalyzes the breakdown of
hydrogen peroxide to water and oxygen
(d) Cofactor is the part of enzyme which does not affect the catalytic activity of the
enzyme
(1) Statements (b) and (d) (2) Statements (a) and (b)
(3) Statements (b) and (c) (4) Statements (a), (c) and (d)
128. The character which can express only in homozygous condition in case of garden
pea is –
(A) Constricted pod (B) Green seed colour
(C) Axial flower (D) Yellow pod
(1) A, B & D (2) A, C & D (3) B, C & D (4) A, B & C
129. Identify A and B in this figure:
(1) A: Polar nuclei, B: Male gametes (2) A: Female gametes, B: Polar nuclei
(3) A: Synergid, B: Egg cell (4) A: Male gametes, B: Synergid
130. Single step blue-white screening of non-recombinant and recombinant is possible
by using selectable marker :-
(1) Bt gene (2) lac Z gene (3) tet gene (4) cry gene
131. Which of the following is not correct regarding the primary treatment of waste
water?
1) Grit and Pebbles settled down by sedimentation process.
2) Initially floating debris is removed by distillation
3) Solilds that settle form the primary sludge
4) Supernatant forms the effluent
132. In a stirred-tank bioreactor, the stirrer facilitates _____.
(1) Mixing of reactor contents (2) Oxygen availability throughout the bioreactor
(3) Sterilisation (4) Both (1) and (2)
133. The correct statement of the following
1) Gas Vacuoles are present is all protista and Mycoplasma
2) Neutral solutes are not transported by simple diffusion across the plasma
membrane
3) The cell walls of certain algal members are having calcium carbonate along
with cellulose suberin and cutin
4) The isolated Lysosomal vesicles contain lipases, proteases and carbohydrases
134. Which of the following flowers show superior ovary?
(1) Guava (2) Cucumber (3) Ray florets of Sunflower (4) Brinjal

135. What is the ploidy of different cells given below?
A- Primary endosperm cell, B- Embryo, C- Primary endosperm nucleus,
D- Zygote, E- Antipodal, F- Synergid
(1) A-3n, B-2n, C-2n, D-n, E-n, F-n (2) A-2n, B-2n, C-3n, D-2n, E-2n, F-n
(3) A-3n, B-3n, C-3n, D-2n, E-n, F-n (4) A-3n, B-2n, C-3n, D-2n, E-n, F-n
136. Which of the following is not the function of steroid hormones secreted by the
male primary sex organs?
(1) Erythropoiesis
(2) Anabolic effects on protein and carbohydrate metabolism
(3) Formation of nucleated abundant blood cells
(4) Both (1) and (3)
137. Select the correct statements
(a) Progesterone also stimulates the formation of sac like structures which store
milk
(b) Small amount of adrogenic steroids are also secreted by the centrally located
tissue of adrenal gland
(c) TCT stimulates the process of bone resorption
(1) a, b correct c incorrect (2) b, c only correct
(3) ‘a’ only correct (4) a and c only correct
138. Which part of the human brain is the most developed?
(1) The part comprises pons, Cerebellum and medulla
(2) The part consists of major part of the human brain, thalamus and
hypothalamus
(3) The part located in between the thalamus and pons
(4) Three major regions like mid brain, pons and medulla oblongata.
139. Match the Following.
Column –I Column –II
(A) 80 bones (i) bones help in the articulation of the upper
limbs with the axial skeleton
(B) Vertebral column (ii) bones distributed along the main axis of the
body
(C) Pectoral Girdle (iii) A depression, below the expanded flat
projection of the spine of scapula
(D) Glenoid cavity (iv) Constitute the main frame work of the trunk
(1) A- (ii), B- (iv), C- (i), D- (iii) (2) A- (ii), B- (iv), C- (iii), D- (i)
(3) A- (iii), B- (i), C- (iv), D- (ii) (4) A- (i), B- (iii), C- (ii), D- (iv)
140. Statement: I Genus has more characters in common in comparison to species of
other genera.
Statement: II Order, class and phylum are identified based on the aggregates of
characters.
(1) Statement –I and statement II are correct
(2) Statement – I is correct and statement –II is incorrect
(3) Statement –I is incorrect and statement II is correct
(4) Statement I and II are incorrect
141. Which of the following phylum has the below mentioned distinctive features?
(a) Presence of notochord (b) Dorsal hollow nerve cord
(c) gill slits presence (d) With limbs or fins
(1) Hemichordate (2) Chordata (3) Vertebrata (4) Protochordata
142. How many of the following animals belong to the phylum to which “ Sea hare”
belongs
Antedon, Chaetopleura, Limulus, Salpa, Pristis, Viper, Dog
(1) 1 (2) 3 (3) 2 (4) 4
143. Find out the incorrect statements concern to frog’s anatomy
(a) Different organ systems are accommodated in the body cavity of frogs
(b) The undigested semi solid waste moves into the rectum.
(1) a and b are incorrect (2) a only incorrect
(3) b only incorrect (4) Both are not incorrect
144. A triangular structure receives blood through the major veins in frog located on
(1) Ventral side of the heart (2) Upper part of the heart
(3) Dorsal part of the heart (4) Front side of the heart

145. During muscle contraction, utilising the energy from ATP hydrolysis, the myosin
head binds to
(1) Active sites on meromyosin (2) ATP binding site on actin
(3) Active sites on thin filament (4) Active sites on monomeric actin filament
Column –I Column –II
(A) Sarcolemma (i) proteins arranged as rod-like structures
(B) Myofibrils (ii) plasma membrane encloses the cytoplasm of
muscle fibre
(C) M-line (iii) thin fibrous membrane
(D) Actin and myosin (iv) parallelly arranged filaments
(1) A- (ii) , B- (iv) , C- (i) , D- (iii) (2) A- (i) , B- (iii) , C- (ii) , D- (iv)
(3) A- (iii) , B- (i) , C- (iv) , D- (ii) (4) A- (ii) , B- (iv) , C- (iii) , D- (i)
147. Terrestrial animals are generally either ureotelic or uricotelic, not ammonotelic
because,
(1) Ammonia is highly toxic and is not soluble in water
(2) Urea and uric acid are required more water for elimination
(3) Land animals have to save water
(4) Terrestrial animals need to conserve urea and uric acid to excrete dilute urine
148. Which of the following statements is false?
(1) Male round worm posterior end is curved
(2) Hirudinaria is a monoecious
(3) Pleurobrachia reproduce only by sexual means
(4) In Saccoglossus protonephridia is the excretory organ.
149. Match the following concern to cockroach
A) Mushroom shaped gland (i) 6 – 8 number
B) Ovaries (ii) 6th to 7th abdominal segments
C) Blind tubules (iii) 100 – 150
D) Malpighian tubules (iv) 2nd to 6th abdominal segments
(1) A – iv, B – ii, C – i,D – iii (2) A – ii, B – iv, C – i,D – iii
(3) A – ii, B – iv, C – iii,D – i (4) A – iii, B – iv, C – i,D – ii
150. A person breaths in some volume of air by forced inspiration after having a
forced expiration. This quantity of air taken in is
(1) VC + RV (2) IC + IRV (3) TV + IRV + ERV (4) TV + IRV
151. State the volume of air remaining in the lungs after a forcible expiration.
(1) RV (2) FRC – IC (3) TV + IRV (4) TV + ERV
152. Congestion of the lungs is one of the main symptoms of
(1) The disease that affects the vessels that carry blood to the heart
(2) The disease that occurs due to conditions that affect the blood flow
(3) The state of heart when it is not pumping blood effectively enough to meet
the needs of the body.
(4) When heart muscle is suddenly damaged by an inadequate blood supply.
153. A chordate animal having flame cells as excretory structure is
(1) Animal which has notochord only in larval tail
(2) Animal in which notochord extends from head to tail region
(3) Animal which migrate to fresh water for spawning
(4) Animals that show metamerism for the first time in animal kingdom
154. The right and left atria are separated by
(1) Thin muscular wall (2) Thick inter-atrial spetum
(3) Thick fibrous tissue (4) Thick muscular wall
155. The mammary glands of the female undergo differentiation A pregnancy and
starts producing milk at the B of pregnancy. A and B respectively.
(1) A- after, B- after (2) A- during, B – end
(3) A- before, B – after (4) A – during, B – after
156. Statement I- The umbilical cord is connected to the embryo through the
placenta.
Statement II- Scientifically it is correct to say that the sex of the baby is
determined by the male primary sex organs that produce homogametes.
(1) Both statements are correct (2) Statement II only correct
(3) statement I only incorrect (4) Both statements are incorrect

157. Removal of gonads cannot be considered as a contraceptive option, because
(1) Removal of gonads is a reversible process
(2) Gametogenesis is ceased
(3) It causes sterility
(4) 2 and 3 are against the contraceptive methods idea. So both are suitable
reasons
158. A single gene can exhibit multiple phenotypic expression such a gene is called
(1) Polygene (2) Pleiotropic gene (3) Linked gene (4) Recessive gene
159. Assertion:Chromosomal aberrations are commonly observed in the cells that
show a property called contact inhibition.
Reason: Alteration in chromosomes results in aberrations or abnormalities
(1) Both assertion and reason are true and reason is the correct explanation of
assertion
(2) Assertion is true but reason is false
(3) Both assertion and reason are true but reason is not the correct explanation
of assertion
(4) Assertion is false but reason is true.
160. The substitution of amino acid in the globin protein results due to the single
base substitution at the sixth codon of the beta globin gene from
(1) GAG to CTC (2) CTC to GAG (3) GAG to GGA (4) GAG to GUG
161. Assertion: Two individuals differ from each other
Reason: DNA sequences of two individual different at all places
(1) Both assertion and reason are true and reason is the correct explanation of
assertion
of assertion
(3) Assertion is false but reason is true.
162. Which of the following are the living modern day counterpart organisms of
dinosaurs?
(1) Crocodiles (2) Archaepteryx (3) Birds (4) Both 1 and 3
163. Assertion: Formation of life was succeeded by chemical evolution(According to
Oparin and Haldane)
Reason:Life originated from the pre – existing non – living organic molecules
(1) Assertion is false and reason is true
of assertion
(3)Both assertion and reason are true and reason is the correct explanation
164. Which of the following deadly disease completely eradicated by using vaccines?
(1) AIDS can be treated by using vaccines
(2) Hepatitis-B disease eradicated completely by using hepatitis B Vaccine
produced from yeast
(3) Small pox
(4) Cancer by using 𝛼 − 𝑖𝑛𝑡𝑒𝑟𝑓𝑒𝑟𝑜𝑛 𝑣𝑎𝑐𝑐𝑖𝑛𝑒
165. A psychological attachment to certain effects such as euphoria and a temporary
feeling of well being associated with drugs or alcohol called as
(1) Dependence (2) Addiction (3) Peer pressure (4) Cirrhosis
166. Which of the following genes that encodes the proteins to control the cotton
bollworms?
(1) CryIAc (2) CryIAb (3) Cry II Ac (4) Both 1 and 3

167. Which of the following genetic material generated by the host plant provides
protection against nematode infestation?
(1) Single stranded DNA (2) Single stranded RNA
(3) Double stranded RNA (4) Double stranded DNA
168. Read the statements and select appropriate option
(a) Lungs remove small amount of CO2
(b) Lungs are the largest associated excretory glands in our body
(c) Some of the hormones get degraded in liver
(1) a, b correct (2) c only correct
(3) b and c are correct (4) a, b and c incorrect
(A) Birds (i) Avoid competition
(B) Pacific salmon fish (ii) Predation
(C) Prickly pear cactus (iii) Breed many times
(D) Warblers (iv) Breed only once in their life time
(1) A- (ii) , B- (iv) , C- (i) , D- (iii) (2) A- (iii) , B- (iv) , C- (ii) , D- (i)
(3) A- (iii) , B- (i) , C- (iv) , D- (ii) (4) A- (ii) , B- (iv) , C- (iii) , D- (i)
170. The amount of biomass or organic matter produced per unit area over a time
period by plants during photosynthesis is called
(1) Gross primary productivity (2) Net primary productivity
(3) Primary production (4) Productivity
171. Organisms occupy a specific place in the food chain based on the source of their
nutrition or food is known as
(1) Biomass (2) Trophic level (3) Standing crop (d) Food web
172. How many trophic level human beings function at in a food chain if there are 3
to 4 trophic levels in a food chain?
(1) 2nd and 3rd only (2) 4th trophic level only
(3) 3rd and 4thtrophic levels (4) 2nd and 4th trophic levels
173. Why the number of eggs produced by an oviparous mother will be more than
young one’s produced by a viviparous mother because
(1) Oviparous animals reproduce only once in their lifespan
(2) In oviparous animals reproductive fitness is more
(3) Development of young one is occurring in the safe conditions in oviparous
than the viviparous
(4) Oviparous animal’s eggs are more prone to environmental conditions and
predators so to overcome the loss more eggs are produced
174. Find out the correct match concern to cockroach’s anatomy
(1) Most part of nervous system – dorsal part of the belly region
(2) Nephrocytes – carry nerve impulses
(3) Spiracles – lateral side of the body
(4) Pseudopenis – female reproductive system
175. Find out the mismatch regarding parasitism
(1) Dog – ticks (2) Marine fish – copepods
(3) Humans – Lice (4) Brood parasitism – winter to summer season
176. What is so special about tropics that might account for their greater biological
diversity compare to temperate regions?
(a) Tropical regions subjected to frequent glaciations in the past
(b) Temperate regions have disturbed for millions of years than tropics.
(c) Temperate regions environments are more seasonal and less constant than
the tropics
(1) a and b only correct explanations (2) a and c only explaining
(3) b and c are the suitable reasons (4) a, b, c are the incorrect reasons

177. ‘Z’ value for plants in Britain
(1) range of 0.1 to 0.02 (2) range of 0.6 to 0.1
(3) range of 0.1 to 0.2 (4) range of 0.6 to 1.2
178. Cystic fibrosis is a recessive condition that affects about 1 in 2,500 babies in
the Caucasian population of the United States. Please calculate the following
using Hardey- Weinberg equilibrium
(A) The frequency of recessive allele in the population
(B) The frequency of the dominant allele in the population
(1) A- 0.02, B – 0.98 (2) A- 0.04, B – 0.96
(3) A- 0.01, B- 0.99 (4) A- 0.03, B – 0.97
179. The centres that could help in diagnosis and corrective treatment of some of the
infertility disorders and enable couples to have children
(1) Fertility clinics (2) RCH program centres
(3) ART centres (4) Infertility clinics
180. Read the statements and select the one which is not belong to the ethical
argument for conserving biodiversity.
(1) We have a moral duty to care for all organisms well being
(2) Ethical argument also argue that every organism has an intrincic value when
it has only economic value
(3) We have to pass on our biological legacy in good order to future generations
(4) Ethical argument relates to what we owe to millions of plants, animals and
microbe species with whom we share this planet.
*******

: ANSWER KEY:
1 3 11 2 21 3 31 3 41 2
2 3 12 4 22 1 32 2 42 2
3 2 13 4 23 4 33 2 43 1
4 1 14 4 24 4 34 1 44 3
5 1 15 3 25 2 35 3 45 2
6 3 16 2 26 3 36 4
7 3 17 1 27 3 37 2
8 1 18 2 28 1 38 1
9 2 19 2 29 4 39 2
10 2 20 2 30 4 40 3
SUB:CHEMISTRY
46 2 56 3 66 4 76 4 86 1
47 2 57 3 67 1 77 4 87 3
48 2 58 3 68 1 78 3 88 2
49 1 59 1 69 1 79 1 89 4
50 2 60 1 70 3 80 3 90 4
51 3 61 3 71 1 81 4
52 2 62 4 72 4 82 3
53 2 63 4 73 2 83 2
54 4 64 2 74 3 84 1
55 3 65 2 75 2 85 2
SUB : BOTANY
91 3 101 1 111 4 121 1 131 2
92 4 102 3 112 4 122 4 132 4
93 2 103 3 113 4 123 4 133 4
94 1 104 2 114 4 124 3 134 4
95 1 105 3 115 1 125 2 135 4
96 4 106 1 116 4 126 3
97 1 107 2 117 1 127 3
98 2 108 2 118 4 128 1
99 2 109 2 119 2 129 1
100 4 110 2 120 4 130 2
136 3 146 4 156 4 166 1 176 3
137 3 147 3 157 4 167 3 177 3
138 2 148 4 158 2 168 2 178 1
139 1 149 2 159 4 169 2 179 4
140 1 150 3 160 4 170 3 180 2
141 2 151 1 161 4 171 2
142 1 152 3 162 4 172 3
143 3 153 2 163 1 173 4
144 3 154 1 164 3 174 3
145 3 155 2 165 2 175 4

XII- NEET GT - 12
answer sheet.

PHYSICS Mr.ABDUL RASHEED
Mr.ANJAIAH
CHEMISTRY
Mr.MANIKANTA
BOTANY Mr.SATHYA
ZOOLOGY Mr.BRAHMAIAH
PHYSICS
1. An alpha nucleus of energy (1/2)mv2 bombards a heavy nuclear target of charge
Ze. Then, the distance of closest approach for the alpha nucleus will be
proportional to
1) v2 2) m 3) 1/v4 4) Ze
2. The force is given in terms of time t and displacement x by the equation
F  A cos Bx  C sin Dt
AD
The dimensional formula of is
B
1)  M 0 LT 1  2)  ML2T 3 3)  M 1 LT
1 2
 4)  M 2 L2T 5 
3. The diagram shows the energy levels for an electron in a certain atom. Which
transition shown represents the emission of a photon with the most energy?
1) III 2) IV 3) I 4) II
4. A particle starts from origin 0 from rest and moves with a uniform acceleration
along the positive X-axis. Identify all figures that correctly represent the motion
qualitatively. (a=acceleration, v=velocity, x= displacement, t = time)
1) [A] 2) [A],[B],[C] 3) [B], [C] 4) [A], [B], [D]

5. Two vectors x and y have equal magnitude. The magnitude of (x- y) is n times the
magnitude of (x+ y). The angle between x and y is
1 n2 1  1  n  1 
2
1  n  1 
2
1  n  1 
2
1) cos  2  2) cos  2  3) cos  2  4) cos  2 
 n 1   n 1   n 1   n 1 
6. When a hydrogen atom is raised from the ground state to an excited state.
1) P.E decreases and K.E. increases
2) P.E. increases and K.E. decreases
3) Both K.E. and P.E. decrease 4) Both P.E. and K.E increase
7. A person is swimming with a speed of 10m/s at an angle of 1200 with the flow
and reaches to a point directly opposite on the other side of the river. The speed
of the flow is x m/s. The value of x is _______
1) 5 2)3 3) 2 4) 4
8. Two nuclei have their mass numbers in the ratio of 1 : 3. The ratio of their nuclear
densities would be
3)  3 
1/ 3
1) 1 : 3 2) 3 : 1 :1 4) 1 : 1

9. Draw the output signal Y in the given combination of gates.
10. Two forces are such that the sum of their magnitudes is 18N and their resultant
which has magnitude 12 N, is perpendicular to the smaller force. Then, the
magnitudes of the forces are
1) 12 N, 6N 2) 13N, 5N 3) 10N, 8N 4) 16N, 2N
11. The coefficient of static friction between two blocks is 0.5 and the table is smooth.
The maximum horizontal force that can be applied to move the blocks together
is _____ N
1) 15 2) 20 3) 25 4) 10
12. A 0.5kg block moving at a speed of 12ms compresses a spring through a
-1
distance 30cm when it speed is halved. The spring constant of the spring will be
____Nm-1
1) 250 2)450 3) 300 4) 600
13. A 8 V Zener diode along with a series resistnace R is connected across a 20V
supply (as shown in the figure). If the maximum Zener current is 25mA, then the
minimum value of R will be __________ 
1) 480 2)240 3)960 4)600

14. An object of mass m1 collides elastically and head on with another object of mass
m2, which is at rest. After the collision, the objects move with equal speeds in
opposite direction. The ratio of the masses m2 : m1 is
1) 3 : 1 2) 2 : 1 3) 1 : 2 4) 1 : 1
15.    
The position vector of 1kg object is r  3iˆ  ˆj m and its velocity, v  3 ˆj  kˆ ms 1 .
The magnitude of its angular momentum is x Js , where x is ______

1) 70 2) 91 3) 85 4) 30
16. The position of the centre of mass of a uniform semi-circular wire of radius R
place in XY- plane with its centre at the origin and the line joining its ends as X-
axis is given by  0,  . Then, the value of |x|is
xR
  
1) 1 2) 4 3) 2 4) 3
17. A mass ‘m’ supported by a masslessstring wound around a uniform hollow
cylinder of mass m and radius R. If the string does not slip on the cylinder, with
what acceleration will the mass fall on release?
m
R
2g g 5g
1) 2) 3) 4) g
3 2 6
18. Four identical discs each of mass M and diameter ‘a’ are arranged in a small plane
x 2
as shown in figure. If the moment of inertia of the system about 00' is Ma .
4
Then, the value of x will be _____
1) 1 2) 2 3) 3 4) 4
19. A fly wheel is accelerated uniformly from rest and rotates through 5 rad in the
first second. The angle rotated by the fly wheel in the next second, will be
1) 7.5 rad 2) 15 rad 3) 20 rad 4) 30 rad
20. Two objects of equal masses are placed at certain distance attracts each other
with a force of F. If one-third mass of one object is transferred to the other object,
then the new force will be
2 16 8
1) F 2) F 3) F 4) F
9 9 9
21. The compressibility of water is 4 105 per unit atmospheric pressure. The
decrease in volume of 100 cm3 of water under a pressure of 100 atmosphere will
be
1) 0.4cm3 2) 4 105 cm3 3) 0.025cm3 4) 0.004 cm3
22. A rectangular film of liquid is extended from (4cm x 2cm) to (5cm x 4cm). If the
work done is 3 104 J , the value of the surface tension of the liquid is:
1) 0.2 Nm 1 2) 8.0 Nm 1 3) 0.250 Nm 1 4) 0.125 Nm 1
23. The temperature of equal masses of three different liquids x, y and z are 100C,
200C and 300C, respectively. The temperature of mixture when x is mixed with y
is 160C and that when y is mixed with z is 260C. The temperature of mixute when
x and z are mixed will be
1) 28.320C 2) 25.620C 3) 23.840C 4) 20.280C

24. The current in the network is
1) 0.2A 2) 0A 3) 0.6A 4) 0.3A

25. A thermodynamic cycle xyzx is shown on a V-T diagram.
The p-V diagram that best describes this cycle is (diagrams are schematic and
not to scale)
26. Which of the following graphs represent the behavior of an ideal gas? (Symbols
have their usual meanings.)
d 2x
27. If a simple haromonic motion is represented by   x  0 , its time period is
dt 2
2 2
1) 2) 3) 2 4) 2 
 
28. A child swinging on a swing in sitting position, stands up, then thetime period of
the swing will
1) Increase 2) Decrease 3) Remain same
4) Increase, if the child is short
29. The two nearest harmonics of a tube closed at one end and open at other end are
220 Hz and 260 Hz. Then the fundamental frequency of the system is
1) 20 Hz 2) 30 Hz 3) 40 Hz 4) 50 Hz
30. An infinite number of point charges, each carrying 1C charge, are placed along
the Y-axis at Y=1m, 2m, 4m, 8m, ……  .The total force on a 1C point charge,
placed at the origin is x 103 N . The value of x to the nearest integer, is
1
_____(Take,  9  10 9 N  m 2 / C 2 ).
4 0
1) 12 2) 6 3) 18 4) 24
31. 27 identical drops are charged at 22V each. They combine to form a biger drop.
The potential of the bigger drop will be ____ V.
1)198 2) 99 3) 49.5 4) 274

32. In a meter bridge, the balancing length from the left end , when standard
resistance of 1 is in right gap is found to be 20cm. The value of unknown
resistance is
1) 0.25 2) 0.4 3) 0.5 4) 4 
33. The magnitude of the magnetic field (B) due to loop ABCD at the origin (O) is
0 /  b  a  0 /  b  a  0 /   
1) Zero 2) 3) 4) 2  b  a    a  b 
24 ab 4  ab  4   3 
34. A particle of charge 16 1018 C moving with velocity 10ms-1 along the X- axis
enters a region where a magnetic field of induction B is along the Y-axis and an
electric field of magnetitude 104Vm-1 is along the negative Z-axis. If the charged
particle continues moving along the X-axis, the magnitude of B is
1) 103 Wb/m2 2) 105 Wb/m2 3) 1016 Wb/m2 4) 10-3Wb/m2
35. In a uniform magnetic field, the magnetic needle has a magnetic moment
9.85 102 A / m2 and moment of inertia 5 106 kg  m2 . If it performs 10 complete
oscillations in 5s, then the magnitude of the magnetic field is______
1) 8 2) 4 3) 2 4) 16
36. A coil is placed in a magnetic field B as shown below.
A current is induced in the coil because B is

1) Outward and decreasing with time
2) Parallel to the plane of coil and decreasing with time
3) Outward and increasing with time
4) Parallel to the plane of coil and increasing with time
37. A boat is moving due East in a region where the earth’s magnetic field is
5.0 195 NA1m1 due North and horizontal. The boat carries a vertical aerial 2m
long. If the speed of the boat is 1.50ms-1, the magnitude of the induced emf in the
wire of aerial is
1) 0.75mV 2) 0.50mV 3) 0.15mV 4) 1mV
38. Figure shows a circuit that contains four identical resistors with resistance
R  2.0 , two identical inductors with inductance L=2.0mH ad an deal battery
with electromotive force E = 9V. The current i just after the switch S is closed will
be
1)2.25A 2) 3.0A 3) 3.37A 4) 9A

39. A transformer consisting of 300 turns in the primary and 150 turns in the
secondary gives output power of 2.2kW. If the current in the secondary coil is
10A, then the input voltage and current in the primary coil are
1) 440V and 5A 2) 220V and 20A 3) 220V and 10A 4) 440V and 20A

40. Light wave travelling in air along x- direction is given by
Ey  540sin104  X  ct  Vm1
Then, the peak value of magnetic field of wave will be (Given, c  3108 ms1 )
1) 18 107 T 2) 54 107 T 3) 54 108 T 4) 18 108T
41. Light enters from air into a given medium at an angle of 450 with interface of the
air-medium surface. After refraction, the light ray is deviated through an angle of
150 from its original direction. The refractive index of the medium is
1) 1.732 2) 1.333 3) 1.414 4) 2.732
42. Find the value of the angle of emergence from the prism. Refractive index of the
glass is 3 .
1) 900 2) 600 3) 300 4) 450

43. A periodic waves of intensities I1 and I2 pass through a region at the same time in
the same direction. The sum of the maximum and minimum intensities is
   
2 2
1) I1  I 2 2) I1  I 2 3) I1  I 2 4) 2  I1  I 2 
44. An electron of mass me and a proton of mass mp are accelerated through the same
potential difference. The ratio of the de-Broglie wave lengths associated with the
electron to that with the proton is
m mp m
1) p 2) 1 3) 4) e
me me mp
45. The surface a metal is illuminated with the light of 400nm. The kinetic energy of
the ejected photoelectrons was found to be 1.68eV. The work function of the metal
is (hc= 1240eV-nm)
1) 3.09eV 2) 1.42eV 3) 151eV 4) 1.68eV
CHEMISTRY
46. 10g of hydrogen and 64g of oxygen were filled in a steel vessel and exploded. What
volume of water produced at STP in this reaction?
1) 22.4L 2) 44.8L 3) 89.6L 4) 11.2 L
47. Wrong statement among the following:
1) SO2 can acts as redusing agent, where as TeO2 is an oxidizing agnet.
2) Stability of halides of 16th group elements decreases in the order
F   Cl   Br   I 
3) Among tetrahalides, TeF4 is solid, where as SeF4 is a liquid.
4) SeCl2 decomposition, is an example of disproportionation reaction.
48. An organic compound made up of C, H and N atoms. It contains 20% Nitrogen.
It's minimum molecular weight is
1) 140 2) 70 3) 100 4) 65
49. The retardation factor (Rf) of four substance A, B, C, D respectively are 0.04, 0.02,
0.09 and 0.06. Which of the following compound has more extent of adsorption.
1) A 2) B 3) C 4) D
50. If the radius of first orbit of H-atom is ao, then deBroglies wavelength of electron
in 3rd orbit is
1) 2𝜋a0 2) 16a0 3) 6 𝜋a0 4) 8 𝜋a0
51. Which of the following order is incorrect against the property indicated?
1) Boiling point → B  Al  Ga  In  Tl
2) Lewis acidic nature → BX 3  AlX 3  GaX 3  InX 3 ( X is any halogen)
3) Melting point → C  Si  Ge  Sn  Pb
4) Stability of +2 oxidation state → C  Si  Ge  Sn  Pb
52. In hydrogen atom, it the energy of an electron in ground state is -13.6ev, then e-
returns from 3rd orbit to 2nd orbit what is the energy gap (∆E) (when de excitation
take place) in eV?
1) 1.51 2) 1.89 3) 3.4 4) 1.5

53. Which of the following benzyl halides undergoes SN1 reaction at the fastest rate:
CH2Br CH2Br CH2Br CH2Br
1) 2) 3) 4)
OCH3 NO2 Cl
54. Match the Species in column. I with the type of hybrid orbitals in column Ⅱ.
(ⅰ) SF4 a) sp3d2
(ⅱ) IF5 b) d2sp³

(ⅲ) NO2 c) sp3d
(iv) NH4+ d) Sp³
e) sp
1) (i) – c, (ii) – a, (iii) – e, (iv) – d 2) (i) – b, (ii) – c, (iii) – a, (iv) – d
3) (i) – a, (ii) – b, (iii) – c, (iv) – d 4) (i) – c, (ii) – a, (iii) – d, (iv) – e
55. The order of reactivity of the following alcohols towards conc. HBr is
CH3 CH3 CH3

CH3
OH ph OH
OH
F I F OH IV
II III
1) I > II > III > IV 2) I > III > II >IV 3) IV > III > II > I 4) IV > III > I > II
56. Which of the following is not isostructural pair?

 
NO3 , CO3-2, ClO3 , SO3
   
1) NO3 , ClO3 2) SO3, NO3 3) CO3-2, SO3 4) NO3 , CO32
57. Which one of the following pairs is not correctly matched?
1) C=O CH2 (Clemmensen’s reduction)
2) C=O CH-OH (Wolf.Kishner’s reduction)
3) - COCl -CHO (Rosenmund’s reduction)
4) -CHO (Stephen’s reduction)

58. Consider the following reaction occuring in an automobile.
2C8 H18 (g) + 25O2(g) → 16 CO2(g) + 18H2O(g)
The Sign of ∆H, ∆S and ∆G would be
1) + ,-,+ 2) -,+,- 3) -,+,+ 4) +,+,-
59. The starting compound(X) needed to make the following compound?
(1) dil.NaOH
X.
(2)
1) Benzaldehyde and 3-pentanone 2) Acetophenone and 2-butanone

3) Acetophenone and butanal 4) Benzaldehyde and 2-pentanone
60. Bond Bond enthalpy
N  N 945 kJ/mole
H-H 436 kJ/mole
N–H 391 kJ/mole
Calculate the enthalpy change of the reaction.
N2(g) + 3H2(g) → 2NH3(g)

1) - 89 kJ/mole 2) -93 KJ/ mole 3) -105 KJ/mole 4) 105 kJ/mole
61. Which of the following reactions will not result in the formation of new carbon-
carbon bonds?
1) Reimer-Tiemann reaction 2) Cannizaro reaction
3) Wurtz reaction 4) Friedel –Crafts acylation
62. The percentage (by weight) of sodium hydroxide in a 1.25 molal NaOH Solution is
1) 4.76% 2) 1.25% 3) 5% 4) 40%
1) Rate of dehydration of alcohol to form ether, in presence of Con.H2SO4 is
10  20  30
2)Correct order of reactivity of alkyl halides in Williamson’s synthesis is 10  20  30
3) When tert. Butyl ethyl reacts with anhydrous HI(Hot) ethyl iodide obtained as
major product.
4) Rate of electrophilic aromatic substitution of anisole is more than that of
benzene and phenol.
64. Calculate the freezing point of aqueoous urea solution which boils at 100.18 𝐶
(𝑘 = 1.86 𝐶 𝑚 , 𝑘 = 0.512 𝐶 𝑚 )
1) −0.18 𝑐 2) 0.65 𝑐 3) −0.65 𝑐 4) 0.18 𝑐
65. In the following sequence of reaction.
H 3O  / T
CH 3 Br 
KCN
 A   B 
LiAlH 4 / ether
H 2O
 C , the end product C is
1) Acetone 2) Methane 3) Acetaldehyde 4) Ethyl alcohol
66. At a certain temp 2HI⇌ 𝐻 + 𝐼 only 50% HI is dissociated at equilibrium. The

Equilibrium constant is
1) 0.25 2) 1.0 3) 3.0 4) 0.50
(Reaction) (Reagents)
(A) Benzophenone→Diphenylmethane (I) LiAlH4
(B) Benzaldehyde→1-phenyl methanol (II) DIBAL-H
(C) Cyclohexanone→1-methylcyclohexanol (III) Zn-Hg/conc.HCl
(D)
.
Pheynl benzoate→Benzaldehyde (IV) CH3MgBr
.
(A) (B) (C) (D) (A) (B) (C) (D)

1) III IV I II 2) III IV II I
68. The 𝑃 of a solution obtained by mixing 50ml of 1N HCl and 30ml of 1N NaOH is
(log 2.5 = 0.3979)
1) 0.6021 2) 1.2042 3) 0.3979 4) 12.042
69. Assertion (A) : N-ethylbenzene sulphonamide is soluble in alkali.

Reason (R) : Hydrogen attached to nitrogen in sulphonamide is strongly acidic
3) Both A and R are incorrect. 4) A is incorrect but R is correct.
70. 100ml of 0.1M HCl + 35ml of 0.1M NaOH, colour of methyl orange in the resulting
solution will be
1) Green 2) Yellow 3) Red 4) Violet
71. Which of the following is/are main forces that stabilize secondary and tertiary
structure of protein?
1) Hydrogen bonds 2) Disulphide linkage
3) Electrostatic force of attraction 4) All of these
72. What is the value of n in the following half equation.
𝐶𝑟(𝑂𝐻) - + OH- ⟶CrO4-2 + H2O + ne-
1) 3 2) 5 3) 6 4) 2
73. Wrong statement among the following, regarding aromatic electrophilic
substitutions reaction of benzene?
1) Arenium ion formed in the mechanism as an intermediate is non aromatic
compound.
2) In Nitration mixture conc. HNO3 acts as a base
3) Electrophile in sulphonation of benzene is SO3

4) n-alkyl benzene cannot be obtained in Friedel craft’s acylation.
74. The Eo for Half cells Fe2+/Fe and cu2+/cu+2 are -0.44V and +0.32V respectively
them
1) Cu+2 Oxidises Fe 2) Cu+2 Oxidises Fe+2
3) Cu Oxidises Fe +2 4) Cu reduces Fe+2
75. Lactose is made of, which of the following monosaccharides?
1) 𝛼 − 𝐷 -glucose and 𝛽 − 𝐷 -glucose 2) 𝛼 − 𝐷 -galactose and 𝛽 − 𝐷 -glucose
3) 𝛼 − 𝐷 - galactose and 𝛼 − 𝐷-glucose 4) 𝛽 − 𝐷 -galactose and 𝛽 − 𝐷 -glucose
76. The emf of a Daniel cell at 298k is E, zn/znso4(0.01m) || cuso4(1.0m)/cu when
the concentration of znso4 is 1.0m and that of cuso4 is 0.01m the emf changed to
E2. What is the relationship between E1 & E2
1) E2=E1=0 2) E1>E2 3) E1<E2 4) E1=E2
77. The decreasing order of acidic character of following phenols.
1) III >II > I > IV 2) IV > I > III > II 3) I > III >IV > II 4) II > IV > I > III
78. A hypothetical reaction; A2+B2 ⟶ 2AB follows mechanism
A2⇋A+A (fast)
A+B2⟶AB+B (slow)
A+B⟶Fast
The order of the overall reaction is
1) 2 2) 3) 1 4) 0
79. When one mole of an alkene on reductive ozonolysis produces 2-moles of
propanone, the alkene is
1) 3-methyl but-1-ene 2) 2, 3- dimethylbut-2-ene
3) Isobutene 4) 2, 3-dmethylpent-2-ene
80. The activation energies of forward and backward reactions respectively are
54kj and 36kj. Then the nature of the reaction is
1) Endothermic reaction 2) Exothermic reaction
3) Either 1 or 2 4) Neither 1 nor 2
1) Bromine oxides Br2O, BrO2 and BrO3 are the least stable halogen oxides and
are very powerful oxidizing agent.
2) Reaction of iodine with water is non-spontaneous reaction, where as I  ion
can be oxidized by oxygen in acidic medium.
3) Among all noble gases electron gain enthalpy in (KJ/mole) is highest for ‘He’
and lowest for ‘Ne’
4) Among the hydrides of 15th group elements, BiH3 has highest boiling point and
ammonia has good reducting property.
82. The ionic radii (A°) of C-4 and O-2 respectively are 2.60 and 1.40. The ionic radius
of the isoelectronic ion N-3 would be
1) 1.71 2) 2.6 3) 1.4 4) 0.95
83. The IUPAC name of the following molecule is
Me Me Me
Me
1) 5, 6-dimethylhept-2-ene 2) 2, 3-dimethylhept-5-ene
3) 5, 6-dimethylhept-3-ene 4) 5-isopropylhex-2-ene
84. Which of the following statement is not correct
1) The ionic radii can be estimated by measuring the distance between cations
and anions in ionic crystals
2) A positive ion is always smaller than the corresponding atom
3) Isoelectronic ions have identical sizes

4) A negative ion is always bigger than the corresponding atom
85. In the newman projection for 2, 2-dimethyl butane (rotation across (C1-C2)
X
H3 C CH3
H H
Y
X and Y respectively be
1) H and H 2) H and C2H5 3) C2H5 and H 4) H and CH3
86. Which one is correct basic character of nitrogen trihalides
1) NF3>NCl3>NBr3>NI3 2) NF3<NCl3 <NI3<NBr3
3) NF3<NCl3<NBr3<NI3 4) NF3<NBr3<NI3<NCl3
87. Which of the following statement is not correct
1) The higher oxidation state of a metal is exhibited either in its oxide or in its
fluoride
2) Cr+2 is a stronger reducing agent than Fe+2
3) The stability of the +6 state of Group 6 elements is W+6 < Mo+6 < Cr+6
4) Cu+1 ion is lesser stable than Cu2+ in aqueous solutions
88. The IUPAC name of [Co (NH3)5ONO]+2 ion is
1) Pentamminenitritocobalt (III)ion 2) Pentammine nitro cobalt (I)ion
3) Pentammine nitro cobalt (IV)ion 4) Pentammine nitrito cobalt (II)ion
89. Magneticmoment of (NH4)2[MnBr4] is _______ BM
1) 4.91 2) 5.91 3) 3.91 4) 2.46
90. The crystal field stabilization energy (CFSE) is highest for
1) [CoF4]-2 2) [Co(NH3)6]+3 3) [Co(Br)4]-2 4) [CoCl4]-2
BIOLOGY
91. Which one of the following cellular part is incorrectly described?
1) Centrioles - Duplicated during S-phase and lie perpendicular to each other
in centrosome
2) Nucleolus - Sites for r-RNA synthesis and non membranous structure
3) Stroma - contains enzyme required for  oxidation of fats
4) SER - part of endomembrane system, helps in synthesis of lipids
92. Segregation of mendelian factors (Aa) occurs during :
1) Diplotene 2) Anaphase-I 3) Pachytene 4) Anaphase-II
93. A structure that connect the cytoplasm of neighbouring cells and another which
holds or glues the different neighbouring cell together. These are :
1) Cell wall and middle lamella respectively
2) Plasmodesmata and middle lamella respectively
3) Middle lamella and desmosomes respectively
4) Middle lamella and plasmodesmata respectively
94. A plasmid containing complete gene copied from human genome is introduced in
a bacterial cell, but the bacteria is unable to make a working copy of the protein
because
1) It cannot recognize the start codon in mRNA
2) Of the absence of similar amino acids in bacteria
3) Of the absence of similar splicing machinery
4) The foreign gene cannot replicate in bacteria
95. Read the following statements about agarose gel electrophoresis and choose the
incorrect option.
1) The agarose gel used in the technique is extracted from seaweeds
2) The DNA fragments separate according to their size
3) Separated DNA fragments can be visualized after staining with ethidium
bromide followed by exposure to infrared rays
4) DNA fragments move from cathode to anode under the influence of an electric
field

96. In anaphase-I, as compared to metaphase-I, cell possessing :

1) Same number of chromosomes and same number of chromatids
2) Half number of chromosomes and half number of chromatids
3) Half number of chromosomes and same number of chromatids
4) Half number of chromosomes and double number of chromatids
97. The molecule represented is ?
1) Uridine and it is a pyrimidine 2) Uridylic acid and it is a nucleoside

3) Uridine and it is a nucleoside 4) Uridylic acid and it is a nucleotide
98. All of the given are true w.r.t. innermost wall layer of anther, except
1) Surronds sporogenous tissue
2) Helps in dehiscence of anther
3) Their cells nourish developing pollen grains
4) Possess dense cytoplasm
Column-I Column-II
a) Alkaloid (I) Vinblastin, curcumin
b) Essential oils (II) Morphine, Codeine
c) Toxins (III) Lemon grass oil
d) Drugs (IV) Abrin, Ricin
1) a-II, b-III, c-IV, d-I 2) a-III, b-II, c-IV, d-I
3) a-II, b-III, c-I, d-IV 4) a-III, b-II, c-I, d-IV
100. Transcription unit in E.coli :
1) Monocistronic 2) Polycistronic 3) Monogenic 4) non-coding
101. Which of the given monerans fixes nitrogen symbiotically as well as in free-living
state?
1) Rhizobium 2) Azotobacter 3) Frankia 4) Anabaena
102. Which of the following RNA polymerase enzyme catalyses the formation of
precursor of mRNA(hnRNA) :
1) DNA ligase 2) RNA Polymerase II
3) RNA Polymerase I 4) DNA Polymerase II
103. DNA and RNA differ from each other with respect to
1) Nitrogen base only 2) Sugar only
3) Nitrogen bases and phosphate 4) Nitrogen bases and sugars
104. If both strands in a given segment of DNA are transcribed then the two RNA
molecules formed must be :
1) Parallel and complementary 2) Parallel and identical
3) Anti-parallel and complementary 4) Anto-parallel and identical
105. A m-RNA coded following sequence of amino acid
Then find out nucleotide sequence of mRNA :

1) AUG, UUU, UUU, UUC, UUU, UUU 2) AUG, UUU, UUU, UUU, UUC, UUG
3) AUG, GUG, UUU, UUA, UUU, UUU 4) GUG, UUU, UUC, UUA, UUG, UUU
106. Which of the following feature generates approximately uniform distance between
the two strand of DNA :
1) One purine always comes opposite to a pyrimidine
2) One purine always comes opposite to a purine
3) One pyrimidine always comes opposite to a pyrimidine
4) Presence of pentose sugar
107. By a monohybrid cross, which of the following phenomenon can’t be explained?
1) Segregation of factors 2) Dominance
3) Independent assortment 4) Pairing of factors
108. In a dihybrid heterozygous plant, how many types and in what ratio the gametes
are produced?
1) 4 types in the ratio of 9 : 3 : 3 : 1 2) 2 types in the ratio of 3 : 1
3) 3 types in the ratio of 1 : 2 : 1 4) 4 types in the ratio of 1 : 1 : 1 : 1

109.
Choose the correct answer for given diagram.

1) A-has negative charge 2) B-is a Linker DNA
3) C-formed by five types of histone protein 4) A-is a sealing
protein
110. What will the distance between gene of white eye and miniature wing in a typical
the dihybrid cross performed by T.H. Morgan
1) 37.2 cM 2) 62.8 cM 3) 1.3 cM 4) 98.7 cM
111. A plant having genotype AaBBTt and all three genes are completely linked then it
will produce pollen grains in ratio :
1) 1 : 1 2) 1 : 1 : 1 : 1 3) 3 : 1 4) 1:1:1:1:1:1:1:1
112. Which option is correct?
1) Introns are present in mRNA while exons are present in tRNA
2) Codons are present in mRNA while anticodons are present in tRNA
3) Every intron is a set of three terminator codons
4) Exons are present in eukaryotes but introns are present in prokaryotes
113. Match the terms given in Column I with their description in Column II and select
the correct option :
Column-I Column-II
a) Co-dominance (i) F1 hybrids donot resemble either of the
parents
b) Pleiotropy (ii) Many alleles control a single character
c) Multiple allelism (iii) Full expression of both alleles in heterozygous
condition
d) Incomplete (iv) A single gene influence many charactens
dominance
Codes :
a b c d a b c d
1) iii iv ii i 2) iii ii i iv
3) ii i iii iv 4) ii iv i iii
114. The process of separation and purification of expressed protein before marketing
is called:
1) Bioprocessing 2) Biofortification
3) Downstream processing 4) Upstream processing
115. Opening of DNA helix during transcription is performed by
1) Helicase 2) RNA polymerase 3) Ligase 4) Topoisomerase
116. Which one of the following helps the plant in absorption of phosphorus from soil?
1) Anabaena 2) Glomus 3) Rhizobium 4) Frankia
117. Red algae
1) Have chlorophyll a and b as major pigments
2) Have starch as stored food
3) Contain cellulose and algin in their cell wall
4) Lack flagella
118. Which of the following is wrongly matched in the given table?
Microbe Product Application
1) Trichoderma Cyclosporin A Immunosuppressive drug
polysporum
2) Monascus purpureus Statins Lowering of blood cholesterol
3) Streptococcus Streptokinase Removal of clot from blood
vessel
4) Clostridium butylicum Lipase Removal of oil stains
119. Large holes in swiss cheese are due to production of a large amount of CO2 by a
bacterium is:
1) Lactobacillus lactis 2) Clostridium butylicum
3) Propionibacterium sharmanii 4) Mycobacterium laprae

120. Select the incorrect statement w.r.t. monocot root.

1) Pericycle gives rise to lateral roots
2) Vascular bundles are polyarch
3) Cambium develops at the time of secondary growth
4) Pith is large and well developed
121. Which of the following is used to speed up the malting process?
1) Auxin 2) GA3 3) Kinetin 4) ABA
122.
Out of four given curves which of the following shows effect of substrate
concentration on progression of enzyme catalysed reaction:
1) (d) 2) (b) 3) (c) 4) (a)
123. Richmond-Lang effect (delay in leaf senescence) in plant is related with :
1) Nutrient mobilisation 2) Triple response
3) Parthenocarpy 4) Fruit ripening
124. Prosthetic group is a non protein part of enzyme and its:
1) loosely attached organic part 2) tightly attached to apoenzyme
3) loosely attached inorganic part 4) tightly attached inorganic part
125.
Major pathway of Anaerobic respiration identify A, B and C :

A B C
1) NAD + Ethanol Lactic acid
2) Ethanol NAD+ Lactic acid
3) Lactic acid Ethanol NAD
4) NAD Lactic acid Ethanol
18
126. If oxygen is labeled with O , which molecule will become radioactive as
glycolysis, Kreb’s cycle and oxidative phosphorylation are completed?
1) Water 2) CO2 3) ATP 4) NADH2
127. Go through the following statements:
(I) Promotes flowering in pineapple.
(II) Used to prepare weed free lawn.
(III) Promotes the abscission of older mature leaves and fruits.
The above functions are carried out by :
1) GA 2) C2H4 3) ABA 4) Auxin
128. The biochemical objective of PSI is to:
1) Oxidize NADPH 2) Hydrolyze ATP 3) Oxidise water 4) Reduce NADP 
129. In C4 plants, during photosynthesis C4 acid undergoes decarboxylation in _______
to produce C3 acid (pyruvic acid) and ______
1) Mesophyll, O2 2) Bundle sheath, ATP
3) Grana, CO2 4) Bundle sheath, CO2
130. Vascular bundles are conjoint and open in
1) Dicot root 2) Monocot root 3) Dicot stem 4) Monocot stem
131. Which complex of ETS has both iron and copper?

1) I-complex 2) II-complex 3) III-compelx 4) IV-compelx
132. How many given statements are incorrect about fermentation?
(A) 7% concentration of alcohol is poisonous for yeast cells.
(B) 13% energy trapped in ATP by partial breakdown of glucose.
(C) NADH  H  oxidised vigorously.

(D) Very common in higher organisms.

1) Three 2) Four 3) Two 4) One
133. One glucose on complete oxidation yield 38 ATP. During this oxidation of glucose,
what is the contribution of Krebs cycle via oxidative phosphorylation:
1) 11 ATP 2) 12 ATP 3) 22 ATP 4) 24 ATP
134. How many of the given plants have actinomorphic and zygomorphic flowers,
respectively?
Mustard, Gulmohur, Canna, Cassia, Datura, Pea
1) 2 and 3 2) 3 and 2 3) 2 and 4 4) 4 and 2
135. Which of the given is medicinal plant of family Fabaceae?
1) Petunia 2) Gloriosa 3) Muliathi 4) Belladonna
136. Match List I with List II and choose the correct answer.
List-I List – II
A) Saccoglossus i) Hooks and suckers
B) Pinctada ii) Nematocysts
C) Limulus iii) Proboscis gland
D) Taenia iv) Calcareous shell
E) Gorgonia v) Book gills
1) A-iii, B-iv, C-i, D-ii, E-v 2) A-iii, B-iv, C-v, D-i, E-ii
3) A-iii, B-iv, C-ii, D-v, E-i 4) A-iii, B-v, C-iv, D-ii, E-i
137. Choose incorrect statement about frog's heart.
1) The left atrium receives blood from lungs and skin
2) The right atrium receives deoxygenated blood from sinus venosus
3) Mixed blood is pumped by the ventricle to all body parts
4) Ventricle opens into conus arteriosus on the dorsal side
138. Branchial respiration is not seen in
1) Chameleon 2) Petromyzon 3) Catla 4) Aplysia
139. Phagocytic cells which destroy microbes are
1) Basophils, Neutrophils 2) Eosinophils, Lymphocytes
3) Lymphocytes, Neutrophils 4) Neutrophils, Monocytes
140. Statement I: The osmolarity gradient in the renal medullary interstitium of
human kidney is mainly caused by NaCl and urea.
Statement II: The ascending limb of loop of Henle allows only passive transport
of electrolytes
2) Statement I is correct and statement II is incorrect
3) Statements I and II are correct 4) Statements I and II are incorrect
141. Which nematode parasite is transmitted by female culex?
1) Wuchereria 2) Plasmodium 3) Ancylostoma 4) Trypanosoma
142. Which method of ex-situ conservation provides protection to the threatened
animals?
1) Biospheres reserves 2) Wild life safari parks
3) Sacred groves 4) National parks
143. Choose correct set of matching between List - I and List-II with reference to
contraception in human.
List-I List – II
a) Condoms. i) Uterus is unsuitable for implantation
b) Diaphragms ii) Prevent insemination into vagina
c) LNG – 20 iii) Block sperm entry into cervix
d) Multiload -375 iv) Suppress sperm motility
e) Oral pills v) Inhibit ovulation
(A) (B) (C) (D) (E) (A) (B) (C) (D) (E)
1) ii iii i v iv 2) ii iii i iv v
3) ii i v iii iv 4) ii iii iv v i

144. Assertion (A): Neurotransmitters are released into synaptic cleft when an action
potential arrives at the axon terminal.
Reason (R): Action potential stimulates the movement of synaptic vesicles which
fuse with the plasma membrane to release neuro transmitters.
1) A is false but R is true
2) Both A and R are true and R is the correct explanation of A
3) Both A and R are true but R is not the correct explanation of A
4) A is true but R is false
145. Which of the following does not represent homology?
1) Thorns of Bougainvillea and tendrils of Cucurbita
2) Flipper of Delphinus and Aptenodytes
3) Flipper of Balaenoptera and wing of Pteropus
4) Hand of human and fore limb of Cheetah.
146. Choose correct set of statements about luteinising hormone.
a) It is secreted by pars distalis b) It acts on Sertoli cells of testis
c) It maintains corpus luteum d) It stimulates secretion of androgens
e) Its surge causes ovulation
1) All except b 2) a, d, e only 3) b, c, d only 4) All are correct
147. Choose the correct set of statements related to human skeleton
a) Acromion of sternum articulates with clavicle.
b) Dicondylic skull articulates with atlas
c) True ribs articulate dorsally with sternum through hyaline cartilage
d) Pubic symphysis contains fibrous cartilage
e) Hyoid is a 'U' shaped bone at the base of buccal cavity
1) a, b, d 2) b, d, e 3) all except a 4) c, d, e
148. Statement I: Degeneration of corpus luteum causes disintegration of
endometrium leading to menstruation.
Statement II: The levels of gonadotropins fall during proliferative phase.
1) Statements I and II are correct
3) Statements I and II are incorrect
149. Claspers are seen in
1) Clarias 2) Carcharodon 3) Caltoes 4) Corvus
150. The birth canal forms from
1) Cervical canal and vagina 2) Vagina and uterus
3) Uterus and cervical canal 4) Ampulla and uterus
151. Observe the given picture showing human respiratory system and identify the
answer with correctly labelled part and description.
1) A – epiglottis - prevents entry of food into trachea

2) C- Alveoli - sites for pulmonary gaseous exchange
3) B – Trachea - supported by complete cartilaginous rings
4) D – Diaphragm - contraction causes expiration
152. Which peptide hormone causes hyperglycemia?
1) Glucagon 2) Insulin 3) Adrenalin 4) Cortisol

153. Match List I with List II and choose correct option.
List - I List – II
a) Myasthenia gravis i) Low levels of estrogen
b) Myotonic dystrophy ii) Hypothyroidism
c) Osteoporosis iii) Autoimmune disorder
d) Atherosclerosis iv) Genetic disorder
v) Deposition of fat in arteries
1) A - ii, B - v, C - i, D - iii 2) A - iii, B - iv, C - i, D - v
3) A - i, B - v, C - ii, D - iii 4) A - v, B - ii, C - i, D - iv
154. The process of breakdown of detritus by detritivores such as earthworms is
1) Catabolism 2) Leaching 3) Fragmentation 4) Mineralisation
155. ZW-ZZ method of sex determination is seen in
1) Grasshoppers 2) Fruit flies 3) Chicken 4) Humans
156. Match List-I with List -II and identify the correct set.
List-I List-II
A) Eosinophils i) Myelin sheath
B) JG cells ii) Allergic reactions
C) Fibrinogens iii) Erythropoietin
D) Schwann cells iv) Plasma
E) Mast cells v) Histamine
1) A - i, B - ii, C - v, D - i, E - iv 2) A - iii, B - ii, C - iv, D - v, E - i
3) A - ii, B - iii, C - iv, D - i, E - v 4) A - ii, B - iv, C - v, D - iii, E – i
157. Which of the following statements are true for catecholamines?
a) Steroid hormones
b) They generate second messengers in target cells
c) Hormones of fight or flight
d) They stimulate glycogenesis and gluconeogenesis
e) They suppress immune responses
1) b, c, d 2) a, e only 3) b, c only 4) a, d, e
158. Statement I: The release of Ca 2  ions from sarcoplasmic reticulum into
sarcoplasm initiates muscle contraction.
Statement II: Ca ions bind to active sites of actin.
159. Assertion (A): Uncontrolled growth of cancer cells is due to contact inhibition.
Reason (R): Cancer cells exhibit the most feared property called metastasis.
3) A is false but R is true 4) A is true but R is false
160. Which of the following STD is not completely curable?
1) Gonorrhoea 2) Syphilis 3) Genital herpes 4) Genital warts
161. According to Hugo devries speciation is caused by
1) Directional variation 2) Single step large mutation
3) Minor, gradual variations 4) Heritable acquired characters
162. Choose the option with correct description for the first genetically engineered
insulin.
1) It elicits immune response 2) C peptide is removed during maturation
3) Chains A and B were combined by creating diester bonds
4) The two DNA sequences were introduced into separate plasmids of E.coli
163. Match List - I with List - II and choose correct set.
List-I List-II
A) Placenta i) Progesterone
B) Endometrium ii) Colostrum
C) Corpus luteum iii) Testosterone
D) Leydig cells iv) Human chorionic gonadotropin
E) Mammary glands v) Implantation
1) A - iv, B - v, C - i, D - iii, E - ii 2) A - iv, B - ii, C - i, D - v, E - ii
3) A - iv, B - i, c - ii, D - iii, E - v 4) A - iv, B - ii, C - iii, D - i, E - v
164. Highest biodiversity is seen in
1) Beetles 2) Fishes 3) Orchids 4) Ants

165. Which of the following statements is correct for human heart?
1) The A-V valves open due to the decreased pressure exerted by the contraction
of atria
2) Decline in ventricular pressure causes opening of semilunar valves
3) The bicuspid and tricuspid valves close due to increased pressure exerted by
the contraction of ventricles
4) 'Dub' sound is associated with closure of semilunar valves during ventricular
systole
166. Metagenesis is seen in which animal?
1) Devil fish 2) Star fish 3) Jelly fish 4) Saw fish
167. If a colour blind man marries a normal woman whose mother is colour blind,
what are the chances of their progeny having colour blindness?
1) 50% 2) 25% 3) 75% 4) 0%
168. Match List-I with List- II and choose the correct set.
A) Natural killer cells i) Immunodeficiency
B) HIV ii) Autoimmunity
C) Antivenom iii) Passive immunity
D) Hepatitis B vaccine iv) Active immunity
E) Rheumatoid arthritis v) Innate immunity
1) A - v, B - ii, C - iii, D - i, E - iv 2) A - v, B - ii, C - iii, D - iv, E - i
3) A - v, B - iv, C - iii, D - i, E - ii 4) A - v, B - i, C - iii, D - iv, E – ii
169. Statement I : Net primary productivity is generally lesser than gross secondary
productivity.
Statement II :Plants use some amount of GPP during respiration
3) Statement is correct and statement II is incorrect
170. Identify the hormone with its correct matching of source and function.
1) Oxytocin – Posterior pituitary, growth and maintenance of mammary glands
2) Melatonin-Pineal gland, regulates the normal rhythm of sleep wake cycle
3) Progesterone-Corpus luteum, stimulation of growth and functions of female
secondary sex organs
4) Atrial natriuretic factor-Ventricular wall increases the blood pressure.
171. Select the difrference wich is wrongly written:
Cartilaginous fish Bony fishes
1) Operculum is absent - Operculum is present
2) Fertilization is internal - Fertilization is external
3) Male with claspers - Male without claspers
4) Mostly oviparous - Mostly viviparous
172. Which of the following animals are ureotelic?
1) Aquatic insects, marine fishes 2) Land snails, birds
3) Mammals, cartilage fishes 4) Bony fishes, aquatic amphibians
173. The correct sequence of ducts from inside to outside the mammary gland is:
1) Alveoli→ mammary duct → mammary tubules → mammary ampulla →
lactiferous ducts
2) Alveoli→ mammary tubules→ mammary ampulla → mammary duct →
lactiferous ducts
3) Alveoli→ mammary tubules → mammary duct → mammary ampulla →
lactiferous duct
4) Alveoli → mammary duct → mammary ampulla → mammary tubules →
lactiferous ducts
174. How many matching are correct
a. Cartilaginous joints - Vertebral column
b. Synovial joints - Ball and socket joint c. Synovial joints - Hinge joint
d. Cartilaginous joints - Saddle joint e. Fibrous joint - Pivot joint
1) Two 2) One 3) Four 4) Three
175. Which is a age-related disorder commonly caused by decreased levels of estrogen
1) Myasthenia gravis 2) Muscular dystrophy 3) Osteoporosis 4) Tetany

176. In the given below hormones how many are not secreted by placenta in human
HCG, HPL, Cortisol, Estrogens, Progestogens, Thyroxine, Prolactin
1) 7 2) 6 3) 5 4) 3
177. If a genetic disease is transferred from a phenotypically normal but carrier female
to only some of the male progeny, the disease is;
3) Sex-linked dominant 4) Sex-linked recessive
178. Which one of the following is not a hormone?
1) CCK 2) GIP 3) TCT 4) Pepsin
179. Select the correct statement for the smooth muscle.
1) It is Involuntary and neurogenic 2) Present in visceral organ
3) A type of muscular tissue 4) All
180. Select the correct statement for the given below diagram:
a) Jaw less vertebrate b) Triploblastic animal

c) Coelomate animal d) Cranium and vertebral column are cartilaginous
1) a,b,c,d 2) Only a,b,c 3) Only b,c,d 4) Only c,d
******

: ANSWER KEY:
STD: XII – NEET GT - 12 DATE: 01-01-2024
1 4 11 1 21 1 31 1 41 3
2 2 12 4 22 4 32 1 42 2
3 1 13 1 23 3 33 2 43 4
4 4 14 1 24 4 34 1 44 3
5 2 15 2 25 2 35 1 45 2
6 2 16 3 26 3 36 1
7 1 17 2 27 2 37 ADD
8 4 18 3 28 2 38 1
9 4 19 2 29 1 39 1
10 2 20 3 30 1 40 1
SUB: CHEMISTRY
46 3 56 1 66 1 76 2 86 3
47 4 57 2 67 4 77 1 87 3
48 2 58 2 68 1 78 2 88 1
49 2 59 1 69 1 79 2 89 2
50 3 60 2 70 3 80 1 90 2
51 4 61 2 71 4 81 4
52 2 62 1 72 1 82 1
53 2 63 4 73 ADD 83 1
54 1 64 3 74 1 84 3
55 3 65 4 75 4 85 2
SUB: BOTANY
91 3 101 4 111 1 121 2 131 4
92 2 102 2 112 2 122 2 132 2
93 2 103 4 113 1 123 1 133 3
94 3 104 3 114 3 124 2 134 1
95 3 105 1 115 2 125 1 135 3
96 1 106 1 116 2 126 1
97 3 107 3 117 4 127 4
98 2 108 4 118 4 128 4
99 1 109 1 119 3 129 4
100 2 110 1 120 3 130 3
Topic: SUB: ZOOLOGY
136 2 146 1 156 3 166 3 176 4
137 4 147 2 157 3 167 1 177 4
138 1 148 4 158 2 168 4 178 4
139 4 149 2 159 3 169 2 179 4
140 2 150 1 160 3 170 2 180 1
141 1 151 2 161 2 171 4
142 2 152 1 162 4 172 3
143 2 153 2 163 1 173 3
144 2 154 3 164 1 174 4
145 2 155 3 165 3 175 3

XII- NEET GT - 13
answer sheet.

PHYSICS
CHEMISTRY
BOTANY
ZOOLOGY Mr.VENU
PHYSICS
1. The RMS speed of oxygen molecules in a gas is V. If the temperature is doubled
and the oxygen molecules dissociated into oxygen atoms, the RMS speed will
become
1) V 2) V 2 3) 2V 4) 4V
2. The thickness of a glass plate is measured to be 2.17mm, 2.17mm and 2.18mm
at three different places. The average thickness of plate taking into account
significant figures is
1) 2.175 mm 2) 2.17 mm 3) 2.18 mm 4) 2.00 mm
3. A source x of unknown frequency produces 8 beats with a source of 250 Hz and
12 beats with a source of 270 Hz. The frequency of source x is
1) 258 Hz 2) 242 Hz 3) 262 Hz 4) 282 Hz
4. The dimensional formula of gravitational constant is
2
1) ML T 2 2) M 1 L3T 2 3) M 1 L2T 2 4) ML3T 1
5. A amount Q of heat is added to a monoatomic ideal gas in a process in which the
gas performs a work Q/2 on its surroundings. The molar heat capacity for the
process is
5R 3R
1) 4R 2) 3) 4) 3R
2 2
6. The velocity of the electron in the first Bohr orbit of hydrogen atom as compared
to that of light is about
1) 1/300 2) 1/500 3) 1/137 4) 1/187
7. The frequency and intensity of a light source are both doubled. Consider the
following statements.
A. The saturation photo current remains the same.
B. The maximum kinetic energy of the photoelectrons is doubled.
1) Both A, B are true 2) A is true, B is false
3) A is false, B is true 4) Both A, B are false
8. A spherical volume contains a uniformly distributed charge of density 2  10 4 C/m 3
. The electric field at a point inside the volume at a distance 4cm from centre is
approximately.
1) 3  105 NC 1 2) 3  10 4 NC 1 3) 2  105 NC 1 4) 3  107 NC 1
9. A ray of light passing through an equililateral prism made of a material of
refractive index 1.732 undergoes minimum deviation. The angle of incidence is
1) 30o 2) 60 o 3) 45o 4) 75o
10. A battery of emf 2V and internal resistance 0.5 is connected across a resistance
of 9.5. The number of electrons that cross through a cross-section of the
resistance in 2 seconds is
1) 1.6  1018 2) 5  1018 3) 2.5  1018 4) 6.4  1018
11. The magnetic field B inside a long solenoid carrying a current of 5A is 3.14  102 T .
The number of turns per unit lengths of the solenoid is
1) 2  103 turns/m 2) 8  103 turns/m 3) 3  103 turns/m 4) 5  103 turns/m
12. An electric field of 20 Vm 1 exists along positive X-axis in space. The potential
difference VB – VA between two points A and B given by co-ordinates A(0, 0) and
B(4m, 2m) is given by
1) 40 5V 2) 40V 3) 80V 4) -80V
13. When a drop of oil is spread on a water surface, it displays beautiful colours in
day light because of
1) Dispersion of light 2) Reflection of light
3) Polarization of light 4) Interference of light
14. The equivalent capacitance between X and Y is
1) 5/6 F 2) 7/6 F 3) 8/3 F 4) 1 F

15. A spring-mass system oscillates in a car. If the car accelerates on a horizontal
road, the frequency of oscillation will
1) Increase 2) Decrease 3) Remains same 4) Becomes zero
16. The wire AB shown is 40cm long. Where should the free
end of galvanometer be connected on AB so that the
galvanometer shows null deflection?
1) 24 cm from A
2) 16 cm from A
3) 22 cm from B
4) 18 cm from B
17. The magnetic field B and the magnetic intensity H in a material are found to be
1.6T and 103 Am 1 respectively. The relative permeability r of the material is
6 4
1)  103 2) 2.4  103 3)  103 4) 4  103
 
18. A neutron collides head on elastically with an atom of mass number A, which is
initially at rest. The fraction of kinetic energy retained by neutron is
2 2 2 2
 A   A 1   A 1   A 1
1)   2)   3)   4)  
 A 1  A 1  A   A 1 
19. Two ideal junction diodes D1, D2 are connected as shown in the gigure. A 3V
battery is connected between A and B. The current supplied by the battery if its
positive terminal is connected to A is
1) 0.1A 2) 0.3A 3) 0.9A 4) 90A

1
20. A body rotating at 20 rad s is acted upon by a constant torque providing it a
deceleration of 2 rad s 2 . The time after which the body will have the same kinetic
energy as the initial value if the same torque continues to act
1) 15s 2) 5s 3) 20s 4) 40s
21. A wire of length L carries a current I along the X-axis. A magnetic field exists
 
which is given as B  B0 iˆ  ˆj  kˆ T . The magnetic force acting on the wire is
1) Zero 2) 2B0IL 3) B0IL 4) 2B0 IL
22. A ball is thrown horizontally from a point 100 m above the ground with a speed
of 40 ms 1 . The velocity with which it strikes the ground is  g  10 ms 2 
1) 60 ms 1 2) 80 ms 1 3) 100 ms 1 4) 40 ms 1
23. A mercury drop of radius R splits into 8 identical droplets. If surface tension of
mercury is T, the increase in surface energy is
1) 32 R 2T 2) 2 R 2T 3) 4 R 2T 4) 8 R 2T
24. In a Atwood machine, two masses m and 2m are connected by a string going over
a clamped smooth pulley. The system is released from rest. The distance
travelled by lighter block in first two seconds is
5g 2g 4g g
1) 2) 3) 4)
2 3 3 2
25. An electric bulb is rated 220 volt and 100 watt. Power consumed by it when
operated on 110 volt is
1) 50 watt 2) 75 watt 3) 90 watt 4) 25 watt
26. The energy equivalent of 5g of a substance is
1) 4.5  1013 J 2) 45  1013 J 3) 4.5  1016 J 4) 45  1016 J
27. The logic expression for the given gate is
1) A  0  A 2) A  A  1 3) A  A  0 4) A  A  A

28. The relative permeability of glass is 3/8 and the dielectric constant of glass is 8.
The refractive index of glass is
1) 1.5 2) 1.1414 3) 1.732 4) 1.6
29. When a metal wire of length ‘l’ is stretched by a load, the fractional change in its
V
volume is proportional to
V
2
l  l  l l
1) 2)   3) 4)
l  l  l l
1 1
30. A steel frame of coefficient of thermal conductivity K  45 W m K of length 60cm
has cross-sectional area 0.2 m 2 . The free ends are maintained at 20o C and 40o C
. The rate of heat flow through the frame is
1) 200 W 2) 300 W 3) 450 W 4) 600 W
31. In an unbiased semiconductor diode, the barrier potential opposes the motion of
1) Free electrons from n-region
2) Holes from p-region
3) Majority carries from both P and n regions
4) Minority carries from both P and n regions
32. The main scale of a vernier calipers is calibrated in mm and 19 divisions on
mainscale are equal in length to 20 divisions of vernier scale. In measuring the
diameter of a cylinder by this instrument, the main scale reads 35 divisions and
the 4th division of vernier coinsides with a main scale division. The radius of
cylinder is
1) 3.52 cm 2) 1.76 cm 3) 3.64 cm 4) 1.82 cm
33. The height above the earth’s surface where acceleration due to gravity is 1% less
than its value at the surface (Re = 6400 Km)
1) 16 km 2) 32 km 3) 64 km 4) 32 2 km
34. A and B are two far away points on the axis and perpendicular bisector
respectively for an electric dipole. Let VA and VB be the potentials at A and B
respectively. Then
1) VA = VB 2) VA = 2VB 3) VA  0, VB = 0 4) VA = 0, VB = 0
35. An inductor may store energy in
1) Its electric field 2) Its coils
3) Its magnetic field 4) Both in electric and magnetic fields
36. An inductor coil joined to a 6V battery draws a steady current of 12A. This coil
is connected to a capacitor and an AC source of RMS voltage 6V in series. If the
current is in phase with the emf, the amplitude of current is
1) 6 2A 2) 12A 3) 12 2A 4) 6A
7 4
37. The Binding energy per nucleon of 3 Li and 2 He nuclei are 5.60 MeV and 7.06
MeV respectively. In the nuclear reaction 37 Li  11 H  2 24 He  Q , the vaule of energy
Q released is
1) 2.4 MeV 2) 8.4 MeV 3) 17.3 MeV 4) 19.6 MeV
38. Three coherent waves having amplitudes 12mm, 6mm and 4mm arrive at a given
point with successive phase difference of /2. Then, the amplitude of the
resultant wave is
1) 7 mm 2) 10 mm 3) 5 mm 4) 4.8 mm
39. One kg of ice at 0 C is mixed with one kg of steam at 100o C . At thermal
o
equilibrium the mass of water in the mixture is

4 1
1) 1 kg 2) 2 kg 3) kg 4) kg
3 3
40. A hemispherical smooth bowl of radius R is set rotating about its axis of symmetry
which is kept vertical. A small block kept in the bowl rotates with the bowl
without slipping on its surface. If ‘’ is the angular position of block with the
vertical, the angular speed of rotation of bowl is
g cos  g sin  g g
1) 2) 3) 4)
R R R sin  R cos 

41. Two cylinders A and B are equal capacity are connected to each other via a stop
cock. A contains an ideal gas at standard temperature and pressure, B is
completely evacuated. The entire system is thermally insulated. The stop cock
is suddenly opened. The process is
1) Isobaric 2) Isothermal 3) Adiabatic 4) Isochoric
42. A black body at 127 C emits the energy at the rate of 10 J/m 2s . The temperture of
o 6
a black body at which the rate of energy emission is 16  106 J/m 2s is

1) 508oC 2) 273o C 3) 400o C 4) 527 o C
Column-A Column-B
a) Quality factor (e) 1 2
LI
2
b) Self induction coefficient (f) VI cos 
c) Average power (g) L0 / R
d) Magnetic energy (h) 
 dI / dt 
Codes:
a b c d a b c d
1) g f h e 2) f e h g
3) g h f e 4) e f g h
44. A converging lens of focal length 60 cm is placed infront of and coaxially with a
convex mirror of focal length 10cm. Their separation is d. If a parallel beam of
light incident on lens returns as a parallel beam, then d is
1) 100 cm 2) 20 cm 3) 40 cm 4) 10 cm
45. Monochromatic radiation of wavelength  is incident on a hydrogen smaple in
gorund state. Hydrogen aotms absorb energy and subsequently emit radition of
six different wavelengths. The energy of the incident radiation is
1) 0.85 eV 2) 12.75 eV 3) 108.8 eV 4) 10.2 eV
CHEMISTRY
46. Statement-I: Acetophenone shows aldol condensation.
Statement-II: Acetophenone contain carbonyl group.
47. According to molecular orbital theory, wich of the following does not exist.
1) He22 2) He2 3) He2 4) H 2
48. In the following there are three carbon-oxygen bonds denoted by x, y, z.
O
x . Theire length are in order
CH 3  C  O  CH 3
y z
1) x = y < z 2) x < y < z 3) x = y = z 4) x < y = z

o
49. The minimum number of 90 angles between hybrid orbitals is observed in which
of the following?
1) sp 3 d 2 2) d 2 sp 3 3) dsp 2 4) sp 3 d
50. The compound which cannot reduce Fehling’s solution
1) HCHO 2) CH3COOH 3) HCOOH 4) CH3CHO
51.  BaO s   O2 g  , H  ve , at equilibrium, pressure of O2 depends upon
BaO2 s  
1) Increase in mass of BaO2 2) Increase in mass of BaO
3) Increase in temperature at equilibrium 4) Increase mass of both BaO2 and BaO
52. The increasing order of basicity of the following compound is
1) b < c < a 2) b < a < c 3) c < a < b 4) c < b < a

53. Ph  O  CH 3  HI   product
in the above reaction product and mechanism is
1) CH 3 I , SN 1 2) CH 3 I , SN 2 3) PhI , SN 1 4) PhI , SN 2
54. For a reaction A  2B, rate of disappearance of A is related to the rate of
appearance of B by the expression
d  A d  B d  A 1 d  B  d  A 1 d  B  d  A d  B
1)  4 2)   3)   4)  
dt dt dt 2 dt dt 4 dt dt dt
55. For the following three reactions i,ii and iii equilibrium constants are given
 CO2 g   H 2 g  ; k1
(i) CO g   H 2O g  
 CO g   3H 2 ; k2
(ii) CH 4 g   H 2O g  
 CO2 g   4 H 2 g  ; k3
(iii) CH 4 g   2 H 2O g  
which of following relation is correct?
1) k3k 23  k12 2) k1 k2  k3 3) k2 .k3  k1 4) k3  k1.k2
56. Wrong statement among the following :
1) In slightly alkaline medium 1-mole KMnO4 can oxidize 3/8 moles of thio
sulphate ions
2) In neutral medium for oxidation of manganous salt by KMnO4, zinc sulphate
acts as catalyst
3) In dichromate ion, all Cr – O bond lengths are not equal, where as in chromate
ion all Cr – O bond lengths are equal
4) Manganate ion is purple in colour and paramagnetic where as permanganate
ion is green in colour and diamagnetic
57. During Lassaigne’s test S and N both are present in an organic compound charge
into
1) NaSCN 2) NaCN 3) Na2S 4) Na2SO4
58. Statement-I: BF3 is a nonpolar molecule.
Statement-II: BF3 contains non-polar bonds.
59. The conjugate acid of NH 2 is
1) NH3 2) NH2OH 3) NH 4 4) N2H4
60. Which one of the following is an outer orbital complex and exhibits paramagnetic
behavior?
2 2 3 3
1)  Ni  NH 3 6  2)  Zn  NH 3 4  3) Cr  NH 3 6  4) Co  NH 3 6 
 CH 3 2 CH  CH  CH  CHOH  CH 3
1) 5-methylhex-3-en-2-ol 2) 2-methylbex-3-en-5-ol
3) 2-hydroxy-5-methyl-3-hexene 4) 5-hydroxy-2-methyl-3-hexene
62. The volume of 0.1M oxalic acid that can be completely oxidised by 20ml of 0.025M
KMnO4 in acidic medium is
1) 125ml 2) 25ml 3) 37.5ml 4) 12.5ml
63. Which of the following will not react with Tollen’s reagent?
1) D-mannose 2) D-fructose 3) Sucrose 4) Lactose
64. Which of the following pair of transitin metal ions, have the same calculated value
of spin only magnetic moment?
1) Ti 2 and V 2 2) Fe 2 and Cu 2 3) Cr 2 and Fe 2 4) Co 2 and Ti 2
65. Which of the following reactions is not an example of dispraportionation reaction?
1) Decomposition of HNO2
2) Decomposition of Cu  ion in aqueous medium
3) MnO42 ion in acidic medium
4) Thermal decomposition of KMnO4 at 513K

66. Which of the follwiong molecules have allylic carbon?
1) CH 3  CH  CH  CH 2  Cl 2) CH 2  CH  CH 2  Cl
3) 4) All the above
67. Name and catalyst of the following reaction is

O
CH 3  C  Cl 
 CH 3  CHO
1) Stephen reaction, H 2  Pd/BaSO4
2) Rosenmund reduction - SnCl2 / HCl  H 3O 
3) Rosenmund reduction - H 2  Pd  BaSO4
4) Etard reaction - CrO2Cl2 / CS2
68. The total number of atomic orbitals in fourth energy level of an atom is
1) 32 2) 8 3) 4 4) 16
69. Oxidation number of carbon in C3O2 are
1) 0 and +2 2) +2 and -2 3) 0 and +4 4) -2 and 0
70.  CO2 g  , H1  94 kJ mole1
C s   O2 g  
 2CO2 g  , H 2  136 kJ mole 1
2CO g   O2 g  
the heat of formation of CO will be
1) 52 kJ 2) -52 kJ 3) 26 kJ 4) -26 kJ
71. Which of the following colligative property is widely used for determination of
molar masses of macro molecules like protein?
1) Vapour pressure 2) Elevation in boiling point
3) Depression in freezing point 4) Osmatic pressure
 B  major 
CH 3OH  excess 
72. CH 3CH 2CN 
DIBAL-H
H 2O
 A  HCl
major product B is
1) Ester 2) Acetal 3) Ketal 4) Hemiketal
73. In which of the following reactions major product obtained can be resolvable.
1) CH 3CH  CH 3  CH  CH 2  HCl 
R2O2
 2) CH 3CH  CH 3  CH  CH 2 
B2 H 6 THF
H O / OH 

2 2
(1) HCl 1 mole 

3) C6 H 6 

(1) C2 H 5Cl / AlCl3
(2) NBS/h
4) CH 3  C  CH 
(2) ICl 1 mole 
74. For a reaction to occur spontaneously

1) H must be negative 2) H - TS must be negative
3) H + TS must be negative 4) TS must be negative
75. The dihydrogen phosphate of certain metal has formula MH2PO4. Then the
formula of the metal chloride is
1) MCl 2) MCl2 3) M2Cl3 4) MCl3
76. Which of the following carbanion is most stable?
..
⊖
..
⊖ ⊖.. ..
⊖
1) 2) CH3 – CH – CH3 3) CH2 = CH – CH2 4) Cl – C – Cl
Cl
77. Which of following is colourless in its aqueous solution?
1) Cr 3 2) Sc 3 3) Mn 4 4) V 3
78. Number of bridged CO groups in CO2(CO)8.
1) 3 2) 1 3) 2 4) Zero
79. The molar conductivity HCl is greater than NaCl at a particular temperature
because
1) Molecular mass of HCl is greater than NaCl
2) HCl has higher pKa value
3) Mobility of H  ion is more than that of Na  ions
4) Ionisation of HCl is lesser than NaCl

80. CaC2  H 2O 
 A 
H 2 SO4
HgSO4
 B 
rearrangement
 C , find A and C in the above reaction.
1) C2H2 and CH3COOH 2) C2H4 and CH3COOH
3) CH4 and HCOOH 4) C2H2 and CH3CHO
81. The vant Hoff factor of 0.005m KCl is 1.95. The degree of ionization of KCl is
1) 0.95 2) 0.97 3) 0.90 4) 0.99
82. Which of the following react with alk.KMnO4 but does not react with ammonical
AgNO3?
1) C2H6 2) C6H6 3) C2H4 4) C2H2
83. Which of the following has lower pKa?
OH OH OH OH
1) 2) 3) 4)
NO2
NO2 OCH3
84. Which of following quantum number set is not possible?
1) n=3, l=0, m=0 2) n=3, l=1, m=-1 3) n=2, l=0, m=-1 4) n=2, l=1, m=-1
85. One faraday electricity deposits _____ during electrolysis.
1) 23g sodium 2) 12g magnesium
3) 9g aluminium 4) all the above
86. At certain temperture, the solution of benzene in toluene exhibits vapour pressure
(in m bar) as P = 150x + 65, where x is mole fraction of benzene, the vapour
pressure of pure benzene
1) 150 m bar 2) 215 m bar 3) 90 m bar 4) 65 m bar
o
87. I. Sc has negative value of EM 3 / M 2
II. Co has higher positive value of EMo 3 / M 2
III. Mn has lower positive value of EMo 3 / M 2 than Fe.
the correct set of statements is
1) I and II only 2) I, II, III 3) I and III only 4) II and III only
88. Which of the following on reaction with Grignard reagent followed by hydrolysis
form alcohol?
1) HCHO 2) CH3CHO 3) CH3COCH3 4) All of these
89. Which compound donot react with open chain form of glucose?
1) HCN 2) NH3 3) NaHSO3 4) Both 2 and 3
14
90. C6 H 5 C OOH on heating with NaHCO3 releases
14
1) C O2 2) CO2 3) CO 4) H2
BIOLOGY
91. Among these, how many belong to class ascomycetes?
Saccharomyces, Rhizopus, Pencillium, Albugo, Puccinia, Claviceps,
Ustilago, Aspergillus, Neurospora
1] 4 2] 5 3] 6 4] 7
92. Find the correct statement:
I) Contagium vivum fluidum is II) Cr-Jacob disease caused by
III) Neurological disease caused by IV) Potato spindle tuber disease caused by
The above statements are assigned to
1) Prion-III only, Virus-I only, Viroid-II and IV
2) Prion-IV only, Virus-III only, Viroid-I and IV
3) Prion-II only, Virus-I only, Viroid-Ill and IV
4) Prion-II and III, Virus-I only, Viroid-IV only
93. Which of the following is correct about bryophytes?
1) Fertilization takes place in the presence of water by non-motile male gametes
2) The female sex organ called archegonium is flask shaped and produces two
eggs
3) Sporophyte undergo reduction division (meiosis) to produce haploid spore
4) Mosses along with marchantia are the first organisms to colonise rocks
94. If the chromosome number in the leaf of funaria is 10. What will be the
chromosome number in the spores and seta respectively?
1) 20 and 10 2) 10 and 20 3) 10 and 10 4) 20 and 20

95. The correct floral formula of Trifolium is
1) % K5 C1+2+2 A9+1 G1 2) % K5 C1+2+(2) A9+1 G2
3) % K(5) C1+2+(2) A(9)+1 G1 4) % K5 C1+(2)+(2) A(9)+1 G2

96. Match the following and find the correct option:
Column-I Column-II
a) Imbricate aestivation i) Tomato
b) Axile placentation ii) Gulmohur
c) Zygomorphic symmetry iii) Rose
d) Apocarpous ovary iv) Cassia
1) a-ii, b-i, c-iv, d-iii 2) a-i, b-ii, c – iii, d-iv
3) a-ii, b-iii, c-i, d-iv 4) a-ii, b-iv, c-i, d-iii
97. I. Epicarp is thin; II. Mesocarp is fleshy and edible; III. Endocarp is stony
hard
These are features of
1) Mango 2) Coconut 3) Both (1) and (2) 4) Brinjal
98. Identify the incorrect statement/s
I) Open vascular bundles do not have the cambium
II) Closed vascular bundles do not have the cambium
III) Open vascular bundles have the cambium
IV) Closed vascular bundles have the cambium
1) I and ll 2) II and III 3) III and IV 4) I and IV
99. From the below statements, how many belong to dicot stem
P) Vascular bundles are conjoint and closed
Q) Tender stem, which possess chloroplast
R) Endodermis are rich in starch
T) Casparian strips are present in the endodermis
S) Vascular bundles are arranged in a ring
1) 2 2) 3 3) 4 4) 5
100. The prokaryotic cell type cell organelle present in eukaryotic cell is/are
a) Lysosome b) Mitochondria c) Plastid d) Ribosome
1) (a) and (b) 2) (b) and (c) 3) (c) and (d) 4) (a) and (d)
101. In prokaryotes, ribosomes are about in size
1) 15 nm by 20 nm 2) 15 pm by 20 pm
3) 15 nm by 20 pm 4) 15 A° by 20 A°
102. Find the correct statement/s:
a) Inclusion bodies: bound by membrane system
b) Inclusion bodies not bound by membrane system
c) Na+/K+ pump is the type of active transport pump
d) Mitochondrial matrix possess 70S ribosome
1) (a), (c) and (d) 2) (b), (c) and (d) 3) Only (b) and (c) 4) Only (b) and (d)
103. Match the Column-I with Column-II and find the correct option:
Column-I Column-II
p) Perinuclear space i) 9 peripheral triplets
q) Length of chloroplast ii) 10-50 nm
r) Centrioles iii) 9 peripheral doublets
s) Flagellum iv) 5-10 μm ( micro metre)
1) p-iv, q-ii, r-i, s-iii 2) p-iv, q-ii, r-iii, s-i
3) p-ii, q-iv, r-i, s-iii 4) p-ii, q-iv, r-iii, s-i
104. If glycogen polymer has 199 glucose monomers how many glycosidic bonds are
present in the given polymer
1) 198 2) 199 3) 197 4) 200
105. Adult human haemoglobin consists of
1) 4 subunits, 2 alpha, 1 beta and 1 gamma
2) 4 subunits, 2 alpha and 2 beta
3) 4 subunits, 2 beta, 1 alpha and 1 gamma
4) 8 subunits, 4 alpha and 4 beta
106. Select the incorrect matching for component percentage of cell
1) Nucleic acid → 5-7% 2) Carbohydrates → 3%
3) Proteins → 20% 4) Lipids → 2%

107. Select the correct option with respect to mitosis:
a) Chromatids starts replicating at early of prophase
b) Golgi complex and endoplasmic reticulum disappear at prophase
c) Centrioles are moved to spindle equator and get aligned along metaphase plate
d) Nucleolus, golgi complex and ER reforms at telophase
1) (a) and (b) 2) (b) and (d) 3) (a) and (c) 4) (a) and (d)
108. If cell has 16 chromosome at one pole of anaphase—I how many chromosome are
present in S phase (Q), G1 phase (P) and metaphase II (R)
1) P-32, Q-16, R-32 2) P-32, Q-32, R-16
3) P-16, Q-16, R-32 4) P-32, Q-16, R-16
109. In which of the following stages of the cell cycle chromosome number becomes
half
1) Anaphase 2) Anaphase-II 3) Anaphase-I 4) Both (1) and (3)
110. In glycolysis, which of the given steps involves ATP utilisation?
(1) Glucose-6-phosphate →Fructose-6-phosphate
(2) Glyceraldehyde-3-phosphate →1,3, bisphosphoglyceric acid
(3) Fructose-6-phosphate →Fructose 1,6-bisphosphate
(4) 1,3 bisphosphoglyceric acid →3-phosphoglyceric acid
111. Select the correct statements regarding enzyme RuBisCO
a) Can be called as RuBp carboxylase-oxygenase
b) Not present in mesophyll cells of the C4 plants
c) Present in mesophyll cells of the C3 plants
d) Present at bundle sheath cells of the C4 plants
1) (a) and (b) only 2) (a), (b) and (c) only
3) (a) and (c) only 4) (a), (b), (c) and (d)
112. 27 ATP and 18 NADPH molecules are utilised in Calvin cycle, how many carbon
dioxide molecules are fixed through the cycle?
1) 9 2) 6 3) 8 4) 10
113. Which of the following is true regarding glycolysis?
P) Takes place in cytoplasm of the bacteriophage
Q) Has no connection with complex II of the ETS
R) Reduces 2 molecules of NADP+ for every glucose molecule
S) The end product of the glycolysis has 3 carbons
1) P and Q 2) Q and R 3) Q and S 4) R and S
114. Mobile electron carriers in ETS in mitochondria
1) Cytochrome a 2) Cytochrome a3 3) Cytochrome c 4) Cytochrome C1
115. What are the substrates for the ATP synthase?
1) Only ADP 2) ADP + Pi 3) Only ATP 4) H+ (protons)
116. Find the incorrect statements:
a) IAA and NAA are natural auxins
b) N7 — furfuryl amino purine is adenine derivative
c) ABA stimulates the closure of stomata only at night time
d) Ethylene promotes female flowers in cucumbers
1) (a), (b) and (c) 2) (a), (b), (d) 3) (a), (c) and (d) 4) (b), (c) and (d)
117. Assertion (A): Decapitation usually results in the growth of lateral buds
Reason (R): The growing apical bud inhibits the growth of lateral buds
1) Both (A) and (R) are true, (R) is the correct explanation of (A)
2) Both (A) and (R) are true, (R) is not the correct explanation of (A)
3) (A) is true, (R) is false 4) Both (A) and (R) are false
118. How many meiotic division are required to produce 208 zygotes in angiospermic
plants?
1) 200 2) 260 3) 104 4) 240
119. Find the correct matching:
1) Maize, Pea-Albuminous seeds 2) Polyembryony-Citrus, Grasses
3) Parasitic plants-Orobanche, Striga
4) False fruits-Cashew, Mango
120. Assertion (A): Bryophytes and pteridophytes need water for the fertilisation
Reason (R): Male and female gametes transport through the water

121. A cross between round seeded, tall plant and round seeded, dwarf plant produced
the following offsprings. Find the genotype of parent
160 Tall plant T-Tall plant
160 Dwarf plant t-Dwarf plant
240 Round seeded R-Round seed
80 Wrinkled seeded r- Wrinkled seed
1) TtRr x RrTT 2) RrTt x Rrtt 3) RrTT x RRtt 4) TTRR x ttrr
122. A woman with blood group '0' has a child with blood group '0'. If she claims a
husband of hers with blood group 'A' as father of the child. The genotype of the
father should be
1) 1A1A 2) 1A1B 3) 1A10 4) 1B10
123. Assertion (A): The strength of linkage will be more when distance between two
genes is greater
Reason (R): Crossing over will be relatively less frequent for distantly located
genes
124. A certain plant homozygous for yellow seeds and red flowers was crossed with a
plant homozygous for gree seeds and white flowers. The F1 plants had yellow
seeds and pink flowers. The F1 plants were selfed to get F2 progeny. Assuming
independent assortment of the two characters, how many phenotypic categories
are expected for these characters in the F2 generation?
1) 9 2) 16 3) 4 4) 6
125. 3'AAATGCGCGATA5' (Template) is the sequence of nucleotides on a gene, after
transcription, the mRNA formed against it and the sequence of bases in the
corresponding codons and anticodons will be
1) 5'UAUCGCGCAUUU3' and 3'AUA-GCG-CGU-AAA5'
2) 5'UUUACGCGCUUU3' and 3'AUG-CGU-GCG-AAA5'
3) 5'UUUACGCGCUAU3' and 3'AAA-UGC-GCG-AUA5'
4) 5'UAUGUGCCAUUU3' and 3'AUA-UGC-GCG-AUA5'
126. Which one of the following is wrongly matched?
1) Transcription-writing information from DNA to t-RNA
2) Translation-using information in m-RNA to make protein
3) Repressor protein-binds to operator to stop enzyme synthesis
4) In Lacoperon, permease helps in hydrolysis of lactose into glucose and
galactose.
127. Match Column-I with Column-II and find the correct option:
Column-I Column-II
P) Hershey and Chase i) 1933-44
Q) Avery, MacLead and McCarty ii) 1928
R) Meselson and Stahl iii) 1958
S) Frederick Griffith iv) 1952
1) P-iii, Q-i, R-iv, S-ii 2) P-iv, Q-i, R – iii, S-ii
3) P-iv, Q – iii, R-i, S-ii 4) P-iii, Q-iv, R-i, S-ii

128. Bacteria grown in 15N for many generations were transferred to 14N for further
replication. DNA from the bacteria was extracted and separated by density
gradient centrifugation. Their results are summarised in the following diagram.
What are the percentages of DNA containing 15N and 14N in tube 4?
PERCENTAGE DNA
15N14N 14N14N
1 0 100
2 10 90
3 25 75
4 15 85
129. Consider the statements regarding lac operon and choose the correct option:
(I) Lactose is the substrate for the enzyme beta-galactosidase and regulates
'switching on and off' of the operon
(II) Lac operon consists of three regulatory genes
(III) Lac operon consists of one structural gene
(IV) Regulation of lac operon by repressor is referred to as positive regulation
1) (I) and (II) only are correct 2) (III) and (IV) only are correct
3) (I) only is correct 4) (IV) only is correct
130. Assertion (A): Selectable marker is meant for distinguishing a recombinant from
non-recombinant
Reason (R): The recombinants can flourish in medium having both ampicillin
and tetracycline, while the non-recombinants cannot
131. What, would the effect on the PCR reaction if taq polymerase not added to the
PCR mixture?
Find the correct option
P) PCR would proceed normally Q) The denaturation of DNA will occur
R) The PCR reaction will begin S) Primer will not bind to the template
1) P and Q 2) Q and R 3) R and S 4) Q and S
132. Observe the below agrose gel electrolphoresis image. Find out the correct option
regarding type of DNA and number of restriction sites
1) S-Lane DNA was circular and had 4 restrictions sites for enzyme
2) R-Lane DNA was linear and had 3 restriction sites for enzyme
3) P-Lane DNA was linear and had 3 restriction sites for enzyme
4) Q-Lane DNA was linear and had 3 restriction sites for the enzyme
133. The enzyme required to breakdown of fungal cell wall is
1) Chitinase 2) Cellulase 3) Protease 4) Both (2) and (3)

134. Find the correct statements regarding Bt (Bacillus thuringeinsis)
P) Scientists have introduced B. thuringeinsis non toxin genes into plants
Q) Available in sachets as dried spores which are mixed with kerosene and
sprayed onto vulnerable plants
R) Introduced in order to control butterfly caterpillars
S) The toxin is released in the gut of the larvae
1) P and Q 2) Q and R 3) R and S 4) P and S
Column-I Column-II
P) Blood cholesterol lowering agent i) Streptokinase
Q) Organ transplant patient ii) Statins
R) Myocardial infarction iii) Antibiotics
S) To treat wounded soldiers iv) Cyclosporin A
1) P-ii, Q-iii, R-iv, S-i 2) P-ii, Q-iv, R-i, S-iii
3) P-iv, Q-ii, R-i, S-iii 4) P-ii, Q-iv, R-iii, S-i
136. Read the following:
(i) As we go higher from species to kingdom, the number of common
characteristics goes on decreasing.
(ii) Lower the taxa, more are the characteristics that the members within the taxon
share.
Options:
1) (i) is true, (ii) is false 2) (i) is false, (ii) is true
3) Both (i) & (ii) are true 4) Both (i) & (ii) are false
137. Find out not true statement w.r.t. silkworm.
1) Bilateral symmetry, coelomate 2) Open circulatory system
3) Oviparous 4) Sense organs like eyes are absent
138. Respiration is by gills, lungs and thorugh skin takes place in
1) Hyla 2) Clarias 3) Naja 4) Neophron
139. Reptiles are characterized by the _____
1) Presence of crop & gizzard in digestive tract
2) Presence of dry & cornified skin
3) Presence of fins & scales 4) Exhibition of viviparity
140. In cockroach, supra-oesophageal ganglion supplies nerves to _____
1) Brain 2) Wings & legs
3) Antennae & compound eyes 4) Whole body parts
141. Male and female cockroaches can be differentiated by the following all, except
____
1) Length of wings 2) Thread like anal styles
3) Shape of 7 sternum of abdomen 4) Eye vision
th
142. How many ureters (or) urinogenital ducts emerge from both the kidneys in the
male frog?
1) Two pairs 2) Zero 3) Only one 4) Two
143. The maximum amount of air that a person can breathe out after a forced
inspiration, under normal physiological conditions, would be about _____
1) 1600 ml 2) 2300 ml 3) 4500 ml 4) 6000 to 8000 ml
144. Oxygen dissociation curve is sigmoid shaped, obtained when ______
1) % saturation of Hb with CO2 is plotted against the pO2
2) % saturation of Hb with O2 is plotted against the pCO2
3) % saturation of Hb with O2 is plotted against the pO2
4) The tissue damage occurs in our body.
145. ABO grouping is based on the presence or absence of ____________
1) Two surface antigens present on the leucocytes
2) Three surface antigens present on the RBCs
3) Three surface antigens present on the leucocytes
4) Two surface antigens present on the RBCs

146. Read the following statements and answer (T/F)
A) The entire heart consists of cardiac muscles, epithelical tissue, connective
tissue and nervous tissue
B) Atrial contraction increases the flow of blood into blood vessels by about 30%
C) For a detailed evaluation of the heart’s function through ECG, multiple leads
are attached to the chest region.
D) Blood pumped by the right ventricle enters the aorta.
A B C D
1) T F T T
2) T F T F
3) T T T T
4) F T T F
147. When the heart stops beating, it is called ____________

1) Heart failure 2) Heart attack 3) Cardiac arrest 4) CAD
148. Observe the figure given below.
Find correct option for ‘A’

1) Has blood with plasma proteins only
2) Has blood with excretory waste product urea in high amount
3) Has blood with excretory waste product NH3 in high amount
4) Is forming renal tubules & vasa recta
149. Statement – I: Both ADH & Aldosterone can cause an increase and decrease
blood pressure.
Statement – II: Various conditions can affect the characteristics of urine.
1) Both Statement-I and Statement-II are true.
2) Both Statement-I and Statement-II are false.
3) Statement-I is true, but Statement-II is false.
4) Statement-I is false, but Statement-II is true.
150. Statement – I: The flow of blood in the two limbs of LH is in opposite directions.
Statement – II: Counter current mechanism helps to maintain concentration
gradient in the cortex of kidney.
151. A motor unit is best described as _____
1) All the nerve fibres and muscle fibres in a single muscle bundle
2) One muscle fibre and its single nerve fibre
3) A motor neuron along with the muscle fibres connected to it.
4) The neuron which carries the message from muscle to CNS
152. Which one of the following is paired bone?
1) Mandible bone 2) Frontal bone 3) Ethmoid bone 4) Maxilla

153. “A” restores the resting potential of the membrane (Axon) at the site of
excitation and the fibre becomes once more responsive to “B” .
A B
1) Na+ influx K+ out flux
2) K+ outflux Further stimutation
3) Na+ influx Further inhibition
4) K+ influx Na+ out flux
154. Which one of the following is not correct for cerebellum?
1) Cerebellum has very convoluted surface
2) It doesnot provide additional space for neurons
3) Structurally similar with cerebrum as – outer grey matter and inner white
matter
4) Second largest part of human brain
155. Which hormone supports the process of RBC formation?
1) Thymosin 2) Aldosterone 3) CCK 4) Tri iodothyronine
156. Which hormonal deficiency is responsible for the following:
a) Altered carbohydrate metabolism b) Acute weakness c) Fatigue
1) Insulin 2) T3 & T4 3) Adrenal cortical hormones 4) GIP
157. Observe the figure given below:
Find out correct label for D and F

1) D-Mammary ampulla, F-Mammary duct
2) D- Mammary duct, F- Mammary ampulla
3) D- Mammary duct, F- Lactiferous duct
4) D- Mammary lobe, F- Lactiferous duct
158. Findout correct match.
1) FSH & LH attain a peak level–post ovulatory phase
2) 44AA+XX - formed by the fusion of Y-chromosome containing sperm with egg
cell
3) External genital organs developed in foetus – 6th month
4) Colostrum – develop resistance for the new-born babies
159. Contraceptive injections used for female are _______
1) Progestogens alone 2) Progestogen + Progesterone combinations
3) Estrogen + Prolactin combinations 4) Estrogens + Cu releasing IUDs
160. Which of the following will deter STIs infected persons from going for timely
detection & proper treatment.
1) Absence (or) less significant symptoms in the early stages
2) Social stigma attached to the STIs
3) Infertility 4) Both 1 & 2
161. Statement – I : Besides the involvement of multiple genes, polygenic inheritance
also takes into account the influence of environment.
Statement – II : Henking could trace a specific nuclear structure all through
oogenesis in insects.

162. Observe the given pedigree,
Find out correct analysis for above given pedigree.

1) From both normal parents, affected progeny produced
2)  -Thalassemia is generally predicted as above
3) Genetic disorder inherited from carrier female parent to male progeny like
colour blindness
4) The given pedigree is about Haemophilia
163. Many loops on finger tips are identified in the following genetic disorder
1) Turner’s syndrome 2) Klinefelter’s syndrome
3) Down’s syndrome 4) Phenylketonuria
164. How much % of genome does not code for proteins in human?
1) Less than 2% 2) 50% 3) More than 98% 4) 0.1%
165. The DNA – finger-printing includes _____
I) Isolation of DNA II) ARG (Auto Radiography)
III) Hybridisation using labelled VNTR probe
IV) Digestion of DNA by RENs.
V) Blotting of separated DNA fragments to Nylon membrane
VI) Electrophoresis
Arrange them in correct order
1) II →I→III→IV→V→VI 2) I→IV→VI→V→III→II
3) IV → I→VI→V→III→II 4) I→IV→V→VI→III→II
166. Which analysis indicating chemical evolution occurring else where in space (like
happened in ocean water)
1) S.Miller’s experiment 2) Oparin & Haldane theory
3) Panspermia theory 4) Meteorite content
A) A study of fossils in different sedimentary layers indicates the geological period
in which they existed.
B) Forelimbs of whales, birds, cheetah and human share functional similarity
C) The count of melanic moths were high at rural areas but lower at industrial
areas
D) Lemur & Numbat both appears similar and shows convergent evolution.
How many statement(s) is/are correct?
168. We describe evolution as a process, when _____
1) We describe the universe
2) We describe the story of this world
3) We describe the story of life on earth
4) Unknown process of variations
169. Assertion (A) : Due to continental drift South America joined North America.
Reason (R) : Pouched mammals of Australia survived because of lack of
competition from any other mammal.

170. Observe the figure given below (stage in the life cycle of Plasmodium affected
RBCs):
Which is correct?
1) RBCs affected by sporozoite
2) Parasite reproduce sexually
3) Causing cycles of fever and other symptoms
4) Parasite reproduce asexually in vector’s RBCs
171. Assertion (A) : Tissue matching, blood group matching and taking immuno –
suppressants are essential before undertaking any graft.
Reason (R) : The body is able to differentiate self & non-self cells/organs.
3) A is incorrect but R is correct 4) A is correct but R is incorrect.
172. How to detect genes in individuals with inherited susceptibility to certain
cancers?
1) Histopathology 2) MRI
3) Antibody-antigen test 4) Molecular biology techniques
173. Excessive doses of drugs may lead to coma and death due to all except _____
1) Respiratory failure 2) Heart failure
3) Heart attack 4) Cerebral hemorrhage
174. Permanent cure to treat ADA-deffciency is ____
1) Bone marrow transplantation 2) Enzyme replacement therapy
3) Gene therapy at embryonic stages
4) Periodic infusion of genetically engineered lymphocytes
175. If a new habitat is just being colonized, which factor will contribute more
significant growth in population?
1) Birth rate 2) Emmigration 3) Death rate + immigration 4) Immigration
176. Assertion (A) : The life cycles of endoparasites are more complex
Reason (R) : Their reproductive potential is greatly simplified.
177. Which factor is not favour for decomposition?
1) Warm environment 2) Moist environment
3) Nitrogen rich detritus 4) Anaerobiosis
178. Pyramid of biomass shows a sharp decrease in biomass at _____
1) Higher altitudes 2) Lower trophic levels
3) Higher trophic levels 4) All of the above
179. What is so special about tropics that might account for their greater biological
diversity?
1) Subjected to frequent glaciations
2) Less seasonal & less constant environment
3) Remained undisturbed for millions of years
4) More solar energy available & less productivity
(A) Air plane (I) Threat to ecosystem
(B) Popping a rivet (II) Ecosystem
(C) Loss of rivets on wing (III) Species extinction
(D) Threat to flight safety (IV) Loss of key species
.
(V) Weakening of ecosystem
.
(A) (B) (C) (D) (A) (B) (C) (D)

1) II V IV I 2) II I III V
3) II III IV I 4) II III V IV

: ANSWER KEY:
STD: XII – NEET GT - 13 DATE :01-01-2024
1 3 11 4 21 4 31 3 41 3
2 2 12 4 22 1 32 2 42 4
3 1 13 4 23 3 33 2 43 3
4 2 14 3 24 2 34 3 44 3
5 4 15 3 25 4 35 3 45 2
6 3 16 2 26 2 36 3
7 4 17 3 27 2 37 3
8 1 18 2 28 3 38 2
9 2 19 2 29 1 39 3
10 3 20 3 30 2 40 4
SUB:CHEMISTRY
46 1 56 4 66 4 76 4 86 2
47 3 57 1 67 3 77 2 87 1
48 2 58 2 68 4 78 3 88 4
49 3 59 1 69 1 79 3 89 4
50 2 60 1 70 4 80 4 90 2
51 3 61 1 71 4 81 1
52 2 62 4 72 2 82 3
53 2 63 3 73 3 83 2
54 2 64 3 74 2 84 3
55 4 65 4 75 1 85 4
SUB : BOTANY
91 2 101 1 111 4 121 2 131 2
92 4 102 2 112 1 122 3 132 2
93 3 103 3 113 3 123 4 133 1
94 2 104 1 114 3 124 4 134 3
95 3 105 2 115 2 125 3 135 2
96 1 106 3 116 1 126 4
97 1 107 2 117 1 127 2
98 4 108 2 118 2 128 3
99 2 109 3 119 3 129 3
100 2 110 3 120 3 130 3
136 3 146 2 156 3 166 4 176 3
137 4 147 3 157 3 167 4 177 4
138 1 148 2 158 4 168 2 178 3
139 2 149 4 159 1 169 1 179 3
140 3 150 2 160 4 170 3 180 3
141 4 151 3 161 3 171 3
142 4 152 4 162 2 172 4
143 3 153 2 163 3 173 3
144 3 154 2 164 3 174 3
145 4 155 4 165 2 175 4

XII- NEET GT - 14
answer sheet.

PHYSICS Mr.AYYAPPA
Mr.MALLESWARARAO
CHEMISTRY
Mr.SRINIVASULU
BOTANY Mrs.SRIDEVI
ZOOLOGY Mr.SOMESWARA RAO
PHYSICS
1. The voltage across a pure inductor is represented by the following diagram. Which
of the following diagrams will represent the current across it?
2. Considering force (F), velocity (v) and energy (E) as fundamental quantities, match
the correct dimensions of following quantities.
(I) Mass P)  F v E 
1 0 1
(II) Light year Q)  F 1v1 E 1 

(III) Frequency R)  F 3v 0 E 2 
(IV) Pressure S)  F 0 v 2 E1 
1) P Q R S 2) P S Q R
3) S P Q R 4) Q P R S
3. In the YDSE shown, the two slits are covered with thin sheets having thickness t
and 2t and refractive index 2  and  respectively. Find the position (y) of central
maxima.
tD 2tD tD
1) Zero 2) 3) D)
d d 2d
4. Choose the correct statement:
A. In the case of small bodies [Uniform gravitational field] centre of mass and
center of gravity concide with each other.
B. In non-uniform gravitiationl field centre of mass and centre of gravity will not
coincide with each other.
C. Centre of mass independent on acceleration due to gravity, but center of gravity
depends on acceleration due to gravity.
D. Center of mass describes the stability of the body where as centre of gravity
describes the nature of motion of the body.
1) A, B and C are true 2) A, C are true
3) B, C and D are true 4) A, B, C and D all are true

5. A current carrying loop placed in uniform magnetic field in four different
orientations. Arrange them in order of their potential energy.
1) C > A > B > D 2) A > C > B > D 3) A > C > D > B 4) D > B > C > A
6. A steel tape measures the length of a copper rod as 90.0 cm when both are at
100C, the calibration temperature, for the tape. What would the tape read for the
length of the rod when both are at 300 C ? Given  steel  1.2  10 5 / 0 C and
 Cu  1.7  105 / 0 C
1) 89.00 cm 2) 90.21 cm 3) 89.80 cm 4) 90.01 cm
7. Figure shows three vectors a, b and c. If RQ=2PR. Which of the following relations
is correct?
1) 2a+c=3b 2) a+3c=2b 3) 3a+c=2b 4) a+2c=3b

8. There exists a uniform electric field in space as shown in the figure. Four points
A,B,C and D are marked which are equidistant from the origin. If VA ,VB ,VC and VD
are their potentials, respectively, then
1) VB  VA  VC  VD 2) VA  VB  VD  VC 3) VA  VB  VC  VD 4) VB  VC  VA  VD
1 1
9. If the power factor changes from to keeping resistance unchanged then what
2 4
is the increase in impedance in AC?
1) 20% 2) 50% 3) 25% 4) 100%
10. A hail is dropped from the roof of a tower of height h. The total distance covered
by it in the last second of its motion is equal to the distance covered by it in first
three seconds. The value of h (in metre) is (Take, g = 10 m/s2)
1) 125 2) 200 3) 100 4) 80
11. A ray of light enters into the prism normally with the face 1 and comes out
normally with the face 3. The minimum refractive index of the prism is

1) cos ec 2) tan  3) sec 4) cos ec 
2

12. A glass tube of 1.0 m length is filled with water. The water can be drained out
slowly at the bottom of the tube. If a vibrating tuning fork of frequency 500 c/s
is brought at the upper end of the tube and the velocity of sound is 330 m/s, then
the total number of resonances obtained will be
1) 4 2) 3 3) 2 4) 1
13. A flexible wire bent in the form of a circle is placed in a uniform magnetic field
perpendicular to the plane of the coil. The radius of the coil changes with time as
shown in the figure. The magnitude of induced emf in the coil is
14. The molecules of a given mass of a gas have a r.m.s. velocity of 200 m/sec at
270C and 1.0 105 N / m2 pressure. When the temperature is 1270 C and pressure is
0.5 105 N / m2 , the r.m.s velocity in m/sec will be
100 2 400
1) 2) 100 2 3) 4) 400
3 3
15. A ball is thrown at an angle  with the horizontal. Its initial kinetic energy is 100
J and it becomes 75 J at half the maximum height. The angle of projection is
3 4
1) 450 2) 300 3) cos 1   4) tan 1  
4 3
16. The capacitance of a parallel capacitor is C. If it is half filled with a dielectric of
constant K, then the new capacitance will become
4K 2K K 2K
1) C 2) C 3) C 4) C
1 K 1 K 2 K 2 K
17. Indicate which of the following junction diodes, are forward biased and which are
reverse biased
1) A, C, D forward biased and B is reverse biased

2) A, B, C forward biased and D is reverse biased
3) C, B, D forward biased and A is reverse biased
4) A, B, D forward biased and C is reverse biased

18. The system is pushed by a force F as shown in figure. Friction coefficient between
 
A and B is . Friction coefficient between B and C is . Minimum value of F to
3 2
prevent block B from downward slipping is
 3   5   2   2 
1)   mg 2)   mg 3)   mg 4)   mg
 2   2   5   3 
19. When water droplets merge to form a bigger drop
1) Enerty is liberated 2) Energy is absorbed
3) Energy is neither liberated nor absorbed
4) Energy may either be liberated or absorbed depending on the nature of the
liquid
20. The relative permeability  r  of a ferromagnetic substance varies with
temperature (T) according to the curve
1) A 2) B 3) C 4) D
21. During an experiment, an ideal gas is found to obey an additional law
VP2=constant. The gas is initially at a temperature T and volume V. When it
expands to 2V, the temperature becomes
T T
1) 2T 2) 2T 3) 4)
2 2
22. A small block of mass m slides along a frictionless loop inside loop as shown. The
minimum value of ratio R/r, so that the block may not lose contact at the highest
point of the inner loop is
2 7 3 5
1) 2) 3) 4)
3 2 2 2
23. The magnetic field of a plane polarized electromagnetic wave moving along z-
direction is given by
  z t 107  
B  1.2 106 sin  2    T
  240 8 
The maximum electric field is
1) 1000 V m-1 2) 180 V m-1 3) 360 V m-1 4) 0.40 V m-1
1
24. A body projected vertically with a velocity equal toVe from surface of earth.
3
The maximum height reached by the body from surface of earth
1) 3200 km 2) 6400 km 3) 7200 km 4) 800 km

25. Current in 4  resistance is (Battery is ideal)
5 5 3 2
1) A 2) A 3) A 4) A
3 6 5 5
26. In the circuit below, A and B represent two inputs and C represents the output,
the circuit represents
1) NOR gate 2) AND gate 3) NAND gate 4) OR gate

27. A thin uniform Rod of mass M and length L is hinged at one end to the level floor.
Initially it stands vertically and is allowed to fall freely on the floor in the vertically
plane. The angular velocity of the rod when the other end hits the floor is
1 1 1
g  g 2 g 2  3g  2
1) 2)   3)   4)  
L  3L  L  L 
28. The level of water in a vessel falls from a height of 64cm to 36cm in 5 min as
water flows out through a hole at its bottom. What further time is required for the
water level to fall from 36 cm to 16cm?
1) 5 min 2) 2 min 3) 8 min 4) 10 min
29. A wooden cube of side ‘l’ just sinks in water when a mass of 200gm is placed over
it. On removing this mass the block raises by 2cm. Value of l is
1) 5 cm 2) 10 cm 3) 20 cm 4) None
30. A monkey of mass 20kg is climbing up on the rope to balance the cage of 25kg.
What is the acceleration of monkey? (g = 10 ms-2)
1) 5 m / s 2 2) 11.5 m / s 2 3) 22.5 m / s 2 4) 2.5 m / s 2

31. Two particles A and B of masses mA and mB , respectively, and having the same
charge are moving in a plane. A uniform magnetic field exists perpendicular to
this plane. The speeds of the particles are v A and vB , respectively and the
trajectories core as shown in the figure. Then
1) m A v A  mB vB 2) m A v A  mB v B 3) m A  mB and v A  vB 4) m A  mB and v A  vB

32. A steel wire is suspended vertically from a rigid support when loaded with a
weight in air, it extends by la and when the weight is immersed completely in
water, the extension is reduced to lw. Then the relative density of the material of
the weight is
l la lw l
1) a 2) 3) 4) w
lw la  l w la  l w la
33. For an ideal monoatomic gas, pressure is directly proportional to square of its
volume in a process. The molar specific heat of the gas in the process would be
1) 5R/2 2) 2R 3) 11R/6 4) 17/6
34. One conducting U tube can slide inside another as shown in figure, maintaining
electrical contacts between the tubes. The magnetic field B is perpendicular to
the plane of the figure. If each tube moves towards the other at a constant speed
v, then the emf induced in the circuit in terms of B, l and v where l is the width
of each tube, will be
1)  Blv 2) Blv 3) 2Blv 4) Zero

235
35. When an atom of 92 U undergoes fission about 200 MeV of energy of released. If
a reactor U 235 has an output of 700 MW and is 20% efficient, the number of
Uranium atoms consumed in a day is nearly
1) 9.5 1024 2) 1.9 1024 3) 3.125 1024 4) 9 1024
36. In a large building, there are 15 bulbs of 40 W, 5 bulbs of 100 W, 5 fans of 80 W
and 1 heater of 1 kW. The voltage of electric mains is 220 V. The minimum
capacity of the main fuse of the building will be:
1) 8 A 2) 10 A 3) 11.4 A 4) 14 A
37. A man in a balloon, throws a stone downwards with a speed of 5 m/s with resepct
to ballon. The balloon is moving upwards with a constant acceleration of 5 m/s2.
Then velocity of the stone relative to the man after 2 s is
1) 10 m/s 2) 30 m/s 3) 15 m/s 4) 35 m/s

38. A bar magnet is placed with its North pole pointing North. Neutral point is at a
distance ‘d’ from the center of magnet. The net magnetic induction at the same
distance on the axial line of the magnet is
1) 2 BH 2) 3 BH 3) BH 4) 7 BH
      
39.   
In the product F  q v  B  qv  Bi  B j  B0 k 
       
For q = 1 and V  2 i  4 j  6 k and F  4 i  20 j  12 k

What will be the complete expression for B ?
           
1) 6 i  6 j  8 k 2) 8 i  8 j  6 k 3) 6 i  6 j  8 k 4) 8 i  8 j  6 k

40. Assertion (A): In SHM, kinetic energy become equal to P.E. when the
1
displacement is times the amplitude.
2
Reason (R): In SHM, kinetic energy is zero when potential energy is maximum
1) Both A and R are true and R explain A
2) Both A and R are true but R doesn’t explain A
3) A is true but R is false 4) A is false but R is true
 p 
41. Two short dipoles p k and k are located at (0, 0, 0) and (1m, 0, 2m), respectively.
2
The resultant electric field due to the two dipoles at the point (1m, 0, 0) is
9p  7 p  7p 
1) k 2) k 3) k 4) None of these
32 0 32 0 32 0
42 The magnitude of charge in steady on either of the plates of condenser C in the
adjoining circuit is
CER2 CER2 CER1

1) CE 2) 3) 4)
 R1  r   R2  r   R2  r 
43. Radiations of two photon energies, twice and five times the work function of metal
are incident successively on the metal surface. The ratio of the maximum velocity
of photon electrons emitted in the two cases will be
1) 1 : 1 2) 1 : 2 3) 1 : 3 4) 1 : 4
44. Two electric bulbs have filaments of lengths ‘L’ and ‘2L’, diameters 2D, D and
emissivities 3e and 4e. Their absolute temperatures are in the ratio 2 : 3, the ratio
of their radiant powers is……
1) 1 : 8 2) 4 : 27 3) 25 : 64 4) 16 : 27
45. An open knife edge of mass m is dropped from a height h on a wooden floor. If
the knife penetrates upto depth of d into the wood, the average resistance offered
by the wood to the knife edge is
2
 h  h  h
1) mg 2) mg 1   3) mg 1   4) mg 1  
 d  d  d
CHEMISTRY
46. How many moles of magnesium phosphate, Mg3(PO4)2 will contain 0.25 mole of
oxygen atoms?
1) 0.02 2) 3.125 102 3) 1.25 102 4) 2.5 102
47. The electrophile, E  , attacks the benzene ring to generate the intermediate  -
complex. Of the following, which  -complex is of lowest energy?
48. With increase of temperature, which of these changes?

1) Molality 2) Weight fraction of solute
3) Molarity 4) Mole fraction

49. Increasing order of stability among the three main conformations (i,e. eclipse,
anti, gauche) of 2-fluoroethanol is
1) Eclipse, gauche, anti 2) Gauche, eclipse, anti
3) Eclipse, anti, gauche 4) Anti, gauche, eclipse
50. The electrons identified by quantum numbers n and l :
(1) n=4,l=1 (2) n=4,l=0
(3) n=3,l=2 (4) n=3,l=1
can be placed in order of increasing energy as
1) (4)<(2)<(3)<(1) 2) (2)<(4)<(1)<(3) 3) (1)<(3)<(2)<(4) 4) (3)<(4)<(2)<(1)
51. Toluene is nitrated and the resulting product is reduced with tin and hydrochloric
acid. The product so obtained is diazotized and then heated with cuprous
bromide. The reaction mixture so formed contains
1) Mixture of o- and m–bramotoluenes
2) Mixture of o- and p-bromotoluenes
3) Mixture of o- and p-dibromobenzenes
4) Mixture of o- and p-bromoanilines
52. Uncertainty in position of a minute particle of mass 25g is 10–5m. What is the
uncertainty in its velocity (in m s–1)? (h = 6.6 × 10–34J s)
1) 2.1×10–34 2) 0.5×10–34 3) 2.1×10–28 4) 0.5×10–23
53. The IUPAC name of is
1) 3-ethyl-4-4-dimethylheptane 2) 1, 1-diethyl-2, 2-dimethylpentane

3) 4, 4-dimethyl-5, 5-diethylpentane 4) 5, 5-diethyl-4, 4-dimethylpentane
54. The molecule having smaller bond angle among the following is
1) AsCl3 2) SbCl3 3) PCl3 4) NCl3
55. An organic compound ‘X’ with molecular formula C9 H10O forms 2, 4-DNP
derivates, reduces Tollens reagent and undergoes cannizzaro reaction. On
vigorous oxidation it gives 1,2-benzene dicarboxylic acid. Identify the correct
structural formula for ‘X’
56. Which of the following are arragned in an increasing order of their bond
strengths?
1) O2  O2  O2  O22 2) O22  O2  O2  O2
3) O2  O22  O2  O2 4) O2  O2  O2  O22
57. Consider the following bromides:
The correct order of SN 1 reactivity is

1) A > C > B 2) B > C > A 3) B > A > C 4) C > A > B
58. For a spontaneous reaction the G, equilibrium constant (K) and Ecell
o
will be
respectively.
1) –ve, >1, +ve 2) +ve, >1, –ve 3) –ve, <1, –ve 4) –ve, >1, –ve

59. Arrange the following compounds in order of decreasing acidity.
1) IV > III > I > II 2) II > IV> I > III 3) I > II > III > IV 4) III > I > II > IV
A) Pressure is an intensive properly while molar entropy is an extensive property.
B) In an isothermal process, the total heat given to the system is converted to
work done by the system.
C) In an adiabatic process, the change in entropy is zero.
61. The major prouduct obtained on interaction of phenol with sodium hydroxide and
carbon dioxide is
1) Benzoic acid 2) Salicylaldehyde 3) Salicylic acid 4) Phthalic acid
62. Which of the following liquid pairs shows a positive deviation from Raoult’s law?
1) Water – hydrochloric acid 2) Benzene – methanol
3) Water – nitric acid 4) Acetone – chloroform
63. Ortho-nitrophenol is less soluble in water than p- and m-nitrophenol because
1) o-nitrophenol shows intramolecular H-bonding
2) o-nitrophenol shows intermolecular H-bonding
3) Melting point of o-nitrophenol is lower than those of m- and p-isomers
4) o-nitrophenol is more volatile in steam than those of m- and p-isomers
64. The density  in g mL1  of a 3.6M sulphuric acid solution that is 29% H2SO4 (molar
mass  98g mol1 ) by mass will be (in g/ml)
1) 1.45 2) 1.64 3) 1.88 4) 1.22
65. In the given transformation, which of the following is the most appropriate
reagent?
1) Zn  Hg / HCl 2) Na, liq.NH 3 3) H 2 / Ni 4) NH 2  NH 2 , OH  / 

66. The equilibrium constant (Kc) for the reaction N 2 g   O2 g   2 NO g  at temperature
1 1
T is 4 104 . The value of Kc for the reaction, NO g   N 2 g   O2 g  at the same
2 2
temperature is
1) 2.5 102 2) 4 104 3) 50.0 4) 0.02
67. Consider the acidity of the carboxylic acids:
I. PhCOOH II. o-NO2C6H4COOH
III. p-NO2C6H6COOH IV. m-NO2C6H4COOH
Which of the following order is correct?
1) I > II > III > IV 2) II > IV > III > I 3) II > IV > I > III 4) II > III > IV > I
68. Four species are listed below :
(i) HCO3 (ii) H 3O 
(iii) HSO4 (iv) HSO3 F
Which one of the following is the correct sequence of their acid strength?
1) iii<i<iv<ii 2) iv<ii<iii<i 3) ii<iii<i<iv 4) i<iii<ii<iv

69. Which of the following order is wrong, against property indicated
 
1) CH  O  CH  CH  CH  O  CH  CH (Stability of carbo cation)
3 3 3 2 2
 
2) CH  CH  CH  CH  CH  CH (Stability of carbanion)
2 2 3 3
 
3) CH  CH  CH CH  CH  CH (Stability of free radical)
3 2 3 3 2
 
4) CH  CH  CH  CH  CH  CH  CH  CH (Stability of resonating structures)
2 2 2 2
70. The standard reduction potentials for Zn2 / Zn, Ni 2 / Ni , and Fe2 / Fe are –0.76,
–0.25 and –0.44V respectively. The reaction X  Y 2  X 2  Y will be spontaneous
when
1) X=Ni, Y=Zn 2) X=Fe, Y=Zn 3) X=Zn, Y=Ni 4) X=Ni, Y=Fe
71. Which of the following is the strongest base?
72. The molar conductivities  oNaOAc and  oHCl at infinite dilution in water at 25o C are
91.0 and 426.2 S cm2 / mol respectively. To calculate  oHOAc , the additional value
required to
1)  oH 2O 2)  oKCl 3)  oNaOH 4)  oNaCl
73. The correct order of increasing basic nature of the following compounds
NH 3 , CH 3 NH 2 and  CH 3 2 NH is (in aqueous medium)
1) CH 3 NH 2  NH 3   CH 3 2 NH 2)  CH 3 2 NH  NH 3  CH 3 NH 2
3) NH 3  CH 3 NH 2   CH 3 2 NH 4) CH 3 NH 2   CH 3 2 NH  NH 3
74. Consider the reaction, 2A + B  products. When concentration of B alone was
doubled, the half-life did not change. When the concentration of A alone was
doubled, the rate increased by two times. The unit of rate constant for this
reaction is
1) s1 2) L mol1 s1 3) no unit 4) mol L1 s1
75. The number of monochloro derivates (only structural isomers) possible for methyl
cyclohexane
1) 4 2) 5 3) 6 4) 3
For the reaction A + 2B  C, rate is given by R   A B  then the order of the
2
76.
reaction is
1) 3 2) 6 3) 5 4) 7
77. Which of the following hydro carbon is more reactive with HBr in CCl4
1) CH 2  CH 2 2) CH 3  C  CH 3) CH 2  CH  CH 3 4) HC  CH
78. The heats of combustion of carbon, hydrogen and ethane are -393, -286 and
-1556 kJ/mol respectively. Then the amount of heat released during the
formation of 6g of ethane from its elements is _______ kJ.
1) 88 2) 17.6 3) 73.33 4) 14.66
79. Which of the following compound does not show geometrical isomerism?
1) 1, 2-dichloro-1-pentene 2) 1, 3-dichloro-2-pentene
3) 1, 1-dichloro-1-pentene 4) 1, 4-dichloo-2-pentene
2
80. Assertion (A): In CrO4 , all Cr – O bonds are equivalent while in Cr2 O72  all Cr – O
bonds are not equivalent.
Reason (R) : CrO42 is stable in basic medium while Cr2 O72  is stable in acidic
medium.
1) Both assertion and reason are correct, and reason is the correct explanation of
the assertion
2) Both assertion and reason are correct, but reason is not the correct explanation
of the assertion
4) Both assertion and reason incorrect

81. Wrong statement among the following is
1) Paper chromatography is a type of partition chromatography
2) Thin layer chromatography is a type of adsorption chromatography
3) Glycerol can be separated from spent lye in soap industry by using vacuum
distillation
4) Chrloroform and aniline are easily separated by solvent extraction method
82. In which of the following octahedral complexs of Co (At.no.27), will the magnitude
of o be the heighest?
3 3 3 3
1)  Co  NH 3 6  2) Co  CN 6  3) Co  C2O4 3  4)  Co  H 2 O 6 
83. 0.92 gm of a gaseous hydrocarbon gives upon combustion 0.72 g of water and
3.08g of CO2. The empirical formula of the hydrocarbon is
1) C7 H 8 2) C2 H 6 3) C3 H 8 4) C6 H 6
84. The correct order of magnetic moments (spin only values in B.M.) among is
(Atomic nos. : Mn = 25, Fe = 26, Co = 27)
4 4
1)  MnCl4   CoCl4    Fe  CN 6  2)  MnCl4    Fe  CN 6   CoCl4 
2 2 2 2
4 4
3)  Fe  CN 6    MnCl4   CoCl4  4)  Fe  CN 6   CoCl4    MnCl4 
2 2 2 2
85. Wrong statement among the following

1) In dimeric form of AlCl3 , all Al-Cl bond lengths are equal, where as all Al-Cl-Al
bond angles are different.
2) Bond order in BF3 molecule is 1.33
3) Tin decomposes steam into tin dioxide, which is an amphoteric oxide.
4) SiCl62 , PbI 4 , R3 N  O (R is alkyl group) and NCl5 molecules does not exist
86. Which among the following will be named as dibromidobis(ethane-1,2-diamine)
chromium(III) bromide?
1) Cr  en 2 Br2  Br 2) Cr  en  Br4  3) Cr  en  Br2  Br 4) Cr  en 3  Br3

87. Which of the following will have a meso-isomer also?

1) 2-chrlorobutane 2) 2,3-dichlorobutane
3) 2,3-dichloropentane 4) 2-hydroxypropanoic acid
88. Assertion (A): Nitrogen has lower catenation power than that of phosphorus.
Reason (R) : N – N bond is weaker than P – P bond.
of the assertion
the assertion
89. During dehydration of alcohols to alkenes by heating with concentrated H 2 SO4
the initiation step is
1) Protonation of alcohol molecule 2) Formation of carbocation
3) Elimination of water 4) Formation of an ester
90. Assertion (A): From carbon to silicon, IP decreases rapidly but from silicon to
lead, the decrease is relatively very low.
Reason (R) : In silicon, the S- and P-electrons offer good screening effect while
from Ge to Pb, the d-and f-electrons offer poor screening effect.
of the assertion
the assertion

BIOLOGY
91. Formation of peptide bond involves in the process of
1) Dehydration 2) Glycosylation 3) Hydrolysis 4) Both 1 and 3
92. Assertion (A) : Buttercup plant shows heterophilly
Reason (R) : Development of heterophylly is due to environment
2) A is correct but R is not correct
3) A is not correct but R is correct
93. BOD can be defined as
1) Amount of O2 consumed by bacteria to oxidize all the inorganic matter present
in one litre of sewage water.
2) Amount of O2 consumed by Fishes to oxidize all the organic matter present in
one litre of sewage water.
3) Amount of O2 consumed by bacteria to oxidize all the organic matter present
in one litre of sewage water.
4) Amount of O2 consumed by bacteria to reduce the all organic matter present
in total sewage water.
(A) Metaphase (I) Initiation of condensation of chromosomal
material
(B) Interphase (II) Nuclear envelops assembles around the
chromosomes clusters
(C) Telophase (III) Chromosomes arranged at equatorial plate
(D) Prophase (IV) The period between two cell divisions-M-
.
phase
(A) (B) (C) (D) (A) (B) (C) (D)
.
1) I II III IV 2) IV I II III
3) IV III I II 4) III IV II I
95. Freeliving and symbiotic nitrogen fixes respectively are
1) Azotobacter and Azospirillium 2) Azospirillum and Rhizobium
3) Rhizobium and Azotobacter 4) Rhizobium and Glomus
96. The cytoskeleton in a cell are involved in
1) Mechanical support 2) Motility
3) Maintenance of the shape of the cell 4) All of the above
97. Which one of the following is not considered as a part of the endomembrane
system?
1) Lysosome 2) Glogi complex 3) Ribosome 4) Vacuole
98. What kind of microbes are present in ‘flocs’ formed during secondary treatment
of sewage?
1) Aerobic 2) Anaerobic 3) Symbiotic 4) All the above
99. Yeasts poison themselves to death when the concentration of alcohol reaches
1) About 13% 2) About 11% 3) At 18% 4) About 16%
100. T.W. Engelmann using a prism split the light into its spectral components and
then illuminated a green alga, placed in a suspension of aerobic bacterium. Name
that green alga
1) Chlorella 2) Cladophora 3) Chlamydomonas 4) Nostoc and Anabaena
101. What is the genotypic ratio of progeny obtained from a cross Aa BB x aa BB?
1) 1 Aa BB : 1 aa BB 2) 1 Aa BB : 3 aa BB
3) 3 Aa BB : 1 aa BB 4) All Aa BB : No aa BB
102. When CO2 is added to PEP, the first stable product synthesized is
1) Phosphoglycerate 2) Oxaloacetic acid
3) Pyruvate 4) Glyceraldehyde-3-phosphate
103. Pure yellow round seeded plant crossed with green and wrinkled seeded plant
and F2 progenies were selfed. In F2 plants how many plants will have round and
green seeds out of 960 plants.
1) 180 2) 360 3) 540 4) 720
104. Z-scheme of photosynthesis involves
1) Ps-II 2) Ps-I 3) Electron carries 4) All of these

105. “Gametes are never hybrid”. This is a statement of
1) law of dominance 2) law of independent assortment
3) law of segregation 4) Law of random fertilization
106. A mixture containing DNA fragments, a. b. c and d with molecular weight of
a + b = c, a > b and d > c, was subjected to agarose gel electrophoresis. The
position of these fragments from anode to cathode sides of gel would be
1) b,a,c,d 2) a, b, c, d 3) c, b, a. d 4) b, a, d, c
107. What will be the amount of DNA in meiosis II product if meiocyte is containing 20
pg DNA in GI phase?
1) 10 pg 2) 5 pg 3) 20 pg 4) 15 pg
108. Presence of conjuctive tissue is a characteristic feature of
I) Dicot leaf 2) Dicot root 3) Monocot stem 4) Monocot leaf
109. A : These are thin walled parenchymatous cells with numerous intercellular
spaces produced by activity of phellogen.
B : They create pressure on epidermis which soon results in rupture of epidermal
cells and form lenticels. Above statements are true for
I) Hydathodes 2) Stomata 3) Complementary cells 4) Bulliform cells
110. How many molecules of ATP are required in reduction step of calvin cycle to
produce one molecule of sucrose?
1) 12 2) 24 3) 18 4) 36
111. Statement A : Mosses along with lichens are the first organisms to colonise rocks.
Statement B : Diploid spores germinate to produce gametophyte in bryophytes.
Correct the above statements and select the correct option
3) Both statements A and B are correct
4) Both statements A and B are incorrect
112. This picture suggests that
1) Tip of the coleorhiza is the source of Auxin

2) Tip of coleoptile is the source of Auxin
3) Base of coleoptile is the source of Auxin
4) Base of coleorhiza is the source of Auxin
113. Choose the substrate level phosphorylation reaction step
1) PEP → Pyruvate 2) Succinyl CaA → Succinate
3) 1,3 bispGA → 3pGA 4) All of the above
114. In angiosperms ______A______ meiotic division(s) and ____B____ mitotic divisions
are required to form 2 male gametes from microspore mother cell. Here A and B
are respectively.
I) 2 and I 2) 1 and 2 3) 2 and 3 4) 2 and 4
115. Which of the following yields the most ATP when glucose is completely oxidized?
1) Glycolysis 2) TCA cycle
3) Oxidative phosphorylation 4) Conversion of pyruvate to acetyl CoA
116. Intra molecular rearrangement is catalyzed by
1) Class – 1 enzymes 2) Class – 2 enzymes
3) Class – 4 enzymes 4) Class – 5 enzymes

117. Identify the given organism and label A. then select the suitable option
Organism Label A
(a) Laminaria Stipe
(b) Porphyra Frond
(c) Fucus Air bladder
(d) Polysiphonia Branches
1) (a) 2) (b) 3) (c) 4) (d)
118. Which abiotic factor is not essential for early growth of the plant but growth is
sustained only in its presence ?
1) Water 2) Oxygen 3) Nutrients 4) Light
119. "Protoxylem lies towards the _____A____ in stem. Such arrangement of xylem is
called ____B____ . Select the correct option for A and B.
1) A-Centre, B-Exarch 2) A-Periphery, B-Exarch
3) A-Centre. B-Endarch 4) A-Periphery, B-Endarch
120. Integral cell membrane proteins are
1) Partially / completely embedded in lipid layers.
2) Show lateral movement in lipid bilayer
3) Act as carriers 4) All the above
List – I List - II
(A) Coenzyme (I) Organic, tightly bound substance to
apoenzyme
(B) Prosthetic group (II) Organic, loosely bound substance to
apoenzyme
(C) Apoenzyme (III) Protein part of a holoenzyme
(D) Cofactor (IV) Non protein part of holoenyzme
.
(A) (B) (C) (D) (A) (B) (C) (D)

1) I II III IV 2) II I III IV
3) II III I IV 4) III I IV II
122. Read the given statements and select the correct ones regarding viroids.
(a) A protein coat is present (b) Smallest self replicating particle
(c) Discovered by T.O. Diener (d) They infect plants
1) Only (a) & (b) 2) Only (b) & (c) 3) Only (b), (c) & & (d) 4) Only (c) & (d)
123. Assertion (A): Members of kingdom fungi show a great diversity in their
morphology and habitat.
Reason (R): Fungi are cosmopolitan and prefer to grow in cool and humid places
only.
1) Both Assertion and Reason are true and the reason is the correct explanation
of the assertion
2) Both Assertion and Reason are true but the reason is not the correct
3) Assertion is true statement but Reason is false
4) Both Assertion and Reason are false statements
124. Spores in slime moulds
1) Are formed during unfavourable conditions 2) Are without cell wall
3) Are dispersed with the help of water only 4) Are formed in gemmae cups

125. Match the columns and select the correct option:
(A) Polyandrous condition (I) Sepals united
(B) Polyadelphous condition (II) Filaments are united into more
than two bundles
(C) Epiphyllous stamen (III) Free stamens
(D). .
Gamosepalous condition (IV) Stamen is attached to perianth
(A) (B) (C) (D) (A) (B) (C) (D)
1) I II III IV 2) IV III II I
3) II I IV III 4) III II IV I
126. Flowers of which of the given plants are asymmetric?
(a) Canna (b) Cassia (c) Bean (d) Mustard (e)
Datura
I) Only (b) 2) Both (c) and (c) 3) Both (d) and (e) 4) Only (a)
127. Choose the incorrect match w.r.t. placentation
I) Tomato — axile 2) Mustard — Parietal
3) Marginal — Pea 4) Free central — Sunflower
1) Split-gene arrangement is a characteristic feature of eukaryotes
2) During splicing introns are removed and exons are joined
3) In prokaryotes, mRNA does not require any processing to become active
4) For the transmission of genetic information, DNA is better material
129. What is the correct sequence of the formation of female gametophyte in
angiosperms?
1) Nucellus, megaspore tetrad, megaspore, mother cell, megaspore, female
gametophyte.
2) Megaspore tetrad, nucellus, megaspore mother cell, megaspore, female
gametophyte
3) Nucellus, megaspore mother cell, megaspore tetrad, megaspore, female
gametophyte
4) Megaspore mother cell, megaspore tetrad, megaspore, nucellus, female
gametophyte.
130. Match column I and column II with respect to transcription and post
transcriptional processing of mRNA.
(A) Capping (I) Binding of RNA polymerase to
promoter
(B) Tailing (II) Removal of introns and joining of
exons
(C) Splicing (III) Addition of methyl guanosine
triphosphate at 5’ end of hnRNA
(D) Initiation (IV) Addition of adenylate residues to
.
the 3’ end of hnRNA
(A) (B) (C) (D) (A) (B) (C) (D)
.
3) III I IV II 4) III IV II I
( Plant ) ( Character )
(A) Chlamydomonas (I) Monoecious sporophophyte
(B) Pinus (II) Heterosporous pteridophyte
(C) Selaginella (III) Zoospores
(D)
.
Sphagnum (IV) Monoecious gametophyte
(A) (B) (C) (D) (A) (B) (C) (D)
.
1) I II III IV 2) IV III I II
3) III I II IV 4) IV III II I

132. Statement — I : DNA polymerases catalyse polymerisation only in one direction,
that is 5' → 3'
Statement —II : During replication of DNA, Okazaki fragments are formed on
the leading strand
I) Both statement I and statements II are correct
2) Both Statement I and statement II are incorrect
3) Statement 1 is correct but statement II is incorrect
4) Statement I is incorrect but statements Il is correct
133. A fragment of DNA molecule has 60 adenine and 40 guanine bases. The total
number of hydrogen bonds are
1) 200 2) 240 3) 260 4) 300
134. Assertion (A): When a restriction enzyme made a staggered cut in DNA. Over
hanging stretches or sticky ends are formed.
Reason (R) : Some restriction enzymes cut the strand of DNA a little away from
the centre of palindromic site
I) Both A and R are correct and R is the correct explanation of A
2) Both A and R arc correct but R is not the correct explanation of A
3) A is correct but It is not correct 4) A is no correct but R is correct
135. In general the egg apparatus of embryo sac in angiosperm consists of
1) One egg cell, two synergids, three antipodal cells, two polar nuclei
2) One egg cell, two synergids, three polar nuclei
3) One egg cell, two synergids
4) One egg cell, two synergids. two antipodal cells
136. Match the column I and Column II select the correct option.
.
(A) Camelus (I) Water vascular system
(B) Ctenoplana (II) Radula
(C) Ophiura (III) Jointed legs
(D) Chaetopleura (IV) Comb plates
(V) Notochord
(A) (B) (C) (D) (A) (B) (C) (D)
1) V IV I II 2) IV V I III
3) I II III IV 4) II III IV V
137. Which of the following group animals, lives in relatively diversified habitats?
1) Arthropoda 2) Porifera 3) Echinodermata 4) Cnidaria
138. What are the total number of ova produced by a woman when she gives birth to
identical twins and fraternal twins respectively?
1) 1 and 1 2) 2 and 1 3) 2 and 2 4) 1 and 2
139. Which one of the following statement correct
1) Cancer cells have the ability of contact inhibition.
2) Metastasis is shown by benign tumors
3) Cancer cell growth is highly controlled and regulated
4) C-onc (or) proto-oncogens when activated can cause cancer
140. Active immunity from the following
1) Colostrum with IgA 2) Lysozyme enzyme in tear
3) COVID Vaccine 4) Antitetanous serum
141. Which of the following is correct with respect to proliferation phase of menstrual
cycle:
1) Estrogen  FSH  LH  Progesterone 
2) Estrogen  FSH  LH  Progesterone 
3) Estrogen  FSH  LH  Progesterone 
4) Estrogen  FSH  LH  Progesterone 
1) All insects the mechanism of sex determination is the ‘XO’ type
2) The sex determination in honey bee is based on the environmental factors
3) The drone have paternal grand father
4) The number of chromosomes, in the male and female grasshopper are unequal.

143. A woman with normal vision, whose father was colourblind, marries a colourblind
man. Suppose the fourth child of this couple was a boy. This boy
1) Must have normal colour vision
2) Will be partially colourblind since he is heterozygous
3) Must be colourblind
4) May be colourblind (or) may be of normal vision
144. In the given hormones how many of the following interact with intra cellular
receptors (or) mobile receptors (or) nucleo cytoplasmic receptors?
[Estrogen – Progesterone – Thyroxine – Cortisol – FSH – Insulin – Calcitonin]
1) 5 2) 4 3) 3 4) 6
145. Identify set of animals that convergent evolution with respect to mammals.
Marsupials Placentals
1) Lemur Flying squirrel
2) Wolf Mouse
3) Mole Wombat
4) Tasmanian tiger cat Bobcat
146. Statement – I: Though mutations are random, the evolution need not be random.
Statement – II: Mutations are subjected to natural selection.
147. Statement – I: The VNTR belongs to a class of macrosatellite DNA
Statement – II: Repeated sequence make up very large portion of the human
genome.
148. Which of the following statement is INCORRECT ?
A. The sodim – potassium pump which transports 3Na+ inwards for 2K+ outwards
from the cell.
B. The Axonal membrane is more permeable to negatively charged proteins
C. The rise in the stimulus induced permeability to way is extremely short lived.
D. Chemical synapsis are rare in our system
1) All A,B,C,D 2) Only B,D 3) B,C,D only 4) A,B,D only
149. Genetic engineering has been successfully for producing
1) Transgenic mice for testing safety of Polio vaccine before use in humans
2) Trnasgenic models for studying new treatement for chromosomal disorders
3) Transgenic cow Rosie which produce high fat milk for making ghee
4) Transgenic monkey better for testing safety than transgenic mice.
150. Consider the following features
A. Internal fertilization B. A pair of jaws C. Mostly viviparous
Select the correct option of animal group, that posses all the above
characteristics.
1) Chondrichthyes and mammalia 2) Reptilia and mammals
3) Chondrichthyes and osteichthyes 4) Amphibia and mammalia
151. If due to some injury the chordate tendinae of the tricuspid value of the human
heart is partially non-functional, what will be the immediate effect?
1) The flow of blood into the aorta will be slowed down
2) The ‘pace maker’ will stop working
3) The blood will tend to flow back into the left atrium
4) The flow of blood into the pulmonary artery will be reduced

152. In which region of sarcromere of myofibril, the thick filaments are not overlapped
by thin filament during relaxation of muscle
1) Z membrane 2) Entire A-band 3) H zone 4) Margin of A-bond
153. When a threatened plant need urgent measures to save it from extinction
desirable approach is
1) In situ conservation 2) Ex situ conservation
3) Cryopreservation 4) Bio preservation
154. Which of the following is a viral vector born disease
1) Malaria, Elephantiasis 2) Chikungunya, Dengue
3) Diptheria, Polio 4) AIDS, Chikungunya
155. Identify correct statement from the following.
1) High levels of estrogen triggers the ovulatory surge
2) Oogonial cells start to proliferate and give rise to functional ova in regular
cycles from puberty onwards.
3) Sperms released from seminiferous tubules are without tail
4) Progesterone level is high during the post ovulatory phase of menstrual cycle.
156. Which one of the following option gives the correct categorization of animals
according to the type of nitrogenous wastes they give out?
Ammonotelic Ureotelic Uricotelic
1 Pigeon, Human Aquatic Amphibia, Lizzards Cockraoch, Frog
2 Frog, Lizzards Aquatic Amphibia, Human Cockroach,
Pigeon
3 Aquatic Insects, All Amphibians Pigeon,
Aquatic Amphibia Cockroach
4 Aquatic insects, Cartilegenous Fishes, Adult Terstrial insects
Exocetous, Amphibia, Whales Crow, Pigeon
Hippocampus
157. Which of the following sarcomeres is labelled correctly?
158. Which of the following statement is correct pertaining to the functioning of kidney
1) If the afferent renal arteriole is decreases than of efferent arteriole the ultra
filtration will be slower.
2) More glucose reabsorbed passively in PCT.
3) There is no hormonal influence on the reabsorption of filtration load in DCT.
4) The number of nephrons equal to the number of collecting ducts.
159. Observe the following bones from A-D (belog to I – III) identify the odd one in that
given combination.
A B C D
I. Tibia Tarsals Carpals Phalanges
II. Scapula Clavicle Glenoidcavity Ilium
III. Coccyx Coxal bone Sacrum Atlas
Identify correct one
1) 1-C, II-D, III-B 2) I-B, II-A, III-C 3) I-B, II-D, III-A 4) I-D, II-B, III-C

160. Which one of the following items gives its incorrect total number related to human
1) Skull – 2 condyles 2) True ribs -7 pairs
3) Cervical vertribrae – 7 4) False ribs – 2 pairs
161. Mark the correct order of lung volumes and capacities
1) TV < RV < ERV < IRV 2) TV < RV < IRV < ERV
3) EC < FRC < IC < VC 4) EC < IC < FRC < VC
162. Select the incorrect statement about down’s syndrome.
1) It is caused by nondisjunction of autosomes during oogenesis
2) Late pregnancy in woman might be the cause of Down’s syndrome
3) Affected individuals exhibit 21st trisomy condition
4) The affected individual exhibit broad shield like chest
163. Which among the following is incorrect during each cardiac cycle.
1) The volume of blood pumped out by the right and left ventricles is same
2) The seond heart sound is produced during ventricle systole by the closure of
semilunar valve.
3) Just before atrial systole begins all the four chambers of heart are in relaxed
state.
4) Cardiac output = SV × number of heart beats per minute.
164. The timica externa in the wall of blood vessels is formed by
1) Fibrous connective tissue with collagen fibres
2) Fibrous connetive tissue with elastic fibres
3) Smooth muscles with elastic fibres
4) Squamous endothelium
165. Which of the following is not a goal of HGP?
1) Addressing on ELSI 2) Storage of information in data bases
3) Physical mapping of human genome
4) Identification of non-protein coding genes
166. Find the incorrect statement
1) In terrestrial ecosystem larger fraction of energy flow occurs through DFC
2) In aquatic ecosystem a major conduct for energy flow in GFC
3) Detritus food chain is not at all connected with GFC at any level
4) Natural inter connection of food chain makes it a food web
167. In the following Hardy Weinberg population find out the frequency of dominant
allele. The population include : 20 Homozygous Recessive 160 heterozygotes and
320 Homozygous dominat individuals.
1) 20% 2) 40% 3) 60% 4) 80%
168. Choose the correct statement(s) regarding given chemical structure of a drug
1) Effective cardiovascular system

2) Producing sense of Euphoria
3) Extracted from latex of poppy plant
4) Obtained from Erylhroxylum coca
169. Choose the incorrect one among the following?
I. Copper ioans releasing IUD’s are more efficient than non medicated methods
II. All reproductive tract infections are STI’s but all STI are not reproduction tract
infections.
III. MTP are always surgical
IV. Intensely lactating mothers do not generally conceive due to the suppression
gonadotropin inhibiting hormone.
1) I, IV 2) III, IV 3) Only III 4) II, III

170. Read the following statements and select the correct option.
Statement – I: Subcutaneous implantation of synthetic progestogens prevents
pregnancy for about 5 years
Statement – II: A tiny amount of progestogens is steadily released from the
implants into the blood
171. Assertion (A): ELISA has been used to detect the presence of antigens or
antibodies.
Reason (R): Very low concentration of bacteria (or) virus can be detected by
amplification of their nucleic acid by PCR
172. If 30 J of energy is available at produce level as a NPP, then how much energy
will be available as food in the following chains to snake
Grass – Grass Hopper – Frog - Snake
1) 0.0003 kJ 2) 0.03 kJ 3) 0.003 kJ 4) 0.3 kJ
173. Which of the following is incorrect statement?
1) If a new habitat is just being colonized immigration and may contribute more
significantly to population growth than birth rate.
2) The bell shapes of pyramid indicates equal number of young and middle age
individual.
3) The urn shapes of pyramid indicates post reproductive individuals less than
reproductive age individuals
4) The expanding age pyramid indicates equal number of pre and post
reproductive.
174. Which of the following statements is correct in relation to the endocrine system?
1) Non-nutrient chemicals produced by the body in trace amounts that act as
intercellular messenger are knows as hormones.
2) Releasing and inhibitory hormones are produced by the pituitary gland
3) Adenohypophysis is under direct neural regulation of the hypothalamus
4) Organs in the body like gastrointestinal tract, heart, kidney and liver do not
produce any hormones.
175. Match Column –I with Column-II and select the correct option from the codes
given below.
A) Fertilization I) Isthmus of oviduct
B) Cleavage II) Later part of oviduct
C) Morula III) Cervix
D) Blastocyst IV) Ampulla of oviduct
E) Parturition V) Uterine wall
1) A- IV, B- I,C –II,D-III, E-V 2)A –II,B –I, C – IV, D- III,E- V
3) A- II, B –I, C- III, D- IV, E-V 4) A-IV, B-I, C- II,D-V, E-III

176. Observe the following diagram and identify the correct statements pertaining to
A,B,C,D,E and F
i. Two ‘A’ are connected by ‘B’

ii. ‘C’ and ‘D’ are the parts of brain stem
iii. ‘F’ consists of fibre tracts that interconnect different regions of the brain
iv. ‘E’ has centers for urge of eating and cardio vascular.
1) i, ii and iii 2) i and iii 3) ii, iii and iv 4) ii and iv
177. Hormones, stimulates production of erythrocytes from bone marrow.
1) Aldosterone, Calcitonin, Cortisol.
2) Erythropoietin thyrocalcitonin, Growth hormone.
3) Cortisol, thyroxine, Erythropoietin.
4) Thyroxine, Epinephrine, Erythropoietin.
178. Given below is the EGC of a normal human. Which one of its components is
correctly interpreted below?
1) By counting QRS complexes number can determine the number of heart beats.
2) Peak T-initiation of total cardiac contraction
3) Peak P and Peak R together – systolic and diastolic blood pressures
4) Peak P-initiation of left atrial contraction only
1) Jawless fish probably evolved around 350 mya.
2) Tyrannosaurus rex was biggest dinosaur, about 20 feet in height and had huge
fearsome dagger like teeth
3) About 15 mya, primates called Dryopithecus and Ramapithecus existed.
4) Australopithecus with a brain size of 1400 cc lived in east and central Asia
between 100000 – 40000 years back
180. Which of the following about repetitive sequences is incorrect
1) They are stretches of DNA sequences repeated many times
2) They shed light on chromosome structrure, dynamics and evolution
3) They are heritable DNA sequence
4) They have direct coding function
*******

: ANSWER KEY :
1 4 11 4 21 2 31 2 41 2
2 3 12 2 22 4 32 2 42 3
3 2 13 2 23 3 33 3 43 2
4 1 14 3 24 1 34 3 44 2
5 2 15 1 25 2 35 1 45 3
6 4 16 2 26 4 36 3
7 4 17 1 27 4 37 4
8 2 18 2 28 1 38 2
9 4 19 1 29 2 39 3
10 1 20 3 30 4 40 2
SUB:CHEMISTRY
46 2 56 2 66 3 76 1 86 1
47 3 57 4 67 4 77 3 87 2
48 3 58 1 68 4 78 2 88 4
49 3 59 4 69 3 79 3 89 1
50 1 60 4 70 3 80 2 90 3
51 2 61 3 71 4 81 4
52 3 62 2 72 4 82 2
53 1 63 1 73 3 83 1
54 2 64 4 74 2 84 1
55 4 65 4 75 2 85 1
SUB : BOTANY
91 1 101 1 111 1 121 2 131 3
92 1&4 102 2 112 2 122 3&4 132 3
93 3 103 1 113 4 123 3 133 2
94 4 104 4 114 2 124 1 134 1
95 2 105 3 115 3 125 4 135 3
96 4 106 1 116 4 126 4
97 3 107 1 117 2 127 4
98 1 108 2 118 4 128 4
99 1 109 3 119 3 129 3
100 2 110 2 120 4 130 4
136 1 146 3 156 4 166 3 176 2
137 1 147 3 157 1 167 4 177 3
138 4 148 4 158 1 168 3 178 1
139 4 149 1 159 1 169 2 179 4
140 3 150 1 160 4 170 1 180 4
141 2 151 4 161 3 171 2
142 4 152 3 162 4 172 add
143 4 153 2 163 2 173 4
144 2 154 2 164 1 174 1
145 4 155 4 165 4 175 4

XII- NEET GT - 15
answer sheet.

PHYSICS Mr.VENKAT
Mr.RAMAKRISHNA REDDY
CHEMISTRY
Mr.RAMAKRISHNA
BOTANY Mr.PRABHAKAR
ZOOLOGY Mrs.PRABHAVATHI
PHYSICS
1. A capacitor of capacitance 5 F is connected as shown in the figure. The internal
resistance of the cell is 0.5 . The amount of charge on the capacitor plates is
1) 80 C 2) 40 C 3) 20 C 4) 10 C
2. For a material the Young’s modulus is 3.2 times that of rigidity modulus. Its
Poisson’s ratio is
1) 0.6 2) 0.3 3) 0.2 4) 0.5
3. In an L-C-R circuit inductance is changed from L to L/2. To keep the same
resonance frequency, C should be changed to
C C
1) 2C 2) 3) 4C 4)
2 4
4. Output B is given by
1) X  Y  Z 2) XY  Z 3) X  YZ 4) X  XYZ
5. A particle moving with uniform acceleration has average velocities v1, v2 and v3
over the successive intervals of 5s, 10s and 15s respectively. Then, the value of
v1  v2
will be
v2  v3
5 3 1
1) 2) 1 3) 4)
3 5 2
6. The density of a solid ball is to be determined in an experiment. The diameter of
the ball is measured with a screw gauge, whose pitch is 0.5 mm and there are 50
divisions on the circular scale.The reading on the main scale is 2.5 mm and that
on the circular scale is 20 divisions. The percentage error in the radius is nearly
1) 0.9% 2) 0.01% 3) 7% 4) 25%
7. An ideal solenoid having 5000 turns/m has an aluminium core and carries a
current of 5 A. If   2.3  10 5 , then the magnetic field developed at centre will be
1) 0.57 T 2) 0.35 T 3) 0.027 T 4) 0.050 T
8. Find current through 10 in circuit shown in figure.
1) 0.5 A 2) 0.2 A 3) 1 A 4) Zero

9. A mass M is broken into two parts of masses m1 and m2. For the force of attraction
or gravitation to be maximum between them, the m1 and m2 have value
M 2M 2M M M M 3M
1) m1  , m2  2) m1  , m2  3) m1  m2  4) m1  , m2 
3 3 3 3 2 4 4

10. Kepler space telescope generated a plot of intensity of radiation versus wavelength
of three stars in Andromeda galaxy. What is the relation between their
temperature?
1) TA > TB > TC 2) TC > TB > TA 3) TA > TC > TB 4) TB > TC > TA

11. Tension in a string is
1) electromagnetic force 2) gravitational force
3) strong nuclear force 4) weak nuclear force
12. A sphere is rotating about a diameter :-
1) The particle on the surface of the sphere donot have any acceleration
2) The particle on the diameter mentioned donot have any linear acceleration
3) Different particles on the surface have different angular speeds
4) All the particles on the surface have same linear speed.
13. In the given circuit, the current through the resistor 2k is
1) 2 mA 2) 4 mA 3) 6 mA 4) 1 mA
14. The longitudinal waves starting from a ship return from the bottom of the sea to
the ship after 1.414 s. If the bulk modulus of water be 2200 N mm2 and the
density is 1.1103 kgm3 , the depth of sea is  take, g = 9.8 N kg 1 
1) 2 km 2) 1 km 3) 10 km 4) 200 km
15. The maximum vertical distance through which a full dressed astronaut can jump
on the earth is 0.5 m. The maximum vertical distance through which he can jump
on the moon, which has a mean density (2/3) rd that of earth and radius one
quarter that of earth is
1) 1.5 m 2) 3 m 3) 6 m 4) 7.5 m
16. Two slits are separated by a distance of 0.5 mm and illuminated with light of
  6000 Å. If the screen is placed 2.5m from the slits, the distance of the third
bright fringe from the centre will be
1) 1.5 mm 2) 3 mm 3) 6 mm 4) 9 mm
17. If 1 and 2 are the wavelengths of the first members of the Lyman and Paschen
series respectively, then l : 2 is
1) 1: 3 2) 1: 30 3) 7 : 50 4) 7 : 108
18. The wavelength  of a photon and the de-Broglie wavelength of an electron have
the same value. Find the ratio of energy of photon to the kinetic energy of electron
in terms of mass m, speed of light c and Planck constant h.
 mc hmc 2mc
1) 2) 3) 4) h mc
h  h
A B
19. Potential energy of a particle in a force field is given by U  2  where, A and B
x x
are positive constant and x is distance of particle from centre of the field. For
stable equilibrium, the distance of particle is
A B 2A B
1) 2) 3) 4)
B A B 2A

20. Assertion(A) :- Under electrostatic conditions net electric field inside a solid
conductor will be zero.
Reason (R):- under electrostatic conditions there will be no free electons inside a
conductor.
3) (A) is true but (R) is false
4) (A) is false but (R) is true
21. Fraunhofer spectrum is a
1) line absorption spectrum 2) band absorption spectrum
3) line emission spectrum 4) none of the above
22. A light ray enter in a glass slab of R .I .  3 . The angle of incident is 60o . If ray
travel 5 cm inside the slab and emerge out of the slab. Find the lateral shift
between the incident ray and emergent ray :
5 3 7 5 5
1) cm 2) cm 3) cm 4) cm
2 2 2 2
23. The effective resistance of n number of identifical resistor when connected in
parallel is P. If one of the resistor is removed, the effective resistance becomes
Q. Then, the resistance of resistor which is removed is
PQ PQ P 2Q 2 PQ
1) 2) 3) 4)
P Q QP Q  P  P Q
2
24. The mass of Jupiter is 1.9 1027 kg and that of sun is 1.99  1030 kg . The mean
distance of the Jupiter from the sun is 7.8 10 m . Assume that the Jupiter moves
11
in a circular orbit around the sun. Velocity of Jupiter is

1) 1.3 104 ms1 2) 1.5 105 ms1 3) 1.2 106 ms1 4) 1.6 107 ms1
25. In a match a sixer is hitted by a batsman and the ball touches the ground outside
the boundary. Then, which of the following graph describes the variation of the
cricket ball’s vertical velocity v with time between the time t as it hits the bat and
time t, when it touches the ground?
26. The excess pressure inside a spherical drop of water is five times that of another
drop, then their respective mass ratio is
1) 5 : 3 2) 25 : 137 3) 125 : 137 4) 1: 125
27. A thin symmetrical double convex lens of refractive index 2=1.5 is placed between
a medium of refractive index 1=1.3 to the left and another medium of refractive
index 3=1.2 to the right. Then, the system behaves as
1) a convex lens 2) a concave lens
3) a glass plate 4) a convex or concave lens
28. 22
Ne nucleus after absorbing energy decays into two -particles and an unknown
nucleus. The unknown nucleus is
1) nitrogen 2) carbon 3) boron 4) oxygen
29. At room temperature (27° C) a vehicle tyre has pressure of 3 atm. The temperature
at which the pressure in tyre 1 atm is
1) 246K 2) 274K 3) 217K 4) 100K

30. With respect to photo electric effect experiment match the Column-I with the
Column-II
Column-I Column-II
a) If f (frequency) is increased (i) stopping potential increases
keeping I (intensity) and ϕ (work
function) constant
b) If I is increased keeping f and ϕ (ii) Saturation current increases
constant.
c) If the distance between anode and (iii) maximum K.E. of electron
cathode increases increases
d) If ϕ is decreased keeping f and I (iv) stopping potential remains the
constant. same
1) (i)-a; (ii)-b; (iii)-d; (iv)-b 2) (i)-b; (ii)-c; (iii)-b; (iv)-a
3) (i)-c; (ii)-a; (iii)-b; (iv)-d 4) (i)-d; (ii)-d; (iii)-d; (iv)-d
31. In sonometer experiment a string vibrates in 3 loops, when 8 g were placed in the
pan. To make the string vibrates in 5 loops, the mass should be placed is of value
1) 2 g 2) 2.88 g 3) 2.5 g 4) 4 g
32. A uniform solid right circular cone and a hemisphere of same base radius 2m and
same mass are placed on each other, so as to have common face. The centre of
mass of the compositive solid lies on the common face. The height of the cone is
1) 2m 2) 6m 3) 3m 4) none of these
33. The resistance of the wire in platinum resistance thermometer at ice point is 3 
and at steam point is 9 . When the thermometer is inserted in an unknown hot
bath its resistance is found to be 12. The temperature of the hot bath is
1) 100° C 2) 50° C 3) 75° C 4) 150° C
34. For an ideal gas pressure vs internal energy graph is as shown. Which of the
following pressure volume graph is equivalent to this graph?
35. The maximum intensity of fringes in Young’s experiment is I. If one of the slit is
closed, then the intensity at that place becomes I0. Which of the following relation
is true?
1) I = I0 2) I = 2I0
3) I = 4I0 4) there is no relation between I and I0
36. Two thin long parallel wires separated by a distance a are carrying a current I A
each. The magnitude of the force per unit length will be
I 0 I 0 I 2 I
1) 0 2) 3) 4) 0
4 a 4 a 2
2 a 2 a
37. A billiard ball of mass m and radius r hit by a cue stick at a height h above the
centre with a linear velocity v. The angular velocity  acquired by the ball is
5vh 5vr 2 2vr 2 2vr
1) 2
2) 3) 4)
2r 2 5h 5r 2

38. Match the columns :
Column-I Column-II
a) Magnetic field inside solenoid (p)  0 nI
b) Magnetic field outside (large (q) 0 N 2 A
distance) the solenoid l
c) Self Inductance of solenoid (r) B 2
2 0
d) Energy density inside solenoid (s) Zero
1) (a)→p, (b)→s, (c)→q, (d)→r 2) (a)→p, (b)→s, (c)→r, (d)→q
3) (a)→s, (b)→p, (c)→r, (d)→q 4) (a)→q, (b)→p, (c)→r, (d)→s
39. Minimum excitation potential of Bohr’s first orbit in hydrogen atom is
1) 3.6 V 2) 10.2 V 3) 13.6 V 4) 3.4 V
40. When a positive charge particle is moving on a equipotential surface, then work
done in this process will be
1) positive 2) negative 3) zero 4) None of these
41. Two plane mirror of length 24 m each are kept at a distance of 8 cm parallel to
each other. A ray of light incident on one end of one mirror at angle of 53°. Then,
 4
total number of reflections before it reaches the other end is  given, tan 53o  
 3
1) 225 2) 500 3) 100 4) 10
42. A particle executes SHM of amplitude 25 cm and time period 3s. The minimum
time required for the particle to move between two points 12.5 cm on either side
of the mean position is
1) 0.25 s 2) 0.5 s 3) 1 s 4) 1.25 s
43. A voltmeter has a resistance of G Ohm and range of V volt. The value of resistance
used in series to convert it into a voltmeter of range nV volt is
G G
1) nG 2) 3) (n – 1)G 4)
 n  1 n
44. An EM wave of intensity I falls on a surface kept in vacuum and exerts radiation
pressure P on it. Then choose incorrect option :-
I
1) Radiation pressure is if wave is totally absorbed
C
I
2) Radiation pressure is if wave is totally reflected
C
2I
3) Radiation pressure is if wave is totally reflected
C
I 2I
4) Radiation pressure is in the range P for real surface
C C
45. If 8 dipoles of charges of magnitude  e are placed inside the cube. The electric
flux coming out of cube will be
1) 16e/E0 2) 8e/E0 3) e/E0 4) Zero
CHEMISTRY
46. Which of the following shows higher vapour pressure?
1) 1.6 molal aq.KCl 2) 1.6 molal aq.glucose
3) 1.6 molal aq.BaCl2 4) 1.6 molal aq.AlCl3
o
47. The bond length of HCl molecule is 1.275 A and its dipolemoment is 1.03 D. The
percentage of ionic character of the molecule is
1) 100 2) 67.3 3) 33.66 4) 16.83
48. Vapour pressure of dilute aqueous solution of glucose is 750 mm of Hg at 373K.
The molefraction of solute is :
1 1 1 1
1) 2) 3) 4)
76 7.6 38 10
+
49. The nitrogen atoms in NH3, NH 2 , N H 4 are all surrounded by eight electrons.
When these species are arranged in increasing order of H – N – H bond angle,
correct order is
  
1) NH 3 , N H 2 , N H 4 2) NH 4 , NH 2 , NH 3 3) NH 3 , N H 4 , N H 2 4) N H 2 , NH 3 , N H 4

50. Which of the following will increase the voltage of the cell?
Sn s   2 Ag aq  
 Snaq2   2 Ag  s 
1) Increase in the size of silver rod
2) Increase in the concentration of Sn2 ions
3) Increase in the concentration of Ag  ions
4) None of these
51. Element with atomic number 115 has configuration as ______ and with most
stable oxidation state is _______.
1) [Rn] 7s25d104f147p3 M+3
2) [Rn] 7s 5d 4f 7p
2 10 14 3 M+5
3) [Rn] 7s25d104f147p3 M+
4) [Rn] 5d 4f 7p
10 14 5 M+5
52. Which of the following statements are not true?
1) Molar conductivity of weak electrolytes is low as compared to that of strong
electrolyte assuming both have same molar concentration
2) M decreases with increasing concentration of electrolyte
3) Conductivity of an electrolyte increases with decreases in concentration
4) All of these
53. Electronegativity ( Pauling scale) and electron affinity of an atom of an element A
are x and y ( in electron volt per atom ) respectively. Hence ionization potential
of A is
x y
1) 2) 2x  y 3) 2y  x 4) 5.6 x  y
2
Ea

54. The rate constant is given by the expression K  P.Ze . Which factor should
RT
register a decrease for the reaction to proceed more rapidly?

1) T 2) Z 3) Ea 4) P
55. Which of the following carbonyl compound when reacts with hydroxyl amine, in
presence of acid, the product obtained exhibits geometrical isomerisms
1) formaldehyde 2) 3-pentanone 3) cyclohexanone 4) Benzaldehyde
56. If 90% of a first order reaction completes in t minutes then 99% of same reaction
completes in _______ minutes.
1) 2t 2) 10 t 3) 4t 4) 5t
57. Most acidic compound among the following is..
CH3 O
1) 2) 3) 4)
O
O
58. Assertion (A): In CrO42 , all Cr – O bonds are equivalent while is Cr2O72  all bonds
are not equivalent.
Reason (R) : CrO42 is stable in basic medium while Cr2O72  is stable in acidic
medium.
the assertion
of the assertion
4) Both assertion and reason are incorrect
59. Select the correct statement among the following.
1) In the chlorination of n-butane, 2-chlorobutane is major product.
2) Bromine is less reactive towards alkanes in general than chlorine but bromine
is more selective in the site of attack when it does react.
3) Reactivity of halogens towards alkanes is in order F2 > Cl2 > Br2 > I2
4) All the above are correct statements.

60. Which of the following order’s is not in accordance with the property stated
against it?
1) HI  HBr  HCl  HF - Acidic property in H2O
2) NaF  NaCl  NaBr  NaI - Lattice energy
3) F2  Cl2  Br2  I 2 - Oxidising power
4) Cl2  Br2  I 2  F2 - Bond dissociation energy
61. Which of the following alkene when reacts with Br2 / CCl4 gives meso compound
(major product)
1) Cis-2-butene 2) trans-2-butene 3) 1-butene 4) butane
62. Assertion (A): In a given period, IP1 of 15 group element is higher than that of
th
16th group element.

Reason (R) : 15th group elements have stable half filled (np3) configuration.
the assertion
of the assertion

63. In the following reaction sequence, C 2 H 5Cl  KCN C 2 H 5 OH
 X 
H 3O / T
 Y  NH 3 .
What is the molecular formula of ‘y’?
1) C3H6O2 2) C3H5N 3) C2H4O2 4) C2H6O
64. Assertion (A): H2O is a liquid while H2S is a gas.
Reason (R) : Due to higher electronegativity of oxygen atom, in water H2O
molecules are associated through intramolecular H-bonding.
the assertion
of the assertion
65. CH 3CH 2 MgBr 
 ii  H 
( i ) CO2
 X 
Alc . KOH
 Y  major 
( iii ) Re d ' P '  Br2 1mole 
What is Y in the above reaction?

1) CH2(OH)COOH 2) CH2=CH-COOH
3) CH3CH(OH)COOH 4) CH2(OH)CH2COOH
66. In chromyl chloride test orange red vapours are obtained. These are due to
1) Cr2O72 2) CrO2Cl2 3) CrO5 4) None of these
67. Identify the product P in the following sequence of reactions

 
Phenol 
NaOH
 X  CO2
4 7 atm 410 K
Y 
H
 Z 
Ac2O / H
P
1) Asprin 2) Salicylablehyde 3) Benzoic acid 4) Salicylic acid
68. Which of the following is more stable complex?

3) CoF6  4) CoCl6 
3 3 3 3
1) Co  en 3  2)  Co  NH 3 6 
69.  CH 3 3 C  OH  Na  X , C2 H 5OH  PCl5   Y , X  Y 
 Z . What is Z?
CH3  C  CH 2
1) | 2) CH 3CH 2CH 2  O  CH3
CH 3
CH 3
| CH 3  CH  O  C2 H 5
3) CH 3  C  O  C2 H 5 4) |
| CH 3
CH 3
70. Which of the following is neither oxidation nor reduction?
1) S 2O82   SO42 2) NO2 
 NO3 3) Br2   Br  4) Cr2O72  
 CrO42

71. (I) HCHO (II) CH3CHO (III) CCl3CHO (IV) CH3 – CO – CH3
(V) PhCOCH3 (VI) C6H5CHO.
Which of the above compounds undergo aldol condensation?
1) Only II, III, IV and VI 2) Only II, IV and V
3) Only II and III 4) All except I
72. Ionic product of heavy water (D2O) is 11016 at 7 o C . The PD of value of pure heavy
water at 7 o C is
1) 7 2) 8 3) 6 4) 10
CHO
73. (i) conc.NaOH
O
(ii) H+
CHO (iii) ∆
C
1) C 2) O
COOH CH2
CH2OH
C
3) 4)
OH CHO
74. Among the first lines of Lyman, Balmer, Paschen and Bracket series of H-atomic
spectrum, which is associated with lower wavelength ?
1) Lyman 2) Balmer 3) Paschen 4) Brackett
75. ?
which of the following reagent is suitable for the preparation of the product in the
above reaction?
1) NaBH4 2) H2N – NH2 | C2H5ONa / ∆
3) Ni / H2 4) Red P + Cl2
76. Consider the following ionsiation steps :
 X g1  1e  ; H  100 unit ; X  g  
X  g    X g2  2e  ; H  250 unit
Select incorrect statement(s)
1) I.E1 of X(g) is 100 unit 2) I.E1 of X g  is 150 unit
3) I.E2 of X(g) is 250 units 4) I.E2 of X(g) is 150 unit
77. The correct order of increasing basic nature for bases NH3, CH3NH2 and (CH3)2NH
in gaseous phase.
1) CH3NH2 < NH3 < (CH3)2NH 2) NH3 < CH3NH2 < (CH3)2NH
3) CH3NH2 < (CH3)2NH < NH3 4) (CH3)2NH < NH3 < CH3NH2
78. Assertion (A): Noble gases have very low boiling points.
Reason (R) : Being monoatomic, Noble gases donot have strong interatomic forces
where only weak dispersion forces operate.
the assertion
of the assertion
79. In which of the following set, both compounds forms yellow precipitate with I2 +
NaOH?
1) CCl3CHO, PhCHO 2) CH3CH2CHO, HCHO
3) CH3CH2OH, CH3CH(OH)CH3 4) PhCOCH3, HCOOH


80. Equivalent weight of MnO4 in acidic, weak basic and neutral medium are in the
ratio of
1) 3 : 5 : 15 2) 5 : 3 : 1 3) 5 : 1 : 3 4) 3 : 5 : 5
81. Pick the wrong statement from the following:
1) Deficiency of vitamin B6 ( Pyridoxine ) results in convulsions.
2) The bacteria of the gut can produce some of the vitamins required for our body.
3) Deficiency of vitamin D causes xeropthalamia
4) Consumption of citrus fruits and green leafy vegetables in food prevents scurvy.
82. Which of the following is not extensive property?
1) heat capacity 2) free energy
3) electrode potential 4) entropy
83. Wrong order among the following against the property indicated.
1) CH 3CH  CH  CH 2  CH 3CH  CH 2  Heat of hydrogenation.
2) CH3  O  CH 2Cl  CH3  NH  CH 2Cl  Rate of S N 1 reactivity
3) CH 2  NO2   CHO  CH 2  Cl  CHO  Rate of nucleophilc addition
Cl Cl Cl
4)
< < - rate of nucleophilic substitution
NO2 CHO
84.  B+C, and that of KC2 is for B+C 
If the KC1 is for A   P. The equilibrium
 )P is
constant for A( 
KC1
1) K C1  K C2 2) K C2  K C1 3) K C1  K C2 4)
KC2
85. Which one of the following statements is correct?
1) Starch on complete hydrolysis gives fructose.
2) Lactose on hydrolysis gives glucose and fructose.
3 Maltose on complete hydrolysis gives galactose and glucose.
4) Cellulose is not digestible in the human body.
86. Which of the following is hexadentate ligand?
1) Ethylene diamine 2) EDTA
3) 1, 10-phenanthroline 4) Acetyl acetonato
87. Nesselers reagent is used to detect the presence of
1) CrO42 2) PO43 3) MnO4 4) NH 4
List-I (Complex) List-II (CFSE (0))
A)  Cu  NH 3 6 
2
(I) -0.6
B) Ti  H 2O 6 
3
(II) -2.0
C)  Fe  CN 6 
3
(III) -1.2
D)  NiF  (IV) -0.4

4
6
1) A-I, B-IV, C-II, D-III 2) A-II, B-III, C-I, D-IV

3) A-I, B-II, C-IV, D-III 4) A-III, B-IV, C-I, D-II
89. Cyanohydrin of which compound on hydrolysis will give lactic acid?
1) C6H5CHO 2) HCHO 3) CH3CHO 4) CH3CH2CHO
90. A metal M forms chlorides in its +2 and +4 oxidation states. Which of the
following statements about these chlorides is correct?
1) MCl2 is more covalent than MCl4
2) MCl2 is more easily hydrolysed than MCl4
3) MCl2 is more volatile than MCl4
4) MCl4 is more covalent than MCl2

BIOLOGY
Column-I (Location) Column-II (PGRs)
A) Human urine 1) Cytokinin
B) Gibberella fujikuroi 2) Auxin
C) Herring fish DNA 3) Ethylene
D) Ripening fruit 4) ABA
E) Inhibit seed germination 5) GA
Codes :
A B C D E A B C D E
1) 2 3 4 5 1 2) 2 5 1 3 4
3) 1 2 3 4 5 4) 5 4 3 2 1
92. What is the fate of the male gametes discharged in the synergid?
1) One fuses with egg other(s) degenerate(s) in the synergid
2) All fuse with the egg
3) One fuses with the egg, other(s) fuse(s) with synergid nucleus
4) One fuses with the egg and other fuses with central cell nuclei
93. Arrange the following events of meiosis in correct sequence :
(A) Crossing over (B) Synapsis
(C) Terminalization of chiasmata (D) Disappearance of nucleous
1) (B), (A), (C), (D) 2) (A), (B), (C), (D) 3) (B), (C), (D), (A) 4) (B), (A), (D), (C)
94. Assertion : Enzyme increases the rate of biochemical reactions.
Reason : Enzymes lower down the energy of activation.
95. Why C4 plants are special? Because,
(i) they have a special type of leaf anatomy.
(ii) they tolerate higher temperatures.
(iii) they show a response to high light intensities.
(iv) they lack a process called photorespiration.
(v) they have greater productivity fo biomass.
1) (i) and (ii) only 2) (i), (iii) and (iv) only
3) (i), (ii), (iii) and (iv) only 4) All of these
96. When two molecules of acetyl Co-A enter the TCA cycle, net gain at the end of
this cycle is
1) 2NADH2 + 2FADH2 + 1 GTP 2) 3NADH2 + 2FADH2 + 2 GTP
3) 6NADH2 + 2FADH2 + 2 GTP 4) 3NADH2 + 1FADH2 + 4 GTP
97. Identify the phytohormone responsible for the given functions.
I. Horizontal growth of seedlings.
II. Swelling of the axis and apical hook formation in dicot seed.
III. Promoting senescence and abscission of leaves and flowers.
IV. Highly effective in fruit ripening.
V. Promotes rapid internode/petiole elongation in deep water rice plants.
1) ABA 2) GA 3) Cytokinin 4) Ethylene
98. Identify the correct sequence from the following events of development process in
a plant cell choose the correct option.
I. Plasmatic growth II. Differentiation
III. Maturation IV. Senescence
1) IIIIIIIV 2) IIIIVIII 3) IVIIIIII 4) IVIIIIII
99. What is the correct order of the stages of aerobic cellular respiration?
1) Krebs’ cycle  Electron transport chain  Glycolysis
2) Electron transport chain  Krebs’ cycle  Glycolysis
3) Glycolysis  Krebs’ cycle  Electron transport chain
4) Glycolysis  Electron transport chain  Krebs’ cycle
100. The emasculated flowers are bagged to
1) Protect flower from strong sunlight 2) Protect flower from rain
3) Protect flower from unwanted pollen 4) Protect flower from insects

101. The second law of inheritance, i.e., law of segregation is based on the fact that :
1) Alleles do not show any blending
2) Both characters are recovered as such in F2 generation
3) One allele dominantes the other allele
4) Both (1) and (2)
102. Flowers that have a single ovule in the ovary and are packed into florescence are
usually pollinated by
1) Water 2) Bee 3) Wind 4) Bat
103. For storage of seeds
1) Dehydration is important only
2) Dormancy is important only
3) Neither dehydration nor dormancy is needed
4) Both dehydration and dormancy are crucial
104. Which of the following statement is correct in relation to the ETS?
1) It is present in the mitochondrial matrix
2) Oxidation of one molecule of NADH gives rise to 2 molecules of ATP, while that
of one molecule of FADH2 produces 3 molecules of ATP
3) Oxygen acts as the final electron acceptor
4) In respiration, light energy is utilized for the production of proton gradient
105. Photorespiraiton :
1) occurs because oxygen rather than carbon dioxide links to the RuBisCO
enzyme in the Calvin cycle
2) occurs more in C4 than in C3 plants under identical conditions
3) describes the uptake of CO2 & the release of oxygen in chloroplasts
4) all of the above
106. Which of the following tools of recombinant DNA technology is incorrectly paired
with its use?
1) EcoRI – Production of sticky ends
2) DNA ligase – multiplication of rDNA molecules
3) Ori-control copy number of linked DNA
4) Selectable marker – Identification of transformants
107. Gel electrophoresis is a
1) technique of separation of charged molecules under the influence of magnetic
field
2) technique of incorporation of DNA molecules into the cell through translient
power made due to electrical impulses
3) technique of separation of DNA fragments through the pores of agarose gel
under the influence of electrical field
4) technique of separation and purification of gene products
108. Baculoviruses (Nucleopolyhedrovirus) does not show
1) host specificity
2) narrow spectrum applications
3) effects on non-target pathogens
4) utility in IPM programme
109. The purpose of biological treatment of waste water is to
1) reduce BOD 2) increase BOD
3) reduce sedimentation 4) increase sedimentation
110. Biolistics (gene-gun) is suitable for
1) DNA finger printing 2) Disarming pathogen vectors
3) transformation in plant cells 4) Constructing DNA molecules
Column-I Column-II
A) Statins (I) Yeast
B) Ethanol (II) Blood-cholesterol lowering agent
C) Dung (III) Insect-resistant plant
D) Bt-cotton (IV) Biogas
1) A-II, B-I, C-IV, D-III 2) A-III, B-IV, C-I, D-II
3) A-I, B-II, C-III, D-IV 4) A-IV, B-II, C-I, D-III

112. Which of the following criteria should be fulfilled by a molecule to act as a genetic
material?
(i) It should be able to replicate.
(ii) It should be structurally and chemically stable.
(iii) It should be able to undergo slow mutations.
(iv) It should be able to expess itself in the form of ‘Mendelian characters’.
1) (i) and (ii) 2) (ii) and (iii) 3) (i), (ii) and (iii) 4) (i), (ii), (iii) and (iv)
113. Benefits of mycorrhiza are represented by which of the following statements?
(i) Resistance to root-borne pathogens.
(ii) Tolerance to salinity and absorption of phosphorus.
(iii) Tolerance to drought.
(iv) Overall increase in the plant growth and development.
1) (i) and (ii) 2) (ii) and (iii) 3) (iii) and (iv) 4) All of these
114. Which of the following statements are incorrect?
(i) RNA act as a genetic material as well as a catalyst.
(ii) RNA is more stable than DNA.
(iii) RNA has evolved from DNA.
1) (i) and (iii) only 2) (ii) and (iii) only 3) (i), (ii) and (ii) 4) (i) and (ii) only
115. The amino acid attaches to the tRNA at its
1) 5 - end 2) 3 - end 3) anticondon site 4) DHU loop
32
116. If the DNA of a virus is labeled with P and the protein of the virus is labeled
with 35 S , after transduction which molecule(s) would be present inside the
bacterial cells?
1) 32 P only 2) 35 S only 3) Both (1) and (2) 4) None of these
117. During transcription, the site of DNA molecule at which RNA polymerase binds is
called
1) promoter 2) regulator 3) receptor 4) enhancer
118. The frequency of recombination between gene pairs on the same chromosome as
a measure of the distance between genes was explained by
1) T.H. Morgan 2) Gregor J.b. Mendel
3) Alfred Sturtevant 4) Sutton Boveri
119. Assertion : At F2 stage in monohybrid cross, both parental traits are expressed
in the proportion of 3 : 1.
Reason : The contrasting parental traits show blending at F2 stage.
120. If Meselson and Stahl’s experiment is continued for four generations in bacteria,
the ratio of 15 N /15 N :15 N /14 N :14 N /14 N containing DNA in the fourth generation
would be
1) 1 : 1 : 0 2) 1 : 4 : 0 3) 0 : 1 : 3 4) 0 : 1 : 7
121. Which of the following statements is not correct regarding chitin?
1) It is a storage polysaccharide
2) It is a homopolysaccharide
3) It is a constituent of arthropod exoskeleton and fungal cell wall
4) It have as building blocks, amino-sugars and chemically modified sugars
(e.g., glucosamine, N-acetylgalactosamine etc)
122. During anaphase I of meiosis
1) homologous chromosomes separate
2) non-homologous chromosomes separate
3) sister chromatids of each chromosomes seperate
4) All of the above
123. In the F2 generation of a Mendelian dihybrid cross the number of phenotypes and
genotypes are
1) phenotypes-4; genotypes-16 2) phenotypes-9; genotypes-4
3) phenotypes-4; genotypes-8 4) phenotypes-4; genotypes-9

124. Match column I with column II and select the correct option from the given codes.
Column-I Column-II
A) GLUT-4 (i) Intercellualr ground substance
B) Antibody (ii) Enzyme
C) Collagen (iii) Hormone
D) Trypsin (iv) Fights infectious agents
E) Insulin (v) Enables glucose transport in cells
1) A-(i), B-(ii), C-(iii), D-(iv), E-(v) 2) A-(v), B-(iv), C-(i), D-(ii), E-(iii)
3) A-(v), B-(iv), C-(iii), D-(ii), E-(i) 4) A-(ii), B-(i), C-(iv), D-(v), E-(iii)
125. Consider the following statements and choose the correct statement.
(i) The endomembrane system includes mitochondria, chloroplast and
peroxisomes.
(ii) Smooth endoplasmic reticulum is the major site for synthesis of lipqid.
(iii) Rough endoplasmic reticulum is actively involved in protein synthesis.
(iv) Mitochondrial matrix possesses single circular DNA, a few RNA and 80S
ribosomes.
Of the above statements.
1) (i) and (iii) 2) (ii) and (iv) 3) (iii) and (iv) 4) (ii) and (iii)
126. _______ are self replicating, extra chromosomal segments of double stranded
circular and naked DNA, present in a bacterial cell.
1) Plasmids 2) Nucleoid 3) Mesosomes 4) Genophore
127. Which of the following statements about sporopollenin is incorrect?
1) Exine is made up of sporopollenin
2) Sporopollenin is one the resistant organic materials
3) Exine has apertures called germ pores where sporopollenin is present
4) Sporopollenin can withstand high temperatures and strong acids
128. Study the following statements regarding the anatomy of isobilateral leaf.
(i) Stomata are equally distributed on both the surfaces.
(ii) Certain adaxial epidermal cells are modified into bulliform cells in grasses.
(iii) The vascular bundles are radial.
(iv) Phloem is adaxially placed.
Which of the above statements are correct?
1) (i) and (ii) 2) (ii) and (iii) 3) (ii) and (iv) 4) All are correct
129. A typical monocotyledonous root is characterised by
1) usually more than six xylem bundles 2) large and well developed pith
3) no secondary growth 4) all of these
Column-I Column-II
A) Marginal (i) Sunflower, marigold
B) Parietal (ii) Pea
C) Axile (iii) Mustard, Argemone
D) Free central (iv) Hibiscus, tomato, lemon
E) Basal (v) Dianthus, Primrose
1) A-(ii), B-(iii), C-(iv), D-(v), E-(i) 2) A-(i), B-(iii), C-(ii), D-(v), E-(iv)
3) A-(i), B-(ii), C-(iii), D-(iv), E-(v) 4) A-(iii), B-(ii), C-(iv), D-(v), E-(i)
131. Which of the following gymnosperms has branched stems?
1) Pinus 2) Cycas 3) Cedrus 4) Both (1) and (3)
132. Which of the following statements about Phaeophyceae is incorrect?
1) Vegetative reproduction occurs by fragmentation
2) Asexual reproduction is by biflagellate pear-shaped zoospores
3) In sexual reproduction, gametes are pyriform and bear 2 laterally attached
flagella
4) They have dominant pigment is r-phycoerythrin
1) Most plant viruses are RNA viruses
2) Bacteriophages possess dsDNA
3) Viroids caused potato spindle tuber disease
4) Prions possess only nucleoid and no proteins

134. Select the mismatched pair.
1) Taproot system - Dicots
2) Fibrous root system - Monocots
3) Fasciculated roots - Curcuma
4) Stilt roots - Sugarcane
135. Which of the following statements is not correct regarding the class Ascomycetes?
1) Conidia are the asexual spores produced endogenously on conidiophores
2) Ascospores are the sexual spores produced endogenously in asci
3) Aspergillus, Neurospora and Claviceps are Ascomycetes fungi
4) Mycelium is generally branched and septate in Ascomycetes
136. Choose incorrect pair with respect to sex determination in different organisms.
1) Grass hopper – XX-XO type 2) Birds – ZZ – ZW type
3) Drosophila – ZZ - ZO type 4) Human – XX – XY type
137. Nocturnal vision in cockroach is known as
1) mosaic vision with more sensitivity and high resolution
2) mosaic vision with more sensitivity but less resolution
3) mosaic vision with less sensitivity and less resolution
4) mosaic vision with less sensitivity but high resolution
138. Read the following
a) Spongilla b) Catla c) Asterias d) Ctenoplana
e) Ophiura f) Charcarodon
Which of the above are exclusively confined to marine habitat?
1) a, b, c and d 2) b, e and f 3) a and e 4) c,d , e and f
139. Match the following & choose the correct set.
Organism Feature
I) Sycon a) Metagenesis
II) Ctenoplana b) Hermaphrodite
III) Nereis c) Only sexual reproduction occurs
IV) Meandrina d) Dioecious
e) Coral formation
1) I-b,II-c,III-d,IV-e 2) I-b,II-c,III-d,IV-a
3) I-c,II-b,III-d,IV-e 4) I-d,II-c,III-b,IV-a
140. Percentage of energy transferred to each higher trophic level from the lower
trophic level is
1) 1% 2) 10% 3) 40% 4) 90%
141. It is understood that the first organisms that invaded land were
1) amphibians 2) insects 3) plants 4) reptiles
142. Species interaction with negative influence on both partners is referred to as
1)amensalism 2) mutualism 3) commensalism 4) competition
143. Sports persons may misuse which of the following to increase muscle strength?
1) Narcotic analgesics 2) Anabolic steroids 3) Diuretics 4) all of the above
144. An animal which is not a mammal
1) Bat 2) Turtle 3) Dolphin 4) Platypus
145. Heart of cockroach consists of an elongated muscular tube lying along mid dorsal
line of
1] Abdomen and head 2) Head and thoracic
3] Both [1] and [2] 4) Thoracic and abdomen
146. The gestation period of Dogs, Elephants, Cats and Humans respectively.
1) 2 Months, 20 Months, 2 Months, 9 Months
2) 3 Months, 4 Months, 5 Months, 9 Months
3) 6 Months, 7 Months, 8 Months, 45 Weeks
4) 60 Months, 600 Months, 60 Months, 9 Months.
147. Identify the stage in the process of oogenesis in women, that is characterized by
a fully developed antrum
1) Primordial follicle 2) Secondary follicle
3) Primary follicle 4) Tertiary follicle
148. Which of the following statements are true regarding Mendelian disorders?
a) they are mainly determined by alteration or mutation in the single gene
b) Their inheritance can be traced in a family by pedigree analysis
c) They may be dominant or recessive
d) They are restricted to autosomes
1) a, b, c, d 2) a,b,c 3) b,c,d 4) a,c,d

149. Identify the incorrect pair from the salient observations drawn from the human
genome project
1) total number of genes – 30,000
2) total number of nucleotide bases – 3164.7 billion
3) number of bases in the average gene – 3,000
4) number of locations where SNPs occur – 1.4 million
150. Identify the correct one among the following
Organism Taxon Character
1) Trygon Chondrichthyes Air bladder for buoyancy
2) Hippocampus Osteichthyes Males with claspers
3) Neophron Aves Skin completely devoid of glands
4) Balaenoptera Mammalia Viviparous homeotherm
151. In male frog, vasa efferentia first release sperms into
1) cloaca 2) Bidder’s canal 3) ureter 4) urinogenital duct
152. Study the following statements & choose the correct answer
Statement 1: Inactivated or weakened pathogens or antigenic proteins are
introduced into the host body to induce active immunity.
Statement 2: In passive immunization preformed antibodies or antitoxins are
injected into the host body.
1) Both Statement 1 and 2 are correct
2) Both Statement 1 and 2 are incorrect
3) Statement 1 is correct but 2 is incorrect
4) Statement 1 is incorrect but 2 is correct
153. High risk of AIDS and Hepatitis – B is observed in
1) Drug abusers 2) Drug and alcohol abusers
3) Drug / Alcohol / Tobacco users
4) Drug abusers consuming drugs intravenously
154. Which of the following diseases are caused by bacteria?
1) Pneumonia, Genital warts 2) Diphtheria, Plague
3) Dysentery, Trichomoniasis 4) Hepatitis-B, Amoebiasis
155. In a H.W. population of 250 individuals 40 exhibit the recessive phenotype. Find
out the number of heterozygotes in the population.
1) 80 2) 90 3) 120 4) 160
156. “Don’t die of ignorance” slogan is used to create awareness for
1) AIDS 2) Cancer 3) Typhoid 4) Rabies
157. 50% of the sperms produced are devoid of sex chromosome in case of
1) Grasshoppers 2) Human 3) Birds 4) Drosophila
158. The antibodies produced in allergies are
1) Ig A type 2) Ig G type 3) Ig E type 4) Ig M type
159. The most important cause for the loss of biodiversity is
1) over-exploitation 2) alien species invasion
3) habitat loss and fragmentation 4) co-extinction
160. In the mammalian kidney counter current multiplier system for concentration of
urine occurs in
1) The two limbs of loop of Henle 2) The two limbs of vasa recta
3) PCT and DCT 4) Both 1 and 2
161. During the cardiac cycle the semilunar valves open
1) during the atrial systole when pressure rises in the ventricles
2) during the ventricular systole when pressure rises in them
3) during the ventricular diastole when pressure increases in them
4) during the ventricular systole when pressure increases in the atria

162. The total volume of air that can be accommodated in the lungs at the end of forced
inspiration is
1) Vital Capacity 2) Inspiratory capacity
3) Inspiratory Reserve volume 4) Total Lung capacity
163. Study the following diagram and identify the correct answer
1) A- thermostat of the body

2) B- major coordinating centre for sensory & motor signaling
3) C- control hunger 4) D- regulation of tears is a function
164. Seminal plasma in human is rich in
1) fructose, calcium and certain enzymes
2) fructose and calcium but has no enzymes
3) glucose and certain enzymes but has no calcium
4) fructose and certain enzymes but poor in calcium
165. The joint between adjacent vertebrae in the vertebral column which permits
limited movement is a
1) fibrous joint 2) cartilaginous joint 3) pivot joint 4) condyloid joint
166. In the process of contraction of the skeletal muscle, the cross-bridge is broken
when
1) ATP is hydrolysed 2) power stroke is completed
3) power stroke is initiated 4) a new ATP molecule binds to the head of myosin
167. If a colour blind man marries a woman whose mother is colour blind, then among
their progeny,
1) 25% are colour blind 2) 50% are colour blind
3) 50% sons & 25% daughters are colourblind
4) all sons are colour blind & all daughters are carriers
168. Study the following statements.
Statement 1: PTH stimulates demineralisation of bones, reabsorption of Ca+
from renal tubules and absorption of Ca+from the digested food.
Statement 2: Glucocorticoids stimulate protein synthesis and lipogenesis.
1) Both Statement 1 and 2 are correct
2) Both Statement 1 and 2 are incorrect
3) Only statement 1 is correct 4) Only statement 2 is correct
169. Natural selection in which more individuals acquire a value other than the mean
character value leads to
1) Stabilizing selection 2) Directional selection
3) Disruptive selection 4) adaptive radiation
170. The hierarchial category between kingdom and class is:
1) Order 2) Phylum 3) Family 4) Species
171. High regeneration capacity is possessed by
1) Aurelia 2) Pheretima 3) Bombyx 4) Planaria
172. Match the following & choose the correct set
Contraceptive method Feature
A) Barriers i) Most preferred in India
B) IUDS ii) Prevent ovulation
C) OCPs iii)Inserted into female reproductive tract to cover cervix
D) Natural methods iv) Higher risk of failure
v) Protection against STD s
1) A-iii, B-i, C-ii, D-v 2) A-v, B-i, C-ii, D-iv
3) A-iv, B-iii, C-i, D-ii 4) A-v, B-iii, C-i, D-iv

173. Identify the correct one among the following with respect to partial pressure of
respiratory gases
1) Systemic veins ---- pO2=55 mm Hg, pCO2=40 mm Hg
2) Systemic arteries ---- pO2=95 mm Hg, pCO2=40 mm Hg
3) Pulmonary veins---- pO2=104 mm Hg, pCO2=45 mm Hg
4) Alveolar air---- pO2=159 mm Hg, pCO2=40 mm Hg
174. During embryonic development of man, the stem cells that have the potency to
give rise to all the tissues and organs are present in the
1) Inner cell mass 2) Trophoblast 3) Zygote 4) Umbilical cord
175. Statement-I: Heart of fish contains only deoxygenated blood.
Statement-II: Oxygenated blood do not return back to the heart in fishes.
1) Both statement-I and statement-II are true
2) Both statement-I and statement-II are not true
3) Statement-I is true but statement-II is false
4) Statement-I is false but statement-II is true
176. In the nephron maximum reabsorption of glomerular filtrate takes place in
1) DCT 2) PCT 3) CD 4) Loop of Henle
177. ATPase enzyme needed for muscle contraction is located in
1)Myosin tail 2)Tropomyosin 3)Troponin 4)Myosin head
178. Given below are two statements : one is labelled as Assertion (A) and the other is
labelled as Reason (R).
Assertion (A) : All vertebrates are chordates but all chordates are not vertebrates
Reason (R) : Notochord is replaced by vertebral column in the adult vertebrates
179. Which of the following statement is incorrect regarding menstrual cycle.
1) Menstrual flow occurs due to lack of pregnancy hormone
2) Cyclic menstruation is an indicator of normal reproductive phase and extends
between menarche and menopause.
3) The reproductive cycle of female primates is also called Oestrous cycle.
4) Two pituitary and one ovarian hormones are high in concentration at ovulatory
phase.
180. Given below are two statements : one is labelled as Assertion (A) and the other is
labelled as Reason (R).
Assertion (A) : Osteoporosis is characterized by decreased bone mass and
increased chance of fractures.
Reason (R) : Common cause of osteoporosis is increased levels of estrogen.
In the light of the above statements, choose the most appropriate answer from
the option given below:
*******

: ANSWER KEY:
1 4 11 1 21 1 31 2 41 1
2 1 12 2 22 3 32 3 42 2
3 1 13 3 23 2 33 4 43 3
4 1 14 2 24 1 34 2 44 2
5 3 15 2 25 1 35 3 45 4
6 3 16 4 26 4 36 3
7 1 17 4 27 1 37 1
8 4 18 3 28 2 38 1
9 3 19 3 29 4 39 2
10 3 20 3 30 1 40 3
SUB:CHEMISTRY
46 2 56 1 66 2 76 3 86 2
47 4 57 1 67 1 77 2 87 4
48 1 58 2 68 1 78 1 88 1
49 4 59 4 69 3 79 3 89 3
50 3 60 4 70 4 80 4 90 4
51 1 61 2 71 2 81 3
52 3 62 1 72 2 82 3
53 4 63 1 73 2 83 4
54 3 64 3 74 1 84 1
55 4 65 2 75 2 85 4
SUB : BOTANY
91 2 101 4 111 1 121 1 131 4
92 4 102 3 112 4 122 1 132 4
93 1 103 4 113 4 123 4 133 4
94 1 104 3 114 2 124 2 134 3
95 4 105 1 115 2 125 4 135 1
96 3 106 2 116 1 126 1
97 4 107 3 117 1 127 3
98 1 108 3 118 3 128 1
99 3 109 1 119 3 129 4
100 3 110 3 120 4 130 1
136 3 146 1 156 1 166 4 176 2
137 2 147 4 157 1 167 2 177 4
138 4 148 2 158 3 168 3 178 1
139 1 149 2 159 3 169 2 179 3
140 2 150 4 160 4 170 2 180 3
141 3 151 2 161 2 171 4
142 4 152 1 162 4 172 2
143 4 153 4 163 2 173 2
144 2 154 2 164 1 174 1
145 4 155 3 165 2 175 1

NEET GRAND TEST - 1
STD : XII & LT SET – 1 Max. Marks : 720
answer sheet.
The question paper consists of four parts (Physics, Chemistry, Botany &
In every part contains two sections A&B. Section-A : 35 Q; Section-B : 15 Q
Each question has four choices (1), (2), (3) and (4) out of which ONLY ONE IS
CORRECT.
Candidate have attempt all the questions in Section-A and only 10 questions in
Section-B;
Marking Scheme :
Section-A : 35 questions – 140 Marks
Section-B : 15 Questions – 40 Marks
For each question in every part you will be awarded4 Marks if you darken the
bubble corresponding to the correct and zero mark if no bubbles are
darkened, minus (–1) will be awarded for incorrect answer.

GT - 1 (SET-1) XII & LT-NEET MODEL-19.04.2024
PHYSICS
SECTION – A
ANSWER ALL THE FOLLOWING QUESTIONS:
1. In pure semiconductor, the number of conduction electrons is 6  1018 per cubic
metre. How many holes are there in a sample of size 1 cm  1 cm  1 mm?
1) 3  1010 2) 6  1011 3) 3  1011 4) 6  1010
2. In a vernier calipers, one main sacle division is x cm and n division of the vernier
scale coincide with (n – 1) divisions of the main scale. The lest count (in cm) of
the calipers is
 n 1  nx x x
1)  x 2) 3) 4)
 n   n  1 n  n  1
3. A ball is released from the top of a tower. The ratio of work done by force of
gravity in 1st second, 2nd second and 3rd second of the motion of ball is
1) 1 : 2 : 3 2) 1 : 4 : 16 3) 1 : 3 : 5 4) 1 : 9 : 25
2
gx
4. The equation of a projectile is y  3 x  . The angle of projection is given by
2
  
1) 2) 3) 4) zero
6 3 2
5. If 106 electrons/s are flowing through an area of cross section of 10 4 m 2 then the
current will be :
1) 1.6 107 A 2) 1.6 1013 A 3) 1 106 A 4) 1 102 A
6. A force acts on a body of mass 50kg at rest, for 10 seconds. When the force stops
acting on the body, the body covers 80m in the next 10 seconds. What is the
magnitude of the force?
1) 40N 2) 50N 3) 30N 4) 60N
7. A metallic ring is attached with the wall of a room. When the north pole of a
magnet is brought near to it, the induced current in the ring will be
S
a
N
1) First clockwise then anticlockwise 2) In clockwise direction

3) In anticlockwise direction 4) First anticlockwise then clockwise
8. The de-Broglie wavelength of a particle moving with a velocity 2.25  108 m/s is
equal to the wavelength of photon. The ratio of kinetic energy of the particle to the
energy of the photon is (velocity of light is 3  108 m/s)
1) 1/8 2) 3/8 3) 5/8 4) 7/8
9. In the figure S1 and S2 are identical springs. The oscillation frequency of the
mass m is f. If one spring is removed, the frequency will become
1) f 2) f  2 3) f  2 4) f / 2
10. The graph plotted between the velocity and displacement from mean position of a
particle executing SHM is
1) circle 2) ellipse 3) parabola 4) straight line
11. Relationship between P (pressure), V (volume) and E (kinetic energy) for a gas is
3 2 3 2
1) P  EV 2) V  EP 3) PV  E 4) PV  E
2 3 2 3
12. Write down the following temperatures in the increasing order 50oF, 50oC and
50oK.
1) 50 K < 50oF < 50oC 2) 50oF < 50 K < 50oC
3) 50 C < 50 F < 50 K
o o 4) 50oF < 50oC < 50oK
13. The internal energy change in a system that has absorbed 2 kcal of heat and
done 500J of work is
1) 8900 J 2) 6400 J 3) 5400 J 4) 7900 J

14. If U and W represent the increase in internal energy and work done by the
system respectively in a thermodynamical process, which of the following is true?
1) U = -W, in an adiabatic process 2) U = W, in an isothermal process
3) U = W, in an adiabatic process 4) U = -W, in an isothermal process
15. The kinetic energy per gm mol for a diatomic gas at room temperature is
5 3 1
1) 3RT 2) RT 3) RT 4) RT
2 2 2
16. Two charges are at a distance d apart. If a copper plate (Conducting medium) of
thickness d/2 is placed between them, the effective force will be
1) 2F 2) F/2 3) 0 4) 2F
17. Let a wire be suspended from the ceiling (rigid support) and stretched by a weight
W attached at its free end. The longitudinal stress at any point of cross-sectional
area A of the wire is
1) W/2A 2) Zero 3) 2W/A 4) W/A
18. Two concentric circular loops of radii r1 and r2 carry clockwise and anticlockwise
currents i1 and i2. If the centre is a null point, i1/i2 must be equal to
1) r2 / r1 2) r22 / r12 3) r12 / r22 4) r1 / r2
19. Assertion (A): The angle of contact of pure water with glass is acute
Reason (R): The adhesive force between molecules of water and glass is greater
than cohesive force between water molecules.
20. An electron moving around the nucleus with an angular momentum L has a
magnetic moment.
e e 2e e
1) L 2) L 3) L 4) L
m 2m m 2 m
21. A planet moving along an elliptical orbit is closer to the sun at a distance r1 and
farthest away at a distance of r2 . If v1 and v2 are the linear velocities at these
v
points respectively, then the ratio 1 is
v2
1)  r1 / r2  3)  r2 / r1 
2 2
2) r2 / r1 4) r1 / r2
22. The earth (mass = 6 × 1024kg) revolves around the sun with an angular velocity of
2  10 7 rad / s in a circular orbit of radius 1.5 ×108km. The force exerted by the sun
on the earth, in newton, is
1) 36  10 21 2) 27  1039 3) Zero 4) 18  1025
23. Tube A has both ends open while tube B has one end closed, otherwise they are
identical. The ratio of fundamental frequency of tubes A and B is
1) 1 : 2 2) 1 : 4 3) 2 : 1 4) 4 : 1
24. According to Bohr’s atomic model”
1) The electron radiates energy only when it jumps to inner orbit
2) An atom has heavy, positively charged nucleus
3) The electron can move only in particular orbits
4) All of the above statements are true
25. For the given figures, choose the correct options:
1) The rms current in circuit (b) can never be larger than that in (a)
2) The rms current in figure (a) is always equal to that in figure (b)
3) The rms current in circuit (b) can be larger than that in (a)
4) At resonance, current in (b) is less than that in (a)

26. A magnet is brought towards a coil
(i) speedly (ii) slowly then the induced e.m.f./induced charge will be respectively
1) More in first case / More in first case
2) More in first case/Equal in both case
3) Less in first case/More in second case
4) Less in first case/Equal in both case
27. A plane mirror reflects a pencil of light to form a real image. Then the pencil of
light incident on the mirror is
1) Parallel 2) Convergent 3) Divergent 4) None of the above
28. Two mirrors are inclined at an angle of 50 . The number of images formed for an
0
object placed in between the mirrors is

1) 5 2) 6 3) 7 4) 8
29. Which of the following property of light is a sure proof of wave nature of light?
1) Interference 2) Diffraction
3) Photoelectric effect 4) Both (1) & (2)
 
30. On superposition of two waves y1  3sin t  kx  and y2  4sin   t  kx   at a
 2
point, the amplitude of resulting wave will be
1) 7 2) 5 3) 7 4) 6.5
31. At absolute zero, Si acts as a
1) metal 2) semi conductor 3) insulator 4) none of these
32. A difference of temperature of 40oC is equivalent to a difference of
1) 45oF 2) 72oF 3) 30oF 4) 25oF
33. Three identical point charges are placed at each corner of an equilateral triangle.
Then
1) at the centre of the triangle the resultant electric intensity is zero
2) at the centre of the triangle the net electric potential is zero
3) the electrostatic potential energy of the system is zero
4) the resultant electric intensity at any corner is zero
34. Two small spheres each carrying a charge ‘q’ are placed ‘r’ metre apart. If one of
the spheres is taken around the other one in a circular path of radius r, the work
done will be equal to
1) Force between them  r 2) Force between them  2r
3) Force between them / 2r 4) Zero
35. Two bodies of masses m and 4m have kinetic energies in the ratio 1 : 2. Their
momentum P1 and P2 are in the ratio
1) 1: 2 2 2) 1: 2 3 3) 2 2 :1 4) 3 2 :1
SECTION – B
ANSWER ANY TEN OF THE FOLLOWING QUESTIONS:
36. The current in a conductor varies with time t as I  2t  3t 2 where I in amperes and
t in seconds. Electric charge flowing through a section of the conductor during
t = 2s to t = 3s is:
1) 10C 2) 24C 3) 33C 4) 44C
37. Assertion: The stretching of a spring is determined by the shear modulus of the
material of the spring.
Reason: A spring of copper has more tensile strength than a steel spring of same
dimensions.
38. Two parallel, long wires carry currents i1 & i2(i1>i2) when the currents are in the
same direction, the magnetic indudctin at a point midway between the two wires
is X. If the direction of i2 is reversed, the magnetic induction becomes 2x, then
i1/i2 is
1) 1 2) 2 3) 3 4) 4

39. The variation of magnetic susceptibility    with absolute temperature T for a
ferromagnetic material is given in figure by
40. Assertion (A): A needle placed carefully on the surface of water may float, where
as a ball of same material sinks
Reason (R): Archimedes principle is applicable for only spherical bodies.
41. If all vectors shown in figure here have the same magnitude, then which of the
following has resultant of highest magnitude?
1) I 2) II 3) III 4) II and III

42. The moment of inertia of a wheel of radius 20cm is 40kg m2. If a tangential force
of 80 N applied on the wheel which is at rest, its Rotational K.E. after 4s is
1) 16.2J 2) 51.2J 3) 25.6J 4) 24.8J
43. Two bodies of mass 5kg and 3kg are moving towards each other with 2 ms 1 and
4 ms 1 respectively. Then velocity of centre of mass is
1) 0.25 ms 1 towards 3kg 2) 0.5 ms 1 towards 5kg
3) 0.25 ms 1 towards 5kg 4) 0.5 ms 1 towards 3kg
44. An inductor of inductance 2  H is connected in series with a resistance, a
variable capacitor and an AC source of frequency 7 kHz. The value of capacitance
1
for which maximum current is drawn into the circuit is farad , Where the value
x
 22 
of x is ___________  Take   
 7 
1) 3872 2) 3972 3) 3862 4) 3852
45. The energy that should be added to an electron, to reduce its de-Broglie
wavelengths from 10 10 m to 0 . 5  10 10 m, will be
1) Four times the initial energy 2) Thrice the initial energy
3) Equal to the initial energy 4) Twice the initial energy
46. A force F  k / x 2  x  0  acts on a particle in x-direction. Find the work done by
the force in displacing the particle from x = -a to x = 2a.
9k
1) 3k / 2a 2) 4k / a 2 3) 3k / 2a 2 4)
a2
47. A tunning fork arrangement (pair) produces 4 beats/s with one fork of frequency
288 cps. A little wax is placed on the unknown fork and it then produces 2
beats/s. The frequency of the unknown fork is
1) 286 cps 2) 292 cps 3) 294 cps 4) 288 cps
48. Ionization potential of hydrogen atom is 13.6 eV. Hydrogen atoms in the ground
state are excited by monochromatic radiation of photon energy 12.1 eV. The
spectral lines emitted by hydrogen atoms according to Bohr’s theory will be:
1) One 2) Two 3) Three 4) Four

49. Two positive point charges are 3 m apart and their combined charge is 20  C . If
the force between them is 0.075 N, the charges are
1) 10  C ,10  C 2) 15 C ,5 C 3) 12  C ,8 C 4) 14  C , 6  C
50. The velocity of water waves v may depend upon their wavelength , the density of
water  and the acceleration due to gravity g. The method of dimensions gives
the relation between these quantities as
1) v 2   g 1  1 2) v 2  g  3) v 2  g  4) v 2  g 1 3
CHEMISTRY
SECTION – A
ANSWER ALL THE FOLLOWING QUESTIONS :
51. Which of the following shows higher vapour pressure?
1) 0.6m aqueous AlCl3 2) 0.6m aqueous BaCl2
3) 0.6m aqueous Sucrose 4) 0.6m aqueous KCl
52. 0.8 mole of Al2(SO4)3 is dissolved in a 2 lit solution. Among the following
statements.
A) Molarity of the solution is 0.4 Mol.lit 1 .
B) Normality of the solution is 2.4N.
C) Normality of Al 3 ion is 1.2N.
C) Normality of SO42 ion is 0.8N.
The correct statements are
1) All A, B, C and D 2) Only A and B
3) Only A, C and D 4) Only A, B and C
53. Phenol and carboxylic acid can be distinguished from each other using
1) NaOH solution 2) NaCl solution 3) NaHCO3 solution 4) Na metal
54. The electron gain enthalpy of chlorine is -3.6eV/atom. The amount of energy
released in kJ when 1g of chlorine atoms is completely converted to Cl  ions in
the gaseous state is 1ev / atom  96.483 kJ / mol 
1) 48 2) 195.6 3) 9.78 4) 4.8
55. Elements X, Y and Z have atomic numbers 19, 37 and 55 respectively. Which of
the following statements is true about them?
1) Their ionization potential would increase with increasing atomic number
2) ‘Y’ would have an ionization potential between those of X and Z
3) Z would have the highest ionization potential
4) X would have the highest ionization potential
OH
CH3
1) 4 – methyl cyclo pent-1-ene-2-ol 2) 2-methyl cyclopent-4-ene-4-ol
3) 3 – methyl cyclo pent-1-ene-2-ol 4) 5-methyl cyclo pent-2-ene-1-ol
57. An electron is moving in Bohr’s fourth orbit. Its de Broglie wavelength is λ. Then
the circumference of the third orbit?
 6 9 4
1) 2)  3)  4) 
2 4 4 3
58. Uncertainty in the position of an electron moving with a velocity 300 ms-1
accurate upto 0.001% will be
1) 3.84 x 10-2 m 2) 19.2 x 10-2 m 3) 5.76 x 10-2 m 4) 1.92 x 10-2 m
59. Which conformation of the alkane has the highest potential energy?
1) 2) 3) 4)
60. An azo dye aniline yellow will be formed when benzene diazonium chloride reacts
with
1) Phenol 2) Aniline 3) -Naphthol 4) Nitrobenzene

List-I (functional group) List-II (reagent)
1) –OH (Alcohol) a) Ceric ammonium nitrate
2) –COOH b) NaHCO3
3) >C = O c) 2,4-DNP
4) –NH2 d) C6H5SO2Cl
1 2 3 4 1 2 3 4
1) a b c d 2) d c b a
3) a c d b 4) a c b d
62. A sodium salt on treatment with MgCl2 gives white precipitate only on hating.
The anion of the sodium salt is
1) HCO3 2) CO32  3) NO3 4) SO42
63. Which of the following is diamagnetic?
1) O2 2) O2 3) O22 4) O2
64. Read the following statements and choose the correct option. Here T stands for
True and F stands for False statement.
(i) The smaller the size of the cation and the larger the size of the anion, the
greater the covalent character of an ionic bond.
(ii) The smaller the charge on the cation, the greater is the covalent character
(iii) For cations of the same size and charge, the one with electronic configuration
 n  1 d 10 ns 0 , typical of transition metals, is more polarizing than the one with
noble gas configuration, ns 2 np 6 , typical of alkali and alkaline earth metal cations.
1) T T T 2) T T F 3) T F T 4) F T T
65. In which of the following the central atom does not undergo sp3 hybridisation ?
1) CCl 4 2) NH3 3) H 2 O 4) SCl4
66. Statement –1 : Pyridine is more basic than aniline.
Statement –2 : In pyridine the lone pair on nitrogen is localised
for Statement-1
2) Statement-1 is true, Statement-2 is true, Statement-2 is not a correct
O O
67. Statement –1 : is more acidic than CH3 – CO2H.
CH 3  C  CH 2  C  CH 3
Statement –2 : Above active methylene hydrogen is less acidic than carboxylic
acid.
for Statement-1
68. Which of the following 13th group elements, have noble gas configuration plus
10d-electrons in their penultimate shell ?
1) B & Al 2) Ga & In 3) Al & Ga 4) In & B
Asserion (A) :  SiF6  is known, but  SiCl6 
2 2
69. is not known
Reason (R) : Six large chloride ions cannot be accommodated around Si 4 ion
70. The correct order of reactivity towards the electrophilic substitution of the
compounds aniline (I), benzene (II) and nitrobenzene (III) is
1) III > II > I 2) II > III > I 3) I < II = III 4) I > II > III

71.
72. Which one is not prepared by Wurtz reaction?

CH 3  CH  CH  CH 3
1) C2 H 6 2) C4 H10 3) CH 4 4) | |
CH 3 CH 3
73. Copper metal reacts with nitric acid. Assume that the reaction
3Cu(s) + 8HNO3(aq)  3Cu(NO3)2 (aq) + 2NO(g) + 4H2O()
(given : MW of Cu(NO3)2 is 187.5g/mol)
If 18.75 g Cu(NO3)2 is eventually obtained, then how many grams of nitric oxide,
NO, would have also formed, according to the preceeding equation ?
(1) 2 g. (2) 4 g. (3) 6 g. (4) 8 g.
74. One mole of P4 molecules contain :
(1) 1 molecule (2) 4 molecules
1
(3)  6.022  1023 atoms (4) 24.088 × 1023 atoms
4
75. Oxidation number of carbon is zero in the compound
1) Methyl chloride 2) Chloroform
3) Glucose 4) Carbon tetrachloride
76. The major product of the following reaction is
77. The correct order of bond enthalpy of ‘C – X’ bond is

1) CH 3  Cl  CH 3  F  CH 3  Br  CH 3  I 2) CH 3  F  CH 3  Cl  CH 3  Br  CH 3  I
3) CH 3  F  CH 3  Cl  CH 3  Br  CH 3  I 4) CH 3  F  CH 3  Cl  CH 3  Br  CH 3  I
78. Oxygen is divalent, where as sulphur exhibits a valency of 2,4 or 6. This is due to
1) High electronegativity of oxygen than sulphur
2) Large size of sulphur atom
3) High ionization potential of oxygen
4) Availability of vacant d-orbitals in the valency shell of sulphur
79. Bond dissociation energies of HF, HCl, HBr follow the order
1) HCl  HBr  HF 2) HF  HBr  HCl
3) HF  HCl  HBr 4) HBr  HCl  HF
80. For a first order reaction, the rate of reaction is 2.4 103 M .min 1 and
concentration of reactant is 0.048M. Then 75% of the reaction completes in _____
min.
1) 69.3 2) 13.86 3) 27.72 4) 55.44

81. For a reaction, A2  B2 
 2 AB , following mechanism is given.
 2 A  fast 
A2 
 2 B  slow 
B2 
 2 AB  fast 
2 A  2 B 
Then the order of the reaction is
1) 2 2) 1.5 3) 4 4) 1
82. The best reagent to convert pent-3- en-2-ol into pent-3-en-2-one is
1) Acidic permanganate 2) Acidic dichromate
3) Anhydrous chromic anhydride 4) LiAlH4
83. Acetyl bromide reacts with an excess of CH3MgI followed by treatment with water
gives.
1) acetone 2) acetyl iodide 3) 2-methyl-2-propanol 4) acetamide
84. From the following data,
(i) H2(g) + Cl2(g)   2HCl(g) + x kJ
(i) H2(g) + Cl2(g)   2HCl(l) + y kJ
The enthalpy change for the following process is _____
HCl  l  
 HCl  g 
1)  x  y  / 2 2)  y  x  / 2 3) x  y 4) y  x
85. On combustion carbon forms two oxides CO and CO2, heat of formation of CO2
is -94.3 kcal and that of CO is -26.0 kcal. Heat of combustion of carbon is :
1) -26.0 kcal 2) -68.3 kcal 3) -94.3 kcal 4) -120.3 kcal
SECTION – B
86. The basic character of the transition metal monoxide follows the order.
(At. No of Ti = 22, V = 23, Cr=24, Fe = 26)
1) TiO > VO > CrO> FeO 2) VO > CrO > TiO > FeO
3) CrO > VO > FeO > TiO 4) TiO > FeO > VO > CrO
87. Which of the following is diamagnetic ?
1) ScCl3 2) FeCl3 3) TiCl3 4) VCl3
88. (i) O3
X O. ‘X’ can be
(ii) Zn-H2O
CH3
1) 2) 3) 4)
89. The final product B in the following reaction,

HC  CH HgSO 4
H 2 SO4
 A 
CH 3 MgX
H 2O
 B.
1) Acetic acid 2) Isopropyl alcohol 3) Acetone 4) Ethanol
90. Consider the complexes : A =[FeCl6]4-, B=[Fe(H2O)6]2+ and C=[Fe(H2O)6]3+. The
correct order of decreasing wavelength of light absorbed for the following
complexes is
1) C > B > A 2) A > C > B 3) B > A > C 4) A > B > C
91. Spin only magnetic moment of [ZnCl4]2- is
1) 2 2BM 2) 3BM 3) Zero 4) 15BM
92. Less stable metal carbonyl among the following is
1) Ni(CO)4 2) V(CO)6 3) Fe(CO)5 4) Cr(CO)6
93. Assertion (A) : Introduction of catalyst does not affect position of equilibrium.
Reason (R) : For a reversible reaction, presence of a catalyst influences both
forward & backward reaction to the same extent.
1) Both Assertion and Reason are true and the Reason is the correct explanation
of the Assertion
2) Both Assertion and Reason are true, but the Reason is not correct explanation
of the Assertion

2
 Zn aq   Cu s  , G  0, but K C  1 .
94. Assertion (A) : For Zn s   Cu  2
Reason (R) : For a process under equilibrium, Gibb’s energy change is zero, but
G 0 is not zero.
of the Assertion
of the Assertion
95. If the solubility of Ca(OH)2 is 3 , What is its solubility product?
1) 3 2) 3 3 3) 27 4) 12 3
96. The basic character of methyl amines in vapour phase is
1) 3o  2o  1o  NH 3 2) 2o  3o  1o  NH 3 3) 1o  2o  3o  NH 3 4) 2o  1o  3o  NH 3
97. Gabriels phthalamide reaction is used to prepare.
1) 10-amine 2) 20-amine 3) 30-amine 4) All of these
98. Which of the following does not conduct current in aqueous solution
1) KNO3 2) CH3COOH 3) CH3OH 4) NaOH
99. The cell constant is the product of resistance and
1) conductance 2) molar conductance
3) specific conductance 4) specific resistance
100. The two cyclic hemiacetal forms of glucose differing only in the configuration of
hydroxyl group at C1 are called
1) Anomers 2) Enantiomers 3) Functional isomers 4) Metamers
BOTANY
SECTION – A
101. The character that unified all the organisms belong to kingdom plantae of two
kingdom classification was presence of
1) Chloroplast 2) Cell wall 3) Nuclear membrane 4) Vacuole
102. Which one of the following cellular parts is correctlydescribed?
1) Centrioles - Sites for active RNA synthesis
2) Lysosomes - Optimally active at a pH of about8.5
3) Thylakoids - Flattened membranous sacs forming the grana of chloroplasts.
4) Ribosomes - Those on chloroplasts are larger(80S) while those in the cytoplasm
are smaller (70S).
103. Match the Column I and Column II and select the correct option.
(A) Plantae (I) Exclusive prokaryotic kingdom
(B) Protista (II) Multicellular walled heterotrophs
(C) Fungi (III) Multicellular walled autotrophs
.
(D) Monera (IV) Unicellular eukaryoyic kingdom
(A) (B) (C) (D) (A) (B) (C) (D)
.
1) III IV II I 2) II III I IV
3) III II IV I 4) IV I II III
104. Microbes are present everywhere –in soil, water air, inside our bodies and, that of
other plants and animals. Even at sites where no other life form could possibly
exist, such as ______
1) Deep inside the geysers [Temperature may be high as 1000C]
2) Deep in the soil and under the layers of snow several meters thick.
3) In highly acidic environment. 4) All of the above
105. Monothecous anthers are present in
1) mustard 2) china rose 3) sun flower 4) 1 and 2

106. Identify the blank spaces A, B and C in the following table and select the correct
option.
Type of microbe Shape/disease Magnified Picture
Bacteria A 1500x
Virus Rod-shaped B
Bacteria C 50,000X
1) (A) Rod- shaped, (B)1,00,000-1,50,000X, (C) Rod shaped

2) (A) Spherical shaped, (B) 1,0000 -15000X, (C) 5000X
3) (A) Rod-shaped, (B), 100000-150000X, (C) 5000X
4) (A) Spherical shaped, (B) 1,0000 – 15000X, (C) 50,000X
I.The cyanobacteria that are also referred to as blue green algae are not ‘algae’
any more.
II. The earliest systems of classification used only gross superficial morphological
characters such as habit, colour, number and shape of leaves, etc.
III. Artificial classification system was based mainly on vegetative characters or
on the reproductive characters (androecium structure )
IV. Artificial classification systems gave equal weightage to vegetative and sexual
characteristics.
Which of the statements given above are correct?
1) I, III and IV are correct 2) II, III and IV are correct
3) I, II and V are correct 4) I, II, III and IV are correct
108. Identify the A, B and C shown in this figure?
1) A–Gametophyte (n), B–Zygote (2n), C–Gametogenesis

2) A–Zygote (2n), B–Gametophyte (n), C–Gametogenesis
3) A–Zygote (2n), B–Gametogenesis, C–Gametophyte (n)
4) A–Gametogenesis, B–Zygote (2n), C–Gametophyte (n)

109. Choose the incorrect statement regarding mosses .
1) The leafy stage develops from the secondary protonema as a lateral bud.
2) They are attached to the soil through multicellular and branched rhizoids.
3) The gametophytic leafy stage bears the sex organs.
4) The Mosses lifecycle spores develops into a sporophyte.
110. Find, which is not a part of biotechnology
1) Test tube baby development 2) Developing-DNA vaccine
3) Not synthesising a gene 4) Correcting a defective gene
111. A small double strandard circular DNA cuts into 6 fragments what would be
number of recognition sites present in that DNA for same restriction
endonuclease.
1) 5 2) 6 3) 12 4) 3
112. Genetic engineering techniques to alter the chemistry of genetic material such as
1) DNA only 2) RNA only 3) Protein only 4) Both [1) and [2)
113. Statement-I: The integration of natural science and organisms, cells, parts there
of, and molecular analogues for products and services is called bioinformatics
Statement-II: Making curd, bread or wine, which are all microbe mediated
processes also form of biotechnology
1) Statement-I is true, Statement-II is false
2) Statement-I is false, Statement-II is true
3) Both Statements I and II are true
4) Both Statements I and II are false
Column-I Column-II
P) Asexual reproduction i) Origin of replication
Q) Sexual reproduction ii) Not permits variation
R) Genetic engineering iii) Permits variation
S) Initiation of replication iv) Recombinant DNA
1) P-iii, Q-ii, R-i, S-iv 2) P-iii, Q-ii, R-iv, S-i
3) P-ii, Q-iii, R-iv, S-i 4) P-ii, Q-iii, R-i, S-iv
115. Primary root and its branches constitute
1) Adventitious root system 2) Fibrous root system
3) Tap root system 4) Prop root system
116. Bicarpellary, syncarpous, superior ovary with parietal placentation are floral
characters of family
1) Malvaceae 2) Leguminosae 3) Cruciferae 4) Poaceae
117. Statement –I :The stamens unite into one bundle as in China rose showing
monadelphous condition.
Statement –II :Floral formula shows cohesion and adhesion within the parts of
whorls and between whorls.
1) Both statements-I and Statement-II are true
2) Both statements-I and Statement-II are false
List-I List-II (Family)
A) Leaves are alternate, simple palmately (I) Compositae
compound, stipulate reticulate venation
B) Leaves are simple, exstipulate, reticulate (II) Malvaceae
venation
C) Stem is cylindrical with spiny, glandular (III) Cruciferae
hairs, secretory canals with resin
D) Leaves are sessile with long sheathing base, (IV) Poaceae
`
`
parallel venation
A B C D A B C D
1) I II III IV 2) III I II IV
3) II III I IV 4) I IV III II

119. “The negatively charged DNA is wrapped around positively charged A octamer
to form B ”. Complete the above statement by selecting correct option for A and
B.
A B
1) Histone Genophore
2) Non-histone Chromatin
3) Polyamine Chromosome
4) Histone Nucleosome
120. Euchromatin differs from heterochromatin as the former is/has
(a) Genetically or transcriptionally inactive DNA.
(b) Lightly stained region.
(c) Densely packaged.
1) (a) & (b) 2) (c) only 3) (b) 4) (a) & (c)
14
121. A hybrid DNA is allowed to grow in N medium for two consecutive generations.
What will be the proportion of hybrid DNA after 2nd generation?
1 1 3 1
1) 2) 3) 4)
2 4 4 8
122. Identify the option not true for the below given replicatin fork.
1) Strand A is synthesised continuously

2) Strand B is synthesised discontinuously
3) DNA polymerase unwind DNA helix
4) DNA synthesis occurs in 5 to 3 direction
123. Genes in eukaryotes
(a) Have introns (b) Are split (c) Are polycistronic
1) (a) & (b) only 2) (b) & (c) only 3) (a) & (c) only 4) All (a), (b) & (c)
124. Identify the false statement.
1) In prokaryotes transcription and translation are often coupled
2) Bacterial mRNA undergoes splicing to become functional
3) Prokaryotes have single RNA polymerase
4) In bacteria () factor is required for termination of transcription
125. Ground tissue system is consists of
1) Parenchyma only 2) Collenchyma only
3) Sclerenchyma only 4) All the above
126. Assertion : The anatomy of isobilateral leaf is similar to that of dorsiventral leaf
in many ways.
Reason : Mesophyll is differentiated into palisade & spongy parenchyma in
isobiateral leaf & dorsiventral leaf.
3) ‘A’ is true and ‘R’ is false 4) ‘A’ is false and ‘R’ is true
127. The feature which is common to both heartwood and sapwood is
1) Both are the regions of secondary xylem
2) Both are involved in the conduction of water
3) Both comprise dead elements with the accumulation of aromatic compounds
4) Both are located in the central layers of the stem
128. The degree by which progeny differ from their parents is known as
1) Heritity 2) Inheritance 3) Variation 4) Both 1 & 3

129. Sahiwal cows of Punjab are developed by
1) Artificial selection 2) Domestication
3) Both 1 & 2 4) Mutation
130. How many true breeding pea plant varieties were selected by mendel?
1) 14 2)7 3) 21 4) 27
131. Mendel selected Pisum sativum for hybridization experiments because of
1) Clear contrasting characters and short life span
2) Long life span and fertile hybrids
3) Presence of unisexual flowers
4) Infertile hybrids and production of large number of seeds by each plant.
132. Assertion (A) : Mendel was successful in his hybridization.
Reason (R) Garden pea proved to be the ideal experimental material.
133. Find out the correct statement.
1) Unicellular organisms are capable of independent existence
2) Based on the presence or absence of a membrane bound nucleus and other
organelles,cells and hence organisms can be named as eukaryotic or prokaryotic
3) Nucleus not only controls the activities of organelles but also plays a major role
in heredity
4) All of the above.
134. Match the column with respect to organelles andtheir respective function:
Column I Column I
a. Golgi apparatus i. Helps in spindle formation
b. Ribosomes ii. Reserve food in Prokaryotes
c. Microtubules iii. Proteins factory
d. Inclusion bodies iv. Helps in pseudopodiaformation
v. Packing of materials to be delivered
1) a-i, b-ii, c-iv, d-v 2) a-v, b-iii, c-i, d-ii
3) a-v, b-iii, c-iv, d-ii 4) a-iv, b-iii, c-v, d-ii
135. Embryo develops at which end of embryosac?
1) Micropylar end 2) Chalazal end 3) Funiculus 4) Outside the ovary
SECTION – B
136. Which one of the following option gives the correct categorisation of six plants
according to types of pollination (A, B, C) on the basis of pollinating agents:-
A B C
Hydrophily (water) Entomophily (insect) Anemophily (wind)
1) Grass, Hydrilla Grass, Hydrilla Grass, Hydrilla
2) Vallisnaria, Zostera Yucca, Amor phophallus Grass, Maize
3) Vallisnaria, Grass Maize, Yucca Zostera, Hydrilla
4) Maize, Zostera Water hyacinth, Water lily Amorphophallus, Yucca
137. Which one of the following option gives the correct categorisation of six structures
according to their ploidy level (A, B, C) in a typical angiosperm :-
A B C
Haploid Diploid Triploid
1) Pollen mother MMC, PEC PEN, MMC
cell, Embryo sac
2) Egg apparatus, Nucellus, Perisperm Endosperm, Aleurone
Megaspore layer
3) Microspore, Secondary Nucellus, Megaspore Perisperm, Embryosac
nucleus
4) PEC, MMC Nucellus, Megaspore Endosperm, Perisperm
138. How many meiotic divisions are required for formation of 100 seeds in
angiosperm ?
1) 100 2) 125 3) 300 4) 400
139. If base order in one chain of DNA is ATCGA then how many number of H-bonds
found in DNA duplex.
1) 20 2) 12 3) 10 4) 11

140. Statement –I : All the elements present in a sample of earth’s crust are also
present in sample of living tissue.
Statement –II : A closer examination reveals that the relative abundance of
carbon, calcium and hydrogen with respect to other elements is higher in any
living organism than to earth crust.
1) Both statements-I and Statement-II are wrong
2) Both statements-I and Statement-II are correct
3) Statement-I is correct, Statement-II is wrong
4) Statement-I is wrong, Statement-II is correct
141. Growth is a
1) Irreversible increase in size 2) Reversible increase in size
3) Reversible increase in shape 4) 2 and 3
142. Plant growth promoters are
1) Auxin, cytokinin, GA 2) Auxin, cytokinin, ABA
3) GA, ABA, cytokinin 4) ABA, Auxin, Cytokinin
143. Statement – I: Ethephon promotes the female flower formation in cucumbers
Statement – II : Ethephon increases the yield in cucumbers.
1) Both statement I and statement – II are correct
2) Statement – I is correct and statement – II is incorrect
3) Statement – I is incorrect and statement – II is correct.
4) Both statement I and Statement – II are incorrect
144. Number of SLP ATP’s formed in complete oxidation of one molecule of glucose in
presence of oxygen.
1) 3 2) 2 3) 4 4) 6
145. Each pole receives half the chromosome number of the parent cell in which phase
1) Anaphase 2) Anaphase – I 3) Anaphase – II 4) Metaphase – II
146. How many PGAL molecules would regenerate 15 RuBP?
1) 30 2) 25 3) 15 4) 20
147. The first step in dark reaction of photosynthesis is
1) Formation of ATP
2) Attachment of carbon dioxide to a pentose sugar
3) Excitement of an electron of chlorophyll by photon of light
4) Ionisation of water.
148. Read the following statements and find out the incorrect statement.
1) Second step of Calvin cycle ( i.e., reduction ) involve utilisation of 2 molecules
of ATP for reduction and 2 of NADPH for phosphorylation per CO2 molecule fixed.
2) The regeneration steps require one ATP for phosphorylation to form RuBP.
3) It is probably to meet the differences in number of ATP and NADPH used in
dark reaction that the cyclic phosphorylation takes place.
4) Plants that are adapted to dry tropical regions have the C4 pathway.
149. During Krebs cycle Acetyl Co-A binds to oxaloacetic acid to form
1) Formaldehyde 2) Citrate 3) Acetate 4) Isocitrate
150. Final electron acceptor in respiration is
1) Oxygen 2) Hydrogen 3) Carbon dioxide 4) NADH
ZOOLOGY
SECTION – A
151. Which of the following are related to Jurassic period?
1) Ginkgos, seed ferns, Gnetales
2) Gnetales, Ferns, Arborscent lycopods
3) Conifers, Ferns, Herbaceous lycopods
4) Cycads, Gnetales, Conifers

152. How many statements are related to the below given vertebrate?
a) It’s a synapsid b) It’s a sauropsid

c) It’s an ancestor of thecodonts d) It’s an ancestor of mammals
1) a, b only 2) a, d only 3) c, d only 4) b, c only
153. The story of evolution of modern man is most interesting and appears to A of
human B . The A, B respectively are
1) Parallel evolution, heart and brian
2) Convergent evolution, heart and spinal cord
3) Convergent evolution, brain and language
4) Parallel evolution, brain and language
154. Match the following and choose the correct option.
Genotype Skin colour
(a) AABBCC (i) Intermediate
(b) aabbcc (ii) Darkest
(c) AaBbCc (iii) Lightest
1) a-iii, b-ii, c-i 2) a-ii, b-iii, c-i 3) a-ii, b-i, c-iii 4) a-i, b-ii, c-iii
155. Statement-I : There are more than 20,000 species of orchids and 28,000 species
of ants.
Statement-II : Biodiversity is the term popularized by the naturalist Edward
Wilson.
156. Where was the World Summit on Sustainable Development held?
1) South Africa 2) USA 3) South America 4) UK
157. What percentage of all living species will go extinct within next 100 years due to
human activities?
1) nearly 20% 2) nearly 40% 3) nearly 50% 4) nearly 75%
158. The body of cockroach can be morphologically distincted as
1) Head and abdomen only 2) Head, thorax and abdomen
3) Head, abdomen and tail 4) Head and trunk only
159. Consider the following statements:
(A) Body of cockroach is covered by a hard exoskeleton made up of chitin.
(B) In male cockroach, the abdomen consists of 10 segments
1) A is true, B is false 2) Both A and B are false
3) A is false, B is true 4) Both A and B are true
160. In male frog, ureter transfers
1) Urine 2) Sperms 3) Both 1 and 2 4) Faecus
161. Which of the following statements is false?
1) The neural system provides an organized network of point-to-point connections
for a quick coordination
2) The endocrine system provides chemical integration through hormones
3) The neural organisation is very complex in lower invertebrates
4) The human neural system includes CNS and PNS
162. Unipolar neuron/unipolar nerve cells mean
1) Nerve cell with one dendrite 2) Nerve cell with many dendrites
3) Nerve cell without dendrites 4) Neuron with one dendrite and one axon
163. Size of population is
1) Population density 2) Number of individuals present per unit area
3) Designated as N 4) All of the above

164. Select an incorrect statement.
1) Natality refers to the number of births during a given period
2) If a new habitat is just being colonized, emigration may contribute more
significantly to population growth.
3) In 1981, the “r” value for human population in India was 0.0205
4) Any species growing exponentially under unlimited resources condations can
reach enormous population densites in a short time
165. Find out correct match:
1) Cartilagenous fishes – Ammonotelism
2) Mammals - Ureotelism
3) Land birds - Ureotelism
4) All marine fishes - Ammonotelism
166. In Cortical nephrons __________
1) The loop of Henle is too long and extends into deep medulla
2) Malpighian corpuscle, PCT & DCT are situated in medulla.
3) The loop of Henle is too short and extends very little into the medulla
4) Vasa recta is much longer
167. ICBN full form is
1) International Culture Botanical Nomenclature
2) International Conditions Botanical Nomenclature
3) International Code for Botanical Nomenclature
4) International Conversation for Botanical Nomenclature
168. Which of these are present in the plasma of a person having ‘O’ blood group?
1) anti-A and anti-B antibodies 2) anti-A antibody only
3) anti-B antibody only 4) Antibodies are absent
169. Arrange the following events in the correct order as they occur during inspiration
I) Air flows in to the lungs
II) Intra pulmonary volume increases
III) Thoracic volume increases
IV) Intra pulmonary pressure decreases
1) I – II – III – IV 2) IV – III – II – I
3) II – I – III – IV 4) III – II – IV – I
170. Two types of embryo transfer methods are
1) ZIFT & GIFT 2) IUT & IUI 3) ZIFT & IUT 4) GIFT & IUI
171. The defects with which the child inherits from parents by birth is called
as______________
1) infectious disease 2) Lifestyle disorder
3) Genetic disorder 4) Mental disorder
172. The use of vaccines and immunization programmes have enabled us to
completely eradicate a deadly disease like
1) Polio 2) Diphtheria 3) Chickungunya 4) Smallpox
173. Which of the following statements is correct?
1) Inspiration is a passive process whereas expiration is active.
2) Inspiration is active process whereas expiration is passive.
3) Inspiration and expiration both are active processes
4) Inspiration and expiration both are passive processes
174. How many of the following diseases or transmitted by female Aedes mosquito
Filariasis, Elephantiasis, Dengue, Malaria, Chikungunya
1) 1 2) 2 3) 3 4) 4
175. Ovulation in the human female normally takes place. [in a menstrual cycle]
1) Just before the end of menstruation
2) At the beginning of the proliferative phase
3) At the end of the secretory phase
4) At the end of the proliferative phase
176. Cardiac muscle is characterized by
1) Straited appearance 2) Involuntary control
3) Branching pattern 4) All of these
177. Genome of which of the following organism was not sequenced during HGP.
1) Caenorhabditis 2) Arabidopsis 3) Yeast 4) Paramecium
178. Similarity between star fish and Balanoglossus
1) Are segmented animals 2) Are Coelomates
3) Have radial symmetry 4) Have direct development

179. Incorrect statement related with Phylum-Ctenophora is
1) Reproduction takes place only by sexual means.
2) Fertilisation is external with direct development
3) Fertilisation is external with indirect development
4) Bioluminescence property is present
180. Correct statement related with class Cyclostomata
1) Body is devoid of scales and paired fins
2) Cranium and vertebral column are cartilaginous
3) Circulation is of closed type
4) All the above statements are correct
181. The _________ hormone stimulates secretion of bile juice from gall bladder
1) Gastrin 2) Secretin
3) Cholecystokinin 4) Gastric Inhibitory peptide(GIP)
182. Exopthalmic goitre is a form of _________
1) Hypothyroidism 2) Hypoparathyroidism
3) Cretinism 4) Hyperthyroidism
183. Transfer of separated fragments of DNA to synthetic membranes such as Nylon or
Nitrocellulose is called as:
1) Hybridisation 2) Autoradiographic detection
3) Gel electrophoresis 4) Blotting technique
184. Choose the wrong one w.r.t Bt toxin
1) Insecticidal protein 2) Exists as protein crystals
3) Exists as inactive protoxins 4) Produced by virus
185. Given below are two statements
Statement I: An ecosystem can be visualized as a functional unit of nature,
where living organisms interact among themselves and also with the surrounding
physical environment.
Statement II : Ecosystem varies greatly in size from a small pond to a large
forest or a sea.
Choose the correct answer from the option given below:
SECTION – B
1) Stratification is the formation of vertical layers where vegetation is dense.
2) Gross primary productivity is the total amount of organic matter synthesized
by producers per unit time and area.
3) Pyramid of biomass in sea is generally inverted
4) Standing crop is an ecosystem's amount of inorganic nutrients
187. Select the mismatched pair :
1) Coitus interruptus-Traditional method 2) Diaphragm-Barrier
3) MTP-Sterilization in male 4) Copper releasing IUD–Multiload 375
188. Assertion: An artificial pacemaker can replace the sino-atrial node of heart.
Reason: This is because, an artificial pacemaker is capable of stimulating the
heart electrically to maintain its beats.
1) Both the assertion and the reason are true and the reason is a correct
explanation of theassertion.
2) Both the assertion and reason are true but the reason is not a correct
3) Assertion is true but the reason is false.
4) Both the assertion and reason are false.
189. Maintenance of ionic and acid-base balance of body fluids during urine formation
is carried out by _____
1) Glomerular filtration 2) Tubular reabsorption
3) Tubular secretion 4) All of the above

190. When 1200 mL air is left in the lungs, it is called
1) Vital capacity 2) Tidal volume
3) Residual volume 4) Inspiratory reserve volume
191. Which of the following is true about hypertension?
1) It leads to cardiac diseases.
2) It affects vital organs like brain and kidney.
3) If repeated checks of blood pressure of an individual is 140/90 or higher, it
shows hypertensions.
4) All the above
192. Choose the correct option.
A) Skin - I) Physiological barrier
B) Saliva - II) Physical barrier
C) Macrophages - III) Cellular barrier
D) Interferons - IV) Cytokines barrier
1) A-I, B-II, C-III, D-IV 2) A-II, B-I, C-III, D-IV
3) A-II, B-I, C-IV, D-III 4)A-IV, B-II, C-I, D-III
193. Assertion: Woman should not be blamed for giving birth to female progeny.
Reason: The genetic make up of the sperm decides the sex of the child.
1) Both Assertion and Reason are correct and reason is the correct explanation of
assertion.
2) Both Assertion and Reason are correct and reason is not the correct
explanation of assertion.
3) Assertion is true and reason is false
194. Given pedigree belongs to sickle cell anemia. Which of the following reprents
parental genotype correctly?
1) Aa, Aa 2) AA, aa 3) Aa, aa 4) Aa, AA

195. Which of the following is incorrect about skeletal muscles?
1) Striped appearance under microscope hence called striated muscle.
2) They are voluntary muscles.
3) Primarily involved in locomotory actions and changes the body postures.
4) They are involuntary muscles.
196. Statement –I : Cyclic menstruation is an indicator of normal reproductive phase
and extends between menarche and menopause.
Statement –II : Spermatogenesis results in the formation of sperms that are
transported by the male sex accessory glands.
1) Both statements-I and II are correct and statement-II is correct explanation for
statement-I
2) Both statements-I and II are correct, but statement-II is not correct
explanation for statement-I
4) Both statement-I and II are incorrect
197. Read the following statements and choose the correct option.
Statement A: Bt toxin get activated in alkaline pH of insect gut, which
solubilises the protein crystals.
Statement B: Activated toxin binds to the surface of midgut epithelial cells.
1) Only statement A is correct
2) Only statement B is correct
3) Both A and B statements are correct
4) Both A and B statements are incorrect

198. Find the correct statement
1) Energy that is trapped in an organism remains in it forever
2) In terrestrial ecosystems, the grazing food chain is the major conduit for the
energy flow
3) In aquatic ecosystems, a large fraction of energy flows through the detritus
food chain
4) All organisms are depended for their food on producers either directly or
indirectly
199. Two percent of the humans on the planet have red hair (recessive). What percent
of humans are heterozygous for this trait?
1) 24% 2) 42% 3) 12% 4) 0.4%
200. The given disorder is due to
I. Polymerisation of haemoglobin under low oxygen tension.

II. Substitution of glutamic acid by valine
III. Absence of a protein from cascade of proteins
IV. Quantitative disorder
1) I, II, III 2) I, II, III, IV 3) II, IV 4) I, II
*******

: ANSWER KEY:
SET-1 SUB: PHYSICS
1 2 11 4 21 2 31 3 41 3
2 3 12 1 22 1 32 2 42 2
3 3 13 4 23 3 33 1 43 3
4 2 14 1 24 4 34 4 44 1
5 2 15 2 25 1 35 1 45 2
6 1 16 3 26 2 36 2 46 1
7 3 17 4 27 2 37 3 47 2
8 2 18 4 28 3 38 3 48 3
9 4 19 1 29 4 39 1 49 2
10 2 20 2 30 2 40 3 50 3
SUB:CHEMISTRY
51 3 61 1 71 3 81 4 91 3
52 2 62 1 72 3 82 3 92 2
53 3 63 3 73 1 83 3 93 1
54 3 64 3 74 4 84 2 94 1
55 4 65 4 75 3 85 3 95 4
56 4 66 1 76 1 86 1 96 1
57 3 67 4 77 3 87 1 97 1
58 4 68 2 78 4 88 1 98 3
59 3 69 1 79 3 89 2 99 3
60 2 70 4 80 3 90 4 100 1
SUB : BOTANY
101 2 111 2 121 2 131 1 141 1
102 3 112 4 122 3 132 1 142 1
103 1 113 2 123 1 133 4 143 1
104 4 114 3 124 2 134 2 144 4
105 2 115 3 125 4 135 1 145 2
106 1 116 3 126 3 136 2 146 2
107 4 117 1 127 1 137 2 147 2
108 2 118 3 128 3 138 2 148 1
109 4 119 4 129 3 139 2 149 2
110 3 120 3 130 1 140 3 150 1
151 3 161 3 171 3 181 3 191 4
152 2 162 3 172 4 182 4 192 2
153 4 163 4 173 2 183 4 193 1
154 2 164 2 174 2 184 4 194 1
155 1 165 2 175 4 185 4 195 4
156 1 166 3 176 4 186 4 196 3
157 3 167 3 177 4 187 3 197 3
158 2 168 1 178 2 188 1 198 4
159 4 169 4 179 2 189 3 199 1
160 3 170 3 180 4 190 3 200 4

NEET GRAND TEST - 2
answer sheet.
CORRECT.
Section-B;
Marking Scheme :

PHYSICS
SECTION – A
1. An electron moving in a circular orbit of radius R with frequency f. The magnetic
field at the centre of the orbit is
 ef  ef ef 2
1) 0 2) 0 3) 4) Zero
2 R 2R 2R
2. When a copper ball is heated the largest percentage increases will occur in its
1) Diameter 2) Area 3) Volume  4) Density
3. 110J of heat is added to a gaseous system, whose internal energy increase by
40J, then the amount of external work done is
1) 150J 2) 70J 3) 110J 4) 40J
4. What is the unit vector perpendicular to the vectors 2iˆ  2 ˆj  kˆ and 6iˆ  3 ˆj  2kˆ ?
iˆ  10 ˆj  18kˆ iˆ  10 ˆj  18kˆ iˆ  10 ˆj  18kˆ iˆ  10 ˆj  18kˆ
1) 2) 3) 4)
5 17 5 17 5 17 5 17
5. Keeping the number of moles, volume and temperature are same, which of the
following are the same for all ideal gases?
1) rms speed of a molecule 2) density
3) pressure 4) average magnitude of momentum
6. Which of the following statements about the Bohr model of the hydrogen atom is
false?
1) Acceleration of electron in n = 2 orbit is less than in n = 1 orbit
2) Angular momentum of electron in n= 2 orbit is more than that in n = 1 orbit
3) Kinetic energy of electron in n= 2 orbit is less than that is n = 1 orbit
4) Potential energy of electron in n = 2 orbit is less than that in n = 1 orbit
7. In an n-type silicon, which of the following statements is true?
1) Electrons are majority carriers and trivalent atoms are the dopants
2) Electrons are minority carriers and pentavalent atoms are the dopants
3) Holes are minority carriers and pentavalent atoms are the dopants
4) Holes are majority carriers and trivlaent atoms are the dopants
8. The following four wires are made of the same material. Which of these will have
the largest extension when the same tension is applied?
1) length = 200 cm, diameter = 2 mm
3) length = 50 cm, diameter = 0.5 mm
9. Assertion (A): It is better to wash the clothes in cold soap solution
Reason (R): The surface tension of cold solution is more than the surface tension
of hot solution.
10. The graph shown in figure represents
1) motion of a simple pendulum starting from mean position

2) motion of a simple pendulum starting from extreme position
3) simple pendulum describing a horizontal circle
4) none of these
11. A hole is drilled in a copper sheet. The diameter of the hole is 4.24 cm at 27oC.
What is the change in the diameter of the hole when the sheet is heated to
227oC? Coefficient of linear expansion of copper = 1.70 x 10-5 oC-1
1) 1.44 102 cm 2) 3.44  102 cm 3) 5.44  102 cm 4) 7.44 102 cm
12. The dimensional formula for Boltzmann’s constant is
1)  ML2T 2 1  2)  ML2T 2  3)  ML0T 2 1  4)  ML2T  1 1 

13. A metallic ring connected to a rod oscillates freely like a pendulum. If now a
magnetic field is applied in horizontal direction so that the pendulum now swings
through the field, the pendulum will
× × × × ×
× × × × ×
× × × × ×
× × × × ×
1) Keep oscillating with the old time period

2) Keep oscillating with a smaller time period
3) Keep oscillating with a larger time period
4) Come to rest very soon
14. If time of flight of a projectile is 10 seconds(take g= 10m/s2). The maximum
height attained by it will be
1) 125m 2) 50m 3) 100m 4) 150m
15. The rate of mass of the gas emitted from rear of a rocket is initially 0.1kg/sec. If
the speed of the gas relative to the rocket is 50m/sec and mass of the rocket is
2kg, then the net acceleration of the rocket in m/sec2 is
1) 5 2) 5.2 3) 2.5 4)25
16. The molecular weights of two monoatomic gases are M1 and M2, then at a
temperature the ratio of root mean squaer velocity v1 and v2 will be
M1 M2 M1  M 2 M1  M 2
1) 2) 3) 4)
M2 M1 M1  M 2 M1  M 2
17. A force acts on a 2kg object, so that its position is given as a function of time as
x  3t 2  5 . What is the work done by this force in first 5 seconds?
1) 850J 2) 900J 3) 950J 4) 875J
18. 
Light of wavelength strikes a photo-sensitive surface and electrons are ejected
with kinetic energy E. If the kinetic energy is to be increased to 2E, the
wavelength must be changed to ' where

1)  '   2) ' 2 3)   ' 4)  '  
2 2
19. If the magnitude of displacement in SHM is numerically equal to that of
acceleration, then the time period is
1) 1 second 2)  second 3) 2 second 4) 4 second
20. A short bar magnet has points A and B along its axis at distances of 24cm and
48cm on the opposite sides. Ratio of magnetic fields at these points will be
1
1) 8 2) 3) 3 4) 4
2 2
21. A charge Q is placed at the centre of the line joining two equal charges q. The
system of the three charges will be in equilibrium if Q is equal to
q q q q
1)  2)  3)  4) 
2 4 4 2
22. The geometrical path of ray of light in a medium of refractive index 2 is 8m. The
optical path is
1) 16m 2) 3m 3) 2m 4) 1m
2
In an ac generator, a rectangular coil of 100 turns each having area 14 10 m is
2
23.
rotated at 360 rev/min about an axis perpendicular to a uniform magnetic field of
magnitude 3.0 T. The maximum value of the emf produced will be ___V.
 22 
 Take   
 7
1) 1244 2) 1584 3) 1388 4) 1484

24. Length of a string tied to two rigid supports is 40cm. Maximum wave length in
cm of a stationary wave produced on it, is
1) 20 2) 80 3) 40 4) 120
25. The moment of inertia of a solid sphere of density  and radius R about its
diameter is :
105 5 105 2 176 5 176 2
1) R  2) R  3) R  4) R 
176 176 105 105
26. Two magnets of same size and mass make respectively 10 and 15 oscillations per
minute at certain place. The ratio of their magnetic moments is
1) 4 : 9 2) 9 : 4 3) 2 : 3 4) 3 : 2
27. Two plane mirrors are inclined to each other such that a ray of light incident on
the first mirror and parallel to the second is reflected from the second mirror
parallel to the first mirror. The angle between the two mirrors is
1) 30o 2) 45o 3) 60o 4) 75o
28. A galvanometer of resistance 20 is to be shunted so that only 1% of the current
passes through it. Shunt connected is
1) 99/20 2) 9/20 3) 20/99 4) 2/99
29. The polarizing angle for a material is 60 then the refractive index of material is
0
1 3 3
1) 2) 3) 3 4)
3 2 2
30. In planetary motion, the areal velocity of position vector of a planet depends on
angular velocity   and the distance of the planet from sun (r). IF so, the correct
relation for areal velocity is
dA dA dA dA
1)  r 2)   2r 3)  r 2 4)  r
dt dt dt dt
31. Gravitational force is required for
1) Stirring of liquid 2) Convection
3) Conduction 4) Radiation
32. Two point charges q1  4  C and q2  9  C are placed 20cm apart. The electric field
due to them will be zero on the line joining them at distance of
80 80
1) 8cm from q1 2) 8cm from q2 3) cm from q1 4) cm from q2
13 13
33. In a Neon discharge tube 2.9 1018 Ne ions move to the right each second, while
1.2 1018 electrons move to the left per second; electron charge is 1.6 1019 C . The
current in the discharge tube is :
1) 1A towards right 2) 0.66A towards right
3) 0.66A towards left 4) Zero
34. Two identical metal plates are given positive charges Q1 and Q2 (<Q1) respectively.
If they are brought close together to form a parallel plate capacitor with
capacitance ‘C’, the P.D, between them is
Q  Q2 Q  Q2 Q  Q2 Q  Q2
1) 1 2) 1 3) 1 4) 1
2C C C 2C
35. In an unbiased p-n junction, holes diffuse from the p-region to n-region because
1) free electrons in the n-region attract them
2) they move across the junction by the potential difference
3) hole concentration in p-region is more as compared to n-region
4) all of these
SECTION – B
36. Given ‘’d’’ is the plate separation and A is the area of the plates of a capacitor.The
electric field  E  between two parallel plates of a capacitor will be uniform if
1) d 2  A 2) d 2  A 3) d 2  A 4) d 2  A
37. In an experiment, to measure the height of a bridge by dropping stone into water
underneath, if the error in measurement of time is 0.1s at the end of 2s, then the
error in estimation of height of bridge will be
1) 0.49m 2) 0.98m 3) 1.96m 4) 2.12m

38. A watch shows time as 3 : 25 when seen through a mirror, time appeared will be
1) 8 : 35 2) 9 : 35 3) 7 : 35 4) 8 : 25
(A) Equation of continuity (E) Less than critical velocity
(B) Bernoullie’s theorem (F) Formation of eddies & Vortices
(C) Turbulent flow (G) Law of conservation of mass
.
(D) Stream line flow (H) Law of conservation of energy
.
(A) (B) (C) (D) (A) (B) (C) (D)

1) H F E G 2) G E H F
3) F G H E 4) G H F E
40. A disc and a ring of same mass are rolling and if their kinetic energies are equal,
then the ratio of their velocities will be :
1) 4 : 3 2) 3 : 4 3) 3 : 2 4) 2 : 3
41. A bullet moving with a uniform velocity v, stops suddenly after hitting the target
and the whole mass melts be m, specific heat S, initial temperature 25o C , melting
point 475o C and the latent heat L. Then
mv 2 mv 2
1) mL  ms  475  25   2) ms  475  25   mL 
2J 2J
2
mv mv 2
3) ms  475  25   mL  4) ms  475  25   mL 
J 2J
42. A solenoid is 1.5 m long and its inner diameter is 4.0 cm. It has three layers of
windings of 1000 turns each and carries a current of 2.0 amperes. The magnetic
flux for a cross-section of the solenoid is nearly
1) 2.5  10–10 weber 2) 6.31  10–6 weber
3) 5.2  10–1 weber 4) 4.1  10–20 weber
43. In the given circuit, rms value of current 1rms  through the resistor R is:
1
1) 2A 2) A 3) 20 A 4) 2 2A
2
44. A wave y  a sin t  kx  on a string meets with another wave producing a node at
x=0. Then the equation of the unknown wave is
1) y  a tan t  kx  2) y  a sin t  kx  3) y  a sin t  kx  4) y  a sin t  kx 
45. In the experiment on photoelectric effect, the graph between 𝐸 ( ) and 𝑣 is
found to be a straight line as shown in Figure
The Planck’s constant according to this graph is

1) 6 × 10 J − s 2) 5 × 10 J − s 3) 4 × 10 J−s 4) 3 × 10 J−s

46. If the ratio of diameters, lengths and Young’s modulus of steel and copper wires
shown in the figure are p, q and s respectively, then the corresponding ratio of
increase in their lengths would be
5q 7q 2q 7q
1) 2) 3) 4)
 7sp 2  5sp 2   5sp   5sp 
47. A body, under the action of a corce F  6iˆ  8 ˆj  10kˆ , acquires an acceleration of
1ms-2.The mass of this body must be
1) 2 10kg 2) 10kg 3) 20kg 4) 10 2kg
48. The following diagram indicates the energy levels of a certain atom when the
system moves from 2E level to E, a photon of wavelength  is emitted. The
4E
wavelength of photon produced during its transition from level to E is:
3
1)  / 3 2) 4 /3 3) 3 4) 3 / 4
49. A particle moves in one dimension from rest under the influence of a force that
varies with the distance travelled by the particle as shown in the figure. The
kinetic energy of the particle after it has travelled 3m is
1) 4J 2) 2.5J 3) 6.5J 4) 5J
2
50. There is a current of 40 amperes in a wire of 0.01cm area of cross-section. If the
number of free electrons per m3 is 1029 , then the drift velocity will be
1) 1.25 103 m/s 2) 2.50 103 m/s 3) 25.0 103 m/s 4) 250 103 m/s
CHEMISTRY
SECTION – A
51. The freezing point of a given aqueous solution of glucose is 1.488o C . If the
freezing point of same molal aqueous solution of NaCl is 2.53o C , then the degree
of dissociation of NaCl is _____
Given : K f of H 2O = 1.86 K.mol1.Kg & FP = 0oC 
1) 60% 2) 70% 3) 80% 4) 90%
52. The density of 2.5 molar aqueous NaCl solution is 1.12 g/mol. Then the molality
of the solution is ________
1) 2.57 m 2) 2.43 m 3) 2.68 m 4) 2.36 m

53. Which of the following observations is correct and is useful in identifying
carboxylic acids?
1) Carboxylic acids liberate CO2 gas from NaHCO3 solution.
2) They produce fruity smell of esters when heated with alcohol in presence of
concentrated H2SO4.
3) Acids liberate I2 from a mixture of KIO3and KI.
4) All of these
54. The most reactive electronegative element(X) and most reactive electropositive
element(M) combine to form a compound having the formula of
1) MX2 2) MX3 3) MX 4) M2X
55. The elements ‘X’, ‘Y’ and ‘Z’ form oxides which are acidic, basic and amphoteric
respectively. The correct order of their electro negativity is
1) X>Y>Z 2) Z>Y>X 3) X>Z>Y 4) Y>X>Z
OH
Br
Br
56. The IUPAC name of is
Br
1) 2 – hydroxy – 1, 3, 5 – tribromobenzene
2) 1-hydroxy – 2, 4, 6 – tribromobenzene
3) 2, 4, 6 – tribromophenol 4) picric acid
57. The total number of electrons present in Zn2+ ion with magnetic quantum
number (m) = 0.
1) 6 2) 8 3) 12 4) 10
58. If uncertainty in position and momentum are equal, then uncertainty in velocity
is
1 h 1 h 1 h h
1) 2) 3) 4)
m  2  2m  2
59. The number of geometrical isomers for the foloiwng compound are
CH3  CH  CH  CH  CH  C2 H 5 is :
1) 4 2) 3 3) 2 4) 5
2
60. On the addition of few drops of a solution containing CrO4 ions to the solution of
Ba 2 , Sr 2 and Ca2 ions, the yellow precipitate obtained first will be of :
1) CaCrO4 2) SrCrO4
3) BaCrO4 4) A mixture of all the three
61. Which gives blue bead in borax bead test?
1) Cr 2 or Mg 2 2) Co2 or Cu 2 3) Ni 2 or Fe2 4) Cd 2 or Fe3
62. The pH of 0.1 M solution of the following salts increases in the order
1) NaCl < NH4Cl < NaCN < HCl 2) HCl < NH4Cl < NaCl < NaCN
3) NaCN < NH4Cl < NaCl < HCl 4) HCl < NaCl < NaCN < NH4Cl
63. Match Column-I with Column-II and Column-III and choose the correct option
from the given codes.
Column-I Column-III
(Molecule) (Shape of molecule)
A) NH3 p) Bent
B) SO2 q) Trigonal pyramidal
C) SF4 r) T-shape
D) ClF3 s) See-Saw
1) A-(q), B-(p), C-(r), D-(s) 2) A-(q), B-(p), C-(s), D-(r)
3) A-(q), B-(s), C-(r), D-(q) 4) A-(p), B-(r), C-(q), D-(s)

64. Assertion (A) : p-nitro phenol is lesser volatile than o-nitro phenol.
Reason (R) : p-nitro phenol possesses intra molecular hydrogen bonding while
o-nitro phenol possesses inter molecular hydrogen bonding.
65. Look at the following potential energy curve which of the following correctly
represents the most stable state of hydrogen molecule.
1) A 2) B 3) C 4) D
CH3 CH3
.. CH3 .. CH3
C C
CH3 CH3
66. Statement –1 : is more stable than
Statement –2 : –CH3 group exert +I effect.

for Statement-1
67. H
f
H d H
e
H
a
b c
H H
Statement –1 : In the above compound C – H bond energy(homolytic) is
d > c > f > b > a > e.
Statement –2 : With increase in stability of free radicals formed, the C – H bond
energy decreases.
for Statement-1
68. Assertion : Atomic radius of Galium is less than that of Al of 13th group
elements.
Reason : In gallium, (n-1)d electrons offer poor shielding effect.
1) Both Assertion and Reason are correct and Reason is the correct explanation
of Assertion
2) Both Assertion and Reason are correct and Reason is not the correct
explanation of Assertion
3) Assertion is correct but Reason is incorrect

69. Assertion : CCl4 does not undergo hydrolysis while SiCl4 undegoes hydrolysis
Reason : CCl4 is an ionic compound while SiCl4 is a covalent compound
of Assertion
70. The most stable conformation of n-butane is
1) Gauche 2) Fully staggered 3) Skew boat 4) Fully eclipsed
71. When acetylene is passed through dil. H 2 SO4 in the presence of HgSO4 , the
compound formed is
1) Acetic acid 2) Ketone 3) Ether 4) Acetaldehyde
72. On electrolysis of sodium succinate, the product obtained is ______ and nature of
solution after electrolysis is ________.
73. The emperical fomula of a compound is CH2O and its vapour density is 30. Then
the molecular formula given compound is
1) C6H12O6 2) C2H4O2 3) CH2O 4) C4H8O4
74. Ammonia is produced by Haber's process, which is :


N2 + H2 
 NH3
To produce 10 L NH3 at STP, the total volume of N2 and H2 required will be :

(1) 30 L (2) 15 L (3) 20 L (4) 40 L
75. In the reaction, I 2  2 KClO3  2KIO3  Cl2
(i) Iodine is oxidized to IO3
(ii) Chlorate ion is reduced
(iii) Iodine displaces chlorine from Chlorate ion
(iv) KClO3 is decomposed
The correct combination is
1) Only i & iv are correct 2) Only iii & iv are correct
3) i, ii, iii are correct 4) All are correct
76. Which of the following configuration is enantiomeric with the molecule (I) given
below?
77. Chlorobenzene is formed by reaction of chlorine with benzene in the presence of

AlCl3. Which of the following species attacks the benzene ring in this reaction?
4)  AlCl4 

1) Cl  2) Cl  3) AlCl3
78. Which of the following non-metal possess highest atomicity?
1) Oxygen 2) Sulphur 3) Phosphorus 4) Nitrogen
79. 
The electron affinity values in kJ mol 1
 of three halogens X,Y and Z are
respectively -349, -333 and -325. Then X,Y and Z respectively are
1) F , Cl and Br 2) Cl , F and Br 3) Cl , Br and F 4) Br , Cl and F
80, 90% of a given reaction is completed in 26 minutes and 99% of same reaction is
completed in 52 minutes. Then the order of the reaction is _______
1) 0 2) 1 3) 2 4) -1

o
81. For a given reaction, at 30 C , the rate of reaction is 3 units. Temperature
coefficient of the reaction is 3. Then the rate of same reaction at 60o C is ______
units.
1) 81 2) 27 3) 9 4) 243
82. The best reagent to convert pent-3- en-2-ol into pent-3-en-2-one is
1) Acidic permanganate 2) Acidic dichromate
3) Anhydrides Chromic anhydride 4) LiAlH4
83. In the following sequence of reactions, the compound D is
1) Butanal 2) n – butyl alcohol 3) n – propyl alcohol 4) propanol

84. The entropy change involved in isothermal reversible expansion of 2 moles of an
ideal gas from a volume of 10 dm3 to a volume of 100 dm3 at 27o C is :
1) 42.3 J mol1K 1 2) 38.3 J mol1K 1 3) 35.8 J mol1K 1 4) 32.3 J mol1K 1
85. The bond dissociation energies for Cl2, I2 and ICl are 242.3, 151 and
211.3 kJ/mol respectively. The enthalpy of sublimation of iodine is 62.8 kJ/mol.
What is the standard enthalpy of formation of ICl(g)?
1) -211.3 kJ/mol 2) -14.6 kJ/mol 3) 16.8 kJ/mol 4) 33.5 kJ/mol
SECTION – B
86. When KMnO4 acts as an oxidizing agent and ultimately forms
 MnO4  , MnO2 , Mn2O3 , Mn2 then the number of moles of electrons transferred per
2
one mole of KMnO4 are respectively

1) 4, 3, 1, 4 2) 1, 4, 3, 7 3) 1, 3, 4, 5 4) 3, 5, 7, 1
87. Assertion (A): Eu2+ ion is a strong reducing agent
Reason (R) : Eu2+ ion possesses stable half filled, 4 f 7 configuration
88. Which of the following is Gattermann-Koch reaction?
CHO
CO + HCl
1) Anhyd, AlCl3/CuCl
CH3 CHCl2 CHO
Cl2/hv H2 O
2) 373K
CH3 CH(OCOCH3)2 CHO
CrO3+(CH3CO)2O 𝐻𝑂
3) 273-278K 
CH3 CH(OCrOHCl2)2 CHO

4) CS2 𝐻𝑂
+ CrO2Cl2
89. Which of the following compounds does not react with NaHSO3?
O O O O
1) 2) 3) 4)
H C  H CH 3  C  H
90. The IUPAC name of [Co(NH3)6]Cl3 is

1) Hexaamminecobalt(III) chloride 2) Hexaammineobalt(II) chloride
3) Hexaamminetrichlorde cobalt(II) 4) Hexaamminetrichloride cobalt(III)

91. Total number of isomrs of [Co(NH3)3Cl3] is
1) 2 2) 3 3) 4 4) 6
92. In which of the following C-O bond length is relatively high?
1) Ni  CO 4 2) Fe  CO 5
3) Cr  CO 6 4) Same in all the above given options
93. The pH of the neutralization point of 0.1 N NaOH with 0.1 N HCl is
1) 1 2) 6 3) 7 4) 9
94. A gas ‘X’ is passed through water to form a saturated solution. The aqueous
solution on treatment with silver nitrate gives a white precipitate. The saturated
aqueous solution also dissolves magnesium ribbon with evolvution of a colourless
gas ‘Y’. Identify ‘X’ and ‘Y’
1) X=CO2, Y=Cl2 2) X=Cl2, Y=CO2 3) X=Cl2, Y=H2 4) X=H2, Y=Cl2
95. Equal volumes of two solutions with pH = 3 and pH = 11 are mixed. Then the pH
of resulting solution is
1) 8 2) 7 3) 6 4) 0
96. What is the end product in the folloiwng sequence of reactions?
C2 H 5 NH 2 
HNO2
 A 
PCl5
 B 
NH 3
C
1) ethyl cyanide 2) ethyl amine 3) methyl amine 4) acetamide
o o o
97. 1 , 2 &3 nitroalkanes can be identified by the action of :
1) HNO2 + NaOH(aq) 2) CHCl3 + NaOH(aq)
3) CHCl3 + KOH(alc) 4) Tollen’s reagent
98. Assertion (A) : Fuel cells are preferable when compared to thermal plants.
Reason (R) : Fuel cells are more efficient and pollution free.
99. When 1 amp of current is passed through an electrolyte for one second, the mass
deposited is equal to
1) 1 mole of hydrogen 2) 1 gram equivalent of hydrogen
3) 1 electro–chemical equivalent 4) 1 gram of any substance
100. The number of chiral carbon atoms are present in glucose and fructose
respectively are
1) 4,4 2) 3, 3 3) 3,4 4) 4, 3
BOTANY
SECTION – A
101. Which of the following takes place in matrix of mitochondria?
1) ATP is converted into ADP 2) Pyruvic acid is converted into CO2 and H2O
3) Glucose is converted into CO2 4) Glucose  pyruvic acid
102. In animal cells, like muscle, during exercise when O2 is inadequate for cellular
respiration, pyruvic acid is reduced into lactic acid by
1) O2 2) Carboxylation
3) Lactate dehydrogenase 4) Both 1 and 2
103. Which statement about photosynthesis is false?
1) Enzymes required for carbon fixation are located in grana of chloroplasts.
2) In green plants, both PS I and PS II are required for synthesis of NADPH + H+
3) Electron carriers of photophosphorylation are located on thylakoid membranes
4) Photosynthesis is a redox process in which water is oxidised and CO2 is
reduced.
104. How many meiotic divisions are needed to produce 1000 microspore tetrads in
mustard flower?
1) 1000 2) 250 3) 2000 4) 500

105. Study the following flow chart depicting the formation of curd from milk. Identify
the missing parts M and N.
Milk is incubated Growth of Production
with curd LAB of M
Coagulation and digestion Improved nutritional quality

of milk protein due to increased N
1) M-citricacid N-Vitamin C 2) M-Lacticacid N-Vitamin B2
3) M-Lacticacid, N-Vitamin B12 4) M-Citricacid N-Vitamin B12
106. How many of the following plants are belong to family Asteraceae?
(A) Candytuft (B) Cotton (C) Tajetus (D) Lady’s finger
(E) Sunflower (F) Lathyrus (G) Chrysanthimum
1) 5 2) 3 3) 6 4) 7
107. Classification done on the basis of cytological information, chromosome number,
structure and their behaviour, is known as
1) molecular classification 2) cytotaxonomy
3) chemotaxonomy 4) Numerical taxonomy
108. In mosses, the second gametophytic stage is leafy stage. Consider the following
statements about leafy stage.
I. Leafy stage is produced from the secondary protonema as a lateral bud.
II. They consist of upright, slender axis bearing spirally arranged leaves.
III. They are attached to the soil through multicellular rhizoids.
IV. This leafy stage bears the sex organ.
1) I, II and III only 2) I, III and IV only
3) II, III and IV only 4) I, II, III and III only
109. In which of the following gametophyte is not independent and free-living?
1) Funaria 2) Marchantia 3) Pteris 4) Pinus
110. Why an alien DNA is linked with origin of replication sequence?
1) To replicate alien DNA in the host
2) To replicate alien DNA outside the host
3) To transcribe alien DNA in the host
4) To transcribe alien DNA outside the host
111. The first recombinant DNA was created by
1) Linking of antibiotic resistance gene with E.Coli plasmid
2) Linking of antibody resistance gene with Salmonella typhimurium plasmid
3) Linking of antibiotic resistance gene with Salmonella typhimurium plasmid
4) Linking of antibody resistance gene with E.Coli plasmid
112. The first r-DNA was created by
1) Stanley Miller and Herbert Boyer 2) Stanley Cohen and Herbert Boyer
3) Herbert Miller and Stanley Cohen 4) Herbert Cohen and Stanley Boyer
113. Statement-I: Plasmid is autonomously replicating linear extra chromosomal DNA
Statement-II: Plasmid has its own origin of replication
3) Both Statements I, II are false 4) Both Statements I, II are true
114. Find the incorrect matching:
1) Molecular scissors - Restriction endonuclease
2) Agarose – sea weeds
3) Salmonella - Protozoan
4) DNA ligase – Sealing enzyme
115. In A the primary root is short-lived and replaced by a large number of roots
which orginate from base of stem and constitute B .
Select the correct option for A and B.
A B A B
1) Mustard Fibrous root 2) Wheat Fibrous root
3) Wheat Tap root 4) Sugarcane Taproot
116. Select the incorrectly matched pair of angiospermic family.
1) Potato – Leguminosae 2) Sugarcane – Poaceae
3) Candytuft – Brassicaceae 4) Cotton – Malvaceae

117. Statement –I :Rose flower is described as perigynous.
Statement –II :In rose flower, ovary is half inferior.
Column-I Column-II
a) Monadelphous stamens (i) Cucurbita
b) Aleurone layer (ii) Hibiscus
c) Epigynous flower (iii) Solanum
d) Cymose inflorescence (iv) Zea mays
1) a-(iv), b-(i), c-(ii), d-(iii) 2) a-(iv), b-(ii), c-(i), d-(iii)
3) a-(ii), b-(iv), c-(i), d-(iii) 4) a-(iii), b-(iv), c-(i), d-(ii)
119. Lac-operon gets switched on when
1) Repressor binds to operator 2) RNA polymerase binds to operator
3) Lactose binds to repressor 4) Lactose binds to operator
120. Select the correct option w.r.t. labels P, Q, R and S in the given flow of genetic
information
P Q R S
1) Replication Transcription Translation Reverse transcription
2) Replication Replication Translation Transcription
3) Transcription Replication Reverse transcription Translation
4) Transcription Transcription Replication Reverse transcription
121. Aminoacid lysine was not coded by which of the following codon m-RNA.
1) AAA 2) AAU 3) AAG 4) Both 1 and 2
122. Match column-I with column-II and select the correct option.
Column-I Column-II
A) Peptidyl Transferase (i) Joins DNA fragaments
B) DNA ligase (ii) Activation of amino acid
C) Amino acyl tRNA synthetase (iii) Unwinding of DNA helix
`
D) Helicase (iv) Peptide bond formation
A B C D A B C D
1) iv iii ii i 2) iv i ii iii
3) ii i iv iii 4) iii i iv ii
123. In which of the given organisms, Taylor et.al. have proved semiconservative mode
of chromosome replication by using 3 H -thymidine?
1) Vicia faba 2) E.coli 3) Pneumococcus 4) Streptococcus
124. Observe the following tRNA molecules with their anticodon pairing with respective
codon on m-RNA. Which type of t-RNA is not possible?
3 3 3 3
t 5 t 5 t 5 t 5
1) 2) 3) 4)
U C A A U G A U U U G C
A G U U A C U A A A C G
5 3 5 3 5 3 5 3
125. Parenchymatous cells are usually present in
1) Cortex & pericycle 2) Pith & medullary rays only
3) Primary stem & roots only 4) All

126. Assertion : The veins vary in thickness in the reticulate venation of the dicot
leaves.
Reason : The vascular bundles are surrounded by a layer of thick walled bundle
sheath cells.
127. The spring wood present in an annual ring
1) Is dark coloured 2) Has high density than autumn wood
3) 1 and 2 4) Has low density than autumn wood
128. F1 always resembled either one of the parents and the trait of the other parent
was not seen in them. This is due to
1) Segregation 2) Complete dominance
3) Incomplete dominance 4) Both 1 & 2
129. A plant with AaBb composition, on self pollination result in which of the following
genotypic ratio of the progeny?
AABB AABb AaBB AaBb AABB AABb AaBB AaBb
1) 2/16 2/16 2/16 2/16 2) 1/16 2/16 2/16 4/16
3) 1/16 2/16 2/16 1/16 4) 1/16 1/16 1/16 1/16
130. In monohybrid cross what is the ratio of homozygous dominant and homozygous
recessive individuals in F2 generation.
1) 1 : 2 : 1 2) 2 : 1 : 1 : 2 3) 3 : 1 : 1 : 3 4) 1 : 1
131. The main cause for the discovery of laws of heredity by mendel is :
1) He analysed every trait independently
2) He did not come across the phenomenon of linkage
3) His plants were true breeding
4) All the above
132. Assertion (A): Mendel conducted cross pollination experiments on true breeding
lines.
Reason (R): For several generations, true breeding lines have stable traits o
inheritance.
133. Match the following columns and identify the correct combination :
Column I Column II
(Chromosome) (Position of centromere)
a. Metacentric (i) At the top / terminal
b. Submetacentric (ii) Close to its end
c. Acrocentric (iii) In the middle
d. Telocentric (iv) Slightly away from middle
1) a–iv, b–i, c–ii, d–iii. 2) a–i, b–ii, c–iv, d–iii
3) a–iii, b–ii, c–iv, d–iii 4) a–iii, b–iv, c–ii, d–i.
134. a. The passage through which movement of RNA and protein molecules takes
place in both directions in a nuclear pore.
b. Interphase nucleus is highly extended and elaborate nucleoprotein fibres called
chromatin.
c. DNA moves easily in both directions through the nuclear pore.
Read the following and select the correct option
1) a and b are true 2) b and c are true
3) c and a are true 4) a, b and c are true.
135. If seed coat is removed from water soaked pea seed, the remaining structure is :–
1) Full mature embryo 2) Cotyledons, endosperm and pericarp
3) Only cotyledons 4) Only endosperm
SECTION – B
136. Ovule generally differentiate a single megaspore mother cell in which region of
nucellus ?
1) Chalaza 2) Hilum 3) Micropyle 4) Integument

137. In flowering plants ovule is also called :-
1) Megasporangium 2) Microsporangium
3) Megaspore 4) Microspore
138. From among the situations given below, choose the one that prevents both
autogamy and geitonogamy :-
1) Dioecious plant bearing unisexual flowers
2) Monoecious plant bearing only male or female flower.
3) Monoecious plant with bisexual flowers
4) Both 1 and 2
139. Which of the following set of compounds are homopolymers?
1) Starch, cellulose, Glycogen and inulin
2) Insulin, Chitin and Pectin
3) Cellulose, Insulin and Polypeptide
4) Protein, lipid and mucopolysaccharide
140. Statement –I : We can take any living tissue and grind it in Cl3CCOOH using a
mortar pestele we obtain a thick slurry.
Statement –II : Scientists have found thousands of organic and inorganic
compounds in acid soluble pool.
141. The cells in a watermelon may increase in size by upto
1) 30,000 times 2) 77,500 times 3) 3,50,000 times 4) 2,50,000 times
142. Environmental plasticity is seen in
1) Cotton 2) Coriander 3) Larkspur 4) Buttercup
143. Statement – I: Auxins are widely used for plant propagation in horticulture.
Statement – II : Auxins help in root initiation on stem cuttings.
144. Synergids can be observed in
(A) Pteris (B) Cycas (C) Ginkgo (D) Pinus
(E) Marchantia (F) Mustard (G) Pea (H) Castor
1) F, G, H 2) A, B, C, D 3) E, F 4) D, E, H
145. Select the incorrect w.r.t Anaphase – II.
1) Splitting of centromere
2) Sister of chromatids associate at centromere
3) Chromatids move toward opposite pole 4) Both 1 & 3
146. In C4 plants, Calvin cycle operates in
1) Stroma of bundle sheath chloroplasts 2) Grana of bundle sheath chloroplasts
3) Grana of mesophyll chloroplasts 4) Stroma of mesophyll chloroplasts
147. The C4 plants are different from the C3 plants with reference to the
1) The substance that accepts CO2 in carbon assimilation
2) Types of end product of photosynthesis
3) The number of NADPH that are consumed in preparing sugar
4) Types of pigments involved in photosynthesis.
(A) Monera (I) Tissue / Organ
(B) Protista (II) Cellular, Prokaryotic
(C) Plantae (III) Tissue / Organ / Organ system
.
(D) Animalia (IV) Cellular, eukaryotic
(A) (B) (C) (D) (A) (B) (C) (D)
.
1) IV II I III 2) II IV III I
3) II IV I III 4) IV I III II
149. All are the criteria used for the five kingdom classification in the following except.
1) Cell structure 2) body organization
3) Nuclear membrane composition 4) Phylogenetic relation

150. In five kingdom system of classification of R.H. Whittaker how many kingdoms
contain multicellular eukaryotes.
1) Two kingdoms 2) Three kingdoms 3) Four kingdoms 4) Five kingdoms
ZOOLOGY
SECTION – A
151. Which was absent in the atmosphere at the time of origin of life?
1) CH4 2) O2 3) H2 4) NH3
152. Industrial melanism is an example of
1) Natural selection 2) Gene flow
3) Recombination 4) Linkage
153. What is common between Penguin, oviparous mammal and Macropus?
1) Toothless jaws 2) Oviparity 3) Homeotherms 4) Poikilotherms
154. The _________ hormone increases calcium levels in blood, by stimulating the
process of _____
1) Progesterone, Glycogenesis 2) Thyrocalcitonin, bone resorption
3) Parathyroid, bone resorption 4) Thyroxine, demineralization
155. Select the incorrect statements with respect to biodiversity on earth.
a) Robert May places the global species diversity at about of 7 millions.
b) India has more than 1000 genetically different strains of rice and 50,000
varieties of mango.
c) Out of every 10 animals on this planet, 7 are insects.
d) India has only 8.1 percent of world’s land.
1) (b) and (d) 2) (a) and (b) 3) (a) and (c) 4) (a) and (d)
156. Species-area relationships among very large areas like the entire continents,
Z-values in the range of _______
1) 0.6 and 1.2 2) 0.1 and 1.2 3) 1.01 and 0.02 4) 0.6 and 0.12
157. Conventional taxonomic methods are not suitable for identifying.
1) Amphibian species 2) Insects species
3) Microbial species 4) Gymnospermic species
158. Which of the following statements is incorrect about development of Periplaneta
americana?
1) On an average female produces 9 – 10 oothecae each containing 14 – 16 eggs
2) The development is paurometabolous
3) The nymph grows by moulting about 7 -8 times to reach adult form
4) The next to last nymphal stage has wing pads but only adult cockroach has
wings
159. In cockroach, eye consists of visual units called
1) Ostia 2) Ommatidia 3) Gonapophyses 4) Spiracles
160. Which of these are not completely curable eventhough detected early?
1) Hepatitis-B, Syphilis & HIV 2) Syphilis, Gonorrhoea & HIV
3) Gonorrhoea, Chlamydiasis & HIV 4) Hepatitis-B, genital herpes & HIV
161. A woman heterozygous for haemophilia marries a haemophilic man. What will be
the ratios of carrier daughters, haemophilic daughters, normal sons and
haemophilic sons respectively in F1 generation?
1) 1:2:2:1 2) 2:1:1:2 3) 1:1:1:1 4) 1:2:1:2
162. The most abundant intracellular cation in neuron is ______
1) Ca 2 2) Na 2 3) H  4) K 
163. The nerve impulse is another name of
1) Resting potential 2) Polarised potential
3) Action potential 4) Repolarisation
164. _________ is a potent force in organic evolution.
1) Intraspecfic competition 2) Predation
3) Interspecific competition 4) Parasitism
165. Consider the given statements and select correct statement for transport of
oxygen?
(a) 70% of oxygen is carried as bicarbonates.
(b) About 97% of oxygen is transported by RBCs in blood.
(c) It is carried by haemoglobin as carbamino haemoglobin.
1) a , b 2) b , c 3) only b 4) only c

166. A healthy adult human excretes (on an average) _____ of urea per day.
1) 25-30 mg 2) 25-30 gm 3) 50-60 gm 4) 15-20mg
167. Oxalates formed within the kidney are ______
1) Nitrogenous wastes
2) Removed by the process called haemodialysis
3) Insoluble mass of crystallised salts 4) Passed into the renal vein.
168. Pacemaker is _________
1) AV node 2) SA node 3) Bundle of His 4) Ventricle muscles
169. Study the given pedigree chart and answer the questions that follow.
The pattern of inheritance and genotype of the Ist generation parents respectively
are _________
1) Autosomal recessive, aa, Aa 2) X linked recessive, Aa,aa
3) Autosomal dominant, AA,aa 4) Autosomal dominant, aa,Aa
170. Assertion: Plasma without the clotting factors is called serum.
Reason: Serum contain immunoglobulins.
3) The assertion is true but the reason is false.
171. This ion is responsible for unmasking of active sites for myosin or cross-bridge
activity during muscle contraction.
1) Potassium 2) Magnesium 3) Sodium 4) Calcium
172. “Don’t die of ignorance” this statement refers to which disease _________
1) AIDS 2) Typhoid 3) Dengue 4) Hepatitis – B
173. Oxyhemoglobin dissociates into oxygen and hemoglobin at tissue level due to
1) Low oxygen pressure in tissues. 2) High oxygen pressure in tissues.
3) Equal oxygen pressure inside and outside tissue.
4) All times irrespective of oxygen pressure.
174. ____________ is a very effective sedative and pain killer and is very useful in
patients who have undergone surgery .
1) Cannabinoids 2) Morphine 3) Heroin 4) Crack
175. How many of the below stages are in diploid condition?
Spermatogonia, Oogonia, Primary oocyte, Primary spermatocyte,
Spermatid, Sertoli cells, secondary oocyte, Ootid
1) 3 2) 4 3) 5 4) 7
176. Choose the incorrect option w.r.t. to human reproductive system.
1) Epididymis – Posterior surface of each testis
2) Interstitial cells – Interstitial spaces
3) Ovaries – Lower abdomen
4) Bulbourethral gland – above the prostate
177. Lowest number of genes in human genome is in
1) Chromosome-y 2) Chromosome-2 3) Chromosome-6 4) Chromosome-1
178. Which of the following is not a difference between cartilaginous and bony fishes?
1) Types of scales 2) Air bladder
3) Claspers 4) Body temperature
179. The maximum number of existing transgenic animals is of ______
1) Fish 2) Mice 3) Cow 4) Pig
180. I. Alimentary canal is complete with a well developed muscular pharynx.
II. Sexes are separate (Dioecious) means males and females are united.
III. Often males are longer than females
IV. Fertilisation is external and development is only indirect
In the above statements, How many are correct and related with round worm

181. The coal deposits formed slowly in the earth due to the falling of
1) Bryophytes 2) Dicotyledons 3) Giant ferns 4) Ginkgos
182. Which among the following hormones supresses immune responses?
1) Aldosterone 2) Thymosins 3) Triiodothyronine 4) Cortisol
183. DNA fingerprinting identifies differences in:
1) Repetitive DNA 2) bulk DNA 3) Mitochondrial RNA 4) Both 1 & 2
184. Assertion (A): Despite occupying about 70 percent of the surface, the
productivity of oceans is only 55 billion tons.
Reason (R): In the deep sea, productivity is limited by light and nitrogen
In the light above statements, choose the most appropriate answer from the
options given below.
1) A is true, R is false.
2) A and R are true, and R is not the correct explanation of A.
3) A and R are true, and R is the correct explanation of A
4) Both A and R are false
185. Which one is a limitation of ecological pyramids?
1) It assumes a simple food chain
2) It does not take into account the species belonging to two or more trophic
levels
3) Saprophytes are not given any place 4) All of These
SECTION – B
186. Select the incorrect statement with respect to the food chain.
1) There is a progressive decrease in available biomass and energy with rise in
trophic level
2) The presence of separate or isolated food chains adds to the instability of the
ecosystem.
3) It increases the adaptability and competitiveness of the Organisms.
4) Only the members of same trophic level compete to obtain the same food.
187. Of the following, which one is odd one?
1) CuT 2) Cu7 3) Multiload 375 4) LNG-20
188. A hibernating frog respires with
1) Lung 2) Diaphragm 3) Buccal epithelium 4) Skin
189. Statement I:- Properties of tissues are present in the constituent cells but arise
as a result of interactions among them.
Statement II:- Plant families like Convolvulaceae, Solanaceae are included in the
order Polymoniales.
190. Read the following statements and select the incorrect?
1) Respiratory rhythm centre present in medulla region.
2) A chemosensitive area is highly sensitive to CO2 & H+.
3) Pneumotaxic centre can reduce the duration of inspiration and there by
respiratory rate unaltered.
4) The role oxygen in the regulation of respiratory rhythm is quite insignificant.
191. In human kidney, number of nephrons _______
1) Equals to collecting ducts
2) Equals to number of afferent arterioles
3) Less than the number of renal arteries
4) Various according to water intake
192. ___________ uses x- rays to generate a three - dimensional image of the internals
of an object.
1) Computed tomography 2) Biopsy
3) Magnetic resonance imaging 4) Both (2) and ( 3)

Column-I Column-II
a) Commensalism (i) Predation
b) Plant & Herbivores (ii) Pseudocopulates
c) Sunken stomata (iii) Sea anemone & clone fish
d) Orchid Ophrys (iv) CAM pathway
1) a-i, b-iii, c-iv, d-ii 2) a-iv, b-ii, c-iii, d-i
3) a-ii, b-iv, c-i, d-iii 4) a-iii, b-i, c-iv, d-ii
194. Assertion: Thalassemia is a qualitative problem.
Reason: In thalassemia due to mutation very few number of globin molecules are
synthesised comparing to a normal person.
assertion.
3) Assertion is true and reason is false 4) Assertion is false and reason is true
195. The symptoms of allergic reactions are _________,__________
1) Watery eyes,running nose 2) Sneezing , Coughing
3) Headache, fever 4) Difficulty in breathing, stomach pain
196. The pivot joint between atlas and axis is a type of _______
1) Fibrous joint 2) Synovial joint 3) Saddle joint 4) Cartilaginous joint
197. Cry-I endotoxins obtained from Bacillus thuringiensis are effective against _____
1) Nematodes 2) Flies 3) Mosquitoes 4) Boll warms
198. Which of the following is correct about the origin and evolution of man
(i) Agriculture came around 10,000 years back
(ii) Dryopithecus and Ramapithecus primates existed about 15 mya
(iii) Homo erectus probably ate meat
(iv) Modern Homo sapiens arose during the ice age between 75,000–10,000 years
ago
1) i, iv only 2) i, ii, iv only 3) i, iii, iv only 4) i, ii, iii, iv
199. Statement I: Mendel’s studies mainly described the traits that have distinct
alternate forms.
Statement II: The influence of environment also plays a major role in polygenic
inheritance.
1) Statement I is true, Statement II is false
2) Both statement I and II are true 3) Both statement I and II are false
4) Statement I is false, Statement II is true
200. What is the atrio-ventricular septum made of?
1) Cartilage 2) Fibrous tissue 3) Osteocytes 4) Mucous membrane
********

: ANSWER KEY:
SET-1 SUB: PHYSICS
1 2 11 1 21 2 31 2 41 2
2 3 12 1 22 1 32 1 42 2
3 2 13 4 23 2 33 2 43 1
4 3 14 1 24 2 34 4 44 2
5 3 15 3 25 3 35 3 45 1
6 4 16 2 26 1 36 3 46 2
7 3 17 2 27 3 37 3 47 4
8 3 18 3 28 3 38 1 48 3
9 4 19 3 29 3 39 4 49 3
10 1 20 1 30 3 40 1 50 2
SUB:CHEMISTRY
51 2 61 2 71 4 81 1 91 1
52 1 62 2 72 2 82 3 92 1
53 4 63 2 73 2 83 3 93 3
54 3 64 3 74 3 84 2 94 3
55 3 65 2 75 3 85 3 95 2
56 3 66 2 76 1 86 3 96 2
57 3 67 4 77 2 87 2 97 1
58 3 68 1 78 2 88 1 98 1
59 1 69 3 79 2 89 4 99 3
60 3 70 2 80 2 90 1 100 4
SUB : BOTANY
101 2 111 3 121 2 131 4 141 3
102 3 112 2 122 2 132 2 142 4
103 1 113 2 123 1 133 4 143 1
104 1 114 3 124 3 134 1 144 1
105 3 115 2 125 4 135 1 145 2
106 2 116 1 126 2 136 3 146 1
107 2 117 1 127 4 137 1 147 1
108 4 118 3 128 2 138 1 148 3
109 4 119 3 129 2 139 1 149 3
110 1 120 1 130 4 140 3 150 2
151 2 161 3 171 4 181 3 191 2
152 1 162 4 172 1 182 4 192 1
153 3 163 3 173 1 183 1 193 4
154 3 164 3 174 2 184 3 194 4
155 1 165 3 175 3 185 4 195 1
156 1 166 2 176 4 186 3 196 2
157 3 167 3 177 1 187 4 197 4
158 3 168 2 178 4 188 4 198 4
159 2 169 4 179 2 189 3 199 2
160 4 170 2 180 1 190 3 200 2

NEET GRAND TEST - 3
answer sheet.
CORRECT.
Section-B;
Marking Scheme :

PHYSICS
SECTION – A
The Vander Waal’s equation of state for real gases is given as  P  2  V  b   nRT
a
1.
 V 
which of the following terms has dimensions different from that of energy
a ab
1) PV 2) 2 3) 2 4) bP
V V
2. A photosensitive metallic surface has work function hv 0 . If photons of energy
2hv0 fall on this surface the electrons come out with a maximum velocity of
4  10 6 m / s . When the photon energy is increases to 5hv0 then maximum velocity
of photo electron will be
3) 16  10 m / s 4) 8  10 m / s
6 6
1) 2  10 6 m / s 2) 2  10 7 m / s
3. A mass of 1kg is suspended by a string. It is first lifted up with an acceleration of
4.9m/s2 and then lowered down with same acceleration. The ratio of tensions in
the string in the two cases, respectively is (g = 9.8m/s2).
1) 1 : 3 2) 2 : 1 3) 3 : 1 4) 1 : 2
4. A particle of mass 1kg is moving in S.H.M. with an amplitude 0.02m and
a frequency of 60Hz. The maximum force acting on the particle is (in newton’s)
1) 144 2 2) 188 2 3) 288 2 4) None of these
5. A forward biased diode is
6. The graph AB shown in figure is a plot of temperature of a body in degree Celsius

and degree Fahrenheit, then
1) slope of line AB is 9/5 2) slope of line AB is 5/9

3) slope of line AB is 1/9 4) slope of line AB is 3/9
7. Two long straight wires, each carrying a current I in opposite directions are
separated by a distance R. The magnetic induction at a point mid-way between
the wires is
I 20 I I
1) Zero 2) 0 3) 4) 0
R R 4 R
8. A gas is compressed isothermally to half its initial volume. The same gas is
compressed separately through an adiabatic process until its volume is again
reduced to half. Then
1) compressing the gas through adiabatic process will require more work to be
done
2) compressing the gas isothermally or adiabatically will require the same
amount of work
3) which of the case (whether compression through isothermal or through
adiabatic process) requires more work will depend upon the atomicity of the gas
4) compressing the gas isothermally will require more work t be done

9. Three copper wires are there with lengths and cross-sectional areas as
 l , A  ;  2l ,  and  , 2 A  . Resistance:
A l
 2 2 
A
1) minimum for the wire of cross-ection are
2
2) minimum for the wire of cross-ection are A
3) minimum for the wire of cross-ection are 2A
4) same for all the three cases
10. The elongation of a wire on the surface of the earth is 104 m . The same wire of
same dimensions is elongated by 6  105 m on another planet. The acceleration
due togravity on the planet will be _____ ms2 . (Take acceleration due to gravity
on the surface of earth  10ms 2 )
1) 2 2) 4 3) 6 4) 8
2
11. A square aluminium (shear modulus is 25 10 Nm ) slab of side 60 cm and
9
thickness 15cm is subjected to a shearing force (on its square face) of 18.0 104 N .
The lower square face is riveted to the floor. The displacement of the upper edge
is ______ m.
1) 3 2) 30 3) 300 4) 3000
4
12. A wooden sphere floats on suface of water, its th part is submerged in water.
5
The density of wood is:
1) 1.4  103 kg / m 3 2) 1.5  103 kg / m 3 3) 0.8  103 kg / m 3 4) 1.7  103 kg / m 3
13. The mass of a ball is four times the mass of another ball. When these balls are
separated by a distance of 10cm, the gravitational force between them is
6.67 107 N . The masses of the two balls are (in kg)
1) 10, 20 2) 5, 20 3)20, 30 4) 20, 40
14. The density of a newly discovered planet is twice that of earth. The acceleration
due to gravity at the surface of the planet is equal to that at the surface of the
earth. If the radius of the earth is R, the radius of the planet would be
1 1
1) 2R 2) 4R 3) R 4) R
4 2
15. A cylindrical resonance tube open at both ends has fundamental frequency ‘f’ in
air. If half of the length is dipped vertically in water, the fundamental frequency of
the air column will be
1) f/2 2) f 3) 3f/2 4) 2f
16. A solid metallic sphere is rotating about an axis passing through its diameter.
Suddenly its volume is increased by 6% without change its mass, then the
change in its angular speed will be ……
1) -2% 2) +2% 3) -4% 4) +4%
17. If a spherical mirror is immersed in a liquid. It’s focal length will
1) increase 2) decrease
3) remain unchanged 4) depend on the nature of liquid
18. In YDSE, the ratio of maximum intensity at a point to the intensity at same point
when one slit is closed
1) 2 2) 3 3) 4 4) 1
19. Assertion (A) : Acceleration of charged particle in non- uniform electric field does
not depend on velocityof charged particle.
Reason (R) : Charge in an invariant quantity, i.e. amount of charge on particle
does not depend on frame of reference.

20. The spatial distribution of the electric field due to charges (A, B)is shown in the
figure. Which one of the following statements is correct?
1) A is +ve and B – ve and |A| > |B| 2) A is –ve and B +ve and |A| > |B|
3) Both are +ve but A > B 4) Both are –ve but A > B
21. The root mean square speed of molecules of ideal gases at the same temperature
are
1) Directly proportional to the square root of the molecular weight
2) Inversely proportional to the square root of the molecular weight
3) Directly proportional to the molecular weight
4) Inversely proportional to the molecular weight
22. A wire of uniform cross-section A, length l and resistance R is bent into a
complete circle; the resistance between any two of diametrically opposite points
will be :
R R R
1) 2) 3) 4) 4R
2 4 8
23. A uniform metallic rod rotates about its perpendicular bisector with constant
angular speed. If it is heated uniformly to raise its temperature slightly,
1) its speed of rotation increases 2) its speed of rotation decreases
3) its speed of rotation remains same
4) its speed increases because its moment of inertia increases
24. Two light sources are said to be coherent when, their
1) Amplitude are equal and have constant phase difference
2) Wavelengths are equal
3) Intensities are equal
4) Frequencies are equal and have constant phase difference
25. When a wire loop is rotated in a magnetic field, the direction of induced e.m.f.
changes once in each
1 1
1) revolution 2) revolution 3)1 revolution 4) 2 revolution
4 2
26. The reading of spring balance when a block is suspended from it in air, is 60N.
This reading is changed to 40N when the block is immersed in water. The relative
density of the block is
2 3
1) 3 2) 3) 6 4)
3 2
27. Which of the following has longest wave length?
1) Ultraviolet light 2)  -rays 3) Visible radiation 4) Infrared radiation
28. The displacement of a S.H.M. doing particle when K.E. = P.E. (amplitude = 4cm)
is
1
1) 2 2cm 2) 2cm 3) cm 4) 2cm
2
29. A simple pendulum performs S.H.M. about x = 0 with an amplitude a, and time
period T. The speed of the pendulum at x = a/2 will be
a 3 a 3 a 3 2 a
1)  2) 3) 4)
T 2T T T

30. Thermodynamic processes are indicated in the following diagram.
Match the following:

Column-I Column-II
(P) Process I A) Adiabatic
(Q) Process II B) Isobaric
(R) Process III C) Isochoric
(S) Process IV D) Isothermal
1) P-A, Q-C, R-D, S-B 2) P-C, Q-A, R-D, S-B
3) P-C, Q-D, R-B, S-A 4) P-D, Q-B, R-A, S-C
31. The moment of inertia of a solid cylinder about its own axis is the same as its
moment of inertia about an axis passing through its centre of gravity and
perpendicular to its length. The relation between its length L and radius R is
1) L 2 R 2) L 3 R 3) L  3R 4) LR
1
32. A convex mirror of focal length f forms an image which is times the object. The
n
distance of the object from the mirror is
n 1  n 1
1)  n  1 f 2)  f 3)  f 4)  n  1 f
 n   n 
33. A coil having n turns and resistance R  is connected with a galvanometer of
resistance 4 R  . This combination is moved in time t seconds from a magnetic
field W1 weber to W2 weber. The induced current in the circuit is
W  W1 n (W2  W1 ) (W  W1 ) n(W2  W1 )
1)  2 2)  3)  2 4) 
5 Rnt 5 Rt Rnt Rt
34. A wire of length L metre carrying a current of I ampere is bent in the form of a
circle. Its magnetic moment is
 
1) IL2 / 4 A-m 2  
2) I  L2 / 4 A-m2  
3) 2IL2 /  A-m2  
4) IL2 / 4 A-m2
35. Two bodies are thrown up at angle of 45o and 60o respectively, with the
horizontal. If both bodies attain same vertical height, then the ratio of velocities
with which these are thrown is
2 2 3 3
1) 2) 3) 4)
3 3 2 2
SECTION – B
36. If energy E, velocity V and time T are taken as fundamental quantities, the
dimensional formula for surface tension is

1) EV 2T 2  
2) E 2VT 2  
3) EV 2T 1  
4) E 2V 2T 1 
37. A ball is thrown from a point with a speed ‘v0’ at an elevation angle of . From the
same point and at the same instant, a person starts running with a constant
'v '
speed 0 to catch the ball. Will the person be able to catch the ball? If yes, what
2
should be the angle of projection ?
1) No 2) Yes, 30o 3) Yes, 60o 4) Yes, 45o

38. A uniform cable of mass M and length L is placed on a horizontal surface such
that its   th part is hanging below the edge of the surface. To lift the hanging
1
n
part of the cable upto the surface, the work done should be
2MgL MgL MgL
1) 2
2) nMgL 3) 2
4)
n n 2n2
39. Two blocks of masses 3kg and 5kg are connected by a metal wire going over a
75
smooth pulley. The breaking stress of the metal is Nm2 . What is the


minimum radius of the wire? take g = 10 ms 2

1
1) m 2) 2 m 3) 2 m 4) 4 m
2
40. A mass less rod BD is suspended by two identical massless strings AB and CD of
equal lengths. A block of mass m is suspended at point P such that BP is equal
to x, if the fundamental frequency of the left wire is twice the fundamental
freuquence of right wire, then the value of x is :
l
1)
5
l
2)
4
4l
3)
5
3l
4)
4
41. Assertion (A) : When the lift moves with uniform velocity the man in the lift will
feel weightlessness.
Reason (R) : In downward retarded motion of lift, apparent weight of a body
decreases.
42. A photon and an electron have equal energy E. photon / electron is proportional to
1) E 2) 1 / E 3) 1 / E 4)Does not depend upon E
(a) When capacitors are connected in parallel the effective capacitance is less
than the individual capacitance.
(b) The capacitances of a parallel plate capacitor can be increased by decreasing
the separation between the plates.
(c) When capacitors are connected in series the effective capacitance is less than
the least of the individual capacities
(d) In a parallel plate capacitor the electrostatic energy is stored on the plates.
1) (a) and (b) 2) (a) and (c) 3) (c) and (d) 4) (b) and (c)

44. Match the terms of Column I with the items of Column II and choose the correct
option from the codes given below.
Column-I Column-II
A) Diamagnetic (p)   0 , r  1 and   1
B) Paramagnetic (q) 1    0, 0   r  1 and   0
C) Ferromagnetic (r) 0     (  small positive number ),1   r  1   and   0
Codes :
A B C A B C
1) q r p 2) r p q
3) p q r 4) p r q
45. Match List I with List II :
List-I List-II
a) Electric potential inside a (e) Inversely proportional to square of
Conducting charged sphere the distance (r2)
b) Electric potential outside the (f) Directly proportional to distance
conducting charged sphere (r) from the centre
c) Electric field inside the non (g) Constant
conducting charged sphere
d) Electric field outside a conducting (h) Inversely proportional to distance
charged sphere (r)
1) a-f, b-e, c-g, d-h 2) a-e, b-f, c-h, d-g
3) a-h, b-g, c-e, d-f 4) a-g, b-h, c-f, d-e
46. A beam of mixture of  particles and protons are accelerated through
same potential difference before entering into the magnetic field of strength B. If
r1 = 5cm, then r2 is
1) 5 cm 2) 5 2cm 3) 10 2cm 4) 20 cm
47. An oscillating LC circuit consist of a 75 mH inductor and a 1.2  F capacitor. If

the maximum charge to the capacitor is 2.7 C . The maximum current in the
circuit will be ________mA.
1) 8 2) 9 3) 7 4) 6
48. The efficiency of a transformer is 98%. The primary voltage and current are
200V and 6A. If the secondary voltage is 100 V, the secondary current is
1) 11.76 A 2) 12.25 A 3) 3.06 A 4) 2.94 A
49. The frequency of first line of Balmer series in hydrogen atom is v0 . The frequency
of line emitted by singly ionized helium atom is:
1) 2v0 2) 4v0 3) v0 / 2 4) v0 / 4
50. The circuit shown in the figure contains two diodes each with a forward
resistance of 30 and with infinite backward resistance. If the battery is 3V, the
curent through the 50 resistance (in ampere) is
1) zero 2) 0.01 3) 0.02 4) 0.03

CHEMISTRY
SECTION – A
51. The vapour pressure of two pure liquids A and B are 450 mm Hg and 700 mm Hg
respectively. If the vapour pressure of a given solution of these two liquids is
600 mm Hg, then the mole fraction of liquid ‘B’ in vapoure phase is _____
1) 0.4 2) 0.6 3) 0.3 4) 0.7
52. Mole fraction of N2 in air is 0.8. KH value of N2 is 400 bar at 27o C . Then the
number of moles of N2 that can be dissolved in 10 mole of water at 27o C is _____
at 5 atmospheric pressure of air.
1) 0.01 2) 0.1 3) 0.09 4) 0.125
53. An organic compound contains C, H, N, S and Cl. For detection of chlorine in the
compound, the Sodium extract of the compound is at first heated with a few
drops of concentrated HNO3 and then silver nitrate solution is added to get a
precipitate of AgCl. This digestion with HNO3, prior to addition of AgNO3, is
required
1) To prevent the formation NO2
2) To convert the CN- and S2- ions to volatile HCN and H2S, otherwise, they will
interfere with the test by forming AgCN and Ag2S.
3) To prevent the hydrolysis of NaCN and Na2S
4) To form S4N4 which prevent formation of AgCl with AgNO3
54. For the process
X  g   e   X g  ; H  x and X g   X  g   e  ; H  y
Select the correct statement :
1) ionisation energy of X g  is y 2) electron affinity of X(g) is x
3) electron affinity of X(g) is –y 4) all are correct statements
55. In which of the following arrangements, the order is not correctly given according
to the property indicated against it?
1) Li < Na < K < Rb ; Increasing metallic character
2) B < C < N < O ; Increasing first ionization energy
3) Si < P < Cl < S ; Incresing second ionisation potential
4) Al 3  Mg 2  F   O2 …. Increasing ionic size
56. The correct IUPAC name of the compound
O
COOH
OHC
1) 5-carboxy-3-oxocyclohexane carboxyldehyde
2) 2 – carboxy – 5 – formyl cyclohexane
3) 4 – formyl – 2 – oxocyclohexane carboxylic acid
4) 4 – carboxy – 3 - oxocyclohexanal
57. The energy required to melt 1g ice is 33.135J. The number of quanta of radiation
of frequency 5 x 1013 sec-1 that must be absorbed to melt 10g ice is
1) 1022 2) 1023 3) 1020 4) 1024
A) Degenerate orbitals of a given subshell differ in their orientation
B) A 4P orbital can accommodate 6 electrons.
C) The presence of five unparired electrons in Mn2+ ion is according to Hund’s
rule.
1) All A, B and C are correct. 2) Only A and B are correct.
3) Only A and C are correct. 4) Only B and C are correct.
59. Which of the following molecule has highest enol content?

60. Assertion (A) : 3 group cations (Al or Fe3+) are precipitated by NH4OH in the
rd 3+
presence of NH4Cl.
Reason (R) : For Al(OH)3 and Fe(OH)3, the Ksp values are relatively low.
61. Na2CO3 cannot be used in place of (NH4)2CO3 for the precipitation of V group,
because
1) Na  interferes in the detection of V group
2) conc. of CO32 is very low
3) Na will react with acid radicals
4) Mg will be precipitated
62. To the given salt solution aqueous BaCl2 solution is added. Formation of white
precipitate confirms the presence of _________ ion.
1) Cl  2) NO3 3) NO2 4) SO42
63. Which among the following can form intermolecular H-bonding?
1) A only 2) B and C only 3) B, C and D only 4) A and C only

64. The electronic configuration of carbon is 1s 2 2 s 2 2 p 2 . There are 12 electrons in C2
molecule. The correct electronic configuration of C2 molecule according to
molecular orbital theory.
1)  1s 2  *1s 2  2s 2  *2s 2  2 pz2  2 px2 
2)  1s 2  *1s 2  2s 2  *2 s 2  2 px2   2 p y2 
3)  1s 2  *1s 2  2s 2  *2s 2  2 pz2  2 p1x   2 p1y 
4)  1s 2  *1s 2  2s 2  *2 s 2  2 px2   2 p1y 
65. In which of the following molecules the central atom undergoes sp3 hybridisation
but shape is Pyramidal?
1) BrCl3 2) SO3 3) NH3 4) CCl4
66. Statement –1 : p-Hydroxybenzoic acid has a lower boiling point than that of
o-hydroxybenzoic acid.
Statement –2 : o-Hydroxybenzoic acid has intramolecular hydrogen bonding.
for Statement-1
67. Among the followingncarboxylic acid, which one has highest Ka value.
1) PhCOOH 2) CH3COOH 3) phCH2COOH 4) HCOOH
68. Which of the following 13 group element used for measuring high temperatures
th
by using liquid thermometer?

1) B 2) Al 3) Ga 4) In
69. Which of the following pairs of compounds(both) are having electrostatic bond
(ionic bond)?
1) SiF4, SnF4 2) SnF4, PbF4 3) GeF4 & PbF4 4) SiCl4, CCl4

70. Which one of the following is a free-radical substitution reaction?
71. Using H+ ion as catalyst, which one of the following reaction(s) produces
ethylbenzene (PhEt)?
1) H 3C  CH 2OH  C6 H 6 2) CH 3  CH  CH 2  C6 H 6
3) H 2C  CH 2  C6 H 6 4) Both 1 and 3
72. An acidic buffer contains equal concentrations of acid and salt. The dissociation
constant of acid is 10-5. The pH of the buffer solution is
1) 5 2) 9 3) 4.49 4) 5.5
73. Which of the following does not contain one mole electrons?
1) 1.8g of H2O 2) 1.7g of NH3 3) 1.6g of CH4 4) 2.8g of CO
74. What is the molarity of H2SO4 solution that has a density 1.84 g/cc at 35ºC and
contains 98% by weight-
(1) 4.18 M (2) 8.14 M 3) 18.4 M (4) 18 M
75. Average oxidation number of carbon in C3O2, Mg2C3 are respectively:
4 4 4 4 2 2 2 4
1)  ,  2)  ,  3)  ,  4)  , 
3 3 3 3 3 3 3 3
CH 3  CH  CH 2  Br
76. Which of the following is the correct IUPAC name for | .
C2 H 5
1) 1 – Bromo – 2 – ethylpropane 2) 1 – Bromo – 2 – ethyl – 2 – methylethane
3) 1 – Bromo – 2 – methylbutane 4) 2 – Methyl – 1 - bromobutane
77. Which of the following is halogen exchange reaction?
78. The boiling points of H 2O , H 2 S , H 2 Se and H 2Te are in the following order
1) H 2O  H 2 S  H 2 Se  H 2Te 2) H 2O  H 2Te  H 2 Se  H 2 S
3) H 2Te  H 2 Se  H 2 S  H 2O 4) H 2 S  H 2O  H 2Te  H 2 Se
79. Halogen that absorbs lowest wavelength from visible region to exhibit colour?
1) Cl2 2) F2 3) Br2 4) I 2
80. In a reaction, 2A  P , the concentration of ‘A’ decreases from 0.5M to 0.4M in
10min. Then the rate of reaction is _____ M min-1.
1) 0.01 2) 0.005 3) 0.02 4) 0.1
81. For a reaction, A → product, the rate constant is 2  10 min1 and initial conc. of
3
reactant is 0.4M. The initial rate of the reaction is ________M.min-1.

1) 5 103 2) 8  104 3) 8  103 4) 5 104
82. The H+ ion concentration of a solution is 4 105 M . Then the OH  ion
concentration of the same solution is
1) 4 105 M 2) 2.5 109 M 3) 1.0 107 M 4) 2.5 1010 M

83. What is the IUPAC name of the following compound?
1) 2-methyl-4-hexanamine 2) 4-methyl-2-pentanamine
3) 2-methyl-4-aminohexane 4) 5-methyl-3-aminohexane
84. The heats of combustion of carbon, hydrogen and propane are -393, -286 and
-2220kJ/mol respectively. Then the heat of formation of propane is _____kJ/mol.
1) -103 2) +103 3) -326 4) +326
85. Statement - I: The heat absorbed during the isothermal expansion of an ideal
gas against vacuum is zero.
Statement - II: In free expansion of a gas, Pext=0.
SECTION – B
86. Assertion (A) : In 3d-series zinc has lower enthalpy of atomization than other
elements of same series.
Reason (R) : In zinc only two valence electrons participate in metallic bonding
while in other element more than two valence electorns participate in metallic
bonding.
87. Which of the following is likely to show +2 oxidation state in its compounds?
1) La(Z=57) 2) Eu(Z=63) 3) Ce(Z=58) 4) Gd(Z=64)
88. In the reaction,
If one equivalent of each is taken, the major product will be
1) 2)
3) 4)
89. Select the correct statement for haloform reaction.

1) CH3O – group undergoes this reaction
2) CH3CO – group of aldehdyes and ketones and CH3CH(OH) – group of alcohols
take part in this reaction
3) Sodium hypohalite is used as a reagent in this reaction
4) Both (2) and (3)
90. Which among the following complexes is diamagnetic in nature?
1) [Mn(H2O)6]Cl3 2) K4[Fe(CN)6] 3) K3[Fe(CN)6] 4) [Ni(NH3)6]2+
91. Which of the following complex can show optical isomerism?
1)  Zn  H 2O  4  Cl2 2) Co  NH 3 4 Cl2  Cl
3) Co  NH 3 6  Cl3 4)  Fe  H 2O  NH 3  Py  ClBrI 

92. Which among the complex species has longest ‘C-O’ bond length?
1) Cr  CO 6 

2) V  CO 6 

3)  Mn  CO 6  4) C-O bond length is same in all the given complexes
93. Solution containing 0.1 N NH4OH and 0.1 N NH4Cl has the pH of 9.25. Then pKb
of NH4OH is
1) 9.25 2) 4.75 3) 3.75 4) 8.25
94.
95. Which of the following compound is lest reactive for electrophilic aromatic
substitution?
96. Which of the following would be the most readily dehydrated in basic conditions?
97. Which of the following reactions will not give a primary amine?
1) CH 3CONH 2 
Br2 / KOH
 2) CH 3CN 
LiAlH 4

3) CH 3 NC 
LiAlH 4
 4) CH 3CONH 2 
LiAlH 3

98 Single electrode potential depends on which of the following factor(s).
1) the nature of the electrode
2) temperature
3) concentration of the ion with respect to which it is reversible
4) all the above
99. During the electrolysis of aqueous NaCl, the total volume of the gases liberated is
2.24 litre at STP. If the current strength is 50amp then the time of electrolysis is
____ minutes.
1) 3.217 2)6.434 3) 3.862 4) 2.68
100. Which of the following product formed when glucose oxidation with conc.HNO3
1) Gluconic acid 2) Saccharic acid 3) Sulphuric acid 4) Glyconic acid
BOTANY
SECTION – A
101. Amino acids are added one by one and translated into polypeptide sequences.
This reaction is dictated by
1) mRNA 2) tRNA 3) DNA 4) Ribosomes
102. Choose the incorrect pair.
1) Chrysophytes - Wallessprotists 2) Monerans – Eubacteria
3) Protozoans - Eukaryotes 4) Lichens - Composite orgnisms
103. Cells that stay in Go. phase permanently and fail to proliferate are
1) skin cells 2) gut cells 3) heart cells 4) liver cells

104. Identify the mis-match with respect to physiological effects of phytohormones
1) Xylem differentiation — Auxin 2) Adventitious shoot growth — Gibberellins
3) Bolting in cabbage — Gibberellins 4) Sprouting of potato tuber — Ethylene
105. Zea mays (maize/corn) is associated with the following characters given below.
Choose the option with correct set of characters:
A) Stilt roots B) Parallel venation
C) Anemophily D) Monoecious condition
E) Endospermic seeds F) Single cotyledon ‘scutellum’
1) A, B, C, D, E, F 2) A, C, E only
3) C, D, E, F only 4) B, C, F only
106. Read the following statements and choose the correct statement regarding DNA:
1) Two nucleotides of opposite strands are linked by phosphodiester bonds
2) The pitch of the DNA is 36°
3) The distance between the successive base pairs would be 3.4nm
4) B - DNA consist of ten base pairs in each turn of helix
107. Assertion (A): Plasmids and bacteriophages could replicate within the bacterial
cells independent of the control of chromosomal DNA
Reason(R): Plasmid DNA and DNA of bacteriophage consists autonomous
replication sequence.
1) A and R are true, and R is the correct explanation of A
2) A and R are true, and R is not the correct explanation of A
3) A is true, R is false 4) Both A and R are false
108. Which of the following is untrue about sunflower?
1) has heterogamous head 2) Ray florets have only pistil
3) Fruit is caryopsis 4) Single seeded fruit
109. Identify the fungus that does not have sex organs but shows sexual reproduction
1) Rhizopus 2) Mucor 3) Penicillium 4) Agaricus
110. Which of the following is an example of lateral meristem not formed by
dedifferentiation
1) Interfascicular cambium 2) Intrafascicular cambium
3) Cork cambium 4) Vascular cambium of dicot root
111. Centrioles undergo duplication during _A_ of _B_ and begin to move towards
opposite poles of the cell during _C_
(A) (B) (C) (A) (B) (C)
1) S Phase Interphase Prophase 2) S phase Interphase Anaphase
3) Prophase Mitosis Metaphase 4) Prophase Mitosis Anaphase
112. How many ATP’s are generated in the process of complete oxidation of glucose
aerobically through E.T.S.
1) 38 2) 40 3) 24 4) 34
113. In a plant, red fruit (R) is dominant over yellow fruit (r) and tallness (T) is
dominant over shortness (t). If a plant with RRTt genotype is crossed with a plant
that is rrtt,
1) 25% will be tall with red fruit 2) 50% will be tall with red fruit
3) 75% will be tall with red fruit 4) All the offsprings will be tall with red fruit
114. Find the wrongly matched pair?
1) Process of splicing — Dominance of RNA world
2) Split gene arrangement — Ancient feature of the genome
3) Presence of exons — Reminiscent of antiquity
4) Lac operon — Shows negative and positive regulation
115. Read the following statements and choose those in which fungi has a role in
human welfare
a) Penicillin b) Statins c) Citric acid d) Cyclosporin-A
f) Bread e) Curd
1) All the above except a 2) All the above except d
3) All the above except e 4) All the above except b

Column – I (Plant) Column – II (Placentation )
(A) Dianthus (I) Basal
(B) Marigold (II) Free central
(C) Argemone (III) Axile
(D) Lemon (IV) Parietal
(E) Pea (V) Marginal
.
(A) (B) (C) (D) (E) (A) (B) (C) (D) (E)
.
1) IV II I III V 2) I IV III II V
3) II I IV III V 4) III IV I II V
A) Leaves - Alternate phyllotaxy B) Sepal 4, free, 2 + 2
C) Petals 4, free, cruciform corolla D) Stamens : 6, (4 long and 2 short)
E) Carpels: 2, parietal placentation G) Seed: Non endospermic
The above characters are related to
1) China rose 2) Pea 3) Mustard 4) Lily
118. Vascular bundles are conjoint and closed in
1) Dicot stem and monocot stem 2) Dicot root and monocot root
3) Monocot stem and leaves 4) Monocot root and leaves
119. DNA fragments generated by the restriction endonucleases in a chemical reaction
can be separated by
1) centrifugation 2) polymerase chain reaction
3) electrophoresis 4) restriction mapping
120. Sutton and Boveri used to explain Mendel's law's and used
1) Chromosome structure 2) Chromosome shape
3) Chromosome movement in meiosis 4) Allelic position
121. Commercially used natural hydrocolloid substance is produced by
1) Spiruilina 2) Gracilaria 3) Chlorella 4) Chara
122. The daughter cell which has withdrawn from cell cycle after a division shows the
following events in its development at cellular level
A. Plasmatic growth B. Cell expansion
C. Cell differentiation D. Cell maturation
1) A and B only 2) C and D only 3) A, B and D only 4) A, B, C and D
123. Identify the statements as true(T) or false(F)
I. Lac Z gene codes for   galactosidase enzyme which is a selectable marker in a
plasmid.
II. pBR322 contains two antibiotic resistant genes as selectable marker.
III. Biolistic or gene gun method is suitable for vector less gene transfer in
animals IV. Lysozyme enzyme is used for isolating gene of interest from fungal
cell.
1) I — T, II — T, III — F, IV — F 2) I — F, II — F, III — T, IV - T
3) I — T, II — T, III — T, — F 4) I — F, II — T, III — T, — F
124. Statement-I (S-I): Photorespiration does not occur in C4 plants
Statement-II (S-II): In C4 plants there is a mechanism that increases the 02 at
the enzyme site
3) S-I is correct but S-II is incorrect 4) S-I is incorrect but S-II is correct
125. Read the following statements and select the option with all correct statements:
A) In liver worts and mosses, the gametophytes are free living
B) Both Cycas and Marchantia are dioecious plants
C) In all seed bearing plants endosperm is post fertilization product
D) Sexual reproduction in Fucus and Volvox is Oogamous
1) A, C and D 2) A, B and D 3) B and D 4) C and D

List — I List – II
a) Pyrenoid 1) Golgi apparatus
b) central Hub 2) Chloroplast
c) Hydrolytic enzymes 3) Centriole
d) Cisternae with cis and trans faces 4) Lysosome
The correct match is:
1) a — 2, b — 3, c — 4, d — 1 2) a — 2, b — 1, c — 4, d — 3
3) a— 3, b — 2, c — 1, d— 4 4) a — 4, b — 3, c — 1, d — 2
127. Which of the following trait is expressed in only homozygous condition?
a) Yellow seed (cotyledon) colour b) Green pod colour
c) Inflated pod shape d) Terminal position of flower
e) Yellow pod colour
1) Only e 2) a, b and c 3) a,b,c and e 4) d and e
128. Find the incorrect match if 16 chromosomes are present in somatic cell of a plant
1) Zygote: 16 2) Perisperm: 8
3) Nucellus: 16 4) Generative cell in pollen: 8
129. Virus with RNA as genetic material is seen in all except
1) TMV 2) QB bacteriophage
3) HIV 4)  x174 bacteriophage
A. The LHC are made up of hundreds of pigment molecules bound to proteins
B. The single chlorophyll a molecule forms the reaction centre
1) Both A and B are correct 2) Only A is correct
3) Only B is correct 4) Both A and B are incorrect
131. Which one among the following is false?
1) Carrot and turnip store food materials in tap roots
2) Sweet potato and Asparagus stores food materials in adventitious roots
3) Ginger and turmeric stores food materials in underground tap roots
4) Pneumatophores in Rhizophora are negatively geotropic
132. Read the following steps involved in translation and arrange them in correct
sequence:
A) Chain elongation B) Initiation
C) Charging of tRNA D) Termination
E) Activation of amino acids F) Formation of peptide bond
1) B-E-A-C-D-F 2) E-C-A-F-B-D 3) B-E-F-C-A-D 4) E-C-B-F-A-D
133. If a mother cell of mitosis at G2 phase contains 14 chromosomes and 4C amount
of DNA, then each of its daughter cell will receive.
1) 14 chromosomes, 2C amount of DNA 2) 14 chromosomes, 4C amount of
DNA 3) 7 chromosomes, 2C amount of DNA 4) 28 chromosomes, 4C amount
of DNA
134. Which one among the following exemplify modified leaf?
1) Phylloclade of Opuntia 2) Thorns in Bougainvillia
3) Phyllode in Australian acacia 4) Both 1 & 2
135. Statement - I: Oxygen serves as the terminal electron acceptor during oxidative
phosphorylation
Statement - II: NADP+ is the terminal electron acceptor in non-cyclic
photophosphorylation
SECTION – B
136. Assertion (A): Number of bivalents are half to the chromosome number in a
species
Reason (R): Bivalent represents a pair of homologous chromosomes
2) Both A and R are true, but R is not the correct explanation of A
3) If A is true, but R is false 4) Both A and R are false

List — I List — II
(A) Polynucleotides (i) Rubber
(B) Polypeptides (ii) RNA
(C) Polysaccharides (iii) GLUT-4
(D) Polymeric substance (iv) Glycogen
The correct match is:
1) A — iii, B — I, C —iv, D — ii 2) A — ii, B — iii, C —iv, D — i
3) A — ii, B — i, C— iii, D — iv 4) A — iii, B — ii, C —iv, D — i
138. S-I: Transcriptional unit is DNA flanked on either side by promoter and
terminator S-II: Translational unit is mRNA flanked on either side by initiator
codon and terminator codon
139. Pericycle of roots is the site for origin of all except
1) Root hairs 2) Lateral roots 3) Vascular cambium 4) Both 1 & 2
140. Mobile electron carriers in ETS of mitochondrial membrane are
1) PQ, PC 2) UQ, Cyt C 3) PQ, Cyt C 4) PC, CoQ
141. The following events are/is not a part of 'Pollen Pistil interaction'
1) Germination of pollen grain 2) Growth of pollen tube through style
3) Entry of pollen tube into the ovule 4) Fertilisation
142. Which one of the following statements is incorrect w.r.t PCR?
1) It is based on principle of antigen-antibody interaction
2) In these multiple copies of gene of interest is synthesized in vitro
3) It uses two sets of primers. 4) It is also called as polymerase chain reaction.
143. Axillary bud is formed from
1) apical meristem of shoot 2) intercalary meristem
3) vascular cambium 4) cork cambium
144. Wasteful oxygenation reaction occurs in
1) mesophyll cells of C3 plants 2) Bundle sheath cells of C4 plants
3) Mesophyll cells of C4 plants 4) Bundle sheath cells of C3 plants
145. Which of the following reactions are catalysed in a template independent
manner?
1) Synthesis of mRNA by polynucleotide phosphorylase
2) 3'- tailing (poly adenylation) in hnRNA processing
3) Ligation of DNA fragments by DNA ligase
4) All of these
146. Which one among the following is NOT true?
1) Cassia - Zygomorphic flowers and imbricate activation
2) China rose - Actinomorphic flowers and twisted aestivation
3) Calotropis - Opposite phyllotaxy and valvate aestivation
4) Guava Alternate phyllotaxy and half inferior ovary
147. Find the correct statement among the following:
1) Microbodies are found only in plant cells
2) Nucleolus is membrane bounded and involved in rRNAsysnthesis
3) Centrosome holds two chromatids of a chromosome together during metaphase
4) Both mitochondria and chloroplast have protein biosynthetic mechanisms due
to the presence of DNA, RNA and 70 `S' ribosomes
A. Griffith 1. Codon is triplet
B. Gamow 2. Double helical DNA
C. Watson and Crick 3. Induced mutation
D. Meselson and Stahl 4. Semiconservative replication of DNA
5. Phenomena of transformation
1) A-5, B-1, C-2, D-4 2) A-1, B-5, C-4, D-2
3) A-1, B-2, C-3, D-4 4) A-5, B-1, C-4, D-2
149. Which biochemical is synthesized in cytoplasm and transported into nucleus for
its activity?
1) DNA 2) t RNA 3) Protein 4) hn RNA

150. The phenotype of an individual may be affected if the modified allele produces
(a) No enzyme at all
(b) The normal/less efficient enzyme
(c) A non-functional enzyme
1) Only (a) is correct 2) (a) and (c) are correct
3) (b) and (c) are correct 4) Only (c) is correct
ZOOLOGY
SECTION – A
151. Which of the following may accentuate the variations that lead to appearance of
new species resulting in evolution?
1) Genetic drift 2) Habitat fragmentation 3) Continental drift 4) Both 1 & 2
152. The study of history of life forms on earth is called
1) Palaentology 2) Microbiology 3) Molecular biology 4) Evolutionary biology
153. Saltation is concept of
1) Darwin 2) Lamarck 3) Hugo de Vries 4) Morgan
154. Which of the following is an occupational respiratory disorder?
1) Anthracis 2) Silicosis 3) Botulism 4) Emphysema
155. Tidal volume and Expiratory Reserve volume of an individual is 500 mL and
1000mL respectively. What will be his expiratory capacity if the residual volume
is 1200 mL?
1) 2700 mL 2) 1500 mL 3) 1700 mL 4) 2200 mL
156. Match column-I with column-II.
Column-I Column-II
a) Nile perch in lake Victoria (i) Direct economic benefits from nature
b) Narrowly utilitarian (ii) Habitat fragmentation
c) Main cause for loss of biodiversity (iii) High endemism
d) Hot spots (iv) Alien species
1) a-ii, b-i, c-iv, d-iii 2) a-iv, b-i, c-ii, d-iii
3) a-i, b-iii, c-ii, d-iv 4) a-ii, b-i, c-iii, d-iv
157. Which of the following statements is wrong regarding Medical Termination of
Pregnancy (MTP)?
1) Nearly 45 to 50 millions MTP’s are performed in a year all over the world.
2) Indian Government legalized MTP in 1951.
3) MTPs are considered to be relatively safe during the first trimester.
4) It needs the assistance of qualified medical practitioners.
158. In male cockroach the brood pouch has
1) Dorsal anus, ventral genital pore and gonapophysis
2) Ventral anus, dorsal genital pore and gonapophysis
3) Dorsal anus, ventral genital pore but no gonapophysis
4) Dorsal anus, ventral genital pore, colleterial glands
159. Which of the following is correct about cockroach?
1) Sexual dimorphism is observed
2) The anal styles are present on 10th sternite of female only
3) In both sexes the 9th segment bears a pair of jointed filamentous structures
called anal cerci
4) Both 2 and 3
160. Which of the following is false about the nervous system of frog?
1) Forebrain includes paired olfactory lobes, paired cerebral hemispheres and
paired diencephalon
2) Midbrain comprises paired optic lobes
3) Hindbrain comprises cerebellum and medulla oblongata
4) There are 10 pairs of cranial nerves

161. Assertion : The resting membrane potential is due to negatively charged proteins
present in axoplasm.
Reason : To maintain the unequal distribution of Na  and K  , the neurons use
electrical energy.
the assertion
162. Observe the following figure and identify correct label for A and B.
1) Site-A polarized state, Site-B depolarized stae

2) Site-A depolarized state, Site-B polarized state
3) Site-A polarized state, Site-B repolarized state
4) Site-A repolarized state, Site-B depolarized state
163. Malfunctioning of Kidney can lead to _____
1) Accumulation of urea in kidneys 2) Accumulation of ammonia in blood
3) Accumulation in urea in blood 4) Formation of soluble mass of oxalates
164. How many of the following processes are involved in urine formation.
a) Glomerular filtration b) Tubular reabsorption
c) Tubular secretion d) Micturition
1) a & b 2) b & c 3) a, b & c 4) a, b, c & d
165. Which of the following one acts as a check on renin- angiotensin mechanism?
1) Aldosterone mechanism 2) ADH mechanism
3) Glucagon 4) ANF mechanism
166. Number of heart chambers present in fish, amphibians, reptiles, birds and
mammals respectively is
1) 2, 3, 4, 4, 4 2) 2, 2, 3, 4, 4
3) 2, 3, 3, 3, 4 4) 2, 3, 3, 4, 4
167. Which statement is incorrect about Plasma?
1) Straw-coloured and slightly alkaline
2) It constitutes about 45% of the blood
3) 6-8% of proteins are present in plasma
4) Major component of plasma is water
168. Cardiac output is
1) The product of heart rate and stroke volume
2) Th+e blood pumped in one hour
3) The blood pumped during one cardiac cycle
4) The sum of heart rate and stroke volume
169. What is shown in the figure?
1) Opium 2) Datura 3) Cannabis 4) Tobacco

170. The appearance of dry scaly lesions on body such as skin, nails and scalp is
caused by
1) Phylum - Microsporum
2) Genera - Epidermophyton
3) Class - Trichophyton
4) All the above
171. Asthma may be attributed to
1) Bacterial infection in the lungs
2) Histamine released from mast cells
3) Seretonin released from macrophages
4) Histamine released from lymphocytes
172. a) Maintenance of personal hygiene b) Consumption of clean drinking water
c) Proper disposal of waste d) Cleaning pools, cesspools and tanks
The above measures are related to
1) To eradicate cancer 2) To prevent congenital diseases
3) To prevent cholesterol accumulation in heart and liver
4) To prevent infectious diseases.
173. M.S. Swaminathan initiated collaboration with ________ which culminated in the
“Green revolution”
1) Norman Borlaug 2) Watson and crick
3) Ramdeo misra 4) Alphonso corti
174. Assertion: Sex determination in honey bee is called Haplodiploidy system.
Reason: The number of chromosomes in male honey bee is 32 and in female
honey bee is 16.
assertion.
175. Malignant malaria caused by _____ is the most serious one and can even be fatal.
1) Streptococcus pneumonia 2) Trichophyton
3) Plasmodium falciparum 4) Plasmodium malariae
176. _________ drugs will quickly reduce the symptoms of allergy.
1) Anti-retro viral 2) Narcotic analgesics
3) Antibiotics 4) Anti-histamine
177. Choose the incorrect option about pregnancy.
1) By the end of the second month of pregnancy, the foetus develops limbs and
digits
2) The first movements of the foetus usually observed during the fifth month
3) By the end of second trimester, the body of foetus is covered with fine hair
4) After the one week of pregnancy, the embryo’s major organ systems are formed
178. Statement I : Net primary productivity is generally lesser than gross primary
productivity.
Statement II : Plants use some amount of GPP during respiration
2) Statement I is incorrect, and statement II is correct
3) Statement is correct, and statement II is incorrect
179. How many base pairs are found in the genome of human cell?
1) 3 106 2) 3 103 3) 3 109 4) 3 102
180. Which of the following pairs are incorrectly matched?
Animals Morphological feature
A) Crocodile 4-chambered heart
B) Sea urchin Parapodia
C) Obelia Metagenesis
D) Cannis Thecodont
1) A only 2) A,C and D only 3) Only A and C 4) B only
181. Identify the incorrect match
1) Limbless amphibian - Icthyophis 2) Jawless vertebrate – Myxine
3) Fish with electric organs – Trygon 4) Poisonous snake – Vipera

182. The Pyramid of energy always shows ___ in energy at higher than lower trophic
levels.
1) increase 2) decrease 3) no change 4) either increase or decrease
183. Statement – I: Islets of Langerhans represent only 2-3% of pancreatic tissue.
Statement – II: There are about 1-2 million Islets in normal human pancreas.
1) Both S – I & S – II are true 2) Both S – I & S – II are false
3) S – I is true , S – II is false 4) S – I is false , S – II is true
184. Choose the incorrect statement from the following with respect to colour
blindness.
(i) It is due to defective red cone of the eye only.
(ii) The defect is due to mutation of certain genes located on Y chromosomes.
(iii) It is an autosomal recessive disorder.
(iv) In this disorder, there is a failure in discrimination between red and green
colour.
1) (iv) only 2) (ii), (iii) 3) (i), (ii) 4) (i), (ii), (iii)
185. The size of VNTR sequences vary in the range of:
1) 0.1 – 2 kb 2) 10 – 20 kb 3) 0.2 – 10 kb 4) 0.1 – 20 kb
SECTION – B
(i) In polygenic inheritance, the number of dominant or recessive allele in a
genotype determines the skin colour.
(ii) A single gene which exhibits multiple genotypic expression is called pleiotropic
gene
(iii) In human males and females, 21 pair of chromosomes are exactly same.
(iv) Inheritable mutations are studied by generating pedigree of a family
1) ii, iii 2) ii,iii, iv 3) i,ii,iii 4) iii,iv
A) Amoebiasis P) Bacteria
B) Typhoid Q) Protozoa
C) Plague R) Fungi
D) Common Cold S) Virus
E) Ringworm
1) A-P, B-Q, C-R, D-S, E-P 2) A-Q, B-P, C-P, D-S, E-R
3) A-R, B-P, C-P, D-Q, E-S 4) A-P, B-S, C-Q, D-R, E-R
188. Assertion (A): ANF is a peptide hormone secreted by ventricular walls of Heart
Reason (R): ANF is secreted in response to high blood pressure causing dilation of
blood vessels thereby reducing the blood pressure.
1) Both A & R are true, and R is correct explanation of A
2) Both A & R are true, and R is not correct explanation of A
189. X-linked recessive disorders are passed from mothers to their sons and from
fathers to their daughters. If a male expresses a X-linked recessive disorder, the
which of the following is true for his parents?
I. His mother is a carrier
II. His father expresses the same disorder
III. His mother does not express the disorder
1) I only 2) II only 3) I, II, III 4) I and III only
190. Match column I with Column II and select the correct option from the codes given
below.
(A) Chrodate without vertebral column (I) Ostrich
(B) Vertebrate without jaws (II) Ascidia
(C) Fish without operculum (III) Hag fish
(D) Reptile without limbs (IV) Naja
(E) Bird without flight (V) Scoliodon
(A) (B) (C) (D) (E) (A) (B) (C) (D) (E)
1) II III IV V I 2) III II V IV I
3) II III V IV I 4) II V III IV IV

correct statements:
A) Pyramids of energy can never be inverted, because when energy flows from a
particular trophic level to the next trophic level, some energy is always lost as
heat at each step
B) In all ecosystems, the pyramids of number and biomass are upright
C) The Pyramid of biomass of the sea is generally inverted because the biomass of
fish far exceeds that of phytoplankton
1) Only A 2) A and B only 3) A and C only 4) All A,B and c
1) Mammary glands differentiate during pregnancy and secrete milk towards the
end of pregnancy
2) The zygote undergoes repeated meiotic division to form a blastocyst
3) The mammary glands are one of the female secondary sexual characteristics
4) Ovarian follicles in different stages of development are embedded in the stroma
of ovary
193. What are the causes of higher population growth?
I) Rapid decline in death rate.
II) Rapid increase in MMR and IMR.
III) Repid decline in MMR and IMR.
IV) Increase in number of people in the reproducible age
V) Rapid increase in the death rate.
1) All of the above 2) I, II, IV 3) I, III, IV 4) III, IV, V
194. The broadly utilitarian arguments for conserving biodiversity are
1) Philosophical and spiritual
2) The ecosystem services that the nature provides
3) The enormous benefits we can reap through bioprospecting
4) The countless direct benefits humans derive from nature
195. Which animal is correctly matched with its particular taxonomic category.
1) Housefly – Musca, order 2) Humans – primate, family
3) Cuttlefish – mollusca, class 4) Tiger – tigris, species
1) A stable community should show much variation in productivity from year to
year
2) Species diversity increases as we move from the poles towards the equator
3) The historic convention on biological diversity was held in 1992
4) Off-site conservation is the desirable approach for endangered or threatened
species
197. Match the items given in column I with those in column II and select the correct
option given below
Column I Column II
A) Tidal Volume i) 2500 – 3000 mL
B) Inspiratory reserve volume ii) 1100 – 1200 mL
C) Expiratory reserve volume iii) 500 – 550 mL
D) Residual volume iv) 1000 – 1100 mL
(A) (B) (C) (D) (A) (B) (C) (D)
1) (iii) (ii) (i) (iv) 2) (iii) (i) (iv) (ii)
3) (i) (iv) (ii) (iii) 4) (iv) (iii) (ii) (i)
198. Find the mismatch related to convergent evolution.
A) Lemur = Numbat B) Bobcat = Tasmanian tigercat
C) Sugar glider = Flying phalanger D) Mouse = Bandicoot
1) A, B only 2) A, C only 3) B, C, D only 4) A, C, D only
199. First clinical gene therapy was conducted in
1) 1983 2) 1997 3) 1890 4) 1990
200. Transgenic models exist for how many human diseases given in the box below?
Cancer, Cystic fibrosis, Rheumatoid arthritis, Aizheimer’s
*******

: ANSWER KEY:
SET-1 SUB: PHYSICS
1 2 11 1 21 2 31 2 41 add
2 4 12 3 22 2 32 1 42 2
3 3 13 2 23 2 33 2 43 4
4 3 14 4 24 4 34 4 44 1
5 1 15 2 25 2 35 3 45 4
6 2 16 3 26 1 36 1 46 2
7 3 17 3 27 4 37 3 47 2
8 1 18 3 28 1 38 4 48 1
9 3 19 2 29 1 39 1 49 2
10 3 20 1 30 2 40 1 50 3
SUB:CHEMISTRY
51 4 61 4 71 4 81 2 91 4
52 2 62 4 72 1 82 4 92 2
53 2 63 3 73 1,4 83 2 93 2
54 4 64 2 74 3 84 add 94 4
55 2 65 3 75 2 85 1 95 3
56 3 66 4 76 3 86 1 96 1
57 1 67 4 77 1 87 2 97 3
58 3 68 3 78 2 88 3 98 4
59 4 69 2 79 2 89 4 99 1
60 1 70 1 80 2 90 2 100 2
SUB : BOTANY
101 3 111 1 121 2 131 3 141 4
102 1 112 4 122 4 132 4 142 1
103 3 113 2 123 1 133 1 143 1
104 2 114 3 124 3 134 3 144 1
105 1 115 3 125 2 135 1 145 4
106 4 116 3 126 1 136 1 146 4
107 1 117 3 127 4 137 2 147 4
108 3 118 3 128 2 138 3 148 1
109 4 119 3 129 4 139 1 149 3
110 2 120 3 130 1 140 2 150 2
151 4 161 3 171 2 181 3 191 3
152 4 162 2 172 4 182 2 192 2
153 3 163 3 173 1 183 4 193 3
154 2 164 3 174 3 184 4 194 2
155 2 165 4 175 3 185 4 195 4
156 2 166 4 176 4 186 1 196 1
157 2 167 2 177 4 187 2 197 2
158 1 168 1 178 1 188 4 198 2
159 1 169 3 179 3 189 1,4 199 4
160 1 170 2 180 4 190 3 200 1

NEET GRAND TEST - 4
answer sheet.
CORRECT.
Section-B;
Marking Scheme :

PHYSICS
SECTION – A
az
  k
1. In the relation p e , p is the pressure, z the distance, k is Boltzmann

constant and  is the temperture, the dimensional formula of  will be
1)  M o L2T o  2)  ML2T  3)  MLoT 1  4)  ML2T 1 
2. Two identical masses of 5 kg each fall on a wheel from a height of 20 m. The wheel
disturbs a mass of 4 kg water, the rise in temperature of water will be:
1) 2.6oC 2) 0.48oC 3) 0.32oC 4) 0.12oC
6
3. The effective resistance is  , when two wires are joined in parallel. When one of
5
the wire breaks, the effective resistance is 2 ohms. The resistance of the broken
wire was :.
3 6
1)  2) 2 3)  4) 3
5 5
     
4.   
If for two vectors A and B , A  B is perpendicular to the A  B . The ratio of 
A
their magnitude is
B
1) 1 2) 2 3) 3 4) None of these
5. A spring balance is attached to the ceiling of a lift. A man hangs his bag on the
spring and the spring reads 49N, when the lift is stationary. If the lift moves
downward with an acceleration of 5m/s2, the reading of the spring balance will be
1) 49N 2) 24N 3) 74N 4) 15N
6. A machine gun fires a bullet of mass 40g with a velocity 1200m/s. The man
holding it can exert a maximum force of 144N on the gun. How many bullets can
be fired per second at the most?
1) Only one 2) Three 3) Can fire any number of bullets 4) 144 ×48
7. A long straight rod with a charge of  per unit length passes through an
imaginary cube of edge a. The maximum flux of the electric field through the cube
will be
a a 6 a 2 3 a
1) 2) 3) 4)
0 0 0 0
8. An uniformly charged solid non-conducting sphere of radius R having total
charge q rotates about its diametric axis with constant angular speed . The
magnetic moment of the sphere is
1 2 1 2
1) qR 2 2) qR 2 3) qR 2 4) qR 2
3 3 5 5
9. The current voltage graph for a given metallic conductor at two different
temperatures T1 and T2 are as shown in the figure. Then :
1) T1 > T2 2) T1 = T2
3) nothing can be said about T1 and T2 4) T1 < T2
 t 
10. y  2  cm  sin     what is the maximum acceleration of the particle doing the
2 
S.H.M.
 2 2 
1) cm/s2 2) cm/s 2 3) cm/s 2 4) cm/s2
2 2 4 4
11. Taking into account of the significant figures, what is the value of
3.33 kg – 0.033 kg?
1) 3.267 kg 2) 3.29 kg 3) 3.30 kg 4) 3.3 kg

12. A metal rod moves at a constant velocity in a direction perpendicular to its
length. A constant uniform magnetic field exists in space in a direction
perpendicular to the rod as well as its velocity. Select the correct statement(s)
from the following
1) The entire rod is at the same electric potential
2) There is an electric field in the rod
3) The electric potential is highest at the centre of the rod and decreases towards
its ends
4) The electric potential is lowest at the centre of the rod and increases towards
its ends
13. A monoatomic gas at a pressure p, having a volume V expands isothermally to a
volume 2V and then adiabatically to a volume 16V. The final pressure of the gas
 5
is  take  = 
 3
p
1) 64p 2) 32p 3) 4) 16p
64
14. An electric charge 103 C is placed at the origin (0, 0) of X-Y coordinate system.
Two points A and B are situated at  
2, 2 and (2, 0) respectively. The potential
difference between the points A and B will be
1) 9V 2) Zero 3) 2V 40 4.5V
15. If the degree of freedom of a gas are f, then the ratio of two specific heats Cp/Cv is
given by
2 2 1 1
1) 1 2) 1  3) 1  4) 1 
f f f f
16. When a transparent sheet of thickness t and refractive index  is introduced in
one of the paths in YDSE having slit width d and distance between slit and
screen is D, then the fringe pattern shifts by
d d D dt
1)    1 t 2) 3)    1 t 4)
D D    1 t d    1 D
17. To increase the resonant frequency in series LCR circuit.
1) Source frequency should be increased
2) Another resistance should be added in series with the first resistance.
3) Another capacitor should be added in series with the first capacitor.
4) The source frequency should be decreased
18. A body of mass m = 10kg is attached to one end of a wire of length 0.3m. The
maximum angular speed  in rad s 1  with which it can be rotated about its other
end (Breaking stress of wire  4.8  107 Nm 2 and area of cross-section of the
wire  10 2 cm 2 )
1) 4 2) 1 3) 8 4) 2
19. A boat having a length of 12 metre and breadth 2 metre is floating on a lake. The
boat sinks by 0.3 cm when a man gets on it. The mass of the man is
1) 60 kg 2) 62 kg 3) 72 kg 4) 128 kg
20. The maximum velocity of an electron emitted by light of wavelength  incident on
the surface of a metal of work function  , is
1/2 1/2 1/2
 2(hc   )  2(hc   )  2(hc   )   2(h    ) 
1)  m  2) 3)  m  4)  
  m    m 
Where h = Planck's constant, m = mass of electron and c = speed of light.
21. Startng from the centre of the earth having radius R, the variation of g
(Acceleration due to gravity ) is shown by

22. At what height from the surface of earth the gravitation potential and the value of
g are 5.4 107 Jkg 1 and 6ms-2 respectively. Take the radius of earth as 6400km.
1) 1400km 2) 2000km 3) 2600km 4) 1600km
23. An open pipe is suddenly closed at one end with the result that the frequency of
thid harmonic of the closed pipe is found to be higher by 100 Hz than the
fundamental frequency of the open pipe. The fundamental frequency of the open
pipe is :
1) 200 Hz 2) 300 Hz 3) 240 Hz 4) 480 Hz
24. The total energy of an electron in an atom in orbit is -3.4 eV. Its kinetic and
potential energies are, respectively
1) -3.4 eV, -3.4 eV 2) -3.4 eV, -6.8 eV
3) 3.4 eV, -6.8 eV 4) 3.4 eV, 3.4 Ev
25. Identify the following circuit elements
(I) Resistor P)
(II) Capacitor Q)
(III) Diode R)
(IV) LED S)

1) Q S P R 2) S P R Q
3) P Q R S 4) S R Q P
26. A coil of area 80 square cm and 50 turns is rotating with 2000 revolutions per
minute about an axis perpendicular to a magnetic field of 0.05 Tesla. The
maximum value of the e.m.f. developed in it is
10 4 2
1) 200 volt 2) volt 3) volt 4) volt
3 3 3
27. An object is placed in front of a convex mirror at a distance 25cm. A plane mirror
is introduced covering the lower half of the convex mirror. If the distance between
the object and the plane mirror 20cm, it is found that there is no parallax
between the images formed by the two mirrors. What is the radius of curvature of
convex mirror.
1) 37.5 cm 2) 75 cm 3) 50 cm 4) 100 cm
28. Two short magnets of magnetic moment 1000 Am2 are placed as shown at the
corners of a square of side 10cm. The net magnetic induction at P is
1) 0.1T 2) 0.2T 3) 0.3T 4) 0.4

 
29. Two light waves given below superimpose at a point y1  a sin 2 t , y2  2a sin  2 t  
 3
The resultant amplitude of the wave is
1) a 6 2) a 5 3) a 3 4) a 7
30. A polyatomic gas with n degrees of freedom has a mean translational kinetic
energy per molecule given by
1) nkT/NA 2) nkT/2NA 3) nkT/2 4) 3kT/2
31. A square surface of side L metres is in the plane of the paper. A uniform electric
field E(volt/m), also in the plane of the paper, is limited only to the lower half of
the square surface, (See figure). The electric flux in SI units associated with the
surface is
1) Zero 2) EL2 3) EL2 /  2 0  4) EL2 / 2

32. A machine gun fires 360 bullets per minute, with a velocity of 600 ms1 . If the
average power of the gun is 5.4 kW, then mass of each bullet is
1) 5 kg 2) 0.5 kg 3) 5 g 4) 0.5 g
33. An infinite number of electric charges each equal to 2 nano coulombs in
magnitude are placed along x-axis at x = 1cm, x = 3cm, x = 9cm, x = 27cm….and
so on. In this setup if the consecutive charges have opposite sign, then the
electric potential at x = 0 is
1) 1250V 2) 1350V 3) 2700V 4) 2500V
34. A thermodynamic system undergoes cyclic process ABCDA as shown in figure.
The work done by the system in the cycle is
p0V0
1) p0V0 2) 2p0V0 3) 4) Zero
2
35. The equation of SHM of a particle is a  4 2 x  0 where a is instantaneous linear
acceleration at displacement x. The frequency of motion is
1
1) 1 Hz 2) 4 Hz 3) Hz 4) 4Hz
4
SECTION – B
36. A body is projected at an angle  with the horizontal. Another body is projected
with the same velocity at an angle  with the vertical. The ratio of the times of
flights is
1) 1 : 1 2) tan2  :1 3) 1 : cot  4) 1: tan 2 
37. A galvanometer has resistance G and current Ig produces full scale deflection. S1
is the value of the shunt which converts it into an ammeter of range 0 – I and S2
is the value of shunt for the range 0 – 2I. The ratio of S1 and S2 is
1  I  Ig  2I  I g
1)   2) 3) 1/2 4) 2
2  2 I  ig  I  ig
38. A massive ball moving with speed v0 collides head-on with a tiny ball at rest
having a mas very less than the mass of the first ball. If the collision is elastic,
then immediately after the impact, the second ball will move with a speed
approximately equal to:
v
1) v0 2) 0 3) 2v0 4) 
2

39. A paramagnetic sample shows a net magnetization of 8 Am 1 , when a placed in an
external magnetic field of 0.6T at a temperature of 4K. When the same sample is
palced in an extneral magnetic field of 0.2T at a temperature of 16K, the
magnetisation will be
32 2
1) Am 1 2) Am 1 3) 6 Am 1 4) 2.4 Am 1
3 3
40. When a convex lens   1.5 is immersed in water of    1.33 then effective focal

length of the lens
1) Increases 2) Decreases
3) Remains unchanged 4) Becomes doubled
41. A sphere rolls down on an inclined plane of inclination . What is the
acceleration of the sphere while it reaches bottom:
5 3 2 2
1) g sin  2) g sin  3) g sin  4) g sin 
7 5 7 5
42. Star S1 emits maximum radiation of wavelength 540 nm and the Star S2 emits
maximum radiation of wavelength 720 nm, what is the ratio of the temperature of
S1 and S2.
1 1
 4 4  3 2
1) 4 / 3 2)   3) 3/4 4)  
3 4
43. The rms value of conduction current in a parallel plate capacitor is 6.9  A . The
capacity of this capacitor, if it is connected to 230 V ac supply with an angular
frequency of 600 rad/s, will be:
1) 5 pF 2) 50 pF 3) 100 pF 4) 200 pF
44. In an experiment to determine the Young’s modulus, steel wires of five diffent
lengths (1, 2, 3, 4 and 5m) but of same cross section (2 mm2) were taken and
curves between extension/load) of the curves were plotted with the wire length
and the following graph is obtained. If the Young’s modulus of given steel wires
is x  1011 Nm 2 , then the value of x is ________
1) 0.2 2) 2 3) 0 4) 2.2
45. The fraction of a floating object volume V0 and density d0 above the surface of a
liquid of density d will be:
d0 dd0 d  d0 dd0
1) 2) 3) 4)
d d  d0 d d  d0
46. In a photoemissive cell with exciting wavelength  , the fastest electron has speed
v. If the exciting wavelength is changed to 3  / 4 , the speed of the fastest emitted
electron will be
1) v (3 / 4 )1 / 2 2) v (4 / 3)1 / 2 3) Less than v (4 / 3)1 / 2 4) Greater than v (4 / 3)1 / 2
47. Whenever a hydrogen atom emits a photon in the Balmer series:
1) It must emit another photon in the Lyman series
2) It may emit another photon in the Balmer series
3) It need not emit any more photon
4) It may emit another photon in the Paschen series

48. Two open organ pipes of different length and different gases at same temperature
as shown in figure. Let fC and fD be their fundamental frequencies, then
fC f 33 f 11 f 57
1)  2 2) C  3) C  4) C 
fD fD 80 fD 28 fD 160
49. A sinusoidal voltage of rms value 220V is applied to a diode and a resistor R in
the circuit shown in figure, so that half wave rectification occurs. It the diode is
ideal, what is the rms voltage across R1?
1) 55 2V 2) 110V 3) 110 2V 4) 220 2V

50. A ring of mass m and a particle of mass 2m are placed as shown in figure. If the
centre of mass of the combination lies at origin, the value of x is:
2R R
1) 2)
 
R 2R
3) 4)
2 3
CHEMISTRY
SECTION – A
51. At a given temperature, the vapour pressure of pure benzene is 0.85 bar. 0.5g of
non-volatile non-electrolyte solid is dissolved in 39g of benzene where vapour
pressure of the solution is found as 0.845 bar. Then the molar mass of given
solid is ______g/mol.
1) 169 2) 180 3) 156 4) 176
52. 90g of glucose, C6H12O6, is dissolved in 1kg of water. At what temperature will
water boil at 1.013 bar?
[Kb for water  0.52 K.mol1.kg and BP of H2O = 373.15K]
1) 373.202K 2) 373.26K 3) 373.41K 4) 373.67K
53. IUPAC name of the given compound is K 3  Cr  C2O4  3 
1) Potassium trioxalatochromium(III) 2) Potassium trioxalatochromate(III)
3) Potasium trioxalatochromate(IV) 4) Potassium trioxalatochromium(IV)
54. With an increase in the atomic number of lanthanides, the size of their atoms
decrease gradually except.
1) Yb, Tm 2) Sm, Eu 3) Ce, Nd 4) Eu, Yb
55. Which one of the following is the correct order of the size of iodine species?
1) I  I   I  2) I  I   I  3) I   I   I 4) I   I  I 
CH 3CH 2CHCH 3
56. IUPAC name of the compound | is
SH
1) 2 – thiobutane 2) 3 – thiobutanol
3) 2 – butanethiol 4) 1 – methyl – 1 - thiopropane
57. Number of waves made by the electron revolving in an orbit of hydrogen atom for
which an angular momentum is 2h /  is _____
1) 2 2) 4 3) 6 4) 1

58. When more number of electrons from excited hydrogen atoms reach the ground
state, then
1) The number of spectral lines in Lyman series increases
2) Frequency of the spectral lines increases
3) Wave length of the spectral lines increases
4) Energy of the spectral lines decreases
59. Match the following columns:
Column-I Column-II
1) Conformations A) Polarimeter
2) Meso form B) Optically inactive
3) Specific rotation C) Eclipsed and staggered forms
4) Non-superimposable D) Enantiomers
mirror images
Codes :
1 2 3 4 1 2 3 4
1) A D B C 2) D A C B
3) B C D A 4) C B A D
60. An organic compound taken in a test tube and acetyl chloride is added to it.
White fumes appeared when a glass rod dipped in NH3 is placed at the mouth of
test tube. This indicates that organic compound may contain _____ group
1) –Cl 2) -CHO 3) –OH 4) double bond
61. Which statement is correct?
1) Fe3 ions give deep green precipitate with K4Fe(CN)6 soluiton
2) Carbonate salt on treating with dilute HCl gives a colourless gas which gives
yellow precipitate when passed through lime water.
3) Zinc salts give a violet coloured bead in borax bead test
4) From a mixed precipitate of AgCl and AgI ammonia solution dissolves only
AgCl
62. Which gives blood red colour with ammonium thio cyanate?
1) Fe3 2) Fe2 3) Cu2 4) Cd 2
63. The experimentally observed dipole moment of A B is 3.6 Debye. The distance
between two oppositely charged ions is 1A0. Then the percentage of ionic
character of the given ionic compound is
1) 50% 2) 62% 3) 75% 4) 90%
64. Match the column-I (molecule) with column-II (type of hybridisation) and choose
the correct option from the codes given below:
Column-I (Molecule) Column-II (Type of hybridisation)
A) SF6 p) sp d
3
B) PF5 q) sp3
C) BCl3 r) sp3d2
D) C2 H6 s) sp2
1) A-r, B-p, C-s, D-q 2) A-r, B-p, C-q, D-s
3) A-p, B-r, C-q, D-s 4) A-p, B-r, C-s, D-q
65. Match the columns :
Column-I (A.O) Column-II (A.B.M.O) Column-III (B.M.O)
A) 1s p) i)
B) 2pz q) ii)
C) 2px r) iii)
1) A-(q, iii), B-(r, i), C-(p, ii) 2) A-(q, iii), B-(p, ii), C-(r, i)
3) A-(p, iii), B-(q, ii), C-(r, i) 4) A-(p, ii), B-(q, iii), C-(r, i)

66. Which one of the following statement is not correct?
1) Phenols are more acidic than water.
2) There are some other organic acids which are more acidic than carboxylic
acids.
3) SIR (steric inhibition of resonance) always increases acidic nature of a
comound.
4) Equilibrium of an acid base reaction generally shifts towards the direction of
weaker acid and weaker base.
68. Which of the folloiwng pair of 13th group elements have highest boiling point &
lowest melting point?
1) B – Ga 2) B – Al 3) B – In 4) B – Tl
69. Which of the following can liberate H2 gas from steam?
1) Si 2) Ge 3) Pb 4) Sn
70. Monobromination of 2-methylbutane gives how many distinct isomers(only
structural) ?
71. 2-Bromopentane is heated with potassium ethoxide in ethanol. The major
product obtained is
1) trans-pent-2-ene 2) Pent-1-ene
3) 2-ethoxypentane 4) cis-pent-2-ene
72. Statement I: When butyne-2 is reacted with Na/liq NH3 then trans-2-butene is
formed.
Statement II: When butyne-2 is reacted with H2 – Pd / CaCO3, quinolone, cis-2-
butene is formed.
73. How much water should be added to 200 cc of semimolar solution of NaOH to
make it exactly decimolar:
(1) 200 cc (2) 400 cc (3) 800 cc (4) 600 cc
74. In a compound Carbon = 52.2%, Hydrogen = 13%, Oxygen = 34.8% are present
and vapour density of the compound is 46. Calculate molecular formula of the
compound ?
(1) C3H8O2 (2) C4H8O2 (3) C4H10O (4) C4H12O2
75. In the reaction the stoichiometry coefficients of Cr2O72  , NO2 and H+ respectively
are
Cr2O72   NO2  H   Cr 3  NO3  H 2O
1) 1, 3, 8 2) 1, 4, 8 3) 1, 3, 12 4) 1, 5, 12

76. The correct order of reactivity of following alcohols with halogen acids is
__________.
CH 3
CH 3CH 2  CH  OH |
(I) CH 3CH 2  CH 2  OH (II) | (III) CH 3CH 2  C  OH
CH 3 |
CH 3
1) (I) > (II) > (III) 2) (III) > (II) > (I) 3) (II) > (I) > (III) 4) (I) > (III) > (II)
77. Arrange the following compounds in increasing order of their boiling points.
CH 3
|
(I) (II) CH 3CH 2 CH 2 CH 2 Br (III) H 3C  C  CH 3
|
Br
1) (II) < (I) < (III) 2) (I) < (II) < (III) 3) (III) < (I) < (II) 4) (III) < (II) < (I)
78. Oxygen is more electronegative than sulphur, yet H 2 S is acidic while H 2O is
neutral. This is because
1) Water is a highly volatile compound
2) H – S bond is weaker than H – O bond
3) H 2 S is a gas while H 2O is a liquid
4) The molecular weight of H 2 S is more than that of H 2O
79. Which of the following reactions does not occur?
1) F2  2Cl   2 F   Cl2 2) Cl2  2 F   2Cl   F2
3) Br2  2 I   2 Br   I 2 4) Cl2  2 Br   2Cl   Br2
80. Assertion (A): Rate of reaction increases with increase in concentration of
reactants(Except for zero order).
Reason (R) : As the concentration of reactants increase, the number of effective
collisions increases.
81. 75% of a first order reaction completed in 36min. Then 93.75% of same reaction
completes in _____ minutes.
1) 108 2) 72 3) 144 4) 54
82. Identify Z in the sequence of reaction,
CH 3  CH 2  CH  CH 2  HBr
H 2 O2
 Y  
C2 H 5ONa
Z
1) (CH3)2CH2−O−CH2CH3 2) CH3(CH2)4−O−CH3
3) CH3CH2−CH(CH3)−O−CH2CH3 4) CH3−(CH2)3−O−CH2CH3
83. Identify Z in the following reaction sequence.
Br2  CCl4
CH 3CH 2CH 2OH  conc.H2 SO4
160 180o C
 X   Y 
NaNH 2
Z
1) CH3−CH(NH2)−CH2NH2 2) CH3−CH(OH)−CH2OH
3) CH3−C(OH)=CH2 4) CH3−C≡CH
84. The enthalpy of neutralization of oxalic acid by a strong base is 25.4 kcal mol1 .
The enthalpy of neutralization of strong acid and strong abse is 13.7 kcal mol1 .
The enthalpy of dissociation of oxalic acid is :
1) 1 kcal mol1 2) 2 kcal mol1 3) 18.55 kcal mol1 4) 11.7 kcal mol1
85. Which is an extensive property?
1) Viscosity 2) Temperature 3) Volume 4) Refractive index
ION – B
86. Transition metals are less reactive because of their
1) High ionization potential ad low melting point
2) Hihg ionization potential and high melting point
3) Low ionization potential and low melting point
4) Low ionization potential and high melting point

87. Four successive members of the first row transition elements are listed below
with their atomic numbers. Which one of them is expected to have the highest
third ionization enthalpy?
1) Vanadium (Z=23) 2) Chromium (Z=24)
3) Iron (Z=26) 4) Manganese (Z=25)
88. Alkali metal salts of carboxylic acids on electrolysis in aqueous medium forms
hydrocarbons having twice the number of C-atoms present in the alkyl gourp of
the acid. The reaction is known as
1) Kolbe electrolysis 2) Decarboxylation
3) HVZ-reaction 4) Friedel-Crafts reaction
89. Select the correct statement(s) for the following :
1) Nitriles are hydrolyzed to amides and then to acids in the presence of H  or
OH  as catalyst
2) Mild reaction conditions are used to stop the reaction at the amide stage
during the hydrolysis of nitriles
3) Grignard reagents react with dry ice to form salts of carboxylic acids which in
turn give corresponding carboxylic acids after acidification.
4) All of the above
90. 11.5 mg of an organic compound containing nitrogen was digested according to
Kjeldahl’s method and the evolved ammonia was absorbed in 20 mL of 0.1 M
HClsolution. The excess of the acid required 15mL of 0.1 M NaOH solution for
complete neutralization. The percentage of nitrogen in the compound is
1) 50.0 2) 60.8 3) 23.7 4) 47.4
91. The compound CoCl2(NO2).6H2O can show
1) Only linkage isomerism 2) Only hydrate isomerism
3) Only ionisation isomerism 4) Linkage, hydrate and ionization isomerism
92. Select the correct statement ragarding  NiCl4  ion
2
1) Paramagneteic in nature 2) sp3d hybridized

3) Square planar shape 4) Magnetic momet is 18 BM
93. 
At 298 K, the equilibrium constant for a reaction A g   B g   C g   D g  is 100. If
the initial concentration of each species is 1M, the equilibrium concentration of D
in molL1 is
1) 0.818 2) 1.909 3) 1.182 4) 0.182
94. What is the effect of a ten-fold increase in pressure on KP in the reaction at

equilibrium N 2 g   3H 2 g   2 NH 3 g  ?
1) A ten-fold increase 2) A ten-fold decrease
3) Kp does not change 4) Kp becomes equal to KC
95. In the equilibrium NH 4 HS s   NH 3 g   H s S g  .The forward reaction can be favoured
by
1) Adding some more NH4HS 2) Adding some more NH3
3) Removing some ammonia from the reaction mixture
4) Adding some more H2S
96. The correct order of basicity of the following compounds
1) B > A > C 2) A > B > C 3) C > A > B 4) C > B > A

97. The correct order of percentage of ortho, meta and para nitroaniline formed
during the direct nitration of aniline with nitration mixture is
1) o  m  p 2) p  m  o 3) p  o  m 4) m  p  o
A) Salt bridge is used in galvanic cell to prevent the accumulation of charges in
two half cells
B) In the preparation of salt bridge particularly KCl type electrolytes are used
because K+ and Cl- have same ionic mobility
C) Salt bridge increases the cell potential abnormally
1) All A,B and C are correct 2) Only A and B are correct

99. The heat of combustion of propane is -2220 KJ/mole. Considering 80% efficiency
of propane oxygen fuel cell, the cell potential of the cell is _______volt.
1) 1.84 2) 0.86 3) 0.92 4) 1.26
100. The correct statement about the following sugars A and B is
1) A is reducing sugar and B is non-reducing sugar

2) The glycosidic linkage in A is ' ' and in B is '  '
3) The glycosidic linkage in A and B are ' ' and ' ' respectively
4) Both A and B are non-reducing sugars.
BOTANY
SECTION – A
101. The following is incorrect about Mycoplasma
1) These are the smallest free living cells known
2) They completely lack cell wall
3) They survive only in the absence of oxygen
4) Many of these are pathogenic in plants and animals
102. The kingdom without the well defined boundaries is
1) Monera 2) Protista 3) Fungi 4) Animalia
(A) Algal protists (I) Slime moulds
(B) Fungal protists (II) Protozoans
(C) Intermediate protists (III) Chrysophytes
.
(D) Animal protists (IV) Euglenoids
(A) (B) (C) (D) (A) (B) (C) (D)
.
1) III II IV I 2) IV III I II
3) III I IV II 4) I III II IV
104. Benefits of mycorrhiza are represented by which of the following statements?
(i) Resistance to root-borne pathogens.
(ii) Tolerance to drought.
(iii) Tolerance to salinity and absorption of phosphorus.
(iv) Overall increase in the plant growth and development.
1) (i) and (ii) only 2) (ii) and (iii) only
3) (iii) and (iv) only 4) All of these
105. Treatment of waste water is done by the
1) Autotrophic microbes 2) Heterotrophic microbes
3) Chemoautotrophic microbes 4) All the above
106. Primary treatment of sewage waste involves.
1) Filtration only 2) Sedimentation only
3) Filtration and sedimentation 4) Biological treatment
107. Natural classification systems developed, which were based on the following
except.
1) Natural affinities among the organisms
2) Ultrastructure and anatomy, Embryology and phytochemistry features.
3) This classification systems gave equal weightage to vegetative and sexual
characteristics
4) Classification for flowering plants was given by George Bentham and Joseph
Dalton Hooker.

108. What is true about male and female gametophyte in plant kingdom?
1) In some liverworts and some pteridophytes they have independent free-living
existence
2) In gymnosperms and angiosperms they have no independent free-living
existence
3) In bryophytes, pterdophytes and angiosperms, they have free-living and
independent. They remain in sporangia which are retained on sporophytes
4) Both (1) and (2)
109. Study the following statements regarding the bryophytes.
I) Bryophytes include the various mosses and liverworts
II) Bryophytes are also called amphibians of the plant kingdom
III) They do not play important role in plant succession on bare rocks/soil.
IV) Bryophytes can live in soil but are dependent on water for sexual
reproduction.
3) I, II and III are correct 4) I, II, and IV are correct
110. EcoRI enzyme recognises the sequence GAATTC. A stretch of linear DNA with six
GAATTC sites, upon digestion with EcoRI, will give rise to
1) 8 fragments 2) 6 fragments
3) 7 fragments 4) 5 fragments
111. Genes A,B & C are linked. Genes A & B are more close than A & C
I. ‘A’ might be before B & C II. ‘B’ might be between A & C
III. ‘C’ might be between A & B
IV. More crosses cannot occur between A & C than A & B
Find the correct option for given information
1) I & II 2) II & III 3) III & IV 4) I, II, IV
112. Match the columns I and II, and choose the correct combination from the options
given
Column-I Column-II
(Structure) (Function)
(a) Contractile vacuoles i. Acid hydrolases
(b) Lysosomes ii. Transportation of molecules across it
(c) Centrioles iii. Excretion
(d) Plasma membrane iv. Basal body of cilia
1) a-iii, b-iv, c-i, d-ii 2) a-ii, b-i, c-iv, d-iii
3) a-i, b-ii, c-iii, d-iv 4) a-iii, b-i, c-iv, d-ii.
113. Statement-I: Bacterial cells are made competent by treating them with specific
concentration of a trivalent cation
Statement-II: This increases the efficiency with which DNA enters the fungi
through pores in its cell wall
p) PCR : DNA Primer and DNA polymerase
q) PBR322 : Plasmid and linear
r) Cloning vector : Amplification of gene
s) Competent host : Heat shock, at 50 C
1) p, q and s 2) p and r 3) q and s 4) q, r and s
115. Identify correct one w.r.t. stem.
1) Develops from radicle part of embryo
2) Bears nodes, internodes and buds
3) Does not perform the function of vegetative propagation
4) Is involved in the conduction of water only

116. Examine the figure given below and select the incorrect statement.
1) Seed coat is membranous and fused with pericarp

2) Embryo has shield-shaped cotyledon called scutellum
3) Aleurone layer is inner covering of endosperm and is proteinaceous
4) Plumule and radicle are enclosed in a sheath
117. Analyse statements w.r.t. below diagram.
S–I :Develops from multicarpellary ovary.

S–II :Ovules are present in multilocular ovary.
S-III : Ovules are borne on central axis without septa.
1) Both S-I and S-II are true 2) Both S-II and S-III are true
3) S-I false and S-III true 4) All S-I, S-II, S-III are false
118. Match column I and column II and select the correct option.
Column-I Column-II
a) A2+4 (i) Petunia
b) G1 (ii) Tulip
c) 
C A (iii) Mustard
 5 5
d) P(3+3) (iv) Trifolium

1)a-(ii), b-(iv), c-(i), d-(iii) 2) a-(iii), b-(iv), c-(i), d-(ii)
3) a-(ii), b-(i), c-(iv), d-(iii) 4) a-(iv), b-(iii), c-(i), d-(ii)
119. The unequivocal proof that DNA is the genetic material came from
the experiments of –
1) Hershey and Chase (1952) 2) Frederic Griffith (1928)
3) Watson and Crick 4) Meselson and Stahl (1958)
120. In a transcription unit promoter is located towards:-
1) 3' end of coding strand 2) 5' end of coding strand
3) 5' end of template strand 4) 3' end of sense strand
121. How many nucleotides including stop codons would be needed to
polymerise 99 amino acids from one molecule of m-RNA
1) 300 2) 100 3) 33 4) 297
122. The given figure represent one of the step in the process of
transcription in bacteria. Identify the step and label A, B & C marked
in the figure.
1) Initiation; A – DNA, B – RNA, C – Promoter

2) Termination; A – RNA, B – RNA polymerase, C – Rho factor
3) Elongation; A – RNA, B – RNA polymerase, C – Sigma factor
4) Elongation; A – DNA, B – DNA polymerase, C – RNA

123. Number of regulatory and structural genes present in Lac operon
respectively
1) 1 & 2 2) 1 & 3 3) 1 & 1 4) 2 & 1
124. Statement-I: RNA being unstable, mutate at a faster rate.
Statement-II: RNA can directly code for synthesis of proteins, hence can easily
express the characters.
125. In which of the following organs metaxylem was located outside & protoxylem
located inside
A. Root of maize B. Stem of sugar cane
C. Root of mustard D. Stem of sunflower
1) A & C 2) A & B 3) B & D 4) C & D
126. Assertion : The parenchymatous cells in roots which lie between the xylem and
phloem are called conjuctive tissue.
Reason : The cells arranged in multiple layers between epidermis and pericycle
are called cortex.
127. What is the characteristics of a vascular bundle of monocot stem?
1) Open and surrounded by a sclerenchymatous bundle sheath
2) Closed and not surrounded by bundle sheath
3) Closed and surrounded by bundle sheath
4) Open and not surrounded by a bundle sheath
128. Segregation of genes occur during which phase of cell division.
1) Prophase I 2) Anaphase I 3) Telophase I 4) Metaphase II
129. If 75% of the offsprings show dominant character, the parents are
1) Both heterozygous dominant 2) One dominant and one recessive
3) Both recessive 4) Both homozygous dominant
130. Howmany types of gametes can be produced from the AaBbCc type of F1 hybrid.
1) 6 2) 8 3) 16 4) 4
131. A test cross distinguishes between
1) Two homozygous forms
2) A homozygous dominant and a heterozygous dominant form
3) A homozygous recessive and a heterozygous form
4) Two heterozygous forms
132. Assertion (A): Gametes are pure for a particular trait.
Reason (R): Gametes contain many alleles of a gene.
133. Which of the following are correct for Mitochondria :-
(a) are easily visible under the microscope (without specifically stained)
(b) are typically sausage-shaped or cylindrical
(c) are double membrane bound structures
(d) have two aqueous compartments
1) a, d correct and b, c incorrect 2) a, b correct and c,d incorrect
3) a incorrect and b, c, d correct 4) a, d incorrect and b, c correct
134. Protein synthesis in an animal cell occurs
1) on ribosomes present in cytoplasm, on E.R as well as in mitochondria.
2) on ribosomes present in the nucleolus as well as in cytoplasm.
3) only on ribosomes attached to the nuclear envelope and endoplasmic
reticulum, not in mitochondria
4) only on the ribosomes present in cytosol.
135. Large, colourful, fragrant flowers with nectar are seen in
1) Wind pollinated plants 2) Insect pollinated plants
3) Water pollinated plants 4) Both 1 and 3

SECTION – B
136. In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo
sac sequentially are:
1) Synergids, antipodals and Polar nuclei
2) Synergids, Primary endosperm nucleus and zygote
3) Antipodals, synergids, and primary endosperm nucleus
4) Synergids, Zygote and Primary endosperm nucleus
137. In angiosperms the correct sequence of events in formation of female
gametophyte in the ovule is:
(A) 3 successive free nuclear divisions in functional megaspore.
(B) Degeneration of 3 megaspores.
(C) Meiotic division in megaspore mother cell.
(D) Six of eight nuclei are surrounded by cell wall
(E) Resulting structure is seven celled, eight nucleated embryosac.
1) (A), (B), (C), (D), (E) 2) (C), (E), (A), (D), (B)
3) (B), (C), (A), (D), (E) 4) (C), (B), (A), (D), (Ε)
138. In general the embryo sac in angiosperm consists of
1) One egg cell, two synergids, two antipodal cells, two Polar nuclei
2) One egg cell, two synergids, three antipodal cells, two Polar nuclei
3) One egg cell, two synergids, two antipodal cells, three Polar nuclei
4) One egg cell, three synergids, two antipodal cells, two Polar nuclei
139. Lipid comes under acid insoluble fraction during analysis of the chemical
composition of tissues why?
1) It has low molecular weight
2) It has high molecular weight
3) It is polymer
4) On grinding the biomembranes are broken into pieces and form insoluble
vesicles
140. Statement–I: Purines are dicyclic and heterocyclic rings structures.
Statement–II : Pyrimidines are monocyclic and heterocyclic ring structutres.
141. Increased vacuolation, cell enlargement, and new cell wall deposition are the
characteristics of
1) Meristematic phase 2) Maturation phase
3) Elongation phase 4) All of these
142. Which one of the following plants does not show plasticity?
1) Maize 2) Cotton 3) Coriander 4) Buttercup
143. The gaseous plant growth regulator is used in plants to :
1) promote root growth and root hair formation to increase the absorption surface
2) help overcome apical dominance
3) kill dicotyledonous weeds in the fields
4) speed up the malting process
(A) G1-phase (I) Replication of DNA
(B) S-phase (II) Quiescent stage
(C) G2-phase (III) Condensation of chromatin
(D) G0-phase (IV) Protein synthesis
(V) Interval between M-phase and DNA replication
1) A-III, B-V, C-I, D-II 2) A-V, B-IV, C-I, D-III
3) A-V, B-I, C-IV, D-II 4) A-V, B-II, C-III, D-IV

145. With respect to diplotene which of the following are incorrect?
a) formation of synaptonemal complex
b) oocytes of some invertebrates
c) oocytes of some vertebrates diplotene can last for months or years
d) x – shaped structure formation
e) Terminalisation of x-shaped structure
1) a,b,e only incorrect 2) c,e only incorrect
3) Except a,b,d all are incorrect 4) Except c,e all are incorrect
146. If there as 12 molecules of CO2 to be fixed in photosynthesis, then how many
turns of Calvin cycle and how many molecules of glucose will be synthesized
respectively?
1) 9 turns, 2 molecules 2) 12 turns, 1 molecule
3) 6 turns, 1 molecule 4) 12 turns, 2 molecules
147. Statement–I: In Blackman’s Law, if a chemical process is affected by more than
one factor, then its rate will be determined by the factor which is nearest to its
maximum value.
Statement–II : For photosynthesis, light is rarely a limiting factor in nature.
148. Mark the correct matched combination with respect to A,B and C
S.No (A) (B) (C)
Plant Number of carbon in Number of carbon in
primary CO2 primary CO2 fixation
acceptor product
1) C3 Plant 2 3
2) C4 Plant 6 4
3) C3 Plant 5 2
4) C4 Plant 3 4
149. Which of following is connecting link between glycolysis and Krebs’ cycle?
1) Pyruvic acid 2) Isocitric acid
3) Acetyl Co-A 4) Phosphoglyceric acid
150. Correct sequence of electron transport during E.T.S. of respiration.
1) cyt-a, a3,c2 2) cyt-b, c,a, a3 3) cyt-b, c, a3, a 4) cyt-c, b, a, a3
ZOOLOGY
SECTION – A
151. Which of the following may accentuate the variations that lead to appearance of
new species resulting in evolution?
1) Genetic drift 2) Habitat fragmentation
3) Continental drift 4) Both 1 & 2
152. ________, need for adventure, ____ and experimentation constitute common
causes, which motivate youngsters towards drug and alcohol use.
1) Addiction, dependence 2) Curiosity, Exctement
3) Peer pressure, Excel in academics 4) Fatigue, isolation
153. Saltation is the concept of
1) Darwin 2) Lamarck 3) Hugo de Vries 4) Morgan
154. Which of the four names are correctly written as per rules of binomial
nomenclature?
1) SOLANUM MELONGENA 2) Solanum melongena
3) Solanum Melongena 4) solanum melongena
155. Which of the following is not a subspecies of tiger?
1) Bali 2) Dodo 3) Javan 4) Caspian
156. Statement A : Greenland at 71 N has only 57 species of birds.
o
Statement B : Colombia located near the equator has nearly 1200 species of
bird.
1) Both statements A and B are correct 2) Both statements A and B are incorrect

157. In periodic abstinence method
1) Female has to take contraceptive pills periodically
2) Couple should avoid from coitus periodically
3) Couple should avoid from coitus for few months or years
4) Female do not ovulate for a few months.
158. In cockroach, the first pair of wings is known as
1) Terga 2) Sterna 3) Tegmina 4) All the above
159. An individual sarcomere consists of:
1) A stack of myosin fibres only 2) A stack of actin fibres only
3) Overlapping actin and troponin 4) Overlapping actin and myosin
160. Mesorchium in frog refers to
1) A duble of fold of peritoneum between kidney and testis
2) Internal tissue of kidney
3) Internal tissue of testis 4) Capsule of kidney
161. Statement – I : When neuron is resting, the axonal membrane is comparatively
more permeable to K+ ions.
Statement – II: K+ diffuses outside the axon membrane and restores the resting
potential of the membrane at the site of excitation.
162. Find the incorrect statement from the following :
1) The CNS include the brain and the spinal cord
2) The PNS comprises of all the nerves of the body associated with the ANS only
3) The nerve fibres of the PNS are of two types afferent fibres and efferent fibres
4) The afferent nerve fibers transmit impulses from organ to the CNS
163. Which of the following is called a detritivore?
1) An organism feeding on decaying organic matter
2) An organism feeding on a host organism
3) An organism degrading the detritus into simple inorganic substances
4) An organism that decompose the soil
164. Statement–I: Analysis of urine helps in clinical diagnosis of many metabolic
disorders.
Statement–II: Liver also helps in the elimination of excretory wastes.
165. Nearly all of the essential nutrients, 70-80% of electrolytes & H2O are reabsorbed
by PCT because _____
1) It is the next part of glomerular capsule
2) It is located in cortex of kidney.
3) PCT is lined by simple cuboidal brush border epithelium
4) It does not maintain the pH & ionic balance of the body fluids.
166. The circulation between heart and cardiac musculature is called
1) Coronary circulation 2) Systemic circulation
3) Portal circulation 4) Pulmonary circulation
167. Congestion of the lungs is one of the main symptoms in
1) Hypotension 2) Coronary artery disease
3) Angina 4) Heart failure

168. The figure given below shows a small part of human lung where exchange of
gases takes place. Select the option which represents labeled part (A, B, C or D)
correctly identified along with its function.
1) C: arterial capillary- passes oxygen to tissues

2) A: alveolar cavity- main site of exchange of respiratory gases
3) D: capillary wall- exchange of O2 and CO takes place here
4) B: red blood cells- transport of CO2 only
169. When ready-made antibodies are directly given to protect the body against foreign
agents, it is called __________
1) Auto-immunity 2) Active-immunity
3) Passive-immunity 4) Both 1 & 2
170. Identify the number of secondary lymphoid organs.
Peyer’s patches, Tonsils, Thymus, Thyroid, Spleen, Vermiform appendix, Bone
marrow.
1) 4 2) 3 3) 5 4) 2
171. The study of history of life forms on earth is called
1) Palaentology 2) Microbiology 3) Molecular biology 4) Evolutionary biology
172. Smoking is associated with increased incidence of cancers of _________
1) Uterus, heart, gut 2) Colorectal, blood, brain
3) Lung, urinary bladder, throat 4) Gut, breast, oral cavity
173. During spermatogenesis, reduction division occurs between the stages of
1) Spermatogonia and primary spermatocyte
2) Spermatid and sperms
3) Primary spermatocyte and secondary spermatocyte
4) Secondary spermatocyte and spermatid
174. Structural and functional unit between developing embryo (foetus) and maternal
body is
1) Placenta 2) Umbilical cord 3) Yolk sac 4) Amnion
175. Which the following are non-human model genome are sequenced,
A. Drosophila B. Caenorhabditis elegans
C. Plants (Rice and Arabidopsis) D. Yeast
E. Earth worm
1) A, B and E only 2) B, C and D only 3) A, C and D only 4) All except E
176. Incorrect statement related with second largest phylum is:
1) The mouth contains a file-like rasping organ for feeding, called radula
2) The space between the hump and the mantle is called the mantle cavity in
which feather like gills are present
3) Gills are also related with respiratory, excretory and reproductive functions.
4) Usually dioecious and oviparous with indirect development
177. Incorrect one related with chrodata characters
1) Double ventral solid nerve cord 2) Ventral heart
3) Notochord
4) Pharyngeal gill slits, in all stages of life
178. All of the following are true about birds except
1) Preen glands at the base of the tail
2) Alimentary canal has the crop and gizzard
3) Endoskeleton is fully ossified
4) Mostly oviparous and some are viviparous
179. Statement - I: Iodothyronines regulate menstrual cycle & CNS development.
Statement - II: Thyroxine & PTH act upon the renal tubules.

180. Which one of the following is not an inverted pyramid?
1) Pyramid of numbers on a big tree with many number of insects
2) Pyramid of biomass in aquatic ecosystem
3) Pyramid of energy in pond ecosystem 4) Pyramid of biomass in ocean
181. Application of DNA fingerprinting involves all of the following except
1) Phylogenetic studies (evolutionary) 2) Determining genetic diversity
3) Forensic analysis 4) Environmental remediation
182. Carrying capacity is
1) The capacity of an individual to produce young ones
2) Availability of resources in a given habitat to support a certain number of
individuals of population, beyond which no further growth is possible
3) The base of natural logarithms
4) Intrinsic rate of natural increase
183. Statement I: In a large number of insects, eggs bear an additional X
chromosome besides the autosomes.
Statement II: Some of the sperms of majority of the insects bear X chromosomes
while others don’t.
2) Both statement I and II are true
3) Both statement I and II are false
184. Given pedigree belongs to Myotonic dystrophy. Which of the following represents
the genotype of parents correctly?
1) Father is AA and mother is aa 2) Father is aa and mother is Aa

3) Mother is aa and father is Aa 4) None of the above
185. ___________is used for silencing a specific mRNA.
1) RNAi 2) DNA polymerase
3) Restriction enzyme 4) All of these
SECTION – B
186. Assertion (A): Pyramid of energy is most reliable representation of functional
relationship of any ecosystem.
Reason(R): Energy flow is always unidirectional without any energy loss.
1) Both (A) & (R) are true and the (R) is the correct explanation of the (A)
2) Both (A) & (R) are true but the (R) is not the correct explanation of the (A)
3) (A) is true but (R) is false 4) Both (A) and (R) are false
187. Select the incorrect combination of the disease and its symptoms;
1) Acromegaly – Severe facial disfigurement
2) Addison’s disease – loss of water, dehydration, protruded eye balls
3) Dwarfism – Stunted growth
4) Diabetes insipidus – loss of water and dehydration
188. During haemodialysis, the cleared blood is pumped back to the body through a
(an) ______ after _____ to it.
1) Artery, removing heparin 2) Vein, adding heparin
3) Vein, adding anti – heparin 4) Lymphatic vessel, adding anti heparin
a) Natural method of contraception is a traditional method to prevent pregnancy.
b) The basic principle of natural method of contraception is to avoid the chances
of ovum and sperms meeting.
1) a is true, b is false 2) a is false, b is true
3) Both a and b are true 4) Both a and b are false

190. Assertion: Faced with the conflict between development and conservation, many
nations find in-situ conservation is unrealistic and economically not feasible to
conserve all their biological wealth.
Reason: Pollinators include bees, bumblebees, birds and bats.
the assertion
191. Find the mismatch related to convergent evolution.
A) Lemur = Numbat B) Bobcat = Tasmanian tiger at
C) Sugar glider = Flying phalanger D) Mouse = Bandicoot
1) A, B only 2) A, C only 3) B, C, D only 4) A, C, D only
192. Assertion (A): Larynx is a cartilaginous box which helps in sound production.
Reason (R): Epiglottis (flap) covers the glottis during swallowing and prevents the
entry of food into the larynx.
3) (A) is true but (R) is false
193. If due to some injury the chordae tendinae of the tricuspid valve of the human
heart is partially non-functional, what will be the immediate effect?
1) The flow of blood into the aorta will be slowed down
2) The ‘pace maker’ will stop working
3) The blood will tend to flow back into the left atrium
4) The flow of blood into the pulmonary artery will be reduced
194. Reduction in pH of blood will
1) Decrease the affinity of haemoglobin with oxygen
2) Release bicarbonate ions by the liver
3) Reduce the rate of heartbeat
4) Reduce the blood supply to the brain.
195. The following are the features of a mendelian disorder.
I. The heterozygous female may transmit the disease to the sons.
II. Many of the members of pedigree of Queen Victoria showed the disorder
III. Blood clotting mechanism is affected in this disorder.
The given disorder is
1) Haemophilia 2) Sickle cell anemia 3) Colour blindness 4) Thalassemia
196. Silencing of mRNA molecule in order to control the production of a harmful
protein has been used in the protection of plants from
1) Beetles 2) Armyworm 3) Budworm 4) Nematodes
197. Which of the following statements are incorrect regarding Movements?
A. Protoplasmic streaming helps in movement of Amoeba.
B. Cilia helps for pushing the food through cytopharynx in Euglena.
C. Hydra which belong to phylum ctenophora use its tentacles for capturing prey.
D. In human, limbs are used for changes in body postures only.
1) B and C only 2) A, B and C only 3) B, C and D only 4) B and D only
198. In cockroach mouth consists of a labrum, a pair of mandibles, a pair of maxillae
and a labium. Labrum and labium act as
1) Upper and lower jaws, respectively 2) Lower and upper jaws, respectively
3) Upper jaw and lips, respectively 4) upper and lower lips, respectively

199. The figure given below is a diagrammatic representation of response of organisms
to abiotic factor. What do (a), (b) and (c) represent, respectively?
1) a-Regulator , b-Partial regulator, c-Conformer

2) a-Partial regulator, b-Regualtor, c-Conformer
3) a-Regulator, b-conformer c-Partial regulator
4) a-Conformer, b-Regulator, c-Partial regulator
200. The possible genotype of F1 progeny in a cross made between skin colour with
genotype AABBCC and aabbcc is
1) AABbCc with darkest skin colour 2) AaBbCC with lightest skin colour
3) AaBbCc with very dark skin colour 4) AaBbCc with intermediate skin colour
*******

: ANSWER KEY:
SET-1 SUB: PHYSICS
1 1 11 3 21 3 31 1 41 1
2 4 12 2 22 3 32 3 42 1
3 4 13 3 23 1 33 2 43 2
4 1 14 2 24 3 34 4 44 2
5 2 15 1 25 2 35 1 45 3
6 2 16 3 26 3 36 3 46 4
7 4 17 3 27 2 37 2 47 1
8 3 18 1 28 1 38 3 48 2
9 4 19 3 29 4 39 2 49 3
10 2 20 3 30 4 40 1 50 2
SUB:CHEMISTRY
51 1 61 4 71 1 81 2 91 4
52 3 62 1 72 3 82 4 92 1
53 2 63 3 73 3 83 4 93 2
54 4 64 1 74 4 84 2 94 3
55 4 65 2 75 1 85 3 95 3
56 3 66 3 76 2 86 2 96 3
57 1 67 3 77 3 87 4 97 2
58 1 68 1 78 2 88 1 98 2
59 4 69 4 79 2 89 4 99 3
60 3 70 4 80 1 90 2 100 2
SUB : BOTANY
101 3 111 1 121 1 131 2 141 3
102 2 112 4 122 2 132 3 142 1
103 3 113 3 123 2 133 3 143 1
104 4 114 2 124 4 134 1 144 3
105 2 115 2 125 3 135 2 145 1
106 3 116 3 126 2 136 4 146 4
107 3 117 1 127 3 137 4 147 4
108 4 118 2 128 2 138 2 148 4
109 4 119 1 129 1 139 4 149 3
110 3 120 2 130 2 140 2 150 2
151 4 161 1 171 4 181 4 191 2
152 2 162 2 172 3 182 2 192 2
153 3 163 1 173 3 183 2 193 4
154 2 164 1 174 1 184 2 194 1
155 2 165 2 175 4 185 1 195 1
156 2 166 1 176 3 186 3 196 4
157 2 167 4 177 1 187 2 197 3
158 3 168 2 178 4 188 3 198 4
159 4 169 3 179 1 189 3 199 4
160 1 170 1 180 3 190 2 200 4

NEET GRAND TEST - 5
answer sheet.
CORRECT.
Section-B;
Marking Scheme :

PHYSICS
SECTION – A
1. The acceleration due to gravity is measured on the surface of earth by using a
simple pendulum. If  and  are relative errors in the measurement of length and
time period respectively, then percentage error in the measurement of
acceleration due to gravity is
 1 
1)       100 2)   2  3)  2    100 4)   2   100
 2 
2. What is the de Broglie wavelength (in m) of the wave associated with an electron
that has been accelerated through a potential difference of 50.0 V? (nearly)
1) 2.7 × 10 2) 1.74 × 10 3) 3.6 × 10 4) 4.9 × 10
3. A large number of bullets are fired in all directions with the same speed v. What
is the maximum area on the ground on which these bullets will spread?
 v2  v4 2 v
2
 2v 4
1) 2) 2 3)  2 4)
g g g g2
4. A metal wire of resistance R is cut into three equal pieces which are then
connected side by side to form a new wire, the length of which is equal to one
third of the original length. The resistance of this new wire is :-
R R
1) R 2) 3R 3) 4)
9 3
5. A block of mass m is kept on a frictionless inclined surface with angle of
inclination ‘  . The incline plane is given an acceleration ‘a’ to keep the block
stationary. Then ‘a’ is equal to
1) g cosec  2) g/tan  3) g tan  4) g

6. A stream of protons and -particles of equal momenta enter a uniform magnetic
field perpendicularly. The radii of their orbits are in the ratio
1) 1 : 1 2) 1 : 2 3) 2 : 1 4) 4 : 1
7. A body of mass 5 10 kg moving with speed 2 m/s collides with a body of mass
3
15 103 kg inelastically and stiks to it. Then, loss in kinetic energy of the system
will be
1) 7.5 kJ 2) 15 kJ 3) 10 kJ 4) 5 kJ
8. The height attained by a ball after 3 rebounds on falling from a height of h on
floor, having coefficient of restitution e is
1) e3h 2) e4h 3) e5h 4) e6h
9. A particle of mass 10gm is describing S.H.M. along a straight line with period of
2sec and amplitude of 10cm. Its kinetic energy when it is at 5cm from its
equilibrium position is
1) 37.5 2erg 2) 3.75 2erg 3) 375 2erg 4) 0.375 2erg
10. A resistance R and inductor L is connected to supply voltage as shown
Which of the following quantities have zero average value over a cycle?
1) Current through inductor 2) Induced emf in inductor
3) Magnetic energy stored in inductor 4) Both 1 and 2

11. Pressure versus temperature graph of an ideal gas of equal number of moles of
different volumes are plotted as shown in figure. Choose the correct alternative.
1) V1  V2 , V3  V4 and V2  V3 2) V1  V2 , V3  V4 and V2  V3
3) V1  V2 V3  V4 4) V3  V3 V2  V1
12. In the given figure two tiny conducting balls of identical mass m and identical
charge q hang from non-conducting threads of equal length L. Assume that  is
so small that tan   sin  , then for equilibrium x is equal to
1 1 1 1
 q2 L 3  qL2  3  q 2 L2  3  q2 L 3
1)   2)   3)   4)  
 2 0 mg   2 0 mg   4 0 mg   4 0 mg 
13. One mole of an ideal gas goes from an initial state A to final state B via two
processes. It first undergoes isothermal expansion from volume V to 3V and then
its volume is reduced from 3V to V at constant pressure. The correct p-V
diagram representing the two processes is
1) 2) 3) 4)
14. In YDSE, if the intensity ratio of bright and dark fringes is 81 : 25. The ratio
intensity of two waves is
1) 1 : 49 2) 49 : 4 3) 1 : 4 4) 4 : 40
15. If number of molecules of H2 are double than that of O2, then ratio of kinetic
energy of hydrogen and that of oxygen at 300K is
1) 1 : 1 2) 1 : 2 3) 2 : 1 4) 1 : 16
16. The coefficient of self inductance of a solenoid is 0.18 mH. If a core of soft iron of
relative permeability 900 is inserted, then the coefficient of self inductance will
become nearly
1) 5.4 mH 2) 162 mH 3) 0.006 mH 4)0.0002 mH
17. The area of cross section of the rope used to lift a load by a crane is 2.5 104 m2 .
The maximum lifting capacity of the crane is 10 metric tons. To increase the
lifting capacity of the crane to 25 metric tons. The required area of cross section

of the rope should be take g = 10ms 2 
1) 6.25 104 m 2 2) 10 104 m2 3) 1104 m2 4) 1.67 104 m 2
18. A man grows into a giant such that hs linear dimensions increase by a factor of
9. Assuming that his density remains same, the stress in the leg will change by a
factor of
1 1
1) 9 2) 3) 81 4)
9 81

19. The ratio of de-Broglie wavelength of a -particle to that of a proton being
subjected to the same magnetic field so that the radii of their path are equal to
each other assuming the field induction vector B is perpendicular to the velocity
vectors of the -particle and the proton is
1) 1 2) 1 3) 1 4) 2
4 2
20. Water is flowing through a non-uniform radius tube. If ratio of the radius of entry
and exist end of the pipe is 2 : 3 then the ratio of velocities of exit and entering
liquid is:
1) 4 : 9 2) 9 : 4 3) 8 : 27 4) 1 : 1
21. The ratio of escape velocity at earth  ve  to the escape velocity at a planet  v p 
whose radius and mean density are twice as that of earth is
1)1 : 4 2) 1: 2 3) 1 : 2 4) 1: 2 2
22. A satellite S is moving in an elliptical orbit around the earth. The mass of the
satellite is very small compared to the mass of the earth. Then
1) The linear momentum of S remains constant in magnitude
2) The acceleration of S is always directed towards the centre of the earth.
3) The angular momentum of S about the centre of the earth changes in
direction, but its magnitude remains constant
4) The total mechanical energy of S varies periodically with time.
23. Two points charges –q and +q are located at points (0, 0, -a) and (0, 0, a)
respectively. The electric potential at point (0, 0, z) is (z>a)
q q 2qa 2qa
1) 2) 3) 4)
4 0 z 2
4 0 a 4 0  z  a 
2 2
4 0  z 2  a 2 
24. If n1, n2, n3 are the fundamental frequencies of three segments into which a
string is divided, then the original fundamental frequency n of the string is given
by
1) n = n1 + n2 + n3 2) n  n1  n2  n3
1 1 1 1 1 1 1
3)    4) n   
n n1 n2 n3 n1 n2 n3
25. The distance of closest approach of 1.0 MeV  -particles from a gold nucleus
(Z=79) is nearly
13 11 10 12
1) 2.27  10 m 2) 1.135  10 m 3) 2.27  10 m 4) 2.27  10 m
26. A wire carrying a curent of 3A is bent in the form of a parabola y 2  4  x as shown
in figure, where x and y are in metre. The wire is placed in a uniform magnetic
field B  5kˆ tesla. The force acting on the wire is
ˆ
1) 60iN ˆ
2) 60iN ˆ
3) 30iN ˆ
4) 30iN
27. A ray of light propagates from air to glass as shown in the figure. The ratio of
magnitude of momentum of photon in air and glass is
1 1
1) 2 2) 3 3) 4)
2 3

28. The refractive index of a certain glass is 1.5 for light whose wavelength in vacuum
is 6000 Å. The wavelength of this light when it passes through glass is
1) 4000 Å 2) 6000 Å 3) 9000 Å 4) 15000 Å
29. Which statements is true for interference?
1) Two independent source of light can produce interference
2) There is no violation of conservation of energy
3) White light cannot produce interference
4) All the above
30. A metal rod of Young’s modulus Y and coefficient of thermal expansion  is held
at its two ends such that its length remains invariant. If its temperature is raised
by t oC , the linear stress developed in it is
1 t Y
1) 2) 3) 4) Y t
Y t  Y t
31. Two small spheres each having the charge +Q are suspended by insulating
threads of length L from a hook. This arrangement is taken in space where there
is no gravitational effect, then the angle between the two suspensions and the
tension in each thread will be
0 1 Q2 0 1 Q2 0 1 Q2 0 1 Q2
1) 180 , 2) 90 , 3) 180 , 4) 180 ,
4 0  2 L 2 4 0 L2 4 0 2L2 4 0 L2
32. An aluminium sphere is dipped into water. Which of the following statement is
true? (ignore the expansion of sphere)
1) Buoyancy will be less in water at 0oC than that in water at 4oC
2) Buoyancy will be more in water at 0oC than that in water at 4oC
3) Buoyancy in water at 0oC will be same as that in water at 4oC
4) Buoyancy may be more or less in water at 4oC depending on the radius of the
sphere.
33. Two pulses in a stretched string, whose centres are initially 8 cm apart, are
moving towards each other as shown in the figure. The speed of each pulse is 2
cm/s. After 2s the total energy of the pulses will be :
1) zero
2) purely kinetic
3) purely potential
4) partialy kinetic and partialy potential
34. Between the plates of a parallel plate capacitor of capacity C, two parallel plates,
of the same material and area same as the plate of the original capacitor, are
palced. If the thickness of each plate is equal to 1/5th of the distance between
the plates of the original capacitor, then the capacity of the new capacitor is
5 3 3C 10C
1) C 2) C 3) 4)
3 5 10 3
35. Two resistances R1 and R2 are made of different materials. The temperature
coefficient of the material of R1 is  and that of the material of R2 is . The
resistance of the series combination of R1 and R2 does not change with
temperature, then the ratio of resistances of the two wires at 0°C will be :
   2  2 
1) 2) 3) 4)
    
SECTION – B
36. A stone projected with a velocity u at an angle  with the horizontal reaches

maximum height H1. When it is projected with velocity u at angle     with
2 
the horizontal, it reaches maximum height H2. The relation between the
horizontal range R of the projectile, height H1 and H2 is
H12
1) R  4 H1 H 2 2) R  4  H1  H 2  3) R  4  H1  H 2  4) R  2
H2

37. Binding energy per nucleon verses mass number curve for nuclei is shown in the
fig. W,X,Y and Z are four nuclei indicated on the curve. The process that would
release energy is
1) Y  2Z 2) W  X  Z 3) W  2Y 4) X  Y  Z
38. A cyclist leans with the horizontal at angle 30 , while negotiating round a circular
0
road of radius 20 3m . The speed of the cycle should be

1) 7 3m / s 2) 14m/s 3) 7 6m / s 4) 10 6m / s
39. Assertion (A): Paramagnetic substances get poorly attracted in magnetic field.
Reason (R): Because magnetic dipoles are aligned along external magnetic field
weakly.
1) Both assertion and reason are correct and reason is the correct explanation of
assertion
2) Both assertion and reason are correct but reason is not correct explanation of
assertion
3) Assertion is true and reason is incorrect
40. A solid sphere and a solid cylinder have equal mass. They rolled down on inclined
planes of height h1 and h2 respectively. To have equal velocities for the two objects
at the bottom of the inclined planes the ratio of height h1 : h2 should be = ……….
15 7 14 5
1) 2) 3) 4)
14 5 15 7
41. A solenoid has 2000 turns wound over a length of 0.30 metre. The area of its
cross-section is 1.2 103 m2 . Around its central cross-section, a coil of 300 turns is
wound. If an initial current of 2 A flowing in the solenoid is reversed in 0.25 sec,
then the e.m.f. induced in the coil is
1) 6  104 V 2) 4.8 103V 3) 6  102 V 4) 48 mV
42. The value of universal gas constant is 8.3 J/mole/K, the mean kinetic energy of
32gm of oxygen at 73o C will be
1) 480J 2) 4980J 3) 2490J 4) 100J
43. A particle undergoes simple harmonic motion having time period T. Starting from
mean position, time taken by it to complete 3/8th of oscillation
3 5 5 7
1) T 2) T 3) T 4) T
8 8 12 12
44. For a series LCR circuit, I vs  curve is shown:
A. To the left of 1 , the circuit is mainly capacitive.
B. To the left of 1 , the circuit is mainly inductive.
C. AT 1 , impedance of the circuit is equal to the resistance of the circuit.
D. At 1 , impedance of the circuit is 0.
Choose the most appropriate answer from the options given below.
1) A and D only 2) B and D only 3) A and C only 4) B and C only

45. An incompressible fluid flows steadily through a cylindrical pipe which has radius
2R at point A and radius R at point B farther along the flow direction. If the
velocity at point A is v, its velocity at point B is:
v v
1) 2v 2) v 3) 4)
2 3
46. A vernier callipers has 1mm marks on the main scale. It has 20 equal divisions
on the Vernier scale which match with 16 main scale divisions. For this Vernier
callipers, the least count is
1) 0.02mm 2) 0.05mm 3) 0.1mm 4) 0.2mm
47. The absorption transitions between the first and the fourth energy states of
Hydrogen atom are 3. The emission transitions between these states will be:
1) 3 2) 4 3) 5 4) 6
48. Particles of masses 1kg and 3kg are at (2i + 5j + 13k)m and (-6i + 4j – 2k)m then
instantaneous position of their centre of mass is
1 1
1)  16i  17 j  7k  m 2)  8i  17 j  7k  m
4 4
1 1
3)  6i  17 j  7k  m 4)  6i  17 j  5k  m
4 4
49. A p-n photodiode is made of a material with a band gap of 2eV. The minimum
frequency of the radiation that can be absorbed by the matieral is nearly
(hc = 1240 eV nm)
1) 11014 Hz 2) 20 1014 Hz 3) 10 1014 Hz 4) 5 1014 Hz
50. In the given circuit, A and B represents two inputs and C represents the output.
The circuit represents.
1) AND gate 2) NOR gate 3) OR gate 4) NAND gate
CHEMISTRY
SECTION – A
51. The mass of urea (m.w = 60g/mol] required to prepare 2.5 kg of 0.2 molal
aqueous solution is _________g.
1) 30 2) 29.64 3) 29.42 4) 29.82
52. The solubility of a toxic gas ‘X’ in water is 0.2m at STP. Henry’s law constant of
‘X’ is _____bar.
1) 282 2) 292 3) 272 4) 256
53. Carbylamine reaction is used for the detection of
1) aliphatic 2° amines 2) aliphatic 1° amines
3) aromatic 1° amines 4) Both (2) and (3)
54. Which of the following is incorrectly matched?
1) Cr  Mn : IP2 2) Zn  Cu : IP3 3) Fe  Mn : IP3 4) Cu  Zn : IP2
55. The formula of a metallic carbonate is MCO3. The formula of that metallic
perchlorate is
1) MClO4 2) M2ClO4 3) M3ClO4 4) M(ClO4)2
56. IUPAC name of the compound
O
H2 N
OH
OH
1) 1 – amino – 3 – hyroxybutanoic acid
2) 4 – amino – 2 – hydroxy butanoic acid
3)  - amino -  - hydroxy butanoic acid
4) 2 – amino – 3 – hydroxy butanoic acid

57. If the electron of a hydrogen atom is present in the first orbit, the total energy of
the electron is
e2 e2 e2 e2
1) 2) 2 3) 4)
r r 2r 2r 2
A) The four quantum numbers ( n, l , m and s) for the valence electron of Rb are
respectively 5, 0, 0,  1 / 2 .
B) The radius of second orbit of H-atom is equal to the radius of 4th orbit of Be3+
ion.
C) A revolving electron makes more number of revolutions in the first orbit of He 
ion than that in 1st orbit of H-atom.
59. Which of the following pairs of compounds are geometrical isomers?
1) Crotonic acid and cinnamic acid
2) Maleic acid and malonic acid
3) Ethylene dichloride and ethylidene dichloride
4) Maleic acid and fumaric acid
60. Chlomyl chloride test is an conformation test of chloride ion in a given simple
salt. Which of the following chloride salt does not respond to chromyl chloride
test.
1) Hg2Cl2 2) MgCl2 3) AgCl 4) Both 1, 3
2 2 2 2
61. A solution which is 10 M each in Mn , Fe , Zn and Hg is treated with 1016 M
3
sulphide ion. If Ksp of MnS, FeS, ZnS and HgS are 1013 ,1018 ,1024 and 1053
respectively, which one will precipitate first
1) FeS 2) MgS 3) HgS 4) ZnS
62. For III group cations precipitation, NH4Cl is added before adding NH4OH. It is to
1) decreasing conc. of OH  2) decreasing conc. of NH 4
3) increasing conc. of NH 4 4) increase conc. of OH  ions
63. Assertion (A): The experimentally determined carbon to oxygen bond length in
metal carbonyls is higher than C = O bond length in carbon monoxide molecule.
Reason (R) : In carbon monoxide, carbon atom undergoes sp hybridisation.
the assertion
64. Statement – I: Ionic bonds are dierectional in nature whereas covalent bonds are
non-directional.
Statement – II: According to orbital overlap concept, the formation of a covalent
bond between two atoms results by pairing of electrons present in the valence
shell having same spins.
65. Which of the following diatomic molecule has highest bond energy, according to
molecular ofbital theory?
1) B2 2) O2 3)F2 4) C2
66. Which of the following carbocation is more stable?
 
1) CH3  CH 2  O  CH2 2) CH3  CH2  NH  CH2
3) CH 3  CH  CH  CH 2 4) CH 3  O  CH 2  CH 2
67. Which of the following most basic in nature?
1) CH 3  CH  CH  NH 2 2) Ph  CH 2  NH 2
O
3) || 4) CH  CH 2  CH  NH
CH 3  C  NH  CH 3

68. Order of decreasing tendency to accept lone pair of electron of halides of 13th
group elements is
1) BX3 > AlX3 > GaX3 > InX3 > TlX3 2) AlX3 > BX3 > GaX3 > InX3 > TlX3
3) GaX3 > AlX3 > BX3 > InX3 > TlX3 4) InX3 > TlX3 > AlX3 > BX3 > GaX3
69. Order of decreasing stability of tetrahalides of IVA group elements is
1) CF4 > CCl4 > CBr4 > CI4 2) CI4 > CBr4 > CCl4 > CF4
3) CBr4 > CCl4 > CF4 > CI4 4) CI4 > CF4 > Cl4 > CBr4
70. In the following compounds the decreasing order of B.P. is
71.
72. Which of the following halides are not suitable as reagents for Friedel-craft
alkylation?
1) CH 3  CH  Cl   CH  CH 3 2) C6H5Cl
3) CH3 –CH=CH-CH2Cl 4) Both 1 & 2
73. What approximate volume of 0.40 M Ba(OH)2 solution must be added to 50.0 mL
of 0.30 M NaOH solution to get a solution in which the molarity of the OH– ions
is 0.50 M ?
(1) 33 mL (2) 66 mL (3) 133 mL (4) 100 mL
74. The pH of a given NaOH solution is 11. Then the pH of H2SO4 solution having
same molarity of given NaOH solution is ______
1) 3 2) 2.7 3) 6 4) 3.3
 2
75. The number of moles of MnO4 and Cr2O7 separately required to oxidise 1 mole of
FeC2O4 each in acidic medium respectively.
1) 0.5 : 0.6 2) 0.6 : 0.4 3) 1.2 : 0.5 4) 0.6 : 0.5
76. Molecules whose mirror image is non-superimposable over them are known as
chiral.
Which of the following molecules are chiral in nature?
1) 2 – Bromobutane 2) 1 – Bromobutane
3) 2 – Bromopropane 4) 2 – Bromopropan – 2 – ol
77. Which of the following compounds will give racemic mixture of nucleophilic
substitution by OH  ion?(Assume SN1 mechanism for all)
Br
CH 3  CH  Br | CH 3  CH  CH 2 Br
(I) | (II) CH 3  C  CH 3 (III) |
C2 H 5 | C2 H 5
C2 H 5
1) (I) only 2) (I), (II), (III) only 3) (II), (III) only 4) (I), (III) only
78. Which of the following is incorrect match?
1) Thermal stability : H 2O  H 2 S  H 2 Se  H 2Te
2) Bond enthalpy : H 2O  H 2 S  H 2 Se  H 2Te
3) Acidic character : H 2O  H 2 S  H 2 Se  H 2Te
4) Melting point : H 2O  H 2Te  H 2 Se  H 2 S

79. Statement – I: Compared to other noble gases ‘Xe’ is chemically active.
Statement – II: ‘Xe’ has low IP value and vacant ‘d’ orbitals available for the
excitation of electron from ‘p’ orbitals of valence shell.
80. For a zero order reaction, the graph drawn between conc.of reactant (At) vs time
(t) gives a straight line with –ve slope and +ve intercept. The magnitude of the
slope is 0.04M.min-1 and intercept is 0.8mol.lit-1. Then the half life of the reaction
is _____minutes.
1) 20 2) 10 3) 40 4) 17.325
81. 20g of a radioactive substance is reduced to 5g in 30days. Then 100g of the
substance is reduced to 6.25g in _____days.
1) 120 2) 45 3) 60 4) 90
COLUMN – I COLUMN – II (Characteristics of glucose
(Reaction of molecule)
glucose with)
(I) HI ,  P) O
Presence of group
C 
(II) HCN Q) Presence of aldehyde functional group
(III)  CH 3CO 2 O R) All six carbon atoms are linked in a straight
chain
(IV) Br2 , H 2O S) Presence of 5-OH groups
1) P R S Q 2) R S P Q
3) R P S Q 4) R P Q S
83. Acetyl bromide reacts with an excess of CH3MgI followed by treatment with a
saturated solution of NH4Cl gives
1) acetone 2) acetyl iodide
3) 2-methyl-2-propanol 4) acetamide
84. Identify the correct statement regarding entropy :
1) at absolute zero temperature, the entropy of a perfectly crystalline substance is
taken to be zero
2) at absolute zero of temperature, the entropy of a perfectly crystalline substance
is +ve
3) at absolute zero of temperature the entropy of all crystalline substances is
taken to be zero
4) at 0o C the entropy of a perfectly crystalline substance is taken to be zero
85. The factor of G values is important in metallurgy. The G values for the
following reactions at 800o C are given as :
2S  s   2O2  g  
 2SO2  g  ; G  544 kJ
2Zn  s   S2  s  
 2ZnS  s  ; G  293 kJ
2Zn  s   O2  s  
 2ZnO  s  ; G  480 kJ
The G for the reaction, 2ZnS  s   3O2  s  
 2ZnO  s   2SO2  g  will be :
1) -357 kJ 2) -731 kJ 3) -773 kJ 4) -299 kJ
SECTION – B
86. Titanium shows magnetic moment of 1.73 B.M. in its compound. What is the
oxidation number of Ti in the compound?
1) +1 2) +4 3) +3 4) + 2

2 
1) VO2  Cr2O7  MnO4  Oxidising power
2) Co2  Fe2  Mn2  Magnetic moment
3) CrO3  MoO3  WO3  Stability of  6 oxidation state
4) Fe  Mn  Co  vevalue of 0M 3 / M 2
88. Statement –I : Sodium hydrogen sulphite adds to aldehydes and ketones is a
useful method for separation and the purification of aldehydes.
Statement –II : The hydrogen sulphite addition compound is water soluble and
can be converted back to the original carbonyl compound by treating it with
dilute mineral acid or alkali.
89. Match Column I with Column II and choose the correct combination from the
options given.
Column-I Column-II
(reaction) (name of the reactions)
A) C6 H5CHO  NaOH  C6 H5COOH  C6 H5CH2OH (p) Rosenmund’s reaction
B) C6 H 6  CH 3Cl 
Anhyd
AlCl3
 C6 H 5CH 3 (q) Kolbe’s reaction
C) RCOCl  H2 
Pd / BaSO4
 RCHO (r) Friedel-Crafts reaction
D) OH (s) Cannizzaro’s reaction
C6 H 5OH  NaOH  CO2 

Heat
H
 COOH
Codes :
A B C D A B C D
1) s q r p 2) r s p q
3) s r p q 4) q r s p
90. The IUPAC name of  Ag  NH 3 2   Ag  CN 2  is

1) Diamminesilver (I) dicyanidoargentate (I)
2) Diaminesilver (I) dicyanidoargentate (III)
3) Diemminesilver (III) dicyanoargentite (III)
4) Diammineargentate (I) dicyanosilver(I)
91. The co-ordination number of Cu in CuSO4.5H2O is
1) 4 2) 5 3) 3 4) 2
92. The total number of stereo isomers possible with the complex Mabcdef is
1) 15 2) 30 3) 45 4) 10
93. In which of the following reaction, the concentration of product is higher than the
concentration of reactant at equilibrium?
1) A  B : k  0.01 2) M  N : k  10
3) X  Y : k  0.05 4) K  P : k  0.01
94. At low temperature, Nitrogen dioxide, a reddish brown gas gets associated to form
the colourless dinitrogen tetroxide as in the reaction 2 NO2 g    N 2O4 g  . Then at
equilibrium
1) There would be an increase in colour intensity
2) The mixture would become colourless
3) There would be a decrease in colour intensity
4) There would be no change in colour intensity
95. A buffere solution contains 0.04 mole acetic acid (pha=4.75) and 0.08 mole of
sodium acetate. If 0.02 mole of NaOH is added, then the change in the pH is
1) 0.4 units increased 2) 0.4 units decreased
3) Not changed 4) 0.3 units increased

96. Aniline has high boiling point, high vapour pressure at 100°C and is insoluble in
water. Aniline is therefore, separated from aniline-water mixture
1) Steam distillation 2) Simple distillation
3) Distillation at low pressure 4) Sublimation
97. The reaction,
C6 H 5 NH 2  ClCOC6 H 5  NaOH
 C6 H 5 NHCOC6 H 5 is called
1) Friedel-crafts reaction 2) Claisen condensation
3) Benzoylation or Schotten Baumann reaction 4) None of these
98. The electro chemical equivalent of a metal is 0.0006735 g/C. The weight of metal
deposited at cathode by passing 30amp current for 20 minutes through its
molten chloride is _______ gram.
1) 24.24 2) 0.4 3) 12.12 4) 48.48
99. From the following data,
I) Cl2  2e  2Cl  ; E o  1.36V
II) Na   e  Na; E o  2.71V
III) MnO4  2 H 2O  2e  MnO2  4OH  , E o  0.6V
IV) H 2O2  2H   2e  2H 2O; E o  1.78V
Which of the following is most powerful oxidizing agent?
1) Cl2 2) Na 3) MnO4 4) H2O2
100. The product X will be
1, 2  epoxypropane HBr
Excess
X .
What is X (major) in the above reaction?
1) 2) 3) 4)
BOTANY
SECTION – A
101. The rapid multiplication of which of the following may cause decrease in the yield
of marine fishes
1) water blooms 2) Golden algae 3) Gonyaulax 4) Slime moulds
102. The protists that are wall less in vegetative stage but produce spores with the
walls are
1) Dinoflagellates 2) Diatoms
3) Protozoans 4) Slime moulds
(A) Chrysophytes (I) Myxotrophs
(B) Dinoflagellates (II) Saprophyte protists
(C) Euglenoids (III) Diatoms & Desmids
.
(D) Slime moulds (IV) Gonyaulax
(A) (B) (C) (D) (A) (B) (C) (D)
.
1) III IV I II 2) IV III I II
3) III II IV I 4) II III IV I
104. Which of the following is wrongly matched in the given table?
Microbes Product Application
1) Trichoderma polysporum Cyclosporin Immunosuppressive drug
2) Monascus purpureus Statins Lowering of blood cholesterol
3) Streptococcus Streptokinase Removal of clot from blood vessel
4) Clostridium butylicum Lipase Removal of oil stains
105. All solids that settle form the A and the supernatant forms the B . If from the
primary settling tank is taken for C treatment.
1) A – primary sludge, B – Effluent, C – Secondary
2) A – anaerobic sludge, B – Effluent, C – Primary
3) A – Primary sludge, B – Effluent, C- Primary
4) A – Activated sludge, B – Effluent, C – Primary

106. The Effluent is passed into aeration tank for

1) Primary treatment 2) Secondary treatment
3) Both (1) and (2) 4) Tertiary treatment
1) Pteridophytes are used for medicinal purposes and as soil-binders.
2) Pteridophytes are also frequently grown as ornamentals.
3) The Pteridophytes are found in cool, damp, shady places though some may
flourish well in sandy-soil conditions
4) In Pteridophytes the dominant phase in the life cycle is the gametophytic plant
body.
I. Algae are nonchlorophyllous, complex, thalloid, autotrophic and largely
aquatic (both fresh water and marine) organisms.
II. Algae occur in a variety of other habitats: moist stones, soils and wood.
III. Algae also occur in association with Cyanobacteria (lichen) and all animals
and higher plants.
IV. The algae reproduce by vegetative, asexual and sexual methods.
1) I, II, and IV are correct 2) I, II, III and IV are correct
3) I, II and V are correct 4) II, and IV are correct
109. The dicotyledons are characterised by seeds having ……A… cotyledons,
……B……… venations in leaves, and …C……… or………D… flowers.
A B C D
1) One Parallel Trimerous Pentamerous
2) Two Reticulate Tetramerous Pentamerous
3) Two Parallel Trimerous Pentamerous
4) One Reticulate Tetramerous Pentamerous
110. Restriction endonuclease is employed for cutting
1) A single stranded DNA 2) Double stranded DNA
3) RNA fragment 4) mRNA
111. Bacterial plasmid contains
1) RNA 2) RNA + Protein 3) DNA 4) Protein only
112. Restriction endonucleases are
1) Used in genetic engineering for unwinding two DNA molecules
2) Used in in vitro DNA synthesis
3) Present in mammalian cells for degeneration of DNA of dead cells
4) Synthesized by bacteria for their defence
113. Statement-I: Transformation is a procedure through which a piece of protein is
introduced into a host
Statement-II: Retroviruses have also been disarmed and are now used to deliver
desirable genes into plant cell
3) Both Statements I, II are false
4) Both Statements I, II are true
1) T-DNA : E.coli 2) Bam HI : ampR 3) PvuII : rop 4) Pst I : Tet R
115. Identify the correct statements.
A. In racemose type of inflorescences, the flowers are borne laterally in a
basipetal succession.
B. In mustard, datura and chilli flowers can be divided into two similar halves
only in one particular vertical plane.
C. A flower is a modified shoot where in the shoot apical meristem changes to
floral meristem.
D. China rose, mustard and sunflower plants show opposite types of phyllotaxy.
E. Neem has a pinnately compound leaf.
1) C and E 2) A, C and D 3) B and E only 4) B, D and E only

116. Identify the parts of seed labeled as A and B.
A B
1) Embryo Endosperm
2) Endosperm Embryo
3) Perisperm Endosperm
4) Endosperm Perisperm
117. Analysis statements w.r.t. below diagram.
S–I :The margin of thalamus encloses ovary completely and fuses with the ovary.
S–II :The ovary here is said to be half-inferior.
3) Both Statements I, II are false 4) Both Statements I, II are true
List-I (Example) List-II (Family)
A) Spice : Chilli (I) Cruciferae
B) Spices : Black mustard (seeds) (II) Solanaceae
C) Drug : Calendula (III) Poaceae
`
`
D) Builidng material : Bambusa (IV) Asteraceae
A B C D A B C D
1) II I IV III 2) II III IV I
3) III II I IV 4) IV I III II
119. Consider the following statements about DNA replication and choose
the correct options:
I. In E. coli, the average rate of polymerisation during DNA
replication is approximately 2000 base pairs per second.
II. DNA polymerases catalyse polymerisation only in the 5' to 3'
direction, leading to continuous synthesis on the 3' to 5' template
and discontinuous synthesis on the 5' to 3' template.
III. DNA replication in E. coli initiates from a specific sequence called
the origin of replication.
IV. In eukaryotes, DNA replication occurs during the G1 phase of the
cell cycle.
1) Only I, II, and III are correct 2) Only II, III, and IV are correct
3) Only I and III are correct 4) All I, II, III, and IV are correct
120. An experiment was conducted to understand the regulation of gene
expression in E. coli. The bacteria were grown in a medium containing
lactose but no glucose. Which of the following outcomes is expected
based on the functioning of the lac operon?
1) The repressor protein remains bound to the operator, blocking RNA
polymerase and preventing transcription of the operon.
2) The lac repressor protein gets inactivated by lactose, allowing RNA
polymerase to access the promoter and initiate transcription of the
operon.
3) The presence of lactose has no effect on the lac operon as glucose is
the preferred carbon source for E. coli.

4) Both glucose and lactose are required simultaneously for the
expression of the lac operon
121. Which of the following option is incorrect with reference to the
transforming principle ?
1) S strain  injected into mice  mice died
2) R strain  injected into mice  mice lived
3) S strain (heat killed)  injected into mice  mice died
4) S strain (heat killed) + R strain (live)  injected into mice  mice died.
122. Back bone in structure of DNA molecule is made up of :-
1) Pentose Sugar and phosphate 2) Hexose sugar and phosphate
3) Purine and pyrimidine 4) Sugar and purine
123. P was used to radiolabel the which component of bacteriophage in
32
Hershey and Chase experiment :-

1) Viral protein 2) Viral DNA
3) Viral RNA 4) Both DNA and protein
124. If base sequence of one strand is 5' GCCTTAAGC 3' of a DNA
molecule, then its complementary sequence will be :-
1) 3' CGGUUAACG 5' 2) 3' CGGAATTCG 5'
3) 5' GCCUUAAGC 3' 4) 5' CGGTTAACG 3'
125. In dicot stem
1) Protoxylem lies towards pith 2) Metaxylem lies towards periphery
3) Endarch arrangement is present 4) All the above are correct
126. Assertion : The secondary growth occurs in most of the dicotylendonous roots.
Reason : The cambium is present in between the xylem and phloem of vascular
bundles in dicotyledonous roots.
127. Formation of which tissue is example of dedifferentiation
1) Interfascicular cambium 2) Apical meristem
3) Intrafascicular cambium 4) Intercalary meristem
128. Offspring of which of the following crossed are all phenotypically alike?
1) Dd × Dd 2) Dd × dd 3) DD × Dd 4) Ww × Ww
129. If an organism produces 32 types of gametes its genotype should be heterozygous
for
1) 4 genes 2) 5 genes 3) 8 genes 4) 16 genes
given
Column-I Column-II
(a) Golgi apparatus i. Membrane bound minute vesicles
(b) Osmosis ii. Cis face and trans face
(c) Microbodies iii. Two cylindrical structures
(d) Centrosome iv. Passive transport
1) a-iii, b-i, c-ii, d-iv 2) a-ii, b-iv, c-i, d-iii
3) a-i, b-ii, c-i, d-iii 4) a-iv, b-ii, c-iii, d-i.
131. What is the meaning of segregation in law of segregation?
1) Allelic separation 2) Chromosomal separation
3) Crossing over 4) Linkage
132. Statement-I: Co-dominance and incomplete dominance are different process.
Statement-II: In co-dominance characters express themselves completely in F1
hybrid while in incomplete dominance partial co-existance of characters is seen.
3) Both Statements I, II are false
4) Both Statements I, II are true
133. Which of the following statement is not true?
1) Response to gram stain is due to the cell envelope.
2) The cell envelope act as a single protective unit.
3) The glycocalyx layer is similar in all the bacteria.
4) Glycocalyx as loose sheath known as Slime layer.

134. In prokaryotes, chromatophores are

1) specialized cytoplasmic granules responsible for colouration of cells.
2) structures responsible for organizing the shape of the organism.
3) inclusion bodies lying free inside the cells for carrying out various metabolic
activities.
4) membrane extensions into cytoplasm found in cyanobacteria
135. Identify the incorrect statement related to Pollination:
1) Pollination by water is quite rare in flowering plants
2) Pollination by wind is more common amongst abiotic pollination
3) Flowers produce foul odours to attract flies and beetles to get pollinated
4) Moths and butterflies are the most dominant pollinating agents among insects
SECTION – B
136. The term used for transfer of pollen grains from anthers of one plant to stigma of
different plant which, during pollination, brings genetically different types of
pollen grains to stigma, is:
1) Geitonogamy 2) Chasmogamy 3) Cleistogamy 4) Xenogamy
137. In some members of which of the following pairs of families, pollen grains retain
their viability for months after release?
1) Poaceae ; Leguminosae 2) Poaceae ; Solanaceae
3) Rosaceae ; Leguminosae 4) Poaceae ; Rosaceae
138. The plant parts which consist of two generations one within the other:
1. Pollen grains inside the anther
2. Germinated pollen grain with two male gametes
3. Seed inside the fruit
4. Embryo sac inside the ovule
1) (1), (2) and (3) 2) (3) and (4) 3) (1) and (4) 4) (1) only
139. Enzymes that catalyse inter-conversion of optical, geometrical (or) positional
isomers are
1) Ligases 2) Lyases 3) Hydrolases 4) Isomerases
140. Statement –I : Hydrophilic and cytoplasmic composition roughly in acid soluble
fraction.
Statement –II : Hydrophobic polymers (carbohydrates, proteins, phospholipids,
amino acids) are strictly biomacro molecules.
141. Identify the correct statement about meristematic phase of growth.
I) It is characterized by increased vacuolation
II) It shows cell enlargement
III) In this phase new cell wall is deposited
IV) Growth is maximum
1) III, I and II 2) I, II and III 3) II, IV and III 4) All are wrong
142. Read the following factors affecting plant development and select the number of
extrinsic factors.
Light, Genes, Temperature, Plant growth regulators, water, oxygen, nutrition.
1) 4 2) 5 3) 2 4) 6
143. Which hormone promotes internode/petiole elongation in deep water rice?
1) Kinetin 2) Ethylene 3) 2, 4-D 4) GA3
144. (i) Snapdragon (ii) Selaginella (iii) Ladybird (iv) Trichoderma (v) Viciafaba
How many of the above follow “Separation of cytoplasm by cell plate method”
1) 1 2) 2 3) 3 3) 5
145. Which of the following is not incorrect?
1) Nucleolus reappear in prophase
2) New DNA molecules formed in G1 phase
3) Equatorial plate is not formed in metaphase
4) Major reorganization of all components of cell takes place in m-phase.

146. Which one is incorrect for the figure given?
1) Organelle exhibit clear division of labour

2) They align themselves along the walls of the mesophyll cells, such that they get
the optimum quantity of the incident light.
3) Material present outside the membrane system is responsible for trapping the
light energy and also for the synthesis of ATP and NADPH.
4) They could align themselves perpendicular to the incident light during mid day
or when light intensity in the ambience is more than required.
147. Release of 6 molecules of oxygen from a green leaf, requires reduction of how
many molecules of CO2 ?
1) 6 2) 3 3) 12 4) 18
148. A small plant growing in dense forest. The factor that act as limiting factor is
1) CO2 concentration 2) Light intensity
3) Available water 4) Temperature
149. Which of the following enzyme is responsible for formation of glucose-6-
phosphate from glucose?
1) Hexokinase 2) Aldolase 3) Dehydrogenase 4) Phosphatase
150. In the electron transport system present in the inner mitochondrial membrane,
complexes I and IV are respectively
1) NADH Dehydrogenase and FADH2
2) NADH2 and NADH Dehydrogenase
3) NADH Dehydrogenase and cytochrome-c oxidase complex
4) NADH dehydrogenase and ATP synthase
ZOOLOGY
SECTION – A
151. For the first time, therapy was tried on a 4 year old girl in 1990 to treat________
1) Cytosine Deaminase (CDA) 2) Adenosine Deaminase (ADA)
3) Tyrosine oxidase 4) Glutamate tryhydrogenase
152. The direct ancestor of modern man is
1) Ramapithecus 2) Homo habilis 3) Homo erectus 4) Australopithecines
153. The ancient fossil of horse
1) Procamelus 2) Pliohippus 3) Dryopithecus 4) Stegolophodon
154. Select the hormone-releasing Intrauterine Devices.
1) Multiload 375, Progestasert 2) Progestasert, LNG-20
3) Lippes Loop, Multiload 375 4) Vaults, LNG-20
155. What is common to Lantana, Eicchornia and African catfish?
1) All are invasive species of India 2) All are key stone species of India
3) All are endemic species of India 4) All are threatened species of India
156. The peak of richness of species over the latitudinal range is observed
1) Between 410N and 710N 2) Between 410S and 710S
3) Between 23.5 N to 23.5 S
0 0 4) Between 43.50N and 44.50N
157. A woman has an X-linked condition on one of her X chromosomes. This
chromosome can be inherited by :-
1) Only daughters 2) Only sons
3) Only grandchildren 4) Both sons & daughters
158. Mark the false statement regarding the heart of cockroach.
1) Heart is present along the mid-dorsal line of thorax and abdomen
2) Alary muscles attached to heart chambers
3) Heart is elongated muscular tube

4) It is 10/11 chambered
159. Phylum having radula, calcareous ossicles muscular pharynx and jointed
appendages are respectively.
1) Arthropoda, Aschelminthes, Echinodermata, Mollusca
2) Mollusca, Echinodermata, Aschelminthes, Arthropoda
3) Aschelmithes, Echinodermata, Mollusca, Arthropoda
4) Echinodermata, Mollusca, Platyhelminthes, annelida
160. Which of the following is found in frog?
1) Five fingers and four toes 2) Four fingers and five toes
3) Five fingers and five toes 4) Four fingers and four toes
Column-I Column-II
A) Unipolar neuron (1) Cerebral cortex
B) Bipolar neuron (2) Embryonic stage
C) Multipolar neuron (3) Retina of eye
1) a-1, b-2, c-3 2) a-3, b-1, c-2 3) a-2, b-3, c-1 4) a-2, b-1, c-3
162. Corpus callosum is tracts of nerve fiber connects.
1) Obliquely divided cerebrum 2) Transversely divided thalamus
3) Longitudinally divided cerebrum 4) Longitudinally divided thalamus
163. Statement –I : The female mosquito is not considred as a parasite.
Statement –II : The female mosquito needs our blood for reproduction.
Column-I (Species A-B) Column-II (Interaction)
a) Herbivores-plants (i) Commensalism
b) Mycorrhiza-plants (ii) Mutalism
c) Sheep-cattle (iii) Predation
d) Orchid-mango tree (iv) Competition
1) a-i, b-iii, c-iv, d-ii 2) a-iv, b-ii, c-i, d-iii
3) a-iii, b-ii, c-iv, d-i 4) a-ii, b-i, c-iii, d-iv
165. Statement – I : Conditional reabsorption of Na+ and water takes place in PCT.
Statement – II : PCT maintain the pH and ionic balance of the body fluids.
1)Both Statement-I and Statement-II are true.
166. Vital capacity + A = Total lung capacity (TLC). In this ‘A’ stands for
1) IC 2) RV 3) ERV 4) IRV
(A) Urea (I) Reabsorbed at collecting duct
(B) GFR (II) 180 lit/day
(C) Nephrons (III) 1 million in a kidney
(D)
.
Kidney width (IV) 5 to 7 cm
(A) (B) (C) (D) (A) (B) (C) (D)
1) IV III II I 2) I III IV II
3) I II IV III 4) I II III IV
168. Arteries are best defined as the vessels which
1) Carry blood away from heart to different organs
2) Vessels with wide lumen
3) Carry blood from one visceral organ to another visceral organ
4) Supply oxygenated blood to different organs
169. The number of antigens in a person who have AB positive blood.
1) 2 2) 3 3) 1 4) Zero

170. The partial pressures (in mm Hg) of oxygen and carbon-dioxide is represented as
95
in/at
40
1) Oxygenated blood 2) Deoxygenated blood
3) Aeveoli 4) Tissues
171. The immediate adverse effects of drugs and alcohol abuse are manifested in form
of reckless behavior, __________ and _______
1) Stealing , financial help for family 2) Vandalism , violence
3) Emphysema , cancer 4) Nausea, sweating
172. Statement (S-I): Fragmentation is a process in which the detritus is breakdown
into smaller particles by detritivores.
Statement (S-II): Decomposition is faster if the detritus is rich in lignin and
chitin
1) S-I & S-II are correct 2) S-I is correct, S-II is incorrect
3) Both S-I & S-II are incorrect 4) S-I is incorrect, S-II is correct
173. The _______ are small solid structures located at different points along the
lymphatic system
1) Lymph nodes 2) Peyer’s patches 3) Spleen 4) Thymus
174. The mature infective stages (sporozoites) escape from gut and migrate to the
mosquito’s ____
1) Haemolymph 2) Malphigian tubules
3) Lumen of gut 4) Salivary glands
175. The rate of formation of new organic matter in consumers is known as
1) Gross primary productivity 2) Secondary productivity
3) Net primary productivity 4) Photosynthetically active radiation
176. Read the following and choose the correct sequence of events in a menstrual
cycle.
a) Secretion of FSH b) Development of ovarian follicles
c) Secretion of progesterone d) Secretion of esteogen (Ist time)
1) abcd 2) abdc 3) dcba 4) acbd
177. Statement –I : The human genome contains 3164.7 billion bp, according to
Human Genome Project (HGP).
Statement –II : Less than 2 percent of the human genome codes for proteins,
according to HGP.
178. Alfonso Corti, is a
1) Italian ecologist 2) German geographer
3) Italian anatomist 4) British naturalist
179. Identify the group of animals that exhibit the following characters.
I. Two pairs of limbs, adapted for walking, running, climbing, burrowing,
swimming or flying
II. Different types of teeth are present in the jaw
III. External ears or pinnae are present
IV. They are viviparous with few exceptions.
1) Reptilia 2) Aves 3) Amphibia 4) Mammalia
180. Which of the following is correct one?
1) Neural coordination absent in Hydra
2) Mesoderm absent in Tapeworm
3) Sea urchin has anus on upper (dorsal) side
4) Fertilisation is external in flat worms
181. Which of the following molecular diagnostic technique is used to detect the
presence of a pathogen in its early stage of infection-
1) Angiography 2) Radiography
3) Enzyme replacement technique 4) Polymerase chain reaction

182. Statement – I: Progesterone acts on mammary glands and stimulates milk
ejection.
Statement – II: Progesterone help in development of ovarian follicles, regulation
of female sexual behaviour and mammary gland development
183. The applications of DNA fingerprinting include:
1) Forensic science 2) Population genetics
3) Genetic diversity studies 4) All of the above
184. The process of gaining of a segment of DNA, which results in alteration in
chromosome is due to ______
1) Insertion 2) Deletion 3) Duplication 4) Both 1 and 3
185. In pedigree analysis the following symbol represents,
1) Unrelated mating 2) Consanguineous mating

3) Affected parents 4) Non- Identical twins
SECTION – B
186. Assertion : Nature’s biological library is burning even before we catalogued the
titles of all the books stocked there.
Reason : Many taxonomists and the time is required to complete species
inventory of the biological wealth of our country.
the assertion
187. Statement – I: Neutrophils are the most abundant phagocytic granular
lymphocytes.
Statement – II: Tunica externa is the external fibrous connective tissue layer of
blood vessels with elastic fibres.
188. Choose from the following, the correct symptoms of the disorder shown in the
figure.
I. Furrowed tongue
II. Short statured with underdeveloped feminine character
III. Retarded psychomotor development
IV. Many loops on fingertips
V. Sterility
1) I,III,IV 2) III,IV,V 3) I,III,V 4) I,II,III,IV,V

189. Choose the correct match.
Column-I Column-II
A) Testicular lobules (I) Each testis has about 250 compartments
B) Ampulla (II) Paired folds of tissue
C) Birth canal (III) Wider part of the oviduct
D) Labia majora (IV) Narrow lumen
(V) Cervical canal along with vagina
(VI) Site of fertilisation
Codes :
A B C D A B C D
1) I II,III IV V,VI 2) I IV,VI V II
3) II V VI III,IV 4) I III,VI V II
190. Match the following .
1) Radiotherapy - p) Anti cancer drugs
2) Chemo therapy - q) X- rays
3) Immunotherapy - r) Suspected tissue
4) Biopsy - s) Cancer specific antibodies
1) 1-s, 2-p, 3-q, 4-r 2) 1-q, 2-r, 3-s, 4-p
3) 1-q, 2-p, 3-s, 4-r 4) 1-p, 2-q, 3-r, 4-s
191. The rate of biomass production by autotrophs which becomes available for
consumption to heterotrophs is termed as
1) Gross Primary Productivity 2) Net Primary Productivity
3) Gross Secondary Productivity 4) Net Secondary Productivity
A) Cervical caps and vaults are not cost effective as they cannot be reused.
B) Contraceptive efficiency of vaults and cervical caps can be increased by using
spermicidal creams along with these barriers.
1) A is true, B is false 2) Both A and B are true
3) A is false, B is true 4) Both A and B are false
193. Match the following and pick correct option.
(A) Genetic drift (I) Genetic drift due to small colonizing
population
(B) Founder effect (II) Change in allele frequency by a chance
event
(C) Genetic recombination (III) A major factor to introduce variations
in sexually reproducing populations.
(D)
.
Bottle neck effect (IV) Adverse environmental factors
(A) (B) (C) (D) (A) (B) (C) (D)
1) II I III IV 2) I III II IV
3) III II I IV 4) III I II IV
194. Statement – I: The taxonomic categories are distinct morphological aggregates
not merely biological entities.
Statement – II: Classification is a single step process but involves hierarchy of
steps.
195. Assertion (A): Increasing osmolarity towards the inner medullary inerstitium is
caused by NaCl & Urea.
Reason (R) : Counter current in loop of Henle & vasa recta help in maintaining
increasing osmolarity towards medulla.

196. Assertion(A): The pO2 in alveoli is considerably less than that in the atmosphere.
Reason (R):Lungs in mammals do not completely empty with each breath.
1) Both assertion and reason are true and reason is correct explanation of
assertion.
2) Both assertion and reason are true and reason is not correct explanation of
assertion.
3) Assertion is true but reason is false.
4) Both assertion and reason are false.
197. Which of the following is incorrect about the given graph.
1) Increase in partial pressure of CO2 favours dissociation of oxyhaemoglobin

2) Low temperature favours formation of oxyhaemglobin
3) Lesser H+ concentration favours the formation of oxyhaemoglobin
4) Decrease in partial pressure of oxygen cause formation of oxyhaemoglobin
198. Match the following and choose the right option.
(Period) (Plant group)
(A) Permian (I) Seed ferns
(B) Silurian (II) Progymnosperms
(C) Carboniferous (III) Zosterophyllum
(D) Devonian (IV) Arborescent lycopods
.
(A) (B) (C) (D) (A) (B) (C) (D)

1) IV III I II 2) III IV II I
3) I II III IV 4) II III IV I
199. Statement–I:Glucocorticoids stimulate gluconeogenesis, lipolysis and proteolysis.
Statement–II:Aldosterone acts mainly on renal tubules and stimulates the
reabsorption of K + and phosphates and excretion of Na+ and water
200. A motor unit constitute:
1) One muscle fibre and its single nerve fibre
2) It is the neuron which carries the message from muscle to CNS
3) A single motor neuron and all the muscle fibres that it innervates
4) All the nerve fibres and muscle fibres in a single muscle bundle
*******

: ANSWER KEY:
SET-1 SUB: PHYSICS
1 4 11 1 21 4 31 1 41 4
2 2 12 1 22 2 32 1 42 3
3 2 13 4 23 3 33 2 43 3
4 3 14 2 24 3 34 1 44 3
5 3 15 1 25 1 35 4 45 1
6 3 16 2 26 1 36 1 46 4
7 1 17 1 27 3 37 3 47 4
8 4 18 1 28 1 38 4 48 1
9 3 19 3 29 2 39 1 49 4
10 4 20 1 30 4 40 3 50 3
SUB:CHEMISTRY
51 2 61 3 71 1 81 3 91 4
52 1 62 1 72 4 82 3 92 2
53 4 63 2 73 1 83 3 93 2
54 3 64 4 74 2 84 1 94 4
55 4 65 4 75 4 85 2 95 1
56 2 66 2 76 1 86 3 96 1
57 3 67 2 77 1 87 3 97 3
58 1 68 1 78 3 88 1 98 1
59 4 69 1 79 1 89 3 99 4
60 4 70 1 80 2 90 1 100 2
SUB : BOTANY
101 3 111 3 121 3 131 1 141 4
102 4 112 4 122 1 132 4 142 2
103 1 113 3 123 2 133 3 143 2
104 4 114 3 124 2 134 4 144 3
105 1 115 1 125 4 135 4 145 4
106 2 116 2 126 3 136 4 146 3
107 4 117 1 127 1 137 3 147 1
108 4 118 1 128 3 138 3 148 2
109 2 119 1 129 2 139 4 149 1
110 2 120 2 130 2 140 3 150 3
151 2 161 3 171 2 181 4 191 2
152 3 162 3 172 2 182 2 192 3
153 2 163 1 173 1 183 4 193 1
154 2 164 3 174 4 184 4 194 4
155 1 165 4 175 2 185 2 195 2
156 3 166 2 176 2 186 1 196 2
157 4 167 4 177 4 187 4 197 4
158 4 168 1 178 3 188 1 198 1
159 2 169 2 179 4 189 4 199 3
160 2 170 1 180 3 190 3 200 3

NEET GRAND TEST - 6
answer sheet.
CORRECT.
Section-B;
Marking Scheme :

PHYSICS
SECTION – A
1. The speed (v) of ripples on the surface of water depends on surface tension (),
density () and wavelength (). The square of speed (v) is proportional to
  
1) 2) 3) 4) 
  
2. Value of current i in the following circuit is :-
1) 13A 2) 12A 3) 9A 4) None of the above

     
3. If A  B  3 A.B then the value of A  B is
  2)  A2  B 2  AB 
1/ 3 1/ 2
1) A2  B 2  3 AB
1/ 2
 AB 
3)  A2  B 2   4) A + B
 3
4. If the radius of curvature of the path of two particles of same masses are in the
ratio 1 : 2, then in order to have same centripetal acceleration, their velocity
should be in the ratio of
1) 1 : 4 2) 4 : 1 3) 2 :1 4) 1: 2
5. The pulleys and strings shown in figure are smooth and of negligible mass. For
the system to remain in equilibrium, the angle  should be
1) 450 2) 600 3) 750 4) 900

6. A stone tied to a rope is rotated in a vertical circle with uniform speed. If the
difference between the maximum and minimum tensions in the rope is 20N,
mass of the stone in kg is (g = 10ms-2)
1) 0.75 2) 1.0 3) 1.5 4) 0.5
7. Acceleration versus displacement of a particle executing S.H.M. is as shown in
given figure. The time period of its oscillation is (in sec)
1) /2 2) 2 3)  4) /4
8. In the given figure each capacitor is equal to 45F then the equivalent capacity
between A and B in the given circuit is
1) 15F 2) 10F 3) 40F 4) 135F

9. In YDSE, if a liquid is filled between the space of screen and slit, then
1) Central bright fringe will shift upward
2) Central bright fringe will not shift
3) Central bright fringe will shift downward
4) Central fringe may shift downward or upward
10. A body dropped from a height h onto the floor makes elastic collision with the
floor. The frequency of oscillation of its periodic motion is
1 g 1 2h 1 g g
1) 2) 3) 4) 2
2 2h 2 g 2 2h 2h
11. The refractive indices of glass and water w.r.t. air are 3/2 and 4/3 respectively.
The refractive index of glass w.r.t. water will be
1) 8/9 2) 9/8 3) 7/6 4) None of these
12. Following figures show the arrangement of bar magnets in different configurations.
Each magnet has magnetic dipole moment m. Which configuration has highest
net magnetic dipole moment?
1) 2) 3) 4)
13. A thermodynamic system is taken from state A to B along ACB and is brought
back to A along BDA as shown in the p-V diagram. The net work done during the
complete cycle is given by the area
1) p1ACBp2p1 2) ACBBAA 3) ACBDA 4) ADBBAA

14. The temperature of 5 moles of a gas at constant volume is changed from 1000C to
1200C. The change in internal energy is 80J. The total heat capacity of the gas
at constant volume will be in joule/kelvin is
1) 8 2) 4 3) 0.8 4) 0.4
15. At a pressure of 24 10 dyne/cm , the volume of O2 is 10 litre and mass is 20gm.
5 2
The r.m.s. velocity will be

1) 800 m/sec 2) 400 m/sec 3) 600 m/sec 4) 200 m/sec
16. A screen is placed 100 cm from a single slit which is illuminated with 5000 Å
light. If distance between the first and third minima of the diffraction pattern is
5mm. The width of the slit is
1) 2mm 2) 0.2m 3) 2 104 m 4) 4 105 m
17. A thin uniform rod of length “L” is bent at its mid point as shown in the figure.
The distance of the centre of mass from the point “O” is
L  L 
1) sin 2) cos
2 2 2 2
L  L  
3) sin 4) cos
4 2 4 2 O
18. Assuming that shear stress at the base of the mountain is equal to the force/area
due to its weight. Calcualte the maximum possible height of a mountain on the
earth if breaking shear stress for a typical rock is 30  107 Nm 2 and the density is
3  103 kgm 3
1) 4 km 2) 8 km 3) 10 km 4) 16km

19. Statement – I: The reactance of an ac circuit is zero. It is possible that the circuit
contains a capacitor and an inductor.
Statement – II: In ac circuit, the average power delivered by the source never
becomes zero.
20. In the given figure, if a very small hole is made in container, then which of
following will be correct?
H
1) v  2 gh 2) For Rmax , h  3) Rmax  H 4) All of these
2
21. The given truth table is for which logic gate?
A B Y
1 1 0
0 1 1
1 0 1
0 0 1
1) NAND 2) XOR 3) NOR 4) OR
22. The period of a satellite in an orbit of radius R is T. Its period of revolution in an
orbit of radius 4R will be
1) 2T 2) 2 2T 3) 4T 4) 8T
23. If temperature of ideal blackbody increased by 10%. Then percentage increase in
radiating power emitted from its surface will be
1) 10% 2) 40% 3) 46% 4) 100%
24. The amplitude of a wave represented by displacement equation
1 1
y sin t  cos t will be
a b
ab a b a b a b
1) 2) 3) 4)
ab ab ab ab
25. An electron of a stationary hydrogen atom passes from the fifth energy level to the
ground level. The velocity that the hydrogen atom acquired as a result of photon
emission will be (h – Plank’s constant, m – mass of electron, R – Rydberg
constant)
24hR 25hR 25m 24m
1) 2) 3) 4)
25m 24m 24hR 25hR
26. Nickel shows ferromagnetic property at room temperature. If the temperature is
increased beyond Curie temperature, then it will show
1) paramagnetic 2) anti-ferromagnetism
3) diamagnetism 4) no magnetic property
27. A vessel of depth 2d cm is half filled with a liquid of refractive index 1 and the
upper half with a liquid of refractive index 2 . The apparent depth of the vessel
seen perpendicularly is
   1 1  1 1   1 
1) d  1 2  2) d    3) 2d    4) 2d  
 1  2   1 2   1 2   12 
28. The current flowing in a coil of self inductance 0.4 mH is increased by 250 mA in
0.1 sec. The e.m.f. induced will be
1) + 1 V 2) – 1 V 3) +2 mV 4) – 1 mV

29. A wire can sustain a weight of 20kg before breaking. The wire is cut into two
halves, each part can sustain a force of
1) 10 kg 2) 20 kg 3) 40 kg 4) 80 kg
30. When a light of certain wavelength is incident on a plane surface of a material
making an angle of 300 with the plane, the reflected light is polarized. The angle
of refraction is
1) 60o 2) 30o 3) 45o 4) 40o
31. An infinite line charge produces a field of 9 104 N / C at a distance of 2cm.
calculate the linear charge density.
1) 10-5C/m 2) 10-6C/m 3) 10-7C/m 4) 10-8C/m
9
32. An electric dipole with dipole moment 4 10 C  m is aligned at 300 with the
direction of a uniform electric field of magnitude 5 104 N / C . What is the
magnitude of the torque acting on the dipole?
1) 10-2Nm 2) 10-3Nm 3) 10-4Nm 4) 10-5Nm
33. In elastic collision,
I. initial kinetic energy is equal to the final kinetic energy.
II. kinetic energy during the collision time t is constant.
III. total momentum is conserved.
Which of the above statement(s) is/are correct?
1) Only I 2) Both I and III 3) Only III 4) Only II
34. Four plates of the same area of cross section are joined as shown in figure. The
distance between each plate is d. The equivalent capacity across A and B will be
2 0 A 3 0 A 3 0 A  A
1) 2) 3) 4) 0
d d 2d d
35. Which of the following is not the unit of time
1) Micro second 2) Leap year 3) Lunar month 4) Parallactic second
SECTION – B
36. The potential difference between X and Y in volts is :
1) 1 2) -1 3) 2 4) -2
37. A charged particle is projected into a transverse uniform magnetic field. The area
enclosed by its path.
(i) Directly proportional to its KE.
(ii) Inversely proportional to square of charge.
(iii) Directly proportional to velocity.
(iv) Inversely proportional to time.
3) all are correct 4) i and iv are correct
38. Statement –1: The graph between velocity and displacement for a harmonic
oscillator is an ellipse.
Statement –2 : Velocity does not change uniformly with displacement in harmonic
motion.
for Statement-1

39. Three rods of equal length l are joined to form an equilateral triangle PQR. O is
the mid-point of PQ. Distance OR remains same for same change in temperature.
Coefficient of linear expansion for PR and RQ is same, i.e.,  2 but that for PQ is
 1 . Then,
1)  2  31
2)  2  41
3) 1  3 2
4) 1  4 2
40. A particle of mass 'm' is projected with a velocity 'v' making

an angle of 45 with the horizontal. The magnitude of angular momentum of the
o
projectile about the point of projection, when the particle is at its maximum height
is
mv3 mv3 2 mv3
1) Zero 2) 3) 4)
4 2g 2g g
41. A rectangular loop is being pulled at a constant speed v, through a region of
certain thickness d, in which a uniform magnetic field B is set up. The graph
between position x of the right hand edge of the loop and the induced emf E will
be
42. A circular coil of radius 5 cm has 500 turns of a wire. The approximate value of
the coefficient of self induction of the coil will be
1) 25 millihenry 2) 25 103 millihenry
3) 50 103 millihenry 4) 50 103 henry
43. Water flows steadily through a horizontal pipe of variable cross-section. If the
pressure of water is P at a point where flow speed is v, the pressure at another
point where the flow speed is 2v, is:-
3 v 2 v2 3 v 2
1) P  2) P  3) P  4) P   v
2
2 2 4
44. A sinusoidal voltage V(t)=210 sin 3000t volt is applied to a series LCR circuit in
which L = 10 mH, C  25  F and R  100  . The phase difference   between
the applied voltage and resultant current will be:
1) tan
1
 0.17  2) tan
1
 9.46 3) tan
1
 0.30  4) tan
1
13.33
45. A simple pendulum has length l and the mass of the bob is m, the bob is given a
charge q coulomb. The pendulum is suspended between the vertical plates of a
charged parallel plate capacitor. If E is the electric field strength between the
plates, the time period of the pendulum is given by
l 1 1 1
1) 2 2) 2 3) 2 4) 2
g qE qE  qE 
2
g g g 2

m m  
 m 

46. If maximum velocity with which an electron can be emitted from a photo cell is
4 108 cm / sec , the stopping potential is (mass of electron = 9  10–31 kg)
1)30 volt 2) 45 volt 3) 59 volt 4) Information is insufficient
47. Gas at a pressure P0 is contained in a vessel. If the masses of all the molecules
are halved and their speed are doubled, the resulting pressure P will be equal to
p
1) 4P0 2) 2P0 3) p0 4) 0
2
48. Consider a hypothetical hydrogen like atom. The wavelength in A0 for the
1500 p 2
spectral lines for transistion from n  p to n  1 are given by   where
p2  1
p  2,3,4 ….. The wavelength of the most energetic photon in this series is
1) 1800 A0 2) 1650 A0 3) 1500 A0 4) 1300 A0
49. The circuit given in figure, is equivalent to
1) AND gate 2) OR gate 3) NOT gate 4) NAND gate

50. For a satellite moving in an orbit around the earth, the ratio of kinetic energy to
potential energy is
1) 1/2 2) 1/ 2 3) 2 4) 2
CHEMISTRY
SECTION – A
51. The boiling points of two liquids A and B are 60o C and 76o C respectively. In the
solution of A and B liquids, it is found that average intermolecular attractions are
decreased. Then the boiling point of the solution is
1) 68o C 2)  76o C 3) below 60o C
4) Any temperature between 60o C and 76o C depending upon composition of
liquid mixture
52. Assertion (A): When a non-volatile solid is dissolved in a pure liquid, then it
freezes at lower temperature than the freezing point of pure liquid.
Reason (R) : When a non-volatile solid is added to pure liquid, vapour pressure
decreases and at low temperature solid and liquid forms show same vapour
pressure.
the assertion
53. The most suitable method for separation of 1:1 mixture of ortho- and para
nitrophenols is:
1) Steam distillation 2) Crystallisation 3) Sublimation 4) Chromatography
54. Which of the following properties increases across a period?
1) Reducing property 2) Size of atoms
3) Acidic nature of oxides 4) Metallic property
55. The electronegativity of the following elements increase in the order
1) C, N, Si, P 2) N, Si, C, P 3) Si, P, C, N 4) P, Si, N, C
O
56. What is the IUPAC name of  ?
H  C  CH 2  CH 2  O  CH 3
1) 2 – formyl methoxy ethane 2) methoxy propanal
3) 2 - methoxy propanal 4) 3 - methoxy propanal

57. In a given sample of hydrogen gas electrons are excited to 7th orbit and returned
to ground state. Then the total number of spectral lines formed is _____ and
number of spectral lines associated with colours is ______ respectively.
1) 21, 6 2) 21, 5 3) 15, 5 4) 15, 4
58. Which of the following set of quantum numbers(n, l, m, s) is valid?
1) 3, 3, -1, -1/2 2) 2, 3, +1, -1/2 3) 4, 2, -1, +1/2 4) 4, 1, -2, +1/2
59. A similarity between optical and geometrical isomerism is that
1) Each forms equal number of isomers for a given compound
2) Both are interconvertible isomers
3) Both are included in stereo-isomerism
4) They have no similarity
60. Chromyl ion is :
1) CrO2 2) CrO22 3) CrO 2 4) CrO23
61. To a given salt solution dol.H2SO4 is added. A colourless gas with rotten egg smell
is evolved. This gas turns lead acetate paper black. Then which of the following is
wrong?
1) Colourless gas liberated is H2S
2) H2S turns lead acetate paper black due to the formation of PbS.
3) The given salt contains sulphide ion.
4) The colourless gas becomes reddish brown on exposure to air.
62. Lyophilic sols are more stable than lyophobic sols because :
1) The colloidal particles have positive charge
2) The colloidal particles have no charge
3) The colloidal particles are highly solvated
4) There are strong electrostatic repulsions between the negatively charged
colloidal particles .
63. Which of the following has higher dipole moment?
1) CHCl3 2) CH2Cl2 3) CH3Cl 4) CCl4
64. For a given ionic solid, in water the solubility decreases with increase in
temperature. Then which of the following may be more appropriate reason for it?
1) Lattice energy is higher than its hydration energy
2) Heat of solution is positive
3) Hydration energy is higher than its lattice energy
4) Solid crystallises in ccp lattice
65. Assertion (A): In Benzene all six C-C bond lengths are same.
Reason (R) : Benzene molecule contains 12 and 3 bonds.
the assertion
66. Which of the following compounds cannot show tautomerism?
67. Give the correct order of increasing acidity of the following compounds.
ClCH 2COOH , CH 3CH 2COOH , ClCH 2CH 2COOH ,  CH 3 2 CHCOOH , CH 3COOH
I II III IV V
1) V<II<IV<I<III 2) IV<II<V<III y 3) y > x 4) Can’t predict

69. Among the following statemetns.
A) Among 14th group elements carbon has higher catenation power because C-C
bond enthalpy is relatively high
B) The isotope of carbon used in carbon dating technique is C-14
C) The IUPAC name of last element of 14th group element belonging to 7th period
is ununtrium.
70. CH3  CH  CH  CHO 
A
CH3  CH  CH  CH3
The best suitable reagent ‘A’ is
1) H2 / Ni 2) N 2 H 4 / KOH / Glycol ,  3) Zn  Hg / conc.HCl 4) HI / P(red )
71. C6 H 5CH 2CH 2CH 3 is when oxidised in the presence of hot, acidified KMnO4, the
product obtained is
1) C6 H 5CHO 2) C6 H 5COOH 3) C6 H 5CH 2CH 2CHO 4) C6 H 5COCH 3
72. Assertion (A) : Alkynes are more reactive than alkenes towards electrophilic
addition rection.
Reason (R) : Alkenes form stable carbocation than alkynes.
of the Assertion
of the Assertion
73. In alkaline medium, KMnO4 reacts as
2KMnO4 + 2KOH  2K2MnO4 + H2O + [O]
Hence, the equivalent weight of KMnO4 (MW = 158g/mol) is :
(1) 31.6 (2) 63.2 (3) 126.4 (4) 158
74. 30g of Mg is made to burnt in 30g of oxygen. Then the maximum possible weight
of MgO formed is _____g.
1) 30 2) 60 3) 75 4) 50
75. In the oxidation reaction, CH3OH→HCOOH, the number of electrons involved are
1) 4 2) 3 3) 2 4) 1
76. Assertion : Electrophilic substitution reactions in haloarenes occur slowly as
compared to those in benzene.
Reason : Halogens are ortho and para – directors.
of the Assertion
of the Assertion
77. Assertion : Melting points of isomeric dihalo-benzenes are the same.
Reason : Isomeric dihalobenzenes have similar molecular masses.
of the Assertion
of the Assertion
78. Incorrect statement about SF4 is
1) See-saw structure 2) sp 3d hybridisation
3) One lone pair is present on Sulphur 4) Sulphur is in second excited state
79. Which of the following can not undergo reaction with F2 even under specified
experimental conditions?
1) Ne 2) Xe 3) Rn 4) Kr
80. For a zero order reaction, when initial conc. of reactant is 2M, the rate of reaction
is 4  103 M .min1 . After 20min. conc. of reactant is decreased to 1.92M. Then the
rate of reaction after 20 min is ______M. min-1
1) 4  103 2) 7.68  103 3) 8  103 4) 2.08  103

81. For reaction, A + B → products, rate of the reaction is increased by 8 times when
the conc. of both A and B is doubled. The rate of reaction remains same when the
conc. of ‘B’ alone is doubled. Then the correct rate law is _____
1) Rate = K[A]2[B] 2) Rate =K[A]3[B]0 3) Rat = K[A]4[B]1 4) Rate = K[A]4[B]0
82. Phenol reacts with bromine in CS2 at low temperature to give
1) m-bromophenol 2) o-and p-bromophenol
3) p-bromophenol 4) 2,4,6-tribromophenol
83. How many phenolic isomers of a compound C7H8O will give toluene on distillation
with Zn dust?
1) 1 2) 2 3) 3 4) 4
84. What will be the heat of formation of methane, if the heat of combustion of
carbon is ‘–x’ kJ, heat of formation of water is ‘–y’ kJ and heat of combustion of
methane is ‘–z’ kJ?
1) (– x – y + z)kJ 2) (– z – x + 2y)kJ 3) (– x – 2y- z)kJ 4) (– x – 2y + z)kJ
85. The molar specific heats of an ideal gas at constant pressure and volume are
C
denoted by CP and CV respectively. If   P and R is the universal gas constant,
CV
then CV is equal to
1  R  1
1) 2) 3) 4)  R
1   1 R
SECTION – B
86. Mark the correct statement(s)
(i) Manganese can exhibit maximum +7 oxidation state
(ii) Zinc forms coloured ions
(iii) [CoF6]3- is diamagnetic
(iv) Sc can show +4 oxidation state
(v) Zn exhibits only +2 oxidation state in its compounds.
1) (i) and (ii) 2) (i) and (v) 3) (ii) and (iv) 4) (iii) and (iv)
(i) La(OH)3 is the least basic among hydroxides of lanthanides
(ii) Zr and Hf posses almost the same atomic radii.
(iii) Ce4+ can act as an oxidizing agent.
Which of the above is/are true?
1) (i) and (iii) 2) (ii) and (iii) 3) (ii) only 4) (i), (ii) and (iii)
Column-I (Compounds) Column-II (Differentiate by)
A) MeOH and EtOH (p) Lucas reagent
B) OH (q) NaOH + I2
OH
and
C) O (r) 2,4-DNP
H
and
O
D) O (s) Fehling soluiton
HCHO and Me  C  OH
Codes :
A B C D A B C D
1) q,r q,p q,s r,s 2) q,p q,r q,s r,s
3) q,r q,s p,q p,r 4) q q,p q,s r,s
89. Which of the follwiong is least reactive towards Grignard reagent?
O O
1) 2) CH 3  CH  O 3) C2 H 5  CH  O 4)
H C  H CH 3  C  CH 3
90. In which of the following complexes C – O bond length is shortest?
2) Cr  CO 6 
2  
1)  Fe  CO 6  3) V  CO 6  4)  Mn  CO 6 

91. Which of the foillowing is wrong?
1) All octahedral complexes of Mn3+ ion are paramagnetic irrespective of nature of
ligand.
2) To show linkage isomerism, the complex compound must have ambidentate
ligand.
3) In complexes, ligands act as Lewis acids
2
4) Both  Ni  CO 4  and  Ni  CN  4  are diamagnetic
92. The oxidation number of iron in [Fe(CO)5] is
1) Zero 2) +2 3) +1 4) -1
93. K C for the reaction:
 CO g   H 2O g 
CO2 g   H 2 g  
is found to be 16 at a given temperature. Originally equal number of moles of H2
and CO2 were placed in the flask. At equilibrium, the pressure of H2 is 1.20 atm.
What is the partial pressure of CO and H2O ?
1) 1.20 atm. each 2) 2.40 atm. each 3) 4.80 atm. each 4) 9.60 atm.
each
94. Which of the following is given wrong order?
1) I   Br   Cl   CN   Basic strength
2) HClO4  HClO3  HClO2  HClO  Ka
3) CsOH  RbOH  KOH  NaOH  Kb
4) FCH 2COOH  ClCH 2COOH  BrCH 2COOH  pkb
95. The pH of 0.01M of a salt, MCl [Kb of MOH = 10-6] is _____
1) 2 2) 10 3) 5 4) 4
96.
Above reaction is known as:

1) Gatter mann reaction 2) Sandmeyer's reaction
3) Balz scimann reaction 4) Stephen's reaction
97. Which of the following reagents will convert p-methylbenzenediazonium chloride
into p-cresol?
1) Cu powder 2) H2O 3) H3PO2 4) C6H5OH
98. The molar conductances of HCl, NaCl and CH3COONa are 426, 126 and
91-1cm2mol-1 respectively. The molar conductance for CH3COOH is
1) 561-1cm2mol-1 2) 391-1cm2mol-1
3) 261-1cm2mol-1 4) 612-1cm2mol-1
99. A reversible galvanic cell is connected to an external battery. If the EMF of the
battery is less than EMF of the galvanic cell, current
1) Will not pass through the circuit
2) Flows from the battery into the galvanic cell
3) Flows from the galvanic cell into the battery
4) All the three may take place
100. Which of the following aminoacid is essential amino acid?
1) Alanine 2) Proline 3) Valine 4) Glutamic acid
BOTANY
SECTION – A
101. Which of the following has abundant reserve food materials in the ovule?
1) Integuments 2) Hilum 3) Nucellus 4) Funicle
102. Which type of linkage/bond is formed when two nucleotides are linked to form a
dinucleotide?
1) N-glycoside linkage 2) Peptide bond
3) Phosphodiester linkage 4) Both 1 & 2


A. Pollen grains are well preserved as fossils because of the presence of
sporopollenin
B. Intine in pollen grain is a thin and continuous layer made up of cellulose and
pectin.
1) Only statement A is incorrect 2) Only statement B is incorrect
3) Both the statements are incorrect 4) Both the statements are correct
104. State true T or false F for given statement and choose the correct option.
a. The lac operon consists of two regulatory genes and four structural genes.
b. The y gene codes for permease, which increases permeability of the cell to
 -galactosides.
a b a b a b a b
1) T T 2) T F 3) F T 4) F F
1) A translational unit in mRNA is the sequence of RNA that flanked by the start
codon(UAA) and the stop codon (AUG).
2) An mRNA has some additional sequence that are not translated and are
referred as untranslated regions(UTR)
3) The UTRs are present at both 5'-end and 3'-end
4) Regulation of lac operon by repressor is referred as negative regulation
106. A. The DNA-dependent DNA polymerases catalyse polymerization only in one
direction, that is 5' → 3'
B. The DNA-dependent RNA polymerase catalyses the polymerization only in one
direction, that is 3' →5
Choose the correct option for the given statements
1) Only statement A is correct 3) Both the statements are correct
2) Only statement B is correct 4) Both statements are incorrect
107. Select the incorrect match
1) Aspergillus Niger - Acetic acid 2) Lactobacillus — Lactic acid
3) Saccharomyces — Ethanol 4) Clostridium butylicum — Butyric acid
108. Which of the following is a member of Phaeophyceae?
1) Volvox 2) Porphyra 3) Laminaria 4) Both 1 & 2
109. How many chromosomes will be found in a cell of at anaphase- II, if meiocyte has
2n=50 ?
1) 50 2) 40 3) 100 4) 25
110. Which of the following characters are belongs in family leguminaceae?
A) Stamens found in single bundle
B) Placenta forms a ridge along the ventral suture of the ovary
C) False septum called replum makes the ovary into two locules.
D) Vexillary aestivation is found in first whorl of the flower.
1) Both B & D 2) Only A 3) Only B 4) Both A & B
111. Observe the following :
X Y
| |
C  C 
 X Y  C  C
Which class of enzymes catalyse the reaction?.
1) Ligases 2) Hydrolases 3) Lyases 4) Isomerases
112. Which of following is correct sequence of different phase of prophase I of meiosis?
a) Zygotene b) Pachytene c) Leptotene d) Diplotene e) Diakinesis
1) a → b → c → e → d 2) b → a → d → c → e
3) c → b → a → d → e 4) c → a → b → d →e
113. Which of the following is called DNA sugar?
1) C6 H10O5 2) C10 H10O5 3) C5 H10O4 4) C5 H10O6
114. Which of the following chromosomes has centromere slightly away from the
middle of the chromosome resulting into one shorter arm and one longer arm?
1) Metacentric 2) Acrocentric 3) Sub-metacentric 4) telocentric

115. Select the incorrect match w.r.t examples of classes of fungi

1) Phycomycetes-Albugo, Colletotrichum
2) Basidiomycetes- Ustilago, Puccinia
3) Deuteromycetes- Trichoderma, Alternaria
4) Ascomycetes- Neurospora, Claviceps
1) Smooth endoplasmic reticulum is extensive and continuous with the outer
membrane of the nucleus
2) In animal cells, steroidal hormones are synthesized in smooth endoplasmic
reticulum
3) Golgi apparatus is the important site of formation of glycoproteins
4) Golgi apparatus remains in close association with the endoplasmic reticulum
117. All of the following are correct w.r.t the spring wood, except
1) Lighter in colour 2) Has a higher density
3) Vessels have wider lumen 4) Is also called early wood
118. Which of the following is incorrect w.r.t anatomy of the monocotyledonous stem?
1) The ring arrangement of vascular bundles is a characteristic of monocot
system
2) The phloem parenchyma is generally absent
3) Vascular bundles are conjoint and closed
4) Monocot stem has as sclerenchymatous hypodermis
119. Select the incorrect statement w.r.t C4 plants
1) They are adapted to the tropical conditions
2) They have a special type of leaf anatomy
3) They perform a process called photorespiration
4) They tolerate higher temperature
120. Find out the wrong statement regrading bryophytes
1) The plant body of bryophytes is more differentiated than of algae
2) The Sporophyte of bryophyte is haploid
3) The sex organs in bryophytes are multicellular
4) The male sex organs is called antheridium
121. Match the classes of pteridophytes with their example given below and choose the
correct option
Column — I Column - II
a) Lycopsida i) Equisetum
b) Liverworts ii) Dryopteris
c) Pteropsida iii) Selaginella
d) Sphenopsida iv) Marchantia
1) a-ii, b-iii, c-iv, d-i 2) a-iii, b-iv, c-ii, d-i
3) a-iii, b-i, c-ii, d-iv 4) a-ii, b-i, c-iv, d-iii
122. During the tricarboxylic acid cycle(TCA), a molecule of GTP is synthesized during
conversion of
1) a - Ketoglutaric acid to succinyl —CoA 2) Succinic acid to fumaric acid
3) Succinyl CoA to succinic acid 4) Malic acid to oxaloacetic acid
123. In pea plants, yellow seeds are dominant to green. If a heterozygous yellow seeded
plant is crossed with a green seeded plant, what ratio of green and yellow seeded
plants would you expect in Flgeneration ?
1) 3 : 1 2) 1 : 2 3) 1 : 1 4) 9 : 1
124. Z-scheme of photosynthesis involves
1) Ps-II 2) Ps-I 3) Electron carriers 4) All of these
125. Identify the following compound and select the correct option.
1) Adenine 2) Adenosine 3) Uracil 4) Uridine

126. Final electron acceptor in oxidative phosphorylation is
1) Oxygen 2) H2O 3) cyt-b6 4) NADH2
127. What will be the amount of DNA in meiosis II product if meiocyte is containing
20 pg DNA in G1 phase?

1) 10 pg 2) 5 pg 3) 20 pg 4) 15 pg
128. Presence of conjuctive tissue is a characteristic feature of
1) Dicot leaf 2) Dicot root 3) Monocot stem 4) Monocot leaf
129. A : These are thin walled parenchymatous cells with numerous intercellular
spaces produced by activity of phellogen.
B : They create pressure on epidermis which soon results in rupture of epidermal
cells and from lenticels. Above statements are true for
1) Hydathodes 2) Stomata 3) Complementary cells 4) Bulliform cells
130. How many molecules of ATP are required in reduction step of calvin cycle to
produce one molecule of sucrose?
1) 12 2) 24 3) 18 4) 36
131. Statement A : Mosses along with lichens are the first organisms to colonise
rocks.
Statement B : Diploid spores germinate to produce gametophyte in bryophytes.
Correct the above statements and select the correct option
132. Surface area of a leaf has increased from 50 cm2 to 55 cm2. Calculate its relative
growth rate and select the correct option
1) 5 % 2) 10 % 3) 50 % 4) 100 %
133. Choose the substrate level phosphorylation reaction step
1) PEP → Pyruvate 2) Succinyl CoA → Succinate
3) 1,3 bispGA → 3pGA 4) All of the above
134. How many mitotic divisions are needed to produce 1000 male gametes in
mustard plant?
1) 125 2) 1000 3) 250 4) 2000
135. How many three carbon compounds formed in glycolysis as an end product?
1) 4 2) 6 3) 2 4) 8
SECTION – B
136. Synthesis of which of the following will be affected if RNA polymerase III is
removed from the cell?
1) 5.8S rRNA 2) 5S rRNA 3) 28S rRNA 4) hnRNA
137. The starch synthesis regarding the grain size in garden pea show A for Bb
genotype. Here A is
1) Codominance 2) Dominance
3) Incomplete dominance 4) Multiple allelism
138. A : It is produced by the bacterium and is modified by genetic engineering.
B : It is used as clot buster for removing clots from the blood vessels of patients
who have undergone myocardial infraction.
Above statements are true for
1) Statins 2) Proteases 3)Streptokinase 4)Cyclosporin A
139. Exalbumins seeds from the following are
a) Sunflower b) Cauliflower c) Tomato d) Mustard
e) Maize f) Barley g) Pea h) Castor
1) a,b,g,h 2) a,b,c,d,g 3) c,e,f,h 4) a,b,d,g
140. Bacterial transcription requires
a) DNA segment b) RNA polymerase c) Sigma factor
d) Rho factor e) Promoters f) Capping
1) a,b,c,d,e,f 2) b,c only 3) d,e only 4) a,b,c,d,e
141. G2 phase of cell cycle involves duplication of all the organelles, except
1) Centrioles 2) Chloroplast 3) Mitochondria 4) Golgi bodies
142. The infectious RNA particles which are devoid of protein coat are
1) Viruses 2) Prions 3) Both 4) Viroids
143. Margins of petals in whorl just touch each other with out overlapping in
1) China rose 2) Calotropis 3) Cotton 4) Cassia
144. How many heterozygous round yellow seeds are formed in f2 generation of
dihybrid cross?

3 4 1 2
1) 2) 3) 4)
16 16 16 16
145. Which among the following algae has stored food very similar to amylopectin and
glycogen?
1) Laminaria 2) Porphyra 3) Ulothrix 4) Fucus
146. The process through which multiple copies of the gene (or DNA) of interest are
synthesized in — vitro requires all, except
1) DNA polymerase 2) Primers
3) DNA templates 4) Stirrer
147. Ratio 1 : 2 : 1 is applicable to
A) Phenotype of monohybrid cross
B) Genotype of dihybrid cross
C) Phenotypic ratio of incomplete dominance
D) Genotypic ratio of incomplete dominance
E) Phenotypic ratio of dihybrid cross
F) Genotypic ratio of monohybrid cross
1) C,D,F 2) C,D,E,F 3) A,B,C 4) B,C,D,E
148. Formation of sexual spore is absent in
1) Aspergillus 2) Albugo 3) Agaricus 4) Trichodenna
149. A : These organisms have a very simple structure but are very complex in
behavior.
B : They exhibit a primitive form of sexual reproduction
C : They lack nuclear membrane. The above given statements are true for
1) Bacteria 2) Fungi 3) Plants 4) Protists
150. How many fragments are formed, if a ds-circular DNA has 6 recognition sites?
1) 7 2) 3 3) 6 4) 12
ZOOLOGY
SECTION – A
151. A genetic disorder which transmits from carrier female parent to male progeny
only is _____
1) X linked recessive 2) X linked dominant
3) Autosomal recessive 4) Autosomal dominant
152. Which of the following uses X-rays to detect cancers of internal organs?
a) MRI b) CT scan c) Radiography d) Biopsy
1) a,b 2) b,c 3) c,d 4) a,d
153. Which of the following represents the paleontological evidence of evolution?
1) Presence of analogous structures.
2) Presence of vestigial parts
3) Presence of homologous structures
4) Preserved remains of dinosaurs obtained from sedimentary rocks.
154. Assertion (A) : The Pyramid of biomass is always upright for the tree ecosystem
Reason (R) : The total biomass of a tree in a specific area is more than that of
herbivores
1) Both A and R are true, and the R is a correct explanation of the A
2) Both A and R are true, but R is not a correct explanation of the A
3) A is true, but the R is false
4) Both A and R are false
155. Why to choose close relative as a donor during kidney transplantation?
1) To minimise the chances of blood clotting
2) To minimise the chances of rejection of transplant
3) To administrate immunosuppressants through out life
4) To increase the success rate of haemodialysis usage
156. Which one of the following has the greatest biodiversity on earth?
1) Tropical Amazon rain forest 2) Eastern ghats
3) Western ghats 4) All of these
157. The value of ‘Z’ lies in the range of ______ regardless of the taxonomic group or
the region.
1) 0.5 to 0.7 2) 0.3 to 0.7 3) 0.2 to 0.3 4) 0.1 to 0.2
158. Which of the following trait is not a characteristic of frog?

1) Scaleless skin 2) Aquatic reproduction
3) Copulatory pad on hind limb 4) Cutaneous respiration
159. During copulation, cockroach transfers male gametes in the form of

1) Sperms 2) Spermatophore
3) Seminal vesicles 4) Spermatid
160. In male cockroach, mushroom shape gland, acting as an accessory reproductive
gland is situated in the ______ abdominal segments
1) 4th – 5th 2) 6th – 7th 3) 7th – 8th 4) 8th – 9th
161. Abortions are much more riskier in
1) 1st Week 2) 2nd Week 3) 3rd Week 4) Second Trimester
162. The regions which makeup the brian stem are all except ____
1) Mid brain 2) Pons 3) Amygdala 4) Medulla oblongata
163. Find out the correct statement.
1) Permanent outward movement of some individual from a local population is
called immigration
2) Size of gene pool and local population decreases due to immigration
3) Maximum birth rate achieved under ideal conditions is called mortality
4) Immigration may contribute more significantly to population growth than birth
rates, in a just colonized new habitat
164. Select an incorrect statement for “J”-shaped growth curve.
1) Presence of asymptote phase 2) Prolanged exponential phase
3) Density independent 4) All of these
165. Observe the figure given below:
Find out correct option for B.

1) In association with DCT have built-in mechanism for the regulation of GFR.
2) Where large amount of water could be reabsorbed during urine formation
3) Forms peritubular capillaries around renal tubule
4) Is functional unit of kidney
166. Which among the following is not true w.r.t Pyramid of energy?
1) It is always upright.
2) The amount of energy at the lower trophic level is highest.
3) With successive trophic levels, some energy is lost.
4) The highest amount of energy is present at the higher trophic level.
167. Excretion in tadpole is
1) Ammonotelic 2) Ureotelic 3) Urecotelic 4) Both 1 and 2
168. Which of the following proteins is required for coagulation?
1) Fibrinogen 2) Globulin 3) Albumin 4) All of these
169. Number of erythrocytes in mm-3 blood are
1) 4.5 to 5 million 2) 5 to 5.5 million
3) 5.5 to 6.5 million 4) 3 million
170. Select the true statement about RBC
1) RBCs have an average life span of 120 days.
2) RBCs are destroyed in the spleen (graveyard of RBCs)
3) RBCs are devoid of nucleus in most of the mammals
4) All of these
171. Special creation theory has three connotations. Select the correct among the
following.
1) All living organisms (Species or types) that we see today were created as such.
2) The diversity was always the same since creation and will be the same in
future also
3) Earth is about 4.5 billion years old.
4) Both 1 & 2
172. Choos the correct match.
A) Amoebiasis - p) Muscular pain

B) Typhoid - q) Abdominal pain
C) Ascariasis - r) Stomach pain
1) A-p, B-q, C-r 2) A-q, B-r, C-p 3) A-r, B-q, C-p 4) A-q, B-p, C-r
173. Which one of the following statements is correct about all the four of jellyfish,
starfish, platypus and pigeon?
1) Pigeon is homeothermic while the remaining three are poikilothermic.
2) Starfish is a marine form while all other are freshwater forms.
3) Jellyfish has cnidocytes all others lack cnidocytes.
4) Starfish is radially symmetrical while all others are bilaterally symmetrical
174. __________ is slow and takes time to give its full effective response
1) Passive immunity 2) Auto immunity
3) Active immunity 4) Both 1 and 3
175. All of the following factors play role in the regulation of respiratory rhythm except
1) CO2 2) H+ conc.
3) O2 4) None of the above is correct
Column-I Column-II
(i) Relaxin a) Formation of milk
(ii) Prolactin b) Ovulation
(iii) Progesterone c) Parturition
(iv) LH d) Pregnancy hormone
1) i-a, ii-c, iii-b, iv-d 2) i-c, ii-d, iii-b, iv-a
3) i-c, ii-b, iii-d, iv-a 4) i-c, ii-a, iii-d, iv-b
177. The technique of DNA fingerprinting was initially developed by _____
1) F.Sanger 2) Alec Jeffreys 3) Jacob 4) Jacque Monod
178. Two halves of pelvic girdle are joined together by
1) Pubic symphysis 2) Acromion 3) Glenoid 4) Clavicle
179. At present, about ______ recombinant therapeutics have been approved for
human-use the world over.
1) 12 2) 30 3) 20 4) 8
180. Which one of the following statements is incorrect about notochord?
1) It is present only in larval tail in Ascidia
2) Present during embryonic state in Rana.
3) It is present throughtout life in Amphioxus.
4) Absent even during embryonic stage in Homo sapien.
181. Among the following hormones, how many of them bind and interact with intra
cellular receptors?
Insulin, Glucagon, FSH, LH, ACTH, Prolactin, TSH, GH, Testosterone, Cortisol,
estradiol, GnRH, Progesterone, Somatostatin, Aldosterone
1) 5 2) 6 3) 7 4) 8
182. In man thoracic cage (or) ribcage composed of :
1) Ribs and thoracic vertebrae only
2) Ribs and sternum only
3) Ribs, sternum and thoracic vertebrae
4) Ribs, sternum and cervical vertebrae
183. The _______ is the basis of DNA fingerprinting as well as genetic mapping of
human genome
1) Exon sequences 2) Polymerization 3) Polymorphism 4) Anticodons
184. If a normal man marries a woman who is carrier for haemophilia, what is the
probability that their sons will be haemophilic?
1) 25% 2) 50% 3) 75% 4) 100%
(I) Invertebrates (A) 350 mya
(II) Jawless fish (B) 500 mya
(III) Sea weeds (C) 320 mya
.
(IV) Fish like reptiles (D) 200 mya
(A) (B) (C) (D) (A) (B) (C) (D)
1) II I III IV 2) I II III IV
3) IV III II I 4) I III II IV

SECTION – B
186. The individual with Phenylketonuria (PKU), lacks enzyme ___A___ which forms
amino acid ___B___ from ___C___
1) A- Thrombokinase ,B- valine , C- Glutamic acid
2) A- Phenylalanine hydroxylase, B- Phenylalanine, C-Tyrosine
3) A- phenylalanine hydroxylase, B-Tyrosine, C-Phenylalanine
4) A- Tyrosinase, B-Phenylalanine, C-Tyrosine
187. The correct sequence with respect to Sickle cell anaemia is
1) A -GAG , B-GUG 2) A -CTC, B-CAC 3) A-GAG, B-GTG 4) A-CTC, B-GUG

188. Stud the following statements.
Statement I: Any calculation of energy content, biomass, or numbers has to
include all organisms at that trophic level.
Statement II : One must remember that the trophic level represents a functional
level, not a species as such.
189. Presently A per cent of all birds species, B per cent of all mammal species,
C per cent of all amphibian species and D per cent of all gymnosperm
species in the world face the threat of extinction.
1) A-23, B-12, C-32, D-31 2) A-12, B-31, C-23, D-32
3) A-12, B-23, C-32, D-31 4) A-23, B-32, C-12, D-31
190. Assertion (A) : Evolution is not a directed process in the sense of determinism.
Reason (R) : Evolution is based on chance events that occur in nature.
1) Both A & R are correct but R is not correct explanation of A
2) Both A & R are correct and R is correct explanation of A
3) A is correct but R is incorrect
191. Statement –I : Peripheral nervous system consist two types of nervefibers.
Statement –II : The axon terminal contain synaptic vessicles without neuro
transmitters.
192. In context of Amniocentesis, which of the following statement is incorrect?
1) It is used to legally check female foeticides.
2) It is also can be used for prenatal sex determination.
3) It can be used for detection of Down syndrome.
4) It can be used for detection of Genetic disorders after delivery
193. Match the common name with its class:
(a) Man (i) Monocotyledonae
(b) Housefly (ii) Dicotyledonae
(c) Mango (iii) Mammalia
(d) Wheat (iv) Insecta

(a) (b) (c) (d) (a) (b) (c) (d)
1) ii i iii iv 2) iii iv ii i
3) iii ii iv I 4) i ii iv iii
194. Assertion : All copulations not lead to fertilisation.
Reason : Fertilisation can only occur if the ovum and sperms are transported
simultaneously to the ampullary region.
of Assertion
195. Different respiratory volumes are given below-
I. Tidal Volume= 500 ml
II. Residual Volume= 1000 ml
III. Inspiratory Reserve Volume= 2500 ml
IV. Expiratory Reserve Volume = 1000 ml
The functional residual capacity (FRC) is-
1) 3500 ml 2) 2000 ml 3) 600 ml 4) 3000 ml
196. Which of the following sequences is correct for inspiration?
I. The contraction of external intercostal muscles raises the ribs and sternum
II. Volume of thorax increases in the dorso-ventral axis
III. Intrapulmonary pressure decreases
IV. Diaphragm contraction
V. Air rushes into lungs
VI. Volume of thorax increases in the antero-posterior axis
1) IV, VI, I, II, III, V 2) I, II, III, IV, V 3) I, II, IV, VI, III, V 4) VI, I, II, III, V
197. Sexual stages of plasmodium develop in
1) Blood platelets 2) Lymph vessels
3) Red blood cells 4) White blood cells
198. The first transgenic cow, Rosie produced
1) Human calcium enriched milk (2.4 g/litre)
2) Human protein enriched milk (2.4 g/litre)
3) Human calcium enriched milk (2.6 g/litre)
4) Human protein enriched milk (2.8 g/litre)
199. Match column I with column II and select the correct match only.
Column I Column II
A) Choanocytes I. Fasciola
B) Cnidoblast II. Pleurobrachia
C) Flame cells III. Sycon
D) Nephridia IV. Pheretima
E) Comb plates V. Ancylostoma
1) A only 2) A,B,C and D only 3) D only 4) C,D and E only
200. Under-production of Adrenal cortex hormones alters the ________ metabolism
leading to a disease called _________
1) Protein, Addison’s disease 2) Fat, Grave’s disease
3) Carbohydrate, Addison’s disease 4) Carbohydrate, Grave’s disease
*******

: ANSWER KEY:
SET-1 SUB: PHYSICS
1 1 11 2 21 1 31 3 41 2
2 1 12 3 22 4 32 3 42 1
3 2 13 3 23 3 33 2 43 1
4 4 14 2 24 4 34 2 44 1
5 1 15 3 25 1 35 4 45 4
6 2 16 3 26 1 36 1 46 2
7 2 17 4 27 2 37 1 47 2
8 4 18 3 28 4 38 3 48 3
9 2 19 2 29 2 39 4 49 1
10 1 20 4 30 2 40 2 50 1
SUB:CHEMISTRY
51 3 61 4 71 2 81 2 91 3
52 1 62 3 72 4 82 2 92 1
53 1 63 3 73 4 83 3 93 3
54 3 64 3 74 4 84 4 94 4
55 3 65 2 75 1 85 2 95 3
56 4 66 4 76 2 86 2 96 2
57 2 67 2 77 4 87 2 97 2
58 3 68 3 78 4 88 4 98 2
59 3 69 2 79 1 89 4 99 3
60 2 70 2 80 1 90 1 100 3
SUB : BOTANY
101 3 111 3 121 2 131 1 141 1
102 3 112 4 122 3 132 2 142 4
103 4 113 3 123 3 133 4 143 2
104 3 114 3 124 4 134 2 144 2
105 1 115 1 125 3 135 3 145 2
106 1 116 1 126 1 136 2 146 4
107 1 117 2 127 1 137 3 147 1
108 3 118 1 128 2 138 3 148 4
109 1 119 3 129 3 139 4 149 1
110 3 120 2 130 2 140 4 150 3
151 1 161 4 171 4 181 1 191 3
152 2 162 3 172 2 182 3 192 1, 4
153 4 163 4 173 3 183 3 193 2
154 1 164 1 174 3 184 2 194 1
155 2 165 3 175 3 185 1 195 2
156 1 166 4 176 4 186 3 196 1
157 4 167 1 177 2 187 3 197 3
158 3 168 1 178 1 188 4 198 2
159 2 169 2 179 2 189 3 199 3
160 2 170 4 180 4 190 2 200 3

NEET GRAND TEST - 7
answer sheet.
CORRECT.
Section-B;
Marking Scheme :

PHYSICS
SECTION – A
1. Two cells X and Y are connected to a resistance of 10 as shown in the figure.
The terminal voltage of cell Y is:
1) Zero 2) 2V 3) 4V 4) 10V
2. A screw gauge gives the following reading when used to measure the diameter of
a wire.
Main scale reading : 0 mm
Circular scale reading : 52 divisions
Given that 1 mm on main scale corresponds to
100 divisions of the circular scale.
The diameter of wire from the above data is
1) 0.052 cm 2) 0.026 cm 3) 0.005 cm 4) 0.52 cm
3. Two particles X and Y having equal charges, after being accelerated through the
same potential differences enter a region of uniform magnetic field and describe
circular paths of radii R1 and R2 respectively. The ratio of the mass of X to that of
Y is
1)  R1 / R2  3)  R1 / R2 
1/ 2 2
2) (R2/R1) 4) (R1/R2)
4. A particle moves along a semicircle of radius 10m in 5 seconds. The average
velocity of the particle is
1) 2 ms 1 2) 4 ms 1 3) 2 ms 1 4) 4 ms 1
5. A bar magnet of length l and magnetic dipole moment M is bent in the form of an
arc as shown in figure.
The new magnetic dipole moemtn will be

3 2 M
1) M 2) M 3) M 4)
  2
6. Which of the following is a one dimensional motion?
1) Landing of an aircraft 2) Earth revolving around the sun
3) Motion of wheels of moving train 4) Train running on a straight track
7. For the system shown in figure both the block A and B are moving together. If
coefficient of friction between both the blocks is , the work done by friction on
block B is :
1) Zero 2) Negative 3) Positive 4) None of these

8. A bar magnet of magnetic moment M is placed at right angles to a magnetic
induction B. If a force F is experienced by each pole of the magnet, the length of
the magnet will be
1) MB/F 2) BF/M 3) MF/B 4) F/MB

9. A particle of mass m executes SHM with amplitude ‘a’ and frequency ‘v’. The
average kinetic energy during motion from the position of equilibrium to the end
is:
1
1) 2 ma 2 v 2 2)  2 ma 2 v 2 3) ma 2 v 2 4) 4 2 ma 2 v 2
4
10. Given below are two statements.
Statement – I: Maximum power is dissipated in a circuit containing an inductor,
a capacitor and a resistor connected in series with an AC source, when resonance
occrus
Statement – II: Maximum power is dissipated in a circuit containing pure
resistor due to zero phase difference between current and voltage.
In the above statements, choose the correct answer from the options are given
below.
11. Calcualte the power for following F-V curves.
1) 30W 2) 40W 3) 45W 4) 50W

12. What is the coefficient of mutual inductance when the magnetic flux changes by
2  10 2 Wb and change in current is 0.01A
1
1) 2 henry 2)3 henry 3) henry 4) Zero
2
13. A capacitor of capacitance 1000  F is connected to an alternating source of emf
given by E  30sin 100t V . The maximum value of current in the circuit is
approximately equal to:
1
1) 3A 2) A 3) 2A 4) 2 2A
2
14. How much heat energy in joules must be supplied to 14 gms of nitrogen at room
temperature to raise its temperture by 400C at constant pressure? (mol. wt. of
N2 = 28 gm, R = constant)
1) 50R 2) 60R 3) 70R 4) 80R
15. Which curve shows the relationship between the energy 𝐸 and the wavelength 𝜆 of
a photon of electromagnetic radiation?
16. Among gravitational, electrostatic and nuclear forces, the two attractive forces
between two neutrons are
1) Electrostatic and nuclear 2) Electrostatic and gravitational
3) Gravitational and nuclear 4) Electrostatic
17. A nucleus ruptures into two nuclear parts which have their velocity-ratio as 2 : 1.
The ratio of the their nuclear sizes (nuclear radii) is
1) 21/ 3 :1 2) 31/ 2 :1 3) 1: 21/ 3 4) 1:31/ 2

18. For a gas, the difference between the two specific heats is 4150 J Kg1K 1 and the
ratio of specific heats is 1.4. What is the specific heat of the gas at constant
volume in J Kg 1K 1 ?
1) 8475 2) 5186 3) 1660 4) 10375
19. In figure, V0 is the potential barrier across ap-n junction, when no battery is
connected across the junction.
1) 1 and 3 both correspond to forward bias of junction

2) 3 corresponds to forward bias of junction and 1 corresponds to reverse bias of
junction
3) 1 corresponds to forward bias and 3 corresponds to reverse bias of junction
4) 3 and 1 both correspond to reverse bias of junction
20. Find the false statement.
1) Gravitational force acts along the line joining the two interacting particles
2) Gravitational force is independent of medium
3) Gravitational force forms an action-reaction pair
4) Gravitational force does not obey the principle of superposition
21. Four equipotential curves in an electric field are shown in the figure. A, B and C
are three points in the field. If electric intensity at A, B, C are EA, EB and EC
respectively, then
1) EA = EB = EC 2) EA > EB > EC 3) EA < EB < EC 4) EA > EB < EC

22. A car is travelling along a curved road of radius r. If the coefficient of friction
between the tyres and the road is  , the car will skid if its speed exceeds
1) 2  rg 2) 3 rg 3) 2  rg 4)  rg
23. If for hydrogen CP – CV = m and for nitrogen CP – CV = n, where CP and CV refer to
specific heats per unit mass respectively at constant pressure and constant
volume, the relation between m and n is (molecular weight of hydrogen = 2 and
molecular weight of nitrogen = 28)
1) n = 14m 2) n = 7m 3) m = 7n 4) m = 14n
24. A spherical black body with a radius of 12cm radiates 450W power at 500K. If the
radius were halved and the temperature doubled, the power radiated in watt
would be
1) 1800 2) 225 3) 450 4) 900
25. If 5 grams of U 235 is completely destroyed in a reactor, the energy released would
be:
1) 45  10 J 2) 45  10 J 3) 15 10 J 4) 60  10 J
13 17 10 15
26. A closed organ pipe of length L and an open organ pipe contain gases of densities
1 and 2 respectively. The compressibility of gases are equal in both the pipes.
Both the pipes are vibrating in their first overtone with same frequency. The
length of the open organ pipe is :
L 4L 4 L 1 4 L 2
1) 2) 3) 4)
3 3 3 2 3 1

27. A point positive charge is brought near an isolated conducting sphere (figure) The
electric field is best given by
28. Two charges +4e and +e are at a distance x apart. At what distance, a charge q
must be placed from charge +e so that it is in equilibrium.
1) x/2 2) 2x/3 3) x/3 4) x/6
29. Light waves of intensities I and 9I interfere to produce a fringe pattern on a
3
screen. The phase difference between the waves at a point P is and 2 at
2
other point Q. Then the ratio of intensities at P and Q is
1) 8 : 5 2) 5 : 8 3) 1 : 4 4) 9 : 1
30. Let VG and EG denote gravitational potential and field respectively, then choose
the wrong statement.
1) VG  0, EG  0 2) VG  0, EG  0 3) VG  0, EG  0 4) VG  0, EG  0
31. A convex lens of focal length 40 cm is in contact with a concave lens of focal
length 25 cm. The power of combination is
1) -1.5D 2) -6.5D 3) +6.5D 4) +6.67D
32. A square plate of 0.1 m side moves parallel to a second plate with a velocity of 0.1
m/s, both plates being immersed in water. If the viscous force is 0.002 N and the
coefficient of viscosity is 0.01 poise, distance between the plates in m is:
1) 0.1 2) 0.05 3) 0.005 4) 0.0005
33. A child is standing with folded hands at the centre of a platform rotating about its
central axis. The kinetic energy of the system is K . The child now stretches his
arms so that the moment of inertia of the system doubles. The kinetic energy of
the system now is :
K K
1) 2K 2) 3) 4) 4K
2 4
34. The root mean square velocity of the molecules in a sample of helium is 5/7th
that of molecules in a sample of hydrogen. If the temperature of hydrogen sample
is 00C, then the temperature of the helium sample is about (approximately)
1) 50C 2) 0K 3) 2730C 4) 1000C
35. A stone dropped from the top of a tower of height 340m high splashes into the
water of a pond near the base of the tower. When is the splash heard at the top,

given that the speed of sound in air is 340 ms1 ? g  10 ms2 
1) 8.7s 2) 8.0s 3) 7s 4) 9.2s
SECTION – B
36. For two resistors R1 and R2, connected in parallel ,the relative error in their
equivalent resistane is (Where R1 = (10.0  0.1)  and R2   20.0  0.4  
1) 0.08 2) 0.05 3) 0.01 4) 0.04
37. Assertion (A): If a heavy nucleus is split into two medium sized parts, each of the
new nuclei will have more binding energy per nucleon than the original nucleus.
Reason (R): Joining two light nuclei together to given a single nucleus of medium
size means more binding energy per nucleon in the new nucleus.

38. A converging lens is used to form an image on a screen. When upper half of the
lens is covered by an opaque screen.
1) Half the image will disappear
2) Complete image will be formed of same intensity
3) Half image will be formed of same intensity
4) Complete image will be formed of decresed intensity
39. A block of mass 10kg is in contact against the inner wall of a hollow cylindrical
drum of radius 1m. The coefficient of friction between the block and the inner
wall of the cylinder is 0.1. The minimum angular velocity needed for the cylinder
to keep the block stationary when the cylinder is vertical and rotating about its
axis, will be (g=10m/s2)
10
1) rad / s 2) 10 rad/s 3) 10 rad / s 4) 10rad / s
2
40. Three charges Q, +q and +q are placed at the vertices of a right angled isosceles
triangle as shown in figure. The net electrostatic energy of configuration is zero if
Q is equal to
q  2q
1) 2) 3) -2q 4) +q
1 2 1 2
41. A particle execute S.H.M. from the mean position. Its amplitude is A, its time
period is ‘T’. At what displacement, its speed is half of its maximum speed.
3A 2 2A 3A
1) 2) A 3) 4)
2 3 3 2
42. In YDSE if the width of the slits are gradually decreased, then
1) Bright fringe will become brighter and dark fringe become darker
2) Bright fringe become less bright and dark finge become less dark
3) Bright fringe become brighter and dark fringe become lighter
4) Bright fringe become less bright and dark fringe become darker
43. For a gas if ratio of specific heats at constant pressure and volume is  then value
of degrees of freedom is
3  1 2 9 25
1) 2) 3)    1 4)   1
2  1  1 2 2
44. A battery has e.m.f. 4 V and internal resistance 'r'. When this battery is
connected to an external resistance of 2 ohms, a current of 1 A flows in the
circuit. What current will flow if the terminals of the battery are connected
directly ?
1) 1 A 2) 2 A 3) 4 A 4) infinite
45. Two small spheres of radii r and 4r fall through a same viscous liquid and
attained the same terminal velocity. The ratio of the viscous forces acting on them
is:
1) 1 : 2 2) 4 : 1 3) 1 : 16 4) 1 : 4
46. A particle having charge 100 times that of an electron is revolving in a circular
path of radius 0.8m with one rotation per second. The magnetic field produced at
the centre is
1) 10 7 /  0 2) 10 17  0 3) 10 6  0 4) 10 15 / 0
47. When the current through a solenoid increases at a constant rate, the induced
current
1) Is constant and is in the direction of the increasing current
2) Is a constant and is opposite to the direction of the increasing current
3) Increases with time and is in the direction of the increasing current
4) Increases with time and opposite to the direction of the increasing current

48. A proton when accelerated through a potential difference of 𝑉 volt has a
wavelength 𝜆 associated with it. An 𝛼 -particle in order to have the same
wavelength 𝜆 must be accelerated through a potential difference of
1) 𝑉 volt 2) 4𝑉 volt 3) 2𝑉 volt 4) (𝑉/8) vol
49. If linear deisnty of a rod of length 3m varies as   2  x , then the position of the
centre of gravity of the rod is :
7 12 10 9
1) m 2) m 3) m 4) m
3 7 7 7
50. The output of logica gate is given by Q  A. B  B. A . If the inputs A = 1 and B = 1,
the value of Q is
1) 0 2) 1 3) 10 4) 11
CHEMISTRY
SECTION – A
51. Which of the following is more soluble in water at 298K?
1) Argon (KH = 40.3 kbar) 2) Oxygen (KH = 40.86 kbar)
3) Nitrogen (KH = 82.48 kbar) 4) Hydrogen (KH = 76.42 kbar)
52. 10g of a polymer of molar mass 185,000 is dissolved in 450ml of water at 37o C .
Osmotic pressure of the solution is ________.
1) 309 Pa 2) 256 Pa 3) 189 Pa 4) 472 Pa
53. In Lassaigne’s test the organic compound is fused with sodium metal to:
1) Ignite the compound 2) Oxidise the compound
3) Convert the elements into ionic form 4) Reduce the compound
54. In which of the following process maximum energy is released.
1) O g   e   Og  2) Og   e   Og2 3) S g   e   Sg  4) Sg   e   S2g
55. In which case more energy is required.
1) M g2  M g3  e  2) M  g   M g   e  3) M g   M g2  e  4) M  g   M g3  3e 
56. Which of the following represents the correct IUPAC name of the compound
CH 2  CH  CH 2Cl ?
1) Allyl chloride 2) 1 – chloro prop-3-ene
3) 3-chloroprop-1-ene 4) Vinyl chloride
57. The ground state energy in J, of hydrogen atom is - X. The minimum energy in J
required to promote an electron from n = 1 to n = 2 in He+ is
4X 3X X
1) 3X 2) 3) 4)
3 4 3
58. Which of the following transitions will have minimum wavelength?
1) n10  n2 2) n2 
 n1 3) n100 
 n5 4) n5 
 n2
59. The configurations of the following compounds A, B, C in R, S notation are
1) R, R, S 2) R, S, R 3) R, R, R 4) S, R, S
60. Assertion (A) : In the presence of excess NH4Cl, with aqueous NH3 reagent Al 3
ion gets precipitated as Al  OH 3 but Mg 2 ion can not be precipitated as Mg  OH 2
Reason (R) : Al  OH 3 has sufficiently higher Ksp value than that of Mg  OH 2
61. The weight oxalic acid (MW= 126g.mol-1) that can be oxidized by 0.02mole of
KMnO4 in acidic medium is ________g.
1) 0.63 2) 1.26 3) 6.30 4) 12.6

62. To a given salt solution dil.H2SO4 is added. A colourless gas (x) is evolved. The gas
x becomes reddish brown gas on exposure to air. When the gas x is passed
through aqueous ferrous sulphate solution, brown colour forms. Then which of
the following is wrong?
1) The given salt contains nitrite ion
2) The colourless gas evolved is N2O
3) The reddish brown gas is NO2
4) Brown colour appears due to the formation of  Fe  H 2O 5 NO  SO4 .
63. Four diatomic species are listed below in different sequences. Which of these
respresents the correct order of their increasing bond order?
1) C22  He2  NO  O2 2) He2  O2  NO  C22
3) O2  NO  C22  He2 4) NO  C22  O2  He2
64. Which of the following order is correct?
1) AlCl3 < MgCl2 < NaCl : Polarising power of cation
2) CO  CO2  CO32  : C-O Bond length
3) BeCl2 < NF3 < NH3 : Dipole moment
4) H2S > NH3 > SiH4 > BF3 : Bond angle
65. Assertion (A) : The net dipolemoment of BrF5 is zero.
Reason (R) : BrF5 has trigonal bipyramidal shape due to sp3d hybridization.
66. (I) CH 3  O  CH  CH  CH  CH 2
 ()
(II) CH 3  O  C H  CH  CH  C H 2
 ()
(III) CH 3  O  CH  CH  CH  C H 2
Among these three canonical structures (through more are possible) what would
be their relative contribution in the hybrid :
1) I > II > III 2) III > II > I 3) I > III > II 4) III > I > II
67.
68. Which of the following statements are correct regarding reactivity of 13th group
elements towards air?
(I) Boron is unreactive in crystalline form.
(II) Al-forms a very thin oxide layer on its surface.
(III) Amorphous boron & Aluminium metal on heating in air form B2O3 & Al2O3.
(IV) B, Al with dinitrogen at low temperature they form nitride.
1) I, II, III are correct 2) I, II, IV are correct
3) I, III, IV are correct 4) All are correct
69. On heating lead nitrate forms oxides of nitrogen & lead, the oxides formed are
1) N2O, PbO 2) NO2, PbO 3) NO, PbO 4) NO, PbO2

70. Predict the product C obtained in the following reaction
HI (1mole )
CH 3CH 2  C  CH  HCl 
 B  C
1mole 
71. Which of the following set contains only electrophiles?

1) NH 4 , H 3O  , CO2 2) SO3 , CO2 , NH 4 3) CO2 , SO3 , Cl  4) NH 3 , H 2O, C6 H 6
72. Assertion (A) : But-1-yne has acidic hydrogen but but-2-yne does not.
Reason (R) : In but-1-yne hydrogen atom is attached with sp hybridized carbon
but no hydrogen is attached with sp hybridized carbon in but-2-yne.
of the Assertion
of the Assertion
73. Which of the following is the best example of law of conservation of mass :
(1) 12g of carbon combines with 32g of oxygen to form 44g of CO2
(2) When 12 g of carbon is heated in a vacuum there is no change in mass
(3) A sample of air increases in volume when heated at constant pressure but its
mass remains unaltered.
(4) The weight of a piece of platinum is the same before and after heating in air
74. The total number of protons in 63 mg HNO3 is
(1) 6.02 × 1020 (2) 1.92 × 1022 (3) 10–3 (4) 1.64× 1022
75. Equivalent weight of MnO4 in acidic, basic and neutral media are in the ratio of
1) 3 : 5 : 15 2) 5 : 3 : 1 3) 5 : 1 : 3 4) 3 : 15 : 5
76. Assertion : Chloroform is stored in dark coloured bottles.
Reason : Chronic chloroform exposure may cause damage to the liver and
kidneys.
of the Assertion
of the Assertion
77. Match the column I with column II and mark the appropriate choice.
(A) CH 3  CH 2 3 OH 
NaBr
H 2 SO4 
 (I) CH 3CH  Br  CH 2 2 CH 3
(B)  CH 3 3 COH 
conc . HCl
room temp
 (II) CH 3CH 2 CH 2 Cl
(C) CH 3CH  OH  CH 2 2 CH 3 
PBr
 3 (III)  CH 3 3 CCl
(D) CH3CH2CH 2OH 
SOCl2
 (IV) CH 3  CH 2 3 Br
.
(A) (B) (C) (D) (A) (B) (C) (D)

.
1) IV III I II 2) IV III II I

78. The statements regarding hydrides of VIA group elements are
i) The order of volatility ; H 2O  H 2Te  H 2 Se  H 2 S
ii) The order of B.P ; H 2O  H 2Te  H 2 Se  H 2 S
iii) The order of thermal stability ; H 2O  H 2 S  H 2 Se  H 2Te
The correct combination is
1) All are correct 2) Only i is correct 3) ii & iii are correct 4) i & iii are correct
A) Fluorine excibits only one oxidation state (ie, -1) in its compounds.
B) Halogens are coloured due to the absorption of radiation in visible region for
the excitation of electrons in outer orbitals to higher energy levels.
C) In the preparation of Og, the isotope of calcium used is Ca – 45
80. 50% of zero order reaction is completed in 24min then 100% of the same reaction
completes in _____ min.
1) 36 2) 48 3) 72 4) Infinite
81. For a reaction, A + B →products, the rate law is given by
Rate = k[A]2[B].
If the volume of the vessel is reduced to half of its original volume, then the rate
of reaction increases by _____ times.
1)8 2)6 3)4 4)12
82.
83.

84. For a given reaction, H  35.5 kJ mol and S  83.6 J mol1 . The reaction is
1
spontaneous at (Assume that H and S do not vary with temperature)

1) T > 425 K 2) all temperatures 3) T > 298 K 4) T < 420 K
85. A gas is allowed to expand in a well insulated container against a constant
external pressure of 2.5 atm from an initial volume of 2.50 L to a final volume of
4.50 L. The change in internal energy U of the gas in joules will be
1) -500 J 2) -506.5 J 3) +505 J 4) 1136.25 J
SECTION – B
A) La3+ is bigger in size than Eu3+
B) Mn has higher –ve 0M 2 / M value than that of Ti
C) CrO is basic, Cr2O3 is amphoteric while CrO3 is acidic in nature.
87. Which of the following statements is not correct?
1) Copper liberates hydrogen from acids
2) In higher oxidation states, manganese forms stable compounds with oxygen
and fluorine.
3) Mn3+ and Co3+ are oxidizing agents in aqueous solution.
4) Ti2+ and Cr2+ are reducing agents in aqueous solution.
88. An alkene of molecular formula C9H18 on ozonolysis gives 2,2-dimethylpropanal
and butan-2-one. The IUPAC name of alkene is
1) 2,2,4-trimethylhex-3-ene 2) 2,2,6-trimethylhex-3-ene
3) 2,3,4-trimethylhex-2-ene 4) 2,2,4-trimethylhex-2-ene
89. Which of the following substrates give the same product on the treatment with
DIBAL-H?
1) CH3(CH2)9CN and CH3(CH2)9COOH
2) CH3(CH2)9CN and CH3(CH2)9COOC2H5
3) CH3(CH2)9COOH and CH3(CH2)9CHO
4) CH3(CH2)9COOH and CH3(CH2)9COOC2H5
90. Which of the following is homoleptic complex?
1)  Pt  NH 3 2 Cl2  2) Co  NH 3 5 Cl  Cl2 3)  Fe  H 2O 6  Cl3 4) Na2  ZnCl2 Br2 
91. Which of the following carbonyls will have the strongest C – O bond?
2) Cr  CO 6  4)  Fe  CO 5 

3) V  CO  6 

1)  Mn  CO 6 
92. The two compounds [Co(SO4)(NH3)5]Br and [Co(SO4)(NH3)5]Cl represent:
1) Linkage isomerism 2) Ionisation isomerism
3) Co-ordination isomerism 4) No isomerism
93. Which of the following will produce a buffer solution when mixed in equal
volumes?
1) 0.1 mol dm-3 NH4OH and 0.1 mole dm-3 HCl
4) 0.1 mol dm-3+ CH3COONa and 0.1 mole dm-3 NaOH
94. Ka for CH3COOH is 1.8 x 10-5 and Kb for NH4OH is 1.8 x 10-5. The pH of
ammonium acetate will be
1) 7.005 2) 4.75 3) 7.0 4) Between 6 and 7
95. For a reaction, at equilibrium, the rate of forward reaction is 4.2 103 M .min 1 and
equilibrium constant is 100. Then the rate of backward reaction is
1) 4.2 103 M .min 1 2) 4.2 105 M .min 1 3) 4.2 101 M .min 1 4) 0.01 M.min-1
96. X  Phthalic anhydide   Y NaOH
 Pink colour X, Y respectively are
1) Aniline, Methyl orange 2) Phenol, methyl orange
3) Phenol, Phenolphthalein 4) Aniline, Phenolphthalein

97.
Product (C) is
1) Mixture of n-butane, ethane 2) Only propane
3) Only ethane 4) n-hexane
a) The electrolysis of aqueous NaCl produces hydrogen gas at cathode and
chlorine gas at anode,
b) The electrolysis of a CuSO4 solution using Pt electrodes causes the liberation of
O2 at the anode and the deposition of copper at the cathode.
c) Oxygen and hydrogen are produced at the anode and cathode during the
electrolysis of dilute aqueous solution of H2SO4
d) All electrolytic reactions are redox reactions
1) Only a is correct 2) a,b are correct
3) a,d are correct 4) a,b,c and d are correct
99. The charge required to reduce 1mole Cr2 O72 to Cr 3 ions is
1) 3F 2) 3 C 3) 6F 4) 96500C
100. Polypeptide chains in fibrous proteins are held together by
1) Hydrogen bonds 2) Disulphide bonds
3) Both 1 and 2 4) Only dipole – dipole attractions
BOTANY
SECTION – A
given
Column-I Column-II
(a) Fluid-mosaic model i. 1954
(b) Discovery of nucleus ii. 1898
(c) Discovery of Golgi apparatus iii. 1831
(d) Triple helical structure of collagen iv. 1972
1) a-ii, b-iv, c-i, d-iii 2) a-iv, b-iii, c-ii, d-i
3) a-i, b-iv, c-ii, d-iii 4) a-iv, b-iii, c-i, d-ii
102. Most extensive metabolic diversity is shown by
1) Fungi 2) Protista 3) Bacteria 4) Viruses
(A) Marshy areas (I) Halophiles
(B) Heterocysts (II) Thermoacidophiles
(C) Salty areas (III) Cyanobacteria
.
(D) Hot springs (IV) Methanogens
(A) (B) (C) (D) (A) (B) (C) (D)
.
1) IV III I II 2) IV III II I
3) III II IV I 4) II I III IV
104. Production of beverages and antibiotics on an industrial scale requires growing
microbes in very large vessels called
1) Agitator 2) Sludge digester 3) Settling tank 4) Fermentors
105. Brewer’s yeast is used for A of malted cereals and fruit juices to produce B .
1) A – distillation, B – CO2 2) A – distillation, B – Organic acid
3) A – fermentation, B-CO 4) A – fermentation, B- Ethanol
106. Match the column – I with column – II.
(A) Bread making organism (I) Whisky, brandy
(B) Without distillation alcoholic drinks (II) Fruit juice
(C) Distillation alcoholic drinks (III) Saccharomyces cerevisiae
.
(D) Non-alcoholic drinks (IV) Wine and beer
.
(A) (B) (C) (D) (A) (B) (C) (D)

3) III IV II I 4) IV III I II

107. Fill in blanks and select the correct options for A, B and C
I. Evolutionarily, …A… are the first terrestrial plants to Possess vascular tissues –
xylem and phloem.
II. The Pteridophytes include …B…and…C…
A B C
1) Pteridophytes Liverworts Mosses
2) Bryophytes Horsetails Lycopodium
3) Pteridophytes Horsetails Ferns
4) Gymnosperms Cycas Pinus
108. The monocotyledons are characterised by …A… cotyledonous seeds, …B…
venation in leaves, and …C… flower.
A B C
1) Single Parallel Trimerous
2) Single Reticulate Pentamerous
3) Two Parallel Tetramerous
4) Two Reticulate Trimerous
109. Identify a, b, c in diagram:
1) A–Fucus, B–Laminaria, C–Dictyota 2) A–Laminaria, B–Dictyota, C–Fucus

3) A–Laminaria, B–Fucus, C–Dictyota 4) A–Dictyota, B–Fucus, C–Laminaria
110. How many fragments will be generated if you digest circular DNA molecule with a
restriction enzyme having 5 recognition sites on the DNA?
1) 3 2) 6 3) 5 4) 4
111. The total number of hydrogen bonds present in recognition sequence for EcoRI
1) 12 2) 14 3) 16 4) 18
112. Which one of the following option is correct for A, B and C marked in the given
diagram of recombinant DNA technology?
1) A-Exonuclease; B-Ligases; C-Transformation

2) A-Endonuclease; B-Gyrase; C-Transformation
3) A-Exonuclease; B-Hydrolase; C-Transduction
4) A-Restriction endonuclease; B-Ligases; C-Transformation

113. Statement-I: Each restriction endonuclease recognises a specific palindromic
nucleotide sequences in the RNA
Statement-II: Restriction endonucleases are used in genetic engineering to form
recombinant molecules of DNA
1) Statement-I is true Statement-II is false
2) Statement-I is false Statement-II is true
3) Both Statements I and II are true 4) Both Statements I and II are false
Column-I Column-II
p) Sticky ends a) Palindromic sequence
q) EcoRI b) Host
r) Plasmid c) Overhanging stretches
s) E. Coli d) Vector
1) p-c, q-a, r-d, s-b 2) p-a, q-c, r-b, s-d
3) p-a, q-d, r-c, s-b 4) p-a, q-b, r-c, s-d
115. Root hairs are
1) Unicellular and endogenous 2) Unicellular and exogenous
3) Multicellular branched 4) Multicellular unbranched

116. Symbol P A represents
1) Epiphyllous stamens 2) Epipetalous stamens
3) Gamopetalous condition 4) Cohesion of stamens
117. Statement –I : A flower is modified shoot where in the shoot apical meristem
changes to floral meristem.
Statement –II : The stalk of inflorescence is called as pedicel.
Column-I Column-II
a) Sesbania (i) Poaceae
b) Cotton (ii) Leguminosae
c) Wheat (iii) Malvaceae
d) Lady'sfinger (iv) Brassicaceae
1) a-(ii), b-(iii), c-(i), d-(iii) 2) a-(iv), b-(ii), c-(i), d-(iii)
3) a-(iii), b-(iv), c-(i), d-(ii) 4) a-(ii), b-(iii), c-(iv), d-(i)
119. Identify the correct match for the given apparatus.
Apparatus Function
1) Gene gun Vectorless direct gene transfer
2) Column chromatography Separation of chlorophyll pigments
3) Sparged stirred tank Carry out fermentation process
bioreactor
4) Respirometer Finding out rate of respiration

120. In given diagram identify (c) and (d) :-
1) (c) – Inducer ; (d) – Repressor 2) (c) – Repressor ; (d) – Inducer

3) (c) – Allolactose ; (d) – c-Amp 4) (c) – Galactose ; (d) – Lactose
121. Consider the following four statement (a-d) and select the option
which includes all the correct ones only:-
(a) The codon is read in mRNA in a continuous fashion
(b) AUG codon has dual function in protein synthesis
(c) In actual structure, the tRNA is a compact molecule which looks
like inverted "L"
(d) 28 's' r-RNA in bacteria also behave as ribozyme
1) b, c and d 2) a, b and c 3) a, c and d 4) a and c only
122. What would happen if in a gene encoding a polypeptide of 50 amino
acids, 25th codon (UAU) is mutated to UAA?
1) A polypeptide of 24 amino acids will be formed
2) Two polypeptides of 24 and 25 amino acids will be formed
123. A molecule that can act as genetic material must not have following
properties
1) It should be chemically and structurally stable
2) It should be able to generate its replica.
3) It should provide the scope for slow changes.
4) It should not be able to express in the form of mendelian characters
124. Experiments using N15 to confirm semiconservative replication of DNA were
carried out by :
1) Meselson and Stahl 2) Hershey and Chase
3) Watson and Crick 4) Taylor
125. Tissue system include
1) Epidermal tissue system 2) Ground tissue system
3) Vascular tissue system 4) All the above
126. Assertion : In monocotyledons stem, the vascular bundles are called closed
vascular bundles.
Reason : In monocotyledons stem, the vascular bundles donot have cambium.
Hence they donot form secondary tissues.
127. Meristem which is present inside the vascular bundle is –
1) Apical meristem 2) Intercalary meristem
3) Cork cambium 4) Intra fascicular cambium
128. Find out the correct match :
1) F1 resembled either of the two parents – Dominance
2) F1 resembled in between – Incompelte dominance
3) F1 resembled both parents – Co-dominance
4) All are correct
129. According to Mendel hybridizations, which of the following parental crosses
would result in F2 genotypic ratio as 1:2:1?
1) Yy ×yy 2) YY×YY 3) Yy × YY 4) YY × yy
130. In a typical monohybrid cross the % of F2 resembling dominant parent
phenotypically and genotypically is _____ respectively.
1) 75% and 25% 2)25% and 75% 3) 50% and 25% 4) 25% and 50%

131. A true breeding tall pea plant crossed with a true breeding dwarf pea plant and
F1 on selfing produced 787 tall and 277 dwarf plants is F2 generation. The F1
plants are
1) Homozygous 2) Heterozgous
3) May be homozygous or heterozygous 4) True breeds
132. Assertion (A): Genes which code for a pair of contrasting traits are known as
alleles.
Reason (R): Always only one allele of a gene is expressed in an individual.
133. The plasma membrane consists of
1) Proteins embedded in a phospholipid bilayer
2) Protein embedded in a polymer of glucose molecules
3) Proteins embedded in a carbohydrate bilayer
4) Phospholipids embedded in a protein bilayer.
134. Which of the following statement is correct regarding vacuole?
1) It is membrane-bound and contains storage proteins and lipids.
2) It is membrane-bound and contains water and excretory substances.
3) It lacks membrane and contains food material
4) It lacks membrane and contains water and excretory substances
135. Read the following four statement (A-D)
(A) Flowers are the morphological and embryological marvels and the site of
sexual reproduction.
(B) Anther are attached to proximal end of the filament of stamen.
(C) Androecium and gynoecium represent the non essential parts of flower.
(D) The number and length of stamens are variable in flowers of different species
How many of the above statements are right?
1) Four 2) One 3) Two 4) Three
SECTION – B
136. In an embryo sac, the cells that degenerate after fertilization are :-
1) Synergids & primary endosperm cell
2) Synergids & antipodal cell
3) Antipodal and primary endosperms cell
4) Egg & antipodals
137. How many meiotic divisions are required for formation of 100 seeds in
angiosperm?
1) 100 2) 125 3) 300 4) 400
138. In cleistogamous flowers :-
1) Autogamy and xenogamy can occurs naturally
2) Geitonogamy and autogamy can occurs naturally
3) Only autogamy occurs naturally
4) Only xenogamy occurs naturally
139. Observe the following figure
The above mentioned floral diagram is belongs to

1) Solonaceae-brinjal 2) Asteraceae-disc florets
3) Asteraceae-ray florets 4) Liliaceae-onion

140. Statement –I : The structure of Aminoacids can change by the ionizable nature
of –NH2 and –COOH groups.
Statement –II : pH value of the cytoplasm can change by the nature of amino
and carboxyl groups.
141. Identify the given diagram.
1) Detection of zone of maturation by the parallel line technique

2) Detection of zone of elongation by the parallel line technique
3) Detection of zone of elongation by the diagonal line technique
4) Detection of zone of meristematic activity by the parallel line technique
142. F.W. Went isolated auxins from the
1) Coleoptiles of oat seed lings 2) Coleoptiles of rice seedlings
3) Fungal pathogen 4) Colleoptiles of canary grass
143. Statement – I: Cytokinin promotes the senecence of leaves
Statement – II : Cytokinin inhibit mobilisation of nutrients.
144. Interkinesis occurs in between.
1) G1 & S 2) G2 & M 3) Meiosis-I & II 4) Metaphase & Anaphase
145. Read the following :
(a) Somatic cells
(b) Crossing over
(c) synapsis of homologous chromosomes
(d) genetically similar daughter cells
(e) the stage can last for months or years in oocytes
How many are true for only meiosis but not for mitosis?
1) Except c & d 2) Except c and e 3) Except a & d 4) Except a,b& d
146. When electron move through ETS in between PS II and PS I then proton move
from
1) Grana thylakoid to stromal thylakoid 2) Stroma to lumen of Grana thylakoid
3) Stroma to lumen of Stromal lamellae 4) Lumen of thylakoid of stroma
147. What is the correct ratio of ATP utilisation in steps of Calvin cycle?
1) Reduction : Regeneration :: 1 : 1 2) Reduction : Regeneration :: 2 : 1
3) Reduction : Regeneration :: 2 : 2 4) Reduction : Regeneration :: 1 : 2
148. Which is incorrect statement with respect to RuBisCO enzyme?
1) Most abundant enzyme in the world
2) Bifunctional enzyme
3) It is always present in the stroma of mesophyll cell’s chloroplasts in C4-leaves
4) RuBisCO can catalyse both Calvin cycle as well as photorespiration
149. The chemiosmotic coupling hypothesis of oxidative phosphorylation proposes
that adenosine triphosphate (ATP) is form because :
1) A proton gradient forms across the inner membrane
2) There is a change in the permeability of the inner mitochondrial membrane
towards adenosine diphosphate (ADP)
3) High energy bonds are formed in mitochondrial proteins
4) ADP is pumped out of the matrix into the intermembrane space
150. The number of decarboxylation reactions occur during single TCA cycle is :

ZOOLOGY
SECTION – A
151. Which of the follwong statements are correct?
(i) Renal vein takes blood from kidney.
(ii) Urine becomes hypotonic in ascending limb of loop of Henle.
(iii) Podocytes occur in inner wall of Bowman’s capsule.
(iv) Ultrafiltrate is plasma minus proteins.
1) (i) and (ii) only 2) (i) and (iii) only
3) (iii) and (iv) only 4) (i), (ii), (iii) and (iv)
152. VNTR stands for,
1) Variable Number of Term Repeats 2) Variant Number of Tendon Repeats
3) Variable Number of Tandem Repeats 4) Variable Number of Tandem Results
153. Which of the following phenomena leads to variation in DNA?
1) Genetic recombination 2) Mutation
3) Transcription 4) Both 1 and 2
154. Which of the following is correct of mosaic vision in cockroach?
1) With the help of several ommatidia, a cockroach receives several images of an
object
2) It is with more sensitivity but has less resolution
3) Being common during night, it is called nocturnal vision also
4) All of these
155. One of the main functions of frog's skin is
1) Diffusion of respiratory gases
2) Absorption of ultraviolet rays to produce vitamin D
3) Storage of excess food in the form of subcutaneous fat
4) Excretion of nitrogenous waste in the form of uric acid
156. Synaptic vessicles present in.
1) Dendrites of presynaptic neuron 2) Axon terminal of post synaptic neuron
3) Dendrite of post synaptic neuron 4) Axon terminal of presynaptic neuron
157. A population has more young individuals compared to the older individuals, what
would be the status of the population after some years?
1) It will decline 2) It will increase
3) It will stabilize 4) It will first decline and then stabilize
158. Assertion (A) : Evolution of modern humans exhibited a gradual increase in
brain size.
Reason (R) : Homo habilis had smaller brain capacity.
159. Which of the following animals do not show double circulation?
1) Shark 2) Whale 3) Macropus 4) Parrot
160. I. Large bean shaped organ
II. It has large reservoir of erythrocytes
III. By the time of puberty, its reduced to a very small size
IV. It contains lymphocytes and phagocytes
How many number of statements are true for spleen?
1) 1 2) 2 3) 3 4) 4
161. Transgenic animals are produced for which of the following purposes?
(a) To study how gene are regulated and how they affect the normal functions of
body and its development.
(b) To study the diseases.
(c) To obtain useful biological products.
(d) to test vaccine safety and chemical safety.
1) All of these 2) a and d only 3) b and d only 4) only a
162. How many of the following symptoms are related to disease “Common cold”
1) Fever, Diarrhoea, Stomach pain 2) Sore throat, Cough, headache
3) Fever, Chills, loss of appetite 4) Internal bleeding, anaemia
163. Choose the correct order of layers (or) space from outside to inside around the
ovum (secondary oocyte)
(A) Zona pellucida (B) Perivitelline space (C) Plasma membrane
1) ABC 2) BCA 3) CBA 4) BAC

164. Which of the following is an incorrect match w.r.t. HGP.
1) ELSI – Ethical, legal and social issues
2) YAC – Yeast autosomal chromosome
3) ESTs – Expressed sequence tags
4) BAC – Bacterial artificial chromosome
165. Assertion (A): Obelia exhibits metagenesis.
Reason (R): Its life history includes polyps produced medusa stage and medusa
form the polyps.
166. Statement – I: Vasopressin acts on kidneys and stimulates reabsorption of water
and electrolytes by PCT preventing diuresis.
Statement – II: Prolonged hyperglycemia leads to a condition known as Diabetes
insipidus, causing severe dehydration.
167. In a population at Hardy-Weinberg equilibrium, the frequency of homozygous
dominant genotype is 0.36. What are the frequencies of dominant and recessive
alleles for the locus?
1) p = 0.16; q = 0.48 2) p = 0.6; q = 0.4
3) p = 0.48; q = 0.164 4) p = 0.48; q = 0.16
168. Choose the correct option from the following.
1) Male heterogamety XX-XO type
2) Female heterogamety XX- XY type
3) Male heterogamety XX-XY type
4) Male heterogamety ZW-ZZ type
169. If a boy’s father has haemophilia and his mother has one gene for haemophilia,
what is the chance that the progeny will inherit the diseased boy?
1) 25% 2) 50% 3) 75% 4) 100%
170. Surveys and statistics show that use of drugs and alcohol has been on the rise
especially among the
1) Old 2) Infant 3) Youth 4) Adults
171. Identify the true statements from the below statements :
(I) There are many side effects of tubectomy and vasectomy.
(II) Purpose of tubectomy is to prevent egg formation.
(III) The most important component of the oral contraceptive pills is progestogen.
(IV) Contraceptive oral pills help in birth control by preventing ovulation,
implantation etc.
(V) In India, there is rapid decline in Infant Mortality Rate and MMR.
1) I, II and III 2) I, II and V 3) III, IV and V 4) II, IV and V
172. Identify the correct sequence of taxonomical categories:
1) Species Order Phylum Class 2) Genus Species Order Kingdom
3) Species Genus Order Phylum 4) Class Species Phylum Kingdom

173. Lungs are made up of air-filled sacs, the alveoli. They do not collapse even after
forceful expiration, because of
1) Residual Volume (RV) 2) Inspiratory Reserve Volume (IRV)
3) Tidal Volume (TV) 4) Expiratory Reserve Volume (ERV)
174. Assertion (A) A person goes to high altitude and experiences ‘altitude sickness’
with symptoms like breathing difficulty and heart palpitations.
Reason (R) Due to low atmospheric pressure at high altitude, the body does not
get sufficient oxygen.
given below.
2) Both A and R are true, but R is not the correct explanation of A
3) A is true, but R is false 4) A is false, but R is true
175. What nutritional advantage did Rosie’s human protein-enriched milk offer over
natural cow milk?
1) Higher fat content 2) Increased lactose concentration
3) More balanced nutrition for human babies 4) Enhanced calcium levels
176. Select the incorrect one :
1) Ovum – Flagellar movement 2) Microfilaments – Amoeboid movement
3) Jaw bones – Muscular movement 4) Trachea – Ciliary movement
177. Lamarck was a
1) French Zoologist 2) German Botanist
3) French Naturalist 4) British Naturalist
178. Find the false statement.
1) The number of fungi species in the world is more than the combined total of
the species of fishes, amphibians, reptiles and mammals
2) Conventional taxonomic methods are not suitable for identifying microbial
species
3) For many taxonomic group, species inventories are more complete in
temperate than in tropical countries
4) Insects form 70% of all the plants and animals species recorded
179. Which of the following is not under broadly utilitarian reason for conserving
biodiversity?
1) Pollination 2) Aesthetic pleasures
3) Flood control 4) Moral responsibility
180. Cockroaches are
1) Dioecious and without sexual dimorphism
2) Monoecious and without sexual dimorphism
3) Monoecious with sexual dimorphism
4) Dioecious with sexual dimorphism
181. Choose the function in which hypothalamus of brain is not involved.
1) Urge of eating 2) Osmoregulation and thirst
3) Temperature control 4) Respiration
182. Predation, parasitism and commensalism share a common feature which is
1) The interacting species live closely together
2) The interacting species live apart essentially
3) The interacting species are essentially variables in their body size
4) The species are never the less living in same environmental condition
183. Which of the following statements is correct?
1) Malpighian corpuscles + glomerulus constitute the Bowman’s capsule
2) Renal corpuscle + glomerulus constitute Malpighian corpuscle
3) Bowman’s corpuscles + Malpighian tubules constitute the glomerulus
4) Bowman’s capsule + glomerulus together constitute renal corpuscle
184. If duration of cardiac cycle is 1 sec, calculate cardiac output (assuming stroke
volume to be 70 ml).
1) 5000 ml 2) 6300 ml 3) 4200 ml 4) 4900 ml

185. Statement –I: Primary productivity depends on the plant species inhabiting a
particular area.
Statement – II: Gross primary productivity is the rate of formation of new
organic matter by consumers
1) Both statement -1 and statement – II are true.
2) Statement – 1 is true but a statement – II is false
3) Both Statement –I and Statement – II are false
4) Statement – I is false but Statement – II is true
SECTION – B
186. Select correct matching :
Column-I Column-II
(i) Nirodh. (a) Prevent ovulation
(ii) Cu T. (b) Prevent fertilization
(iii) Pill. (c) Prevent sperms reaching in cervix
(iv) LNG–20. (d) Prevent implantation
1) i-d, ii-c, iii-a, iv-b 2) i-c, ii-a, iii-b, iv-d
3) i-d, ii-b, iii-c, iv-a 4) i-c, ii-b, iii-a, iv-d
187. Match the following columns and select the correct option from the codes given
below.
Column I Column II
A. Pneumotaxic centre 1. Alveoli
B. O2 dissociation curve 2. Pons region of brain
C. Carbonic anhydrase 3. Haemoglobin
D. Primary site of exchange of gases 4. RBC
Codes
A B C D A B C D
1) 1 3 2 4 2) 2 3 4 1
3) 3 2 4 1 4) 4 1 3 2
188. Exploitation of bio resources of a nation by multinational companies without
authorisation from the concerned country is referred to
1) Bioethics 2) Bioweapon 3) Biopiracy 4) Bio-exploitation
189. Statement-I : A motor neuron along with the muscle fibres to it constitute motor
end plate.
Statement-II : The junction between a motor neuron and the sarcolemma of the
muscle fibre is motor unit.
1) Both statements I & II is true
2) Statement I is true, statement II is false.
3) Statement I is false, statement II is true.
4) Both statements I & II is false.
190. Read the following statements
I. Detritivores break down the detritus into smaller particles
II. Vertical distribution of different species occupying different levels is called
stratification
III. Decomposition is largely an oxygen-requiring process
The correct statement (s) is (are)
1) I only 2) II & III only 3) II only 4) I, II & III
191. Amazonian rain forest in South America has the greatest biodiversity on earth, it
is home to
(i) 3000 species of fishes
(ii) 1300 species of birds
(iii) 427 species of reptiles
(iv) 378 species of amphibians
(v) 40,000 species of invertebrates
How many of the above are correct?
1) 2 2) 5 3) 4 4) 3
192. Statement – I: The stromal tissues of Thyroid gland secretes T3 and T4.
Statement – II: Deficiency of iodine leads to hypothyroidism, called Goitre.
3) S – I is true, S – II is false 4) S – I is false, S – II is true

193. Which of the following sets all are hemaphrodites?
1) Pheretima, Taenia, Sycon, Ascaris
2) Euspongia, Ctenoplana, Megascolex, Nereis
3) Sycon, Physalia, Pleurobrachia, Ancylostoma
4) Spongilla, Pleurobrachia, Fasciola, Hirudinaria
194. Whales have flippers, bats have wings, yet both of them are included in
Mammalia. The reason is, they have
1) Four chambered heart 2) direct development
3) Mammary glands 4) Homeothermic
195. At the end of the second meiotic division, the human female germ cells
differentiate to form
1) Oogonia 2) First polar body
3) Second polar body 4) Primary Oocyte
196. Read the following statements and select the correct option. Stating which ones
are true (T) and false (F).
A. Producers can synthesize inorganic food from organic raw materials.
B. Consumers are also called heterotrophs.
C. Tiger is an example of a primary consumer.
D. Decomposer organisms consume the organic matter and digest it internally.
A B C D A B C D
1) F T F T 2) F T F F
3) T T F F 4) T T F T
197. Statement I: Pedigree analysis is useful in studying inheritance of a specific
trait.
Statement II: Genetic information is transmitted from one generation to other
without any change or alteration.
1) Ineffective blood pumping by heart as per need of body is heart failure
2) In heart failure, the congestion of lungs is the main symptom
3) Heart failure is same as cardiac arrest or heart attack
4) The heart attack is due to sudden damage of heart muscle by an inadequate
blood supply
199. Which of the given statement is incorrect?
1) The peak of distribution curve gets higher and narrower by stabilizing selection
2) Directional selection shifts the peak of the distribution curve in one direction.
3) In disruptive selection peak gets higher and narrower.
4) In stabilising selection more individuals aquire mean character value
200. Indicate whether the following statemetns are true (or) false.
A) ADH helps in water reabsorption, making the urine hypotonic
B) Protein-free fluid is filtered into the lumen of Bowman’s capsule from blood
plasma
C) Skin, lungs and liver also assist in excretion.
D) Many nitrogen containing substances, ions, CO2, water from our body will not
be eliminated.
A B C D A B C D
1) F T F T 2) F T T F
3) T T T T 4) F T T T
*******

: ANSWER KEY:
SET-1 SUB: PHYSICS
1 1 11 2 21 3 31 1 41 1
2 1 12 1 22 4 32 4 42 4
3 3 13 1 23 4 33 2 43 2
4 4 14 3 24 1 34 1 44 2
5 2 15 4 25 1 35 4 45 4
6 4 16 3 26 3 36 3 46 2
7 3 17 3 27 1 37 2 47 2
8 1 18 4 28 3 38 4 48 4
9 2 19 2 29 2 39 2 49 2
10 1 20 4 30 3 40 2 50 1
SUB:CHEMISTRY
51 1 61 3 71 3 81 1 91 1
52 1 62 2 72 1 82 3 92 4
53 3 63 2 73 1 83 3 93 3
54 3 64 3 74 2 84 1 94 3
55 4 65 4 75 4 85 2 95 1
56 3 66 3 76 2 86 3 96 3
57 1 67 1 77 1 87 1 97 2
58 2 68 1 78 1 88 1 98 4
59 1 69 2 79 2 89 2 99 3
60 3 70 1 80 2 90 3 100 3
SUB : BOTANY
101 2 111 2 121 2 131 2 141 2
102 3 112 4 122 1 132 3 142 1
103 1 113 2 123 4 133 1 143 2
104 4 114 1 124 1 134 2 144 3
105 4 115 2 125 4 135 3 145 3
106 1 116 1 126 1 136 2 146 2
107 3 117 3 127 4 137 2 147 2
108 1 118 1 128 4 138 3 148 3
109 3 119 3 129 4 139 2 149 1
110 3 120 2 130 1 140 2 150 2
151 4 161 1 171 3 181 4 191 1
152 3 162 2 172 3 182 1 192 4
153 4 163 1 173 1 183 4 193 4
154 4 164 2 174 1 184 3 194 3
155 1 165 1 175 3 185 2 195 3
156 4 166 2 176 1 186 4 196 2
157 2 167 2 177 3 187 2 197 2
158 1 168 3 178 4 188 3 198 3
159 1 169 1 179 4 189 4 199 3
160 3 170 3 180 4 190 4 200 2

NEET GRAND TEST - 8
answer sheet.
CORRECT.
Section-B;
Marking Scheme :

PHYSICS
SECTION – A
1. Find the value of 2.2+4.08+3.125+6.3755.
1) 15.78 2) 15.89 3) 15.8 4) 15.9
2. A stone falls from a balloon that is descending at a uniform rate of 12m/s. The
displacement of the stone from the point of release after 10 sec is
1) 400m 2) 510m 3) 610m 4) 725m
3. A train of 150 metre length is going towards north direction at a speed of 10m/s.
A parrot flies at the speed of 5m/s towards south direction parallel to the railway
track. The time taken by the parrot to cross the train is
1) 12 sec 2) 8 sec 3) 15 sec 4) 10 sec
4. A body is sliding down a rough inclined plane. The coefficient of friction between
the body and the plane is 0.5. The ratio of the net force required for the body to
slide down and the normal reaction on the body is 1 : 2. Then, the angle of the
inclined plane is
1)150 2) 300 3) 450 4) 600
5. A particle moves in one dimensional field with total mechanical energy E. If its
potential energy is U(x), then
1) particle has zero speed where U  x   0
2) particle has zero acceleration where U  x   E
dU  x 
3) particle has zero velocity where 0
dx
dU  x 
4) particle has zero acceleration where 0
dx
6. A uniform chain of length L hangs partially from table and held in equilibrium by
friction. If greatest length of chain that hangs without slipping is l then the
coefficient of friction between chain and table is
l l l l
1) 2) 3) 4)
2 Ll Ll L 1
7. The period of oscillation of a simple pendulum of length ‘L’ suspended from the
ceiling of a vehicle which moves with out friction down in an inclined plane of
inclination ‘’ is given by
L L L L
1) 2 2) 2 3) 2 4) 2
g cos  g sin  g g tan 
8. Two bars of thermal conductivities K and 3K and lengths 3 cm and 6 cm
respectively have equal cross – sectional areas. They are joined length wise was
shown in the figure. If the temperature at the ends of this composite bar is 0oC
and 60oC respectively ( see figure ), then the temperature of the interface (  ) is
100 o 200 o
1) 36oC 2) C 3) 20oC 4) C
3 3
9. The area of the glass of a window of a room is 10 m2 and thickness 4 mm. The
outer and inner temperature are 60oC and 40oC respectively. Thermal
conductivity of glass in MKS system is 0.4 then heat flowing in the room per
second will be
1) 3 104 J 2) 2 104 J 3) 30 J 4) 45 J

10. Assertion : In isothermal process, whole of the heat energy supplied to the body
is converted into internal energy.
Reason : According to the first law of thermodynamics, Q = U + W.
the assertion
of the assertion
11. The average thermal energy of a oxygen atom at room temperature (270C).
1) 4.5  1021 J 2) 6.2  1021 J 3) 3.4  1021 J 4) 1.8 1021 J
12. To what temperture should the hydrogen at 3270C be cooled at constant
pressure, so that the root mean square velocity of its molecules become half of its
previous value
1) -1230C 2) 230C 3) -1000C 4) 00C
13. The coefficient of linear expansion of copper is one and half times that of iron.
Idnetical rods of copper and iron are heated through same temperature range.
The ratio of forces developed in them will be (The young’s modulus for copper and
iron is same)
1) 9/4 2) 3/2 3) 4/9 4) 2/3
14. The modulus of elasticity of a material does not depend upon
1) nature of material 2) shape
3) impurities mixed 4) temperature
15. Spiders and insects move and run about on the surface of water without sinking
because:
1) Elastic membrane is formed on water due to property of surface tension
2) Spiders and insects are lighter
3) Spiders and insects swim on water
4) Spiders and insects experience up-thrust
16. Masses 2kg and 8kg are 18cm apart. The point where the gravitational field due
to them is zero is
1) 6cm from 8kg mass 2) 6cm from 2kg mass
3) 1.8cm from 8kg mass 4) 9cm from each mass
17. The gravitational force between two bodies is decreased by 36% when the
distance between them is increased by 3m. The intial distance between them is
1) 6m 2) 9m 3) 12m 4) 15m
18. Statement-I : During thunderstorm, light is seen much earlier than the sound is
heard.
Statement-II : Light travels faster than sound.
1) Statements-I is true, Statement-II is true, Statement-II is a correct explanation
for statement-I
2) Statements-I is true, Statement-II is true, Statement-II is not a correct
3) Statement-I is true, statement-II is false
4) Statement-I is false, statement-II is true
19. A hollow sphere is placed on a rough horizontal surface. On
applying force F on it in horizontal direction it rolls down without
slipping on the surface. Then its angular acceleration is …….
6 6 F
1) MR 2)
5 5 MR
3F 3 F
3) 4)
14R 5 MR
20. The minimum distance between an object and its real image formed by a convex
lens is
1) 1.5f 2) 2f 3) 2.5f 4) 4f
21. A concave lens of glass, refractive index 1.5, has both surfaces of same radius of
curvature R. On immersion in a medium of refractive index 1.75, it will behave
as a
1) Convergent lens of focal length 3.5R 2) Convergent lens of focal length 3.0R
3) Divergent lens of focal length 3.5R 4) Divergent lens of focal length 3.0R

22. Two slits are made one millimeter apart and the screen is placed one meter away.
What should the width of each slit be to obtain 10 maxima of the double slit
pattern within the central maximum of the single slit pattern.
1) 0.2mm 2) 0.4mm 3) 0.1mm 4) 0.5mm
23. The point charges Q and -2Q are placed at some distance apart. If the electric
field at the location of Q is E, the electric field at the location of -2Q will be
3E E
1)  2)  3) –E 4) -2E
2 2
24. Capacitance of a capacitor becomes 7/6 times its original value if a dielectric slab
of thickness t = 2d/3 is introduced in between the plates. The electric constant
of the dielectric slab is
14 11 7 11
1) 2) 3) 4)
11 14 11 7
25. The equivalent capacity of the combination is
1) C 2) 2C 3) C/2 4) 3C
26. Two positive ions, each carrying a charge q, are separated by a distance d. If F is
the force of repulsion between the ions, the number of electrons missing from
each ion will be (e being the chage on an electron)
4 0 Fd 2 4 0 Fe2 4 0 Fd 2 4 0 Fd 2
1) 2) 3) 4)
e2 d2 e2 q2
27. Two bar magnets having same geometry with magnetic moments M and 2M, are
firstly placed in such a way that their similar poles are in same side then its time
period of oscillation is T1. Now the polarity of one of the magnet is reversed then
time period of oscillation is T2, then
1) T1 < T2 2) T1 = T2 3) T1 > T2 4) T2 = 
28. Two circuits have mutual inductance of 0.1 H. What average e.m.f. is induced in
one circuit when the current in the other circuit changes from 0 to 20 A in 0.02 s
1) 240 V 2) 230 V 3) 100 V 4) 300 V
29. A coil resistance 20 and inductance 5H is connected with a 100V battery.
Energy stored in the coil will be
1) 41.5 J 2) 62.50 J 3) 125 J 4) 250 J
7 4
30. If the binding energy per nucleon Li and He nuclei are respectively 6.60 MeV
and 7.06 MeV, then the energy of the reaction:
Li7  p  22 He4
1) 19.6 MeV 2) 2.4 MeV 3) 10.20 MeV 4) 17.3 MeV
31. If the kinetic energy of the particle is increased to 16 times its previous value, the
percentage change in the de-Broglie wavelength of the particle is
1) 25% 2) 75% 3) 60% 4) 50%
32. The kinetic energy of electron is E, when the incident light has wavelength '  '.
To increase the K.E. to 2E, the incident light must have wavelength-
hc hc h hc
1) 2) 3) 4)
E  hc E  hc E  hc E  hc
33. Nuclear fission experiments show that the neutrons split the uranium nuclei into
two fragments of about same size. This process is accompanied by the emission
of several:
1) Protons, positrons and electrons 2)  - particles
3) Neutrons 4) Protons and  -particles
34. Hole is
1) an anti-particle of electron
2) a vacancy created when an electron leaves a covalent bond
3) absence of free electrons 4) an artificially created particle

35. Assertion : The conductivity of an intrinsic semiconductor depends on its
temperature.
Reason : The conductivity of an intrinsic semiconductor is slightly higher than
that of a lightly doped p-type semiconductor.
the assertion
SECTION – B
36. A student performs an experiment to determine the Young’s modulus of a wire
exactly 2m long by Searle’s method In a particular reading the student measures
the extension in the length of the wire to be 0.8 mm with an uncertainty of
0.05mm at a load of exactly 1.0 kg. The student also measures the diameter of
the wire to be 0.4mm with an uncertainty of 0.01mm. Take g  9.8 ms2 (exact).
The Young’s modulus obtained from the reading is
1)  2.0  0.3 1011 Nm2 2)  2.0  0.2  1011 Nm2
3)  2.0  0.1 1011 Nm2 4)  2.0  0.05  1011 Nm2
37. An insect crawls up a hemispherical surface very slowly. The coefficient of friction
between the insect and the surface is 1/3. If the line joining the centre of
hemispherical surface and the insect makes an angle  with the vertical, what is
the maximum value of  ?
1) cot-1 3 2) tan-1 3 3) sec-1 3 4) cosec-1 3
38. The pendulum of a certain clock has time period 2.04s. How fast or slow does
the clock run during 24 hours?
1) 28.8 minutes slow 2) 28.8 minutes fast
3) 14.4 minutes fast 4) 14.4 minutes slow
39. Springs of spring constants K, 2K, 4K, 8K, ….2048K are connected in series. A
mass ‘m’ is attached to one end the system is aloowed to oscillation. The time
period is approximately.
m 2m m 4m
1) 2 2) 2 3) 2 4) 2
2K K 4K K
40. A drop of water of radius 0.0015 mm is falling in air. If the coefficient of viscosity
of air is 2.0  10 5 kg / m.s , the terminal velocity of the drop will be (neglect density
of air):- (The density of water = 1.0  103 kg / m 3 and g  10 m / s 2 )
4 4 4 4
1) 1.0 10 m / s 2) 2.0  10 m / s 3) 2.5  10 m / s 4) 5.0  10 m / s
41. Sound signal is sent through a composite tube as shown in the figure. The
radius of the semicircular portion of the tube is r. Speed of sound in air is v. The
source of sound is capable of giving varied frequencies in the range of v1 and v2
(where v2>v1). If n is an integer then frequency for maximum intensity is given by
:
nv nv nv nv
1) 2) 3) 4)
r r   2  r  r  2
42. A uniform rod of mass m and length l is suspended by means of two right
inextensible strings as shown in figure. If one string is cut out then the tension in
the other string is ………
mg mg
1) 2) 2mg 3) mg 4)
4 2

43. A charged particle of mass m = 2kg and charge 1 C is thrown from a horizontal
group at an angle of 450 with horizontal with a speed of 10m/s. In space a
horizontal electric field E  2  107 N / C exists. Find the range of the projectile.
1) 5m 2) 30m 3) 10m 4) 20m
44. The work done in turning a magnet of magnetic moment M by an angle of 90o
from the meridian, is n times the corresponding work done to turn it through an
angle of 60 o . The value of n is given by
1) 1/2 2) 1/4 3) 2 4) 1
45. A current of 2 A is flowing through a cell of e.m.f. 5 V and internal resistance
0.5 from negative to positive electrode. If the potential of negative electrode is 10
V, the potential of positive electrode will be :-
1) 5 V 2) 14 V 3) 15 V 4) 16 V
46. A long solenoid has 200 turns per cm and carries a curent i. The magnetic field
at its centre is 6.28 102 Wb/m2 . Another long solenoid has 100 turns per cm and
it carries a curent i/3. The value of the magnetic field at its centre is
1) 1.05 104 Wb/m2 2) 1.05 102 Wb/m2 3) 1.05 105 Wb/m2 4) 1.05103 Wb/m2
47. Two identical charged particles enter a uniform magnetic field with same speed
but at angles 30o and 60o with field. Let a, b and c be the ratio of their time
periods, radii and pitches of the helical paths than
1) abc = 1 2) abc > 1 3) abc < 1 4) abc=0
48. In figure assuming the diodes to be ideal
1) D1 is forward biased and D2 is reverse biased and hence current flwos from A to
B
2) D2 is forward biased and D1 is reverse biased and hence no current flows from
B to A and vice versa
3) D1 and D2 are both forward biased and hence current flows from A to B
4) D1 and D2 are both reverse biased and hence no current flows from A to B and
vice versa
49. Match the column I with column II.
  d B
.
(A) Gauss’s law in electrostatics (I)

.
 E.dl   dt
 
(B) Faraday’s law (II)
 B.dA  0
(C) Gauss’s law in magnetism (III)   d
 B .dl   0ic   0 c
dt
(D) Ampere Maxwell law (IV)   q
 E.ds  0
(A) (B) (C) (D) (A) (B) (C) (D)
1) IV I II III 2) I II III IV
3) III IV I II 4) II III IV I

50. An alternating voltage source V=260 sin(628t) is connected across a pure
inductor of 5 mH. Inductive reactance in the circuit is
1) 3.14 2) 6.28  3) 0.5  4) 0.318 
CHEMISTRY
SECTION – A
51. 2molal aqueous urea solution and 0.8 molal aqueous BaCl2 solution are found to
be isotonic. Then the degree of dissociation of BaCl2 is ______
1) 50% 2) 60% 3) 75% 4) 84%
52. 50ml of 0.04 mole NaCl containing solution is mixed with 150ml of 0.06 mole
containing CaCl2 solution. In the resulting solution the molarity of chloride ion is
______M.
1) 0.5 2) 0.8 3) 0.055 4) 0.1
53. In Lassaigne’s test for the detection of nitrogen in an organic compound, the
appearance of the Prussian blue colour is due to the formation of:
1) Na2FeIII[FeII(CN)6] 2) NaFeII[FeIII(CN)6]
3) Fe4[Fe(CN)6]3 4) Na4[Fe(CN)6]
54. The electronic configuration of an element ‘X’, is 1s 2 2s 2 2 p 6 3s 2 3 p 3 . What is the
atomic number of the element which is just below ‘X’ in the periodic table?
1) 33 2) 34 3) 31 4) 49
55. Incorrect combination among the following :
Period Order of sub shells filled
1) 4 th 4s, 3d, 4p
2) 3rd 3s, 3p, 3d
3) 5 th 5s, 4d, 5p
4) 6 th 6s, 4f, 5d, 6p
O OH
56. The IUPAC name of  | is
CH 3  C  CH 2  CH  CHO
1) 5-oxo-4-hydroxy-2-pentanone 2) 4-hydroxy-5-al-2-pentanone
3) 2-hydroxy-4-oxopentanal 4) 1-al-4-oxo-2-pentanol
57. In hydrogen atom the kinetic energy of electron is 3.4 eV. The distance of that
electron from the nucleus
1) 2.116 Å 2) 0.529 Å 3) 1.587 Å 4) 21.16 Å
58. The number of radial nodes and nodal planes possible for 6dyz are respectively.
1) 3, 0 2) 4, 0 3) 3, 2 4) 4, 2
59. In the newman projection formula of most stable conformation of
3-Hydroxypropanal, the stability is due to
1) Minimum torsional strain
2) Intramolecualr hydrogen bonding
3) Minimum torsional strain and intera molecular hydrogen bonding
4) Minimum steric strain
60. Isobutyl alcohol and ter-butyl alcohol are
1) Chain isomers 2) Position isomers 3) Functional isomers 4) Metamers
61. If Ksp of MOH is 1 x 10 , then pH of its saturated aqueous solution will be:
-10
1) 3 2) 6 3) 9 4) 12
62. To the given salt solution, dilute H2SO4 is added. Effervescences of colourless gas
without any pungent smell are observed. This liberated gas turns lime water
milky. When same gas is passed in excess, the milkyness disappears. Then,
which of the following is correct?
1) Given salt contains carbonate ion
2) Milkyness appears due to the formation insoluble CaCO3
3) Milkyness disappears due to the formation of soluble Ca(HCO3)2
4) All the above are correct.

63. Assertion (A): In BrF3 molecule, the number of bond angles as 900 is zero.
Reason (R) : The lone pair-bond pair repulsion is weaker than bond pair-bond
pair repulsion.
the assertion
List-I List-II
A)  MO   A   B (I) Dipolemoment
B)   Qr (II) Bonding molecular orbital
C) Nb  N a (III) Anti-bonding molecular orital
2
D)  MO   A   B (IV) Bond order
Choose the correct answer from options given below.
1) (A)-(II), (B)-(I), (C)-(IV), (D)-(III) 2) (A)-(III), (B)-(IV), (C)-(I), (D)-(II)
3) (A)-(III), (B)-(I), (C)-(IV), (D)-(II) 4) (A)-(III), (B)-(IV), (C)-(II), (D)-(I)
65. Which of the following molecule is planar and polar?
1) BrF3 2) BF3 3) NH3 4) SF4
66. Which of the structures below would be aromatic?
1) i and iv 2) i, iii and iv 3) iii and iv 4) ii
67.
68. Assertion : White fumes appears around the bottle of anhydrous aluminium
chloride.
Reason : Anhydrous aluminium chloride is partially hydroysed with atmospheric
moisture and liberates HCl gas where moist HCl appears white in colour.
of Assertion
1) Among nitrogen trihalides only NF3 is known to be stable
2) Among trihalides of 15th group elemetns BiF3 is predominantly ionic
3) Oxidation state of Bismuth in Mg3Bi2 is +3
4) PCl5 is more covalent than PCl3.
  A     B     C  . The product ‘C’ is
1) NaNH 2 1 eq 
70. CaC2 H 2O
2) CH 3 Br
Cu2 Cl2 / NH 4OH
1) CH 3  CH 2  C  C  Cu , Red ppt 2) CH 3  CH 2  C  C  Cu , White ppt

3) CH 3  C  C  Cu, Red ppt 4) (1) and (3)

71. Dehydration by conc. H2SO4 is the most difficult in
72. Statement I : Methane cannot be prepared by Kolbe electrolytic reaction.

Statement II : In this reaction alkane is liberated at anode
73. Chlorophyll, the green colouring matter of plants responsible for photosynthesis,
contains 2.68% of magnesium by mass. Calculate the number of magnesium
atoms in 2.00g of chlorophyll.
(1) 1.345 × 1021 (2) 1.345 × 1020
(3) 13.45 × 1021 (4) 1.345 × 1023

74. The equivalent mass of a metal is 9 u. If valency of metal is 3, then the vapour
density of the volatile metal chloride will be:
(1) 66.75 (2) 321 (3) 267 (4) 133.5
75. In Br3O8 molecule, the oxidation state of central bromine atom and average
oxidation state of bromine are respectively _____
1) +6, +5.33 2) +4, +5.33 3) + 7, +6 4) +6, +7
76. The main difference in C – X bond of a haloalkane and a haloarene is
1) C – X bond in haloalkanes is shorter than haloarenes
2) in haloalkanes the C attached to halogen in C – X bond is sp3 hybridised while
in haloarenes it is sp2 hybridised.
3) C – X bond in haloarenes acquires a double bond character due to higher
electronegativity of X.
4) haloalkanes are less reactive than haloarenes due to difficulty in C – X
cleavage in haloalkanes
77. Match the isomers given in column I with their names given in column II and
mark the appropriate choice.
(A) (I) 2 – Bromo – 3 – methylbutane
(B) (II) 2 – Bromopentane
(C) (III) 1-Bromo-3-methylbutane
(D) (IV) 1-Bromo-2-methylbutane
(A) (B) (C) (D) (A) (B) (C) (D)

1) III I IV II 2) IV III II I
3) I II III IV 4) II III IV I
78. Among the following species:
(I) ClO (II) ClO2 (III) ClO3 (IV) ClO4 .
The correct combination regarding hybridization of chlorine atom and shape of
the species is__________.
1) I : SP, linear 2) II : SP2, angular
3) III: SP3, planar trigonal 4) IV: SP3, tetrahedral

79. Which of the following orders of melting point of hydrides of halogens is correct?
1) HF  HCl  HBr 2) HF  HCl  HBr
3) HF  HCl  HBr 4) HF  HCl  HBr
80. A certain zero order reaction, A→Product, has k=0.025M.min-1 for the
disappearance of ‘A’ then the conc. of ‘A’ after 15 min if the initial conc. of A is
0.5M is
1) 0.5M 2) 0.375M 3) 0.125M 4) 0.25M
81. Which of the following can affect rate constant of a reaction as well as equilibrium
constant?
1) Concentration of reactants 2) Time of reaction
3) Catalyst 4) Temperature
82. The alcohol which does not react with Lucas reagent at room temperature is
1) isopropyl alcohol 2) n-butyl alcohol
3) tert-butyl alcohol 4) sec-butyl alcohol
83.
84. The standard reducution potentials of Zn 2  Zn, Cu 2  Cu and Ag  Ag are

respectively -0.76, 0.34 and 0.8V. The following cells were constructed.
a) Zn Zn 2 Cu 2 Cu b) Zn Zn 2  Ag  Ag c) Cu Cu 2 Ag  Ag
What is the correct order Ecell
o
of these cells?
1) b > c > a 2) b > a > c 3) a > b > c 4) c > a > b
85. In which case change in entropy is negative?
1) Evaporation of water 2) Expansion of a gas at constant temperature
3) Sublimation of solid to gas 4) 2H  g  
 H2  g 
SECTION – B
86. Which one of the following arrangements does not represent the correct order of
the property stated against it?
a) Ni 2  Co2  Fe2  Mn2 : Ionic size
b) TiO  VO  CrO  FeO : basic oxide character
c) Sc  Ti  Cr  Mn : maximum possible oxidation state.
d) V 2  Cr 2  Mn2  Fe2 : Paramagnetic behavior
1) b and d 2) a and b 3) a, b and c 4) b, c and d
87. Assertion (A) : d configuration is more stable tha d
5 4
Reason (R) : d5 has more exchange energy as compared to d4.

88. Which of the following reactions is/are correct regarding the preparation of
ketone?
1) Treatment of acyl chlorides with dialkyl cadmium, gives ketones
2) When benzene or substituted benzene is treated with acid chloride in the
presence of anhydrous aluminium chloride, it gives the corresponding ketone
3) Treating an alkyl nitrile with Grinard reagent followed by hydrolysis yields a
ketone
4) All of the above
89. The compositon of silver mirror in Tollens’ test and red ppt in Fehling test are
respectively.
1) Ag2O and Cu2O 2) Cu2O and Ag 3) Ag and Cu2O 4) Cu2O and Ag2O

90. In an octahedral crystal field, the t2g orbitals are
1) Raised in energy by 0.40 2) Lowered in energy by 0.40
3) Raised in energy by 0.60 4) Lowered in energy by 0.60
91. Among the statements(a) – (d), the incorrect ones are :
a) Octahedral Co(III) complexes with strong field ligands have very high magnetic
moments
b) When  0  P , the d-electron configuration of Co(III) is an octahedral complex is
t 42g eg2
c) Wavelength of light absorbed by Co  en 3  is lower than that of CoF6 
3 3
d) If the  0 for an octahedral complex of Co(III) is 18,000cm-1  t for its

tetrahedral complex with the same ligand will be 16,000cm-1
1) b and c only 2) a and b only 3) c and d only 4) a and d only
92. The one that will show optical activity is:
93. The buffer solution comprising of the following has its pH value less than 7.
1) HCOONH4 2) CH3COONH4 3) HCOOH + HCOOK 4) NH4OH + NH4Cl
94. pH of water is 7.0 at 25 C. If water is heated at 80 C:
0 0
1) pH increase 2) pH decrease 3) pH remains 7

4) H conc. Increases but OH ion decreases
+ -
95. Tests on an aqueous solution of a sodium salt having an anion X n  gave the
K 2 Cr2O7 / H  Pb  NO3 2
following results : X n    green solution ; Salt solution   black precipitate
Which one of the following could be X n  :
1) I  2) NO2 3) S 2 4) SO42 
(i) Primary amines show more intermolecular association than secondary amines.
(ii) Tertiary amines do not show intermolecular association.
(iii) Boiling points of isomeric amines follow the order 3° > 2° > 1°
1) (i) and (iii) 2) (i) and (ii) 3) (i), (ii) and (iii) 4) (ii) and (iii)
97. Which of the following statements are correct ?
(i) In Sandmeyer reaction nucleophiles like Cl–, Br– and CN– are indroduced in
benzene ring in the presence of Cu+ ion
(ii) In Gattermann reaction nucleophiles are introduced in benzene ring in the
presence of copper powder and HCl.
(iii) The yield in Gattermann reaction is found to be better than Sandmayer
reaction.
1) (i) and (ii) 2) (i), (ii) and (iii) 3) (ii) and (iii) 4) (i) and (iii)
98. The following reaction is non–spontaneous
1) Zn  2 H   Zn 2  H 2 2) Sn  Fe 2   Sn 2   Fe
3) Zn  Cu2  Zn2  Cu 4) Mg  2 Ag   Mg 2   2 Ag

99. Consider the following data:  f H  N 2 H 4 , l   50kJ / mol ,  f H 0  NH 3 , g   46kJ / mol ,
0
B.E.(N-H)=393kJ/mol and B.E.(H-H)=436kJ/mol.

vap H  N 2 H 4 , l   18kJ / mol
Calculate then N-N bond energy in kJ/mol for N2H4.
1) 190kJ/mol 2) -190kJ/mol 3) 95kJ/mol 4) -95kJ/mol
100. Which one of the following statement is incorrect about enzyme catalysis?
1) Enzyme are mostly proteinous is nature
2) Enzyme action is specific
3) Enzyme are denaturated by change in pH and at high temperature.
4) Enzyme are least reactive at optimum temperature
BOTANY
SECTION – A
101. Consider the description about an organism and identify the organism
a) It is unicellular but not moneran
b) Its eukaryote but not a protists
c) It’s heterotrophic but not animal
d) It has cell wall but not cellulosic
1) Slime mould 2) Paramoecium 3) Yeast 4) Euglena
102. Read the following :
(a) Unicellular prokaryotes. (b) Chitinous wall members.
(c) Unicellular eukaryotes. (d) Mostly autotrophic.
(e) Cellulosic cell wall. (f) Presence of centrioles.
How many of the above characters are applicable to kingdom plantae?
1) Four 2) Five 3) One 4) Two
103. Identify the mismatch in the following.
1) Puccinia Rust fungus
2) Penicilium Medicinally important
3) Toad stools Edible mushrooms
4) Rhizopus Bread mould
104. Biogas is a mixture of gases containing predominantly C produced by B and
which may be used as A .
1) A- Pathogenic activity, B- Fuel, C-H2S 2) A-Fuel, B-Microbial activity, C-C2H4
3) A-Fuel, B-Pathogenic activity C-H2S 4) A-Fuel, B-Microbial activity, C-CH4
105. Identify enzyme A in the given reaction of Krebs’ cycle.
OAA  Acetyl Co-A  H 2O  A
 Citric acid + Co-A
1) Oxaloacetate 2) Citrate synthase
3) Aconitase 4) Dehydrogenase
106. Consider the following w.r.t. pteridophytes.
Statement-I: The diploid sporophyte is represented by dominant, independent,
photosynthetic, vascular plant body.
Statement-II: It alternates with multicellular, autotrophic, independent but
short-lived haploid gametophyte.
1) Both are correct 2) Both are incorrect
3) Statements I is correct and statement II are is incorrect
4) Statements I is incorrect and statement II are is correct
107. Choose the incorrect statement regarding angiosperms.
1) Double fertilisation is syngamy and triple fusion
2) Syngamy is fusion of one male gamete with egg cell (n).
3) Triple fusion is fusion of another male gamete with two polar nuclei.
4) Double fertilisation is characteristic feature of both Angiosperms and
Gymnosperms.
108. In the alternation of generations, the sporophytic generation is ...A... and the
gametophytic generation is ...B... . Here, A and B refer to
1) A–2n; B–n 2) A–n; B–2n 3) A–n; B–n 4) A–2n; B–2n

I) Some mosses provide food for herbaceous mammals, birds and some animals.
II) Mosses form dense mats on the soil, they prevent soil erosion.
III) Sphagnum as packing material for trans-shipment of living material because
of their capacity to hold water.
IV) Sphagnum provide peat that have long been used as fuel.
Which of the statements given above are correct
1) I, III and IV are correct 2) I, II, III and IV are correct
110. Choose the incorrect statement of the following :
I. Each cell of sporogenous tissue in anther is diploid.
II. Generative cell of a pollen grain has a large and irregularly shaped nucleus.
III. In over 60% of angiosperms, pollen grains are shed at 3-cell stage.
IV. All members of legumes maintain the viability of pollen grains for months.
1) I, III and IV 2) II, III and IV 3) III and IV 4) I, II, III and IV
1) EcoRI cuts the DNA between the bases G and A
2) pBR322 is natural plasmid
3) pBR322 is ds circular plasmid
4) Agrobacterium has Ti plasmid
112. The different steps involved in the process of recombinant DNA technology are
given below randomly. Arrange these in correct order
P) Extraction of desired gene product
Q) Amplification of the gene of interest
R) Isolation of a desired DNA fragments
S) Ligation of the DNA fragment into a vector
T) Insertion of recombinant DNA into the host
1) P, Q, R, S and T 2) T, S, R, Q and P
3) P, Q, R, T and S 4) R, Q, S, T and P
113. Statement-I: Agrobacterium tumifaciens, a pathogen of several monocot plants
Statement-II: Agrobacterium deliver a piece of DNA (T-DNA) into the plant cell
2) Statement-I is false, Statement-II true
3) Both Statements I and II are false 4) Both Statements I and II are true
114. Match List-I with List-II and select the correct answer:
List- I List- II
I. UTR A. RNA polymerase-III
II. snRNA B. Methionyl- tRNA
III. 23S rRNA C. 7- Methyl GTP cap in mRNA
IV. Initiator tRNA D. Peptidyl transferase activity
1) I- C, II- A, III- D, IV- B 2) I- C, II- B, III- D, IV- A
3) I- C, II- D, III- B, IV- A 4) I- C, II- D, III- A, IV- B
List- I List- II
I. A,B and O blood group system in human A. Incomplete dominance
II. Human skin colour B. Codominance
III. Pink flowers in snapdragon C. Quantitative inheritance
IV. AB- blood group D. Multiple alleles
1) I- C, II- A, III- D, IV- B 2) I- D, II- A, III- B, IV- C
3) I- D, II- C, III- A, IV- B 4) I- C, II- D, III- B, IV- A
116. Which of the follwiong is true w.r.t. staminode?
1) Elongated internode between stamen and carpel
2) Sterile stamen
3) Wing-like structure formed by corolla in pea
4) Adhesion of stamens with carpel
117. Statement –I : Fruit drupe develops from monocarpellary superior ovary and is
one seeded.
Statement –II : In Mango, endocarp is fleshy and edible.

List-I (Medicinal plant) List-II (Family)
A) Sida (I) Cruciferae
B) Belladona (II) Fabacea
C) Muliathi (III) Solanaceae
`
`
D) Candytuft (IV) Malvaceae
A B C D A B C D
1) I III II IV 2) I III IV II
Column-I Column-II (Gene/ product)
(I) Heat shock method A) Thermostable DNA polymerase
(II) Agarose gel electrophoresis B) Heterologous host
(III) DNA amplification C) To check the progression of restriction
enzyme digestion
(IV) Recombinant protein D) To improve the DNA uptake by bacterial
cells
1) I- C, II- A, III- D, IV- B 2) I- D, II- A, III- B, IV- C
3) I- D, II- C, III- A, IV- B 4) I- C, II- D, III- B, IV- A
120. Observe the floral diagram and the characters belongs to
a) d) Parietal placentation
b) G1 e) Epitepalous
c) K(5) f) Reduced bracts
g) Reniform anther
1) a, b, c only 2) a, c only 3) d, e only 4) a, c, g only
121. Match column-I with column-II and select the correct option from the given
codes.
Column-I Column-II
(Codes) (Translated amino acid)
A) UUU (i) Serine
B) GGG (ii) Methionine
C) UCU (iii) Phenylalanine
D) CCC (iv) Glycine
E) AUG (v) Proline
1) A-iii, B-iv, C-i, D-v, E-ii 2) A-iii, B-i, C-iv, D-v, E-ii
3) A-iii, B-iv, C-v, D-i, E-ii 4) A-ii, B-iv, C-i, D-v, E-iii
122. An E.coli with heavy DNA molecule is transferred into the medium with normal
nitrogen  14 NH 4Cl  after 40 minutes what will be the percentage of heavy DNA
molecule?
1) 12.5% 2) 25% 3) 0% 4) 6.25%
123. Which out of the following statements is incorrect ?
1) Genetic code is ambiguous 2) Genetic code is degenerate
3) Genetic code is universal 4) Genetic code is non-overlapping
124. DNA is not genetc material in
1) QB bacteriophage 2)   174 3)   Phage 4) E.Coli
125. Assertion (A): tRNAs are absent for stop codons.
Reason (R): UAG, UGA and UAA are the nonsense codons.
2) (A) is true but (R) is false.
3) Both (A) and (R) are true but (R) does not correctly explains (A).

126. If pollen grains shed at 2-celled stage, the male gametes will be formed from
generative cell during:
1) Growth of pollen tube in the stigma 2) Growth of pollen tube in the ovule
3) Growth of pollen tube into ovary 4) Entry of pollen tube into embryo sac
127. Identify the incorrect statement w.r.t. secondary growth.
1) Due to deposition of tannins, resins, oils etc., heart wood is dark in colour
2) Heart wood does not conduct water but gives mechanical support
3) Sapwood is involved in conduction of water and minerals
4) Sapwood is the innermost secondary xylem and is lighter in colour
128. If we consider the starch grain size as one of the characters in dihybrid cross,
what will be the proportion of seeds having intermediate size in F2 generation?
1) 25% 2) 50% 3) 75% 4) 100%
129. What is the genotypic ratio of progeny obtained from a cross AaBB × aaBB?
1) 1AaBB : 1aaBB 2) 1AaBB: 3aaBB
3) 3AaBB:1aaBB 4) All AaBB : No aaBB
130. A green full pod with green round seed found in the apex of a pea plant, what is
the ratio of recessive and dominant characters.
1)4 : 1 2) 3 : 2 3) 1 : 4 4) 2 : 3
131. In a test cross involving F1 dihybrid flies more parental type off springs were
produced than the recombination type offsprings. Then indicates.
1) The two genes are located on two different chromosomes.
2) Chromosomes failed to separate during meiosis
3) The two genes are linked and present on the same chromosome
4) Both the chracters are controlled by more than one gene.
132. Assertion (A): Round seeds in pea plant may have large sized or intermediate
sized starch grains.
Reason (R): It is an example of pleiotropy multiple alleles and incomplete
dominance.
3) A is correct but R is incorrect. 4) Both A and R are incorrect
133. Statement I : Golgi apparatus remains in close association with the endoplasmic
reticulum.
Statement II : A number of proteins synthesised by ribosomes on the ER are
modified in the cisternae of the Golgi bodies before they are released from the
trans face.
In the light of the given statements, choose the correct options in given below:
1) Both Statement I and Statement II are correct.
2) Both Statement I and Statement II are incorrect.
3) Statement I is correct but Statement II is incorrect.
134. Match the following columns and identify the correct combination –
Column I Column II
(A) Robert Brown (I) Ribonucleoproteins
(B) Flemming (II) Nucleus as cell organelle
(C) Palade (III) Packaging of materials
(D) Camillo Golgi (IV) Staining of nucleus material
1) A - (II) B - (IV) C - (I) D - (III) 2) A - (II) B - (IV) C - (III) D - (I)
3) A - (I) B - (II) C - (III) D - (IV) 4) A - (IV) B - (III) C - (II) D - (I)
135. The sequence of mRNA is:
5’AGGAGGUAUUGAUCAGUAGUGAUAAAAAAAAAAAA3’.
The peptide chain formed from the above mRNA consists of how many aminoacid
residues?
1) Three 2) Five 3) Seven 4) Eleven
SECTION – B
136. Which one of the following statements regarding post-fertilization development in
flowering plants is incorrect?
1) Ovary develops into fruit 2) Zygote develops into embryo
3) Central cell develops into endosperm 4) Ovules develop into embryo sac
137. Persistent nucellus in the seed is known as
1) Chalaza 2) Perisperm 3) Hilum 4) Tegmen

138. Flowers which have single ovule in the ovary and are packed into inflorescence
are usually pollinated by:
1) Water & Wind 2) Water only 3) Wind 4) Bat
139. A competitive inhibitor of succinic dehydrogenase is
1) Malonate 2) Oxaloacetate 3) -ketoglutarate 4) Pyruvate
140. Assume that a ds-DNA molecule has 204 Ao length in which 20% of Guanine find
the number of H-bonds present in that DNA.
1) 140 2) 144 3) 288 4) 72
141. Statement–I: Development is regarded as the sum of growth and differentiation.
Statement–II : Both intrinsic and extrinsic factors infuluece the growth and
differentiation.
4) Statement – I is correct and statement – II is incorrect.
142. Identify the incorrect statement regarding arithmetic growth.
1) Following mitotic cell division only one daughter cell continues to divide while
the other differentiates and mature.
2) It is exemplified as a root elongation at a constant rate
3) S-curveis obtained on plotting the length of the organ against time
4) Mathematically it is expressed on Lt=L0+rt
143. Which one of the following growth regulators is known as stress hormone
1) Abscisic acid 2) Ethylene 3) GA3 4) IAA
144. Given structural formula is correctly identified along with its related function by
which of the following options?
1) Cholesterol – A component of animal cell membrane

2) Lecithin – A component of cell membrane
3) Triglyceride – An energy source
4) Adenosine – A component of nucleic acid
145. Which of the following is the correct expression of central dogma of molecular
biology after the discovery of Reverse transcriptases?
1) DNA→ RNA→ Proteins 2) DNA ⇌RNA ⇌Protein
3) DNA→DNA⇌RNA→Protein 4) DNA→RNA⇌Protein
146. Which of the following comparisons is incorrect?
C3 Plants C4 Plants
1) Rate of photorespiration Quite high Absent
2) Mesophyll cells Perform complete Perform only initial CO2
photosynthesis fixation
3) Optimum temperature 30 – 45 C
o 10 – 25oC
4) Kranz anatomy Absent Present
147. The following (P to T) are the main steps of chemosynthetic ATP synthesis in the
light reaction. Which answer places them in correct order?
P) H+ concentration gradient generates
Q) H+ diffuses through CF0CF1
R) Carriers use energy from electrons to move H+ across the membrane
S) Electrons from PS II pass along electron transport chain
T) Energy of H+ flow is used by ATP synthetase to make ATP
1) P →Q → T → S → R 2) S → R → P → Q → T
3) T → S → R→ P → Q 4) S → R → P → T → Q

148. Identify A to D in the diagrammatic representation of internal structure of cilia.
1) A-Interdoublet bridge, B-Central microtubule, C-Plasma membrane, D-Radial

spoke
2) A–Plasma membrane, B–Central microtubule, C–Interdoublet bridge, D–Radial
spoke
3) A–Plasma membrane, B–Interdoublet bridge, C–Central microtubule, D–Radial
spoke
4) A–Plasma membrane, B–Interdoublet bridge, C–Radial spoke, D–Central
microtubule
149. Arrange the following structures in the increasing order of minimum reduction
divisions required for their formation:
I. 120 antipodal cells II. 60 synergids
III. 25 egg cells IV. 50 embryo sacs
The correct answer is:
1) II, I, III, IV 2) III, II, I, IV 3) IV, III, II, I 4) IV, I, II, III
150. In the mitochondrial electron transport system, theterm Complex III refers to:
1) NADH dehydrogenase 2) Cytochrome c1
3) FADH2 4) Cytochrome bc1 complex
ZOOLOGY
SECTION – A
(A) Australopithecines (P) First hominid
(B) Homo habilis (Q) Java man
(C) Neanderthal man (R) Burried their dead
.
(D) Homo erectus (S) Fruit eater
(A) (B) (C) (D) (A) (B) (C) (D)
1) P S R Q 2) S P R Q
3) Q S P R 4) R Q P S
152. Statement-I : Loss of Biodiversity increases resistance to environmental
perturbations, such as drought.
Statement-II : Loss of Biodiveristy, decreases variability in certain ecosystem
process.
4) Both, statements I & II are correct
153. In frog, food is captured by
1) Trilobed tongue 2) Bilobed tongue 3) Tentacles 4) Limbs
154. Which of the following is correct related to cockroach?
1) Mosiac vision 2) Paurometabolous development
3) Three thorasic ganglia 4) All of these
155. Assertion : Small size organisms have larger surface area relative to their volume
and they have to spend much energy to generate body heat through metabolism.
Reason : Small-sized organisms are rarely found in polar regions.
the assertion

156. S1 : The myelinated nerve fibres are enveloped with Schwann cells.
S2 : Myelinated nerve fibres are found in spinal and cranial nerves.
157. Which one of the following is not a part of single nephron?
1) Collecting duct 2) PCT 3) DCT 4) LH
158. Which of the following sentences is incorrect with regard to circulating system?
1) Humans have hepatic portal system and hypophysial portal system
2) The blood pressure is low in veins
3) Cardiac output is the volume of blood ejected by either of the ventricles into
the arterial system.
4) Blood pressure is higher in animals with open circulatory system.
159. _________ toxic substance is responsible for the chills and high fever recurring
every 3-4 days in malaria
1) Sporozoites 2) Gametocyte 3) Haemozoin 4) Interferon
160. Absence of acrosome will affect which activity of a normal sperm.
1) Energy utilisation for movement 2) Sperm motility
3) Maturation of sperm 4) Penetration in to the ovum
161. Assertion (A): Amphibians are the earliest tetrapods.
Reason (R): Among vertebrates limbs first appeared in amphibians.
3) A is correct and R is incorrect.
4) Both A and R are incorrect
162. Statement–I: Testis is covered by a dense covering.
Statement–II: Interstitial cells present in intertubular spaces produce a group of
hormones called androgens mainly testosterone.
163. The inner layer of adrenal cortex is called ________
1) Zona fasciculate 2) Zona reticularis
3) Zona glomerulosa 4) Zona pellucida
164. Choose the correct statement from the following.
(i) 50% of ovum in few insects carry X-body as named by Henking.
(ii) In female heterogamety two different gametes are produced by male
(iii) In birds, male have a pair of Z chromosomes besides autosomes.
(iv) In fowls, eggs are responsible for the sex of the chicks
1) i, ii 2) iii, iv 3) ii,iii,iv 4) i,ii,iii
165. Which of the following is an example for link species?
1) Chimpanzee 2) Dodo bird 3) Sea weed 4) Lobe fined fish
166. Select the correct statements:
a) The productivity of the ocean are only 55 billion tons.
b) Only 10% of the energy is transferred to each trophic level from the lower
trophic level
c) 2 to 10% of PAR [Photosynthetically active radiation] sustains the entire world
1) a, b only 2) b, c only 3) a, c only 4) a, b, c
167. Which of the following is an incorrect statement for Periodic abstinence?
1) The couple should abstinence from coitus from day 10 to 17 of the
menstrualcycle when ovulation could be expected.
2) 10th to 17th day of the cycle is fertile period, when the chances of fertilisation
are high.
3) This prevents the chances of union of male and female gametes.
4) In this method, the ovum and sperms are prevented from physically meeting
with the help of barriers
168. Which one of the following statements is not correct?
1) The scientific name of mango is written as Mangifera indica.
2) The scientific names ensure that each organism has only one name.
3) Name of the author appears after the genus.
4) Biological names are generally in Latin and Written in italics.

169. Name the pulmonary disease in which alveolar surface area involved in gas
exchange is drastically reduced due to damage in the alveolar walls.
1) Fibrosis 2) Emphysema 3) Pneumonia 4) Asthma
170. Select the correct statements with reference to Pectoral and Pelvic girdle:
1) Each clavicle is a long slender bone with three curvatures.
2) Pelvic girdle consists of three coxal bones.
3) At the point of fusion of three bones in each coxal, a cavity is called glenoid
4) The two halves of the pelvic girdle meet ventrally to form the pubic symphysis.
171. Statement–I: Directional selection changes the population towards one
particular direction.
Statement–II: Directional selection favours average sized individuals.
172. Amazon rainforest is called ‘lungs of the planet’ because
1) It covers a large land area of the earth.
2) It is a natural habitat at for evergreen trees
3) It harbors many endemic species
4) It produces through photosynthesis 20% of the total oxygen in the earth
atmosphere
173. If the head of cockroach is cut off, it will still live for as long as one week. It is
because
1) Body is covered with a hard chitinous exoskeleton
2) Head holds a small bit of nervous system
3) Head is of no use
4) Food capturing apparatus is found elsewhere
174. Competition is most severe between two
1) Closely related species growing in different niches
2) Closely related species growing in the same habitat
3) Distantly related species growing in the same habitat
4) Distantly related species growing in different niches
175. The condition diuresis is prevented by _______hormone.
1) ADH 2) FSH 3) PRL 4) GH
176. As the sino-atrial node which initiate the impulses in the heart of mammal hence
it is called.
1) cholinergic 2) adrenergic 3) neurogenic 4) myogenic
177. Each antibody molecule has _____ peptide chains,______small called light chains
and _____ longer called heavy chains.
1) 4, 2, 2 2) 3, 1, 2 3) 8, 4, 4 4) 4, 1, 1
178. Which one of the following statements is incorrect about menstrual cycle?
1) The first menstruation begins at puberty and is called menarche
2) The reproductive cycle in the female primates (eg. Monkey, Dog, Man) is called
menstrual cycle
3) Corpus luteum secretes large amounts of progesterone
4) In absence of fertilisation, corpus luteum degenarates in luteal phase and new
follicles start developing immediately
179. Which of the following is correctly matched?
1) Pterophyllum – magur 2) Exocoetus – saw fish
3) Carcharodon – Great, black shark 4) Chaetopleura – Chiton
180. The _______ normally remain confined to their original location and do not spread
to other parts of the body and cause little damage
1) Carcinogens 2) Benign tumors 3) Malignant tumors 4) Oncogenes
181. Henking observed that in few insects, 50% of the sperm received a specific
nuclear structure,whereas the other 50% sperm did not receive it. Henking gave a
name to this structure as :-
1) Y-body 2) X-body 3) Barr Body 4) W-Chromosome
182. Productivity at the second trophic level is always:
1) Greater than the productivity at the first trophic level.
2) Less than the productivity at the first trophic level.
3) Equals to the productivity at the first trophic level.
4) Extremely high compared to the productivity at the first trophic level.

183. Reduction in pH of blood will
1) reduce the blood supply to the brain
2) decrease the affinity of haemoglobin with oxygen
3) release bicarbonate ions by the liver
4) reduce the rate of heartbeat
184. The term used to refer to the use of bio-resources by multinational companies
and other organizations without proper authorisation from the countries and
people concerned without compensatory payment is
1) Bioprospecting 2) Biopiracy 3) Biotechnology 4) Bioinformatics
185. A cup shaped bone covering knee ventrally is called:
1) Tarsals 2) Femur 3) Patella 4) Fibula
SECTION – B
186. Which of the following is not a factor responsible for species richness of tropical
regions?
1) Less variation in productivity 2) Stable abiotic conditions
3) Higher productivity 4) Less productivity
187. The sodium potassium pump-ATP dependent.
1) Transport Na  and K  out of the neuron
2) Transport Na  into the neuron and K  out
3) Transport K  into the neuron and Na  out
4) Transports Na  and K  into the neuron
188. Uricotellic mode of excretion is found in _____
1) Birds & earthworm 2) Frog &snake
3) Insects & amphibians 4) Reptiles &birds
189. Which of the following diseases is also known as atherosclerosis?
1) Hypertension 2) Angina pectoris
3) Heart attack 4) Coronary artery disease (CAD)
190. Allelic sequence variation has been described as DNA polymorphism if ________
variant (allele) at a locus occurs in a human population with a frequency ________
1) >1 , >0.1 2) >1, >0.01 3) <1 , <0.1 4) <1 , <0.01
191. In the following organisms, which is free living non-pathogenic nematode.
1) Drosophila 2) Arabidopsis 3) Meloidegyne 4) Caenorhabditis
192. Match Column I with Column II and select correct option from the codes given
below.
(A) Fish with electric organs (I) Trygon
(B) Fish with poison sting (II) Salamandra
(C) Amphibian with tail (III) Torpedo
(D) Amphibian without limbs (IV) Ichthyophis
(A) (B) (C) (D) (A) (B) (C) (D)
1) I III II IV 2) III I IV II
3) III I II IV 4) III II I IV
193. Statement I: Haemophilia is a chromosomal disorder that is characterised by the
improper blood clotting
Statement II: In this disorder, a single protein which is a part of cascade of
proteins involved in blood clotting is affected.
194. The man made ecosystems are
1) Crop fields 2) Aquarium 3) Wetlands 4) Both 1 and 2
195. Statement–I : Saheli pill is one of the better oral contraceptive pill.
Statement–II : It is a non steroidal pill and can be used once in a week.
1) S–I and S–II are correct. 2) S–I is correct & S–II is incorrect.
3) S–I is incorrect & S–II is correct. 4) S–I and S–II are incorrect.

196. Identify the wrong statement with reference to transport of oxygen.
1) Partial pressure of CO2 can interfere with O2 binding with haemoglobin
2) Higher H+ concentration in alveoli favours the formation of oxyhaemoglobin
3) Low pCO2 in alveoli favours the formation of oxyhaemoglobin
4) Binding of oxygen with haemoglobin is mainly related to partial pressure of O2.
197. How many documented varieties of Basmati rice are grown in India?
1) 17 2) 67 3) 38 4) 27
198. In a rabbit population small ear lobe is a recessive trait of that allelic frequency is
0.3, what is the expected frequency of heterozygous long ear lobe bearing
organisms is likely to be
1) 9% 2) 49% 3) 58% 4) 42%
199. Which of the following is not a feature of Down's Syndrome?
1) It is caused by a non-disjunction in an autosome
2) The affected individual has trisomy of chromosome 21
3) The affected individual has a characteristic palm crease
4) The individuals have abnormal skin and possess deaf mutism
200. If cattle egret is associated with grazing cattle then ______is associated with sea-
anemone.
1) Clown fish 2) Carmorant 3) Bumble bee 4) Barnacle
*******

: ANSWER KEY:
SET-1 SUB: PHYSICS
1 3 11 2 21 1 31 2 41 2
2 3 12 1 22 1 32 2 42 1
3 4 13 2 23 2 33 3 43 4
4 3 14 2 24 1 34 2 44 3
5 4 15 1 25 2 35 3 45 2
6 3 16 2 26 3 36 2 46 2
7 1 17 3 27 1 37 1 47 1
8 1 18 1 28 3 38 1 48 2
9 2 19 2 29 2 39 2 49 1
10 4 20 4 30 3 40 3 50 1
SUB:CHEMISTRY
51 3 61 3 71 3 81 4 91 4
52 4 62 4 72 3 82 2 92 3
53 3 63 3 73 1 83 4 93 3
54 1 64 3 74 1 84 2 94 2
55 2 65 1 75 2 85 4 95 3
56 3 66 3 76 2 86 1 96 2
57 1 67 1 77 4 87 1 97 1
58 3 68 1 78 4 88 4 98 2
59 3 69 3 79 3 89 3 99 1
60 2 70 3 80 3 90 2 100 4
SUB : BOTANY
101 3 111 2 121 1 131 3 141 1
102 4 112 4 122 3 132 3 142 3
103 3 113 2 123 1 133 1 143 1
104 4 114 1 124 1 134 1 144 1
105 2 115 3 125 1 135 1 145 3
106 1 116 2 126 1 136 4 146 3
107 4 117 3 127 4 137 2 147 2
108 1 118 4 128 2 138 3 148 3
109 2 119 3 129 1 139 1 149 2
110 2 120 4 130 4 140 2 150 4
151 2 161 1 171 3 181 2 191 4
152 1 162 1 172 4 182 2 192 3
153 2 163 2 173 2 183 2 193 4
154 4 164 2 174 2 184 2 194 4
155 1 165 4 175 1 185 3 195 1
156 1 166 4 176 4 186 4 196 2
157 1 167 4 177 1 187 3 197 4
158 4 168 3 178 2 188 4 198 4
159 3 169 2 179 4 189 4 199 4
160 4 170 4 180 2 190 2 200 1

NEET GRAND TEST - 9
answer sheet.
CORRECT.
Section-B;
Marking Scheme :

PHYSICS
SECTION – A
1. Given below are two statements :
Statement-I : Photovoltaic devices can convert optical radiation into electricity.
Statement-II : Zener diode is designed to operate under reverse bias in
breakdown region.
given below.
2) Statement I and statement II are incorrect
4) Statements I is incorrect but statement II is correct
2. The respective number of significant figures for the numbers 23.023, 0.0003 and
2.1103 are
1) 5, 1, 2 2) 5, 1, 5 3) 5, 5, 2 4) 4, 4, 2
3. A particle moves in a straight line with a constant acceleration. It changes its
velocity from 10ms 1 to 20ms 1 while passing through a distance 135m in t second.
The value of t is
1) 12s 2) 9s 3) 10s 4) 1.8s
 
4. Position of an ant (S in metres) moving in Y-Z plane is given by S  2t 2 j  5 k
(where t is in second). The magnitude and direction of velocity of the ant at t = 1 s
will be
1) 16 m/s in y-direction 2) 4 m/s in x-direction
3) 9 m/s in z-direction 4) 4 m/s in y-direction
5. A particle of mass m moving eastward with a speed v collides with another
particle of the same mass moving northwards with same speed v. The two
particles coalesce on collision. The new particle of mass 2m will move with
velocity
v v v v
1) North  East 2) South  West 3) North  West 4) North  East
2 2 2 2
6. A horizontal force of 10N is necessary to just hold a block stationary against a
wall. The coefficient of friction between block and wall is 0.2. The weight of the
block is
1) 20N 2) 50N 3) 100N 4) 2N

7. A car is moving at a speed of 60km/h traversing a circular road track of radius
60m. The minimum coefficient of friction to prevent the skidding of the car is
(g=10m/s2)
1) 25/54 2) 21/54 3) 15/44 4) 21/44
8. A nuclear reaction along with the masses of the particles taking part in it is as
follows
A + B  C + D + Q MeV
1.002 + 1.004  1.001 + 1.003 + Q
(a.m.u) (a.m.u) (a.m.u) (a.m.u)
The energy Q liberated in the reaction is:
1) 0.234 MeV 2) 0.931 MeV 3) 0.465 MeV 4) 1.862 MeV
9. Two identical particles each of mass 0.5 kg are interconnected by a light spring of
stiffness 100 N/m, time period of small oscillation is
   
1) s 2) s 3) s 4) s
5 2 10 2 5 10

10. Two lenses L1 and L2 having focal length 10cm and 15 cm respectively. The
distance between L1 & L2 is:
1) 10cm 2) 15 cm 3) 25 cm 4) 35 cm
11. The ratio of the diameters of two metallic rods of the same material is 4 :1 and
their lengths are in the ratio 1 : 2. If the temperature difference between them are
equal, the rate of flow of heat in there will be in the ratio of
1) 2 : 1 2) 4 : 1 3) 16 : 1 4) 32 : 1
12. The molecules of an ideal gas at a certain temperature have
1) Only potential energy 2) Only kinetic energy
3) Potential and kinetic energy both 4) None of the above
13. Stream at 100oC is passed into 20 g of water at 10oC. When water acquires a
temperature of 80oC, the mass of water present will be ( Take, specific heat of
water = 1 calg-1 oC-1 and latent heat of steam = 540 cal g-1)
1) 50 g 2) 100 g 3) 150 g 4) 22.5 g
14. Wheatstone bridge principle is used to measure the specific resistance  S1  of
given wire, having length L, radius r. If X is the resistance of wire , then specific
  r2 
resistance is: S1  X   . If the length of the wire gets doubled then the value of
 L 
specific resistance will be
S S
1) 1 2) 2S1 3) 1 4) S1
4 2
15. The translational kinetic energy of gas molecule for one mole of the gas is equal to
3 2 1 2
1) RT 2) RT 3) RT 4) KT
2 3 2 3
16. Light travels in two media A and B with speeds 1.8  108 ms 1 and 2.4  108 ms 1
respectively. Then the critical angle between them is
2 3 2 3
1) sin 1   2) tan 1   3) tan 1   4) sin 1  
3 4 3 4
17. A solid rubber ball is carried from the surface to the bottom of a 200 metre deep
pond as a result of which its volume decreses by 0.1%. The density of pond water
is 1.0  103 kgm 3 . If g = 10 ms 2 then the bulk modulus of elasticity of rubber will be
in Nm 2
1) 2  109 2) 2  102 3) 109 4) 103
18. Assertion (A): The deformation is large, stress not proportional to strain.
stress
Reason (R) : If deformation is small will decrease.
strain
1) Both assertion and reason are correct
2) If assertion is correct but R is wrong
3) If assertion is wrong but R is correct
4) Both assertion and reason are wrong
19. A liquid drop of diameter D breaks into 125 tiny drops. The change in energy is:
1) 2 TD 2) 4 TD 3)  TD 4) 8 TD
2 2 2 2
20. A cell supplies a current of 0.9 A through a 2 resistor and a current of 0.3A
through a 7 resistor. The internal resistance of the cell is :-
1) 1.0  2) 0.5  3) 2.0  4) 1.2 
21. Two satellites A and B go round a planet P in circular orbits having radii 4R and
R respectively. If the speed of the satellite A is 3V, the speed of the satellite B is
1)12V 2) 6V 3) 4V 4) 3V

22. The magnetic susceptibility is negative for
1) ferromagnetic material only
2) paramagnetic and ferromagnetic materials
3) diamagnetic matieral only 4) paramagnetic matieral only
23. Two vibrating strings of the same material but of lengths L and 2L have radii 2r
and r respectively. They are stretched under the same tension. Both the strings
vibrate in their fundamental modes, the one of length L with frequency f1 and the
f
other with frequency f2. The ratio 1 is given by:
f2
1) 2 2) 4 3) 8 4) 1
24. A particle of mass m is moving in a straight line with uniform speed v parallel to
x-axis in X-Y plane at a height ‘h’ from the X-axis. Its angular momentum about
the origin is
1) Zero
2) mvh and is directed along positive z-axis
3) mvh and is directed along negative z-axis
4) mvh and is directed along positive x-axis
25. A charged particle of charge 4mc enters a uniform magneric field of induction
B  4 i  yj  zk tesla with a velocity v  2 i  3 j  6k . If the particle continues to
move undeviated, then the strength of the magnetic field induction (B) is
________tesla.
1) 3.5 2) 2 3) 14 4) 28
26. A block of mass m moving at a velocity v collides with another block of mass 2m
at rest. The lighter block comes to rest after collision. Find the coefficient of
restitution.
1 1 1
1) 2) 1 3) 4)
2 3 4
27. If the angle of incidence is twice the angle of refraction in a medium of refractive
index '  ' then the angle of incidence (in air) is
  
1) cos 1   2) sin 1   3) 2 cos 1   4) sin 1 
 
2  
2  
2
28. The product of angular speed and tangential speed of electron in nth orbit of
hydrogen atom is
1) Directly proportional to n2 2) Directly proportional to n3
3) Inversely proportional to n4 4) Independent of n
29. in Young’s double slit experiment, intensity at the point of maxima and minima
are I0 and zero respectively. Intensities of individual sources are
I I
1) 4I0 2) 0 3) 2I0 4) 0
2 4
30. A cell of e.m.f. 2 V and negligible internal resistance is connected to resistors R1
and R2 as shown in the figure. The resistance of the galvanometer, R1 and R2 are
80, 40 and 80 respectively. The p.d across of the galvanometer is:-
1) 1.78V 2) 1.60V 3) 0.80V 4) 1.33V

31. Electric charge is unifiormly distributed along a straight wire of radius 1mm, the
charge per centimeter length of the wire is Q coulomb. Another cylindrical surface
of radius 50cm and length 1m symmetrically encloses the wire as shown in fig.
the total electric flux passing through the cylindrical surface is
Q 100Q 10 100Q
1) 2) 3) 4)
0 0  0  0
32. Two condensers, one of capacity C and other of capacity C/2 are connected to a
V-volt battery, as shown. The work done in charging fully both the condensers is
1 3 1
1) CV 2 2) CV 2 3) CV 2 4) 2CV 2
4 4 2
33. A hollow metallic sphere of radIus 10cm is charged such that potential of its
surface is 80V. The potential at the centre of the sphere would be
1) 80 V 2) 800 V 3) Zero 4) 8 V
34. A charged particle of mass m and charge q is released from rest in an electric
field of constant magnitude E. The kinetic enrgy of the particle after time t is
2E 2t 2 E 2 q 2t 2 Eq 2 m Eqm
1) 2) 3) 2
4)
mq 2m 2t 2t
35. Two coherent light sources S1 and S2 are kept at equal distances  from the
cetnre of circle on the same plane of the circle as shown in figure. In one
complete revolution on the circular path, number of maxima observed is ( =
wavelength of light used)
1) 4 2) 6 3) 8 4) 12
SECTION – B
36. Surface tension of a liquid is 50 N/m. If its thin film is made in a ring of area
0.02cm 2 , then its surface energy will be:
4 4 4 4
1) 5  10 Joule 2) 2.5  10 Joule 3) 3  10 Joule 4) 2  10 Joule
37. The moment of inertia of a thin uniform rod of length L and mass M about an axis
passing through a point at a distance of L/3 from one of its ends and
perpendicular to the rod is
ML2 ML2 7 ML2 7 ML2
1) 2) 3) 4)
6 9 24 48
38. An electric current passes through a long straight wire. At a distance 5 cm from
the wire, the magnetic field is B. The field at 20 cm from the wire would be
B B
1) 2B 2) 3) 4) B
4 2

39. The speed of a satellite that revolves around earth at a height 3R from earth’s
surface is (g=10m/s2 at the surface of earth, radius of earth R = 6400km) (in kms-
1)
1) 2 2 2) 4 3) 4 2 4) 8
40. When the engine is switched off a vehicle of mass M is moving on a rough
horizontal road with moment p. If the coefficient of friction between the road and
tyres of the vehicle is k , the distance travelled by the vehicle before it comes to
rest is
p2 2 k M 2 g p2 p2M 2
1) 2) 3) 4)
2 k M 2 g p2 2 k g 2 k g
41. An inductor L, a resistance R, and two identical bulbs, B1 and B 2 are connected to
a battery through a switch S as shown in the figure. The resistance R is the same
as that of the coil that makes L. Which of the following statements gives the
correct description of the happenings when the switch S is closed
L B1
R B2
B
S
1) The bulb B2 lights up earlier than B1 and finally both the bulbs shine equally
bright
2) B1 light up earlier and finally both the bulbs acquire equal brightness
3) B2 lights up earlier and finally B1 shines brighter than B2
4) B1 and B2 light up together with equal brightness all the time
42. A and B are two points in a closed circuit. The potential difference across the
condenser of capacity 5F is
1) 6V 2) 10V 3) 16V 4) 4V
43. A long straight wire of radius ‘a’ carries a steady current i. The curernt is
uniformly distributed across its cross-section. The ratio of the magnetic fields at
a/2 and 2a is
1) 1 2) 1/2 3) 1/4 4) 4
44. The square root of the product of inductance and capacitance has the dimension
of
1) Length 2) Mass 3) Time 4) No dimension
45. The equation of motion of a particle started at t = 0, is given by
 
y  5sin  20t   cm . The least time after which acceleration becomes zero is
 3
   
1) sec 2) sec 3) sec 4) sec
90 120 60 30

46. With respect to photoelectric effect experiment, match the entries of Column I
with the entries of Column II
Column-I Column- II
(A) If 𝑓 (frequency) is increased keeping (p) Stopping potential increases
𝐼 (intensity) and 𝜙 (work
function) constant
(B) If 𝐼 is increased keeping 𝑓 and 𝜙 (q) Saturation photocurrent increases
constant
(C) If the distance between anode and (r) Maximum KE of the photoelectrons
cathode increase increases
(D) If 𝜙 is decreased keeping f and 𝐼 (s) Stopping potential remains the same
constnat
CODES :
A B C D
1) p q s r
2) r s p q
3) s r q p
4) r p q s
47. The phenomenon of fusion is used in the construction of:

1) The hydrogen bomb 2) The atom bomb
3) An ordinary bomb 4) The neutron bomb
48. A mass of 10g moving horizontally with a velocity of 100 cm s 1 strikes a pendulum
bob of same mass. The two masses after collision stick together. What will be
the maximum height reached by the system now? (Take, g  10 ms2 )
1) 125 cm 2) 1.25 cm 3) 2.5 cm 4) 5 cm

49. Two full turns of the circular scale of a screw gauge cover a distance of 1mm on
its main scale. The total number of divisions on the circular scale is 50. Further,
it is found that the screw gauge has a zero error of -0.03mm. While measuring
the diameter of a thin wire, a student notes the main scale reading of 3mm and
the number of circular scale divisions in line with the main scale as 35. The
diameter of the wire is
1) 3.73mm 2) 3.67mm 3) 3.38mm 4) 3.32mm
50. The given graph represents V-I characteristic for a semi conductor device.
Which of the following statement is correct?

1) It is V-I characteristic for solar cell where, point A represents open circuit
voltage and point B short circuit current
2) It is a for a solar cell and point A and B represent open circuit voltage and
curent, respectively
3) It is for a photodiode and points A and B represent open circuit voltage and
current, respectively
4) it is for a LED and points A and B represent open circuit voltage and short
circuit curent respectively

CHEMISTRY
SECTION – A
51. Assertion (A): One molal aqueous acetic acid solution shows slightly higher
boiling point than 100.52o C while one molal acetic acid in benzene shows higher
freezing point than 0.36o C .
[Given : Kb of H 2O  0.52 K.molal1 . Kg and BP of H 2O  100o C; K f for benzene is
5.12 K .molal 1 and F.P. of pure benzene  5.48o C ]
Reason (R) : In water acetic acid dissociates while in benzene acetic acid
dimerises.
the assertion
52. The freezing points of 1 molal aqueous solutions of binary electrolytes AB, XY and
CD are 3.42o C , 3.18o C and 2.96o C respectively. Which of the following
dissociates more? [Kf for water  1.86 K.mol1kg ]
1) CD 2) XY 3) AB 4) Insufficient data
53. If the sodium fusion extract of an organic compound develops a blood red colour
on treatment with FeCl3 solution, which of the following ions must be present in
the sodium extract that responds to this colour test?
1) CN  2) CNO  3) SCN  4) S 2
54. At 270C if the solubility product of M(OH)2 is 3.2 x 10-11, its solubility in gL-1 is
(molar mass of M(OH)2 is 58 g mol-1)
1) 2  104 2) 1.16 1014 3) 1.16 102 4) 5.8 103
55. Atomic radii of fluorine and neon in Angstrom units are respectively given by
1) 0.72, 1.60 2) 1.60, 1.60 3) 0.72, 0.72 4) 1.60, 0.72
56. The IUPAC name of acrylaldehyde is
1) Prop-2-en-1-al 2) propenylaldehyde
3) but-2-en-1-al 4) propanal
57. In a photoelectric effect experiment, irradiation of a metal with light of frequency
5.2  1014 s 1 ejects electrons with maximum kinetic energy 1.3  10 19 J . Then the
threshold frequency of the metal is
1) 3.24  1014 s 1 2) 3.24  1012 s 1 3) 2.64  1011 s 1 4) 2.64  1014 s 1
58. Which of the following is violation of Pauli’s exclusion principle?
59. Assertion : The boiling point of cis-2-butene is more than trans-2-butene.

Reason : Cis-2-butene is more polar than trans-2-butene
60. To the given metal chloride solution excess NH4OH is added then dimethyl
glyoxime is added. Formation of red colour complex confirms the presence of
1) Cu2+ 2) Fe3+ 3) Ni2+ 4) Zn2+
61. Methyl orange gives red colour in
1) KOH solution 2) HCl solution 3) Na2CO3 solution 4) NaCl solution
62. A mixture contains 1 mole each of Fe2 and Fe3 ions. Volume of 1M KMnO4
required by mixture for the oxidation of the given mixture is ______
1) 400 ml 2) 200 ml 3) 100 ml 4) 1000 ml
1) Al2O3  MgO   Lattice energy 2) CH 3Cl  CH 3 F 
 Dipole moment
3) O2  B2 
 Bond strength 4) Na   Mg 2 
 Hydration enthalpy

64. The correct combination is:
1)  NiCl4 
2 2
-square-planar;  Ni  CN  4  -paramagnetic
2
2)  Ni  CN  4  -tetrahedral;  Ni  CO 4  -paramagnetic
3)  NiCl4  -paramagnetic;  Ni  CO 4  -tetrahedral
2
4)  NiCl4  -diamagnetic;  Ni  CO 4  -square-planar

2
65. Assertion : N2, CO and CN  are having same bond order.

Reason : Bond order is equal to the half of the difference between number of
electrons in bonding molecular orbitals and number of electrons in anti-bonding
molecular orbitals
1) ‘A’ is false but ‘R’ is true 2) ‘A’ is true but ‘R’ is false
3) Both ‘A’ and ‘R’ are true and ‘R’ is the correct explanation of ‘A’
4) Both ‘A’ and ‘R’ are true but ‘R’ is not the correct explanation of ‘A’
66. The decreasing order of bond length of C = C in the following compounds is :
1) II>I>IV>III 2) III>I>II>IV 3) II>III>IV>I 4) IV>I>II>III

67. Among the following the correct order of basicity is :
1) 2)
3) 4)
68. Which of the following statements are not true?
1) PbX2 is more stable than PbX4 2) SiO exists only at high temperature
3) IUPAC name of Flerovium is ununquadium
4) CCl4 undergoes hydrolysis readily.
69. Assertion : N2 is less reactive than P4.
Reason : Nitrogen has more negative electron gain enthalpy than that of
phosphorous.
of Assertion
70. When propyne is treated with aqueous H2SO4 in presence of HgSO4, the major
product is
1) Propanal 2) Propyl hydrogensulphate
3) Propanone 4) Propanol
(  of light absorbed)
(A) CoCl  NH 3 5 
2 (I) 310
(B) Co  NH 3 6 
3 (II) 475
(C) Co  CN 6 
3 (III) 535
(D) Co  H 2O 6 
3 (IV) 600
.

(A) (B) (C) (D) (A) (B) (C) (D)
1) IV I III II 2) III II I IV
3) III I II IV 4) II III IV I

72. Benzene on nitration gives nitrobenzene in presence of conc.HNO3 and H2SO4
mixture, where:
1) Both H2SO4 and HNO3 act as bases
2) HNO3 acts as an acid and H2SO4 acts as a base
3) Both H2SO4 and HNO3 act as acids
4) HNO3 acts as a base and H2SO4 acts as an acid
73. A solution of sodium sulphate contains 92 g of Na+ ions per kilogram of water.
The molality of Na+ ions in that solution in mol kg–1 is :
(1) 16 (2) 12 (3) 8 (4) 4
74. Volume of oxygen at NTP will be required to react with 1g of calcium is
1) 0.28L 2) 0.56L 3) 1.12L 4) 2.24L
75. Which of the following arrangements represent increasing order of oxidation
number of the central atom?
1) BrF3 , ClO3 , CrO42  , MnO4 2) ClO3 , CrO42 , MnO4 , ClO2
3) ClO2 , ClO3 , MnO4 , CrO42 4) CrO42  , MnO4 , ClO2 , ClO3
76. Methyl bromide reacts with AgF to give methyl fluoride and silver bromide. This
reaction is called
1) Fittig reaction 2) Swarts reaction
3) Wurtz reaction 4) Finkelstein reaction
77. Allyl phenyl ether can be prepared by heating:
1) C6 H5 Br  CH 2  CH  CH 2  ONa 2) CH 2  CH  CH 2  Br  C6 H5ONa
3) C6 H  CH  CH  Br  CH3  ONa 4) CH 2  CH  Br  C6 H5  CH 2  ONa
78. Which of the following is not correctly matched?
1) SF4  gas 2) SeF4  liquid 3) TeF4  solid 4) SF6  solid
79. Which of the following order correctly represents the stability of oxides of
halogens.
1) Cl  I  Br 2) I  Cl  Br 3) Br  Cl  I 4) Br  I  Cl
80. For a reaction, A → product, the conc. of ‘A’ is decreased from 1M to 0.6M in 26
minutes. The time taken for decreasing the concentration of A from 0.6M to
0.36M is 26 minutes, then the order of reaction is _____
1) 0 2) 1 3)2 4) 3
81. For the decomposition of ozone, the following mechanism is given.
O3 →O2 + O(fast)
O+O3 →2O2(slow)
Then the rate law is given by
1) Rate = K[O3]4/3 2) Rate =K[O3]2[O2]
3) Rate = K[O3]2[O2]-1 4) Rate = K[O3][O2]-1
82. 50ml of 0.2M ammonia solution is treated with 25mL of 0.2 M HCl. If pKb of
ammonia solution is 4.75, the pH of the mixture will be:
1) 3.75 2) 4.75 3) 8.25 4) 9.25
83.
84. At 298K, the enthalpy of fusion of a solid (X) is 2.8 kJ mol-1 and the enthalpy of
vaporization of the liquid (X) is 98.2 kJmol-1. The enthalpy of sublimation of the
substance (X) in kJ mol-1 is ______.
1) 101 2) 95.4 3) 103.8 4) 92.6

q
85. The entropy change can be calculated by using the expression S  rev . When
T
water freezes in a glass beaker. Choose the correct statement among the
following :
1) S (system) decreases but S (surroundings) remains the same
2) S (system) increases but S (surroundings) decreases
3) S (system) decreases but S (surroundings) increases
4) S (system) decrease but S (surroundings) also decreases
SECTION – B
86. The set of correct statements is:
(I) Manganese exhibits +7 oxidation state in its oxide.
(II) Ruthenium and Osmium exhibit +8 oxidation in their oxides
(III) Sc shows +4 oxidation state which is oxidizing in nature.
(IV) Cr shows oxidizing nature in +6 oxidation state
1) II and III 2) I, II and IV 3) I and III 4) II, III and IV
87. Which one among the following are good oxidizing agent(s)?
A) Gd3+ B) Eu2+ C) Ce4+ D) Tb4+
Choose the most appropriate answer from the options given below:
1) C only 2) D only 3) B only 4) C and D only
88. CH3Cl HNO3/H2SO4 KMnO4

A B C
Anhyd.AlCl3
In the above reaction, C is

CHO COOH CHO COOH
1) 2) 3) 4)
NO2 NO2
NO2 NO2
89. In the given reaction,
 2RCOO Na  X
2RCOOH  2Na 
 RCOO Na  H2O  Y
RCOOH  NaHCO3 
Identify X and Y in the given reaction.
X Y
1) H2 CO
2) H2 O CO2
3) H2 CO2
4) H2 O CO
90. In which of the following dehydration by conc.H2SO4, rearrangement is not
favourable?
91. Choose the compound of each of the following pairs that has the more solubility
in water :
(a) BeSO4, BaSO4 (b) NaCl, MgCl2 (c) AgCl, AgI
1) BeSO4, MgCl2, AgI 2) BeSO4, MgCl2, AgCl
3) BeSO4, NaCl, AgCl 4) BaSO4, MgCl2, AgI
92. The compound that inhibits the growth of tumors is
1) trans-[Pt(Cl)2(NH3)2] 2) cis-[Pd(Cl)2(NH3)2]
3) cis-[Pt(Cl)2(NH3)2] 4) trans-[Pd(Cl)2(NH3)2]
93. In the manufacture of H2SO4 the oxidation of SO2 to SO3 by O2 is an exothermic
reaction. The yield of SO3 will be maximum if:
1) temperature is increased and the pressure is decreased
2) both the temperature and pressure are decreased
3) the temperature is reduced and V2O5 is used as catalyst
4) both the temperature and pressure are increased

94. Resistance of 0.2M solution of an electrolyte is 50 . The specific conductance of
the solution is 1.3Sm-1. If resistance of the 0.4M solution of the same electrolyte
is 260 , its molar conductivity is
1) 6.25 104 Sm2 mol 1 2) 625 104 Sm2 mol 1
3) 62.5 Sm2 mol 1 4) 6250 Sm2 mol 1
95. Pair of elements with the following atomic numbers have the same chemical
properties
1) 13 & 22 2) 3 & 11 3) 4 & 24 4) 2 & 1
96. Match the columns.
Column-I Column-II
A)  
ArN 2 Cl   ArOH (p) HBF4 / NaNO2, Cu 
B) ArN 2 Cl  
 ArNO2 (q) H2 O
C) ArN 2 Cl  
 ArH (r) HBF4, 
D) ArN 2 Cl  
 ArF (s) CH3CH2OH
1) A – (q), B – (p), C – (s), D – (r) 2) A – (s), B – (p), C – (q), D – (r)
3) A – (q), B – (s), C – (p), D – (r) 4) A – (q), B – (s), C – (r), D – (p)
97. Assertion : Acetanilide is less basic than aniline.
Reason : Acetylation of aniline results in decrease of electron density on nitrogen.
1) Assertion is correct, reason is correct; reason is a correct explanation for
assertion.
2) Assertion is correct, reason is correct; reason is not a correct explanation for
assertion
3) Assertion is correct, reason is incorrect
4) Assertion is incorrect, reason is correct
98. Given that EH 2O H 2 Pt  0 at 298K. The pressure of H2 gas would be
1) 107 atm 2) 1014 atm 3) 1010 atm 4) 1012 atm
99.
100. Which of following statements is/are true? (A, T, G, C and U are nitrogenous
bases)
1) DNA has A,G,C,T bases 2) RNA has G,U,T bases
3) In DNA, A makes three hydrogen bonds with C 4) All the above
BOTANY
SECTION – A
101. The fungal groups that show exogenous sexual spores and endogenous sexual
spores respectively are
1) Ascomycetes and Basidiomycetes 2) Algal fungi and club fungi
3) Club fungi and Sac fungi 4) Sac Fungi and imperfect fungi

102. With respect to fungal sexual cycle choose the correct sequence of events.
1) Plasmogamy, meiosis, karyogamy 2) Plasmogamy, karyogamy, meiosis
3) Karyogamy, plasmogamy, meiosis 4) Meiosis, karyogamy, plasmogamy
(A) Non mycelial fungus (I) Phycomycetes
(B) Fungi with no asexual spores (II) Yeast
(C) Fungi without dikaryotic stage (III) Basidiomycetes
.
(D) Fungi without sexual reproduction (IV) Deuteromycetes
(A) (B) (C) (D) (A) (B) (C) (D)
.
1) II I III IV 2) II III IV I
3) II III I IV 4) III I II IV
104. The technology of biogas production was developed in India mainly due to the
efforts of
1) IPM 2) IARI and KVIC 3) IRRI 4) ICAR
105. Methanogenic bacteria are not found in
1) Rumen of cattle 2) Gobar gas plant
3) Thermophilic areas 4) Both 1 and 2
106. The chitinous exoskeleton of arthropods is formed by the polymerisation of
1) lipoglycans 2) keratin sulphate and chondroitin sulphate
3) D-glucosamine 4) N-acetyl glucosamine
107. Select the mismatch.
1) Pinus – Dioecious 2) Cycas – Dioecious
3) Salvinia – Heterosporous 4) Equisetum – Homosporous
108. Male gametophyte with least number of cells is present in……..
1) Pteris 2) Funaria 3) Hibiscus 4) Lycopodium
109. Study the following statements regarding the liverworts .
1) The liverworts grow usually in moist, shady habitats such as banks of streams,
marshy ground, damp soil, bark of trees and deep in the woods.
2) Gemmae are green, unicellular, sexual buds.
3) The leafy members of liverworts have tiny leaf-like appendages in two rows on
the stem-like structures.
4) The plant body of a liverwort is thalloid, e.g., Marchantia.
110. Study the given diagrammatic and identify the enzymes A and B involved in Step
I and Step II:
1) Step-I: EcoRI, Step-II: DNA ligase 2) Step-I: EcoRI, Step-II: EcoRI

3) Step-I: DNA ligase, Step-II: DNA ligase 4) Step-I: DNA ligase, Step-II: EcoRI
111. The floral formula of Pea is represented as :
112. Of the dsDNA sequences given below, the sequence that is expected have higher
temperature to induce denaturation
1) ATGACATTATTACATTAGTGTAT 2) ATGATTACTACGTAATGTATATA
3) GCATATTACTATATCTATATATA 4) GCCGACGCTGCGCCGTGGCCGCG

113. Statement-I: When DNA is cut by the same restriction enzyme, the resultant DNA
fragments have the same kind of sticky ends
Statement-II: Restriction exonucleases are used in genetic engineering to form
recombinant DNA
1) Statement-I is true, Statement-II is false 2) Statement-I is false, Statement-true
114. Match Column-I with Column-II and find correct option w.r.t. PCR.
Column-I Column-II
p) Denaturation a) Breaking of phosphodiester bonds
q) Annealing b) Breaking of hydrogen bonds
r) Extension c) Formation of hydrogen bonds
d) Formation of phosphodiester bonds
1) p-b, q-c, r-a 2) p-b, q-a, r-d 3) p-b, q-c, r-d 4) p-a, q-c, r-d
115. Identify the modified structure (labeled A) in the given diagram.
1) Stem tendril 2) Axillary bud tendril

3) Leaf tendril 4) Stipular tendril
116. The 1 largest petal, 2 lateral petals and 2 anterior fused petals in vexillary
aestivation are called
1) Standard, keel, wing respectively 2) Standard, wing, keel respectively
3) Keel, wing, standard respectively 4) Wings, keel, standard respectively
117. Read the following statements w.r.t. characters of Asteraceae.
A) The inflorescence is captiulum (or) Head inflorescence.
B) Hairy pappus are observed in both ray and disc florets.
C) Seeds are endospermous.
D) Fruits are mostly one seeded caryopsis.
1) A and B 2) B and C 3) C and D 4) D and A
List-I List-II
A) 
C A (I) Fabaceae
5 
B) C4A2+4 (II) Malvaceae

C) C1+2+(2) A(9)+1 (III) Solanaceae
`
`
D) C(5) A5 (IV) Brassicaceae
A B C D A B C D
3) II IV I III 4) III I IV II
119. If coding strand of DNA has the nitrogenous base sequence as 5’ATCTG3’ what
would be the m RNA strand sequence?
1) 5’AUCUG3’ 2) 5’TUGUC3’ 3) 5’UACAG3’ 4)3’UAGUC3’
120. Which of the following represents the floral characters of Poaceae?
1) Pedicellate, bracteates, bisexual, trimerous actinomorphic, complete and
superior ovary
2) Pedicellate, bracteates, bisexual, pentamerous, zygomorphic, comlete and
superior ovary
3) Sessile, bracteates, bracteolate, incomplete, uni or bisexual, perianth modified
into lodicules, stamens three, superior ovary and feathery stigma
4) Bracteate, unisexual, actinomorphic stamens five and inferior ovary
121. How many chromosomes shall be present in a diploid cell at mitotic anaphase if
ovum of same species has ten chromosomes?
1) 10 (Ten) 2) 20 (Twenty) 3) 30 (Thirty) 4) 40 (Forty)

122. Nirenberg synthesized an m-RNA containing 34 poly-Adenine (A-A-A-A-A-A--) and
found a polypeptide formed of 11 poly-lysine this proved that genetic code for
lysine was :
1) one-adenine 2) A-A doublet 3) A-A-A triplet 4) Many adenines
123. The radioactive elements used by Hershey and chase in their experiment?
1) P30, S34 2) N14, P32 3) N15, S35 4) P32, S35
1) Rhofactor – Initiation of transcription 2) RNA polymerase I- r-RNA
3) Promoter – binding site for RNA polymerose
4) Amino acyl tRNA synthetase – Activation of aminoacids
125. Which of the following is true about guard cells?
1) Outerwall is thin
2) Innerwall is thick
3) Bean-shaped in dicots and dumb-bell shaped in grasses
4) All of the above
126. Assertion : Monocot stem have sclerenchymatous hypodermis.
Reason : In monocot stem peripheral vascular bundles are generally large &
centrally located are small
127. Match List -I with List - II.
List-I List-II
a) Lenticels (i) Phellogen
b) Cork cambium (ii) Suberin deposition
c) Secondary cortex (iii) Exchange of gases
d) Cork (iv) Phelloderm
a b c d a b c d
1) iv i iii ii 2) iii i iv ii
3) ii iii iv i 4) iv ii i iii
128. Which of the following is a monohybrid?
1) RrYy 2) RRYY 3) RrYY 4) rryy
129. In a dihybrid cross 400 individuals are produced in F2 generation. Approximately
how many will be phenotypically different to parents?
1) 225 2) 175 3) 150 4) 100
130. Crossing over in diploid organism is responsible for
1) Dominance of genes 2) Linkage between genes
3) Recombination of linked genes 4) Segregation of alleles
131. Select the odd one out with respect to the chromosomal theory of inheritance
1) It was proposed by Sutton and Boveri
2) The behaviour of chromosomes is parallel to the behaviour of genes
3) Chromosomes and genes occur in pairs in diploid and haploid cells respectively
4) The paired condition of both, chromosome as well as mendelian factor is
restored during fertilization.
132. Assertion (A): Emasculation is the process of removal of pistils from bisexual
flowers.
Reason (R): Emasculation is used to induce self pollination.
1) A single human cell has 2.2 m long thread of DNA
2) Part of chromosomes after second constriction is called telomere
3) Centromere forms first site of constriction
4) Chromatin consists of DNA, RNA, histones and non-histones
134. If selfing occurs in the plant having genotype RrYy, then ratio of given genotype
will be :
RRYY, RrYY, RRYr, RrYy
1) 1 : 2 : 2 : 4 2) 1 : 2 : 2 : 1 3) 1 : 1 : 1 :1 4) 2 : 2 : 2 : 1

135. Attractants and rewards are required for:
1) Anemophily 2) Entomophily 3) Hydrophily 4) Cleistogamy
SECTION – B
136. Continued self-pollination results in:
1) Genetic drift 2) Heterosis
3) Inbreeding depression 4) Polyembryony
137. The ovule of an angiosperm is technically equivalent to:
1) Megaspore mother cell 2) Megaspore
3) Megasporangium 4) Megasporophyll
138. In majority of angiosperms:
1) Reduction division occurs in the megaspore mother cell
2) A small central cell is present in the embryo sac
3) Egg has a filiform apparatus 4) There are numerous antipodal cells
139. Biogas generation is three stage anaerobic digestion of animal and other organic
waste. Study the following flow chart and select the correct option for stages I, II
and III.
1) In stage- I, anaerobic microorganisms bring about enzymatic breakdown of

complex organic copounds into simple soluble compounds or monomers.
2) In state – II, monomers are converted into organic acids by fermentation
causing microbes
3) In stage- III, organic acids are acted upon by methanogenic bacteria to produce
biogas
4) All of these
140. Statement–I : More than one polypeptide upon each other in the form of a cube
(or) plate etc.
Statement–II : In adult human beings of hemoglobin two sub units of -type and
two subunits of  type polypeptides form cuboid quarternary structure.
141. Examples of tissues that are formed by redifferentiation are
1) Secondary xylem 2) Secondary phloem
3) Cork cell 4) All of these
142. Statement–I: Natural cytokinins are synthesized in regions where rapid cell
division occurs.
Statement–II : Cytokinins promote nutrient mobilization which inhibits the delay
of leaf senescence.
143. Ethylene initiates
1) Flowering in pineapple 2) Floweirng in mango
3) Fruit ripening in tomato 4) All of these
144. Read the statements:
I) The complete disintegration of nuclear envelope marks metaphase.
II) Pairing of homologous chromosomes is called synopsis.
III) Condentation of chromosomes is completed.
Select correct option.
1) I and III true for Metaphase 2) II is true for Anaphase – I
3) II is true for prophase 4) I and II true for Metaphase

145. In x phase centrosome undergone duplication & in y phase begins to move
opposite poles of the cell.
1) x – prophase, y – interphase 2) x – interphase, y – prophase
3) x – interphase, y – metaphase 4) x – prophase, y – metaphase
146. During breakdown of proton gradient, energy is released. It causes
conformational change in -
1) Proton pump 2) Fo of ATPase 3) F1 to ATPase 4) NADP reductase
147. Calvin cycle takes place in :-
1) Only C3 plants 2) Only C4 plants
3) Both C3 and C4 plants 4) Neither C3 nor C4 plants
148. Select incorrect statement w.r.t. LHC.
1) Made up of hundreds of pigment molecules
2) Pigment molecules are bound to lipids
3) Harvest different wavelengths of light
4) Help to make photosynthesis more efficient
149. For every molecule of glucose during glycolysis, the ratio between pyruvic acid
formed and net gain of ATP molecules formed by S.L.P is
1) 1 : 1 2) 2 : 1 3) 2 : 3 4) 3 : 1
150. Pyruvic acid enters into krebs cycle as
1) Phosphoenol pyruvate 2) 2 - PGA
3) 3 - PGA 4) Acetyl CoA
ZOOLOGY
SECTION – A
151. Assertion(A): The immune responses of old persons are generally weak.
Reason(R): Thymus is degenerated in old individuals resulting in the decreased
production of thymosins.
1) Both A & R are true, and R is correct explanation of A
2) Both A & R are true, and R is not correct explanation of A
152. Food and air pathway are divided at
1) Pharynx 2) Larynx 3) Oesophagus 4) Glottis
153. What is being represented by the end of the T wave?
1) End of systole of heart 2) End of systole and starting of a new wave
3) End of atrial systole only 4) Disorder of SA node
154. Statement–I : Only two factors affect Hardy Weinberg equilibrium
Statement–II : Hugo de Vries gave idea of mutation by working on evening
primerose.
155. Following are signs which indicate improved reproductive health of the society
a) Better awareness about sex-related problem.
b) Better detection and cure of STDs.
c) Increased number of couples with large families.
1) (a) & (c) 2)(b) & (c) 3) (a) & (b) 4)(a),(b) &(c)
156. The relationship between the species richness and the area for a wide variety of
taxa appears as
1) straight line 2) sigmoid curve
3) J-shaped curve 4) rectangular hyperbola
157. Amongest birds, mammals, amphibians and Gymnosperms, the minimum and
maximum threat of extinction is faced respectively by
1) Birds, Amphibians 2) Amphibians, Gymnosperms
3) Mammals, Amphibians 4) Mammals, Birds
158. The nervous system in cockroach
1) Is does not spreads throughout the body because head holds a bit of nervous
system
2) Is represented by segmentally arranged ganglia and ventral nerve cord
3) Confined only to head and thorax region
4) Consists of supra-oesopharyngeal ganglia in head and dorsal nerve cord

159. The excretory organs in cockroach are
1) Green glands 2) Hepatic caecae
3) Malpighian tubules 4) Malpighian corpuscles
160. Frog heart is
1) 2-chambered 2) 3-chambered 3) 4-chambered 4) 5-chambered
161. The MAP (mean annual precipitation) of tropical forest is about ______ (in cm).
1) 150-400 2) 50-80 3) 100-150 4) 10-50
162. The Abingdon tortoise in Galapagos islands versus introduction of goats in the
some island stood as an example for
1) Competitive exclusion 2) Competitive release
3) Resource partitioning 4) Competitive interference
163. Organ of corti is located on/in
1) Basilar membrane 2) Reissner’s membrane
3) Tectorial membrane 4) Scala vestibuli
164. Which of the following is not the function of skeleton?
1) Movement 2) Storage of minerals
3) Production of body heat 4) Both 1 and 2
165. Which one of the following statement is correct with respect to kidney function
regulation?
1) Expossure to cold temperatures stimulates ADH release
2) An increase in glomerular blood flow stimulates the formation of angiotensin–II
3) When the body loses a lot of water by sweating, the release of vasopressin is
suppressed.
4) When blood pressure increases, atria of heart release ANF.
166. The correct functions of ascending limb of LH is _____
1) Impermeable to water and active transport of electrolytes
2) Permeable to water and sodium-potassium balance in blood.
3) Selective secretion of H+ and reabsorption of large amount of water.
4) Both 1 & 3.
167. Assertion (A) :Urinary blader & ureter are lined by involuntary muscles.
Reason (R) :Ureters carry the urine to urinary bladder where it is stored.
168. The human heart pumps _______ of blood every minute
1) 1 to 2L 2) 5 to 6 L 3) 8 to 10 L 4) 12 to 15 L
169. The portal circulation in human body exists between
a) Hypothalamus and adenohypophysis b) Intestine and liver
c) Hind limbs and kidney d) Gonads and kidney
1) a and b 2) a,b and c 3) c and d 4) b only
170. Evolution of life shows that life forms had a trend of moving from
1) Land to water 2) Dry land to wet land
3) Freshwater to sea water 4) Water to land
171. Which of the following are not taken into account in ecological pyramids?
(a) Omnivores (b) Carnivores (c) Herbivores (d) Saprophytes
Options :
1) a, d 2) b, c 3) c, d 4) a, c
172. A) Cannabinoids - P) Depressant
B) Cocaine - Q) Accelerant
C) Heroin - R) Euphoria
- S) Cardiovascular system
1) A-P, B-Q, C-S 2) A-Q, B-R, C-S 3) A-S, B-P, C-Q 4) A-S, B-R, C-P
173. The break bone fever is caused by
1) Bacteria 2) Virus 3) Protozoan 4) Helminths
174. HIV virus enters into which of the following cells?
1) B-lymphocytes 2) Monocytes 3) Macrophages 4) Neutrophils

175. Read the following statements and choose the correct.
1) One ejaculatory duct is formed by the union of ducts from seminal vesicles and
vasa deferentia of both sides
2) The placenta facilitate the supply of oxygen and nutrients from mother to
embryo
3) Gametogenesis is one of the event between parturition and lactation
4) Female offspring inherits both X-chromosomes from mother only (in normal
condition)
176. For increasing the food production, which biotechnological application is applied
1) Agro-chemical based agriculture
2) Organic agriculture
3) Genetically engineered crop based agriculture
4) All of the above
177. Statement –I : The functions are unknown for over 50% of the discovered genes.
Statement–II : More than 2% of the genome codes for proteins.
178. Which of the following pairs incorrectly matchetd related to locomotory organs?
1) Pseudopodia - Amoeba
2) Combplates - Cnidaria
3) Limbs - Mammalia
4) Parapodia - Neries
179. Given the following possess pharyngeal Gill slits except
1) Dog fish 2) Pristis 3) Clarius 4) Echinus
180. The critical research area of biotechnology is/are :
1) Downstream processing technologies to purify the protein/organic compound
2) Providing the best catalyst in the form of improved organism usually a microbe
or pure enzyme
3) Creating optimal conditions through engineering for a catalyst to act
4) All of the above
181. The example of adaptive radiation in the development of new species is
1) Darwin finches 2) Marsupials of Australia
3) Placental mammals of Australia 4) All of these
182. Melatonin regulates the following functions except:
1) Pigmentation 2) Diurnal rhythm
3) Body temperature 4) Erythropoiesis
183. Statement–I : In PKU phenylpyruvic acid and other derivatives are excreted
through urine because of their poor absorption by kidney.
Statement–II : Aneuploidy is due to segregation of chromatids during cell
division cycle.
1) S–I and S–II are correct. 2) S–I is incorrect & S–II is correct.
3) S–I is correct & S–II is incorrect. 4) S–I and S–II are incorrect.
184. Assertion: UV radiation has the ability to cause mutations in the organisms.
Reason: UV radiation is a common mutagen.
assertion.
185. Statement–I : Mendelian disorders are mainly determined by mutation of single
gene.
Statement–II : Mendelian disorders can be traced in a family by pedigree
analysis.

SECTION – B
186. If both parents carrier for Sickle cell anaemia, what is the probability of progeny
getting affected with the disease?
1) 75% 2) 50% 3) 25% 4) 100%
187. The given pedigree is
1) X-linked recessive 2) Y-linked

3) X-linked dominant 4) Autosomal dominant
188. The ‘r’ value of human population in 1981 is _____
1) 0.0205 2) 0.12 3) 0.015 4) 0.10
189. Spleen is a bean shaped organ it contains abundant
a) Monocytes b) Phagocytes c) Lymphocytes d) Neutrophils
1) a, b 2) b, c 3) c,d d) a,d
190. Fill in the blanks (A – D) with the appropriate terms with respect to the detritus
food chain (DFC).
The detritus food chain begins with ___A___. It is made up of decomposers which
are ___B__ organisms, mainly ___C___. They meet their energy and nutrient
requirements by degrading ___D____.
1) A - detritus, B - autotrophic, C – earthworm, D - dead organic matter
2) A - dead organic matter, B - heterotrophic, C - fungi and bacteria, D – detritus
3) A – dead organic matter, B – autotrophic, C - fungi and plants, D – dead
organic matter
4) A – grass, B – heterotrophic, C – fungi and bacteria, D – dead organic matter
191. Statement–I : IUDs are most widely used contraceptives by female in India.
Statement–II : IUDs prevents ovulation and STDs.
1) S–I and S–II are correct. 2) S–I is correct & S–II is incorrect.
3) S–I is incorrect & S–II is correct. 4) S–I and S–II are incorrect.
192. The common man would find it hard to believe that there are more than _____
species of ants, ________ species of beetles, _______species of fishes.
1) 3,00,000 ; 20,000 ; 28,000 2) 28,000 ; 20,000 ; 3,00,000
3) 3,00,000 ; 20,000 ; 20,000 4) 20,000 ; 3,00,000 ; 28,000
193. Match the following and chose the correct option:
A. Family i. tuberosum
B. Kingdom ii. Polymoniales
C. Order iii. Solanum
D. Species iv. Plantae
E. Genus v. Solanaceae
1) A-iv, B-iii, C-v, D-ii, E-i 2) A-v, B-iv, C-ii, D-i, E-iii
3) A-iv, B-iii, C-v, D-i, E-ii 4) A-iv, B-iii, C-ii, D-v, E-i
194. Statement-I : Rate of breathing is regulated by respiratory rhythm centres
present in the medulla oblongata.
Statement-II : Changes in the CO2 and H+ concentration in the arterial blood is
recognized by the chemo receptors.
195. Find out correct statement from the following:
I) According to Darwin there is a gradual evolution of life forms.
II) Darwin travel in H.M.S Beagle
III) Alfred Wallace worked in Malay Archipelago
IV) Fossils are remains of life forms which have found in sedementary rocks
1) I, II only 2) III, IV only 3) I, II, IV only 4) I, II, III, IV
196. Mammalian lungs contain a large number of minute alveoli (air sacs). This is to
allow.
1) More space for increasing the total volume of inspired air
2) More surface area for diffusion of gases
3) More spongy texture for keeping lungs in proper shape
4) More nerve supply to keep the organs working more efficiently

Column-I Column-II
A) White matter (i) 3 Na out, 2K  in

B) Na+/K+ pumps transport (ii) Cortex

C) Gastric secretion (iii) Inner to cortex
D) Prominent folds (iv) Fore brain
E) Cerebral hemispheres (v) Medulla oblongata
1) A-iv, B-v, C-iii, D-i, e-ii 2) A-i, B-v, C-iv, D-ii, e-iii
3) A-i, B-iv, C-ii, D-iii, e-v 4) A-iii, B-i, C-v, D-ii, e-iv
198. Match List I and List II:
List I List II
A. Vertebrochondral ribs I. 12
B. Facial bones II. 6
C. Thoracic vertebrae III. 7
D. Ankle bones IV. 14
1) A – I, B – II, C – III, D – IV 2) A – IV, B – II, C – I, D – III
3) A – III, B – I, C – IV, D – II 4) A – II, B – IV, C – I, D – III
199. Assertion (A): Fertilisation in Scoliodon is internal.
Reason (R): Male Scoliodon bears claspers on its pectoral fins.
3) A is correct and R is incorrect.
1) Spermatogenesis starts at the puberty due to significant increase in the
secretion of GnRH
2) LH acts on the Leydig cells and stimulates synthesis and secretion of
androgens
3) Androgens stimulate the seprmatogenesis
4) Menstrual cycle is the reproductive cycle in all mammals
*******

: ANSWER KEY:
SET-1
SUB: PHYSICS
1 1 11 4 21 2 31 2 41 1
2 1 12 2 22 3 32 2 42 1
3 2 13 4 23 4 33 1 43 1
4 4 14 4 24 3 34 2 44 3
5 4 15 1 25 3 35 3 45 4
6 4 16 4 26 1 36 4 46 1
7 1 17 1 27 3 37 2 47 1
8 4 18 1 28 3 38 2 48 2
9 4 19 2 29 4 39 2 49 3
10 3 20 2 30 3 40 1 50 1
SUB:CHEMISTRY
51 1 61 2 71 2 81 3 91 2
52 3 62 2 72 4 82 4 92 3
53 3 63 4 73 4 83 3 93 3
54 3 64 3 74 1 84 1 94 1
55 1 65 4 75 1 85 3 95 2
56 1 66 2 76 2 86 2 96 1
57 1 67 2 77 2 87 4 97 1
58 2 68 4 78 4 88 4 98 2
59 1 69 3 79 2 89 3 99 1
60 3 70 3 80 2 90 1 100 1
SUB : BOTANY
101 3 111 1 121 4 131 3 141 4
102 2 112 4 122 3 132 4 142 2
103 3 113 1 123 4 133 2 143 4
104 2 114 3 124 1 134 1 144 1
105 3 115 3 125 4 135 2 145 2
106 4 116 2 126 3 136 3 146 3
107 1 117 1 127 2 137 3 147 3
108 3 118 3 128 3 138 1 148 3
109 1 119 1 129 3 139 4 149 1
110 1 120 3 130 3 140 2 150 4
151 1 161 1 171 1 181 4 191 2
152 1 162 1 172 4 182 4 192 4
153 1 163 1 173 2 183 3 193 2
154 4 164 3 174 3 184 1 194 1
155 3 165 4 175 2 185 1 195 4
156 4 166 1 176 3 186 3 196 2
157 1 167 1 177 3 187 2 197 4
158 2 168 2 178 2 188 1 198 4
159 3 169 1 179 4 189 2 199 3
160 2 170 4 180 4 190 2 200 4

NEET GRAND TEST - 10
STD : XII, LT & CC SET – 1 Max. Marks : 720
answer sheet.
CORRECT.
Section-B;
Marking Scheme :

GT - 10 (SET-1) XII, LT & CC-NEET MODEL-01.05.2024
PHYSICS
SECTION – A
1. If C, R, L and I denote capacity, resistnace, inductance and electric current
respectively, the quantities having the same dimensions of time are
L
(A) CR (B) (C) LC (D) LI 2
R
1) (A) and (B) only 2) (C) and (D) only 3) (A) and (D) only 4) (A), (B) and (C) only
2. The kinetic energy of a given sample of an ideal gas depends only on its
1) Volume 2) Pressure 3) Density 4) Temperature
3. A particle moves along a straight line such that its displacement at any time t is
given by S  t 3  6t 2  3t  4 . The acceleration at t = 2 sec is
1) 3 ms 2 2) 12 ms 2 3) 42 ms 2 4) 0 ms 2
4. A charged particle of mass m and charge q is accelerated through a potential
difference of V volts. It enters a region of uniform magnetic field B which is
directed perpendicular to the direction of motion of the particle. The particle will
move on a circular path of radius
Vm 2Vm 2mVq Vm  1 
1) 2
2) 2
3) 4)  
2qB qB Bq q B
5. The maximum force required to move a body up an inclined plane of inclination
1
300 is (the coefficient of friction between the body and the plane is )
3
mg mg
1) 2) mg 3) 2 mg 4)
2 3
6. A coil having 20 turns is suspended in a magnetic field of 0.2 wb/m 2 of a
Galvanometer by a suspension wire of couple per unit twist 106 N-m/ o . If the least
measurable deflection is 0.1o then the least measurable current is (area of coil is
103 m 2 )
1) 25 mA 2) 50 mA 3) 25 A 3) 50 A
7. Which of the substance A,B and C has low specific
heat (for same mass):-
1) A 2) B
3) C 4) All have same specific heat
8. A hollow sphere is filled with water. Which of the following points the positions of
C.M of the system shown in figure?
1) A 2) B 3) C 4) D
9. Two short magnets each of moment M are placed one over
the other at right angles. The resultant magnetic induction
at point ‘P’, that lies at a distance ‘d’ from the common
centre is
 3M  3M
1) 0 3 2) 3 0 3
4 d 4 d
0 M 0 M
3) 5 4)
4 d 3 4 d 3
10. In a straight line motion, the distance covered is proportional to the square of the
time taken. Then the acceleration of the particle is proportional to tn, value of n
is (v = instantaneous velocity)
1) zero 2) 1/2 3) 2 4) 3

11. The amount of heat required in converting 2 g ice at – 10oC into steam at 100oC
will be (Lf = 80 cal/g, Lv= 540 cal/g, Sice= 0.5 cal/g0C, Swater= 1 cal/g0C)
1) 420 cal 2)1450cal 3) 205 cal 4) 290 cal
12. In an electromagnetic wave, at an instant and at a particular position, the electric
field is along the negative z-axis and magnetic field is along the positive x-axis.
Then the direction of propagation of electromagnetic wave is:
1) At 450 angle from positive y-axis 2) Negative y-axis
3) Positive z-axis 4) Positive y-axis
13. In thermodynamic processes which of the following statements is not true?
1) In an isochoric process pressure remains constant.
2) In an isothermal process the temperature remains constant.
3) In an adiabatic process PV  =constant
4) In an adiabatic process the system is insulated from the surroundings.
14. The ratio of mean free path of molecules in samples of two gases with diameters
of molecules as d and 2d is (other parameters are constant)
1)4 : 1 2) 1 : 4 3) 1 : 1 4) 1 : 2
15. If l1   20  0.2  cm and l2  15  0.1 , then l1  l2 in cm is
1) 5  0.1 2) 5  0.3 3) 35  0.3 4) 35  0.1
16. A solid metallic sphere has a charge +3Q. Concentric with this sphere is a
conducting sphereical shell having charge –Q. The charge on the outer surface of
the shell is
1) 2Q 2) 2Q 3) 4Q 4) 4Q
17. An ideal gas is compressed to half its initial volume by means of several
processes. Which of the process results in the maximum work done on the gas?
1) Isochoric 2) Isothermal 3) Adiabatic 4) Isobaric
18. What force is required to stretch a wire of 1 cm2 in cross-section to double its
length? Given
Y  2 1011 N / m 2
1) 2  107 N 2) 2  108 N 3) 2 1011 N 4) None
19. The refractive index of a prism for a monochromatic wave is 2 and its refracting
angle is 60 o . For minimum deviation, the angle of incidence will be
1) 30o 2) 45 o 3) 60 o 4) 75o
20. Effective capacitance of the circuit between A and C is
1) 20  F 2) 40  F 3) 10 F 4) 50  F
21. In the energy band diagram of a material shown below, the open circles and filled
circles denote holes and electrons respectively. The matieral is
1) an insulator 2) a metal
3) an n-type semiconductor 4) a p-type semiconductor
22. In a Young’s double slit experiment, 12 fringes are observed to be formed in a
certain region of the screen when light of wavelength 600 nm is used. If the light
of wavelength 400 nm is used, the number of fringes observed in the same region
of the screen will be
1) 12 2) 18 3) 24 4) 8
23. Tuning fork ‘A’ when sounded with a tuning fork ’B’ of frequency 480Hz gives 5
beats per second. When the prongs of ‘A’ are loaded with wax, it gives 3 beats per
second. Original frequency of A
1) 485 2) 483 3) 475 4) 480

24. In the circuit shown in figure, the power which is dissipated as heat in the 8
resistor is same as R resistor .What is the value of resistance R in the circuit?
1) 6 2) 10 3) 3 4) 8
25. Which of the following statements is true for nuclear forces:
1) They obey the inverse fourth law of distance
2) They obey the inverse thid power law of distance
3) They are short range forces
4) They are equal in strength to the electro magnetic forces
26. A small square loop of wire of side l is placed inside a large square loop of wire of
side L (L>>l). The loop are coplanar and their centre coincide. The mutual
inductance of the system is proportional to
1) l / L 2) l 2 / L 3) L / l 4) L2 / l
sin i
27. In the figure shown is equal to
sin r
22 3  
1) 2) 3) 3 2 1 4) 1
3 1 1 2 3
28. By what factor will the de Brogile wavelength changes if the K.E if the free
electron is doubled?
1 1
1) 2) 3) 2 4) 2
2 2
29. In Young’s double slit experiment the separation between the slits is 4 ( is the
wavelength of the light used). The possible maxima formed on the screen placed
at a distance of 1m from the slits, is
1) 6 2) 5 3) 9 4) 13
30. Statement – I: The angular momentum is an axial vector
dL
Statement – II:Angular momentum is conserved if  ext  0  0.
dt
31. The bulk modulus of a spherical object is ‘B’. If it is subjected to uniform
pressure ‘p’, the fractional decrease in radius is
B 3p p p
1) 2) 3) 4)
3p B 3B B
32. If a hemispherical body is placed in a uniform electric field E then the flux linked
with the curved surface is
1) 2 R 2 E 2)  R 2 E 3) 4 R 2 E 4) 6 R 2 E
33. A capacitor connected to a 10V battery collects a charge 40  C with air as
dielectric and 100  C with oil as dielectric. The dielectric constant of oil is
1) 2 2) 2.5 3) 4 4) 10
34. Two capillary tubes of different diameters are dipped in water. The rise of water is
1) The same in both tubes 2) Greater in the tube of larger diameter
3) Greater in the tube of smaller diameter
4) Independent of the diameter of the tube

35. A tuning fork of frequency 340 Hz is vibrated just above a cylindrical tube of
length 120cm. If the speed of sound in air is 340 ms-1, then the maximum height
of water required for resonance is
1) 75 cm 2) 95 cm 3) 25 cm 4) 105 cm
SECTION – B
36. A 6  resistance is connected in the left gap of a meter bridge. In the second gap
3  and 6  are joined in parallel. The balance of the bridge is at_________
1) 75cm 2) 60cm 3) 30cm 4) 25cm
37. The displacement-time (x-t) graph of a particle executing simple harmonic motion
is shown in figure. The correct variation of net force F acting on the particle as a
function of time is
38. A body of mass 10kg moves on rough horizontal surface with initial velocity
10m/s and travels 500m before coming to rest. The coefficient of friction is
(g=10 ms-2)
1) 0.1 2) 0.5 3) 0.05 4) 0.01
39. A rod of ferromagnetic material with dimensions 10cm  0.5cm  2cm is placed in a
magnetizing field of intensity 2 10 A / m . The magnetic moment produced due it is
5
6 amp  m2 . The value of magnetic induction will be…….102 T

1) 100.48 2) 200.28 3) 50.24 4) 300.48
40. The potential energy of a particle executing SHM varies sinusoidally with
frequency f. The frequency of oscillation of the particle will be
f f
1) 2) 3) f 4) 2 f
2 2
41. The moment of inertia of a uniform semicircular disc of mass M and radius r
about a line perpendicular to the plane of the disc through the centre is
1 1 2
1) Mr 2 2) Mr 2 3) Mr 2 4) Mr 2
2 4 5
42. The wing span of an aeroplane is 20 metre. It is flying in a field, where
the vertical component of magnetic field of earth is 5 10 5 telsa, with velocity
360 km/h. The potential difference produced between the blades will be
1) 0.10 V 2) 0.15 V 3) 0.20 V 4) 0.30 V
43. In the diagram shown in figure, collision is perfectly elastic. Match the following
columns and mark the correct option form the codes given below.
Column-I Column-II
A) For v = v (p) m1  m2
B) For v = 2v (q) m1  m2
C) For v = 0 (r) m1  m2
Codes :
A B C A B C
1) P Q R 2) Q P R
3) S R Q 4) S P R

44. A plane electro magnetic wave of frequency 25 MHz travels in free space along the
 
x-direction. At a particular point in space and time E  6.3 j . The magnetic field

B at this point is
   
1) 4.2  10 8 k T 2) 2.1 10 8 k T 3) 18.9 108 k T 4) 9.1 10 8 k T
45. The work done in blowing a soap bubble of radius 0.2 m, given that the surface
3
tension of soap solution is 30  10 N / m , is:
1) 24  10 J 2) 8  10 J 3) 96  10 J 4) 192  10 J
4 4 4 4
46. Assertion: The graph of stopping potential frequency of incident

radiation is a straight line and not passing through the origin.
Reason: According to Einstein’s photoelectric equation the slope of the graph
h0
between and is and negative y intercept
c
1) If both (A) and (R) are true, and (R) is the correct explanation of (A).
2) If both (A) and (R) are true but (R) is not the correct explanation of (A).
3) If (A) is true but (R) is false. 4) If (A) is false but (R) is true.
47. Fusion reactions take place at high temperature because:
1) Atoms are ionized at high temperature
2) Molecules break up at high temperature
3) Nuclei break up at high temperature
4) Kinetic energy is high enough to overcome repulsion between nuclei
48. A thin rod of mass 6m and length 6L is bent into regular hexagon. The M.I of the
hexagon about normal axis to its plane and through centre of system is
1) mL2 2) 3mL2 3) 5mL2 4) 11mL2
49. Choose the correct statement among the following.
Statement (A): In intrinsic semiconductors, the number of free electrons ne is
equal to number of holes nh.
Statement (B): An intrinsic semiconductor will behave like an insulator at
T=0K
1) Only A 2) Only B 3) Both A and B 4) Neither A nor B
50. If our planet suddenly shrinks in size, still remaining perfectly spherical with
mass remaining unchanged.
(A) Duration of the day (P) Increase
(B) Kinetic energy of rotation (Q) Unchanged
(C)
.
Duration of the year (R) Decrease
.
(A) (B) (C) (A) (B) (C)

1) R P Q 2) P R Q
3) Q R P 4) R Q P
CHEMISTRY
SECTION – A
51. Three solutions are separately prepared by dissolving 18g of glucose in 250ml of
water, 5.85 g of NaCl in 400 ml of water and 34.2 g of sucrose in 150 ml of water.
If P1, P2 and P3 are their respective osmotic pressures at 27 o C , then their correct
order is
1) P1>P2>P3 2) P2>P1>P3 3) P3>P1>P2 4) P3>P2>P1
52. The relation among conductance (G), specific conductance (k) and cell constant
(l/A) is :
l A l
1) G  k 2) G  k 3) Gk  k 4) G  kAl
A l A
53. The distillation technique most suited for separating glycerol from spent lye in
the soap industry is
1) fractional distillation 2) steam distillation
3) distillation under reduced pressure 4) simple distillation

54. Which of the following is wrong regarding photoelectric effect?
1) Generally K and Cs are used in photoelectric cells
2) Maximum KE of ejected electron depends upon the wavelength of the incident
radiation
3) The intensity of photocurrent depends upon frequency of the incident radiation
4) Threshold energy depends upon nature of the metal
55. From the following given electronic configuration, identify the correct order of
electron affinity.
(I)  He 2 s 2 2 p 5 (II)  He 2 s 2 2 p 3
(III)  Ne  3s 2 3 p 5 (IV)  Ne  3s 2 3 p 3
1) I>II>III>IV 2) III>I>IV>II 3) I<II<III<IV 4) II>III>IV>I
56. The IUPAC name of the compound CH3CH=CH-C≡CH is
1) Pent – 4 – yn – 2 – ene 2) pent – 3 – en – 1 – yne
3) pent-2-en-4-yne 4) pent – 1 – yn – 3 – ene
2
57. The number of electrons in Mn ion with l = 2 and m = -1 is _______
1) 1 2) 5 3) 3 4) 10
58. Which of the following particle has higher wavelength if all the given particles are
moving with same velocity?
1) He atom 2) H2 molecule 3) N2 molecule 4) O2 molecule
59. The order of stability of the following tautomeric compounds is
1) II > III > I 2) I > II > III 3) III > II > I 4) II > I > III
60. Which of the following is more ionic?
1) LiI 2) KBr 3) NaCl 4) CsF
61. Which of the following does not react with Hinsberg’s reagent?
1) 1o -amine 2) 2o -amine 3) 3o -amine 4) All of these
62. Generally the lyophobic collides like gold sol, silver sol etc are prepared by
1) Peptization 2) Mechanical dispersion
3) Bredig’s arc method 4) Electrophoresis
63. Match the compounds Column-I with its structure in Column-II and assign the
correct code :
Column-I Column-II
(a) SF4 (i) See-Saw
(b) BrF5 (ii) square pyramidal
(c) XeF2 (iii) linear
(d) PCl5 (iv) Trigonal bipyramidal
Codes :
(a) (b) (c) (d)
1) (iv) (i) (ii) (iii)
2) (i) (iii) (iv) (ii)
3) (i) (ii) (iii) (iv)
4) (iv) (iii) (i) (ii)
64. Incorrect statement among the following is
1) p-Nitrophenol has intermolecular H-bonding
2) H2O has higher dipolemoment than that of HF
3) Ammonia possesses intramolecular H-bonding
4) NF3 is polar while BF3 is non-polar
65. Which of the following is paramagnetic with fractional bond order?
1) O2 2) C2 3) B2 4) N 2

66. Statement –I : Pyrrolidine (II) is more basic than pyrrole(I).
Statement –II : Protonated pyrrole has resonance stabilization of positive charge

in aromatic ring.
statement-I
67. Statement –I : The difference between Ka1 and Ka2 for dicarboxylic acids of type
decreases as n increases.
Statement –II : On increasing n the –I effect of –COOH group decreases (Ka1,
decreases) also +I effect of COO  group decreases (Ka2 increases)
statement-I
68. Which of the following pairs of elements have almost same electronegativity in
15th group?
1) N, P 2) P, As 3) As, Sb 4) Sb & Bi
69. Assertion (A): Nitrogen is chemically inert at room temperature.
Reason (R) : In 15th group elements nitrogen has higher electronegativity.
the assertion
70. The order of decreasing reactivity towards an electrophilic reagent, for the
following would be
a. Benzene b. Toluene c. Chlorobenzene d. Phenol
1) d > b > a > c 2) a > b > c > d 3) b > d > a > c 4) d > c > b > a
71. What is X in the following sequence of reactions?
X  Na
1 / 2 H 2
 Z 
NaOH / CaO
 CH 4
1) Methane 2) Ethanoic acid 3) Propane 4) None of these
72. Assertion (A) : Gauche conformer of ethylene glycol is most stable.
Reason (R) : It is due to the formation of intramolecular hydrogen bonding.
of the Assertion
of the Assertion
73. What is the empirical formula of vanadium oxide, if 2.74 g of the metal oxide
contains 1.53 g of metal? (At. wt of V = 50.9 u)
1) V2O3 2) VO 3) V2O5 4) VO2

74. The equation :
3
2Al(s) + O2(g) Al2O3(s) show that
2
3 7
1) 2 mole of Al reacts with mole of O2 to produce mole of Al2O3
2 2
3
2) 2g of Al reacts with g of O2 to produce one mole of Al2O3
2
3
3) 2g mole of Al reacts with litre of O2 to produce 1 mole of Al2O3
2
3
4) 2 mole of Al reacts with mole of O2 to produce 1 mole of Al2O3
2
75. Which of the following can act as both oxidising as well as reducing agent?
1) HNO3 2) H2S 3) K2Cr2O7 4) SO2
76. The oxidation state and covalency of sulphur in S8 molecule are _______
respectively.
1) 0, 2 2) +2, 2 3) -2, 2 4) +6, 2
77. Which of the following reactions is not correctly matched?
1) 2C2 H 5 Br  2 Na 
dry ether
 C4 H 10  2 NaBr ; Wurtz reaction
2) CH 3 Br  AgF 
 CH 3 F  AgBr ; Etard reaction
3) C6 H 5 Br  2 Na  BrC2 H 5 
dry ehter
 C6 H 5C2 H 5  2 NaBr ; Wurtz  Fittig reaction
4) 2C6 H 5 Br  2 Na 
dry ether
 C6 H 5  C6 H 5  2 NaBr ; Fittig reaction
78. Which of the following is most volatile?
1) H2O 2) H2S 3) H2Se 4) H2Te
79. In which of the following pairs, first compound is less covalent than the second
one
1) SnCl4, SnCl2 2) PbCl2, PbCl4 3) SbCl5,SbCl3 4) UF6,UF4
80 For a reaction, the graph drawn between t 1 and [A0] gives a straight line with +ve
2
slope and pass through the origin. Then the order of the reaction is
1) 1 2) 2 3) 0 4) -1
81. Which of the following are the example of double salt?
A) FeSO4.(NH4)SO4.6H2O B) CuSO4.4NH3
C) K2SO4.Al2(SO4)3.24H2O D) K4[Fe(CN)6]
1) A, B and D only 2) A and B only 3) B and D only 4) A and C only
82. Which of the following drug is used in the treatment of typhoid?
1) Chloroform 2) Halothane 3) Chloramphenicol 4) Chloroquine
83. To a given salt solution sodium nitroprusside is added. The solution turns violet.
Then the anion present in the solution is _____
1) SO32  2) S 2 3) NO2 4) I 
84. Which of the following is not a state function?
1) Internal energy 2) Enthalpy 3) Entropy 4) Work done
85. Against constant external pressure of 4 atm, a two mole of gas expanded from 10
dm3 to 15 dm3 volume. Then the work done during the process is _______ kJ.
1) -2.026 2) -4.052 3) -1.013 4) +2.026
SECTION – B
86. Which of the following is coloured?
1) La3 2) Ti 4 3) Ce3 4) Cd 2
87. Electronic configuration of a transition element X in +3 oxidation state is [Ar]3d5.
What is its atomic number?
1) 25 2) 26 3) 27 4) 24
88. Complete the following reaction

89. Give below are two statements :
Statement –I : The boiling points of aldehydes and ketones are higher than
hydrocarbons of comparable molecular masses because of weak molecular
association in aldehydes and ketones due to dipole-dipole interactions.
Statement –II : The boiling points of aldehydes and ketones are lower than the
alcohols of similar molecular masses due to the absence of H-bonding.
In the light of the above statements, choose the most appropriate answer from
the given below.
1) Statements-I is correct, but Statement-II is incorrect
2) Statements-I is incorrect, but Statement-II is correct
3) Both Statement-I and Statement-II are correct
4) Both Statement-I and Statement-II are incorrect
90. Assertion (A) :  Fe  H 2O 5 NO  SO4 is paramagneteic
Reason (R) : Fe in  Fe  H 2O 5 NO  SO4 has three unpaired electrons.
91. When a catalyst is used in a reaction, activation energy decreases from
54.606 kcal to 50 kcal. The final rate of reaction is _____ times that of initial rate
of the reaction. (Temperature is 500 K)
1) 2 2) 100 3) 50 4) 200
92. Complex A has a composition of H12O6Cl3Cr. If the complex on treatment with
conc. H2SO4 loses 13.5% of its original mass, the correct molecular formula of A
is [Given : atomic mass of Cr= 52 amu and Cl=35 amu]
1) Cr  H 2O 6  Cl3 2) Cr  H 2O 3 Cl3  .3H 2O
3) Cr  H 2O 5 Cl  Cl2 .H 2O 4) Cr  H 2O 4 Cl2  Cl.2 H 2O
93. Assertion : NaCl + HCl does not experience common-ion effect.
Reason : Both NaCl and HCl are strong electrolytes.
of the Assertion
of the Assertion
94. Assertion : Ni 2 is not precipitated as sulphide when in its alkaline solution
when H2S is passed.
Reason : The concentration of S2- ion in alkaline medium is insufficient for
precipitation.
of the Assertion
of the Assertion
4) Assertion is false and Reason is false
95. For a reversible reaction, the rate constant of forward reaction is 4.2 103 min 1
and the rate constant of backward is 8.4 104 mol1.lit.min 1 , then the equilibrium
constant is _________
1) 5mol 1.lit 2) 5mol.lit 1 3) 0.2mol.lit 1 4) 0.2mol1lit
96. , C (major product) is
1) 2) 3) 4) None of these

97. The most reactive amine towards dilute hydrochloric acid is _________
1) CH3 – NH2 2) 3) 4)
98. Ag AgCl Cl   C2  Cl   C1  AgCl Ag for this cell G is negative if :

1) C1 = C2 2) C1 > C2 3) C2 > C1 4) Both (1) and (3)
99. When 8g of a solute is dissolved in 750g water at 100o C , the vapour pressure of
water in the resulting solution is found to be 729.6 mm Hg. Then the boiling
point of same solution is ______
[Kb for water  0.52 K.mol1.kg and B.P. of water is 373.15K]
1) 374.3K 2) 373.85 3) 374.15 4) 374.45
100. What is the minimum number of carbon atoms to be presented in a carbohydrate?
1) 2 2) 4 3) 3 4) 6
BOTANY
SECTION – A
101. What is the ploidy of Rhizoidal cell of marchantia and capsule of funaria
respectively?
1) n, n 2) 2n, 2n 3) n, 2n 4) 2n, n
102. Members of which of the following protozoan groups posses silica shells
1) Diatoms 2) Amoeboid 3) Ciliates 4) Sporozoans
(A) Chief producer in oceans (I) Desmids
(B) Red tide (II) Diatoms
(C) Golden algae (III) Euglena
.
(D) Pellicle (IV) Gonyaulax
(A) (B) (C) (D) (A) (B) (C) (D)
.
1) III II I IV 2) II IV I III
3) IV I III II 4) II I IV III
104. BOD refers to the amount of the A that would be consumed if all the B in
one C of water were oxidised by D .
1) A – bacteria, B – CO2, C-ml, D-Oxygen
2) A- microbes, B- organic matter, C- liter, D – bacteria
3) A – oxygen, B – organic matrer, C- liter, D- bacteria
4) A-oxygen, B – inorganic matter, C – ml, D – bacteria
105. BOD is _____ in polluted water and _____ in potable water.
1) More, less 2) Less, more 3) Less in both 4) Medium in both
106. Match the column – I with column – II :
(A) Activated sludge (I) Sediment in primary treatment
(B) Aeration tanks (II) Serve as the inoculum
(C) Primary sludge (III) Function of sludge digester
.
(D) Anaerobic digestion (IV) Site of flocs growth
.
(A) (B) (C) (D) (A) (B) (C) (D)

3) II I IV III 4) I II III IV
107. In family papilionaceae, 5 petals form a unique association. In which 3 different
elements participate, these are vexillum, wing petals & keel petals. What is the
number of these elements?
1) 1, 2, 2 respectively 2) 2, 1, 2 respectively
3) 1, 1, 3 respectively 4) 2, 2, 1 respectively
108. Choose the Mismatched pair.
1) Green algae – Pyrenoids 2) Brown algae – Mannitol, laminarin
3) Red algae – Fucoxanthin 4) Red algae – Floridean starch

I) The sex organs in bryophytes are multicellular.
II) The male sex organ is called antheridium.
III) Antheridium produce biflagellate antherozoids.
IV) The antherozoids are released into air where they come in contact with
archegonium
3) I, II and III are correct 4) I, II, III and IV are correct
110. Study the given figure carefully and select the incorrect statements regarding
this:
i) It represents a typical agarose gel electrophoresis in which lane 1 contains

undigested DNA.
ii) Smallest DNA bands are formed at A and largest DNA bands are formed at B.
iii) The separated DNA fragments can be visualised after staining under the
visible light.
iv) The separated DNA bands are cut from the agarose gel and extracted from the
gel piece. This step is known as elution.
1) (i) and (ii) 2) (ii) and (iii) 3) (iii) and (iv) 4) (i) and (iv)
111. In pBR322, tetracycline resistance gene (TetR) has recognition site for which of
the following restriction endonuclease?
1) Hind III 2) Bam HI 3) EcoRI 4) Pst I
112. Assertion (A): Mendel published his work on inheritance in 1863.
Reason (R): For several reasons it remained unrecognized till 1902.
113. Statement-I: Both vector and alien DNAs are treated separately with different
type of restrictionendonuclease during r–DNA construction.
Statement-II: Ligation is done by the DNA ligase during r – DNA construction.
114. Match Column-I with Column-II and find correct option:
Column-I Column-II
p) Chilled ethanol i) Selectable marker
q) Ampicillin ii) Restriction enzyme
r) amp R iii) To precipitate DNA
s) Hind III iv) Antibiotic
1) p-i, q-ii, r-iii, s-iv 2) p-iv, q-iii, r-ii, s-i
3) p-iii, q-iv, r-i, s-ii 4) p-iii, q-iv, r-ii, s-i
115. Read the following statements and identify them as true (T) or false (F) :
A. Leaf base may bear two lateral small leaf-like structures called bracts.
B. In monocots, the leaf base expands into sheath, covering the stem partially or
wholly.
C. Veins provide rigidity to the leaf blade.
D. The petiole of the leaf helps hold the blade to light.
A B C D A B C D
1) F F T T 2) F T T T
3) T F T T 4) T F T F
116. The fruit of apple is said to be a false fruit because
1) Its pericarp is inconspicuous
2) Its endocarp is fleshy
3) Its actual edible part of fruit is developed from thalamus
4) It develops from an inferior ovary

117. Statement–I : Epipetalous condition is observed in members of solanaceae and
disc florets of Asteraceae.
Statement–II : Fusion of filaments of stamens with ovary wall of carpel is termed
as epipetalous.
Column-I Column-II
a) Epipetalous stamens (i) Pea
b) Apocarpous ovary (ii) Plum
c) Keel petal (iii) Brinjal
d) Half inferior ovary (iv) Rose
1) a-(ii), b-(iv), c-(i), d-(iii) 2) a-(iv), b-(ii), c-(i), d-(iii)
3) a-(iii), b-(iv), c-(i), d-(ii) 4) a-(iv), b-(iii), c-(ii), d-(i)
119. In prokaryotes which of the following r-RNA acts as peptidyl
transferase?
1) 18 s rRNA 2) 16 s rRNA 3) 23 s rRNA 4) 5 s rRNA
120. Refer the given figure of nucleosome and select the option that
correctly identified the parts A, B and C:
A B C
1) DNA Histone octamer H1 histone
2) Histone octamer H1 histone DNA
3) Histone octamer DNA H1 histone
4) DNA H1 histone Histone octamer
121. Histone proteins are :
1) Basic and negatively charged 2) Basic and positively charged
3) Acidic and positively charged 4) Acidic and negatively charged
122. A m-RNA also has some additional sequences that are not
translated called UTR. The function of UTR is:-
1) Charging of t-RNA 2) Formation of phosphodiester bond
3) Helps in efficient translation 4) Both 1 and 2
123. Lactose in lac operon is
1) Repressor 2) Promotor 3) Inducer 4) Both 1 and 2
124. The molecule represented is ?
1) Uridine and it is a pyrimidine 2) Uridylic acid and it is a nucleoside

3) Uridine and it is a nucleoside 4) Uridylic acid and it is a nucleotide
125. How many of the following statements are correct with w.r.t. Epidermal tissue
system?
I) Epidermal tissue system forms the outer most covering of the whole plant body.
II) It comprises epidermal cells stomata, vascular bundles and the epidermal
appendages.
III) It is made up elongated, compactly arranged cells, which from a
discontinuous layer.
1) I only correct 2) II only correct 3) III only correct 4) I,II & III are correct

126. Assertion : The endodermis layer of dicot stem is also referred as starch sheath.
Reason : In dicot stem the cells of the endodermis are rich in starch grains.
127. Water containing cavities in vascular bundles are found in :-
1) Cycas 2) Pinus 3) Sunflower 4) Maize
128. Match the following columns and identify the correct match.
(A) Monohybrid cross (P) T and t
(B) Test cross (Q) TT
(C) Alleles (R) TT × tt
.
(D) Homozygous tall (S) Tt × tt
.
(A) (B) (C) (D) (A) (B) (C) (D)

1) R P T Q 2) R S P Q
3) R T S Q 4) T R Q S
129. Coloured seed coat (S) is dominant over white seed coat(s) when a white seed
coat(ss) plant is crossed with coloured seed coat(Ss) plant, the seed coat colour of
newly developed plant will be
1) All plants are white 2) All plants are coloured
3) Coloured and white in the ratio of 1 : 1 4) Coloured and white in the ratio 3 : 1
130. Each of the progeny have 25% chance of their blood group being O/A/B/AB
when their parents are
1) A × AB 2) O × AB 3) A × B 4) AB × AB
131. Select the correct option w.r.t. law of independent assortment.
1) It can explained by using monohybrid cross
2) Inheritance of one charater is dependent on another character
3) This is applicable universally.
4) Seggregation of one pair of characters is independent of the other pairs of
characters.
132. Microtubules are the constituents of
1) Centrioles, Spindle fibres and Chromatin
2) Centrosome, Nucleosome and Centrioles
3) Cilia, Flagella and Peroxisomes 4) Spindle fibres, Centrioles and Cilia.
133. The correct centripetal sequence of different parts of cilium or flagellum
A. Central sheath B. Central microtubule C. Radial spoke
D. Plasma membrance. E. Peripheral microtubules.
1) D, E,C,B,A 2) D,E,A,C,B 3) D,B,C,A,E 4) D,E,C,A,B
134. Match the column I with column II and identify the correct combination
Column-I Column-II
(a) Golgi apparatus (i) Revealed structural details of cell
(b) Lysosomes (ii) Trap waste and excretory products
(c) Vacuoles (iii) Formation of glycoproteins and glycolipids
(d) Electron microscope (iv) Digesting biomolecules
Choose the right match from options given below:
1) (a)-(iii), (b)-(iv), (c)-(ii), (d)-(i) 2) (a)-(iv), (b)-(iii), (c)-(i), (d)-(ii)
3) (a)-(ii), (b)-(iii), (c)-(iv), (d)-(i) 4) (a)-(i), (b)-(ii), (c)-(iv), (d)-(iii).
135. What is the fate of the male gametes discharged in the synergid?
1) One fuses with egg other(s) degenerate(s) in the synergid.
2) All fuse with the egg.
3) One fuses with the egg, other fuse with synergid nucleus.
4) One fuses with the egg and other fuses with central cell nuclei.
SECTION – B
136. In water hyacinth and water lily, pollination takes place by:
1) Water currents only 2) Wind and water
3) Insects and water 4) Insects or wind
137. A dioecious flowering plant prevents both:
1) Autogamy and xenogamy 2) Autogamy and geitonogamy
3) Geitonogamy and xenogamy 4) Cleistogamy and xenogamy

138. Choose the correct sequence representing the ploidy of Nucellus; Megaspore
mother cell; Megaspore; Egg cell; Zygote; a polar nucleus of embryo sac;
Secondary nucleus and Primary endosperm nucleus.
1) n; 2n; 2n; n; 2n; n; 2n; and 2n 2) 2n; 2n; n; 2n; n; 2n; 3n; and 2n
3) 2n; 2n; n; n; 2n; n; 2n; and 3n 4) 2n; n; n; 2n; 3n; n; and 3n
139. Which of the two groups of following formula involved in peptide bond between
different amino acids?
H2
1
H 2 N  C  COOH 3
R4
1) 2 and 3 2) 1 and 3 3) 1 and 4 4) 2 and 4
140. Statement –I : All homopolysaccharides made by same type of monomers and
involved in common function of plants and animals.
Statement –II : Polysaccharide of potato, paper, exoskeleton of cockroach is
made by same monomer.
141. Statement – I: The PGRs can be broadly classified into two major groups based
on their function in a plant body.
Statement – II : All kinds of PGRs are also called plant growth promoters,
142. Given diagram represents which type of growth
1) Arithmetic 2) Geometric 3) Parabolic 4) Hyperbolic

143. In order of increase the yield of sugarcane crop, which of the following plant
growth regulators should be sprayed
1) Ethylene 2) Auxins 3) Gibberellins 4) Cytokinins
144. Select the correct statement about Diakinesis.
1) Meiotic spindle is assembled
2) Formation of synaptonemal complex
3) Lasts for months in some vertebrates
4) Appearance of recombination nodules
145. Crossing over takes place between which chromatids and in which stage of the
cell cycle?
1) Non-sister chromatids of non-homologous chromosomes at zygotene stage of
prophase-I
2) Non-sister chromatids of homologous chromosomes at pachytene stage of
prophase-I
3) Non-sister chromatids of homologous chromosomes at zygotene stage of
prophase-I
4) Non-sister chromatids of non-homologous chromosomes at pachytene stage of
prophase-I
146. Dominant stage in the life cycle of sphagnum is
1) Sporophyte 2) Spore 3) Gamete 4) Gametophyte
147. Number of S.L.P. ATP’s are formed in E.M.P. pathway.
1) Two 2) One 3) Three 4) Four

148. Match the experiment objective with the scientist who performed it.
Column-I Column-II
(i) Priestley (I) Production of glucose in photosynthesis
(ii) Julius von sachs (II) Role of sunlight in photosynthesis
(iii) Jan ingenhousez (III) Role of air in photosynthesis
Codes :
i ii iii i ii iii
1) I III II 2) II I III
3) II III I 4) III I II
149. The membranous system or grana is responsible for
1) trapping light energy, but not for ATP and NADPH2 formation
2) trapping light energy and also for fixation of CO2
3) ATP and NADPH2 formation, but not for light trapping
4) light capturing and also for NADPH2 and ATP formation
150. Plants do not have any respiratory organ because:
1) each plant part takes care of its own gas exchange needs.
2) plant do not present great demand for gas exchange
3) most cells of plant have at least a part of their surface in contact with air
4) All the above
ZOOLOGY
SECTION – A
151. Which is not an alien species?
1) African catfish 2) Cichlid fish 3) Nile perch 4) Parthenium
152. The side - effects of the use of anabolic steroids in males are ________ and _______
1) Breast enlargement & fever
2) Stomach pain & decreased sperm production
3) Premature baldness & enlargement of prostrate gland
4) Acne, anaemia
153. Failure of cytokinesis after telophase stage of cell division results in an increase
in a whole set of chromosomes in an organism, this phenomenon is known as
1) Polyploidy 2) Somatic variation 3) Arhenotoky 4) Aneuploidy
154. From which of the following techniques early detection is not possible.
1) Serum analysis 2) PCR
3) Recombinant DNA technology 4) All of these
155. What are the reasons that the tropics have greater biological diversity?
1) Long evolutionary time period 2) Undisturbed environment
3) Availability of more solar energy 4) All of these
156. Study the given diagram and identify A, B, C and D.
1) A- Epiglottis, B -Alveoli, C- Bronchus, D – Diaphragm

2) A- Epiglottis, B -Alveoli, C - Bronchioles, D - Diaphragm
3) A- Sound box, B -Alveoli, C - Bronchus, D - Diaphragm
4) A-Sound box, B-Alveoli, C- Bronchioles, D – Diaphragm
157. How many of the following are narrowly utilitarian arguments for conserving
biodiversity?
Food, oxygen, pollination, drugs, fibre
1) Three 2) Four 3) Two 4) One
158. In frog, a triangular structure called _________ joins the right ________.
1) Conus arteriosus; ventricle 2) Conus arteriosus; atrium
3) Sinus venosus; atrium 4) Sinus venosus; ventricle

159. Which of the following is false regarding the respiratory system of cockroach?
1) Opening of spiracles is regulated by sphincters
2) Exchange of gases takes place at the tracheoles by diffusion
3) Oxygen carried through respiratory pigment
4) Spiracles present on the lateral side of the body.
160. How many sperms have vigorous motility, if the human male ejaculates about
100 million sperms during coitus?
1) 40 million 2) 60 million 3) 100 million 4) 24 million
161. Which of the following is right answer that arragned cranial meninges from inner
to outer?
1) ArachnoidDura materPia mater 2) Dura materPia materArachnoid
3) Pia materArachnoidDura mater 4) Pia materDura materArachnoid
162. Limbic system formed by
1) Inner parts of hypothalamus and thalamus and a group of associated deep
structure like amygdala and hippocampus
2) Inner part of pons and cerebellum and a group of associated deep structures
like amygdala and hippocampus
3) A group of associated deep structures like Amygdala and hippocampus and
inner part of cerebral hemisphere
4) A group of associated deep structures like amygdala and hippocampus and
inner part of cerebellum
163. Which of the following is not having the protonephridia as an excretory organ?
1) Rotifers 2) Amphioxus 3) Apis 4) Planaria
164. Find out incorrect statement about cortical & juxta medullary nephrons.
1) Malpighian corpuscle, PCT & DCT are situated in renal cortex
2) Loop of Henle is very short in juxta medullary nephrons
3) Juxta medullary nephrons are minor in number
4) Vasa recta is absent or highly reduced in cortical nephrons,
165. On an average, _________ of blood is filtered by the human kidneys?
1) 1100–1200ml/min 2) 125 ml /min
3) 550–600ml/min 4) 250ml/min
a) Proteins contribute 6 – 8% of the blood plasma
b) Plasma contains small amount of minerals
c) Plasma without the clotting factors is called serum.
Of the above statements, the correct statement(s) is/are
1) Only (a) and (c) 2) Only (b) 3) Only (c) 4) All of these
167. Which of the following cells donot exhibit phagocytosis activity?
1) Monocyte 2) Neutrophil 3) Basophil 4) Macrophage
168. DUB sound is produced during closure of
1) Semilunar valves 2) Bicuspid valve
3) Tricuspid valve 4) Both (2) and (3)
169. Read the following statements and choose the correct.
A) Wing of a moth is analogous to the wing of birds.
B) Genetic drift operates on small isolated population.
C) Most scientists believed that the formation of biomolecules preceded the
appearance of the first cellular forms of life.
D) According to de Vries, the mechanism of evolution is saltation
1) A, B, C, D 2) A, B, C only 3) A, C, D only 4) B, C, D only
170. Full form of NGO
1) National governmental organization
2) National AIDS governmental organization
3) Non - governmental organization
4) Natural governmental organization
171. The symptoms like constipation, abdominal pain, cramps and stool with blood
clots are related to which of the following disease.
1) Filariasis 2) Typhoid 3) Ascariases 4) Amoebiasis
172. The plants with hallucinogenic properties are
1) Atropa belladonna 2) Erythroxylum coca
3) Datura 4) All the above

173. Which of the following event is the last one to be observed in a normal
pregnancy?
1) Eyelids separate and eyelashes are formed
2) Listening to the heart sound of foetus through stethoscope
3) Secretion of oxytocin from mammary glands
4) Vigorous contraction of uterus
174. Which of the following is incorrect regarding the circulatory system of cockroach?
1) Blood vessels are poorly developed
2) Haemocoel is filled with haemolymph
3) The haemolymph is composed of coloured plasma and haemoglobin
4) Blood from sinuses enter heart through ostia
175. How genetic and physical maps were generated in HGP?
1) By using information on polymorphism of restriction endonuclease recognition
sites
2) By using automated DNA sequences
3) By using DNAase 4) By using RNAase
176. Given the following diagrams a and b related to which animals posses
respectively?
1) Sycon, Taenia 2) Ctenoplana, Canis

3) Gorgonia, Meandrina 4) Dentalium, Obelia
177. Scapula is a large triangular flat bone situated in the thorax between
1) Fifth thoracic and third lumbar vertebra
2) Second and the eighth thoracic vertebra
3) Second and the seventh ribs
4) Last thoracic and the third lumbar vertebrae
178. Which of the following is bilaterally symmetrical during larval stage and radially
symmetrical during adult stage?
1) Sepia 2) Asterias 3) Aureia 4) Octopus
179. Find out the wrongly matched pair of hormones with their functions.
1) FSH – regulates spermatogenesis 2) LH – induces ovulation
3) PTH – decreases blood Ca level 2+ 4) Melatonin-influences menstrual cycle
180. Statement – I: Triiodothyronine (T3) is also called as Thyroxine.
Statement – II: Thymosins play major role in both humoral immunity and cell
mediated immunity.
181. The final step in DNA fingerprinting process is:
1) DNA isolation 2) Southern blotting technique
3) Restriction digestion 4) Autoradiographic detection
182. Choose the correct pair.
1) Autosomal recessive–Colour blindness 2) X-linked recessive–Cystic fibrosis
3) Autosomal dominant–Myotonic dystrophy 4) X-linked dominant–haemophilia
183. In which of the following insects, the sex determination is based on the number of
sets of chromosomes an individual receives.
1) Honey bee 2) Cockroach 3) Drosophila 4) Moth
184. Study the following.
I. It is due to point mutation
II. It is due to defective haemoglobin molecule
III.It is due to substitution of GAG to GUG at sixth codon of beta gene.
The above condition matches,
1) Thalassemia 2) Sickle cell anaemia
3) Colour blindness 4) Haemophilia

185. Study the following match column-II with column-I and pick correct option :
(I) Lamarck P) Natural selection
(II) Oparin Q) Chemical evolution
(III) Alfred Wegener R) Use and disuse of organs
(IV) Charles Darwin S) Continental drift theory
(P) (Q) (R) (S) (P) (Q) (R) (S)
1) IV I II III 2) I II IV III
SECTION – B
186. If you draw a pyramid of energy for any ecosystem, saprophytes are placed in
which trophic level.
1) Top 2) Second 3) Bottom 4) Not given any place
187. I. It is a double layered and covers the lungs.
II. Fluid between these layers reduces friction on the lung-surface.
III. Outer layer is in contact with thoracic wall.
IV. Inner layer is in contact with the lung surface.
The above features refer to –
1) Pleura 2) Peritoneum 3) Pericardium 4) Meninges
188. The property of "Humus" responsible for being a reservoir of nutrients is
1) Being colloidal in nature 2) Being Amorphous
3) Being resistant to microbial action 4) All the above
189. What are the various ways through which the reproductive health can be
improved?
I. Better detection and cure of STDs.
II. Awareness about sex related matters.
III. Encouraging myths.
IV. Increased number of medically assisted deliveries.
1) I and II 2) II and III 3) III and IV 4) I, II and IV
190. Chikungunya is caused by a/an
1) RNA virus that belongs to the Alpha virus
2) DNA virus that belongs to the Flavi virus
3) DNA virus that belongs to the Alpha virus
4) None of these
191. Which type selection explains industrial melanism observed in pepper moth,
Biston betularia?
1) Artificial selection 2) Directional selection
3) Stabalising selection 4) Disruptive selection
192. The species diversity of plants A is much less than that of animals B . The
A, B respectively are
1) 22%, 72% 2) 70%, 90% 3) 50%, 20% 4) 15%, 10%
193. Sun is the only source of energy for all ecosystems on Earth except _______
1) Forest ecosystem 2) Pond ecosystem
3) Desert ecosystem 4) Deep sea hydro-thermal ecosystem
194. _______ is a chronic disorder in which alveolar walls are damaged due to cigarette
smoking.
1) Asthma 2) Fibrosis 3) Emphysema 4) Bronchitis
195. Assertion A: Ribs have two articulation surfaces on its dorsal end and is hence
called bicephalic.
Reason R: The vertebrochondral ribs articulate directly with the sternum.
4) Both A and R are true but R is NOT the correct explanation of A
196. Read the following statements and select the correct option:
A. In hemichordate animals development is indirect.
B. Cyclostomes migrate to fresh water for spawning.
1) B is correct but A is false 2) A is correct but B is false
3) Both A and B are true 4) Both A and B are false

197. All living organisms are linked to one another because:
1) They have common biological organisation at every level.
2) They share common genetic material, but to varying degrees.
3) All have common nutrition mode.
4) All of the above
198. Scientists have succeeded in culturing of banana, sugarcane, potato, etc by _____
1) Somatic hybridisation 2) Meristem culture
3) r-DNA technology 4) Anther culture
199. Which one of the following is most appropriately defined?
1) Commensal is an organism which causes harm to host
2) Amensalism is a relationship in which one species is benefited where as the
other is unaffected
3) Predator is an organism that catches and kills other organism for food
4) Parasite is an organism which always lives inside the body of other organism
200. Statement – I : Intensive breeding programme has created breeds that differ
from other breeds (e.g. dogs) but still are of the same group.
Statement – II : Herbicide resistant weeds evolved due to anthropogenic action.
*******

: ANSWER KEY:
STD: XII, LT & CC GT - 10 DATE : 01-05-2024
SET-1 SUB: PHYSICS
1 4 11 2 21 4 31 3 41 2
2 4 12 2 22 2 32 2 42 1
3 4 13 1 23 1 33 2 43 1
4 3 14 1 24 4 34 3 44 2
5 2 15 2 25 3 35 2 45 3
6 3 16 1 26 2 36 1 46 1
7 1 17 3 27 2 37 2 47 4
8 3 18 1 28 2 38 4 48 3
9 3 19 2 29 3 39 1 49 3
10 1 20 3 30 1 40 1 50 1
SUB:CHEMISTRY
51 4 61 3 71 2 81 4 91 2
52 2 62 3 72 1 82 3 92 4
53 3 63 3 73 3 83 2 93 1
54 3 64 3 74 4 84 4 94 4
55 2 65 4 75 4 85 1 95 2
56 2 66 3 76 1 86 3 96 3
57 1 67 1 77 2 87 2 97 2
58 2 68 4 78 2 88 3 98 3
59 3 69 2 79 2 89 3 99 1
60 4 70 1 80 3 90 1 100 3
SUB : BOTANY
101 3 111 2 121 2 131 4 141 1
102 2 112 4 122 3 132 4 142 1
103 2 113 2 123 3 133 4 143 3
104 3 114 3 124 3 134 1 144 1
105 1 115 2 125 1 135 4 145 2
106 2 116 3 126 1 136 4 146 4
107 1 117 3 127 4 137 2 147 4
108 3 118 3 128 2 138 3 148 4
109 3 119 3 129 3 139 2 149 4
110 2 120 3 130 3 140 1 150 4
SUB : ZOOLOGY
151 2 161 3 171 4 181 4 191 2
152 3 162 3 172 4 182 3 192 1
153 1 163 3 173 4 183 1 193 4
154 1 164 2 174 3 184 2 194 3
155 4 165 1 175 1 185 3 195 2
156 1 166 4 176 2 186 4 196 3
157 1 167 3 177 3 187 1 197 2
158 3 168 1 178 2 188 1 198 2
159 3 169 1 179 3 189 4 199 3
160 4 170 3 180 4 190 1 200 1

answer sheet.
CORRECT.
Section-B;
Marking Scheme :

PHYSICS
SECTION – A
1. In Vernier calipers, if M.S.D represents one main scale division and V.S.D
represents one vernier scale division then which of the following condition
represents its principle
1) V.S.D = M.S.D 2) n V.S.D = (n-1) M.S.D
2) (n-1) V.S.D = (n+1) M.S.D 4) (n+1) V.S.D = (n-1) M.S.D
2. When a body of mass ‘m’ is sliding down on a rough inclinded plane of inclination
 then the frictional force present between the body and the inclined plane is
(  - coefficient of friction)
1)  mg sin  2)  mg cos  3)  mg tan  4)  mg  sin   cos 
3. Electric field intensity at a point at a distance ‘r’ from a point charge ‘Q’ is
proportional to
1 1
1) r 4 2) 4 3) r 2 4) 2
r r
4. In an ac circuit containing inductor of a reactance X L and capacitor of reactance
X C and a resistor of resistance R, the relation between X L and X C under
resonance condition is
1 1
1) X L  X C 2) X L  3) X L  X C 4) X L 
XC XC
5. Which of the following materials are strongly attracted by magnets
1) Dia magnetic 2) Para magnetic
3) Ferro magnetic 4) All of these
6. When an electron is revolving in a stationary orbit around the nucleus then its
kinetic energy ‘K’ depends on its principal quantum number ‘n’ as
1 1
1) K  2) K  n 3) K  n 2 4) K  2
n n
7. When a body is immersed in a liquid then buoyancy force acting on the body
depends on
1) Density of body 2) Shape of the body
3) Density of liquid 4) Size of the body
8. A solid sphere of mass ‘M’ and radius ‘R’ is rotating about its own axis with
angular velocity  . Its angular momentum about the same axis is
2 2 7 5
1) MR 2 2) MR 2 3) MR 2 4) MR 2
5 3 5 3
9. The magnitude and nature of force acting per unit length between two long
straight parallel conductors carrying a current of 1 A each in the same direction
and separated by a distance of 1 m is
1) 2  107 N / m, attraction 2) 2  107 N / m, repulsion
3) 2  107 N / m, attraction 4) 4  107 N / m, repulsion
10. The weight of a man in a lift, moving upwards is 608N while the weight of the
same man in the lift moving downwards, with the same acceleration, is 368N. His
normal weight in newton is
1)488 2) 588 3) 480 4) 240
11. The phase difference between velocity and acceleration of simple harmonic
oscillator.
  
1)  2) 3) 4)
2 4 3
12. A clock with a metal pendulum beating seconds keeps correct time at 0oC. If it
loses 12.5 s a day at 25oC, the coefficient of linear expansion of metal pendulum
is
1 1 1 1
1) / oC 2) / oC 3) / oC 4) / oC
86400 43200 14400 28800
13. Water falls from a height of 210m. Assuming whole of energy due to fall is
 J 
converted into heat the rise in temperature of water would be [S =  S  4200
 kg 0 c 
1) 420C 2) 490C 3) 0.490C 4) 4.90C

14. At a given temperature the r.m.s. velocity will be greater for
1) Hydrogen 2) Oxygen
3) Equal for both hydrogen and oxygen 4) Nothing is definite
15. A vessel, whose bottom has round hole with radius of 0.1 mm, is filled with
water. The maximum height to which the water can be filled without leakage is
(S.T. of water = 75 dyne/cm, g = 1000 cm/s2)
1) 100 cm 2) 15 cm 3) 60 cm 4) 30 cm
16. A straight thin uniform rod of length 4L and mass 4M is bent into a square. Its
M.I about one side is
5 2 7 2 ML2 ML2
1) ML 2) ML 3) 4)
3 6 48 3
17. Magnifying power of a simple microscope is (when final image is formed at
D = 25cm from eye, f-focal length of lens)
D D f D
1) 2)1  3) 1  4) 1 
f f D f
18. In a compound microscope, if the objective produces an image I0 and the eye
piece produces an image Ie, then
1) I0 is virtual but Ie is real 2) I0 is real but Ie is virtual
3) Only I0is virtual 4) I0 and Ie are both virtual
19. If the capacity of each condenser is 10F, the equivalent capacity between x and y
is
25 15
1) 10F 2) F 3) 30 F 4) F
4 4
List-I List-II
a) Charging cell e) V=O
b) Discharging cell f) V=E
c) Cell short circuited g) V<E
d) Cell in open circuit (h) V>E
1) a-g, b-h, c-e, d-f 2) a-g, b-e, c-h, d-f
3) a-f, b-g, c-h, d-e 4) a-h, b-g, c-e, d-f
21. A semi circularcurent loop is placed in an uniform magnetic field of 1 tesla as
shown. If the radius of loop is 1m, the magnetic force on the loop is
1) 4N 2) 8N 3) 8/N 4) Zero
22. Assertion:. Photoelectric effect demonstrates the particle nature of light.
Reason: The number of photoelectrons emitted is proportional to the frequency of
incident light.
3) If (A) is true but (R) is false. 4)If (A) is false but (R) is true.
23. An electron positron pair is produced by a gamma ray of 2.1 MeV. How much
K.E. is imparted to each of the chaged particles?
1) 1 MeV 2) 0.54 MeV 3) 1.08 MeV 4) 0.135 Mev
24. Zener diode is used as
1) Amplifier 2) Rectifier 3) Stabilizer 4) Oscillator

25. If a car covers half of the total distance with v1 speed and other half of the
distance with v2speed then average speed is
1 v v 2v v 5v1v2
1) v1v2 2) 1 2 3) 1 2 4)
2 2 v1  v2 3v1  2v2
26. The pulley is smooth and massless. The system is released from rest. The
acceleration of each block is
5g g 4g 2g
1) 2) 3) 4)
2 3 3 3
27. If T1, T2 and T3 are the time periods of a given simple pendulum on the surface of
the earth, at a depth ‘h’ in a mine and at an altitude ‘h’ above the earth’s surface
respectively, then
1) T1 = T2 = T3 2) T2 < T1> T3 3) T2 > T1< T3 4) T1> T2> T3
28. A block of mass 100gm slides on a rough horizontal surface. If the speed of the
block decreases from 10 m/s to 5 m/s, the thermal energy developed in the
process is
1) 3.75 J 2) 37.5 J 3) 0.375 J 40 0.75 J
A
29. M , M n and M p denote the masses of an nucleus Z X , a neutron and a proton
respectively. If the nucleus is separated into its individual protons and neutrons
then
1) M   A  Z  M n  ZM P 2) M  ZM n   A  Z  M p
3) M   A  Z  M n  ZM p 4) M   A  Z  M n  ZM p
30. The K.E. of a satellite is 104J. Its P.E. is
1) -104J 2) 2×104J 3) -2×104J 4) -4×104J
31. A wire of length ‘l’ having tension ‘T’ and radius ‘r’ vibrates with fundamental
frequency ‘f’. Another wire of the same metal with length ‘2l’ having tension 2T
and radius 2r will vibrate with fundamental frequency:
f f
1) f 2) 2f 3) 4) 2
2 2 2
32. Two waves having the intensities in the ratio of 9 : 1 produce interference. The
ratio of maximum to the minimum intensity, is equal to
1) 2 : 1 2) 4 : 1 3) 9 : 1 4) 10 : 8
33. In the circuit shown, if a conducting wire isconnected
between points A and B, the current inthis wire will :
1) flow from A to B
2) flow in the direction which will be decided by thevalue
of V
3) be zero
4) flow from B to A
34. Two coils of self inductance L1 and L2 are placed closer to each other so that total
flux in one coil is completely linked with other. If M is mutual inductance
between them, then
1) M  L1 L2 2) M  L1 / L2 3) M  L1L2 4) M  ( L1 L2 )2
35. For the plane electromagnetic wave given by
E  E0 sin t  kx  and B  B0 sin t  kx  , the ratio of average electric energy
density to average magnetic energy density is
1) 1 2) 1/2 3) 2 4) 4

SECTION – B
36. In the following diagram if V2>V1 then
1) 1  2
2) 1  2
3) 1  2
4) 1  2
37. In a surface tension experiment with a capillary tube water rises up to 10cm. If
the same experiment is repeated on an artificial satellite which is revolving round
the earth. Water will rise in the capillary tube up to a height of
1) 0.1 m 2) 0.98 m 3) 9.8 m 4) Full length of capillary tube
38. A mass of 0.98 Kg suspended using a spring of constant K  300Nm 1 is hit by a
bullet of 20 gm moving with a velocity 3 m/s vertically. The bullet gets embedded
and oscillates with the mass. The amplitude of oscillation will be
1) 0.15 cm 2) 0.12 cm 3) 0.34 cm 4) 12 cm
39. A solenoid has a core of a material with relative permeability 200. The winding of
the solenoid are insulated from the core and carry a current of 2A. If the number
of turns is 1000 per meter, what is the H?
1) 2  10 4 A / m 2) 2  10 4 A / m 3) 2  103 A / m 4) None of these
40. Particle A moves along X-axis with a uniform velocity of
magnitude 10m/s. Particle B moves with uniform velocity
20 m/s along a direction making an angle of 60 o with the
positive direction of X-axis as shown in figure. The relative
velocity of B with respect to that of A is
1) 10 m/s along X-axis
2)10 3 m/s along Y-axis (perpendicular to X-axis)
3) 10 5 along the bisection of the velocity of A and B
4) 30 m/s along negative x-axis
41. If W represents the work done, then match the two columns:
Column-I Column-II
A) Force is always along the velocity (1) W = 0
B) Force is always perpendicular to (2) W < 0
velocity
C) Force is always opposite to velocity (3) W > 0
1) A-1, B-2, C-3 2) A-3, B-1, C-2 3) A-2, B-3, C-1 4) A-3, B-2, C-1
x
42. A string vibrate according to the equation y  5sin   cos  40 t  where x and y are
 3 
in cm’s and t is in second. What is the distance between the adjacent nodes?
1) 3 cm 2) 9 cm 3) 6 cm 4) 4.5 cm
43. A light of wavelength 6000 Å in air enters a medium of refractive index 1.5.
Frequency and wavelength of light in the medium respectively are
1) 5  1014 Hz , 6000 Å 2) 5  1014 Hz , 4000 Å
10 10
3) 1014 Hz, 4000 Å 4) 1014 Hz, 6000 Å
3 3
44. Barrier potential of a p-n junction diode does not depend on
1) doping density 2) diode design 3) temperature 4) forward bias
45. If u1 and u2 are the units select in two systems of measurement and n1 and n2
their numerical values, then
1) n1u1 = n2u2 2) n1u2 + n2u1=0 3) n1n2 = u1u2 4) (n1+u1)=(n2+u2)
46. Assertion (A) :A metallic shield in form of a hollow shell may be built to block an
electric field.
Reason (R): In a hollow spherical shield the electric field inside it is zero at every
point.

47. Three identical rods A,B and C are placed end-to-end. A temperature difference
is maintained between the free ends of A and C. The thermal conductivity of B is
thrice that of C and half of that of A. The effective thermal conductivity of the
system will be (KA is the thermal conductivity of rod A)
1 2
1) K A 2) 3K A 3) 2 K A 4) K A
3 3
48. The maximum horizontal range of projectile on the earth is R. Then for the same
5R
velocity of projection, its maximum range on another planet is . Then, ratio of
4
acceleration due to gravity on that planet and on the earth is
1) 5 : 4 2) 4 : 5 3) 25 : 16 4) 16 : 25
49. The resistance of an ammeter is 13  and itsscale is graduated for currents upto
100 A. Afteran additional shunt is connected to this ammeterit becomes possible
to measure currents upto750 amperes by this meter. The value of shunt-
resistance is
1) 2 k 2) 20  3) 2  4) 0.2
50. An L-R circuit has a cell of e.m.f. E, which is switched on at time t = 0. The
current in the circuit after a long time will be
E E E
1)Zero 2) 3) 4)
R L L2  R 2
CHEMISTRY
SECTION – A
51. The mass of ascorbic acid (vitamin C, C6H8O6) to be dissolved in 100g of acetic
acid to lower its melting point by 1.95o C is ___g. [Kf of acetic acid is 3.9 K.mol1.kg ]
1) 6.092 2) 9.138 3) 7.311 4) 8.8
52. The correct combination is
List-I (Solution) List-II (Vant Hoff factor (i))
A) 0.1M NaCl (P) 1.97
B) 0.01M NaCl (Q) 2.70
C) 0.001M NaCl (R) 1.87
D) 0.01M K2SO4 (S) 1.94
1) A-P, B-R, C-S, D-Q 2) A-R, B-S, C-P, D-Q
3) A-P, B-S, C-R, D-Q 4) A-R, B-S, C-Q, D-P
53. In Kjeldahl method, function of CuSO4 is
1) B.P. elevator 2) Catalyst
3) Freezing point depressor 4) None of these
54. Which of the following will have total number of d-electrons equal to the
difference in the number of total p and s electrons?
1) He 2) Ne 3) Ar 4) Kr
55. The element Z = 114 has been discovered recently. It will belong to which of the
following family/group and will possess which of following electronic
configurations?
1) Carbon family,  Rn  5 f 14 6 d 10 7 s 2 7 p 2 2) Oxygen family,  Rn  5 f 14 6 d 10 7 s 2 7 p 4
3) Nitrogen family,  Rn  5 f 14 6 d 10 7 s 2 7 p 6 4) Halogen family,  Rn  5 f 14 6 d 10 7 s 2 7 p 5
56. Name of the compound given below is
CH3
H3 C
CH3
CH3
1) 5 – ethyl – 6 – methyl octane 2) 4 –ethyl – 3 – methyl octane
3) 3 – methyl – 4 – ethyl octane 4) 2,3 – dimethyl heptane
57. Which one of the following sets of quantum numbers is not possible for an
electron in the ground state of an atom with atomic number 19?
1) n = 2, l = 0, m = 0 2) n = 2, l = 1, m = 0
3) n = 3, l = 1, m = -1 4) n = 3, l = 2, m =  2

58. Which of the following has same units of Rydberg constant?
1) Frequency 2) Wave length 3) Wave number 4) Intensity
59. Which of the following exhibit cis-trnas isomerism?
1) Ethene 2) Propene 3) But-2-ene 4) But-1-ene
60. Methane cannot be prepared by
1) Wurtz reaction 2) Sabatier-Senderens reaction
3) Kolbe’s electrolysis 4) All of these
61. To the given salt solution NH4OH is added and then H2S gas is passed. Then
which of the following can be precipitated?
1) Cu 2  2) Zn 2 3) Ni 2 4) All the above
C  s   O2  g  
 CO2  g  ; H  94 kcal
Here -94 kcal does not represent
1) Heat of combustion of carbon
2) Heat of formation of CO2
3) Heat of reaction at constant temperature and constant volume
4) Heat of reaction at constant temperature and constant pressure
63. Which of the following cation is formed easily?
1) Na  2) Mg 2 3) Al 3 4) K 
64. Which of the following vitamins cannot be stored in human body?
1) A 2) B12 3) C 4) K
65. Which among the following molecules have sp3d hybridisation with one lone pair
of electrons on the central atom ?
(i) SF4 (ii) [PCl4]+ (iii) XeF4 (iv) XeO2F2
1) (i), (ii) and (iii) only 2) (i) and (iv) only
3) (i) and (iii) only 4) (iii) and (iv) only
66. The correct order of reactivity of the compounds towards electrophilic
substitution reaction is :
1) IV>III>II>I 2) I>IV>II>III 3) III>II>I>IV 4) I>III>II>IV

67. Among the following which is more reactive rowards AgNO3?
1) 2) 3) 4)
68. Which of the following oxide is basic in nature?

1) P2O3 2) N2O5 3) Bi2O3 4) As2O3
69. An element belongs to group 15 and 3 period of the periodic table. It’s
rd
electronic configuration would be

1) 1s22s22p4 2) 1s22s22p3 3) 1s22s22p63s23p2 4) 1s22s22p63s23p3
70. With respect to the conformers of ethane, which of the following statements is
true?
1) Bond angle remains same but bond length changes
2) Bond angle changes but bond length remains same
3) Both bond angle and bond length change
4) Both bond angles and bond length remains same
71. Which of the following can be used as catalyst for Friedel Crafts reaction?
1) AlCl3 2) FeCl3 3) BCl3 4) All of these
72. Which of the following does not give turbidity with Lucas reagent at room
temperature?
1) ter-butyl alcohol 2) n-butyl alcohol
3) sec-butyl alcohol 4) Isopropyl alcohol

73. 300 ml of 3.0 M NaCl is added to 200 ml of 4.0 M BaCl2 solution. The
concentration of Cl¯ ions in the resulting solution is
1) 7 M 2) 1.6 M 3) 1.8 M 4) 5 M
74. What volume of oxygen gas (O2) measured at a STP is needed to burn completely
1 L of propane gas (C3H8) measured under the same conditions?
1) 7 L 2) 6 L 3) 5 L 4) 10 L
75. Consider the following recation.
z
xMnO4  yC2O42  zH   xMn2  2 yCO2  H 2O , the value of x, y and z are :
2
1) 2, 5 and 16 2) 5, 2 and 8 3) 5, 2 and 16 4) 2, 5 and 8
76. Which is the correct increasing order of boiling points of the following
compounds?
1–Iodobutane, 1-Bromobutane, 1–Chlorobutane, Butane
1) Butane < 1–Chlorobutane < 1–Bromobutane < 1-Iodobutane
2) 1–Iodobutane < 1–Bromobutane < 1–Chlorobutane < Butane
3) Butane < 1–Iodobutane < 1–Bromobutane < 1–Chlorobutane
4) Butane < 1–Chlorobutane < 1–Iodobutane < 1–Bromobutane
77. C8 H 8Cl2  A  
Aq . NaOH
  B  
Mild reduction
  C  
I 2 / NaOH
 Iodoform  acid salt  D 
In the given sequence of reaction, what would be the structure of (A)?
1) PhCOCH3 2) PhCH(OH)CH3 3) PhCOONa 4) PhC(Cl2)CH3
78. SO2 and TeO2 act as _____________ agents respectively.
1) Reducing and reducing 2) Reducing and oxidising
3) Oxidising and oxidising 4) Oxidising and reducing
79. The oxidation states shown by halogen are -1, +1, +3, +5 and +7. The oxidation
state(s) shown by all the halogens is
1) -1 and +3 2) -1, +1 and +3 3) Only -1 4) Only +3
80. For the reaction, 2NO+Br2 → 2NOBr, mechanism is
NO+Br2   NOBr2(fast)
NOBr2+NO →2NOBr(slow)
Order of the reaction is ______
1) 1 2) 2 3) 3 4) 4
81. For a gaseous reaction,
A →B; k1 = 1015.e-2000/T
C →D; k2 = 1014.e-1000/T
at _____ temperature, k1 = k2
1) 1000K 2) 2000K 3) 2303K 4) 434.2K
82. Match column I and column II and choose the correct combination from the given
options.
Column-I Column-II
1) Antifreeze used in car engine p) Methanol
2) Solvent used in perfumes q) Phenol
3) Starting material for picric acid r) Ethylene glycol
4) Wood spirit s) Ethanol
1) 1-(s), 2-(q), 3-(r), 4-(p) 2) 1-(s), 2-(q), 3-(p), 4-(r)
3) 1-(p), 2-(r), 3-(q), 4-(s) 4) 1-(r), 2-(s), 3-(q), 4-(p)
83.
84. Which of the following is state function?

1) q 2) q + w 3) w 4) All the above

85. The enthalpies of combustion of carbon, hydrogen and acetylene are -94, -68.3
and -310 kcal/mol respectively. Then the heat of formation of acetylene is _____
kcal/mol.
1) 53.7 2) -53.7 3) -26.4 4) +26.4
SECTION – B
86. Assertion (A) : Transition metals show variable valency.
Reason (R) : Transition metals have a large energy difference between the ns2
and (n-1)d electrons.
87. Assertion (A) : K2CrO4 shows colour due to charge transfer.
Reason (R) : CrO42 ion is tetrahedral in shape.
88. The following steps are given for the mechanism of esterification of carboxylic
acdis.
I. The protonated esters loses a proton to give the ester.
II. Protonation of the carbonyl oxgen activates the carbonyl gorup towards
nucleophilic addition of the alcohol.
III. Proton transfer in the tetrahedral intermediate occurs.
IV. Nucleophilic attack of alcohol on protonated carbonyl group.
Arrange the following steps in their correct sequence.
1) IIIIVIII 2) IIVIIIII 3) IIIVIIII 4) IIIIIIVI
89. Statement –I : The nitration of benzaldehyde is slower than benzene, and
m-nitrobenzaldehyde is the product.
Statement –II : -CHO group acts as a deactivating and meta-directing group.
90. Coordination compounds have great importance in biological systems. In this
context which of the following statements is incorrect?
1) Cyanocobalamin is B12 and contains cobalt
2) Haemoglobin is the red pigment of blood and contains iron
3) Chlorophylls are green pigments in plants and contain calcium
4) EDTA is used in the treatment of lead poisoning
91. The correct order of ligands in the spectrochemical series is
1) Cl   en  CN  NCS  2) CN   en  NCS   Cl 

3) NCS   CN  Cl   en 4) en  CN   Cl   NCS 
92. The incorrect combination is
1) CoCl2.NO2.6NH3  shows linkage as well as ionisation isomerism

2) Co  NH 3  4 Cl2   shows optical and isomerism

3) Co  en 2 Cl2   shows optical geometrical isomerism
4) CoCl3.6H2O  shows hydrate isomerism
93. A solution is prepared by mixing 100 ml of 0.1M NH4OH and 200 ml of 0.2M
NH4Cl, pKb of NH4OH is 4.8. Then the pH of the solution is
1) 9.0 2) 8.0 3) 8.5979 4) 5.4021
94. Which of the following undergoes both cationic as well as anionic hydrolysis?
1) CH3COOK 2) NH4NO3 3) NH4CN 4) CsCl
95. The compounds A and B are mixed in equimolar proportion to form the products,
A + B  C + D. At equilibrium, one third of A is found to be consumed. The
equilibrium constant for the reaction is
1) 0.5 2) 4.0 3) 2.5 4) 0.25

96. Assertion : Nitrating mixture used for carrying out nitration of benzene consists
of conc. HNO3 + conc. H2SO4.
Reason : In presence of H2SO4, HNO3 acts as a base and produces NO2 ions.
assertion.
assertion
97. The IUPAC name of diethyl isopropyl amine is
1) N, N-diethylpropan-2-amine 2) N, N-diethylpropan-1-amine
3) N, N-diethylisopropylamine 4) N, N-diethylaminopropane
98. Assertion(A): Button cell (or) mercury cell is used in wrist watches and in
hearing aids.
Reason(R): Button cell has compact size and its potential remains same through
out its life.
1) A and R are correct R is the correct explanation of A
2) A and R are correct R is not the correct explanation of A
3) A is correct, but R is wrong 4) A is wrong, but R is correct
o
99. The Ecell of following cell is 0.76V
Zn  s  Zn 2 1M  H  1M  H 2  g, 1 atm  , Pt
o
Then EZn 2+
/ Zn
is ________V.
1) 0.76V 2) -0.76V 3) 1.52V 4) -1.52V
100. Which of the following structure is the most preferred structure for SO3?
1) 2) 3) 4)
BOTANY
SECTION – A
101. First cell of gametophytic generation and last cell of sporophytic generation
respectively.
1) Spore & spore 2) Zygote & spore
3) Embryo & spore 4) Spore & spore mother
102. Identify the given organism and label A, then select the suitable option
Organism Label A
(a) Laminaria Stipe
(b) Porphyra Frond
(c) Fucus Air bladder
(d) Polysiphonia Branches
1) (a) 2) (b) 3) (c) 4) (d)
103. Select the set of organisms in which flagellated gametes are not formed.
1) Ulothrix, Volvox, Spirogyra 2) Porphyra, Gelidium, Polysiphoria
3) Sargassum, Fucus, Ulothrix 4) Ulothrix, Chara, Chlamydomonas
104. "Protoxylem lies towards the A in stem. Such arrangement of xylem is called B .
Select the correct option for A and B.
1) A-Centre, B-Exarch 2) A-Periphery, B-Exarch
3) A-Centre, B-Endarch 4) A-Periphery, B-Endarch

105. A few epidermal cells, in the vicinity of the guard cells become specialized in their
shape and size, are known as
1) Subsidiary cells 2) Complementary cells
3) Bulliform cells 4) Passage cells
106. Companion cells
1) Are specialized sclerenchymatous cells
2) Are closely associated with sieve tube elements
3) Lack nucleus at maturity
4) Are found in gymnosperms
107. Read the given statements and select the correct ones regarding viroids.
(a) A protein coat is present (b) High molecular weight
(c) Discovered by T.O. Diener (d) They infect plants
1) Only (a) & (b) 2) Only (b) & (c) 3) Only (b), (c) && (d) 4) Only (c) & (d)
108. Assertion (A): Members of kingdom fungi show a great diversity in their
morphology and habitat.
Reason (R): Fungi are cosmopolitan and prefer to grow in cool and humid places
only.
1) Both Assertion and Reason are true and the reason is the correct explanation
of the assertion
2) Both Assertion and Reason are true but the reason is not the correct
3) Assertion is true statement but Reason is false
4) Both Assertion and Reason are false statements
109. Spores in slime moulds
1) Are formed during unfavourable conditions
2) Are without cell wall
3) Are dispersed with the help of flagella
4) Are formed in gemmae cups
110. Match the columns and select the correct option
Column I Column II
a. Polyandrous condition (i) Sepals united
b. Polyadelphous condition (ii) Filaments are united into more than
two bundles
c. Epiphyllous stamen (iii) Free stamens
d. Gamosepalous condition (iv) Stamen is attached to perianth
1) a(i), b(ii), c(iii), d(iv) 2) a(iv), b(iii), c(ii), d(i)
3) a(ii), b(i), c(iv), d(iii) 4) a(iii), b(ii), c(iv), d(i)
111. Flowers of which of the given plants are asymmetric?
(a) Canna (b) Cassia (c) Bean (d) Mustard (e) Datura
1) Only (b) 2) Both (c) and (e) 3) Both (d) and (e) 4) Only (a)
112. Choose the incorrect match w.r.t. placentation
1) Tomato — Axile 2) Mustard — Parietal
3) Marginal — Pea 4) Free central — Sunflower
1) Split-gene arrangement is a characteristic feature of eukaryotes
2) During splicing introns are removed and exons are joined
3) In prokaryotes, mRNA does not require any processing to become active
4) For the transmission of genetic information, DNA is better material
114. Observe the floral diagram and find the characters applicable.
(a) Lemma & palea are present

(b) Stamens are called lodicules
(c) Perianth reduced
(d) Ovary has single ovule
(e) Stamens are monothecous
1) a, b, c 2) a, b, c, d 3) a, c, d 4) a, c, d, e

Column I (Regions of root tip) Column II (Features)
A. Root cap 1. Lengthwise growth
B. Meristematic zone 2. Root hairs
C. Elongation zone 3. Fast cell division
D. Maturation zone 4. Thimble-like structure
A B C D A B C D
1) 4 1 2 3 2) 4 3 1 2
3) 3 1 4 2 4) 1 4 3 2
116. Inferior ovary can be observed in
1) Hibiscus 2) Lilly 3) Pea 4) Sunflower
117. Find the correct match.
1) Auxins – stress hormone 2) Gibberellins – Root formation on stem cutting
3) Cytokinins – cell division 4) ABA – delay of senescence
118. How many ATP molecules are required for regeneration of 6 molecules of RuBP
during regeneration step of C3 cycle?
1) 18 2) 3 3) 6 4) 1
119. The transmembrane channel embedded into the thylakoid membrane that carries
out facilitated diffusion of protons across the membrane into the stroma of the
chloroplast is
1) CF1 -particle 2) CF0 -particle 3) Cytochrome bof 4) PQ
120. Find the incorrect pair.
1) Sweet potato-underground stem 2) Potato-underground stem
3) Opuntia-Modified stem 4) Citrus-Modified axillary buds
121. Pectinases and proteases are used for
1) Clarification of bottled juices
2) Lowering cholesterol levels of blood
3) Suppressing the immune system of the body
4) Primary treatment of sewage
122. Read the following statements and state hue (T) or false (F).
A. Conventional farming is a holistic approach that seek to develop an
understanding of the webs of interaction between the myriad of organisms that
constitute the field fauna and flora.
B. The use of biocontrol measures will greatly reduce the dependence on toxic
chemicals and pesticides.
C. Baculoviruses are available in sachets as dried spores which are mixed with
water and sprayed onto vulnerable plants such as Brassicas and fruit trees.
D. Trichoderma species are free-living fungi that are very common in the root
ecosystems.
1) A(T), B(T), C(T), D(T) 2) A(T), B(T), C(F), D(T)
3) A(F), B(T), C(F), D(T) 4) A(F), B(T), C(T), D(T)
123. How many reductional divisions would be required to produce 1000 wheat
grains/seeds?
1) 250 2) 1250 3) 1000 4) 500
124. Find the correct match.
1) Rice – C4 plant 2) Sorghum – C4 plant
3) Maize – C3 plant 4) Wheat – C4 plant
125. Enzyme recombinase activity is seen in
1) Pachytene 2) Zygotene 3) Leptotene 4) Diplotene
126. Match column I with column II and select the correct option.
Column I Column II
a. S-phase (i) Actual cell division
b. G2 -phase (ii) Centriole duplication
c. G1-phase (iii) Tubulin protein synthesis
d. M-phase (iv) Duplication of most of the cell organelles
1) a(iii), b(ii), c(i), d(iv) 2) a(ii), b(iii), c(i), d(iv)
3) a(ii), b(iii), c(iv), d(i) 4) a(iii), b(ii), c(iv), d(i)
127. Select the odd one out w.r.t. functions of mesosomes
1) They help in cell wall formation
2) They help in DNA replication and distribution to daughter cells
3) They help in respiration and secretion process
4) They decrease the surface area of plasma membrane and enzymatic content

128. Which of the following cell organelles is bounded by a single membrane?
1) Chloroplasts 2) Mitochondria 3) ER 4) Nucleus
129. How many of the following statements is/are correct?
(a) The cell wall of a young plant cell is capable of growth
(b) Secondary cell wall holds or glues the different neighbouring cells together
(c) Middle lamella is formed on the inner side of the plant cell
(d) The cell wall and middle lamella may be traversed by plamodesmata which
connect the cytoplasm of neighbouring cell
1) One 2) Three 3) Four 4) Two
130. Chitin is the complex nitrogen containing homopolysaccharide that forms
1) Fungal cell wall
2) Reserve food material in plants
3) Energy storing material in mammals
4) Most abundant organic compound in biosphere
131. Prosthetic groups differ from coenzymes in that
1) They require metal ions for their activity
2) They are tightly bound to apoenzymes
3) Their association with apoenzymes is transient
4) Both 1 and 3
132. Choose the basic amino acid among the following
1) Glutamic acid 2) Lysine 3) Valine 4) Glycine
133. Experimental verification chromosomal theory of inheritance was done by
1) Bateson and Punnet 2) T.H. Morgan
3) Watson and Crick 4) Sutton and Boveri
Column I Column II
(a) Primary constriction (i) Kinetochores
(b) Beyond secondary constriction (ii) Satellite
(c) Disc shaped structures on the sides (iii) Telomere of primary constriction
(d) End of the chromosome (iv) Centromere
1) a(iv), b(ii), c(i), d(iii) 2) a(iv), b(ii), c(iii), d(i)
3) a(ii), b(iv), c(i), d(iii) 4) a(ii), b(iv), c(iii), d(i)
135. Complete the analogy and select the correct option.
Lysozyme : Bacteria : : Chitinase : ________________
1) Plant cell 2) Fungus 3) Animal cell 4) Protozoan
SECTION – B
136. Restriction enzyme whose restriction site is represented by the region marked 'A'
is
1) Pvu I 2) Bam HI 3) Pst I 4) HindIII

137. DNA that is isolated with the help of enzymes and chilled ethanol can be removed
by a glass rod, process called
1) Elution 2) Dialysis 3) Spooling 4) Cloning
138. Find the incorrect pair of the scientists and the plant material they worked on
w.r.t. discovered of plant growth regulators
1) F.W. Went - Oat seedling 2) E. Kurosawa - Rice seedling
3) F. Skoog - Ripened orange 4) Francis Darwin - Canary grass
139. Arrange the RQ of the following substrates in ascending order and select the
correct option
a. Tripalmitin b. Glucose c. Protein
1) c<b<a 2) a<c<b 3) a<b<c 4) b<c<a
140. In one of the events related to translation of mRNA, the release factor can bind to
all of the following codons, except
1) UAG 2) UAA 3) UGG 4) UGA

141. Assertion (A): Pollen tube enters the ovule usually through micropylar end.
Reason (R): Generally one ovule has one embryosac.
3) (A) is incorrect but (R) is correct 4) (A) is correct but (R) is incorrect
142. Tricarboxylic acid cycle
1) Serve as a common oxidative pathway for carbohydrates, fats and proteins
2) Includes two steps of substrate level phosphorylation reactions in one cycle
3) Occurs in cytosol
4) Is also known as EMP reaction
143. Cytochrome a, a3 and two copper centres constitutes
1) Complex IV of ETS that receives electron directly from cytochrome c
2) Complex V of ETS that receives electron directly from ubiquinone
3) Complex II of ETS that receives electron directly from NADH2
4) Complex I of ETS that receives electron directly from FADH2
144. Choose the incorrect match
1) Auxin - Controls xylem differentiation
2) ABA - Overcome apical dominance
3) Gibberellic acid - Speeds up malting process
4) Ethylene - Promotes abscission in plants
145. True nucleus present in
A) Dinoflagellates B) B.G.A
C) Mycoplasma D) Diatoms E) Halophiles
1) B,C,E 2) A,B,C 3) A,D 4) All
146. A person has both IA and IB alleles of gene I. His blood group will be A due
to B . Select the correct option to fill in the blanks A and B.
A B
1) AB Incomplete dominance
2) A Pleiotropy
3) B Dominance
4) AB Co-dominance
Column I Column II
a. Non-histone chromosomal proteins (i) Nucleotide polymerization
b. Severe Ochoa enzyme (ii) Extrachromosomal DNA
c. H2A, H2B protein (iii) Involved in packaging of chromatin
d. Plasmids (iv) Present in Nucleosome
1) a(ii), b(i), c(iv), d(iii) 2) a(iii), b(i), c(iv), d(ii)
3) a(iii), b(iv), c(i), d(ii) 4) a(i), b(iii), c(iv), d(ii)
148. RNA polymerase I transcribes all of the following except
1) 5.8S rRNA 2) 18 S rRNA 3) 5S rRNA 4) 28S rRNA
149. The unequivocal proof that DNA is the genetic material came from the
experiments of
1) Watson and Crick 2) Avery, Macleod, McCarty
3) Hershey and Chase 4) Meselson and Stahl
150. Sigma (σ) factor and Rho (ρ) factor in prokaryotes are involved in transcription,
respectively in
1) Termination and initiation 2) Elongation and termination
3) Initiation and termination 4) Termination and elongation
ZOOLOGY
SECTION – A
151. Transgenic models exist for may human diseases such as
a. Cancer
b. Cystic fibrosis
c. Rheumatoid arthritis
d. Alzheimer's disease
1) a, b and c 2) a and c 3) a and b 4) a, b, c and d

152. Which among the followings is correct during each cardiac cycle?
1) The volume of blood pumped out by the right and left ventricles per minute
2) The volume of blood pumped out by the right and left ventricles per second
3) The volume of blood received by each atrium per second
4) The volume of blood received by the aorta and pulmonary artery is minute
153. Tuataras are
1) Sauropsids 2) Synapsids 3) Dinosaurs 4) Crocodiles
154. Pick the correct match.
A) Eye of octopus and mammals – Analogy
B) Koala and Wombat – Adaptive radiation
C) Saltation – Small mutation
D) Karl Ernst Von Baer – Galapagos islands
1) A, D 2) B, C 3) A, B 4) B, D
155. Red data book is maintained by
1) IUCN 2) ICBN 3) ICZN 4) ICPN
156. Given below are two statements, choose correct option.
Statement I: Vertebrochondral ribs join the seventh rib with the help of hyaline
cartilage.
Statement II: First vertebra is atlas and it articulates with the occipital condyles.
1) Both Statement I and Statement II are false
2) Statement I is correct but Statement II is false
3) Statement I is incorrect but Statement II is true
157. Rivet popper hypothesis given by ecologist Paul Ehrlich describes ‘rivet’ is
1) Genus 2) Species 3) Ecosystem 4) Community
158. The cerebral aqueduct is found in
1) Cerebral hemisphere 2) Medulla 3) Spinal cord 4) Mid Brain
159. Statement-I: Trachea is a straight tube extending up to the mid thoracic cavity,
which divides at the level of 5th thoracic vertebra in to a right and left pulmonary
bronchi.
Statement-II: The branching network of bronchi, bronchioles and alveoli
comprise the lungs.
1) Statement I and statement II are correct
4) Both the statements are incorrect.
160. Which of the following special venous system is present in frog?
3) Both (1) and (2) 4) Coronary portal system
161. Coxal bone of pelvic girdle is formed by fusion of ______
1) Ilium, ischium and pubis 2) Ileum, ischium and pubis
3) Acromion, scapula and coracoid process
4) Clavicle, scapula and coracoid process
162. Association areas of cerebral cortex is responsible for
1) Memory and communication
2) Respiration, cardiovascular reflexes and gastric secreations
3) Memory and balance of body
4) Sexual behavior, emotional reactions & pleasure
163. Statement –I : Parasite may not reduce population density of its host.
Statement –II : Parasite may reduce survival, growth and reproduction of host.
164. Gause’s principle of competitive exclusion states that
1) Two closely related species competing for the same resources cannot co-exist
indefinitely
2) Competition for the some resources excludes species having different food
preferences
3) More abundent species will exclude the less abundent species through
competetion
4) Large organisms exclude smaller one through competition

165. Pick out the correct statement :-
(a) Haemophilia is a sex-linked recessive disease
(b) Phenylketonuria is an autosomal recessive gene disorder
(c) Sickle cell anaemia is a X-linked recessive gene disorder
1) (a) and (b) are correct 2) (b) and (c) are correct
3) (a) and (c) are correct 4) (a), (b) and (c) are correct
166. The below given is the beta haemoglobin chain of normal and affected individual
for sickle cell anaemia respectively, choose A and B.
1) A -Valine, B-Glutamic acid 2) A-Histidine, B-Valine

3) A-Glutamic acid, B-valine 4) A-valine, B-Histidine
167. Dialysing fluid does not contain ________when compared to blood plasma?
1) Plasma proteins 2) Water 3) Urea 4) Electrolytes
168. What is the correct order of these events?
a) Conversion of fibrinogen to fibrin
b) Retraction of blood clot
c) Formation of thromboplastin
d) Conversion of prothrombin to thrombin
1) (c) → (d)→ (a)→ (b) 2) (d) →(c) →(a)→ (b)
3) (d) → (a) → (c) → (b) 4) (c) → (a) → (d)→ (b)
169. The taxon representing both freshwater and marine species is
1) Cnidaria 2) Ctenophora
3) Echinodermata 4) Cephalochordata
170. Read the following and pick correct statements.
I. Each species is reproductively isolated from every other species.
II. Both sweet potato and potato are the modifications of stem meant for storage
of food.
III. Homo erectus probably ate meat.
IV. Frequency of an allele in an isolated population may change due to gene flow.
1) I, III, IV 2) I, II, IV 3) II, III, IV 4) I, II, III, IV
171. ________is the initiator of “lab to land” food security and several other
environmental Programmes.
1) Alfonso corti 2) Ramdeo misra
3) Watson and crick 4) M.S. Swaminathan
172. For maintaining good health biology states that mind influences , through _______
and _____ system.
1) Digestive and circulatory system 2) Neural and endocrine system
3) Neural and skeletal system 4) Excretory and neural
173. Which of the following diseases are transmitted through contaminated food and
water?
Malaria, Ring worm , Filariasis, Ascariasis, Typhoid, Amoebiasis
1) 1 2) 2 3) 3 4) 4
174. Hepatitis B vaccine produced from _______
1) Fungus 2) virus 3) Yeast 4) Bacteria
175. Which of the following hormone is not present during the proliferative phase of
menstrual cycle?
1) FSH 2) LH 3) Progesterone 4) Estrogen
176. Number of primary spermatocytes and primary oocytes are require for the
formation of 400 sperms and 400 ovum respectively.
1) 100, 400 2) 200, 400 3) 400, 200 4) 400, 400
177. Which was the last human chromosome to be completely sequenced in HGP?
1) Chromosome-X 2) Chromosome-Y
3) Chromosome-11 4) Chromosome-1
178. Bilateral symmetry, metameric segmentatation, coelom and open circulatory
system characterizes which of the following phylum?
1) Annelida 2) Mollusca 3) Arthropoda 4) Echinodermata
179. Which of the following blood vessel carries oxygenated blood?
1) Pulmonary artery 2) Aorta
3) Pulmonary vein 4) Both (2) and (3)

180. A National level approach to build up a reproductively healthy society was taken
up in our country in the year
1) 1951 2) 1994 3) 2017 4)1990
181. Which of the following is a character of cockroach?
1) No wings 2) External fertilisation
3) Presence of Proventriculus 4) Absence of salivary gland
182. Statement–I: Protein hormones normally do not enter the target cells, but
generate secondary messengers like Ca2+, ATP, IP4 etc.
Statement–II: Steroid hormones regulate gene expression by the formation of
hormone – receptor complex within the genome.
183. VNTR belongs to which class of DNA?
1) Mini – Satellite 2) Micro – Satellite
3) Telo – Satellite 4) Macro – Satellite
(A) Vasa recta (I) Produce urine nearly four times concentrated
(B) Human kidneys (II) Angiotensinogen to angiotensin - II
(C) JGA (III) Arise from efferent arteriole
(D) PCT (IV) Reabsorption of HCO3
`
(A) (B) (C) (D) (A) (B) (C) (D)

1) I II III IV 2) III I II IV
3) III I IV II 4) IV I III II
185. Alpha Thalassemia is controlled by_____ gene/genes located on chromosome ____
1) HBB, 16 2) HBA1, HBA2, 16
3) HBB, 11 4) HBA1, HBA2, 11
SECTION – B
186. Kidneys are situated in between __________
1) 11th thoracic to 5th lumbar vertebra
2) 19thto 22ndvertebra
3) 19th thoracic vertebra to 22 lumbar vertebra
4) 12th thoracic to 3rd sacral vertebra
187. Represented below is the inheritance pattern of a certain type of traits in
humans. Which one of the following conditions could be an example of this
pattern?
Mother Father
Daughter Son
1) Haemophilia 2) Thalassemia
3) Phenylketonuria 4) Sickle cell anaemia
188. The rate of production of organic matter during photosynthesis is
a) NPP b) GSP c) GPP
1) a, b & c 2) a & c only 3) c only 4) a & b only
189. Which of the following are the stages of respiration in correct order?
A – Gaseous transport
B – Cellular respiration
C – Diffusion of O2 and CO2 between blood and tissues
D – Breathing
1) A – D – C – B 2) D – A – C – B
3) D – A – B – C 4) D – C – B – A

190. The structure where large number of species are non linearly arranged in an
ecosystem called.
1) Food chain 2) Food web
3) Ecological pyramids 4) All the above
191. Identify the following animals and the classes to which they belong.
A B C
1) Chelone, Reptilia Struthio, Aves Ornithorhynchus, Mammalia
2) Crocodilus, Reptilia Struthio, Aves Ornithorhynchus, Amphibia
3) Crocodilus, Reptilia Struthio, Aves Ornithorhynchus, Mammalia
4) Crocodilus, Reptilia Psittacula, Aves Ornithorhynchus, Mammalia
192. In what way awareness can be created among people about reproduction related
aspects?
(a) Through audio-visual and print media advertisements.
(b) Creating fear among adolescents about sexual practices.
(c) Equal opurtunities for the male and female child.
Select the most appropriate option.
1) (a), (b) and (c) are correct 2) (b) and (c) are correct
3) (a) and (b) are correct 4) (a) and (c) are correct
193. The taxonomic unit ‘Phylum’ in the classification of animals is equivalent to
which hierarchial level in classification of plants?
1) Class 2) Order 3) Family 4) Division
194. Which of the following statements are true/false?
(i) The solubility of CO2 is 20 - 25 times higher than that of O2.
(ii) Approximately 8 - 9% of CO2 is transported being dissolved in the plasma of
blood.
(iii) At the tissue site, CO2 diffuses into blood (RBCs and plasma) and forms
H2CO3.
(iv) The oxyhaemoglobin (HbO2) of the erythrocytes can carry maximum of five
molecules of O2.
(v) Every 100ml of deoxygenated blood delivers approximately 4ml of CO2 to the
alveoli.
1) (i), (iii) and (v) are true; (ii) and (iv) are false
2) (i), (iii) and (v) are false; (ii) and (iv) are true
3) (i), (ii), and (iv) are true; (iii) and (v) are false
4) (i), (ii) and (iv) are false; (iii) and (v) are true
195. It was observed in the forest that a single large tree is utilized by numerous
insects. These insects are eaten by small birds, which in turn are eaten by large
birds.
Which of the following shapes represents the pyramid of numbers for such an
ecosystem?
1) 2) 3) 4)
196. The hormones that helps in maintenance of electrolytes, body fluid volume,
osmotic pressure and blood pressure is ________
1) Aldosterone 2) ADH 3) Epinephrine 4) Both 1 & 2

197. In an ecosystem, four major interdependent components were in the given
proportions :
What would be the new composition of the same ecosystem when majority of the
Hawk were killed.
1) 2)
3) 4)
198. Many freshwater animals connot live for long in sea water and vice versa because
of :
1) Osmotic problems 2) Light problems
3) Temperature problems 4) Non aviailability of food
199. ADA deficiency results in
1) Increased risk of infertility
2) Inability of immune system to function normally
3) Chromosomal disorders
4) Decrease in yield of crop plants
200. Assertion(A) : Primitive earth conditions were created in the laboratory by S.L.
Miller in 1953.
Reason(R): The early earth conditions were like volcanic storms, low
temperature, and oxygen rich atmosphere.
1) Both A & R are correct but R is not correct explanation of A
2) Both A & R are correct and R is correct explanation of A
3) A is correct but R is incorrect
*******

: ANSWER KEY:
STD: XII, LT & CC – NEET GT - 11 DATE : 02-05-2024
SET-1 SUB: PHYSICS
1 2 11 2 21 2 31 3 41 2
2 2 12 1 22 3 32 2 42 1
3 4 13 3 23 2 33 4 43 2
4 1 14 1 24 3 34 3 44 2
5 3 15 2 25 3 35 1 45 1
6 4 16 1 26 2 36 4 46 1
7 3 17 2 27 3 37 4 47 1
8 1 18 2 28 1 38 3 48 2
9 1 19 2 29 4 39 3 49 3
10 1 20 4 30 3 40 2 50 2
SUB:CHEMISTRY
51 4 61 4 71 4 81 4 91 2
52 2 62 3 72 2 82 4 92 2
53 2 63 4 73 4 83 4 93 3
54 4 64 3 74 3 84 2 94 3
55 1 65 2 75 1 85 1 95 4
56 2 66 4 76 1 86 3 96 1
57 4 67 2 77 4 87 2 97 1
58 3 68 3 78 2 88 3 98 1
59 3 69 4 79 3 89 1 99 2
60 2 70 4 80 3 90 3 100 1
SUB : BOTANY
101 4 111 4 121 1 131 2 141 1
102 2 112 4 122 3 132 2 142 1
103 2 113 4 123 2 133 2 143 1
104 3 114 3 124 2 134 1 144 2
105 1 115 2 125 1 135 2 145 3
106 2 116 4 126 3 136 2 146 4
107 4 117 3 127 4 137 3 147 2
108 3 118 3 128 3 138 3 148 3
109 1 119 2 129 4 139 2 149 3
110 4 120 1 130 1 140 3 150 3
151 4 161 1 171 4 181 3 191 3
152 1 162 4 172 2 182 4 192 4
153 1 163 4 173 3 183 1 193 4
154 3 164 1 174 3 184 2 194 1
155 1 165 1 175 3 185 2 195 1
156 4 166 3 176 1 186 2 196 4
157 2 167 3 177 4 187 1 197 1
158 4 168 2 178 3 188 3 198 1
159 1 169 1 179 4 189 2 199 2
160 3 170 1 180 1 190 2 200 3

STD : XII, LT &N CC SET – 1 Max. Marks : 720
answer sheet.
CORRECT.
Section-B;
Marking Scheme :

PHYSICS
SECTION – A
1. Gravel is dropped on a conveyor belt at the rate of 2kg/s. The extra force required
to keep the belt moving at 3ms-1 is
1) 1 N 2) 3 N 3) 4 N 4) 6 N
2. A beam balance or physical balance works on the
1) conservation of energy 2)conservation of angular momentum
3)principle of moments 4) gravitational pull
3. Following diagram performs the logic function of
1) XOR gate 2) AND gate 3) NAND gate 4) OR gate

4. A missile is fired for maximum range with an initial velocity of 20m/s. If g =
10m/s2, the range of the missile is
1) 50m 2) 60m 3) 20m 4) 40
5. A body of mass “m” kg is rotating in a vertical circle at the end of a string of
length ‘r’ metre. The difference in the kinetic energy at the top and the bottom of
the circle is (body moving with critical velocity)
mg 2mg
1) 2) 3) 2mgr 4) mgr
r r
6. Assertion (A) :A player lower his hands while catching a cricket ball to reduce
impulsive force.
Reason (R) : With increase in time of action, the impulsive force increases.
7. A parallel plate capacitor is charged to 60 µc. due to radioactive source, the plate
losses charge at the rate of 1.8 X 10-8 Cs-1. The magnitude of displacement
current is
1) 1.8 X 10-8 Cs-1 2) 3.6 X 10-8 Cs-1 3) 4.1 X 10-11Cs-1 4) 5.7 X 10-12 Cs-1
8. Statement-I :A particle is moving on a circle of radius R with uniform speed. Its
kinetic energy remains the same, but momentum changes.
Statement-II : Work done by centripetal force is zero. Kinetic energy and
p2
momentum are related as K  .
2m
for statement-I
9. In SHM match the following:
Column-I Column-II
a) Max. velocity (e) 1/ 2 M  2 A2
b) Max. Acceleration (f) m ω2 A
c) Max. Force (g) A
d) Max. total energy (h) ω2 A
1) a-g, b-h, c-f, d-e 2) a-h, b-g, c-f, d-e
3) a-f, b-h, c-g, d-e 4) a-g, b-e, c-h, d-f
10. Assertion : The bob of a simple pendulum is a ball full of water. If a fine hole is
made at the bottom of the ball, then the time period will no more remain
constant.
Reason : The time period of a simple pendulum does not depend upon mass.
2)Both ‘A’ and ‘R’ are true and ‘R’ is not the correct explanation of ‘A’

11. Assertion (A) :Blue star is at high temperature than red star.
 l 
Reason (R) : Wien’s displacement law states that T    .
 m 
of the Assertion
of the Assertion
12. Find the momentum of an electron having wavelength 2 A0  h  6.62  1034 Js 
1) 1 1024 Kg ms 1 2) 3.31 1024 Kg ms 1 3) 4  1023 Kg ms 1 4) 6  1024 Kg ms 1
13. Hailstone at 00C falls from a height of 1km on an insulating surface converting
whole of its kinetic energy into heat. What part of it will melt (g = 10 m/s2)
1 1 1
1) 2) 3)  104 4) All of it will melt
33.6 336 33
14. When the incident wavelengths are  and  / 2 , the kinetic energies of the emitted
photo electrons from the same surface are E1 andE2. Then
1) E2=E1 2) E2>2E1 3) E2<E1/2 4) E2=E1/2
15. If VH, VN and VO denote the root mean square velocities of molecules of hydrogen,
nitrogen and oxygen respectively at a given temperature, then
1) VN> VO> VH 2) VH> VN> VO 3) VO = VN = VH 4) VO > VH> VN
16. The specific heat of an ideal gas is
1) Proportional to T 2) Proportional to T2
3) Proportional to T 3 4) Independent of T
17. The magnetic susceptibility of a material of a rod is 499. Permeability of vaccum
is 4  10 7 H / m . The absolute permeability of the material of the rod in
henry/meter is
1)   10 4 2) 2  104 3) 3  104 4) 4  104
18. A uniform rod of mass ‘m’, length L, area of cross-section A and Young’s modulus
Yhangs from the ceiling. Its elongation under is own weight will be
mgL mgL 2mgL
1) zero 2) 3) 4)
2AY AY AY
19. Water rises in a capillary upto a height of 4cm. If it is titled to 300 from the
vertical, then the length of water column in it will be:
8
1) cm 2) 8 3 cm 3) 4cm 4) 2cm
3
20. The work done in forming a soap film of size 10cm  10cm will be, if the surface
2
tension of soap solution is 3  10 N / m
4 2 4 2
1) 3  10 J 2) 3  10 J 3) 6  10 J 4) 6  10 J
21. A rectangular loop carrying a current i is situated near a long straight wire such
that the wire is parallel to one of the sides of the loop. If a steady current I is
established in the wire, as shown in Fig. the loop will
1) Rotate about an axis parallel to the wire

2) Move away from the wire
3) Move towards the wire 4) Remain stationary
22. A coil having an area A0 is placed in a magnetic field which changes from B0 to 4 B0
in time interval t. The emf induced in the coil will be
1) 3 A0 B0 / t 2) 4 A0 B0 / t 3) 3B0 / A0t 4) 4 B0 / A0t
23. Calculate the moment of couple required to keep a bar magnet of magnetic
moment 2  10 2 Am 2 in a uniform field of induction 0.36 T at an angle of 300 with
the direction of uniform field
1) 36 Nm 2) 3.6 Nm 3) 72 Nm 4) 7.2 Nm

24. A 1 cm long string vibrates with fundamental frequency of 256 Hz. If the length
1
is reduced to cm keeping the tension unaltered, the new fundamental frequency
4
will be
1) 64 2) 256 3) 512 4) 1024
25. Four particles of mass 1kg, 2kg, 3kg and 4kg are placed at the four vertices A, B,
C and D of a square of side 1m. The coordinates of centre of mass of the particles
are
1) (0.3m, 0.5m) 2) (0.5m, 0.3m) 3) (0.2m, 0.2m) 4) (0.3m, 0.2m)

26. If E, e,  and m respectivley represent the electric field, charge relaxation time
and mass of the electron, what is drift velocity?
Ee Ee Ee E
1) 2) 3) 4)
m m m me
27. The magnifying power of a telescope is 9. When it is adjusted for parallel rays the
distance between the objective and eyepiece is 20cm. The focal length of lenses
are
1) 10cm, 10cm 2) 15cm, 5cm 3) 18cm, 2cm 4) 11cm, 9cm
28. A ray of light passes normally through a slab    1.5 of thickness ‘t’. If the speed
of light in vaccum be ‘C’ then time taken by the ray to go across the slab will be
t 3t 2t 4t
1) 2) 3) 4)
C 2C 3C 9C
29. A double slit experiment is performed with light of wavelength 500 nm. A thin
film of thickness 2  m and refractive index 1.5 is introduced in the path of the
upper beam. The location of the central maximum will
1) Remain unshifted 2) Shift downward by nearly two fringes
3) Shift upward by nearly two fringes 4) Shift downward by 10 fringes
30. The equivalent capacity between the points A and B in the adjoining circuit will
be
1) C
2) 2C
3) 3C
4) 4C
31. The magnitude of the electric field on the surface of a sphere of radius r having a
uniform surface charge density is  is
1)  /  0 2)  / 2 0 3)  /  0 r 4)  / 2 0 r
32. The amplitude of polarized light transmitted through a polarizer is A. The
amplitude of unpolarised light incident on it is
A A
1) 2) 3) 2 A 4) 2A
2 2
33. If an iron wire is stretched by 1% what is the strain in the wire?
1) 0.01 2) 0.005 3) 0.02 4) 0.03
coil of resistnace wire embedded in a thermally insulated block of specific heat
capacity ‘s’ and mass ‘m’. If the temperture of the block is raised by T, the
potential difference V across the capacitance is
1) 2) 3) 4)
s s C C

35. A current of 3 amperes flows through the 2resistor shown in the circuit. The
power dissipatedin the 5resistor is :-
1) 1 watt 2) 5 watts 3) 4 watts 4) 2 watts
SECTION – B
36. In the circuit shown in the figure, if the potentialat point A is taken to be zero,
the potential atpoint B is :-
1) +1 V 2) -1 V 3) +2V 4) -2 V
37. Match the items in List I with those List II
List I List II
A. Universal gravitational constant E) Central force
B. Gravitational force F) Scalar
C. ‘g’ at equator G) Does not change if earth stops rotating
D. ‘g’ at poles H) Increase by R 2 if earth stops rotating
1) A-F, B-E, C-H, D-G 2) A-F, B-G, C-H, D-E
3) A-H, B-E, C-H, D-G 4) A-G, B-E, C-H, D-F
38. The force on a rocket moving with a velocity 300m/s is 210N. The rate of
consumption of fuel of rocket is
1) 0.7 kg/s 2) 1.4kg/s 3) 0.07 kg/s 4) 10.7kg/s
3h
39. The angular momentum of an electron in the hydrogen atom is .
2
The kinetic energy of this electron is
1)3.4 eV 2) 1.51ev 3)13.6 eV 4) 0.85eV
40. You are given total mass M. How do you divide it into two parts so that the
gravitational force between them at a given distance is maximum
M 3M M 2M M 4M M M
1) . 2) . 3) . 4) .
4 4 3 3 5 5 2 2
41. A current of 2A is passed through a coil of 1000 turns, to produce a flux of 0.5
wb. Calculate the self inductance of the coil
1) 100 H 2) 250 H 3) 300 H 4) 50 H
42. A stone is projected vertically up to a reach a maximum height ‘h’. The ratio of its
4h
kinetic to potential energies at a height will be
5
1) 5 : 4 2) 4 : 5 3) 1 : 4 4) 4 : 1
43. There are two brass spheres at the same temperature. If their radii are in the
ratio 2 : 3. The ratio of their thermal capacities is
1) 4 : 9 2) 2 : 3 3) 8 : 27 4) 27 : 8

44. Identify the correct statements from the following descriptions of various
properties of electromagnetic waves.
A. In a plane electromagnetic wave electric field and magnetic field must be
perpendicular to each other and direction of propagation of wave should be along
electric field or magnetic field.
B. The energy in electromagnetic wave is divided equally between electric and
magnetic fields.
C. Both electric field and magnetic field are parallel to each other perpendicular
to the direction of propagation of wave.
D. The electric field, magnetic field and direction of propagation of wave must be
perpendicular to each other.
Choose the most appropriate answer from the options given below.
1) D only 2) B and D only 3) B and C only 4) A and B only
45. The de-Broglie wavelength of a neutron at 27 o C is . What will be its wavelength
at 927 o C ?
1)  / 4 2)  / 3 3)  / 2 4) 3 / 2
46. A system goes from A to B via two processes I and II as shown in figure. If
U1 and U 2 are the changes in internal energies in the process I and II
respectively, then
1) U 2  U1 2) U 2  U1 3) U1  U 2

4) Relation between U1 and U 2 cannot be determined
47. In an experiment on photoelectric effect, the frequency  of the incident light is
plotted against the stopping potential V0. The work function of the photoelectric
surface is given by (e is charge of electron)
1) OB in eV 2) OB in volt 3)OA in eV 4) The slope of the line AB

48. A nucleus of mass number A, originally at rest, emits an  -particle with speed v.
The daughter nucleus recoils with a speed
4v 4v 2v 2v
1) 2) 3) 4)
A4 A4 A4 A4
49. An object is moving with a uniform acceleration which is parallel to its
instantaneous direction of motion. The displacement(s) –velocity(v) graph of this
object is
1) 2) 3) 4)
50. The correct Boolean operation represented by the circuit diagram drawn is :
1) AND 2) OR 3) NAND 4) NOR

CHEMISTRY
SECTION – A
51. The molality of a given aqueous solution of NaCl is 0.45 mol.kg 1 . Then the mole
fraction of NaCl in the solution is ______
1) 0.0178 2) 0.008 3) 0.026 4) 0.0517
52. In benzene, the Henry’s law constant of methane is 4.27 105 mm Hg at 298K.
Then the solubility of methane in benzene is _______ at 298K and 760 mm Hg
pressure.
1) 0.365 g/1kg benzene 2) 0.516 g/1kg benzene
3) 0.178 g/1kg benzene 4) 0.658 g/1kg benzene
53. 6.2 g of an organic compound when heated in Carius tube with conc. HNO3 and
H3PO4 formed converted into MgNH4.PO4 ppt. The ppt. on heating gave 2.22 g of
Mg2P2O7(mol wt. = 222). The percentage of P in the compound is
1) 20 2) 10 3) 30 4) 5
54. Which of the following is more electropositive and possesses lower IP1 value?
1) Li 2) Be 3) Na 4) Mg
55. Incorrect matching is ______
1) Element with the highest IP118th group
2) Element with the highest –ve electron gain enthalpy  17th group
3) Element with the higher metallic character  1st group
4) Element with the highest oxidising nature  16th group
56. The correct IUPAC name for
1) 5 – methyl – 4 – ( 1 2 – dimethyl propyl) heptane

2) 3 – methyl – 4 – ( 1 2 – dimethyl propyl) heptane
3) 2,3,5 – trimethyl – 4 – propyl heptane
4) 4 – propyl – 2,3,5 – trimethyl heptane
57. The radius of an orbit of H-atom is 4.761Ao . Then the PE of the electron in that
orbit is ________eV.
1) -1.51 2) -3.02 3) +3.02 4) +1.51
58. How many electrons maximum can have n + l = 4 in an atom
1) 8 2) 2 3) 6 4) 18
59. How many structural isomers are possible for dichloroethane?
1) 1 2) 2 3) 3 4) 4
60. Which of the following statements is correct with reference to the ferrous and
ferric ions?
1) Fe3 gives brown colour with potassium ferricyanide
2) Fe3 gives blood red colour with potassium thiocyanate
3) Ni 2 gives blue colour with DMG in the presence of NH4OH
4) Mg 2 gives black ppt with Na2HPO4 in the presence of NH4OH
61. 1 mole of K2Cr2O7 in acidic medium oxidises ______ mole of Fe2 ions.
1) 5 2) 14 3) 3 4) 6
62. Which of the following would not be a good choice for reducing into benzene to
aniline?
1) NaBH4 2) H2/Ni 3) Fe and HCl 4) Sn and HCl
63. The correct order of dipole moment is :
1) CH4 < NF3 < NH3 < H2O 2) NF3 < CH4 < NH3 < H2O
3) NH3 < NF3 < CH4 < H2O 4) H2O < NH3 < NF3 < CH4
64. The dipole moment of HX is 1.4 D. If H–X bond distance is 1.26 Å, what is the
percentage of ionic character in the H–X bond –
1) 23% 2) 34% 3) 20% 4) 27%

65. What are the formal charges on B and N atom respectively in the given structure?
1) –1, + 1, 2) + 1, – 1 3) – 2, + 2 4) 0, 0
66. In which pair second ion is less stable than first?
1) (I) and (II) 2) (II) and (III) 3) only (II) 4) only (III)
67. Statement –I : In strongly acidic solutions, aniline becomes less reactive towards
electrophilic reagents.
Statement –II : The amino gorup being completely protonated in strongly acidic
solution, the lone pair of electrons of the nitrogen is no longer available for
resonance.
statement-I
68. Assertion : C – C bond energy is less than that of H – H bond energy, but carbon
exhibit catenation, where as hydrogen does not.
Reason : Hydrogen is monovalent where as carbon is tetravalent.
of Assertion
69. Element that forms p-p bonds with themselves as well as with carbon and
oxygen is
1) As 2) Sb 3) P 4) N
70. In the reaction, H  C  CH 
(1) NaNH 2 / liq . NH 3
(2) CH 3CH 2 Br
X 
(1) NaNH 2 / liq . NH 3
(2) CH 3CH 2 Br
Y , X and Y are
1) X = 1-Butyne; Y = 2-Hexyne 2) X = 1-Butyne; Y = 3-Hexyne
3) X = 2-Butyne; Y = 3-Hexyne 4) X = 2-Butyne; Y = 2-Hexyne
71. Eclipsed form of ethane has higher energy due to
1) Torsional strain 2) Steric strain
3) Angle strain 4) Both (1) & (2)
72. Assertion (A) : Cyclopentane is more stable than cyclobutane.
Reason (R) : According to Baeyer strain theory angle strain in cyclobutane is more
than cyclopentane.
1) Both Assertion and Reason are true and the Reason is the correct explanation of
the Assertion
of the Assertion
73. Consider the following statements :
(1) If all the reactants are not taken in their stoichiometric ratio, then at least one
reactant will be left behind.
(2) 2 moles of H2(g) and 3 moles of O2(g) produce 2 moles of water.
(3) equal weight of carbon and oxygen are taken to produce CO2, then O2 is
limiting reagent.
The above statements 1, 2, 3 respectively are (T = True, F = False)
1) T T T 2) F T F 3) F F F 4) T F T

74. Carbon and oxygen forms two compouds, Carbon content in one of them is
42.9% while in the other is 27.3%. The given data is in support with :
1) law of definite proportions 2) law of reciprocal proportions
3) law of multiple proportions 4) law of conservation of mass
75. When Cu2S is converted into Cu2+ & SO2 then equivalent weight of Cu2S will be
(M= mol.wt. of Cu2S)
1) M 2) M/2 3) M/4 4) M/8
76. The end product (Q) in the following sequence of reaction is
77. In paper chromatography the stationary phase is a

1) Solid 2) Gas 3) Silicagel 4) Liquid
78. Which of the following is incorrect combination?
1) Baryte – BaSO4 2) Epsom salt - MgSO4.5H2O
3) Galena – PbS 4) Copper Pyrites – CuFeS2
79. Assertion : Eventhough fluorine has lesser –ve electron gain enthalpy than that
of chlorine, fluorine is stronger oxidising agent than chlorine.
Reason : Fluorine has lower bond dissociation enthalpy and F  has higher
hydration enthalpy when compared to chlorine.
1) Both assertion and reason are correct, and reason is correct explanation of the
assertion
assertion
4) Assertion is wrong but Reason is correct
80. For reaction, N 2  g   3H 2  g   2NH 3  g 
the rate of disappearance of hydrogen is 2.4  103 M .min1 . Then rate of
appearance of NH3 is ___________ M.min-1
1) 2.4  103 2) 8  104 3) 1.6  103 4) 3.2  103
81. For a reaction the rate constant at 500 K and 700 K are 0.02 s-1 and 0.07 s-1
respectively. Then the activation energy is ______kJ/mol.
1) 18.231 2) 9.626 3) 10.785 4) 15.286
82. Arrange the following alcohols in order of decreasing boiling point values :
1) A>B>C>D 2) B>D>A>C 3) D>B>C>A 4) A>C>D>B
83.
84. For a reaction the H and S values are 320 Kj.K 1.mol 1 and 162 Jk 1mol 1
respectively. Then the reaction is spontaneous at ______K.
1) 1975.4 2) 2020 3) 1850 4) 2400
85. 5 mole of an ideal gas expanded isothermally and reversibly form 20 lit to 100 lit
volume at 27 o C . Then the work done during the process is _______ kJ.
1) -28.72 2) -6.909 3) -4.836 4) -20.104

SECTION – B
(A) Lanthanide with steel hardness (P) La
(B) Lanthanide with higher M 3 ion size (Q) Lu
(C) Lanthanide with minimum negative value (R) Sm
of E for reaction Ln  aq   3e  Ln  s 
0 3 
(D) Lanthanide whose Ln3+ ion is diamagnetic (S) Eu

.
in nature
.
(A) (B) (C) (D) (A) (B) (C) (D)

1) R S P Q 2) R Q S P
3) S R Q P 4) R P S Q
1) Ce4 is good oxidising agent
2) Eu 2 is good reducing agent
3) W(tungsten) has higher melting point in d-block metals
4) Mn has higher enthalpy of atomisation in 3d-series
88. Match Column I with Column II.
Column-I Column-II
A) CH CHO 
Zn / Hg .HCl (p) OH
3
 CH 3 2 CH
B) CH 3COCH 3 
LiAlH 4
 (q) CH3CH2OH
C) CH 3COCH 3 

NH 2 NH 2 , OH
 (r) CH3CH2CH3
D) HCHO 
(1) CH 3 MgBr
 (s) CH3CH3
(2) H + / H O
2
1) ap, bq, cr, ds 2) as, bp, cr, dq

3) ap, bs, cq, dr 4) aq, bs, cr, dq
89. The IUPAC name of phthalic acid is
1) Benzene-1,2-dicarboxylic acid 2) Benzene-1,4-dioic acid
3) Cyclo-1,3,5-trien-1,2-dioic acid 4) Benzene-1,3-dicarboxylic acid
90. Which of the following has primary valency, 2?
1) [Co( NH 3 )5 Cl ]Cl 2) [Co( NH 3 ) 4 Cl2 ]Cl 3) Co( NH 3 )3 Cl3  4) Co( H 2O)4 Cl2  Cl
91. Which of the following can show both optical and geometrical isomerism?
4)  PtCl2 Br2 
2
1)  PtCl6  2)  Pt  en 2 ClBr  3)  Pt  NH 3 4 Cl2  Cl2
2
92. On addiing AgNO3 solution to a solution of [Pt(NH3)3Cl3]Cl, the percentage of total

chloride ion precipitates is
1) 100 2) 75 3) 50 4) 25
93.  C diamond  ; H  1.9 kJ mol Favourable conditions for getting good yield
C graphite   1
of diamond ( density of graphite and diamond are 2.3 g/ml, 3.5 g/ml).
1) High temperature, low pressure 2) Low temperature, high pressure
3) High temperature, high pressure 4) Low temperature, low pressure
94. 2 mole each of A2 and B2 are taken in a 10 lit vessel at 30o C . At equilibrium 50%
of A2 is found to be reacted. Then for the following process, Kc is ______
A2  g   B2  g  
 2 AB  g 
1) 1 2) 4 3) 16 4) 0.4
95. For the aqueous solution of which of the following, pH is greater than 7?
1) HCOONa 2) (NH4)2SO4 3) NaNO3 4) BaSO4
96.
The basicity order of I, II and III is –

1) III > I > II 2) I > II > III 3) III > II > I 4) II > III > I

97. The correct increasing order of basic strength for the following compounds is
1) II<III<I 2) III<I<II 3) III<II<I 4) II<I<III

98 Calculate Ecell for
Pt | H 2  0.1 atm  | H   0.01 M  || H   0.1 M  | H 2  0.01 atm  | Pt
1) 0.03 V 2) – 0.088 V 3) – 0.03 V 4) 0.088 V
99. Weight of magnesium deposited by passing 1.5 F electricity through molten
MgCl2, at cathode is _________g.
1) 0 2) 36 3) 18 4) 9
(A) Hormones (I) Peptide bonds
(B) Proteins (II) Biocatalysts
(C)
.
Enzymes (III) Message carriers
.
(A) (B) (C) (A) (B) (C)

1) I II III 2) III II I
3) III I II 4) II I III
BOTANY
SECTION – A
101. Identify the wrong statement w.r.t kingdom plantae
1) It is a multicellular, prokaryotic, autotrophic kingdom with absorptive mode of
nutrition.
2) A few members are partially heterotrophic such as insectivorous plants and
parasites
3) Bladderwort, Venus flytrap are the examples of insectivorous plants
4) Cell wall is mainly made up of cellulose.
102. Kingdom Animalia is characterized by
1) Multicellular eukaryotic heterotrophs
2) Animals show holozoic nutrition
3) Higher forms of animals show elaborate sensory and neuromotor system
4) All of these
(A) Diploid phase (I) Gametophyte
(B) Haploid phase (II) Meiosis
(C) Haploid → Diploid (III) Sporophyte
.
(D) Diploid → Haploid (IV) Fertilization
(A) (B) (C) (D) (A) (B) (C) (D)
.
3) III II I IV 4) II I III IV
(A) Trichoderma (I) Free living nitrogen fixing bateria
(B) Streptomyces (II) Biocontrol agent
(C) Azospirillum (III) Free living nitrogen fixing cyanobacteria
.
(D) Anabaena (IV) Source of antibiotic
.
(A) (B) (C) (D) (A) (B) (C) (D)

1) II III IV I 2) II IV I III
3) III I II IV 4) IV II I III
105. Organic farming does not include.
1) Green manures 2) Chemical fertilisers
3) Farmyard manures 4) Compost

106. Biopesticides are
1) The chemicals which are used to destroy the pests.
2) The organisms which destroy the crops.
3) The living organism (or) their products which are used for the pest control.
4) All the above.
1) The predominant stage of the life cycle of a moss is the gametophyte.
2) In Mosses gametophytic stage has two stages.
3) The Mosses gametes are germinate to form free-living gametophytes.
4) The gametophyte first stage is the protonema stage, and second stage is leafy
stage respectively.
108. Study the following statements regarding the gymnosperms?
I) Gymnosperms are heterosporous, naked seeded plants.
II) The strobili bearing microsporophylls and microsporangia are called male
strobili.
III) The microspores develop into a female gametophytic generation which is
highly reduced and is confined to only a limited number of cells.
IV) The development of pollen grains take place within the microsporangia.
1) Funaria, Polytrichum and Sphagnum sporophytic stage depends on
gametophytic generation.
2) Floridean starch similar to amylopectin and glycogen in structure.
3) Ulothrix, Spirogyra have non flagellated zoospores.
4) Laminaria, Sargassum and Fucus have zoospores that are pear-shaped and
have two unequal laterally attached flagella
110. Bio reactors are useful in
1) Separation and purification of a product
2) Processing of large volumes of culture
3) Micro injection 4) Isolation of genetic information
111. Stirred tank bioreactors have been designed for
1) Purification of product 2) Addition of preservatives to the product
3) Availability of oxygen throughout the process
4) Ensuring anaerobic conditions in the culture vessel
112. Which of the following is not a component of down stream processing?
1) Separation 2) Purification 3) Preservation 4) Expression
113. Statement-I: Small volume cultures can yield appreciable quantities of products
Statement-II: Bioreactors can be thought of as vessels in which raw materials
are biologically converted into specific products
2) Statement-I is false, Statement-true
Column-I Column-II
p) RNA i) Pectinase
q) Histone ii) Ribonuclease
r) Pectin iii) Cellulase
s) Cell wall iv) Protease
1) p-i, q-ii, r-iii, s-iv 2) p-iv, q-iii, r-ii, s-i
3) p-ii, q-iv, r-iii, s-i 4) p-ii, q-iv, r-i, s-iii
115. Cymose inflorescence is a feature of
1) Radish 2) Lupin 3) Solanum 4) Brassica
116. Perigynous flowers are found in all except
1) Plum 2) China rose 3) Peach 4) Rose
117. Read the following statements and identify incorrect one.
1) The sterile stamen is called staminode
2) When stamens are united into two bundles it is called diadelphous condition
3) Ovary bears one (or) more ovules attached to a flattened cushion-like placenta
4) When more than one carpel is present, they may be free and are called as
syncarpous

List-I (Example) List-II (Family)
A) Thespesia (I) Cruciferae
B) Sugarcane (II) Compositae
C) Helianthus (III) Poaceae
`
`
D) Turnip (IV) malvaceae
A B C D A B C D
1) IV II I III 2) II III IV I
3) IV III II I 4) IV I II III
119. In prokaryotic translation, the formation of peptide bond between two amino
acids is catalysed by a
1) Proteinaceous enzyme 2) Lysozyme
3) RNA catalyst 4) Ribonuclease
120. The lac operon of E.coli gets switched on when
1) Repressor binds to the operator
2) Lactose binds to the RNA polymerase
3) Lactose binds to the repressor protein
4) Inducer binds to the operator
121. If the anticodon sequence in tRNA is 3' AAA5' , the amino acid carried by it, is
1) Serine 2) Valine 3) Phenylalanine 4) Glutamic acid
122. If the sequence of nitrogenous bases of the coding strand of DNA in a
transcription unit is 5' ATGGCCAT 3'
Then the sequence of bases in its RNA transcript would be
1) 3' AUGGCCAU  5' 2) 3' UACCGGUA  5'
3) 5' AUGGCCAU  3' 4) 5' UACCGGUA  3'
123. On one strand of DNA, its discontinuous synthesis is seen, because
1) It is more efficient process
2) DNA polymerase catalyses polymerization only in one direction i.e. 5' 3'
3) It is energy independent process
4) DNA molecule is very long to be synthesized in a continuous fashion
124. Select the true statement(s) for AUG
A) It codes for an amino acid methionine.
B) It is an initiation codon.
C) It terminates polypeptide chain.
1) Only A 2) Only A and B 3) Only B and C 4) All A, B and C
125. Vascular bundles of roots are
1) Conjoint 2) Concentric 3) Bicollateral 4) Radial
126. Assertion : In winter the cambium is produces fewer xylary elements that have
narrow vessels.
Reason : In winter the cambium is less active.
127. The anatomy of springwood shows some peculiar features. Identify the correct
set of statements about springwood.
(a) It is also called as the earlywood
(b) In spring season cambium produces xylem elements with narrow vessels
(c) It is lighter in colour
(d) The springwood along with autumnwood shows alternate concentric rings
forming annual rings
(e) It has lower density
1) (a),(c),(d) and (e) Only 2) (a), (b) and (d) Only
3) (c), (d) and (e) Only 4) (a),(b),(d) and (e) Only
128. In a test cross involving F1 hybrid their more parental-type offsprings were
produced than the recombinant-type offspring. This indicates
1) Both of the characters are controlled by more than one gene.
2) The two genes are located on two different chromosomes.
3) Chromosomes jointed to separate during meiosis
4) The two genes are linked and present on the same chromosomes

129. (A) used the frequency of recombination between gene pairs on the B as a
measure of the distance between genes and mapped their position on the
chromosome.
(A) (B)
1) Morgan Same chromosome
2) Sturtevant Different chromosomes
3) Morgan Different chromosomes
4) Sturtevant Same chromosomes
130. Which of the following nucleic acids is present in an organism having 70S
ribosomes only?
1) Single stranded DNA with protein coat
2) Double stranded circular naked DNA
3) Double stranded DNA enclosed in nuclear membrane
4) Double stranded circular DNA with histone proteins.
131. Physical association of genes on a chromosome is termed as
1) Linkage 2) Recombination 3) Mutation 4) Crossing over
132. The law of dominance is applicable in inheritance of
1) seed colour in pea 2) flower colour in Mirabilis jalapa
3) starch grain size in pea 4) both 2 and 3
133. Statement I : Membrane proteins can be classified as integral or peripheral.
Statement II : Peripheral proteins lie on the surface of membrane while the
integral proteins are partially or totally buried in the membrane.
given below:
134. Match the following columns and identify the correct combination:
Column-I Column-II
A. Mycoplasma (i) 7.0 μm
B. Human erythrocyte (ii) 0.1 μm
C. Typical bacteria (iii) 0.3 μm
D. PPLO (iv) 1-2 μm
1) A-ii B-i C-iv D-iii 2) A-iii B-i C-iv D-ii
3) A-iii B-iv C-i D-ii 4) A-ii B-iv C-i D-iii
135. Example of polyploid tissue present in an angiosperm plant is:-
1) Perisperm 2) Embryo 3) Tapetum 4) Placenta
SECTION – B
136. Embryosac is represented by :-
1) Megagametophyte 2) Megasporophyll
3) Microgametes 4) Megaspore
137. Wind pollinated flowers are :-
1) Small, producing nectar and dry pollen
2) Small, brightly coloured, producing large number of pollen grains
3) Small, producing large number of dry pollen grains
4) Large, producing abundant nectar and pollen
138. What would be the number of chromosomes of the aleurone cells of a plant with
42 chromosomes in its root tip cells?
1) 42 2) 63 3) 84 4) 21
139. Which one of the following option is correct?
1) DNA has evolved from RNA with chemical modifications
2) DNA being complementary double-stranded resists changes by a process of
repair
3) RNA being a catalyst is reactive and unstable
4) All of the above

140. Statement –I : A general rule of thumb is that rate doubles (or) denature of
enzyme by half for every 10o C change in only one direction.
Statement –II : Catalysed reactions proceed at rates vastly higher than that of
un catalysed ones.
141. Secondary growth in dicotyledonous plants and gymnosperms is due to
1) Intercalary and apical meristem
2) Vascular cambium and cork cambium
3) Apical meristem and vascular cambium
4) Cork cambium and apical meristem
142. Which of the following hormones show synergistic effect in the initiation of
flowering in pineapple?
1) Cytokinins and Ethylene 2) Ethylene and ABA
3) Auxins and Ethylene 4) Auxins and Cytokinins
143. Statement – I: Cytokinin help to produce new leaves.
Statement – II : Cytokinin help in shoot growth and cannot show influence on
adventitious shoot formation.
144. Identify the plant cell in which mitosis does not occur?
1) seta in sporophyte 2) Gemmae of Marchantia
3) main plant body of bryophyte 4) megaspore mother cell in ovule
145. Identify triploid among the following :
1) Egg cell 2) Secondary nucleus
3) Aleurone layer 4) Integuments
146. In addition to the 12 molecules of NADPH(H+), the energy required for the
synthesis of one molecule of hexose by C3 and C4 pathway is–
1) 18 & 18 molecules of ATP respectively
147. The function of ATP in photosynthesis is the transfer of energy from the :-
1) Dark reaction to the light reaction 2) Light reaction to the dark reaction
3) Chloroplasts to mitochondria 4) Mitochondria to chloroplasts
148. In Kranz anatomy, the bundle sheath cells have: -
1) thick walls, many intercellular spaces and few chloroplasts
2) thin walls, many intercellular spaces and no chloroplasts.
3) thick walls, no intercellular spaces and large number of chloroplasts.
4) thin walls, no intercellular spaces and several chloroplasts
149. Respiration is defined as –
1) Formation of C – C bonds of complex compound
2) Breaking of C – C bonds of complex compound
3) Breaking of C – N bonds of complex compound
4) All of the above
150. What is the net gain of ATP from one molecule of glucose in one complete
glycolysis?
1) 4 2) 3 3) 5 4) 2
ZOOLOGY
SECTION – A
151. In a population of 1000 individuals 360 belong to genotype AA, 480 to Aa and the
remaining 160 to aa. Based on this data, the frequency of allele A in the
population is :
1) 0.5 2) 0.6 3) 0.7 4) 0.4

152. Identify the odd one from the following
1) Zoological parks 2) Wild life safari parks
3) Wild life sanctuaries 4) Botanical gardens
153. Frog is called an amphibian because :
1) It has no tail 2) It has got lungs
3) It lives both on land and in water
4) It’s young one, tadpole, is terstrial in its habitat
154. Number of spiracles in cockroach are
1) 2 pairs in thorax and 8 pairs ion abdomen
2) 3 pairs in thorax and 7 pairs in abdomen
3) 3 pairs in thorax and 9 pairs in abdomen
4) 1 pair in thorax and 6 pairs in abdomen
155. Which part of the brain provide additional space for many more neurons.
1) Medulla oblongata 2) Cerebral hemispheres
3) Cerebellum 4) Limbic system
156. Species interaction with negative influence on both is referred to as
1) Amensalism 2) Mutualism 3) Commensalism 4) Competition
157. Many collecting ducts converge and open into the________ through medullary
pyramids in the calyces.
1) Renal pelvis 2) Renal cortex 3) Vasa recta 4) Convoluted tubules
158. The excretory organs of prawan are :
1) Kidneys 2) Nephridia 3) Green glands 4) Malpighian tubules
159. Which of the following is expected if husband is Rh+ and wife is Rh-?
1) No problem in the first pregnancy 2) Problems in future pregnancies
3) Both (1) and (2) 4) Problem in first pregnancy only
160. A widely used diagnostic test for AIDS is
1) Widal test 2) Serum analysis 3) ELISA 4) All of these
161. Side effects of chemotherapeutic drugs are :
Stomach pain, Hair loss, Diarrhoea, Constipation, Anaemia, Headache.
1) Two 2) Three 3) One 4) Four
162. The side effects of anabolic steroids in females are
1) Normal menstrual cycle 2) Breast enlargement
3) Masculinisation 4) Rise in academic performance
163. The shortest and longest periods of menstrual cycle in a healthy human female
respectively.
1) Ovulation and luteal phase 2) Follicular and luteal phase
3) Luteal and ovulatory phase 4) Menstruation and luteal phases
164. Members of the phylum Porifera are :
1) All marine 2) All freshwater
3) Mostly freshwater and few marine 4) Mostly marine and few freshwater
165. Which of the following is not under the control of pituitary?
1) Ovary 2) Thyroid 3) Adrenal cortex 4) Adrenal medulla
166. Following is diagrammatic representation of the mechanism of action of a steroid
hormone. Which of the given options correctly describes the labeled events?
1) I-Hormone, II-second messenger 2) I-Hormone, III-nucleus

3) II-Hormone-receptor complex, IV-DNA 4) II-Second messenger, IV-mRNA
167. In XO type of sex determination
1) Females produce two different types of gametes
2) Male produce two different types of gametes
3) Females produce gametes with Y chromosomes
4) Male produce single type of gametes

168. Chooose the correct order for the path way of sperm from the testes to outside
the body
1) Vas deferens – epididyms – ejaculatory duct – penis
2) Epididymis – Vas deferens – ejaculatory duct – penis
3) Ejaculatory duct – Vas deferens – epididymis – penis
4) Penis – ejaculatory duct – epididymis – Vas deferens
169. Approximately how much of the solar energy that falls on the leaves of plant is
converted to chemical energy by photosynthesis?
1) Less than 1% 2) 2-10% 3) 30% 4) 50%
170. “Saheli” contraceptive oral pill was developed at:
1) Department of Biotechnology, New Delhi
2) CDRI, Lucknow
3) NEERI, Nagpur
4) Department of Molecular Biology, Hyderabad
171. Which of the following ‘suffixes’ used for units of classification in plants indicates
a taxonomic category of ‘family’?
1) –ales 2) –onae 3) –aceae 4) –ae
172. Exchange of O2 & CO2 by simple diffusion over their entire body surface is takes
place in all of the following animals except _______
1) Sponges 2) Coelenterates 3) King crab 4) Flatworms
173. Number of bones in human appendicular skeleton is :
1) 80 2) 126 3) 120 4) 142
174. Statement A : Transgenic animals are now used in toxicity testing of various
toxic chemicals.
Statement B : Such animals carry genes which make them more sensitive to
toxic substances.
1) A and B are true 2) A and B are false
3) A is true but B is fasle 4) A is false but B is true
175. Variation in gene frequencies within populations can occur by chance rather than
by natural selection. This is referred to as :
1) Genetic drift 2) Random mating 3) Natural selection 4) Gene flow
176. The IUCN red list documents the extinction of ________ vertebrates in the last 500
years.
1) 359 2) 784 3) 87 4) 338
177. In cockroach, a ring of 6-8 blind tubules called hepatic/gastric caeca are present
at
1) Foregut 2) Hindgut
3) Midgut 4) Junction of foregut and midgut
178. Commensalism is the interaction in which
1) One species benefits and other is neither harmed nor benefited
2) One species do not benefits and other is harmed
3) One species do not benefits and other is not harmed
4) One species benefits and other is also benefited
179. In human heart, the inter atrial septum is __________
1) Thick and fibrous wall 2) Thin and muscular wall
3) Thin and fibro-cartilaginous wall 4) Thick and cartilaginous wall
180. Which part of the nephron is impermeable to water :
1) PCT 2) Deascending limb of Henle’s loop
3) DCT 4) Ascending limb of Henle’s loop
181. Which of the following hormones is not secreted by human placenta?
1) hCG 2) Estrogens 3) Progesterone 4) LH
182. Flame cells are associated with :
1) Excretion 2) Nutrition 3) Respiration 4) Digestion
183. Canal system of Porifera is concerned with :
1) Food collection 2) Respiration 3) Excretion 4) All of these

Column-I Column-II
A) BAC (I) A type of methodology to
sequence genome
B) Chromosome-1 (II) Most number of genes
C) Repetitive DNA (III) A cloning vector
D) Sequence annotation (IV) Non coding DNA sequence
Codes :
A B C D A B C D
1) I II III IV 2) II III I IV
3) III II IV I 4) IV III II I
185. Following is the diagrammatic view of the position of endocrine glands. Select the
option that correctly labels the glands and their respective hormones.
1) I - Thyroid gland - Thyroxine and TSH

2) II - Parathyroid gland - PTH
3) II - Thyroid gland - Thyroxine and calcitonin
4) I - Parathyroid gland - PTH and calcitonin
SECTION – B
186. Genes with multiple phenotypic effects are known as
1) Hypostatic genes 2) Duplicate genes
3) Pleotropic genes 4) Complementary genes
187. Tall stature with feminised character, short stature and under developed
feminine character are related (respectively) to
1) Down’s syndrome, Turner’s syndrome
2) Turner’s syndrome, Down’s syndrome
3) Klinefelter’s syndrome, Turner’s syndrome
4) Turner’s syndrome, Acron egaly
188. In the equation GPP – R = NPP, R represents :
1) Respiration losses 2) Radiant energy
3) Retardation factor 4) Environmental factor
189. Vertical distribution of different species occupying different levels is called
stratification. In a forest trees occupying which strata or layer?
1) Top layer 2) Middle or second layer
3) Bottom layer 4) Both 2 and 3
190. Statement-I: During inspiration, intrapulumnary pressure decrease.
Statement-II:There is a rise in volume of thorax during inspiration.
191. Respiratory mechanism is controlled by
1) Respiratory rhythm centre 2) Sympathetic nervous system
3) Parasympathetic nervous system 4) Autonomic nervous system
192. Which of the following is not a placental mammal?
1) Numbat 2) Lemur 3) Bobcat 4) Wolf
193. As a method of cellular defence, RNAi takes place in
1) All prokaryotic organisms, 2) All Eukaryotic organisms
3) Both prokaryotic and Eukaryotic organisms 4) Few Eukaryotic organisms

194. Assertion (A) : According to Darwin, the fitness refers ultimately and only to
reproductive fitness.
Reason(R): Those who are better fit in an environment, leave more progeny than
others, therefore, will surive more and hence are not selected by nature.
195. Medulla oblongata contain centres that control :
1) Respiration 2) Cardiovascular reflexes
3) Gastric secretions 4) All of these
196. From atria _____ % of blood passively flows to ventricles
1) 30 2) 70 3) 50 4) 10
197. Amniocentesis can be used to detect all the listed diseases except
1) Haemophilia 2) Malaria 3) Sickle cell anemia 4) Down’s syndrome
198. When muscle is in the resting state, which of the following masks the active
binding sites for myosin?
1) Troponin 2) Myosin 3) F-actin 4) M-Line
199. Which of the following is considered a hot-spot of biodiversity in India?
1) Western ghats 2) Indo-Gangetic plain
3) Eastern ghats 4) Aravalli hills
200. _________ and _______ infections are chronic infections and ultimately fatal
1) HIV and Hepatitis - B 2) Malaria and Typhoid
3) HIV and Typhoid 4) Common cold and Pneumonia
*******

: ANSWER KEY:
SET-1 SUB: PHYSICS
1 4 11 1 21 3 31 1 41 2
2 3 12 2 22 1 32 4 42 3
3 2 13 1 23 1 33 1 43 3
4 4 14 2 24 4 34 4 44 2
5 3 15 2 25 2 35 2 45 3
6 3 16 4 26 1 36 1 46 3
7 1 17 2 27 3 37 1 47 1
8 4 18 2 28 2 38 1 48 1
9 1 19 1 29 3 39 2 49 3
10 2 20 3 30 2 40 4 50 3
SUB:CHEMISTRY
51 2 61 4 71 4 81 1 91 2
52 1 62 1 72 1 82 4 92 4
53 2 63 1 73 1 83 2 93 3
54 3 64 1 74 3 84 3 94 2
55 4 65 1 75 4 85 4 95 1
56 3 66 4 76 3 86 4 96 1
57 2 67 1 77 4 87 4 97 4
58 1 68 1 78 2 88 2 98 4
59 2 69 4 79 1 89 1 99 3
60 2 70 2 80 2 90 1 100 3
SUB : BOTANY
101 1 111 3 121 3 131 1 141 2
102 4 112 4 122 3 132 1 142 3
103 2 113 2 123 2 133 1 143 3
104 2 114 4 124 2 134 2 144 4
105 2 115 3 125 4 135 3 145 3
106 3 116 2 126 1 136 1 146 3
107 3 117 4 127 1 137 3 147 2
108 4 118 3 128 4 138 2 148 3
109 3 119 3 129 4 139 4 149 2
110 2 120 3 130 2 140 4 150 4
151 2 161 1 171 3 181 4 191 1
152 3 162 3 172 3 182 1 192 1
153 3 163 1 173 2 183 4 193 2
154 1 164 4 174 1 184 3 194 3
155 3 165 4 175 1 185 2 195 4
156 4 166 2 176 4 186 3 196 2
157 1 167 2 177 4 187 3 197 2
158 3 168 2 178 1 188 1 198 1
159 3 169 2 179 2 189 1 199 1
160 3 170 2 180 4 190 1 200 1

NEET GRAND TEST - 1
answer sheet.
CORRECT.
Section-B;
Marking Scheme :

PHYSICS
SECTION – A
1. A resistor of 4k with tolerance 10% is connected in parallel with a resistor of
6 k with tolerance 10%. The tolerance of the series combination is nearly
1) 10% 2) 20% 3) 30% 4) 40%
2. When a current carrying coil is situated in a uniform magnetic field with its
magnetic moment antiparallel to the field.
(i) Torque on it is maximum (ii) Torque on it is minimum
(iii) PE of loop is maximum (iv) PE of loop is minimum
3) only iii and iv are true 4) only i, ii and iii are true

3. A projectile is launched with an initial velocity v0   2m / s  iˆ   3m / s  ˆj . At the top of
trajectory, the velocity of the particle will be
1) 22  32 m/s 2) 2m/s 3) 3m/s 4) 5m/s
4. ˆ ˆ ˆ ˆ
The angle between the vectors 2i  3 j  k and 6i  9 j  3k isˆ ˆ
1) 18 0o 2) 90o 3) 30o 4) 60 o
5. Acceleration A planar coil having 15 turns carries 20A current. The coil is
oriented with respect to the uniform magnetic field B  0.5iˆ T such that its
directed area is A  0.04iˆ m2 . The potential energy of the coil in the given
orientation is
1) 0 2) +0.72J 3) 6J 4) -1.44J
6. The X and Y components of a force F acting at 30 to x-axis are respectively:
0
F F F 3 3 1
1) F , 2) ,F 3) , F 4) F, F
2 2 2 2 2 2
7. The unit of magnetic flux is
1) Weber / m 2 2) Weber 3) Henry 4) Ampere/m
8. Kinetic energy of a particle is increased by 4 times. What will be the relation
between initial and final momentum?
p
1) p2  2 p1 2) p2  1 3) p2  p1 4) p2  4 p1
2
9. A child swinging on swing in sitting position stands up. The time period of the
swing will
1) increase 2) decrease
3) remain same 4) increase if the child is tall and decrease if the child is short
10. An instantaneous displacement of a simple harmonic oscillator is
x  A cos t   / 4  . Its speed will be maximum at time
1) /4 2) /2 3) / 4) 2/
11. A centigrade and a Fahrenheit thermometers are dipped in boiling water. The
water temperature is lowered until the Fahrenheit thermometer registers 140o.
What is the fall in temperature as registered by the centigrade thermometer?
1) 30o 2) 40o 3) 60o 4) 80o
.
(A) AC generator (I) Presence of both L and C
.
(B) Transformer (II) Eelectromagnetic induction

(C) Resonance phenomenon to occur (III) Quality factor
(D) Sharpness of resonance (IV) Mutual inductance
(A) (B) (C) (D) (A) (B) (C) (D)
1) IV II I III 2) II I III IV
3) II IV I III 4) IV III I II
13. When the momentum of a proton is changed by an amount P0, the corresponding
change in the de-Broglie wavelength is found to be 0.25%. Then, the original
momentum of the proton was
1)p0 2) 100 p0 3) 400 p0 4) 4 p0
14. If Q, E and W denote respectively the heat added change in internal energy and
the work done in a closed cycle process, then
1) W = 0 2) Q = W = 0 3) E = 0 4) Q = 0

15. At constant volume, temperature is increased. Then
1) Collision on walls will be less
2) Number of collisions per unit time will increase
3) Collisions will be in straight lines
4) Collisions will not change
16. Consider a mixture of oxygen and hydrogen kept at room temperature. As
compared to a hydrogen molecule an oxygen molecule hits the wall.
1) with greater average speed 2) with smaller average speed
3) with greater average kinetic energy 4) with smaller average kinetic energy
17. Two wires are made of the same material and have the same volume. The first
wire has cross-sectional area A and the second wire has cross-sectional area 3A.
If the length of the first wire is increased by l on applying a force F, how much
force is needed to stretch the second wire by the same amount?
1) 9F 2) 6F 3) 4F 4) F
18. The Young’s modulus of steel is twice that of brass. Two wires of same length
and of same area of cross section, one of steel and another of brass are
suspended from the same roof. If we want the lower ends of the wires to be at the
same level, then the weights added to the steel and brass wires must be in the
ratio of
1) 4 : 1 2) 1 : 1 3) 1 : 2 4) 2 : 1
19. Assertion (A): Kerosene Oil spreads out over water surface.
Reason (R): Surface tension is a surface phenomenon.
20. Assertion (A): Detergents should have small angles of contact.
Reason (R): If angle of contact is small therefore detergents rises the clothes dust
in less time.
21. Energy levels A,B,C of a certain atom correspond to increasing value of energy
i.e., E A  E B  EC . If 1 , 2 , 3 are the wavelengths of radiations corresponding to
the transitions C to B, B to A and C to A respectively. Which of the following
statements is correct?
12
1) 3  1  2 2) 3  3) 1  2  3  0 4) 32  12  22
1  2
22. A body of weight 72N moves from the surface of earth at a height half of the
radius of earth, then gravitational force exerted on it will be
1) 36N 2) 32N 3) 144N 4) 50N
23. The displacement y of a wave travelling in the x-direction is given by
 
y  104 sin  600t  2 x   metre, where, x is expressed in metres and t in seconds.
 3
The speed of the wave-motion, in ms 1 is
1) 300 2) 600 3) 1200 4) 200
24. The probability of electrons to be found in the conduction band of an intrinsic
semiconductor at a finite temperature.
1) increases with increasing band gap
2) decreases with increasing band gap
3) decreases with increasing temperature
4) is independent of the temperature and band gap

25. Two particles which are initially at rest, move towards each other under the action
of their internal attraction. If their speeds are v and 2v at any instant, then the
speed of centre of mass of the system will be :-
1) v 2) 2v 3) Zero 4) 1.5v
26. If the earth were to suddenly contract to half its present size, without any change
in its mass, the duration of the new day will be
1) 18 hours 2) 30 hours 3) 6 hours 4) 12 hours
27. If a number of images of a candle flame are seen in a thick mirror, then
1) The first image is the brightest 2) The second image is the brightest
3) The last image is the brightest 4) The image are equally bright
28. A bird flying high up in air does not cast shadow in the ground because
1) The distance of bird large from earth
2) the size of the bird is smaller than earth
3) light rays fall almost normally on the bird
4) none of the above
29. In Young’s double slit experiment a slit is covered with thin film so that the
optical path difference introduced between coherent waves is 5. Then the new
position of central maxima will be at
1) The initial position of 5th maxima 2) The initial positon of 3rd minima
3) The initial position of 2nd minima 4) The initial position of 3rd maxima
30. The largest and the shortest distance of the earth from the sun are r1 and r2. Its
distance from the sun when it is at perpendicular to the major axis of the orbit
drawn from the sun is
r r r r 2r r r r
1) 1 2 2) 1 2 3) 1 2 4) 1 2
4 r1  r2 r1  r2 3
31. Two spherical conductors B and C having equal radii and carrying equal charges
in them repel each other with a force F when kept apart at some distance. A third
spherical conductor having same radius as that of B but uncharged is brought in
contact with B, then brought in contact with C and finally removed away from
both. The new force of repulsion between B and C is
1) F/4 2) 3F/4 3) F/8 4) 3F/8
32. Assertion (A) : If the bob of a simple pendulum is kept in a horizontal electric
field, its period of oscillation will remain same.
Reason (R) : The bob is charged and kept in horizontal electric field, then the
time period must be decreased.
33. An uncharged capacitor is connected to a battery. On charging the capacitor.
1) All the energy supplied is stored in the capacitor
2) Half the energy supplied is stored in the capacitor
3) The energy stored depnds upon the capacity of the capacitor only
4) The energy stored depends upon the time for which the capacitor is charged
34. In case of parallel plate capacitor, the field will not be uniform at the outer edges
of the plates. This is called,
1) Frogging 2) Fringing 3) Jumping 4) Polarizations
35. 10,000 electrons are passing per minute through a tube of radius 1cm. The
resulting current is :
1) 10000A 2) 0.25 1016 A 3) 109 A 4) 0.5 1019 A
SECTION – B
36. There are 8.4 1022 free electrons per cm3 in copper. The current in the wire is
0.21A  e  1.6  10 19
C . Then the drifts velocity of electrons in a copper wire of
1 mm2 cross section, will be :
1) 2.12 105 m/s 2) 0.78 105 m/s 3) 1.56 105 m/s 4) None of these

37. The specific resistance  of a circular wire of radius r. Resistance R and length l
 r2R
is given by   . Given  r  0.24  0.02  cm, R =  30  1  and l   4.80  0.1 cm .
l
The percentage error in  is nearly
1) 7% 2) 9% 3) 13% 4) 20%
1
38. The magnetic field at a distance x on the axis of a circular coil of radius R is th
8
of that at the centre. The value of x is
R 2R
1) 2) 3) R 3 4) R 2
3 3
39. The mathematical equation for magnetic field lines of force is
1) .B = 0 2) .B0.l 3) .B > 0 4) .B < 0
40. Five objects of different masses are simultaneously released vertically downwards
from height ‘h’ (in air). Which physical quantity associated with the objects will
change at the instant they strike the ground?(neglect the air resistance.)
1) Time 2) Momentum 3) Velocity 4) Acceleration
41. A coil of area 100 cm has 500 turns. Magnetic field of 0 .1 weber / metre 2 is
2
perpendicular to the coil. The field is reduced to zero in 0.1 second. The induced
e.m.f. in the coil is
1) 1 V 2) 5 V 3) 50 V 4) Zero
42. A body moves from point A to B under the action of a force varying in magnitude
as shown in figure, then the work done is (force is expressed in newton and
displacement in metre)
1) 30J 2) 22.5J 3) 25J 4) 27J

43. A constant volume gas thermometer shows pressure reading of 50 cm and 90 cm
of mercury at 0oC and 100oC, respectively. When the pressure reading is 60 cm
of mercury, the temperature is
1) 25oC 2) 40oC 3) 15oC 4) 12.5oC
44. A series LCR circuit is connected to an ac source of 220V, 50 Hz. The circuit
contain a resistance R  100 and an inductor of inductive reactance
X L  79.6  . The capacitance of the capacitor needed to maximize the average
rate at which energy is supplied will be _______  F
1) 30 2) 20 3) 40 4) 50
45. During an isothermal expansion, a confied ideal gas does -150J of work against
its surroundings. This implies that
1) 300J of heat has been added to the gas
2) no heat is transferred because the process is isothermal
3) 150J of heat has been added to the gas
4) 150J of heat has been removed from the gas
46. A proton and an -particle are accelerated through a potential difference of 100
V. The ratio of the wavelength associated with the proton to that associated with
an -particle is
1) 2 : 1 2) 2 : 1 3) 2 2 : 1 4) 1 : 1
2 2
47. In Young’s double slit experiment using a light of wavelength ‘’, 60 finges are
seen on a screen. If the wavelength of light is decreased by 50% then the number
of fringes on the same screen will be
1) 30 2) 60 3) 120 4) 90

48. According to Bohr’s postulates which of the following quantities takes discrete
values:
1) Kinetic energy 2) Potential energy 3) Angular momentum 4) Momentum
49. If the energy of a photon of sodium light ( = 589 nm) equals the band gap of
semiconductor, the minimum energy required to create electron hole pair
1) 1.1 eV 2) 2.1 eV 3) 3.2 eV 4) 1.5 eV
50. When two tuning forks (fork 1 and fork 2) are sounded simultaneously, 4 beats
per second are heard. Now, some tape is attached on the prong of the fork 2.
When the tuning forks are sounded again, 6 beats per second are heard. If the
frequency of fork 1 is 200 Hz, then what was the original frequency of fork 2?
1) 200 Hz 2) 202 Hz 3) 196 Hz 4) 204 Hz
CHEMISTRY
SECTION – A
51. Considering 80% dissociation of electrolyte, the boiling point of 1.4 molal
aqueous AlCl3 solution is ______K. [Given Kb for H2O  0.52 K.mol1 kg and B.P. of
pure H 2O  100o C ]
1) 102.48 2) 375.48 3) 374.912 4) 102.912
52. Assertion (A): In water oxygen is more soluble at 298K than at 308K.
Reason (R) : As temperature increases Henry’s law constant (KH) decreases.
the assertion
53. HCHO and C6H5CHO can be distinguished from each other by the use of
1) Fehling’s solution 2) ammonical silver nitrate solution
3) Sodium Carbonate 4) alkaline KMnO4 solution
In the following electronic configuration ns 2  n  1 d  n  2  f 114 . If the value of
0 1
54.
(n-1)=6. Then the given general electronic configuration belongs to
1) Landhanides 2) d-block 3) Actinides 4) s-block
55. Among the following pairs of elements, the pair that is different from others is
1) Li and Mg 2) N and P 3) Be and Al 4) B and Si
56. The correct IUPAC name of (C2H5)4C is
1) tetra ethyl methane 2) 2 – ethyl pentane
3) 3,3 – Diethyl pentane 4) 2,2 – Dimethylpentane
57. If the solubility product of MOH is 1 1010 mol 2 .dm2 , then the pH of saturated
aqueous MOH solution will be
1) 12 2) 9 3) 6 4) 3
58. For an electron to have the same de Broglie wave length as that of Deuteron, its
velocity should be ______ times that of Deuteron.
1) 1836 2) 1/1836 3) 3672 4) 1/3672
59. At room temperture the eclipsed and the staggered forms of ethane cannot be
isolated because :
1) both the conformers are equally stable
2) they interconvert rapidly at room temperature.
3) there is a large energy barrier of rotation about the -bond
4) the energy difference between the conformers is larger
60. Azodye test is used for the identification of
1) Aliphatic - 1o -amine 2) Aromatic - 1o -amine
o
3) Aromatic - 2 -amine 4) Aliphatic - 2 o -amine
61. Red coloured compound formed by ethyl alcohol with cerric ammonium nitrate is
1) (C2H5)2Ce(NO3)6 2) (C2H5)2Ce(NO3)4 3)(C2H5OH)2Ce(NO3)4 4)(C2H5OH)2Ce(NO3)6
62. Which reagent is used to precipitate SO42 and Cl  ?
1) NaOH 2) Pb(NO3)2 3) BaSO4 4) KOH

63. Give the correct order of initial T or F for following statements.
(i) The order of repulsion between different pair of electrons is lp–lp>lp–bp>bp–bp.
(ii) In general as the number of lone pair of electrons on central atom increases,
value of bond angle from normal bond angle also increases.
(iii) The number of lone pair on O in H2O is 2 while on N in NH3 is 1.
(iv) The structures of xenon fluorides and xenon oxyfluorides could not be
explained on the basis of VSEPR theory.
1) T T T T 2) T F T F 3) T F T T 4) T F F F
64. The correct order of bond strength of N2(I), N 2  II  , N 2  III  is
 2
1) I > II > III 2) I > III > II 3) I < II < III 4) III CaO > BaO → Lattice energy
2) NaCl > MgCl2 > AlCl3 → Ionic character
3) NaCl > NaBr > NaI → Dipole moment
4) NH3 < PH3 < AsH3 → Bond angle
66. Statement –1 : Order of nucleophilicity of halides in polar protic solvent follows :
𝐼 ⊝ > 𝐵𝑟 ⊝ > 𝐶𝑙 ⊝ > 𝐹 ⊝
Statement –2 : In polar protic solvent anions are not solvated while in polar
aprotic solvent they are solvated.
for Statement-1
67. Statement –1 : is having higher heat of hydrogenation than
Statement –2 : 1st compound contains two -bonds while 2nd compound has
only one -bond.
for Statement-1
68. Assertion : In 2nd period elements, the p-block elements boron, carbon and
nitrogen show maximum covalency of 4 using 3s and 3p-orbitals.
Reason : In 2nd period elements d-orbitals are not present.
of Assertion
69. The IVA group element with highest & lowest first ionisation potential values.
1) C, Pb 2) C, Sn 3) C, Si 4) Si, Pb
70. The alkene R–CH = CH2 reacts readily with B2H6 and on oxidation with alkaline
hydrogen peroxide produces
71. In the reaction : CH 2  CH 2 

Hypochlorous
acid
 A , what is A?
1) CH 3CH 2OH 2) CH 3  CH3 3) CH3CH2Cl 4) CH 2 Cl  CH 2 OH
72.

73. A mixture of 1.0 mole of Al and 3.0 mole of Cl2 are allowed to react as :
2Al (s) + 3Cl2 (g)  2AlCl3 (s)
(a) Which is limiting reagent ?
(b) How many moles of AlCl3 are formed
(c) Moles of excess reagent left unreacted is
(1) (a) Al, (b) 1.0 (c) 1.5 (2) (a) Cl2, (b) 2.0 (c) 2.0
(3) (a) Al, (b) 0.5 (c) 1.5 (4) (a) Cl2, (b) 1.0 (c) 1.5
74. Volume of CO2 obtained at STP by the complete decompoisition of 9.85 g. BaCO3
is – (At. wt. of Ba = 137)
(1) 2.24 lit (2) 1.12 lit (3) 0.84 lit (4) 0.56 lit
75. Assertion (A) : Reaction of NaOH with chlorine is a disporoportionation reaction.
Reason (R) : All redox reactions are disproportionation recations.
76. Which of the following is suitable to synthesize chlorobenzene?
1) Benzene, Cl2, anhydrous AlCl3 2) Phenol, NaNO2, HCl, CuCl
3) 4)
77. The hydrolysis reaction that takes place at the slowest rate, among the following
is
78. The minimum bond angle is found in which of the following hydrides ?
1) H 2O 2) H 2 Se 3) H 2 S 4) H 2Te
79. Noble gases have very low melting and boiling points because
1) They have high ionization enthalpy
2) They have more positive electron gain enthalpy
3) The type of interatomic forces operating are weak metallic bonds
4) The type of interatomic forces operating are weak dispersion forces
80. For a reaction, A  product, the graph drawn between concentration of product
formed on y-axis and time on x-axis gives a straight line with +ve slope and
passing through the origin. The slope of the straight line is 0.04 mol.lit 1.min 1 . If
the initial concentration of the reactant is 2M, then half life of the reaction is
________ min.
1) 50 2) 25 3) 30 4) 45
81. For a reaction, at 25 the rate constant of the reaction is 1.6 104 mol1.lit.S1 and at
o
35o C , the rate constant of same reaction is 4.8 104 mol1.lit.S1 . Then the order of
the reaction is _______
1) 3 2) 1 3) 0 4) 2

82. In the following reaction, A and B are respectively.
1) 2)
3) 4)
83. Phenyl magnesium bromide reacts with methanol to give

1) a mixture of anisole and Mg(OH)Br
2) a mixture of benzene and Mg(OMe)Br
3) a mixture of toluene and Mg(OH)Br 4) a mixture of phenol and Mg(Me)Br
84. The heat of combustion of ethanol determined in a bomb calorimeter is
670.48 kcal mol1 at 298K. What is E at 298K for the reaction?
1) 760 kcal mol1 2) 670.48 kcal mol1 3) 760 kcal mol1 4) 670.48 kcal mol1
85. Energy required to dissociate 4g of gaseous hydrogen into free gaseous atoms is
208 kcal at 25o C . The bond energy of H – H bond will be :
1) 1.04 cal 2) 10.4 kcal 3) 104 kcal 4) 1040 kcal
SECTION – B
86. Which of the following statemetns are correct?
A) The M3+/M2+ reduction potential for iron is greater than that of manganese
B) The higher oxidation states of first row d-block elements get stabilized by
oxides.
C) Aqueous solution of Cr2+ can liberate hydrogen from dilute acid.
D) Magnetic moment of V2+ is 4.9BM
1) B, C only 2) C, D only 3) A, B, D only 4) A, B only
87. The paif of lanthanides in which both elements have higher IP3 than expected
trend is
1) Eu, Gd 2) Eu, Yb 3) Lu, Yb 4) Dy, Gd
88. Select the structure of chromium complex formed when the toluene reacts with
chromyl chloride, which gives benzaldehyde on hydrolysis.
CH(OCrCl2)2 CH2(OCrOHCl2)
1) 2)
CH(OCrOHCl2)2 CH(OCrOH2Cl2)2
3) 4)
89. Arrange the following compounds in the increasing order of their boiling points.
CH 3CH 2CH 2CHO, CH 3CH 2CH 2CH 2OH , H 5C2OC2 H 5 , CH 3CH 2 CH 2CH 3
I II III IV
1) IV<I<II<III 2) IV<III<II<I 3) IV<III<I<II 4) IV<II<III<I
90. One mole of an octahedral complex, PtCl4.4NH3 reacts with excess of aqueous
AgNO3 to produce ____ moles of precipitate.(Assume all NH3 molecules act as
ligands).
1) 3 2) 4 3) Zero 4) 2

91. Match list – I with list – II
List – I (complex ion) List – II (Magnetic moment)
(A) Cr  CN 6  
3
(I) 4.9BM
(B) Cr  H 2O 6 
2
(II) 5.92BM
(C)  Mn  H 2 O 6 
2
(III) 3.9BM
(D) Co  CN 6 
3
(IV) 0 BM
.

.
(A) (B) (C) (D) (A) (B) (C) (D)

1) I III II IV 2) I II III IV
3) II I III IV 4) III I II IV
92. Following complexes are given
3 3 3
 Fe  H 2O 6   Fe  NH 3 6   Fe  CN 6 
(i) (ii) (iii)
Order of stability of these complexes will be
1) (ii)  (iii )  (i ) 2) (ii) < (i) < (iii) 3) (i) < (ii) < (iii) 4) (iii) < (ii) < (i)
93. A 0.02M a weak base, MOH is 0.1% ionized. Then the pH of the solution is
1) 9.3 2) 8.3 3) 10.3 4) 11.3
94. Identify the correct set from the following for fundamental particles
List – A List - B
(A) Decreasing order of masses (I) 
e  pn
(B) Decreasing order of e/m values (II) p  e  n
(C) Decreasing order of de-Broglie’s (III) n  p  e 
wavelength with same velocities
(D) Decreasing order of uncertainty (IV) n  e  p
.
in velocity when ∆x is same
(A) (B) (C) (D) (A) (B) (C) (D)
1) III I IV I 2) III I I I
3) III IV II I 4) III II IV I
95. The pH of an aqueous solution of CH3COONa of concentration C(molarity) is given
by
1 1 1 1 1
1) 7  pK a  log C 2) pK w  pKb  log C
2 2 2 2 2
1 1 1 1 1 1
3) pK w  pKb  log C 4) pK w  pK a  log C
2 2 2 2 2 2
96. Grignard reagent & acetyl chloride doesnot react with
1) RNH2 2) R2NH 3) R3N 4) NH3
97. Hinsberg’s method to separate amines is based on the use of
1) Benzene sulphonyl chloride 2) Benzene sulphonic acid
3) Ethyl oxalate 4) Acetyl chloride
98. Assertion (A) : In electrolytic cell oxidation takes place at anode while in galvanic
cell oxidation takes place at cathodic half cell.
Reason (R) : In electrolytic cell anode is positive while in galvanic cell cathode is
positive.
99. During the electrolysis of dilute sulphuric acid with Platinum electrode the
reaction takes place at cathode is
1) Oxidation 2) Reduction
3) Either oxidation or reduction 4) Neither oxidation nor reduction
100. Which of the following reaction of glucose cannot be explained by its open chain
structure?
1) Glucose reacts with HCN forms cyanohydrin
2) Pentaacetate of glucose does not react with hydroxyl amine.
3) Glucose is oxidized by Br2 water to form gluconic acid.
4) On prolonged heating with HI, glucose form n-hexane.

BOTANY
SECTION – A
101. The earliest scientific classification of organisms by Aristotle based on
1) Evolutionary relationship 2) Reproductive features
3) Simple morphological characters 4) Presence / absence of cell wall.
102. The two kingdoms consistently seen in all different classification systems
1) Monera and Protista 2) Plantae and Animalia
3) Protista and Fungi 4) Fungi and Animalia
103. Identify the mismatch w.r.t. nutrition
1) Monerans - Autotrophs and heterotrophs
2) Protists - Autotrophs and heterotrophs
3) Plantae - Photoautotrophs and chemoautotrophs
4) Fungi - Heterotrophs
104. Toddy a x of some parts of south India is made by fermenting from Y .
X Y
1) Non-alcohol drink - Xylem sap of palms
2) Traditional drink - Phloem sap of palms
3) Traditional drink - Cell sap of dicots
4) Non-alcohol drink - Xylem and phloem sap of palms
105. Which of the following are used to make food material by fermentation?
I) Milk II) Fish III) Potato IV) Bamboo-Shoot
V) Soya beans
1) I, II, III, V 2) II, III, IV, V 3) I, II, III, IV 4) I, II, IV, V
106. Match different organisms in column I with their uses in column – II and select
the correct option from the given below codes.
(A) Lactobacillus acidophilus (I) Formation of dough
(B) Saccharomyces cerevisiae (II) Roquefort cheese
(C) Propionibacterium shermani (III) Conversion of milk into curd
.
(D) Ripened by specific fungi (IV) Formation of swiss cheese
.
(A) (B) (C) (D) (A) (B) (C) (D)

3) I III IV II 4) I III II IV
107. Classification on the basis of chemical constituents of plants is known as
1) molecular taxonomy 2) numerical taxonomy
3) chemotaxonomy 4) cytotaxonomy
I. Sexual reproduction takes place through fusion of two isogametes called as
Isogamy (e.g., Ulothrix and Spirogyra)
II. Ulothrix have motile and Spirogyra have nonmotile isogametes.
III. Sexual reproduction takes place through fusion of two dissimilar gametes
called as Anisogamy (Eudorina).
IV. Fusion between one large, nonmotile (static) female gamete and a smaller,
motile male gamete is termed oogamous, e.g., Volvox, Fucus.
1) I, II, and IV are correct 2) I, II, III and IV are correct
3) I, II and V are correct 4) II, and IV are correct
109. Pick the mismatched pair regarding Pteridophytes.
1) Psilopsida Liverworts
2) Lycopsida Selaginella, Lycopodium
3) Sphenopsida Equisetum
4) Pteropsida Dryopteris, Pteris, Adiantum
110. Which is not a basic step in genetically modifying an organism?
1) Identification of DNA with desirable genes
2) Introduction of the identified protein into the host
3) Maintenance of introduced DNA in the host and transfer of the DNA to its
progeny
4) Introduction of the identified DNA into the host

111. How many types of enzymes are responsible for restricting the growth of
bacteriophage in E.Coli?
1) 1 2) 2 3) 3 4) 4
112. The first restriction endonuclease A, whose functioning depend on a specific DNA
nucleotide was isolated and characterized B years later
1) A: Hind I, B-5 2) A-Hind-II, B-4 3) A: Hind-II, B-5 4) A-Hind-III, B-5
113. Statement-I: Key tools in r-DNA technology are: restriction endonuclease,
polymerase, ligase, vectors
Statement-II: r-DNA will be created without ligase
Column-I Column-II
P) Restriction enzymes a) 230
Q) Strains of bacteria b) Restriction enzyme
R) Hind-II c) Hind-II
S) 6 base pairs d) 900
1) P-d, Q-a, R-b, S-c 2) P-c, Q-a, R-d, S-b
3) P-b, Q-a, R-c, S-d 4) P-d, Q-C, R-a, S-b
115. Adventitious roots are present in all, except
1) Monstera 2) Banyan tree 3) Mustard 4) Grasses
116. How many of the following features are associated with family Fabaceae?
(i) Marginal placentation
(ii) Non endospermous seeds
(iii) Leaf tendrils
(iv) Monoadelphous stamens
(v) Vexillary aestivation
(vi) Actinomorphic bisexual flowers
1) Six 2) Four 3) Five 4) Three
117. Statement –I :In members of Poaceae, the spikelet bears sessile flowers on a
short axis called rachilla.
Statement –II :Each sessile flower is surrounded by two scales called lemma,
which represents the bract.
Column-I Column-II
a) Perigynous flower (i) Sunflower
b) Epipetalous condition (ii) Plum
c) Apocarpous ovary (iii) Brinjal
d) Basal placentation (iv) Lotus
3) a-(ii), b-(iv), c-(i), d-(iii) 4) a-(ii), b-(iii), c-(iv), d-(i)
119. Find the incorrect statement w.r.t. transformation experiment conducted by
Frederick Griffith in 1928.
1) Heat killed S-strain bacteria when injected into mice, mice survived
2) R-strain bacteria when injected into mice, mice died
3) S-strain bacteria when injected into mice, mice died
4) S-strain bacteria (heat killed) + R-strain bacteria (live) when injected into mice,
mice died
120. During experiment with bacteriophage, Alfred Hershey and Martha Chase (1952)
used
1) P 32 labelled protein coat and S 35 labeled DNA
2) P 32 labelled DNA and S 35 protein coat
3) P 32 labelled bacteria and S 35 labelled bacteriophage
4) P 32 labelled bacteriophage and S 35 labelled bacteria

121. Three sequential steps of Alfred Hershey and Martha Chase experiments were
1) Centrifugation  Blending  Infection
2) Blending  Centrifugation  Infection
3) Infection  Blending  Centrifugation
4) Infection  Centrifugation  Blending
122. In ‘post-transcriptional’ processing, primary transcript is modified in 3 steps.
Which is not true about it?
1) Modification of 5 end by adding methyl guanosine triphosphate
2) Splicing by spliceosome
3) Polyadenylation at 3 end
4) Modification of 3 end by capping
123. RNA splicing and RNA capping
1) Are common features of both prokaryotes and eukaryotes
2) Are pre-transcriptional processes found only in eukaryotes
3) Are post-transcriptional processes found in prokaryotes
4) Are post-transcriptional processes found in eukaryotes
124. ‘Beads-on-string’ is the structure which is composed of
1) Nucleosome + RNA 2) Histones + RNA
3) DNA + nonhistone octamer 4) Histones + DNA
125. The trichomes in the shoot system are usually.
1) multicellular only 2) unicellular
3) preventing water loss due to transpiration 4) 1 & 3
126. Assertion : In roots the vascular bundle arrangement is called radial.
Reason : In roots xylem and phloem within a vascular bundle are arranged in
alternate manner along the different radii.
127. Which of the statements given below is not true about the formation of Annual
Rings in trees?
1) Annual rings are not prominent in trees of temperate regions
2) Annual rings are a combination of spring wood and autumn wood produced in
a year
3) Differential activity of cambium causes light and dark bands of tissue-early
and late wood respectively
4) Activity of cambium depends upon variation in climate
128. Transmission of genetic characters from parents to offspring is
1) Variation 2) Heridity 3) Blending 4) All the above
129. Mark the odd one (w.r.t. dominant trait in garden pea)
1) Yellow pod 2) Inflated pod 3) Axial flower 4) Yellow seed
130. All traits can express themselves in heterozygous condition, except.
1) Tall 2) Violet 3) Round seed 4) Wrinkled seed
131. In pisum sativum experimental error is minimum because
1) They are self pollinated
2) The hybrids produced are fertile
3) Large number of off springs are obtained 4) They are pure lines
132. Assertion (A): Dominant character is expressed in both homozygous and
heterozygous form.
Reason (R): For several generations, true breeding lines have stable traits of
inheritance.
133. Which of the given cell organelles contain(s) ribosomes?
(A) Mitochondria
(B) Chloroplast
(C) Rough Endoplasmic Reticulum
(D) Lysosome
1) Only (A) and (B) 2) All except (D)
3) Both (A) and (D) 4) Only (C)

134. Column I Column II
(a) Stroma of chloroplast i. Nucleoprotein
(b) Cytoskeleton ii. Flat, disc-shaped cisternae
(c) Ribosome iii. Contains enzymes required for synthesis of proteins
(d) Golgi apparatus iv. Help in motility and mechanical support
1) a-iii, b-iv, c-i, d-ii 2) a-ii, b-i, c-iv, d-iii
3) a-i, b-ii, c-iii, d-iv 4) a-iii, b-iv, c-ii, d-i.
135. In lac-operon, permease is coded by
1) lac-y 2) lac-z 3) lac-a 4) lac-i
SECTION – B
136. An example of insect pollinated flower, in which flower provides safe place to lay
eggs for insect is :-
1) Vallisneria 2) Salvia 3) Amorphophallus 4) Maize
137. Endosperm development precedes embryo development, because
1) Embryo provides nutrition to developing endosperm
2) Endosperm provides nutrition to developing embryo
3) Endosperm development starts after embryo development
4) All of the above
138. During embryo sac formation how many nuclei out of eight nucleus go through
cytokinesis or wall formation?
1) All eight 2) Two 3) Six 4) Four
139. Why same restriction endonuclease is employed to cut the cloning vector and
source DNA?
(a) Resultant DNA fragments have same kind of ‘sticky-ends’.
(b) Resultant DNA fragments have complementary sequences.
(c) Allows bond formation between the resultant DNA fragments.
1) a only 2) a and b only 3) a and c only 4) a, b and c
140. Statement –I : If the tissue is fully burnt all the carbon compounds oxidised to
gaseous form and remaining is called ash.
Statement –II : This ash contains inorganic elements like calcium, sulphate,
phosphate and magnesium.
141. Arithmetic growth can be expressed are
1) L1 = L0+rt 2) L1 = L0.rt 3) W0=W1ert 4) W1=W0ert
142. First discovered Gibberellins
1) GA1 2) GA2 3) GA3 4) GA4
143. Which of the following is incorrect w.r.t. abscisic acid?
1) It helps in closing of stomata
2) In most situations it acts as an antagonistic hormone to gibberelins
3) It promotes bud dormancy
4) It helps in sprouting in potato tubers
144. Consider the given statement w.r.t. to meiosis.
Statement I : Conservation of specific chromosome number.
Statement II : Decreases genetic variability
Statement III : It is reduction division.
1) Statement-I, Statement-II & Statement III – all arecorrect
2) Statement-I and Statement-III are correct but Statement II is incorrect
3) Statement-I & Statement-II are correct but Statement – II is incorrect
4) Statement-I, Statement-II & Statement III, all are incorrect
145. Statement I :Prophase of meiosis is longer & complex.
Statement II :Prophase of mitosis follows S, G2 phase of interphase.
1) Statement-I is incorrect, but Statement-II is correct
2) Statement-I is correct, but Statement-II is incorrect

146. Fill in the blanks:
1) Light saturation occurs at ___a____ per cent of full sunlight.
2) There is a ____b____ relationship between incident light and CO2 fixation rates
at low light intensities.
3) C3 plants show saturation at about ___c___ lL1 while C4 corresponds to
saturation about ____d_____ lL1 .
1) a – 2 – 5%, b – sigmoid, c – 350, d – 460
2) a – 50 %, b – linear, c – 460, d – 350
3) a – 10%, b – sigmoid, c – 360, d – 450
4) a – 10%, b – linear, c – 450, d - 360
147. The Floral diagram represents which one of the following families?
1) Fabaceae 2) Brassicaceae 3) Solanaceae 4) Liliaceae

148. With reference to factors affecting the rate of photosynthesis, which of the
following statements is not correct.
1) Increasing atmospheric CO2 concentration upto 0.05% can enhance CO2
fixation.
2) C3 plants respond to higher temperatures with enhanced photosynthesis while
C4 plants have much lower temperature optimum.
3) Tomato is a greenhouse crop which can be growh in CO2–enriched
atmospphere for higher yield.
4) CO2 is major limiting factor for photosynthesis
149. Fate of pyruvic acid during aerobic respiration is
1) Lactic acid fermentation 2) Alcoholic acid fermentation
3) Oxidative decarboxylation 4) Oxidation only
150. In which of the following reactions of glycolysis, oxidation takes place?
1) Glucose 6-PO4 to fructose 6-PO4
2) Glyceraldehydes 3-phosphate to 1, 3-diphosphoglycerate
3) 1,3-diphosphoglycerate to 3-phosphoglycerate
4) 3-phosphoglycerate to 2-phosphoglycerate
ZOOLOGY
SECTION – A
151. Herbaceous lycopods evolved during which era
1) Cenozoic 2) Paleozoic 3) Mesozoic 4) Proterozoic
152. Which is not correct with respect to human kidney?
1) The peripheral region is called cortex and central medulla.
2) Malpighian corpuscle is present in the cortex region
3) Blood enters glomerulus through efferent arterioles
4) The concave part of kidney is called hilum
153. The maximum volume of air you can forcefully exhale after taking the deepest
possible breath is called
1) Tidal volume 2) Total respiratiory volume
3) Residual volume 4) Vital capacity
154. Amazon rainforests in South America is home to more than ______species of
plants and _____ species of fishes.
1) 3000; 40,000 2) 1500; 2500 3) 40,000; 3000 4) 427; 378

155. Which of the statements given below are correct?
I. In earlier days, insulin extracted from pancreas of slaughtered cattle and pigs
was more efficient than genetically engineered insulin.
II. PCR technique is being used for the detection of HIV and genetic mutations, in
suspected cancer patients.
III. ADA deficiency is treated by gene therapy.
1) I and II 2) I and III 3) II and III 4) I, II and III
156. Dorsal part of frog is _____________ and ventral part is
1) Olive green; uniformly pale yellow 2) Olive green; uniformly dark yellow
3) Olive green; nonuniformly pale yellow 4) Olive green; nonuniformly dark yellow
157. In cockroach, the body inspite of being covered by an exoskeleton of strong
chitinous cuticle, it remains flexible due to
1) Tergites 2) Sternites 3) Pleurites 4) Arthrodial membrane
158. Assertion : Nerve impulse can never be transmitted from dendrite or cell body of
of one neuron to the axon of the next neuron, across a synapse.
Reason : Neurotransmitters released into synaptic cleft.
the assertion
3) Assertion is false, but reason is true
159. The correct differnces between exponential and logistic growth rates is
1) Exponential growth depends on birth and death rates and logistic does not
2) In logistic growth, emigration and immigration are unimportant
3) That both are affected by density, but logistic growth is slower
4) That only logistic growth reflects density dependent effects on births a deaths
160. Find out correct match (w.r.t. urine formation)
1) Glucose – Active reabsorption 2) Amino acids – passive transport
3) Urea – Active reabsorption 4) Water – Active reabsorption
161. What happens when blood groups are not compatible during blood transfusion?
1) Formation of eosinophils 2) Only neutrophils are destroyed
3) Destruction of RBCs 4) Formation of basophils
162. Assertion : Both bone marrow and thymus provide micro environment for the
development and maturation of T-lymphocytes.
Reason : 50% of lymphoid tissue in human body is MALT
1) Both assertion and reason are true and the reason is the correct explanation of
the assertion
2) Both the assertion and reason are true but the reason is not the correct
3) Assertion is true but the reason is false
4) Both the assertion and reason are false
163. After the entry of female reproductive tract, energy source of sperm is
1) Secreted by female accessory glands
2) Secreted by male accessory glands
3) Secreted by male primary sex organ
4) Glucose, a secreted by female accessory tract
164. Find out the correct match with respect to HGP.
1) Dystrophin gene  2.4 billion bases 2) Chromosome-12698 genes
3) Chromosome-Y 231 genes 4) SNPs  1.4 billion locations
165. In which one of the following, the animals, its two characters and its
class/phylum are correctly matched?
Animal Two characters Phylum
1 Ascaris i) Muscular pharynx Aschelminthes
ii) Metamarism
2 Comb jelly i) Comb plates help in locomotion Ctenophora
3 Snail i) File – like radula Arthropoda
ii) Skin forms mantle over visceral hump
4 Jelly fish i) Cnidoblasts for defence Porifera
ii) Coelenteron with a single opening

166. Which among the following hormones stimulates RBC production?
1) Erythopoietin 2) Glucagon 3) Cortisol 4) Both 1 & 3
167. In a general ecological context the Pyramid of biomass represent, one of the
following feature:
1) A sharp increase in biomass at higher trophic levels
2) A sharp decrease in biomass at higher trophic levels
3) An equal rate of biomass at all trophic levels
4) a random distribution of biomass at lower trophic levels
168. As we go from species to kingdom in a taxonomic hierarchy, the number of
common characteristics:
1) Will decrease 2) Will increase
3) Remain same 4) May increase or decrease
169. Select the organism that occupies at more than one trophic level.
1) Phytoplankton 2) Tiger 3) Rabbit 4) Human
170. Pick up the correct match.
Column-I. Column-II
(a) IVF. (1) 8-celled embryo into fallopian tube
(b) GIFT. (2) Test tube baby program
(c) AI. (3) Ovum into oviduct
(d) ZIFT. (4) Performed after in vitro fertilization
(e) ET (5) Introducing semen into vagina
1) a-5, b-2, c-1, d-3, e-4 2) a-2, b-4, c-3, d-5, e-1
3) a-2, b-3, c-5, d-1, e-4 4) a-4, b-1, c-2, d-5, e-3
171. Match Column I with Column II
Column I Column II
A. Gross primary productivity I. Self-sustainable ecosystem
B. Net primary productivity II. Artificial ecosystem
C. Pond III. Oxygen requiring process
D. Crop field IV. Photosynthetic production
E. Decomposition V. Available to consumers
Options:
1) A-IV, B-V, C-II, D-I, E-III 2) A-IV, B-V, C-III, D-II, E-I
3) A-IV, B-V, C-I, D-II, E-III 4) A-I, B-V, C-IV, D-II, E-III
172. An individual inspire or expire 6000 to 8000 mL of air per minute. What is the
rate of breathing per minute in that individual? Given that the Tidal volume is
500 mL.
1) 10 – 16 times/min 2) 6 – 8 times/min
3) 12 – 16 times/min 4) 11 – 15 times/min
173. Statement – I : The skull of baby chimpanzee is more like adult human skull
than that of adult chimpanzee skull.
Statement – II : Due to continental drift South America joined North America
1)Statement-I is true, but Statement-II is false.
174. The breathing centre initiates ventilation in response to –
1) A decrease in air pressure 2) A decrease in O2
3) An increase in CO2 4) The rate of gas exchange in the alveoli
175. Renal tubule begins with __________
1) A tubular PCT 2) Highly coiled LH
3) A doule walled cup-like structure 4) Cortex
176. Select the total number of true statements from the following :
(1) Each myosin (thick) filament is also a polymerized protein.
(2) Many monomeric proteins called meromyosins constitute one thick filament.
(3) The HMM component, i.e, the head and short arm projects outwards at
regular distance and angle from each other from the surface of a polymerized
myosin filment and is known as cross arm.
(4) The globular head is an active ATPase enzyme and has binding sites for ATP
and active sites for actin.
1) 1 2) 2 3) 4 4) 3

177. A ‘new’ variety of rice was patented by a foreign company, through such varieties
have been present in Inida for a long time. This is related to
1) Co-667 2) Sharbati Sonora 3) Lerma Rojo 4) Basmati
178. The below given figure is
1) Brachiosaurus 2) Stegosaurus 3) Pteranodon 4) Triceratops

179. Assertion: A genotype with three dominant and three recessive alleles will have
intermediate skin colour
Reason: In polygenic inheritance the effect of each allele is additive.
assertion.
3) Assertion is true and reason is false 4) Assertion is false and reason is true
180. The following given are the symptoms of a Mendelian disorders.
a. Skin pigmentation
b. Change in shape of RBC
c. Anemia
d. Mental retardation
e. Problem in blood clotting
From the above, the number of symptoms that matches PKU are,
1) 3 2) 2 3) 1 4) 4
181. Find the incorrect statement from the following.
1) constant environment promote niche specialization
2) key species are those which drive major ecosystem functions
3) increase in diversity generally increases productivity
4) increase steepness in species area relationship curve decreases species
richness in a given area
182. Excitement, pleasure, rage reactions regulated by
1) Thalamus and hypothalamus 2) Thalamus and limbic lobes
3) Limbic system with hypothalamus 4) Hypothalamus with cerebral aqueduct
183. The major threat to many marine fish population is
1) Habitat loss 2) Over – exploitation
3) Co-extinction 4) Fragmentation of habitat
184. Thin tubes that carry oxygen from the air to all the parts in cockroach constitute
1) Tracheal system 2) Haemolymph 3) Lungs 4) Gills
185. The maximum number of individuals of a population that can be sustained
indefinitely in a given habitat, represents its
1) Carrying capacity (C) 2) Carrying capacity (N)
3) Carrying capacity (K) 4) Carrying capacity (D)
SECTION – B
186. Which of the following is correct?
1) Lymph = Plasma + WBC’s + RBC’s
2) Plasma = Blood – Lymphocytes
3) Neuron = Cyton + Dendron + Axon + Synapse
4) Blood = Plasma + RBC’s + WBC’s + Platelets
187. What is shown in the figure?
1) Sunflower plant 2) Poppy plant 3) Datura plant 4) Tobacco plant

188. Choose the incorrect w.r.t. corpus luteum.
1) It is formed from, the remaining parts of the graafian follicles (after the
ovulation)
2) It secretes a hormone, which is essential for maintenance of the endometrium
3) Menstruation occur due to degeneration of corpus luteum
4) It secretes progesterone hormone only
189. Among non-infectious diseases ______________ is the major cause of death
1) Diabetes 2) Blood pressure 3) Heart Failure 4) Cancer
190. The T wave of the ECG represents ________
1) ventricular depolarization 2) atrial depolarization
3) ventricular repolarization 4) atrial systole
191. Which of the following statements are correct or incorrect regading class
Amphibia?
i. Has body divisible into head and trunk. Tail is present in some amphibians.
ii. Show respiration only by gills.
iii. Has scales in all its members.
iv. Can lead dual life (aquatic and terrestrial)
v. The heart is two chambered
1) All are correct 2) Only i and iv are correct
3) Only III is correct 4) Only ii is incorrect
192. The __________ hormone stimulates secretion of bile juice from gall bladder
1) Gastrin 2) Secretin
3) Cholecystokinin 4) Gastric Inhibitory peptide(GIP)
193. The test-tube Baby Programme employs which one of the following techniques?
1) Intra uterine insemination (IUI).
2) Gamete intra fallopian transfer (GIFT).
3) Zygote intra fallopian transfer (ZIFT).
4) Intra cytoplasmic sperm injection (ICSI).
194. Choose the pattern of inheritance of the below given pedigree.
1) X linked dominant 2) X linked recessive

195. Which of the following statements about the striated muscles is correct?
(1) Thick filaments in the ‘A’ band are held together in the middle by a thin
fibrous membrane called ‘M’ line.
(2) In the centre of each ‘I’ band is an elastic fibre called ‘Z’ line which bisects it.
(3) The thin filaments are firmly attached to the ‘Z’ line.
(4) This central part of thick filament, not overlapped by thin filaments is called
the ‘H’ zone.
1) 2 and 4 2) Only 2 3) 1 and 4 only 4) All of these
196. Assertion (A): The most unique mammalian characteristic is the presence of
mammary glands except ornithorhynchus.
Reason (R): They have well developed lungs for air breathing except aquatic
animals.
3) Both A and R incorrect 4) A is incorrect and R is correct

197. Choose from the following the features that matches to human being.
a. The number of chromosomes in male and female are equal
b. Y- chromosome is smaller than X-chromosome
c. Female heterogamety is seen.
d. Sex chromosomes present in males are X and Y
e. Sex chromosomes present in females are X and X
1) a,b,e 2) a,b,c,d 3) a,b,c 4) a,b,d,e
198. Satellite DNA is classified based on:
1) base composition 2) length of the segment
2) Number of repeating units 4) All of the above
199. The Helper T-cells decrease in HIV patient during this period the person suffer
from
Bouts of fever b) Diarrhoea c) Weight loss d) Allergy
1) a,b 2) a,b,c 3) a,b,d 4) b,d
200. Which of the following lived near east and central Asia
1) Homo erectus 2) Homo habilis 3) Neanderthal man 4) Dryopithecus
*******

: ANSWER KEY:
SET-2 SUB: PHYSICS
1 1 11 3 21 2 31 4 41 2
2 2 12 2 22 2 32 3 42 2
3 2 13 3 23 1 33 2 43 1
4 1 14 3 24 2 34 2 44 3
5 3 15 2 25 3 35 2 45 3
6 4 16 2 26 3 36 3 46 3
7 2 17 1 27 2 37 4 47 3
8 1 18 4 28 1 38 3 48 3
9 2 19 2 29 1 39 1 49 2
10 1 20 1 30 3 40 2 50 3
SUB:CHEMISTRY
51 2 61 3 71 4 81 4 91 4
52 3 62 2 72 2 82 3 92 3
53 1 63 2 73 1 83 2 93 1
54 3 64 1 74 2 84 2 94 2
55 2 65 4 75 3 85 3 95 4
56 3 66 3 76 1 86 1 96 3
57 2 67 1 77 1 87 2 97 1
58 3 68 1 78 4 88 3 98 4
59 2 69 2 79 4 89 3 99 2
60 2 70 4 80 2 90 2 100 2
SUB : BOTANY
101 3 111 2 121 3 131 3 141 1
102 2 112 3 122 4 132 1 142 3
103 3 113 1 123 4 133 2 143 4
104 2 114 1 124 4 134 1 144 2
105 4 115 3 125 4 135 1 145 4
106 2 116 2 126 1 136 3 146 4
107 3 117 1 127 1 137 2 147 2
108 2 118 4 128 2 138 3 148 2
109 1 119 2 129 1 139 4 149 3
110 2 120 2 130 4 140 3 150 2
151 3 161 3 171 3 181 4 191 2
152 3 162 2 172 3 182 3 192 3
153 4 163 2 173 3 183 2 193 3
154 3 164 3 174 3 184 1 194 3
155 3 165 2 175 3 185 3 195 4
156 1 166 4 176 3 186 4 196 3
157 4 167 2 177 4 187 2 197 4
158 3 168 1 178 2 188 4 198 4
159 4 169 4 179 1 189 4 199 2
160 1 170 3 180 2 190 3 200 3

NEET GRAND TEST - 2
answer sheet.
CORRECT.
Section-B;
Marking Scheme :

PHYSICS
SECTION – A
1. Five identical polaroids are placed coaxially with 450 angular separation from
adjacent one as shown in figure (I0 : Intensity of unpolarised light)
The intensity l of light emerging out of 5th Polaroid is

I I I I
1) 0 2) 0 3) 0 4) 0
4 8 16 32
2. Which of the following sets have different dimensions?
1) Pressure, Young’s modulus Stress
2) Emf, Potential difference, Electric potential
3) Heat, Work done, Energy
4) Dipole moment, Electric flux, Electric field
 
3. If A  3iˆ  4 ˆj and B  7iˆ  24 ˆj , the vector having the same magnitude as B and
parallel to A is
1) 5iˆ  20 ˆj 2) 15iˆ  10 ˆj 3) 20iˆ  15 ˆj 4) 15iˆ  20 ˆj
4. The current in a circuit with an external resistance of 3.75 is 0.5 A. When a
resistance of 1 is introduced into the circuit, the current becomes 0.4 A. The
emf of the power source is
1) 1 V 2) 2 V 3) 3 V 4) 4V
5. A rigid ball of mass m strikes a righd wall at 600 and gets reflected without loss of
speed as shown in the figure. The value of impulse imparted by the wall on the
ball will be
1) mv 2) 2mv 3) mv/2 4) mv/3

6. Two long straight conductors carry currents 4A and 2A into the plane of paper. A
circular path is imagined to be enclosing these currents. The value of  B.dl is
1) 60 2) 70 3) 50 4) 20
7. A ball bounces to 75% of its original height. The percentage loss of potential
energy in each bounce is
1) 100% 2) 75% 3) 50% 4) 25%
8. The north pole of a magnet is brought near a metallic ring. The direction of the
induced current in the ring will be
1) Clockwise 2) Anticlockwise 3) Towards north 4) Towards south
9. The total mechanical energy of a spring-mass system in simple harmonic motion
1
is E  m 2 A2 . Suppose the oscillating particle is replaced by another particle of
2
double the mass while the amplitude A remains the same. The new mechanical
energy will
1) become 2E 2) become E/2 3) become 2E 4) remain E
10. The period of oscillation of a mass M suspended from a spring of negligible mass
is T. If along with it another mass M is also suspended, the period of oscillation
will now be
1) T 2) T / 2 3) 2T 4) 2T

11. According to Einstein’s photoelectric equation, the plot of the maximum kinetic
energy of the emitted photoelectrons from a metal versus frequency of the
incident radiation gives a straight line whose slope
1) Depends on the nature of metal used
2) Depends on the intensity of radiation
3) Depends on both intensity of radiation and the nature of metal used
4) Is the same for all metals and independent of the intensity of radiation.
12. Hole is
1) An anti-particle of electron
2) A vacancy created when an electron leaves a covalent bond
3) Absence of free electrons
4) An artificially created particle
13. First law of thermodynamics is a consequence of conservation of
1) work 2) energy 3) heat 4) all of these
14. Two cylinders A and B of equal capacity are connected to each other via a stop
cock. A contains an ideal gas at standard temperature and pressure. B is
completely evacuated. The entire system is thermally insulated. The stop cock is
suddenly opened. The process is
1) adiabatic 2) isochoric 3) isobaric 4) isothermal
15. Which energy state of doubly ionized lithium  Li  has the same energy as that

of the ground state of hydrogen?

1) n = 1 2) n = 2 3) n = 3 4) n = 4
16. Cooking gas containers are kept in a lorry moving with uniform speed. The
temperature of the gas molecules inside will
1) Increase 2) Decrease
3) Remain same 4) Decrease for some, while increase for others
17. The value of tension in a long thin metal wire has been changed from T1 to T2.
The lengths of the metal wire at two different values of tension T1 and T2 are l1
and l2 respectively. The actual length of the metal wire is
T l T l Tl T l l l
1) T1T2l1l2 2) 1 1 2 2 3) 1 2 2 1 4) 1 2
T1  T2 T1  T2 2
18. For wattless power in an AC circuit, the phase angle between the current and
voltage is
1) 00 2) 900 3) 450 4) Not possible
(A) Incompressible liquid (E) Density constant
(B) Turbulent flow (F) Stream lines
(C) Tube of flow (G) Constant
.
(D) Fluid flux rate in laminar flow (H) Reynold’s no. > 2000
.
(A) (B) (C) (D) (A) (B) (C) (D)

1) F E G H 2) E H F G
3) G F E H 4) H G E F
20. The length of a magnet is large compared to its width and breath. The time
period of its oscillation in a vibration magnetometer is 2s. The magnet is cut
along its length into three equal parts and three parts are then placed on each
other with their like poles together. The time period of this combination will be
2 2
1) 2s 2) s 3) 2 3s 4) s
3 3
21. Two spheres of masses m and M are situated in air and the gravitational force
between them is F. The space around the masses is now filled with a liquid of
specific gravity 3. The gravitational force will now be
1) 3F 2) F 3) F/3 4) F/9
22. Let ‘A’ be the area swept by the line joining the earth and the sun during Feb
2007. The area swept by the same line during the first week of that month is
1) A/4 2) 7A/29 3) A 4) 7A/30

23. In electromagnetic the phase difference between electric field vector and magnetic
field vector is
1) Zero 2)  / 2 3)  4)  / 3
24. Two open pipes of length L are vibrated simultaneously. If length of one of the
pipes is reduced by y, then the number of beats heard per second will be if the
velocity of sound is v any y << L :
vy vy vy 2L2
1) 2) 2 3) 4)
2 L2 L 2L vy
25. A uniform rod is 4m long and weighs 10kg. If it is supported on a knife edge at
one meter from the end. What weight placed at that end keeps the rod horizontal ?
1) 8kg 2) 10kg 3) 12kg 4) 16kg
26. When 1500J energy given to a object its angular speed increase by 300 rpm to
600 rpm then the moment of inertia of a object is ……kg m2.
1) 1 2) 0.5 3) 2 4) 0.2
1
27. A man runs towards a mirror at a rate of 6 ms . If the mirror is at rest, his image
will have a velocity (with respect to man)
1) 12 ms1 2) 6 ms1 3) 6 ms1 4) 12 ms1
28. A capacitor of capacity 2 F is charged to 100V. What is the heat generated when
this capacitor is connected in parallel to an another capacitor of same capacity?
1) 2.5 mJ 2) 5.0 mJ 3) 10 mJ 4) 4 mJ
29. In Young’s double slit experiment if separation of the screen is increased from
slits, the fringe width will
1) Decrease 2) Increase 3) Remain the same
4) Any of the above depending on the wavelength of the light used
ky
30. What is the unit of k in the relation U  2 where U represents the potential
y  a2
energy, y respresents the displacement and a represents the maximum
displacement i.e, amplitude?
1) ms1 2) ms 3) Jm 4) Js1
31. Figures below show regular hexagons, with charges at the vertices. In which of
the following cases the electric field at the centre is not zero.
1) 1 2) 2 3) 3 4) 4
32. A cubical block of mass m containing a net positive charge Q is placed on a
smooth horizontal surface which terminates in a vertical wall, as shown in the
figure. The distance between the wall and the block is d. A horizontal electric field
E directed towards the wall is suddenly switched on, assuming elastic collision
the time period of the resulting collision is
4md md 8md md
1) 2) 3) 4)
QE 8QE QE 4QE

33. Two mirrors labelled L1 for left mirror and L2 for right mirror in the figure are
parallel to each other and 3.0m apart. A person standing 1.0 m from the right
mirror (L2) looks into this mirror and sees a series of images. The second nearest
image in the right mirror is situated at a distance
1) 2.0m from the person 2) 4.0m from the person

3) 6.0m from the person 4) 8.0m from the person
34. The equivalent capacitance between P and Q of the given figure is (the
capacitance of each capacitor is 1 F )
1) 2 F 2) 0.5 F 3) 5 F 4) 0.2 F
35. Two wires each of radius of cross section r but of different materials are
connected together end to end (in series). If the densities of charge carriers in the
two wires are in the ratio 1:4, the drift velocity of electrons in the two wires will be
in the ratio
1) 1 : 2 2) 2 : 1 3) 4 : 1 4) 1 : 4
SECTION – B
36. Find the projection of iˆ  2 ˆj on 2iˆ  3 ˆj .

8 8 6 6
1) 2) 3) 4)
5 13 13 5
37. A block of mass m is resting on a smooth horizontal surface. One end of a
m
uniform rope of mass   is fixed to the block, which is pulled in the horizontal
3
direction by applying force F at the other end. The tension in the middle of the
rope is
8 1 1 7
1) F 2) F 3) F 4) F
7 7 8 8
38. A current of 50A is passed through a straight wire of length 6cm, then the
magnetic induction at a point 5cm from the either end of the wire is
1 gauss = 104T 
1) 2.5 gauss 2) 1.25 gauss 3) 1.5 gauss 4) 3.0 gauss
39. Assertion (A): The poles of magnet cannot be separated by breaking it into two
pieces.
Reason (R) : The magnetic moment will be reduced to half when a magnet is
broken into two equal pieces.
1) Both assertion and reason are true and reason is the correct explanation of
assertion
2) Both assertion and reason are true but reason is not correct explanation of
assertion
4) Assertion is false but reason are true

(A) Kinematic viscosity (E) 1
  v22  v12  A
2
(B) Dynamic lift (F) 

(C) Bernoullie’s therorem (G) a v = constant
(D) Equation of continuity (H) 1
p   v 2  pgh  const.
.
.
2
(A) (B) (C) (D) (A) (B) (C) (D)
1) F E H G 2) F E G H
3) G F E H 4) H G F E
41. A spring gun of spring constant 90 N/cm is compressed 12 cm by a ball of mass
16g. If the trigger is pulled, the velocity of the ball is
1) 50 ms1 2) 40 ms1 3) 90 ms1 4) 60 ms 1
42. Assertion (A): Motional induced emf e  Bvl can be derived from the relation
d
e
dt
Reason (R): Lenz’s law is a consequence of law of conservation of energy.
1) Both assertion and reason are true and reason is the correct explanation of
assertion
2) Both assertion and reason are true but reason is not correct explanation of
assertion
4) Assertion is false but reason are true
43. A series LCR circuit is connected to an AC source of 220 V, 50 Hz. The circuit
contains a resistance R  80  , an inductor of inductive reactance X L  70  ,
and a capacitor of capacititve reactance X C  130  . The power factor of circuit is
x
. The value of x is
10
1) 80 2) 18 3) 8 4) 0.8
44. Two wires of same length and radius are joined end to end and loaded. The
Young’s modulii of the materials of the two wires are Y1 and Y2. The combination
behaves as a single wire then its Young’s modulus is
2Y1Y2 Y1Y2 2Y Y YY
1) Y  2) Y  3) Y  1 2 4) Y  1 2
3 Y1  Y2  2 Y1  Y2  Y1  Y2 Y1  Y2
45. The electric field and electric potential at a point are ‘E’ and ‘V’ respectively
1) If E = 0, V must be zero 2) If V = 0, E must be zero
3) If E  0 , V cannot be zero 4) None of the above
46. When a metal surface is illuminated by light of wavelengths 400 nm and 250 nm,
the maximum velocities of the photoelectrons ejected are v and 2v respectively.
The work function of the metal is (h = Planck’s constant, c = velocity of light in
air)
1) 2 hc  10 6 J 2) 1.5 hc  10 6 J 3) hc  10 6 J 4) 0.5 hc  10 6 J
47. If the wavelength of H a line of the Balmer series of the hydrogen spectrum is  ,
the wavelength of the:
7
1) H  line is 
20
5
2) Least energetic spectral line of the Lyman series is 
27
hc
3) Ionisation potential of hydrogen is

4) All the above are true

48. In thermal equilibrium, the average velocity of gas molecules is

1) Proportional to T 2) Proportional to T 2
3) Proportional to T 3 4) Zero
49. A gas at the temperature 250 K is contained in a closed vessel. If the gas is
heated through 1 K, then the percentage increase in its pressure will be
1) 0.4% 2) 0.2% 3) 0.1% 4) 0.8%
50. Potential barrier developed in a junction diode opposes the flow of
1) minority carrier in both regions only 2) majority carriers only
3) electrons in p region 4) holes in p region
CHEMISTRY
SECTION – A
51. The osmotic pressure of 0.6 molar aqueous solution of MgCl2, considering 60%
dissociation of electrolyte is ________ atm at 27o .
1) 14.78 2) 29.56 3) 41.38 4) 32.51
52. Which of the following is not a colligative property?
1) Lowering of vapour pressure 2) Elevation of boiling point
3) Freezing point 4) Osmotic pressure
53. Which of the following compounds will give orange-yellow precipitate with 2,4-
dinitrophenylhydrazine reagent?
1) CH3CH2COOH 2) CH3COOC2H5 3) CH3COCH3 4) C6H5OH
54. Among (a) Na2O, (b) MgO, (c) Al2O3, (d) P2O5 and (e) Cl2O7 the most basic, most
acidic and amphoteric oxide can be
1) a, b, c 2) b, e, c 3) a, e, c 4) e, c, a
55. Based on MOT for which of the following, the bond order is 2 and species is
diamagnetic?
1) O2 2) C2 3) B2 4) Li2
56. The systematic name of C17H35COOH is
1) heptadecanoic acid 2) octa decanoic acid
3) steric acid 4) palmitic acid
57. Which of the following is filled first?
1) 5d 2) 7s 3) 4f 4) 6p
58. If a metal is irradiated with light of frequency 3 x 1019 sec-1, electron is emitted
with kinetic energy of 6.625 x 10-15 J. The threshold frequency of the metal is
1) 2 x 1019 sec-1 2) 1.25 x 1019 sec-1
3) 6.625 x 1035 sec-1 4) 6.625 x 1019 sec-1
59. The compound which is expected to rotate plane polarized light is :
1) 2)
3) 4)
60. Fe(OH)3 can be separated from Al(OH)3 by addition of :

1) Dil. HCl 2) NaCl solution 3) NaOH solution 4) NH4Cl and NH4OH
61. Identify the correct order of solubility of Na2S, CuS and ZnS in aqueous medium :
1) CuS > ZnS > Na2S 2) ZuS > Na2S > CuS
3) Na2S > CuS > ZnS 4) Na2S > ZnS > CuS
2
62. Which combines with Fe to form brown complex?
1) N2O 2) NO 3) N2O3 4) N2O5

63. Which of the following represents zero overlap of atomic orbitals?
1) 2)
3) 4) All of these
64. Following figure repreent a chlorine molecule. Identify A, B and C in the given
figure.
1) A=Bond length, B=van der Waal’s radius C=Covalent radius

2) A=Covalent radius, B=Bond length, C=Ionic radius
3) A=Ionic radius, B=van der waal’s radius, C=Covalent radius
4) A=Covalent radius, B=van der Waal’s radius, C=Bond length
65. The formal charge of Xe atom in the following compound is
O
F F
Xe
F F
1) 1 2) 2 3) 4 4) 0
66. Statement –1 : Order of acidic strength.
OH OH
<
H3 C CH3 H3 C CH3
NO2 CN
Statement –2: –M affect of –CN is greater than –M of –NO2 every time when it is
attached on double bonded caron.
for Statement-1
67. Statement –1 : But-1-ene is more stable than but-2-ene

Statement –2 : But-2-ene have more -H than but-1-ene.
for Statement-1
68. Among 13th group elements more electropositive element is
1) B 2) Al 3) Ga 4) In

69. Assertion (A) : Pb(IV) compounds are good reducing agents.
Reason (R) : For Pb, +2 oxidation state is more stable than +4 oxidation state
due to inert pair effect.
CH 3
70. The compound | on reaction with hot concentrated KMnO4 gives
CH 3  C  CH  CH 3
1) CH 3COCH 3 2) CH 3COCH3  CH3COOH
3) CH 3COCH 3  CH3CHO 4) CH 3CHO  CO2
71. Which of the following conformers for ethylene glycol is most stable?
72. Statement I : On dehydration with concentrated H2SO4, neopentyl alcohol gives

2-methyl but-2-ene.
Statement II : 3o carbocation is more stable than 2 o carbocation.
73. A compound has the molecular formula X4O6. If 10 g of X4O6 has 5.72 g of X, then
atomic mass of X is :
1) 32 amu 2) 37 amu 3) 42 amu 4) 98 amu
74. A 300 g solution of density 1.5 g/ml is prepared by adding 90 g of glucose
(C6H12O6) in water. Find molarity of this solution.
1) 5/3 2) 5/2 3) 2/5 4) 3/5
(A) +3 oxidation state (I) Nitrogen
(B) +1 oxidation state (II) Nitrous oxide
(C) 0 oxidaton state (III) Nitrate ion
(D) +5 oxidation state (IV) Hydroxylamine
.
(V) Nitrite ion
.
The correct match is

(A) (B) (C) (D) (A) (B) (C) (D)
1) I IV III II 2) V II IV III
3) IV V III I 4) V II I III
76. Which of the following alkyl halides will undergo SN 1 reaction most readily?
1)  CH 3 3 C  F 2)  CH 3 3 C  Cl 3)  CH 3 3 C  Br 4)  CH 3 3 C  I
77. Ethylidene chloride is a _________________halide.
1) vic – dihalide 2) gem – dihalide 3) allylic halide 4) vinylic halide
78. The element with highest boiling point in the following is
1) Oxygen 2) Sulphur 3) Tellurium 4) Polonium
79. The most abundant noble gas in the atmosphere is
1) Argon 2) Neon 3) Helium 4) Krypton
80. For a reaction, Aproduct, initial concentration of the reactant is 2M and the
rate constant of the reaction is 0.03465 min 1 . The rate of the reaction after 1 hour
is ________ mol.lit 1.min 1 .
1) 3.465 102 2) 6.93 102 3) 8.66 103 4) 1.7325 102

81. Assertion : The rate of a reaction increases when a +ve catalyst is used.
Reason : A +ve catalyst provides an alternate path for reacting molecules where
lower activation energy is required.
1) If both assertion and reason are True and the reason is a correct explanation
of the assertion
2) If both assertion and reason are True but reason is not a correct explanation of
the assertion
3) If assertion is True but reason is false
4) If both assertion and reason are false
82. Acetyl bromide reacts with an excess of CH3MgI followed by treatment with a
saturated solution of NH4Cl gives
1) acetone 2) acetyl iodide 3) 2-methyl-2-propanol 4) acetamide
83. Given below are two statements, one is labelled as Assertion A and the other is
labelled as Reason R.
Assertion A: Order of acidic nature of the following compounds is A > B > C.
Reason R: Fluoro is a stronger electron withdrawing group than Chloro group.

84. Which of the following reactions defines standard enthalpy of formation of given
compound at 250C and 1atm ?
1 1
1) C diamond   O2  g  
 CO2  g  2) H 2  g   F2  g   HF  g 
2 2
1
3) N 2  g   3H 2  g   2 NH 3  s  4) CO  g   O2  g   CO2  g 
2
85. (H - U) for the formation of carbon monoxide (CO) from its element at 298K is :
 R  8.314 J K 1mol1 
1) 1238.78 J mol1 2) 1238.78 J mol1 3) 2477.57 J mol1 4) 2477.57 J mol1
SECTION – B
86. Given below are two statements:
Statement – I: The E0 value for Ce4+/Ce3+ is +1.74V.
Statement – II: Ce4+ is more stable than Ce3+ state in its compounds.
1) Both statement I and statement II are correct.
2) Statement I is correct but statement II is incorrect.
3) Both statement I and statement II are incorrect.
4) Statement I is incorrect but statement II is correct.
87. K2Cr2O7 paper acidified with dilute H2SO4 turns green when exposed to
1) Carbondioxide 2) Sulphur trioxide
3) Dinitrogen pentoxide 4) Sulphur dioxide
O
88. (1)𝑂𝐻
CHO + ‘X’ CH = CH – C
(2) 293K
Identify the compound X.
1) CH2 – CHO 2) CH2 – CH2 – OH
O
3) C – CH3 4) CH = CH2

89. Bendict’s reagent is used for the differentiation between
1) C2H5CHO and CH3CHO
2) CH3COCH3 and CH3CHO
O O
3) and
C6 H 5  CH 2  C  CH 3 C6 H 5  C  CH 2  CH 3
O
4 and C6H5CHO
Ph  C  CH 3
The correct electronic configuration of the central atom in  MnCl6 
3
90. based on
crystal field theory is
4 0
1) t2g eg 2 2
2) t2g eg 3 1
3) t2g eg 4) e2t22
91. Outer orbital complex among the following is
4
2)  Fe  CN 6  4) CoF6 
3 3 3
1)  Co  H 2 O 6  3)  Mn  CN 6 
92. Statement–I: In the complex, Cr(CO)6, the M-C bond length is less than
expected.
Statement–II: The metal-carbon bond in Cr(CO)6 possess both  and 
character. In the light of the above statements, choose the correct answer.
93. The pH of a solution is 4.301. To 50 ml of this solution 200 ml of water is added.
Then the pH of resulting solution is
1) 4.9 2) 5.301 3) 5.7 4) 5.0
 2 NO2 ;
2 NO  O2 
The rate constant of forward and backward reactions are 8 102 and 2 104
respectively. Then for the reaction,
1

NO2   NO  O2 ;
2
The magnitude of equilibrium constant is ________
1) 4.00 2) 20 3) 0.05 4) 2.5 103
95. An acidic buffer contains 0.06 M salt and 0.02 M acid. The dissociation constant
of acid is 10-4. The pH of the buffer solution is
1) 4 2) 10 3) 4.48 4) 9.52
96. What is the decreasing order of basicity of 1 , 2 and 3 ethylamines & NH3?
0 0 0
1) NH 3  C2 H 5 NH 2   C2 H 5 2 NH   C2 H 5 3 N
2)  C2 H 5 3 N   C2 H 5 2 NH  C2 H 5 NH 2  NH 3
3)  C2 H 5  2 NH  C2 H 5 NH 2  NH 3   C2 H 5 3 N
4)  C2 H 5  2 NH   C2 H 5 3 N  C2 H 5 NH 2  NH 3
97. The number of primary amines of formula C4H11N is
1) 1 2) 3 3) 4 4) 2
98. On electrolysis 1 mole Al atoms will be deposited by
1) 1 mole of electrons 2) 2 moles of electrons
3) 3 moles of electrons 4) 6 moles of electrons
99. For the cell given below, at 250C
Zn  s  | Zn2  C1  || Cu 2  C2  | Cu  s 
(i) When C1  C2  1M ; Ecell  E1 volt
(ii) When C1  0.01M & C2  1M ; Ecell  E2 volt
(iii) When C1  1M & C2  0.01M ; Ecell  E3 volt
Then the correct order is
1) E1 = E2 =E3 2) E2 > E1 > E3 3) E3 > E1 > E2 4) E1 > E2 > E3

100. Which of the following is incorrect match?
1) Glucose, Fructose - Functional isomer
2) Glucose, Galactose – Epimers
3)   D and   D – Glucoses - Anomers
4) D and L – Glucoses – Diasteromers
BOTANY
SECTION – A
101. The following forms the main reason for considering Cyanobacteria under monera
1) Nitrogen fixation 2) Prokaryotic cell structure
3) Presence of cell wall 4) Mucilage sheath
102. In Whittaker’s five kingdom classification Chlamydomonas and Chlorella were
kept along with Amoeba and Paramoecium under
1) Protozoa 2) Animalia 3) Algae 4) Protista
(A) Coccus (I) Rod shaped
(B) Bacillus (II) Spherical
(C) Vibrio (III) Spiral shaped
.
(D) Spirillum (IV) Comma shaped
(A) (B) (C) (D) (A) (B) (C) (D)
.
1) III II I IV 2) IV III II I
3) II I IV III 4) II I III IV
104. Dough kept overnight in warm weather becomes soft and spongy because of
1) Aerobic respiration 2) CO2 absorption
3) Fermentation 4) O2 absorption
105. Cheeses are classified on the basis of A B C. In cheese microorganisms are
required for D . Different types of cheese are produced a large amount of E .
Identify the A, B, C, D, E of the above statement.
1) (A) Texture, (B) Flavour, (C)Taste,(D)Ripening, (E)O2
2) (A) Texture, (B) Smell, (C) Taste, (D) Ripening, (E) CO2
3) (A) Texture, (B) Flavour, (C) Smell, (D) Souring, (E) O2
4) (A) Texture, (B) Flavour, (C) Taste, (D) Ripening (E) CO2
106. Refer to the given figure and select the correct match.
1) (A) Bacterial colony, (B) Fungal colony

2) (A) Fungal colony, (B) Bacterial colony
3) (A) Viral colony, (B) Bacterial colony
4) (A) Fungal colony, (B) Viral colony
107. Choose the incorrect statement regarding Numerical Taxonomy
1) which is now easily carried out using computers is based on all observable
characteristics.
2) Numbers and codes are assigned to all the characters and the data are then
processed.
3) In Numerical Taxonomy each character is not given equal importance
4) At the same time hundreds of characters can be considered .

108. Choose the correct statements regarding heterosporous Pteridophytes.
(I) The megaspores and microspores germinate and give rise to female and male
gametophytes, respectively.
(II) The female gametophytes in these plants are retained on the parent
sporophytes for variable periods.
(III) The development of the zygotes into young embryos take place within the
female gametophytes.
(IV) These are precursor for seed habitat.
1) I, III and IV are correct. 2) II, III and IV are correct.
3) I, II and V are correct. 4) I, II, III and IV are correct.
109. The dipantic life cycle is observed in
1) Algae 2) Marchantia 3) Mosses 4) Fucus
110. Which statement is not correct regarding EcoRI?
1) ‘E’ refers to the genus of the bacteria from which the enzyme is isolated
2) ‘I’ refers to the order in which the enzyme is isolated in a particular strain
3) ‘co’ refers to the cold habitat of the bacteria
4) ‘R’ refers to the strain of the bacteria
111. Restriction enzymes were isolated from
1) Bacteria 2) Fungi 3) Protozoan 4) Bacteriophage
112. Which of the following restriction endonuclease can be used to cut the DNA at
tetR site in PBR322?
(A) BamHI (B) Sal I (C) EcoRI (D) Cla I (E) Pst-I
1) A & C 2) Both A & B 3) D & E 4) A & C
113. Statement-I: Restriction enzymes belong to a larger class of enzymes called
nucleases
Statement-II: Restriction enzymes recognise a specific palindromic sequence in
the DNA
3) Both Statements I, II are true 4) Both Statements I, II are false
Column-I Column-II
P) Endonuclease a) Cuts at the ends of DNA
Q) Exonuclease b) GAATTC
R) EcoRI c) Cuts within the DNA
1) P-a, Q-b, R-c 2) P-c, Q-b, R-a 3) P-c, Q-a, R-b 4) P-a, Q-c, R-b
115. Consider the following.
A. Region of meristematic activity.
B. Region of elongation.
C. Region of maturation.
What will be the correct sequence of different regions of roots from the apex?
1) CBA 2) ABC 3) ACB 4) BCA
116. Which among the following is an incorrect pair?
Family Fruit
1) Brassicaceae Siliqua
2) Fabaceae Legume
3) Malvaceae Cypsela
4) Gramineae Caryopsis
117. Statement –I :Arrangement of main vein and its branches in leaf is called
venation.
Statement –II :Parallel venation is characteristic of dicotyledons.

Column-I Column-II
a) Hilum (i) Pore on seed coat
b) Scutellum (ii) Covering on plumule
c) Micropyle (iii) Scar on seed coat
d) Coleoptile (iv) Cotyledon of monocot seed
3) a-(ii), b-(iv), c-(i), d-(iii) 4) a-(iii), b-(iv), c-(i), d-(ii)
119. Match the column I with II w.r.t. lac operon and select the correct option.
Column-I Column-II
a) lac z (i) Repressor protein
b) lac y (ii) Hydrolysis of lactose
c) lac a (iii) Increases permeability of cell to -galactosides
d) i gene (iv) Transfer acetyl group to -galactosidase
1) a(iv), b(iii), c(ii), d(i) 2) a(iii), b(i), c(ii), d(iv)
3) a(ii), b(iii), c(iv), d(i) 4) a(i), b(iii), c(iv), d(ii)
120. Transcription in prokaryotes
1) Is initiated by only core RNA polymerase enzyme
2) Is elongated by  factor
3) Is carried by three RNA polymerase
4) Is terminated by ‘Rho’ factor
121. The given below diagram represents the components of a
transcription unit. Select the correct option :-
A B C
1) Terminator Promoter Non-coding strand
2) Promoter Terminator Coding strand
3) Promoter Terminator Sense strand
4) Terminator Promoter Coding Strand
122. Match column-I with column-II and select the correct combination
from the given options.
(A) Sigma factor (I) 5' – 3'
(B) Capping (II) Initiation of Transcription.
(C) Tailing (III) Termination of Transcription
(D) Coding strand (IV) 5' end
(V) 3' end
(A) (B) (C) (D) (A) (B) (C) (D)
1) III V IV II 2) II IV V I
3) II IV V III 4) III V IV I
123. Find out the correct match :-
(i) RNA – polymerase – I a) hn – RNA
(ii) RNA – Polymerase – II b) t – RNA
(iii) RNA – Polymerase – III c) 18 – S rRNA
1) I-a, ii-b, iii-c 2) i-b,ii-c, iii-a 3) i-a,ii-c,iii-b 4) i-c, ii-a, iii-b
124. During DNA replication, Okazaki fragments are used to elongate:
1) The lagging strand towards replication fork
2) The leading strand away from replication fork
3) The lagging strand away from the replication fork
4) The leading strand towards replication fork.
125. Mesophyll is included in
1) Epidermal tissue system 2) Ground tissue system
3) Vascular tissue system 4) All of the above

126. Assertion : Conjoint type of vascular bundles are present in stems and leaves.
Reason : In stems & leaves xylem and phloem are jointly situated along the same
radius of vascular bundles.
127. In temperate region plants, the wood with fewer xylary elements and narrow
vessels, is termed as
1) spring wood 2) autumn 3) sap wood 4) heart wood
128. Heterozygous tall plants were crossed with dwarf plants what will be the
percentage of dwarf plants in the progeny.
1) 50% 2) 25% 3) 75% 4) 100%
129. Which one of the following cannot be obtained on the basis of Mendelian law of
dominance?
1) Alleles do not show any blending and both the charaters recover as such in F2
generation.
2) Factors occur in pairs
3) The discrete unit controlling a particular charater is called a factor.
4) Out of one pair of factors, one is dominant and the other recessive.
130. Which one from those given below is the period for mendelian hybridization
experiments?
1) 1840-1850 2) 1857-1869 3) 1870-1877 4) 1856 - 1863
131. Segregation of alleles is a random process, so what would be the chances of a
gamete containing either alleles?
1) 25% 2) 50% 3) 75% 4) 100%
132. Assertion (A): Off springs have characteristics of both the parents.
Reason (R): Characters pass from the parents to their progeny.
133. Algal cell wall is made up of
1) Cellulose, hemicellulose and pectins 2) Cellulose and galactans
3) Mannans and minerals (CaCO3) 4) Both 2 and 3
134. Correlate the given features of animal cells (I to IV) with their respective parts :-
(I) The structure replicates during division and generates the spindle.
(II) Main arena for cellular activities (III) Power house of the cell.
(IV) Increases the surface area for the absorption of materials.
The correct option is :-
I II III IV I II III IV
1) B E H J 2) H D E J
3) H B E G 4) H D G E

135. Persistent nucellus is called as ........ and is found in.....
1) Perisperm, black pepper 2) Perisperm, groundnut
3) Endosperm, black pepper 4) Endosperm, groundnut
SECTION – B
136. The portion of embryonal axis above the level of cotyledons is called :-
1) Hypocotyl 2) Epicotyl 3) Coleorhiza 4) Coleoptile
137. In young anther a group of compactly arranged homogenous cells called :
1) Microsporangium 2) Sporogenous tissue
3) Pollen grains 4) Tapetum
138. In angiosperms pollen grains are shed at 2 called stage in :-
1) 40% plant 2) 30% plant 3) < 50% plant 4) > 60% plant
139. Enzymes, vitamins and hormones can be classified into a single category of
biological chemicals, because all of these
1) Enhance oxidative metabolism
2) Are conjugated proteins
3) Are exclusively synthesised in the body of a living organism
4) Help in regulating metabolism
140. Statement –I : Aminoacids are organic compounds by containing an amino
group and carboxylic group only by  carbon.
Statement –II : Based on nature of R group on -carbon aminoacids are many
types.
141. Typical growth curve in plants is
1) Stair-steps shaped 2) Parabolic 3) Sigmoid 4) Linear
142. The scientists who identified the kinetin is ______
1) Skoog 2) F.W.Went
3) F.Skoog and Miller 4) Miller and Went
143. The gaseous plant growth regulator is used in plants to
1) Kill dicotyledonous weeds in the fields
2) Speed up the malting process
3) Promote root growth and root hair formation to increase the absorption surface
4) Help over come apical dominance
144. A stars which are radiated from centrosome are
1) microbodies 2) microfilaments
3) microtubules 4) mesosomes
145. Select correct statement w.r.t. to Telophase – I
A) Reappearance of nucleolus and nuclear membrane
B) Chromosomes do reach the extremely extended state of interphase nucleus.
C) It is followed by cytokinesis
1) A only 2) A & B only 3) B & C only 4) A & C only
146. If a plant growing in the condition where only light of wavelengths beyond 680nm
are available then find correct option –
(i) No NADPH2 formation (ii) e back to same reaction center
(iii) Only PS II is active (iv) ATP formed
(v) O2 evolution takes – place
Options –
1) (iii) & (iv) are correct 2) ii, iii & iv are correct
3) i, ii & iv are correct 4) iv & v are correct
147. Which of the following is incorrect?
1) Usually the chloroplasts align themselves along the walls of the mesophyll
cells, such that they get the optimum quantity of the incident light.
2) CO2 assimilation reactions are not directly light driven but are dependent on
the products of light reaction.
3) Chlorophyll a absorbs more blue than chlorophyll b and chlorophyll b absorbs
more red than chlorophyll a.
4) The stroma lamellae membranes lack PS II as well as NADP reductase
enzymes.

148. Statement I : As electrons move through the photosystems, protons are
transported aross the membrane.
Statement II : This happens because the primary accepter of electron which is
located towards the outer side of the membrane transfers its electron not to an
electron carrier but to an H carrier.
149. Enzymes of electron transport system are present in
1) Inner mitochondrial membrane 2) Matrix
3) Intermembranous space 4) Endoplasmic reticulum
150. Identify enzyme A in the given reaction of Kreb’s cycle
OAA+Acetyl Co−A+H2O → Citric acid + Co – A
1) Oxaloacetate synthetase 2) Citrate synthetase
3) Aconitase 4) Dehydrogenase
ZOOLOGY
SECTION – A
151. The figures (A-D) show four animals. Select the correct option with respect to a
common characteristic of two of these animals.
1) A and D respire mainly through body wall

2) B and C show radial symmetry
3) A and B have cnidoblasts for defense
4) C and D have a true coelom
152. Assertion (A): pO2 at tissues is less compared to the oxygenated blood.
Reason (R): Low concentration of oxygen at tissues allow dissociation of
oxyhaemoglobin.
153. Exoskeleton of each segment in cockroach consists of
1) Dorsal tergum and a ventral sternum 2) Dorsal sternum and a ventral
tergum
3) Sternum only 4) Tergum only
154. Increasing osmolarity towards the inner medullary interstitium i.e. from 300 to
1200 mOsm/lit is caused by _________.
1) NaCl & H2O 2) NaCl & Urea 3) Only NaCl 4) NaCl & Ammonia
1) There are two types of synapse, namely electrical synapse and chemical
synapse
2) Electrical synapse are rare in human body
3) At chemical synapse, the membrane of pre-and-post synaptic neurons are in
very close proximity
4) Transmission of an impulse across electrical synapses is very similar to
impulse conduction along a single axon

156. (a) Glucagon acts mainly on hepatocytes and stimulates gluconeogenesis
resulting in hyperglycemia
(b) Glucagon stimulates glycogenolysis resulting in hyperglycemia
(c) Glucagon increases cellular glucose uptake and utilisation
(d) Glucagon is not a peptide hormone
(e) Glucagon is secreted by pancreatic islets
How many of the above statements are correct?
1) 1 2) 2 3) 3 4) 4
157. The joint between the two carpal bones and two tarsal bones is
1) Gliding joint 2) Ball and socket joint
3) Hinge joint 4) Saddle joint
158. Which of the following statement is false?
1) WHO has defined reproductive health as a total well being in all aspects of
reproduction in physical, emotional, behavioral, social.
2) Incidence of infection of STDs is maximum in individuals of 15-24 yrs of age.
3) Family planning was initiated in 1951 in India.
4) RCH is a popular contraceptive method.
159. Statement –I: The secretions of the acrosome help the sperm enter into the
cytoplasm of the ovum through the zona pellucida and the plasma membrane of
primary oocyte.
Statement –II: During pregnancy all events of the menstrual cycle stop, but
there is menstruation.
statement-I
4) Both statement-I and II are incorrect
160. Due to genetic and unknown reasons the body attacks self cells.
Identify the disease.
1)Simple Goitre 2) Polio 3) Cancer 4) Rheumatoid arthritis
161. Select the correct statement from the following .
1) The virus HIV enter into the mast cells and replicate to form viral DNA
2) The virus HIV enters into the macrophages and replicates to form viral DNA
3) AIDS result in weight gain, cold and constipation.
4) Treatment of AIDS with anti - retro viral drug is completely curable.
162. During density gradient separation in DNA fingerprinting, major peak represents,
1) Satellite DNA 2) Bulk DNA 3) Circular DNA 4) Repetitive DNA
A. The detritus food chain (DFC) begins with detrivores.
B. In an aquatic ecosystem, GFC is a major conduit for energy flow.
C. Some of the organisms of DFC are prey to the grazing food chain (GFC)
animals.
1) Only A and B 2) Only A and C 3) Only B and C 4) A, B and C
164. Amensalism is _______ type of interaction.
1) (+) and (0) 2) (0) and (–) 3) (+) and (–) 4) (–) and (–)
165. Phenylketonuria (PKU) :
(A) Is controlled by four unlinked genes on chromosome 16.
(B) Inherited as the autosomal recessive trait.
(C) Is a quantitative inheritance.
1) A, B, C 2) B only 3) A only 4) A, B
166. From the traits given below, choose the ones which exhibits polygenic
inheritance.
a. Phenylketonuria
b. Height in humans
c. Skin colour in humans
d. Blood group in humans
e. Alpha thalassemia
1) b,d 2) a,b,c,d,e 3) c only 4) b,c

167. Which of the following is incorrect w.r.t RNAi?
1) Present in all eukaryotic organisms 2) Method of cellular defense
3) Prevent transcription of the gene 4) Involves silencing of specific mRNA
168. One reason for emphysema is –
1) Cigarette smoking 2) Drug addiction
3) Morphine abuse 4) Heavy exercise
169. The term ‘systematics’ refers to
1) Identification and classification of plants and animals
2) Diversity of kinds of organisms and their relationship
3) Nomenclature and identification of plants and animals
4) Different kinds of organisms and their classification
170. Assertion (A): DCT maintain the pH and Na  K  balance in blood.
Reason (R) : DCT is capable of reabsorption of HCO3 and selective secretion of
Hydrogen, K+ ions.
171. Match the following columns :
(A) Ammonotelism (I) Process of release of urine
(B) Bowman’s capsule (II) Requires least amount of water
(C) Micturation (III) Requires more amount of water
.
(D) Uricotelism (IV) Encloses glomerulus
.
(A) (B) (C) (D) (A) (B) (C) (D)

1) III IV II I 2) II IV I III
3) III IV I II 4) I II III IV
172. In humans, during parturition the stimulatory reflex occurs between.
1) The ovary contraction and causes stronger uterine contraction
2) The uterine muscle contraction and causes stronger ovary contractions
3) The uterine muscle contraction and oxytocin secretion
4) The falloplan tube and uterus
173. Choose the correct pathway of the transmission of impulses in heart beat.
1) AV node- SA node- Bundle of His- Purkinje fibres
2) SA node- AV node- Bundle of His- Purkinje fibres
3) SA node- Bundle of His- AV node- Purkinje fibres
4) SA node- Purkinje fibres- Bundle of His- AV node
174. Frog is an amphibian because
1) Tail is not found in it 2) Lungs are found in it
3) Its tadpoles are aquatic in nature 4) It lives in water as well as on land
1) Parthenium – Water hyacinth 2) Eicchornia – Carrot grass
3) Lantana – Nile perch 4) Clarias gariepinus – African catfish
176. Fossils dissovered in Java in 1891 the must stage of human evolution ______
1) Homo habilis 2) Homo erectus 3) Australopithecines 4) Ramapithecus
177. The correct match for convergent evolution.
1) Bandicoot & Wombat 2) More sugarglider
3) Lemur & Spotted cuscus 4) Lemur & wombat
178. Na-K pump transports
1) 3Na  into cellular fluid and 2K  into axoplasm
2) 3Na  into axoplasm and 2K  into cellular fluid
3) 2Na  into axoplasm and 3K  into cellular fluid
4) Blocks the movement of Na  and alow K  movement
179. Which of the following will not coagulate when placed separately on four slides?
1) Blood serum 2) Blood plasma
3) Blood from pulmonary vein 4) Blood from lymphatic tissue
180. The close contact with infected persons (or) their belongings should be avoided
for diseases such as.
a) Typhoid b) Common cold c) Malaria d) Pneumonia e) Ring worm
1) a,c,b 2) a ,b 3) c,d 4) b,d,e

181. Study the following characters and choose the correct option that lists the
characters of Chondrichthyes and Osteichthyes.
A. Internal fertilisation B. External fertilisation
C. Terminal mouth D. Ventral mouth
E. Placoid scales F. Operculum
G. Air bladder
Chondrichthyes Osteichthyes
1) A, C & F B, D,F& G
2) A, D, E & G B,C& F
3) A, D & E B,C,F & G
4) B, D,E& F A, C, & G
182. Assertion (A): Catecholamines are called emergency hormones.
Reason (R): Both the hormones (Catecholamines) decrease the heart rate,
strength of contraction and rate of respiration.
1) If both A & R are true, and R is correct explanation of A
2) If both A & R are true, and R is not correct explanation of A
3) If A is true but R is false 4) If A is false but R is true
183. The Earth is considered as an open ecosystem with reference to which of the
following factor/(s):
1) Oceans 2) Nutrients 3) Energy 4) All the above
184. The acromion process articulates with the
1) Scapula 2) Clavicle 3) Ribs 4) Vertebral column
185. Pick the odd one out
1) Tautara 2) Turle 3) Lizard 4) Stegosaurus
SECTION – B
186. In cockroach, foregut comprises of
1) Pharynx, oesophagus, crop, and gizzard 2) Mesenteron, crop and gizzard
3) Ileum, colon, and rectum 4) Pharynx, oesophagus, and rectum
187. Assertion : Biodiversity is not uniform throughout the world.
Reason : Biodiversity increases as we move from equator to polar region.
the assertion
188. Embryos never pass through the adult stages of other animals. This is according
to
1) Earest Haeckel 2) Hugo de Vries 3) Morgan 4) Von Baer
189. The concept of ‘rivet popper hypothesis’ given by
1) American ecologist Paul Ehrlich 2) German ecologist Paul Ehrlich
3) Stanford ecologist Paul Ehrlich 4) German geographer Paul Ehrlich
190. ________ and ________ provide micro environments for the development and
maturation of T-lymphocytes
1) Bone marrow and Thyroid 2) Bone marrow and thymus
3) Spleen and lymph nodes 4) Tonsils and bone marrow
191. Expressed sequence tags are
1) Polymorphism in VNTR 2) Genes that are expressed as RNA
3) Whole set of genome 4) Coding and non coding sequence
192. In which one of the following, the genus name, its two characters and its phylum
are not correctly
Genus name Characters Phylum
1 Pila i) Body segmented Mollusca
ii) Mouth with radula
2 Asterias i) Spiny skinned Echindodermata
3 Sycon i) Pore bearing Porifera
ii) Canal system
4 Periplaneta i) Jointed appendages Arthropoda
ii) Chitinous exoskeleton

193. Assertion (A): Of the incident solar radiation, less than 50 percent of it is
photosynthetically active radiation.
Reason (R): Plants capture only 50 percent of the PAR and this small amount of
energy sustains the entire living world.
1) Both Assertion (A) and Reason (R) are true, and Reason (R) is a correct
explanation of Assertion (A).
2) Both Assertion (A) and Reason (R) are true, but Reason (R) is not a correct
explanation of Assertion (A).
3) Assertion (A) is true, and Reason (R) is false.
4) Assertion (A) is false, and Reason (R) is true.
194. Choose the right one
2) IUDs increase phagocytosis reaction in the uterus
4) IUDs once inserted need not be replaced
195. Hibernation exhibited by ________
1) Polar bear 2) Zooplanktons 3) Siberiancranes 4) All the above
196. Statement I: Female worker honey bee can have father, but they cannot have
sons.
Statement II: In honey bee, union of sperm and ovum results in formation of
Queen or drone.
197. An unaffected couple have 50% haemophilic sons and 50% non-haemophilic sons
and 50% carrier daughters. The gene for haemophilia is located on
1) X chromosome of father 2) Both X chromosomes of mother
3) One X chromosomes of mother 4) Y chromosome of father
198. In india how many recombinant therapeutics are being presently marketed?
1) 30 2) 20 3) 12 4) 21
199. What will be the pO2 and pCO2 in the atmospheric air compared to those in the
alveolar?
1) pO2 lesser, pCO2 higher 2) pO2 higher, pCO2 lesser
3) pO2 higher, pCO2 higher 4) pO2 lesser, pCO2 lesser
200. In human being the duration of cardiac cycle is ___________
1) 0.8 min 2) 0.5 sec 3) 0.8 sec 4) 8 sec
*******

: ANSWER KEY:
SET-2 SUB: PHYSICS
1 4 11 4 21 2 31 2 41 3
2 4 12 2 22 2 32 3 42 2
3 4 13 2 23 1 33 3 43 3
4 2 14 1 24 1 34 2 44 3
5 1 15 3 25 2 35 3 45 4
6 1 16 3 26 1 36 2 46 1
7 4 17 3 27 4 37 4 47 2
8 2 18 2 28 2 38 3 48 1
9 4 19 2 29 2 39 2 49 1
10 4 20 2 30 3 40 1 50 2
SUB:CHEMISTRY
51 4 61 4 71 4 81 1 91 4
52 3 62 3 72 3 82 3 92 1
53 3 63 3 73 1 83 2 93 4
54 3 64 4 74 2 84 2 94 3
55 2 65 4 75 4 85 2 95 3
56 2 66 3 76 4 86 2 96 4
57 3 67 4 77 2 87 4 97 3
58 1 68 2 78 3 88 3 98 3
59 1 69 4 79 1 89 2 99 2
60 3 70 2 80 3 90 3 100 4
SUB : BOTANY
101 2 111 1 121 4 131 2 141 3
102 4 112 2 122 2 132 1 142 3
103 3 113 3 123 4 133 4 143 3
104 3 114 3 124 3 134 2 144 3
105 4 115 1 125 2 135 1 145 4
106 2 116 3 126 1 136 2 146 3
107 3 117 3 127 1 137 2 147 3
108 4 118 4 128 1 138 4 148 3
109 4 119 3 129 1 139 4 149 1
110 3 120 4 130 4 140 4 150 2
151 4 161 2 171 3 181 3 191 2
152 1 162 2 172 3 182 3 192 1
153 1 163 3 173 2 183 3 193 3
154 2 164 2 174 4 184 2 194 2
155 3 165 2 175 4 185 4 195 1
156 3 166 4 176 2 186 1 196 1
157 1 167 3 177 3 187 3 197 3
158 4 168 1 178 1 188 4 198 3
159 4 169 2 179 1 189 3 199 2
160 4 170 2 180 4 190 2 200 3

NEET GRAND TEST - 3
answer sheet.
CORRECT.
Section-B;
Marking Scheme :

PHYSICS
SECTION – A
1. S  A 1  e  Bxt  , where S is speed and x is displacement. The unit of B is
1) m1s 1 2) m2 s 3) s 2 4) s 1
  
2. The resultant of two vectors A and B is perpendicular to the vector A and its
 
magnitude is equal to half the magnitude of vector B . The angle between A and

B is
1) 120o 2) 150o 3) 135o 4) None of these
3. Identical guns fire identical bullets horizontally at the same speed form the same
height above level planes, one on the Earth and another one on the Moon. Which
of the following statement are “TRUE”?
I) The horizontal distance travelled by the bullet is greater for the moon,
II) The flight time is less for the bullet on the Earth.
III) The velocities of the bullets at impact are the same.
1) III only 2) I and III only 3) I and II only 4) II and III only
4. A mass M is suspended from a spring of negligible mass. The spring is pulled a
little and then released so that the mass executes SHM of time period T. If the
5T m
mass is increased by m, the time period becomes . Then the ratio of is
3 M
25 16 5 3
1) 2) 3) 4)
9 9 3 5
5. An iron bar (young’s modulus = 10 N/m , α = 10 / C) 1 m long and 10-2 m2 in
10 2 -5 o
area is heated from 0oC to 50oC without being allowed to bend or expand. Find the
compressive force developed inside the bar
1) 50,000 N 2) 1000 N 3) 5000 N 4) 105 N
6. In which of the following process, heat is neither absorbed nor released by a
system?
1) Adiabatic 2) Isobaric 3) Isochoric 4) Isothermal
7. A cylinder rolls without slipping down an inclined plane, the number f degrees of
freedom it has, is
1) 2 2) 3 3) 5 4) 1
2
8. The bulk modulus of a liquid is 3  10 Nm . The pressure required to reduce the
10
volume of liquid by 2% is
1) 3  108 Nm 2 2) 9  108 Nm 2 3) 6  108 Nm 2 4) 12  108 Nm 2
9. When temperature is increased
A. Viscosityof the gas increases B. Viscosity of the gas decreases
C. Viscosity of the liquid decreases D. Viscosity of the liquid increases
1) A and C are true 2) B and C are true
3) B and D are true 4) A and D are true
10. Scent sprayer is based on
1) Charle’s law 2) Boyle’s law
3) Archimedes principle 4) Bermoulli’s therorem
11. A 3kg mass and a 4kg mass are placed on x and y axes at a distance of 1 metre
from the origin and a 1kg mass is placed at the origin. Then the resultant
gravitational force on 1kg mass is
1) 7G 2) G 3) 5G 4) 3G
12. An open pipe is in resonance in 2 harmonic with frequency f1. Now one end of
nd
the tube is closed and frequency is increased to f2 such that the resonance again
occurs in nth harmonic. Choose the correct option.
3 5 5 3
1) n  3, f 2  f1 2) n  3, f 2  f1 3) n  5, f 2  f1 4) n  5, f 2  f1
4 4 4 4
13. Which of following statement is true.
1) COM of a rigid body is always inside the body.
2) Mass must be present physically at COM.
3) COM of two particle system is closer to particle with greater mass.
4) All above statements are true

14. The field of view is maximum for
1) Plane mirror 2) Concave mirror 3) Convex mirror 4) Cylindrical mirror
15. In Young double slit experiment, how many minimas can be obtained on a
screen, if wavelength of light used is 2000 Å and slit width is 0.0008 mm.
1) 6 2) 7 3) 8 4) 9
16. When YDSE is carried out in liquid, 5 bright fringe lies at a point on the screen
th
where 3rd dark fringe was lying in air. The refractive index of the medium is
1) 1.5 2) 3 3) 2 4) 1.2
17. The figure shows some of the electric field lines corresponding to an electric field.
The figure suggests.
1) EA > EB > EC 2) EA = EB = EC 3) EA = EC > EB 4) EA = EC < EB

18. Out of the two following statements.
A) Two like charges can only produce a null point.
B) Due to two opposite charges infinite number of zero potential points are
formed.
1) A is correct B is wrong 2) A is wrong and B is correct
3) Both A and B are wrong 4) Both A and B are correct
19. Three identical condensers are connected in different combinations using all
three each time arrange the following cases in the increasing order of effective
capacity.
(i) all in series
(ii) all in parallel
(iii) two in series and one in parallel
(iv) two in parallel and one in series
1) i,iv,iii,ii 2) i,ii,iii,iv 3) ii,iii,i,iv 4) iii,ii,iv,i
20. Two circular coils 1 and 2 are made from the same wire but the radius of the 1st
coil is twice that of the 2nd coil. What is the ratio of potential difference applied
across them, so that the magnetic field at their centres is the same?
1) 3 2) 4 3) 5 4) 2
21. Two long straight conductors with currents I1 and I2 are along X and Y axes. The
equation of locus of points of zero magnetic induction is
1) Y = X
I X
2) Y  2
I1
I
3) Y  1 X
I2
X
4) Y 
I1 I 2
22. I. When radius of a circular wire carrying curernt is doubled, its magnetc moment
becomes four tiems.
II. Magnetic moment is directly proportional to area of the loop.
Which of the follwong statement(s) is/are correct?
1) Only I 2) Only II 3) Both I and II 4) None of these
23. An iron rod of susceptibility 599 is subjected to a magnetizing field of 1200 Am 1 .
The permeability of the material of the rod is (Take,  0  4  10 7 T m A 1 )
1) 8.0  10 5 T m A 1 2) 2.4  10 5 T m A 1 3) 2.4  10 7 T m A 1 4) 2.4  10 4 T m A 1
24. The magnetic flux linked with a coil at any instant ‘t’ is given by  = 5t3 – 100t +
300, the e.m.f. induced in the coil at t = 2 second is
1) – 40 V 2) 40 V 3) 140 V 4) 300 V
25. When a certain metallic surface is illuminated with monochromatic light of
wavelength 𝜆, the stopping potential for photoelectric current is 3𝑉 and when
same surface is illuminated with light of wavelength 2𝜆 , the same stopping
potential is 𝑉 . The threshold wavelength of this surface for photoelectric effect is
1) 6𝜆 2)4𝜆/3 3) 4𝜆 4) 8𝜆

26. In the Bohr model of hydrogen atom, the centripetal force is furnished by the
coulomb attraction between the proton and the electron. If a0 is the radius of the
ground state orbit, m is the mass and e is the charge on the electron and 0 is
the vaccum permittivity, the speed of the electron is:
e e 4 0 a0 m
1) Zero 2) 3) 4)
0 a0 m 4 0 a0 m e
27. Which of the junction diodes shows here are forward biased?
28. The acceleration due to gravity on the planet A is 9 times the acceleration due to
gravity on planet B. A man jumps to a height of 2m on the surface of A. What is
the height of jump by the same person on the planet B?
1) (2/9)m 2) 18m 3) 6m 4) (2/3) m
29. A ball thrown by one player reached the other in 2s. The maximum height
attained by the ball above the point of projection will be (g = 10 m/s2)
1) 2.5m 2) 5m 3) 7.5m 4) 10m
2
30. k / r represents the force under which a particle is moving in a circle of radius r.
The total energy of the particle is
k 2k k k
1) 2) 3) 4) 
2r r r 2r
31. An ideal gas is compresed to half its initial volume by means of several process.
Which of the process results in the maximum work done on the gas?
1) Adiabatic 2) Isobaric 3) Isochoric 4) Isothermal
32. A diatomic molecule has how many degrees of freedom
1) 3 2) 4 3) 5 4) 6
33. The moment of inertia in rotational motion is equivalent to :–
1) angular velocity of linear motion 2) mass of linear motion
3) frequency of linear motion 4) current
34. A real, inverted and equal in size image is formed by
1) a concave mirror 2) a convex mirror
3) a plane mirror 4) none of these
35. When you walk through a metal detector carrying a metal object in your pocket, it
raises an alarm. This phenomenon works on
1) Electromagentic induction 2) Resonance in ac circuit
3) Mutual induction in ac circuits 4) Interference of electromagnetic waves
SECTION – B
36. The circular divisions of shown screw gauge are 50. It moves 0.5mm on main
scale in one rotation. The diameter of the ball is
1) 2.25 mm 2) 2.20 mm 3) 1.20 mm 4) 1.25 mm

37. A simple pendulum is released from A as shown in the figure. If m and l
represent, the mass of the bob and length of the pendulum respectively, the gain
in kinetic energy at B is
mgl 3 mgl 2
1) 2) mgl 3) 4) mgl
2 2 2 3
0.8
38. y  x, t   represents a moving pulse where x and y are in metres and
 4 x  5t 2  5 
 
t in second. Then :
1) pulse is moving in positive x-direction 2) in 2s it will travel a distance of 2.5m
3) its maximum displacement is 0.8m 4) particle vibrating along x-axis
39. An infinitely long cylinder is kept parallel to an uniform magnetic field B directed
along positive z axis. The direction of induced current on the surface of cylinder
as seen from the z axis will be
1) Clockwise of the +ve z axis 2) Anticlockwise of the +ve z axis
3) Zero 4) Along the magnetic field
11
40. The radius of hydrogen atom in its ground state is 5.3  10 m . After collision
11
with an electron it is found to have a radius of 21.2  10 m . What is the principle
quantum number n, of the final state of the atom:
1) n  4 2) n  2 3) n  16 4) n  13
41. A system as shown in figure is in equilibrium and is at rest. The spring and
string are massles, now the string is cut. The acceleration of the masses ‘2m’ and
‘m’ just after the string is cut, will be
g g
1) upwards, g downwards 2) g upwards, downwards
2 2
3) g upwards, 2g downwards 4) 2g upwards, g downwards
42. For a gas at a temperature T the root mean square velocity vrms, the most
probable speed vmp, and the average speed average obey the relationship.
1) vav > vrms > vmp 2) vrms > vav > vmp 3) vmp > vav > vrms 4) vmp > vrms > vav
43. A thin conducting ring of radius R is given a charge +Q. The electric field at the
centre O of the ring due to the charge on the part AKB of the ring is E. The
electric field at the centre due to the charge on the part ACDB of the ring is (K is
mid point of AB)
1) E along KO 2) 3E along OK 3) 3E along KO 4) E along OK

44. A wire has a non-uniform cross-section as shownin figure. A steady current flows
through it. The drift speed of electrons at points P and Q is vP and vQ, then :-
1) vP = vQ 2) vP < vQ 3) vP > vQ 4) data is insufficient

45. The plot represents the flow of current through a wire for different time intervals.
The ratio of charges flowing through the wire corresponding to these time
intervals is (see figure) :
1) 2 : 1 : 2 2) 1 : 3 : 3 3) 1 : 1 : 1 4) 2 : 3 : 4
46. Statement – I: An AC circuit undergoes electrical resonance if it contains either a
capacitor or an inductor.
Statement – II: An AC circuit containing a pure capacitor or a pure inductor
consumes high power due to its non-zero power factor.
In the light of above statements, choose the correct answer from the options given
below.
47. Two identical photo-cathodes receive light of frequencies f1 and f2 . If the velocities
of the photo electrons (of mass m ) coming out are respectively v1 and v 2 , then
1/2
 2h  2h
1) v1  v 2    f1  f2  2) v12  v 22   f1  f2 
m  m
1/2
 2h  2h
3) v1  v 2    f1  f2  4) v12  v 22   f1  f2 
m  m
48. A ball bounces to 80% of its original height. What fraction of its mechanical
energy is lost in each bounce?
1) 20% 2) 25% 3) 26% 4) 30%
49. Two spheres made of same substance have diameters in the ratio 2 : 1. Their
thermal capacities are in the ratio of :
1) 1 : 2 2) 8 : 1 3) 1 : 4 4) 2 : 1
50. The following table provides the set of values of V and I obtained for a given diode.
Let the characteristics  be nearly linear, over this range, the forward and reverse
bias resistance of the given diode respectively are
V I
2.0V 60mA
Forward basing
2.4V 80mA
0V 0A
Reverse basing
-2V -0.25A
1) 10,8 10 
6
2) 20, 4  10 
5
3) 20,8  106  4) 10,10
CHEMISTRY
SECTION – A
51. Which of the following shows higher freezing point?
1) 1.6 molal aqueous Urea 2) 0.9 molal aqueous KCl
3) 0.8 molal aqueous BaCl2 4) 0.6 molal aqueous AlCl3
52. 10g of NaOH is dissolved in 400ml of aqueous solution. 20ml of this solution
neutralises 50ml of given HCl solution. Then the weight of HCl present in 1 litre
of given HCl solution is ______g.
1) 4.563 2) 2.281 3) 9.125 4) 18.25

53. Identify a reagent from the following list which can easily distinguish between
1- Butyne and 2-Butyne?
1) Bromine in CCl4 2) H2, Lindlar’s catalyst
3) Dilute sulphuric acid, HgSO4 4) Ammonical Cu2Cl2 solution
54. IE1 and IE2 of magnesium are 178 and 348 K.cal/mole respectively. The energy
required for the reaction, Mg  g   Mg g2  2e  is_______per 1 mole Mg atoms
1) +178 K.cal 2) +348 K.cal 3) +526 K.cal 4) +170 K.cal
55. The radii of F  , F , O 2  and O are in the order
1) O2  F   O  F 2) O2  F   F  O 3) F   O2  F  O 4) O2  O  F   F
56. Which is not the correct IUPAC name ?
1) Ethanedioic acid 2) 4 – pentanone
3) Pentanedial 4) Pent – 2 – ene
57. Assertion (A) : The frequency of ultraviolet radiation is greater than the
frequency of infrared radiation.
Reason(R) : The velocity of ultraviolet radiation is greater than the velocity of
infrared radiation.
of the Assertion
of the Assertion
58. Glucose does not react with
1) NaHSO3 2) Schiff’s reagent 3) Tollen’s reagent 4) Both 1 and 2
59. Match the following columns :
Column-I Column-II
1) A pair of optical isomers A)
2) A pair of geometrical B)
isomers and
diastereomers
3) A pair of metamers C) C2H5OC2H5; CH3OC3H7

4) A pair of diastereomers D)
Codes :
1 2 3 4 1 2 3 4
1) D A C B 2) A B D C
3) C D B A 4) B C A D
60. Libermann’s nitroso test used for identification of which functional group in
organic compounds
1) Alcohol 2) 1o -amine 3) Phenolic 4) Aldehyde
61. An aqueous solution of a substance gives a white precipitate on treatment with
dilute hydrochloric acid, which dissolves on heating. When hydrogen sulphide
gas is passed through the hot acidic solution, a black precipitate is obtained. The
substance is a
1) Hg 22 salt 2) Cu 2 salt 3) Ag  salt 4) Pb2 salt
62. When a salt solution is treated with aqueous AgNO3 solution then a dark yellow
ppt is formed which is insoluble in ammonia. Then the given salt
contains___anion.
1) Cl  2) Br  3) I  4) NO3

63. Which of the following order is not correct?
1) SF2 > SF4 > SF6 (ionic character)
2) AlF3 < Al2O3 < AIN (covalent character)
3) MgCl2 < AlCl3 < SiCl4 (covalent character)
4) CaCl2 < ZnCl2 < CdCl2 (ionic character)
64. The solubility product of CaSO4 is 6.4 x 10-5. The solubility of salt in moles / litre
is:
1) 8 x 10-16 2) 8 x 10-2 3) 8 x 10-3 4) 1.6 x 10-3
Column-I Column-II
A) Trigonal planar p) PCl5
B) Tetrahedral q) NH 4
C) Trigonal bipyramidal r) SF6
D) Octahedral s) BF3
1) A-p, B-q, C-r, D-s 2) A-s, B-r, C-q, D-p

3) A-s, B-q, C-p, D-r 4) A-r, B-p, C-q, D-s
66. Which of the following compound is aromatic?
1) 2) 3) 4) All of these
67. Correct statement about inductive effect is :

1) It is a temporary effect
2) It decreases as the distance increases
3) It doesn’t depend upon the electronegativity
4) It operates through -bond only

3
68. Assertion : B ion does not exists.
Reason : Sum of IP1, IP2 & IP3 of Boron is very high.
of Assertion
69. Assertion : PbI4 does not exists.
Reason : Pb-I bond formed during the reaction does not release enough energy to
unpair 6s2 electrons and excite one of them to higher orbital.
of Assertion
70. Which will undergo fastest SN 2 substitution reaction when treated with NaOH ?
71. ,
Y in the above reaction is

1) Hexane 2) Cyclohexane 3)Cyclohexylcyclohexane 4) Dicyclohexylether
72. Statement I: When 2-fluorobutane is reacted with alcoholic KOH then butene-1
is formed as major product.
Statement II: Butene-2 is more stable than butene-1.
73. Starting with 2 moles of A and 1 mole of B, the following reaction
2 A + 3B  X + 2Y
is made to take place. Assume the reaction goes to completion. Match the
number of moles listed in column II with various species listed in Column I at the
end of the reaction.
List-I List-II
(a) A (P) 1/3
(b) B (Q) 2/3
(c) X (R) 0.0
(d) Y (S) 4/3
(a) (b) (c) (d) (a) (b) (c) (d)
(1) S R P Q (2) P Q R S
(3) Q S R P (4) Q R S P
74. Chlorophyll, the green colouring matter of plants responsible for photosynthesis,
contains 2.68% of magnesium by mass. The number of magnesium atoms in
2.00g of chlorophyll is
(1) 1.345 × 1021 (2) 1.345 × 1020
(3) 13.45 × 1021 (4) 1.345 × 1023
75. In the reaction: As2 S3  HNO3  H 3 AsO4  H 2 SO4  NO, the element oxidized is/are:
1) As only 2) S only 3) N only 4) Both As and S

76. Which reagent will you use for the following reaction?
CH3CH2CH2CH3 
CH3CH2CH2CH2Cl  CH3CH2CHClCH3
1) Cl2 / UV light 2) NaCl + H2SO4
3) Cl2 gas in dark 4) Cl2 gas in the presence of iron in dark.
77. Arrange the following compounds in the increasing order of their densities.
1) (I) < (II) < (III) < (IV) 2) (I) < (III) < (IV) < (II)
3) (IV) < (III) < (II) < (I) 4) (II) < (IV) < (III) < (I)
78. Which one of the following is wrong?
1) Oxygen and sulphur belong to the same group of periodic table
2) Oxygen is a gas while sulphur is solid
3) Both oxygen and sulphurn show +2,+4 and +6 oxidation states
4) H 2 S has no hydrogen bonding
79. Boiling point is very high for
1) He 2) Ne 3) Kr 4) Xe
80. For a reaction, A+B →products; the rate law is given by
rate  K  A  B 
3/2 1
. Then the order of reaction ___________
1) Zero 2) -1 3) 3/2 4) 1/2
81. 75% of first order reaction is completed in 40min. Then the rate constant of the
reaction is _____
1) 0.05min-1 2) 0.3465 mol.L-1.min-1
3) 0.03465 min-1 4) 0.114 min-1
82. Benzenediazonium chloride on reaction with phenol in weakly basic medium
gives
1) diphenyl ether 2) p-hydroxyazobenzene
3) chlorobenzene 4) Benzene
83. Methanol and ethanol are distinguished by:
1) Treating with Schiff's reagent 2) Treating with Lucas reagent
3) Heating with iodine and alkali 4) Treating with CrO3 in dil. H2SO4
84. Which of the following is an extenstive property?
1) Molar entropy 2) Viscosity 3) Pressure 4) Heat capacity
85. When 1 mol of water at 100 C is converted into steam at 100 o C at a constant
o
 
pressure of 1 atm, the entropy change in cal K 1mol1 is : [Heat of vaporization of
water at 100 C  540 cal/g ]
o
1) 6.66 2) 12.44 3) 20.22 4) 26.06

SECTION – B
86. In the alloy mischmetall, along with 95% of lanthanoid, which of the following has
higher percentage in its total composition?
1) Al 2) Ca 3) Fe 4) S
87. In which of the following pairs both the ions are coloured in aqueous solutions?
1) Sc3+, Ti3+ 2) Sc3+, Co2+ 3) Ni2+, Zn2 4) Ni2+, Ti3+
88. Which of the following is the best method for synthesis of benzoic acid from
bromobenzene?
H 3O  H 3O 
1) C6 H 5 Br  KCN 
 A   2) C6 H 5 Br  AgCN  A  
4) C6 H5 Br  
Mg
3) C6 H 5 Br 
Mg
THF
 A 
CO2
H O
 THF
3
89. Hydrolysis of an ester gives acid A and alcohol B. The acid reduces Fehling’s
solution. Oxidation of alcohol B gives acid A. The ester is
1) Methyl formate 2) Ethyl formate 3) Methyl acetate 4) Ethyl acetate
90. Select the incorrect option regarding Na3[CoF6]
1) Octahedral geometry 2) High spin complex
3) 4 unpaired electrons 4) d2sp3 hybridisation

3
91. Spin only magnetic moment value of  Mn  CN 6  ion is
1) 2.83 BM 2) 3.87 BM 3) 4.9 BM 4) 1.73 BM
92. Which of the following is not an outer orbital complex?
2)  MnCl6  3)  FeF6  4) CoF6 
3 3 3 3
1)  Co  C 2 O4 3 
93. For which of the following the pH is exactly 3 ?
1) 0.001M CH3COOH 2) 0.001M NaCl
3) 0.001M NaOH 4) 0.0005M H2SO4
94. Which of the following linear combinations of atomic orbitals is correctly
depicted?
95. How much PCl5 must be added to a one litre vessel kept at 250oC in order to

obtain 0.1 mole of Cl2 gas [ KC for PCl5 g   PCl3 g   Cl2 g  is 0.0414 mol/L ]
1) 0.0341 mole 2) 0.341 mole 3) 0.241 mole 4) 0.024 mole
96. The conjugate base of  CH 3 2 NH 2 is

1)  CH 3 2 NH 2)  CH 3 2 N  3)  CH 3 3 N  4)  CH 3 2 N 
97. Arrange the following amines in the decreasing order of their basicity
1) 1 > 3 > 2 2) 3 > 2 > 1 3) 1 > 2 > 3 4) 2 > 1 > 3

98. For the following cell reaction
Al  s  / Al 3 1M  // Fe 2 1M  / Fe  s 
Standard Gibb’s energy change is ______ kJ
Given : E Al0 3 / Al  1.66 V and E Fe
0
2
/ Fe
 0.44 V
1) -117.73 2) -353.19 3) -235.46 4) -706.38
A) In galvanic cell chemical energy of a redox reaction is converted to electrical
energy.
B) In electrolytic cell a non-spontaneous reaction is taken place by passing
electricity .
C) Nickel-cadmium cell has longer life than lead storage battery
100. A gas absorbs a photon of wavelength 355 nm and emit it at two wavelengths. If
one of the emissions is at 680 nm, the other is at
1) 1035 nm 2) 325 nm 3) 743 nm 4) 518 nm
BOTANY
SECTION – A
101. The organisms considered as “smallest known living cells” differ from all the other
members of its own kingdom by being
1) facultively anaerobic 2) Parasitic
3) Wall less 4) Prokaryotic
102. The name of some common diseases are given below
Cholera, Typhoid, Tobacco Mosaic, Influenza, Tetanus, Citrus – canker
How many of the above are bacterial diseases caused in human beings?

(A) Photoautotrophs (I) Recycling of nutrients
(B) Chemoautotrophs (II) Most abundant
(C) Heterotrophic (III) Water blooms
bacteria
.
(D) Pathogenic (IV) Mycoplasmas
(A) (B) (C) (D) (A) (B) (C) (D)
.
1) III IV II I 2) I II III IV
3) II I IV III 4) III I II IV
104. Select a mismatch.
1) Plague – Bacterial disease
2) Whooping - Cough – Kali khansi-Viral infection
3) Diphtheria - Gal ghotus - Bacterial disease
4) Leprosy – Kushtrog - Bacterial disease
105. Pick out a true statements from the following:
1) A) Prolife means – not against,
B) Alexander Fleming discovered staphylo cocci
2) A) Antibiotics are chemical substances,
B) Staphylococci are tend to form chains
3) A) ‘Anti’ is a Greek word that means – against,
B) Flemming, Chain, and flory were awarded their noble prize for the discovery
of penicillin
4) A) Bio means life,
B) A chemical produced by the virus kills the growth of moulds on unwashed
petridishes.
106. Which of the following options contains the end products formed during
anaerobic respiration in yeast?
1) H2O, CO2 and energy 2) H2S, C6H12O6 and energy
3) CO2, C2H5OH and energy 4) H2O and CO2 only
1) The haploid gametophyte is main plant body in Algae , Bryophytes .
2) The diploid sporophyte is dominant phase in Pteridophytes, Gymnosperms,
and Angiosperms.
3) Both gametophyte and sporophyte phases are free-living, photosynthetic in life
cycle of Pteridophytes.
4) Both gametophyte and sporophyte phases are free-living, photosynthetic in life
cycle of bryophytes.
108. Choose the Mismatched pair
1) Isogamous………… Ulothrix, Spirogyra 2) Anisogamous…………… Eudorina
3) Oogamous………… Volvox, Fucus. 4) Nonmotile Isogametes…… Ulothrix
109. Which of the following are correct for gymnosperms?
I. They are heterosporous.
II. The roots are generally tap roots.
III. Posses fruits
IV. Requires water for fertilization.
1) I, and II are correct. 2) II, III and IV are correct.
3) I, II and V are correct. 4) I, II, III and IV are correct
110. Restriction enzymes are
1) Not required in genetic engineering
2) Essential tool in genetic engineering
3) Nucleases that cleave DNA at specific sites
4) Both (2) and (3)
111. Find out the correct polindromic sequence of DNA.
𝐺𝐴𝑇𝐺𝐴𝑇 𝐴𝐴𝐴𝑇𝐶𝐺 𝐴𝐴𝐴𝑇𝑇𝐴 𝐺𝐺𝐶𝐺𝐶𝐶
1) 2) 3) 4)
𝐶𝑇𝐴𝐶𝑇𝐴 𝑇𝑇𝑇𝐴𝐺𝐶 𝑇𝑇𝑇𝐴𝐴𝑇 𝐶𝐶𝐺𝐶𝐺𝐺
112. Recognition sequence in EcoRI is
1) GGCC 2) GAATTC 3) AAGCTT 4) CTGCAG

113. With respect to the agarose gel electrophoresis:
Statement-I: The matrix used in this technique is artificial polymer
Statement-II: After exposed to UV light, it has to be stained with Etbr (Ethidium
bromide).
4) Both Statements I and II are correct
Column-I Column-II
p) Lysozyme a) Plant
q) Cellulase b) Bacteria
r) Chitinase c) Fungi
1) p-a, q-b, r-c 2) p-c, q-b, r-a 3) p-b,q-a, r-c 4) p-b, q-c, r-a
115. Identify the region of root on the basis of the given statement.
A. Cells of this region are very small, thin-walled, and with dense protoplasm.
B. Cells of this region are responsible for the growth of root in length.
C. Some epidermal cells of this region form very fine and delicate thread-like
structures.
A B C
1) Region of meristematic activity Region of elongation Region of maturation
2) Region of meristematic activity Region of cell Region of maturation
differentiation
3) Region of elongation Region of meristematic Region of cell
activity differentiation
4) Region of cell differentiation Region of meristematic Region of elongation
activity
116. Which of the following character is not represented by the given floral diagram of
an angiospermic family?
1) Bicarpellary ovary 2) Imbricate aestivation in calyx

3) Axile placentation 4) Tetradynamous condition of stamen
A :Calyx K, sepals five, free.

B :Androecium : stamens five epiphyllous.
C : Gynoecium : Bicarpellary, apocarpous, parietal placentation.
1) Only A and B are true 2) C and A are true
3) Only A and B are false 4) A, B, C are false
Column-I Column-II
a) Adelphous stamens (i) Carpels more than one, free
b) Apocarpous (ii) Filaments fused; anthers free
c) Syncarpous (iii) Filaments attached to petals
d) Epipetalous (iv) Carpels more than one, fused
1) a-(ii), b-(i), c-(iv), d-(iii) 2) a-(iv), b-(ii), c-(i), d-(iii)
3) a-(iii), b-(iv), c-(i), d-(ii) 4) a-(iv), b-(iii), c-(ii), d-(i)
119. On hydrolysis of a nucleoside would not yield
1) Purine 2) Pyrimidine 3) Pentose sugar 4) Phosphate

120. Which of the following is synthesized through reverse transcription?
1) m-RNA 2) r-RNA 3) t-RNA 4) c-DNA
121. Which of the following correctly represents a replicating fork?
122. DNA and RNA differ with respect to :-

1) only purine 2) only pyrimidine
3) only sugar 4) Both nitrogen base and sugar
123. If the sequence of coding strand in a DNA molecule is, 5'
ATCGATCGACTG 3' then the sequence of RNA transcribed from
template strand would be :-
1) 3' ATCGATCGACTG 5' 2) 5' TAGCTAGCTGAC 3'
3) 3' UAGCUAGCUGAC 5' 4) 5' AUCGAUCGACUG 3'
124. Which of following can be coupled in bacteria?
1) Replication & transcription 2) Transcription & translation
3) Replication & translation 4) Both 1 and 2
125. Root hairs are consided as
1) Unicellular elongation of the epidermals cells of epidermis
2) Multicellular elongation of the epidermals cells of epidermis
3) Unicellular elongation of the cortical cells of epidermis
4) 2 & 3
126. Assertion : The innermost layer of the cortex is called endodermis.
Reason : The outermost layer of the root is called epiblema.
127. A dicot root differs from a monocot root in which of the following-
1) Presence of epidermis
2) Presence of pericycle
3) Presence of less-developed (poorlydeveloped) pith
4) Presence of radial vascular bundles
128. In a cross 45 tall and 14 dwarf plants were obtained, genotype of parent would be
1) TT × TT 2) TT × Tt 3) Tt × Tt 4) TT × tt
given:
Column I Column II
(Plastids) (Storage)
(a) Elaioplast i. Protein
(b) Amyloplast ii. Contain xanthophylls
(c) Aleuroplast iii. Carbohydrate
(d) Chromoplast iv. Fat
1) a-i, b-ii, c-iii, d-iv 2) a-iv, b-i, c-ii, d-iii
3) a-ii, b-iii, c-iv, d-I 4) a-iv, b-iii, c-i, d-ii.
130. Genes do not occur in pairs is
1) Zygote 2) Somatic cell 3) Endosperm cell 4) Gametes

131. Co-dominant genes could be best defined as
1) Dominant genes not showing their effect in a homozygous
2) Alleles, each producing an independent
3) Alleles, each producing a coordinating effect on homozygous
4) Dominant genes producing an intermediate
132. Assertion (A): Law of segregation is one of the most important contributions to
genetics.
Reason (R): It introduced the concept of hereditary factors as discrete physical
entities which do not blend.
133. Which of the following kingdoms has no well defined boundaries?
1) Monera 2) Protista 3) Fungi 4) Plantae
134. Which of the following statement of a bacterial cell is/ are correct?
(i) Mesosome is formed by the extensions of plasmamembrane into the cell.
(ii) The pili are elongated tubular structures made up of a protein.
(iii) Fimbriae helps to attach bacteria to host tissues.
(iv) Ribosomes are about 30 cm by 50 cm in size.
1) (i), (ii) and (iii) 2) All of the above
3) (ii) and (iv) only correct 4) Only (i) is correct
135. Read the following statements carefully and identify the correct statement :-
1) Chalaza is present opposite to micropyle
2) Cells of integument of ovule have abundant food material
3) Megasporangium in angiosperm is commonly called carpel
4) In papaver apocarpous gynoecium is present
SECTION – B
136. Study the following diagram carefully and identify the structure which is involved
in triple fusion :
1) A : Synergids 2) B : Polar nuclei 3) C : Egg cell 4) D : Polar nuclei

137. Which of the following are crucial for storage of seeds ?
1) Dehydration and hydration 2) Dehydration and dormancy
3) Hydration and vivipary 4) Dehydration and vivipary
138. Which of the following set of cells have haploid number of chromosome in their
nucleus ?
1) Antipodal cell, synergids, egg 2) Embryo, egg, synergids.
3) Generative cell, megaspore, nucellus 4) Embryo cell, microspore, tapetum
139. The sum total composition of acid soluble and acid insoluble fraction represent
the entire empirical composition of
1) Dead cells 2) Gene pool 3) Cellular pool 4) Gene library
140. Statement –I : Many lipids have both fatty acids and trihydroxy propane with
ester bonds.
Statement –II : By the esterification of glycerol & fatty acids glycerides are
formed. The number of glycerides (mono, Di etc) are equal to number of evoluved
water molecules.

141. Identify the correct statement w.r.t. the leaves given below.
1) A and B both show equal absolute growth rate but relative growth rate of A is
more than B.
2) A shows more absolute as well as relative growth rate
3) B shows more absolute as well as relative growth rate
4) A and B both show equal absolute growth rate but relative growth rate of B is
more than A.
142. Formation of interfascicular cambium and cork cambium are example of
1) Differentiation 2) Dedifferentiation
3) Redifferentiation 4) Both 2 and 3
143. Which of the following statements are incorrect?
1) There are more than 100 gibberellins to be reported.
2) GA3 was one of the gibberellins to be discovered
3) All in GA are basic
4) GAs are also reported in fungi
Column-I Column-II
(I) Leptotene a) Compaction of chromosome
(II) Zygotene b) Separation of chromosome except at
crossover
(III) Pachytene c) Terminalisation of chiasmata
(IV) Diakinesis d) Appearance of recombination of nodules
(V) Diplotene e) Synapsis
1) I-a, II-e, III-d, IV-c, V-b 2) I-a, II-b, III-d, IV-c, V-e
3) I-c, II-d, III-a, IV-e, V-b 4) I-b, II-a, III-d, IV-e, V-c
145. If the amount of DNA of each daughter cell after the result of meiosis is 42 pg,
what would be the amount of DNA of meiocyte in G2phase.
1) 84 pg 2) 42 pg 3) 168 pg 4) 336 pg
146. Which of the following is generally not a limiting factor and major limiting factor
for photosyntheis respectively
1) Light and oxygen 2) Light and carbondioxide
3) Carbondioxide and light 4) Water and carbondioxide
147. Consider the following statement –
A) Action spectrum of Chl a is similar to absorption spectrum of Chl a
B) Phosphorylation occurs in both mitochondria and chloroplast.
How many are correct?
1) Only A 2) Only B 3) Both A and B 4) Both are wrong
148. OAA forms other four carbon acids which are transported to the bundle sheath
cells in C4 leaves
1) Malic acid and oxalic acid 2) Malic acid and aspartic acid
3) Succinic acid and aspartic acid 4) Succinic acid and glutamic acid
149. What will be the RQ for the following equation
2  C51 H 98O6   145O2 102CO2  98H 2O  Energy
1) 0.9 2) 1 3) 0.8 4) 0.7
150. The C – C bond of complex compound is broken by which process of respiration?
1) Oxidation 2) Reduction 3) Hydrogenation 4) Carboxylation

ZOOLOGY
SECTION – A
151. Statement – I : Finch birds show adaptation from its original insect eating
features.
Statement – II : Finches are small black birds.
152. Name the three subspecies of tiger which are extinct.
1) Thylacine, Javan, Caspian 2) Bali, Javan, Thylacine
3) Bali, Quagga, Caspian 4) Bali, Javan, Caspian
153. Frog shows sexual dimorphism. Male frog can be distinguished from female one
in having
1) Sound producing vocal sacs
2) Copulatory pad on the first digit of the hind limb
3) Cloaca 4) Both (1) and (2)
154. In female cockroach, 7th sternum together with 8th and 9th sterna forms
1) A brood/genital pouch 2) Anal cerci
3) Anal style 4) None of these
155. The given graphic representation of age group of a population shows.
1) Declining population 2) Increasing population

3) Stable population 4) Fluctuating population
156. Micturition signal is initiated by ______
1) Stretching of the urinary bladder as it release urine into urethra
2) Stretching of the urinary bladder as it gets filled with urine
3) Ureters only
4) Simultaneous contraction of urethra & urinary bladder.
157. The P wave of the ECG represents _______________
1) ventricular depolarization 2) atrial depolarization
3) ventricular repolarization 4) ventricular systole
158. Some salient features and phyla of organisms are given below. Select the option
which shows correct combination of organisms, its phylum and salient features.
1 Hydra CoelenterataBilateral Cnidoblasts present

symmetry
2 Planaria Platyhelminthes Bilateral High regeneration
symmetry capacity
3 Ancylostoma Mollusca Bilateral Elongated and worm
symmetry shape
4 Octopus Mollusca Radial symmetry Soft sponge layer of
visceral hump
159. The technique of DNA finger printing was initially developed by
1) Laliji Singh 2) Alec Jeffreys 3) Fredrick sanger 4) Mendel
160. Assertion: Pleiotropic gene exhibits multiple phenotypic expression.
Reason: Pleiotropic gene has effect on metabolic pathways that contribute
towards different phenotype.
assertion.

161. Grazing food chain composed with
1) Green plantsherbivoresprimary carnivoressecondary carnivoressun
2) SunGreen plantsherbivoresprimary carnivoressecondary carnivores
3) Green plantssunherbivoresprimary carnivoressecondary
carnivoresdecomposers
4) Green plantsherbivoresprimary carnivoressecondary carnivores
decompoesers
162. Full form of CDRI is
1) Central Development Research Institute
2) Child Development Research Institute
3) Common Development Research Institute
4) Central Drug Research Institute
163. Select the correct events that occur during inspiration.
I. Contraction of diaphragm.
II. Contraction of external inter-costal muscles.
III. Pulmonary volume decreases.
IV. Intra pulmonary pressure increases.
1) III and IV 2) I, II and IV 3) Only IV 4) I and II
164. After ovulation, the path of secondary oocyte in fallopian tube is
A. Fimbriae B. Coelomic cavity C. Infundibulum D. Ampulla
1) ABCD 2) ADCB 3) ACBD 4) BACD
165. The appearance of dry, Scaly lesions on various parts of the body such as skin,
nails and scalp are the main symptoms of the disease.
1) Ascariasis 2) Ring worm 3) Amoebiasis 4) Typhoid
166. Which of the following events can occur in successive tropic levels after the
primary producer level in an ecosystem in terms of chemical energy?
1) No changes in energy levels 2) gradual decreases in energy levels
3) Rapid increases in energy levels 4) random decreases in energy levels
167. In the grassland ecosystem, which of the pyramids are upright?
a. Pyramid of energy b. Pyramid of number c. Pyramid of biomass
1) Only a 2) Only a and b 3) Only c 4) All a, b and c
168. The disadvantage of using bovine insulin (from cow) and porcine insulin (from
pig) in diabetic patients is-
1) More better than humulin 2) It may cause allergic reaction
3) No side effects 4) All of the above
169. Assertion A: The portion of the myofibril between two successive ‘Z’ lines is
considered as the functional unit of contraction called sarcomere.
Reason R: During contraction, ‘I’ bands get reduced whereas ‘A’ bands retain the
length, thereby causing shortening of the sarcomere.
below:
170. The type of natural selection in which more individuls acquire mean charcter
value is called
1) Disruptive selection 2) Stabalising selection
3) Directional selection 4) Geographical isolation
171. Rivert popper hypothesis explains about
1) Role of exotic species in ecosystem stability
2) Role of key species in ecosystem stability
3) Role of plants in an ecosystem
4) Role of hervibores in an ecosystem
172. Select an incorrect statement for predation.
1) Predation is commonly illustrated by the herbivore-carnivore interaction
2) Reduction in prey population may increase the population of predator
3) Predator keeps check on prey population
4) If the predator population increases, it consumes more prey, there by reducing
the population of prey

173. Sweat produced by the sweat glands is a watery fluid, containing the all following
wastes except _______
1) NaCl 2) Small amount of urea
3) Small amount of hydrocarbons 4) Lactic acid
174. The sequence of pulmonary circulation is
1) Left ventricle → pulmonary artery → lungs →pulmonary vein → right atrium
2) Right ventricle → pulmonary artery → lungs →pulmonary vein → left atrium
3) Left ventricle → pulmonary vein → lungs →pulmonary artery → right atrium
4) Right ventricle → pulmonary vein → lungs →pulmonary artery → left atrium
175. Which of the following statements is true?
1) All vetebrates are chordates 2) All chordates are vertebrates
3) Protochordates are non-chordates 4) Protochordates are vertebrates
176. In 1953 S.L. Miller, an America scientist created similar conditions of early earth,
in laboratory scale observed the first formation of _____.
1) Sugars 2) Pigmens & fats 3) Nitorgen bases 4) Aminoacids
177. Statement - I: Pancreas is a composite gland that acts both exocrine &
endocrine.
Statement - II: Testes perform dual function as primary sex organ and endocrine
gland.
178. Statement I: Myotonic dystrophy is autosomal dominant trait.
Statement II: Chromosomal disorders can be easily traced in a family by
pedigree analysis.
1) Statement I is true, Statement II is false 2) Both statement I and II are true
179. In soil dark coloured amorphours substance is humus which is :
1) Highly suitable for microbial action and undergoes decomposition very fast
2) Highly resistant for microbial action and undergoes decomposition very slow
3) low resistant for microbial action and undergoes decomposition very slow
4) Non mineralized colloidal particles that hustle decomposition activity of
microbes.
180. The barrier method of contraception
(a) can be used by males only
(b) prevents physical meeting of sperm and ovum
(c) are used at the time of coitus.
1) (a) and (c) are correct 2) (a), (b), (c) are correct
3) (b) and (c) are correct 4) Only (b) is correct
181. What is correct with respect to diversity in the living world?
1) 1.8 to 1.9 billion 2) Exporing old areas, no new species
3) Exploring new areas, no new species
4) Dense forest will have greater diversity than our living surroundings.
182. The figure shows a diagrammatic view of human respiratory system with labels A,
B, C and D. Select the option, which gives correct identification and main
function and/or characteristic.
1) A–trachea-long tube supported by complete cartilaginous rings for conducting

inspired air
2) 2) B–pleural membrane-surround ribs on both sides to provide cushion against
rubbing
3) C–alveoli-thin walled vascular bag-like structures for exchange of gases
4) D–lower end of lungs-diaphragm pulls it down during inspiration

183. In human genome, the average gene consists of how many bases.
1) 3000 bases 2) 30,000 bases 3) 3 109 bases 4) 3 106 bases
184. Choose the incorrect statement from the following;
1) The ovary secretes oestrogen and progesterone
2) Growing ovarian follicles secretes oestrogen
3) Growing ovarian follicles secretes progesterone
4) After ovulation ruptured graffian follicle is converted to corpus luteum
185. The source of energy for the respiration of plants is
1) NPP 2) GPP 3) GSP 4) NSP
SECTION – B
186. The sliding filament theory states that:
1) Contraction of a muscle fibre takes place by the sliding of the thick filaments
over the thin filaments
2) Contraction of a muscle fibre takes place by the sliding of the thin filaments
over the thick filaments
3) Relaxation of a muscle fibre takes place by the sliding of the thick filaments
over the thin filaments
4) Relaxation of a muscle fibre takes place by the sliding of the thin filaments
over the thick filaments
187. In an anology if tendril is to cucurbita _______ is to penguin.
1) Feather 2) Wing 3) Flipper 4) Beak
188. Cockroaches breath through
1) Nephridia 2) Chloragogen cells 3) Green glands 4) Spiracles
189. Study the following flow chart related to regulation of kidney function.
Activation of osmoreceptors
C
Identify the correct option.
A B C
1. Excessive loss of Stimulate hypothalamus Release of ADH from
fluid from body Adenohypophysis
2. Excessive intake of Inhibits hypothalamus Release of aldosterone
fluids into the body from Adenohypophysis
3. Extreme summer Stimulate hypothalamus Release of aldosterone
season from Adenohypophysis
4. Excessive loss of Stimulate hypothalamus Release of ADH from
fluid from body Neurohypophysis
190. Which of the following has the thickest wall?
1) Right ventricle 2) Left ventricle 3) Right atrium 4) Left atrium
191. Select a set of peptide hormones which are antagonists to each other
1) TCT & PTH 2) Insulin & PTH 3) Glucagon & Insulin4) PTH & Glucagon
192. Choose the incorrect statement from the following.
(i) An unfertilised egg from Queen bee develops in to male by parthenogenesis.
(ii) Male honey bee produces sperm by meiosis
(iii) Male honey bee has half the number of chromosomes as that of Queen
(iv) Queen produces egg by meiosis
1) ii alone 2) ii, iv 3) i,ii,iii,iv 4) iii,iv

A B C D A B C D
1) I IV III II 2) II IV III I
3) I II III IV 4) I II IV III
194. _______, ________ are essential before undertaking any graft or transplant
1) Blood group, Tissue matching 2) Antibiotics, Immuno suppressants
3) Self, non self antigens 4) None of the above
1) Expiration occurs due to external intercostal muscles
2) Intrapulmonary pressure is lower than the atmospheric pressure during
inspiration
3) Inspiration occurs when atmospheric pressure is less than intrapulmonary
pressure
4) Expiration is initiated due to contraction of diaphragm
196. A) Dengue – Alpha virus
B) AIDS – Flavi virus
C) Chikungunya – Retro virus
D) Common cold – Rhino virus
Find the correct match
1) A, B 2) C, D 3) D 4) A, C
197. The parenting that combines with high levels of nurturance and consistent
discipline, has been associated with lowered risk of ________ abuse
1) Tobacco 2) Drug 3) Alcohol 4) All the above
198. Read the following statements and select the correct option
Animal Level of organisation Gut type
1) Spongilla Cellular Complete gut
2) Ctenoplana Organ level Incomplete gut
3) Fasciola Tissue level Incomplete
4) Asterias Organ system Complete gut
199. Best method to conserve genetic strain of commercially important plants :
1) Cold storage 2) Tissue culture
3) Seed bank 4) Sacred grooves
200. Which of the following male accessory glands secretion help in the lubrication of
penis at the time of coitus?
1) Prostate gland 2) Skene’s glands
3) Bulbourethral glands 4) Seminal vesicles
*******

: ANSWER KEY:
SET-2 SUB: PHYSICS
1 1 11 3 21 3 31 1 41 1
2 2 12 3 22 3 32 3 42 2
3 3 13 3 23 4 33 2 43 4
4 2 14 3 24 2 34 1 44 3
5 1 15 3 25 3 35 2 45 3
6 1 16 3 26 3 36 3 46 4
7 1 17 3 27 1 37 2 47 2
8 3 18 2 28 2 38 2 48 1
9 1 19 1 29 2 39 3 49 2
10 4 20 2 30 3 40 2 50 3
SUB:CHEMISTRY
51 1 61 4 71 2 81 3 91 1
52 3 62 3 72 3 82 2 92 1
53 4 63 4 73 1 83 3 93 4
54 3 64 3 74 1 84 4 94 4
55 1 65 3 75 4 85 4 95 2
56 2 66 1 76 1 86 3 96 1
57 3 67 2 77 1 87 4 97 1
58 4 68 1 78 3 88 3 98 4
59 1 69 1 79 4 89 1 99 1
60 3 70 4 80 4 90 4 100 3
SUB : BOTANY
101 3 111 4 121 3 131 2 141 1
102 1 112 2 122 4 132 1 142 2
103 4 113 3 123 4 133 2 143 3
104 2 114 3 124 2 134 1 144 1
105 3 115 1 125 1 135 1 145 3
106 3 116 3 126 2 136 2 146 2
107 4 117 4 127 3 137 2 147 3
108 4 118 1 128 3 138 1 148 2
109 1 119 4 129 4 139 3 149 4
110 4 120 4 130 4 140 2 150 1
151 4 161 2 171 2 181 4 191 3
152 4 162 4 172 2 182 3 192 1
153 1 163 4 173 3 183 1 193 2
154 1 164 4 174 2 184 3 194 1
155 2 165 2 175 1 185 2 195 2
156 2 166 2 176 4 186 2 196 3
157 2 167 4 177 1 187 3 197 4
158 2 168 2 178 1 188 4 198 4
159 2 169 1 179 2 189 4 199 3
160 1 170 2 180 3 190 2 200 3

NEET GRAND TEST - 4
answer sheet.
CORRECT.
Section-B;
Marking Scheme :

PHYSICS
SECTION – A
1. The percentage errors in the measurement of a mass and speed are 2% and 3%
respectively. How much will be the maximum error in the estimate of kinetic
energy obtained by measuring mass and speed?
1) 11% 2) 8% 3) 5% 4) 1%
2. A Zener diode is specified as having a break down voltage of 9.1V, with a
maximum power dissipation of 364 mW. What is the maximum curent the diode
can handle?
1) 40 mA 2) 60 mA 3) 50 mA 4) 45 mA
3. A particle starts from origin at t = 0 with a velocity 5iˆ ms and moves in x-y plane
1
under the action of a force which produces a constant acceleration of 3iˆ  2 ˆj ms 2 .

The x-coordinate at the instant, when its y-coordiante is 64m, is
1) 12m 2) 24m 3) 136m 4) 48m
4. Figure shows the plot of the stopping potential versus the frequency of the light
used in an experiment on photoelectric effect. The ratio ℎ/𝑒 is
1) 0.5 × 10 V s 2) 2 × 10 Vs 3) 3 × 10 Vs 4) 4.14 × 10 Vs
5. A motor car of mass 300kg is moving with a velocity of 25ms-1, by applying
brakes the car was brought to rest in a distance of 15m. The force of retardation
in Newton is
1) 2500 2) 4500 3) 6250 4) 7500
6. In a series LR circuit X L  R and power factor of circuit is P1. When capacitor
with capacitance C such that X L  X C is put in series, the power factor becomes
P1
P2. The ratio is
P2
1 1 3
1) 2) 3) 4) 2 :1
2 2 2
7. A particle of mass m moving in the x-direction with speed 2v is hit by another
particle of mass 2m moving in the y-direction with speed v. If the collision is
perfectly inelastic, the percentage loss in the energy during the collision is close
to
1) 44% 2) 50% 3) 56% 4) 62%
8. Two identical short bar magnets, each having magnetic moment M, are placed a
distance of 2d apart with axes perpendicular to each other in a horizontal plane.
The magnetic induction at a pont mid-way between them is
  2 M 
1) 0 2 3
4
 
M
d
2) 0 3 3
4
 
M
d
3)  0  3
  d
4) 0 5 3
4
 
M
d
9. A simple pendulum has time period ‘t’. Its time period in a lift which is moving
upwards with acceleration 3 ms2 is
9.8 12.8 9.8 6.8
1) t 2) t 3) t 4) t
12.8 9.8 6.8 9.8
10. Copper and silicon are cooled from 300 K to 60 K; the specific resistance:
1) decreases in copper but increases in silicon
2) increases in copper but decreases in silicon
3) increases in both
4) decreases in both
11. Cooling rate of a sphere of 600 K at external environment (200 K) is R. When the
temperature of sphere is reduced to 400 K then cooling rate of the sphere
becomes
1) (3/16) R 2) (16/3) R 3) (9/27) R 4) None

12. ABC is an equilateral triangle of side 2m. If E  10 NC 1 , then VA – VB is
1) 10V 2) -10V 3) 20V 4) -20V

13. Assertion (A) : The electric field due to a short dipoloe on its axial line at a
distance r is E. Then, electric field due to the same dipole on the equatorial line
and at the same distance will be E/2.
Reason (R) : Electric field due to short dipole varies inversely as the square of the
distance.
14. A thermodynamic system is taken through the cycle ABCDA as shown in figure.
Efficiency of diatomic gas is
400 200 500

1) % 2) % 3) % 4) None of these
13 13 13
15. Which statement is not true for polarization of light?
1) Light vibrations are restrained only in one plane
2) Establishes longitudinal nature of light
3) Intensity of light decreases 4) Both (2) & (3)
16. Assertion: Mean free path of gas molecules, varies inversely as density of the gas.
Reason: Mean free path of gas molecules is defined as the average distance
travelled by a molecule between two successive collisions.
17. If the length of a wire is made double and radius is halved of its respective values.
Then, the Young’s modulus of the material of the wire will :
1) Remain same 2) Become 8 times its nitial value
1
3) Become th of its initial value 4) Become 4 times its initial value
4
18. A metal wire of length 0.5m and cross-sectional area 104 m2 has breaking stress
5 108 Nm2 . A block of 10 kg is attached at one end of the string and is rotating in
a horizontal circle. The maximum linear velocity of block will be ______ ms1 .
1) 30 2) 50 3) 65 4) 18
19. An object is 20cm from a convex mirror of focal length 10cm. The iamge formed
by the mirror is
1) Real and at 20cm from the mirror 2) Virtual and at 20cm from the mirror
20 20
3) Virtual and at cm from the mirror 4) Real and at cm from the mirror
3 3
20. A pipe of non-uniform cross-section has two distinct section 1 and 2 with areas
2cm2 and 4cm2 respectively. If the velocity of flowing liquid at section 1 is 5cm/s,
determine the velocity at section 2 in cm/s is:-
1) 2 2) 2.5 3) 3 4) 4

21. The dependence of acceleration due to gravity g on the distance r from the centre
of the earth, assumed to be a sphere of radius R and of uniform density is as
shown in figures.
22. A uniform sphere has radius R. A sphere of diameter R is cut from its edge as
shown. Then the distance of centre of mass of remaining portion from the centre
of mass of the original sphere is
1) R/7 2) R/14 3) 2R/7 4) R/18

23. The ends of a stretched wire of length L are fixed at x = 0 and x = L. In one
x
experiment the distancement of the wire is y1  A sin   sin  t and energy is E1
 L 
 2 x 
and in other experiment its displacement is y2  A sin   sin 2 t and energy is
 L 
E2. Then :
1) E2 = E1 2) E2 = 2E1 3) E2 = 4E1 4) E2 = 16E1
24. Equations of two progressive waves at a certain point in a medium are givne by
y1  a sin t  1  and y1  a sin t  2  . If amplitude and time period of resultant
wave formed by the superposition of these two waves is same as that of both the
waves, then 1  2 is
 2  
1) 2) 3) 4)
3 3 6 4
25. The work done to raise a mass m from the surface of the earth to a height h,
which is equal to the radius of the earth, is
3 1
1) mgR 2) mgR 3) 2mgR 4) mgR
2 2
26. A circle made of a wire of length l and uniform linear density  , then its moment
of inertia with respect to axis parallel to its plane and passing tangentially is ……..
8 2 3 l 2 3 l 3 l 3
1) 2) 3) 4)
3 l 3 8 2 8 2 8 2
27. Assertion: Radis of curvature of a concave mirror is 20cm. If a real object is
placed at 10cm from pole of the mirror, image is formed at infinity.
Reason: When object is placed at focus, its image is formed at infinity concave
and convex mirror.
28. A boat carrying steel balls is floating on the surface of water in a tank. If the balls
are thrown into the tank one by one, then how will it affect the level of water?
1) It will remain unchanged 2) It will rise
3) It will fall 4) It will first rist one then fall

29. Assertion: The root mean square velocity of molecules of a gas having Maxwellian
distribution of velocities is higher than their most probable velocity, at any
temperature.
Reason: A very small number of molecules of gas possess very large velocities.
1
30. The intensity of the polarized light becomes times its initial intensity. The
a
angle between the axis of analyser and polarizer is
 1   1 
1)   tan 1 a  1 2)   tan 1 
 a
  
3)   sin 1 a  1 4)   sin 1 
 a

31. A gas is taken through the cycle ABCA, as shown. What is the net work
done by the gas?
1) 2000J 2) 1000J 3) Zero 4) -2000J

32. X and Y are large, parallel conduciting plates close to each other. Each face has
an area A. X is given a charge Q. Y is without any charge. Points A, B and C are
as shown in the figure.
Q Q
(i) The field at C is (ii) The field at B is
2 0 A 0 A
(iii) The field at A, B and C are of the same magnitude
(iv) The fields at A and C are of the same magnitude, but in opposite directions.
1) (i), (iii), (iv) 2) (ii), (iii) 3) (ii), (iv) 4) (i), (iii)
33. The rectangular surface of area 4 cm x 2 cm of a black body at a temperature
127oC emits energy at the rate of E. If the length and breadth of the surface are
each reduced to half of the initial value and the temperature is raised to 327oC.
The rate of emission of energy will become
3 81 9 81
1) E 2) E 3) E 4) E
8 10 16 64
34. The potential due to the electric dipole at a distance r from the dipole on the axial
line (length of dipole is 2a and charge q)
1 2qa 1 qa 1 4qa
1) 2) Zero 3) 4)
4 0 r 2
4 0 r 2
4 0 r 2
35. At what temperature will the resistance of a copper wire become three times its
value at 0° C ? [Temperature coefficient of resistance for copper = 4 × 10-3 per °C]
1) 400° C 2) 450° C 3) 500° C 4) 600° C

SECTION – B
36. Three masses of 500g, 300g and 100g are suspended at the end of a spring as
shown, and are in equilibrium. When the 500g mass is removed, the system
oscillates with a period of 2 second. When the 300g mass is also removed, it will
oscillate with a period of
1) 2s 2) 4s 3) 8s 4) 1s
37. When an electron is accelerated through a potential difference V, it experiences a
force F through a uniform transverse magnetic field. If the potential difference is
increased to 2V, the force experienced by the electron in the same magnetic field
is
1) 2F 2) 2 2F 3) 2F 4) 4F
38. Assertion: Magnetic field interacts with a moving charge and not with a
stationary charge.
Reason: Magnetic field will be produced by a moving charge but not by a
stationary charge.
4) Both ‘A’ and ‘R’ are true and ‘R’ is not a correct explanation of ‘A’
39. A ball of 0.5kg collided with wall at 30o with normal and bounced back elastically.
The speed of ball was 12m/s. The contact remained for 1s. What is the force
applied by wall on ball?
1) 12 3N 2) 3N 3) 6 3N 4) 3 3N
40. The variation of magnetic susceptibility with the temperature of a ferromagnetic
material can be plotted as
   
1) 2) 3) 4)
T T T T
41. A wheel with ten metallic spokes each 0.50 m long is rotated with a speed of 120
rev/min in a plane normal to the earth’s magnetic field at the place. If the
magnitude of the field is 0.4 Gauss, the induced e.m.f. between the axle and the
rim of the wheel is equal to
1) 1.256 103V 2) 6.28 104V 3) 1.256 104V 4) 6.28 105V
42. The current through an inductor of 1H is given by i  3t sin t
1) 3sin t  3cos t 2) 3cot t  t sin t 3) 3sin t  3t cos t 4) 3t cos t  sin t
43. A coin is dropped in a lift. It takes time t1 to reach the floor when lift is
stationary. It takes time t2 when lift is moving up with constant acceleration.
Then,
1) t1  t 2 2) t2  t1 3) t1 = t2 4) t1 >> t2
44. The frequencies at which the current amplitude in an LCR series circuit becomes
1
times its maximum value, are 212 rad s 1 and 232 rad s 1 . The value of
2
resistance in the circuit is R  5  . The self inductance in the circuit is
__________mH.
1) 50 2) 150 3) 350 4) 250

45. If the relation between the range R and time of flight T of a projectile is given as
R = 5T2, the value of angle of projection is
1) 45o 2) 15o 3) 60o 4) 90o
46. Light from a hydrogen discharge tube is incident on the cathode of a photoelectric
cell, the work function of the cathode surface is 4.2 eV. In order to reduce the
photo-current to zero, the voltage of the anode relative to the cathode must be
made
1) – 4.2 V 2) – 9.4 V 3)– 17.8 V 4) +9.4 V
47. An electron mass ‘m’ and charge ‘e’ initially at rest gets accelerated by a constant
electric field ‘E’. The rarte of change of debrogile wave length of this electron of
time ‘t’. Ignore relativistic effects is
h eht mh mh
1)  2
2)  3)  2
4) 
eEt E eEt eE
0
48. If the number of particles scattered in the Rutherford’s experiment at 90 is 56
per minute. What is the number of particles scattered at 600.
*1) 224 per minute 2) 100 per minute 3) 448 per minute 4) 112 per minute
49. Which of the following circuits provides full wave rectificationof an ac input?
1) 2)
3) 4)
50. If E, m, J and G represent energy, mass, angular momentum and gravitational

constant respectively, then the dimensional formula of EJ 2 / m5G 2 is
1)  MLT 2  2)  M 0 L0T  3)  M 0 L2T 0  4) Dimensionless
CHEMISTRY
SECTION – A
51. Assertion (A): In the cylinders of scuba divers helium gas (11.7%) is added along
with 56.2% N2 and 31.1% of oxygen.
Reason (R) : As helium is least soluble in blood than Nitrogen, it prevents the
problem, bends.
the assertion
52. The vapour pressures of two volatile liquids A and B are 120mm Hg and 190mm
of Hg at 27o C . A solution of these two liquids is taken in a closed beaker at 27o C .
If XA and XB are molefractions of A and B in liquid phase while X 1A and X B1 are
the mole fraction of A and B in vapour phase, then which of the following is
always correct?
1) XA > XB 2) XA < XB 3) X B1 > XB 4) X 1A > XA
53. In sodium fusion test of organic compounds, the nitrogen of an organic
compound is converted to
1) Sodamide 2) Sodium cyanide 3) Sodium nitrite 4) Sodium nitrate
54. Which of the following sequence contains atomic number of only representative
elements?
1) 55,12,35,53 2) 13,33,54,83 3) 3,33,53,93 4) 22,33,55,66

55. Element ‘X’ belongs to 4 period. It contains 18 and 1 electrons in the
th
penultimate and ultimate orbit respectively. The ‘X’ should be

1) Representative element 2) Transition element
3) Inert gas 4) Inner transition element
56. Which compound is tertiary alcohol?
1) 1 – propanol 2) 2 – methyl – 1 – hexanol
3) 3 – methyl – 2 hexanol 4) 2 – Methyl – 2 - hexanol
57. In a H – atom, the transition takes place from L to K shell. If R = 1.08 x 107m-1,
the wave length of the light emitted is nearly
1) 4400 Ao 2) 1234 Ao 3) 1650 Ao 4) 1850 Ao
58. The maximum number of electrons present in a sub-level with l = 4 and s  1/ 2
is _____
1) 5 2) 3 3) 0 4) 9
59. The isomerism exhibited due to the difference in the nature of the alkyl groups
attached to the same functional gorup is
1) Tautomerism 2) Stereo isomerism
3) Metamerism 4) Optical isomerism
60. To a sulphide ion containing salt solution sodium nitroprusside solution is
added. Then solution turns violet. Then which of the following is wrong?
1) IUPAC name of sodium nitroprusside is, sodium pentacyanido nitrosylium
ferrate(II)
2)Violet colouration is due to the formation of Na4  Fe  CN 5 NOS  complex.
3) Oxidation state of iron in violet coloured complex is +3
4) Oxidation state of iron in sodium nitroprusside is +2.
61. Diamagnetic species among the following is
4)  FeF6 
3 3 3 3
1) Co  C2O4 3  2)  Fe  CN 6  3)  Mn  CN 6 
62. A given salt is mixed with iodide ion containing salt and treated with dil.H2SO4,
violet coloured gas is liberated. This gas turns starch blue. Then the given salt
contains ________ ion.
1) NO2 2) CO32 3) SO42 4) S 2
63. If K1 and K2 are the equilibrium constants of equilibria A and B respectively, then
the relationship between the two constants is
1
A) SO2 g   O2 g   SO3 g   K1 B) 2SO3 g   2SO2 g   O2 g   K 2
2
1 1
1) K1  K 2 2) K2  K12 3) K1  4) K12 
K2 K2
64. Match the column-I and column-II :
Column-I (Molecule) Column-II (Dipolemoment) (D)
A) HCl P) 1.07
B) CCl4 Q) 0.00
C) H2 S R) 0.95
D) NH3 S) 1.47
1) A-P, B-Q, C-R, D-S 2) A-P, B-R, C-Q, D-S

3) A-R, B-Q, C-S, D-P 4) A-Q, B-R, C-P, D-S
65. Which of the following has higher dipole moment?
1) CH3-F 2) CH3-Cl 3) CH3-Br 4) CH3-I
66. Which of the follwiong is correct regarding direction of dipole moment?
1) 2) CH–CH3 3) 4)

67. Which one of the follwong statements is True?
1) PhLi adds to both compound with equal ease

2) PhLi does not add to either of the compound
3) PhLi react readily with 1 but does not add to 2
4) PhLi react readily with 2 but does not add to 1
68. The relative stabilities of +1 oxidation state of 13th group elements is :
1) Al<Ga<In<Tl 2) Al>Ga>In>Tl 3) Ga>Al>In>Tl 4) Tl>Al>Ga>In
69. Assertion : Lead is unaffected by water.
Reason : Lead is inert due to the formation of protective oxide film on its surface.
of Assertion
70. When 3,3 – dimethyl 2-butanol is heated with con.H2SO4, the major product
obtained is
1) 2,3 – dimethyl 2 – butene
2) cis and trans isomers of 2,2 – dimethyl 1-butene
3) 2,3 – dimethyl 1-butene
4) 3,3 – dimethyl 1-butene
71. In the following reaction:
The major product is
72.
73. 6 g of a hydrocarbon for complete combustion requires 22.4g of oxygen and

produces 17.6 g of CO2 and 10.8 g of H2O. This data illustrates the law of :
(1) conservation of mass (2) multiple proportions
(3) constant proportions (4) reciprocal proportions
74. Rearrange the following (I to IV) in the order of increasing masses :
(I) 0.5 mole of O3 (II) 0.5 g.atom of oxygen
(III) 3.011 × 1023 molecules of O2 (IV) 5.6 litre of CO2 at STP
(1) II < IV < III < I (2) II < I < IV < III
(3) IV < II < III < I (4) I < II < III < IV
75. Equivalent weight of Ba(MnO4)2 in acidic medium (M = molar mass)
1) M 2) M/3 3) M/5 4) M/10

76. Identify the compound ‘Y’ in the following reaction.
77. Reaction of C6H5CH2Br with aqueous sodium hydroxide follows

__________________.
1) S N 1 mechanism 2) S N 2 mechanism
3) Any of the above two depending upon the temperature of reaction
4) Saytzeff rule
78. Electron affinity order of chalcogens is
1) S  Se  Te  Po  O 2) O  S  Se  Te  Po
3) S  O  Se  Te  Po 4) O  Po  Te  Se  S
79. Although electron gain enthalpy of fluorine is less negative as compared to
chlorine, Fluorine is stronger oxidising agent than chlorine. This is because of
I. Low enthalpy of dissociation of F-F bond
II. High hydration Enthalpy of F-
III. Smaller size of F2
1) I, II correct 2) I, III correct 3) I, II, III correct 4) II, III correct
80. Assertion (A): When a +ve catalyst is used, the rate of reaction increases
Reason (R) : A +ve catalys provides an alternate path where lower activation
energy is required.
81. The graph drawn between log At vs time gives ______ a straight line.
With positive intercept and negative slope. Magnitude of the slope is 0.02 and
intercept is 0.6021. Then initial rate of the reaction is _____
1) 0.08M.min-1 2) 0.1842min-2.mol.L-1
2 1
3) 4.186  10 M .min 4) 0.1842min-1mol.L-1
82. Which of the following compounds gives fastest reaction with HBr ?
1) (CH3)3COH 2) CH3CH2CH2OH
3) CH3CHOHCH3 4) CH3(CH3)CHCH2OH
83. Compound A, C8H10O, is found to react with NaOI (produced by
reacting Y with NaOH) and yields a yellow precipitate with characteristic smell. A
and Y are respectively:
1) 2)
3) 4)

3
84. S  O2   SO3  2 x kcal;
2
1
SO2  O2   SO3  y kcal;
2
The heat of formation of SO2 is :
1) y – 2x 2) 2x + y 3) x + y 4) 2x/y
85. The heat of vaporization of a liquid at 500K and 1 atm pressure
is 10 kcal/mol. What will be the change in internal energy (U) of 3 moles of
liquid at the same temperature?
1) 30.0 kcal 2) -13.0 kcal 3) 27.0 kcal 4) 33.0 kcal
SECTION – B
86. Assertion (A) : The Mn-O bond length in manganite ion is higher than that in
permanganate ion.
Reason (R) : MnO4 has higher Mn-O bond order than that of MnO42
87. The correct order of decreasing second ionization enthalpy of Ti(22), V(23), Cr(24)
and Mn(25) is:
1) Cr  Mn  V  Ti 2) V  Mn  Cr  Ti 3) Mn  Cr  Ti  V 4) Ti  V  Cr  Mn
88. When propionic acid is treated with aqueous NaHCO3, CO2 is liberated. The
carbon of CO2 comes from
1) Methyl group 2) Carboxylic acid group
3) Methylene group 4) Bicarbonate ion
89. In the following reaction :
NH 3  alc.
CH 3CH 2COOH  Br2
Red P
 X  Y
The product Y is
1) Lactic acid 2) Alanine 3) Ethylamine 4) Propylamine
90. [X] + H2SO4  [Y] a colourless gas with irritating smell,
[Y] + K2Cr2O7 + H2SO4  Green solution, [X] and [Y] is :
1) SO32  , SO2 2) Cl  , HCl 3) S 2  , H 2 S 4) CO32  , CO2
91. In which of the following metal ion configuration, CFSE   0  depends upon the
nature of ligand (neglect pairing energy).
1) d7 2) d8 3) d9 4) d10
2
92. Hybridisation and magnetic moment of Cu in Cu  NH 3  4  are
1) dsp2, 0 BM 2) dsp 2 , 3BM 3) sp3 ,0 BM 4) sp 3 , 3 BM
93. Match the column-I and column-II :
Column-I (Molecule) Column-II (Bond length) (pm)
A) H – Cl P) 127
B) O2 (O = O) Q) 121
C) N=O R) 122
D) CN S) 116
1) A-P, B-Q, C-R, D-S 2) A-S, B-R, C-Q, D-P
3) A-Q, B-S, C-R, D-P 4) A-P, B-R, C-Q, D-P
94. Starting from ‘a’ moles of H2 and ‘b’ moles of I2 an equilibrium H 2  I 2  2 HI is
established with 2x moles of HI. The equilibrium constant KC is
4x 2 4x 2 2x 2 4x2
1) 2) 3) 4)
ab  a  x  b  x   a  x  b  x   a  2 x  b  2 x 
95. The ksp values of three sparingly soluble salts are respectively
AB, 4.0 1016 , XY2 ,3.2 1020 and P2R3, 1.08 1023 . Then the correct order of their
solubilities is _____
1) AB  XY2  P2 R3 2) P2 R3  XY2  AB 3) XY2  AB  P2 R3 4) XY2  P2 R3  AB
96. Which of the following compounds is the weakest Bronsted base?
1) 2) 3) 4)

97. The correct decreasing order of basic strength of the following species is _____
H 2O , NH 3 , OH  , NH 2 .
1) NH 2  OH   NH 3  H 2O 2) OH   NH 2  H 2 O  NH 3
3) NH 3  H 2 O  NH 2  OH  4) H 2O  NH 3  OH   NH 2
98. If mercury is used as cathode in the electrolysis of aq.NaCl solution, the ions
discharged at cathode are
1) H  2) Na  3) OH  4) Cl 
99. The electrochemical equivalent of a metal is “x” g coulomb–1. The equivalent
weight of metal is
1) x 2) x × 96500 3) x/96500 4) 1.6 × 10–19 × x
100. Incorrect match is
1) Amylopectin - Insoluble in water
2) Amylopectin - 15-20% of starch
3) Amylose - Long unbranched chain
4) Starch - Polymer of  - D-glucose
BOTANY
SECTION – A
101. Protistans are connecting link between
1) Fungi and animalia
2) Plants and animals
3) Unicellular prokaryotes and multicellular prokaryotes
4) Unicellular prokaryotes and multicellular eukaryotes
102. The following is not true about protistans
1) They may be motile or non-motile 2) Autotrophic or heterotrophic
3) Walled or wall-less 4) Unicellular or multicellular
(A) Cell wall with stiff cellulose plates (I) Diatoms
(B) Silicified cell wall (II) Slime moulds
(C) Silica shells on surface (III) Dinoflagellates
(D) Fruiting bodies (IV) Marine Amoeboids
.
(A) (B) (C) (D) (A) (B) (C) (D)

.
1) IV I III II 2) IV I V II
3) III I IV II 4) IV II V I
104. In sewage treatment which is sequentially treating to reduce the level of
pollution?
1) Solid waste 2) Liquid waste 3) Grit 4) All
105. Identify the blank spaces A, B, C, D in the following table and select the correct
option.
Type of microbe Scientific name Commercial product
Bacterium A Streptokinase
B Aspergillusniger Citric acid
Fungus Trichoderma polysporum C
Bacterium D Butyric acid
1) A –streptococcus, B- Fungus, C – Cyclosporin-A, D- Clostridium butylicum
2) A-clostridium butylicum, B-Streptococcus, C-Fungus, D-Cyclosporin-A
3) A-streptococcus, B – Yeast, C – Cyclosporin-A, D-Lactobacillus
4) A-streptococcus, B – Cyclosporin-A, C-Statins, D-Clostridium butylicum
106. During the primary treatment of sewage solid particles that settle down are
called?
1) Flocs 2) Primary sludge
3) Activated sludge 4) Anaerobic sludge

I) They usually occur in damp, humid and shaded localities.
II) The plant body of bryophytes is more simple than that of algae.
III) They lack true roots, stem or leaves.
IV) The main plant body of the bryophyte is haploid.
3) I, II and III are correct 4) I, II, III and IV are correct
108. Identify A and B:
1) A–Porphyra, B–Laminaria 2) A–Polysiphonia, B–Porphyra

3) A–Porphyra, B–Polysiphonia 4) A–Volvox, B–Chara
109. How many organisms show haplodiplontic life cycle?

Sphagnum, Volvox, Ulothrix, Marchantia, Polytrichum, Selaginella, Pinus,
Cedrus, Ectocarpus, Polysiphonia
1) Eight 2) Six 3) Seven 4) Nine
110. Given below is a DNA sequence:
5’-ATGCGATGACGATTGACGATGACGATAGAC-3’
Find the correct primer sequence required to synthesize the above DNA in PCR
1) 5’TACGCTAC3’ 2) 5’GTCTATCG3’ 3) 5’TTGCGATG3’ 4) 5’CATCGCAT3’
111. Molecular scissors which can cut DNA at specific locations are
1) DNA polymerase 2) DNA ligases
3) Restriction enzymes 4) Both 1 & 2
112. Plasmids are
1) Extra chromosomal DNA, which cannot self replicate
2) Extra chromosomal DNA which can self replicate
3) Main chromosomal DNA, which cannot self replicate
4) Main chromosomal DNA, which can self replicate
113. Statement-I: Amplification of gene of interest can be done by gel electrophoresis
Statement-II: Preparation of r-DNA required RNA ligase
Column-I Column-II
p) Endonuclease a) ECORI
q) Cloning vectors b) T-DNA
r) Selectable marker c) Tetracycline
s) Ti plasmid d) PBR322
1) p-a, q-d, r-c, s-b 2) p-a, q-b, r-c, s-d
3) p-d, q-c, r-b, s-a 4) p-c, q-b, r-a, s-d
115. The function of stem is
1) Spreading out branches 2) Conduction of water and minerals
3) Storage of food, support and protection 4) More than one option correct
116. Ploidy level of seed structures like endosperm, scutellum, and aleurone layer are
respectively.
1) 3n, 2n, 3n 2) 3n, 2n, 2n 3) 3n, n, 2n 4) 3n, 2n, n

117. Analysse statements w.r.t. below diagram.
S–I :The root is covered by a thimble-like structure called as root cap.
S–II :A few millimeters above the rootcap is the region maturation.
S-III : The cells of meristematic zone are very small, thin-walled and with dense
protoplasm.
S-IV : From the region of maturation, some of the epidermal cells form very fine
and delicate, thread-like structures called root-hairs.
1) Both S-I and S-III are false 2) Only S-II is false
3) Both S-III and S-IV are true 4) Only S-I, S-II, S-III are true
118. Match the Column I with Column II.
Column-I Column-II
a) (i) Brassicaceae
b) (ii) Liliaceae
c) (iii) Fabaceae
d) (iv) Solanaceae
Select the correct answer from the options given below.

1) (a)-(iii), (b)-(iv), (c)-(ii), (d)-(i) 2) (a)-(i), (b)-(ii), (c)-(iii), (d)-(iv)
3) (a)-(ii), (b)-(iii), (c)-(iv), (d)-(i) 4) (a)-(iv), (b)-(ii), (c)-(i), (d)-(iii)
119. In E.coli operator gene combine with :-
1) Inducer gene to switch ON structural gene action
2) Inducer gene to switch off structural gene action
3) Regulator protein (repressor) to switch OFF the structural gene
action
4) Regulator protein to switch ON the structural gene action
120. Observe the following graph.
X,Y,Z respectivley
V V V Vmax
1) K m , Vmax , max 2) Vmax , max , K m 3) K m , max , Vmax 4) , K m , Vmax
2 2 2 2
121. During elongation of translation, newly charged tRNA attached to the
site of ribosome complex?
1) P-site 2) A-Site
3) E-Site 4) Smaller subunit of ribosome
122. There is no anticodons for the following codons on m-RNA
1) UAA, UGG and UGA 2) UAG, UGG and UGA
3) UAA, UAG and UGA 4) UAG, UGA and AUA
123. Assertion : In E. coli, DNA is scattered throughout the cell.
Reason : In E. coli, there is no defined nucleus.
1) Both Assertion & Reason are correct & Reason is correct explanation
for Assertion
2) Both Assertion & Reason are correct but Reason is not correct
explanation for Assertion
3) Assertion is correct and Reason is incorrect
4) Reason is correct and Assertion is incorrect
124. Seed production in coniferous plants by the application of
1) Cytokinin 2) Gibberellins 3) Auxins 4) ABA
125. Epidermal tissue system is made up of
1) Epidermal cells 2) Stomata
3) Epidermal appendages 4) All of these

126. Assertion : Monocotyledonous rotos do not undergo any secondary growth.
Reason : Cambium is absent in vascular bundles of monocotyledonous roots.
127. Polyarch and exarch xylem is the characteristic of-
1) Dicot stem 2) Dicot root 3) Monocot stem 4) Monocot root
128. A plant heterozygous for tallness produces both tall and dwarf plants on self-
pollination this proves.
1) Principle of dominance 2) Law of independent assortment
3) Law of segregation 4) Both 1 and 2
129. Correct representation from the following w.r.t Griffith experiments.
2) S.strain   die
Mice
1) R.strain   live
Mice
3) H.K.S + R.strain  Mice

 mice live 4) Both 1 and 2
130. If a homozygous tall pistillate plant is crossed with a dwarf staminate plant, the
genotype of endosperm will be
1) TTt 2) rrT 3) ttt 4) TTT
131. Multiple alleles are present on
1) Different loci of homologous chromosomes
2) Same loci of non homologous chromosomes
3) Different loci of non homologous chromosomes
4) Same loci of non homologous chromosomes in population.
given
Column-I Column-II
(a) Kinetochores i. Non-staining part
(b) Sec.constriction ii. Microtubules
(c) Cytoskeleton iii. Point of attachment of spindle fibres.
(d) Nucleolus iv. Site for active synthesis of rRNA
1) a-i, b-ii, c-iii, d-iv 2) a-ii, b-iv, c-i, d-iii
3) a-iii, b-i, c-iv, d-ii 4) a-iii, b-i, c-ii, d-iv
133. Identify the labelled part A, B, C and D in given figure of chloroplast :-
134. According to widely accepted “fluid mosaic model”, of cell membranes. Which of
the following statement is incorrect?
1) Proteins in cell membranes can move laterally within the lipid bilayer.
2) Proteins can also undergo flip-flop movements in the lipid bilayer.
3) Ability of proteins to move with in the membrane is measured as fluidity.
4) Lipids in the plasma membrane show quasi fluid nature
135. What is the function of tassels in the corn cob?
1) To protect seeds 2) To attract insects
3) To trap pollen grains 4) To disperse pollen grains

SECTION – B
136. Assertion A: In gymnosperms the pollen grains are released from the
microsporangium and carried by air currents.
Reason R: Air currents carry the pollen grains to the mouth of the archegonia
where the male gametes are discharged and pollen tube is not formed.
given below:
1) Both A and Rare true but R is NOT the current explanation of A
137. Transfer of pollen grains from anther to stigma of another flower of same plant is
known as:
1) Geitonogamy 2) Xenogamy 3) Autogamy 4) Cleistogamy
138. The residual persistent part which forms the perisperm in the seeds of beet is
1) Integument 2) Calyx 3) Endosperm 4) Nucellus
139. Substrate concentration at which an enzyme attains half of its max velocity is
1) Half life of enzyme 2) Km constant of enzyme
3) Concentration ratio 4) Both 2 & 3
140. Statement –I : Carbohydrates, amino acids, lipids, nuclic acids provide the
energy for growth and development of living organisms as primary metabolites.
Statement–II : Secondary metabolites are useful for defence of all living
organisms (plants, animals, fungi, microbes) but they are useful for human
welfare.
141. Identify the given figure.
1) Figure shows geometric growth with formula Lt=L0+rt

2) Figure shows geometric growth with formula ert. W1 = W0 ert
3) Figure shows arithematic growth with formula L1 = L0 +rt
4) Figure shows arithematic growth with formula W1 = W0 ert
142. An example of adenine derivative PGR
1) IAA 2) Kinetin 3) ABA 4) Gibberellic acid
143. Statement – I: Cytokinins are anti ageing hormones
Statement – II : Cytokinins overcome apical dominance
144. Statement I : Interkinesis occurs between two meiotic divisions.
Statement II : Interkinesis occurs between meiosis – I and meiosis – II
1) Statement-I is correct, but Statement-II is incorrect
2) Statement-I is incorrect, but Statement-II is correct

145. Statement A :Root apical meristematic tissue divide all their life.
Statement B :Mitosis in social insects results in haploid daughter cells.
Statement C :Mitosis in lowerparts results in diploid daughter cells.
1) Statement A is correct but Statement B and Statement C are incorrect.
2) Statement A and Statement B are correct but Statement C is incorrect.
3) Statement A, Statement B, Statement – C all are correct.
4) Statement A, Statement B, Statement – C all are incorrect
146. Arrange the following in proper sequence as occuring in z-scheme:
a) Excitation of electrons of PS – II.
b) Down hill transfer of electrons to PS – I.
c) Excitation of electrons and transfer to another acceptor.
d) Uphill transfer of electrons to acceptor.
e) Down hill transfer of electrons causisng NADP+ to reduce into NADPH+H+
1) c,a,b,d,e 2) a,d,b,c,e 3) a,b,d,c,e 4) c,b,a,d,e
147. Which one is incorrect for the cycle given?
1) It is the universal biosynthetic pathway of all the higher photoautotrophic

plants.
2) Six cycle are required to form one glucose molecule.
3) Completes in 3 steps.
4) 12 ATP molecules are required to fix 6 CO2 molecules, through this cycle.
148. Lodicules are not found in
1) Rice 2) Wheat 3) Brinjal 4) Both 1 and 2
149. Fermentation is
1) Aerobic respiration 2) Incomplete oxidation of glucose
3) Complete oxidation of carbohydrate 4) All of the above
150. The respiratory quotient (RQ) or respiratory ratio is
1) RQ = Volume of O2 evolved /Volume of CO2 consumed
2) RQ = Volume of O2 consumed/ Volume of CO2 evolved
3) RQ = Volume of CO2 consumed/ Volume of O2 evolved
4) RQ = Volume of CO2 evolved/ Volume of O2 consumed
ZOOLOGY
SECTION – A
151. The first forms/that invade land are
1) Amphibians 2) Plants 3) Fishes 4) Reptiles
152. Assertion (A) : Darwin asserted that variations which are non-heritable enable
the species to be reproductively fit.
Reason (R) : The work Thomas Malthus on population influenced Darwin.
153. Reptiles were dominant in which era
1) Coenozoic 2) Mesozoic 3) Archeozoic 4) Palaeozoic

154. Evolution of horse started in and as
1) Eocene, Eiohippus 2) Pliocene as Pliohippus
3) Pleistocene, Eqqus 4) Miocene as Merychippus
155. The active chemical drug reserpine is obtained from
1) Datura 2) Rauwolfia 3) Atropa 4) Papaver
156. Biologists are not sure about how many prokaryotic species there might be the
problem is that
1) Converntional taxonomic methods are not suitable for identifying microbial
species
2) Many prokaryotic species are simply culturable under laboratory conditions
3) Microbes are too small that are not easily visible under the microscope
4) Both 1 and 2
157. The major cause of extinction of migratory birds is
1) Pesticides 2) Genetic variability
3) Habitat loss and fragmentation 4) Co-extinction
158. In male frog, cloaca is used to pass out
1) Faecal matter only 2) Urine only
3) Sperms only 4) Faeces, urine and sperm
159. In cockroach, head can move in all directions due to
1) Without any sensory receptors
2) Flexible neck
3) Sensory receptors that help in monitoring the environment
4) Both (2) and (3).
160. Which one of the following is incorrect statement about cockroach?
1) They are serious pest because they destroy food and contaminate it with their
smelly excreta
2) All species have economic importance
3) Development in Periplaneta americana is paurometabolus type
4) Next to last nymphal stage has wing pads
161. According to the idea of co-evolution between predator and prey, when a prey
species evolves a novel defense against a predator.
1) The predator is expected to always go extinct
2) The prey population should increase irreversibly out of controle of the predator
3) Evolution of a predator response should be favoured by natural selection
4) The predator population should increase
162. The given graphic representation of age group of a population shows.
1) Declining population 2) Incresing population

3) Stable population 4) Fluctuating population
163. Excretory organs in crustaceans are __________
1) Protonephridia 2) Green glans 3) Nephridia 4) Kidneys
164. Roughly 1/5 of the blood pumped by each ventricle of the heart in a minute is
th
filtered at _____ during urine formation.

1) Glomerulus only 2) Bowman’s capsule only
3) Renal corpuscle 4) Renal artery

165. Observe the given figure below and label A and B.
A B
1) NaCl Urea
2) Urea NaCl
3) NaCl H2 O
4) H2 O NaCl
166. For circulation, simple organisms such as sponges,coelenterates etc.use
1) Water 2) Blood & lymph 3) Lymph only 4) Haemolymph
167. Select the wrong statement about RBC.
1) Most abundant cells present in blood are RBCs
2) RBCs takes part in O2 and CO2 transport
3) Immature RBCs are non-nucleated
4) They are formed in red bone marrow
168. During ventricular systole
1) Oxygenated blood is pumped into pulmonary artery and deoxygenated blood is
pumped into aorta
2) Oxygenated blood is pumped into aorta and deoxygenated blood is pumped into
pulmonary vein
3) Oxygenated blood is pumped into pulmonary vein and deoxygenated blood is
pumped into pulmonary artery
4) Oxygenated blood is pumped into aorta and deoxygenated blood is pumped into
pulmonary artery
169. The parenting that combines with high levels of nurturance and consistent
discipline, has been associated with lowered risk of ________ abuse
1) Tobacco 2) Drug 3) Alcohol 4) All the above
170. The appearance of dry, Scaly lesions on various parts of the body such as skin,
nails and scalp are the main symptoms of the disease.
1) Ascariasis 2) Ring worm 3) Amoebiasis 4) Typhoid
171. A) Dengue – Alpha virus
B) AIDS – Flavi virus
C) Chikungunya – Retro virus
D) Common cold – Rhino virus
1) A, B 2) C, D 3) D only 4) A, C
172. _______, ________ are essential before undertaking any graft or transplant
1) Blood group, Tissue matching 2) Antibiotics, Immuno suppressants
3) Self, non self antigens 4) None of the above
173. The vasa efferentia in the human reproductive system is blocked, the gametes will
not be transported from
1) Rete testis to epididymis 2) Vagina to uterus
3) Urinary bladder to urethra 4) Ovary to fallopian tube
174. Foetal ejection reflex triggers the release of
1) Oxytocin from the foetal pituitary gland
2) Vasopressin from the material pituitary gland
3) GH from the maternal pituitary gland
4) Oxytocin from the maternal pituitary gland

175. The approach of focusing on identifying the genes that are expressed as RNA in
1) HGP physical mapping 2) genetic mapping
3) Sequence annotation 4) Expressed sequence tags
176. Which of the following statements is correct regarding sponges without any
exception?
1) They have extracellular digestion.
2) They have no co-ordination.
3) They are found only in marine habitat
4) They are all radially symmetrical
177. A common characteristic of all vertebrates without any exception is
1) Notochord 2) Jaws around mouth
3) Two pairs of appendages 4) Dorsal muscular heart
178. Select the correct option that represents animals that exhibit the following
features of reptiles
1) Moist, scaleless skin 2) External ear
3) Epidermal scales 4) Oil gland at the base of the tall
179. Statement - I: Zona fasciculata of adrenal medulla synthesise epinephrine
hormone.
Statement - II: Zona reticularis of adrenal gland secrete steroid hormones.
180. Match the following and choose correct answers
A) Vasopressin i) Defense capability
B) Glucocorticoids ii) Diuresis
C) Melatonin iii) Addison’s disease
1) A-ii, B-iii, C-i 2) A-i, B-iii, C-ii 3) A-iii, B-i, C-ii 4) A-ii, B-i, C-iii
181. The DNA probes used in fingerprinting are
1) Sensitive to IR – rays 2) Radioactive isotopes
3) Emits UV – rays 4) Fluorescent probes
182. Statement I: Phenylketonuria is an autosomal dominant disorder
Statement II: PKU caused by the deletion of two genes located on chromosome 16
183. Given following is a diagram with respect to sex determination in honey bee.
Female Male
32 16
Meiosis C
A 16
Male Female
B D
1) A-16, B-16, C- Mitosis, D- 32 2) A-32, B-16, C- Meiosis, D- 16
3) A-16, B-16, C- Meiosis, D- 16 4) A-16, B-32, C- Mitosis, D- 16
184. Assertion: The chance of occurrence of colour blindness in female is 0.4 percent.
Reason: Female have two X chromosomes as the sex chromosomes.
assertion.
185. Number of autosomes in the somatic cell of an individual affected with Down’s
syndrome would be
1) 47 2) 43 3) 46 4) 45

SECTION – B
186. In an ecosystem, a small standing crop of primary producers supports a large
standing crop of primary consumers. Such a relationship is expressed in
1) Pyramid of number of terrestrial ecosystems
2) Pyramid of biomass of an aquatic ecosystem
3) Pyramid of biomass of terrestrial ecosystem
4) Pyramid of number of aquatic ecosystem.
187. Which of the following option is correctly matched?
1) Net primary productivity - Available biomass for heterotrophs
2) Gross primary productivity - Rate of biomass accumulated in organisms
3) Secondary productivity - Rate of biomass decomposed by microbes
4) Primary productivity - Depends upon environmental factors only
188. If 500 J of energy is trapped at the producer level, then how much energy will be
available to the snake as food in the following chain?
plant→insect→frog→snake→eagle
1) 0.05 J 2) 0.005 J 3) 0.5 J 4) 0.0005 J
189. The barrier method of contraception
(a) Can be used by males only
(b) Prevents physical meeting of sperm and ovum
(c) Are used at the time of coitus.
1) (a) and (c) are correct 2) (a), (b), (c) are correct
3) (b) and (c) are correct 4) Only (b) is correct
190. What is the similarity between vaults and diaphragms?
1) They both prevent ovulation in females.
2) They are used to cover penis of males.
3) They are used to cover the cervix during coitus.
4) They release copper ions to suppress sperm motility
191. Which of the following is correctly matched with its particular taxonomic
category?
1) Triticum – poales - order 2) Fishes – Pisces – Phylum
3) Man – Primate – Family 4) Mango – Sapindales – Class
192. Assertion (A): An increase in pulmonary volume will cause inspiration.
Reason (R): An increase in pulmonary volume increases the intra-pulmonary
pressure to more than the atmospheric pressure.
193. Which of the following factors favour the formation of oxyhaemoglobin in lungs?
1) pO2 ↓, pCO2↑ , H+↑ , Temperature↑ 2) pO2 ↑, pCO2↑ , H+↓ , Temperature↑
3) pO2 ↑, pCO2↓ , H+↓ , Temperature↓ 4) pO2 ↓, pCO2↑ , pH↑ , Temperature↓
194. Receptors associated with aortic arch and carotid artery can recognise changes in
______ and ____ conc. and send necessary signal to _______ for remedial action.
1) O2, CO2, Pneumotaxic centre 2) CO2, H+, respiratory rhythm centre
3) CO2, H+, apneustic centre 4) 02, H+, Pneumotaxic centre
Column-I Column-II
A) Clitoris (i) Male gamete
B) Acrosome (ii) Female accessory gland
C) Seminal vesicle (iii) Male accessory gland
D) Endometrium (iv) Tiny finger like structure
(v) Wall of fallopian tube
(vi) Wall of uterus
Codes :
A B C D A B C D
1) iv i ii v 2) i ii iv vi
3) iv i iii vi 4) ii i iv iii

196. Statement –I : During ovulation usually one ovum is released per menstrual
cycle.
Statement –II : During pregnancy the levels of cortisol, prolactin, thyroxine are
increased several folds in the maternal blood.
197. The main challenge for production of insulin using rDNA techniques was
1) Splitting A and B-peptide chains
2) Addition of C- peptide to proinsulin
3) Getting insulin assembled to mature form
4) Removal of C- peptide from active insulin
198. Which of the following companies prepared human insulin in 1983?
1) Monsanto 2) Eli Lily 3) Genetech 4) GEAC
199. The role of Acetyl choline in muscle contraction is:
1) It attaches the sarcoplasmic reticulum and release the calcium ions
2) It attaches to the sarcolemma and makes membrane more permeable which
generates action potential
3) It attaches to the myosin and makes the myosin to attach with actin
4) It initiates the energy needed for the sliding filaments to move
200. How many of the following statements are true?
A. Increase in calcium level leads to the binding of calcium with all subunits of
troponin.
B. Myosin head binds to the exposed active sites on actin to form a cross bridge
C. This cross bridge pulls the actin filament towards the centre of ‘I’ band.
D. The ‘Z’ line attached to these actins are pulled inwards causing lengthening of
sarcomere.
E. The reaction time of the fibres can vary in different muscles.
*******

: ANSWER KEY:
SET-2 SUB: PHYSICS
1 2 11 1 21 1 31 2 41 4
2 1 12 2 22 2 32 1 42 3
3 3 13 3 23 3 33 4 43 1
4 4 14 1 24 2 34 1 44 4
5 3 15 2 25 4 35 3 45 1
6 2 16 2 26 3 36 4 46 2
7 2 17 1 27 3 37 3 47 1
8 4 18 2 28 3 38 1 48 1
9 1 19 3 29 3 39 3 49 4
10 1 20 2 30 1 40 2 50 4
SUB:CHEMISTRY
51 1 61 1 71 1 81 4 91 1
52 3 62 1 72 2 82 1 92 2
53 2 63 4 73 1 83 3 93 1
54 1 64 1 74 1 84 1 94 2
55 2 65 2 75 4 85 3 95 2
56 4 66 2 76 1 86 1 96 3
57 2 67 3 77 1 87 1 97 1
58 4 68 1 78 1 88 4 98 2
59 3 69 1 79 1 89 2 99 2
60 3 70 1 80 1 90 1 100 2
SUB : BOTANY
101 4 111 3 121 2 131 4 141 2
102 4 112 2 122 3 132 4 142 2
103 3 113 3 123 4 133 1 143 1
104 2 114 1 124 2 134 2 144 2
105 1 115 4 125 4 135 3 145 2
106 2 116 1 126 1 136 2 146 2
107 1 117 2 127 4 137 1 147 4
108 3 118 1 128 1 138 4 148 3
109 2 119 3 129 2 139 2 149 2
110 2 120 2 130 1 140 3 150 4
151 2 161 3 171 3 181 2 191 1
152 4 162 2 172 1 182 1 192 3
153 2 163 2 173 1 183 1 193 3
154 1 164 3 174 4 184 2 194 2
155 2 165 3 175 4 185 4 195 3
156 1 166 1 176 2 186 2 196 1
157 3 167 3 177 1 187 1 197 3
158 4 168 4 178 3 188 1 198 2
159 2 169 4 179 4 189 3 199 2
160 2 170 2 180 1 190 3 200 1

NEET GRAND TEST - 5
answer sheet.
CORRECT.
Section-B;
Marking Scheme :

GT - 5(SET-2) XII & LT-NEET MODEL-24.04.2024
PHYSICS
SECTION – A
1. The thrust developed by a rocket-motor is given by F = mv + A(p1 – p2), where m
is the mass of the gas ejected per unit time v, is velocity of the gas, A is area of
cross-section of the noszzle, p1.p2 are the pressures of the exhaust gas and
surrounding atmosphere. The formula is dimensionally
1) Correct 2) Wrong
3) Sometimes wrong, sometimes correct 4) Data is not adequate
2. Thirteen resistances each of resistance R are connected in the circuit as shown
in the figure. The effective resistance between A and B is :-
4R 2R
1)  2) 2R 3) R 4) 
3 3
3. At the height 80m, an aeroplane is moving with a speed of 150m/s. A bomb is
dropped from it so as to hit a target. At what distance from the target should the
bomb be dropped (given g = 10 m/s2)
1) 600m 2) 500m 3) 80m 4) 230m
4. An object is projected with a velocity of 20m/s making an angle of 45o with
horizontal. The equation for the trajectory is h  Ax  Bx 2 where h is height, x is
horizontal distance, A and B are constants. The ratio A : B is  g  10ms 2 
1) 1 : 5 2) 5 : 1 3) 1 : 40 4) 40 : 1
5. Two masses A and B of15kg and 10kg are connected with a string passing over a
frictionless pulley fixed at the corner of a table (As shown in figure). The
coefficient of friction between the table and block is 0.4. The minimum mass of C,
that may be placed on A to prevent it from moving is:
1) 10kg 2) 5kg 3) Zero 4) 15kg

A) Time period of a charged particle in uniform magnetic field is independent of
K.E of the particle.
B) Time period of a charged particle in uniform magnetic field depends on the
angle between velocity and magnetic field.
C) Time period of a charged particle in uniform magnetic field is inversely
proportional to specific charge.
1) A, B are correct and C is wrong 2) A is correct, B and C are wrong
3) A, C are correct and B is wrong 4) A, B & C are correct
Kinetic energy
7. Assertion : Stopping distance =
Stopping force
Reason : Work done in stopping a body is equal to change in kinetic energy of the
body.
the assertion
of the assertion

8. A telegraph line of length 100 km has a capacity of 0.01  F / km and it carries an
alternating current at 0.5 kilo cycle per second. If minimum impedance is
required, then the value of the inductance that needs to be introduced in series is

_________mH. if   10 
1) 100 2) 200 3) 300 4) 400
9. A clock which keeps correct time at 20 C , is subjected to 40o C . If coefficient of
o
linear expansion of the pendulum is 12 106 per oC . How much will it gain or loose
in time?
1) 10.3 seconds/day 2) 20.6 seconds/day
3) 5 seconds/day 4) 20 minutes/day
10. A pendulum bob is raised to a height h and released from rest. At what height
will it attain half of its maximum speed?
3h h h
1) 2) 3) 4) 0.707h
4 2 4
11. Two identical containers joined by a small pipe initially contain the same gas at
pressure po and absolute temperature To. One container is now maintained at
the same temperature while the other is heated to 2To . The common pressure of
the gases will be
3 4 5
1) po 2) po 3) po 4) 2 po
2 3 3
12. The variation of pressure P with volume V for an ideal diatomic gas is parabolic
an as shown in the figure. The molar specific heat of the gas during this process
is
9R 17 R 3R 8R
1) 2) 3) 4)
5 6 4 5
13. A sample of gas expands from volume V1 to V2. The amount of work done by the
gas is greatest when the expansion is
1) adiabatic 2) isobaric
3) isothermal 4) equal in all above cases
14. Two pure inductors each of self inductance L are connected in parallel but are
well separated from each other. The total inductance is
L L
1) 2L 2) L 3) 4)
2 4
15. A cylinder of capacity 20 litres is filled with H2 gas. The total average kinetic
energy of translatary motion of its molecules is 1.5 105 J . The pressure of
hydrogen in the cylinder is
1) 2 106 N/m2 2) 3 106 N/m2 3) 4 106 N/m2 4) 5 106 N/m2
16. At a certain temperature, the r.m.s. velocity for O2 is 400 m/sec. At the same
temperature, the r.m.s. velocity for H2 molecuels will be
1) 100 m/sec 2) 25 m/sec 3) 1600 m/sec 4) 6400 m/sec
17. One mole of an ideal gas at an initial temperature of T K does 6R joules of work
adiabatically. If the ratio of specific heats of this gas at constant pressure and at
constant volume is 5/3, the final temperature of gas will be
1) (T + 2.4)K 2) (T – 2.4)K 3) (T + 4)K 4) (T – 4) K
18. A rope 1cm in diameter breaks if the tension in it exceeds 500 N. The maximum
tension that may be given to a similar rope of diameter 2cm is
1) 500N 2) 250N 3) 1000N 4) 2000N

19. Three tubes A,B and C are connected to a horizontal pipe in which ideal liqid is
flowing. The radii of the tubes A,B and C at the junction are 2cm, 1cm and 2cm
respectively. It can be said:-
1) The height of the liquid in the tube A is maximum

2) Height of the liquid in the tubes A and B is same
3) Height of the liquid in the tubes A,B and C is same
4) Height of the liquid in the tubes A and C is same
20. Study the circuit shown in the figure. Name the gate that the given circuit
resembles.
1) NAND 2) AND 3) OR 4) NOR

21. The radius of a planet is twice the radius of earth. Both have almost equal
average mass–densities. VP and VE are escape velocities of the planet and the
earth, respectively, then
1) VP = 1.5VE 2) VP=2VE 3) VE = 3VP 4) VE = 1.5VP
22. A ball is dropped from a spacecraft revolving around the earth at a height of
120km. What will happen to the ball?
1) It will fall down to the earth gradually 2) It will go very far in the space
3) It will continue to move with the same speed along the original orbit of
spacecraft
4) It will move with the same speed, tangentially to the spacecraft.
23. The correct curve between intensity of magnetisation (I) and magnetic field (H) for
a ferromagnetic substance is given by
I I I I
1) 2) 3) 4)
H
H H H
24. When an open organ pipe resonates in its fundamental mode then at the centre of
the pipe:
(1) The gas molecules undergo vibrations of maximum displacement amplitude
(2) The gas molecules are at rest
(3) The pressure of the gas is constant
(4) The pressure of the gas undergoes maximum variation
1) 3, 4 2) 2, 3 3) 1, 2 4) 2, 4
25. One quarter section is cut from a uniform circular disc of radius R. This section
has a mass M. It is made to rotate about a line perpendicular to its plane and
passing through the centre of the original disc. Its moment of
inertia about the axis of rotation is :
1 1
1) MR 2 2) MR 2
2 4
1
3) MR 2 4) 2MR 2
8

26. The de Brogile wavelength of an electron in the nth Bohr orbit is related to the
radius R of the orbit as
3
1) n   R 2) n   R 3) n  2 R 4) n  4 R
2
27. If a ray of light takes t1 and t2 times in two media of absolute refractive indices 1
and 2 respectively to travel same distance, then
1) 1t1  2t2 2) 1t2  2t1 3) t1 1  t2 2 4) t1 2  t2 1
28. Rays of light fall on a glass slab ( > 1) as shown in the figure. If  at A is
maximum and at B it is minimum, then what will happen to these rays?
1) they will tilt towards A 2) they will tilt towards B

3) they will not deviate 4) there will be total internal reflection
29. Two monochromatic waves each of amplitude A have a phase difference between

them is . When they superimpose then the amplitude of the resultant wave is
2
1) 2A 2) Zero 3) 4A 4) A 2
30. Two similar conducting balls having charge +q and –q are placed at a separation
d from each other in air. The radius of each ball is r and the separation between
their centres is d(d>>r). Calcualte the capacitance of the two ball system
 r r
1) 4 0 r 2) 2 0 r 3) 4 log e 0 4) 4 log e
d d
31. The electric field intensity at P and Q, in the shown arrangement, are in the ratio
1) 1 : 2 2) 2 : 1 3) 1 : 1 4) 4 : 3
32. Electric chares q, q, -2q are placed at the corners of an equilateral ABC of side l.
The magnitude of electric dipole moment of the system is
1) ql 2) 2ql 3) 3ql 4) 4ql
33. Four equal charges Q are placed at the four corners of a square of each side is ‘a’.
Work done in moving a charge –Q from its centre to infinity
2Q 2 2Q 2 Q2
1) Zero 2) 3) 4)
4 0 a  0 a 2 0 a
34. The average e.m.f. induced in a coil in which the current changes from 2 ampere
to 4 ampere in 0.05 second is 8 volt. What is the self inductance of the coil ?
1) 0.1 H 2) 0.2 H 3) 0.4 H
4) 0.8 H
35. What will be the equivalent resistance between the points A and D?
1) 10 2) 20 3) 30 4) 40

SECTION – B
36. A calorie is a unit of heat and equal 4.2J. Suppose we employ a system of units
in which the unit of mass is  kg, the unit of length is  metre and the unit of
time is  sec. In this new system. 1 calorie =
1)  1 2 2 2) 4.2 2 2 3)  2 2 4) 4.2 1 2 2
37. A bar magnet of moment of inertia I is vibrated in a magnetic field of induction
0.4  10 4 T . The time period of vibration is 12s. The magnetic moment of the
magnet is 120 Am 2 . The moment of inertia of the magnet is  in kg-m 2 
approximately
1) 175.2  10 4 2) 2.1102 3) 1.57  102 4) 1728  10 2
38. Three blocks A, B and C of mass 4kg, 2 kg and 2kg respectively, are in contact on
a frictionless surface, as shown. If a force of 14N is applied on the 4kg block,
then the contact force between A and B is
1) 2N 2) 7N 3) 8N 4) 18N
39. 50 tuning forks are arranged in increasing order of their frequencies such that
each gives 4 beats/sec with its previous tuning fork. If the frequency of the last
fork is octage of the first, then the frequency of the first tuning fork is
1) 200 Hz 2) 204 Hz 3) 196 Hz 4) None of these
40. Assertion (A): The magnetism of magnet is due to the spin motion of electrons.
Reason (R) : Dipole moment of electron is smaller than that due to orbit motion
around nucleus.
1) Both assertion and reason are correct and reason is the correct explanation of
assertion
assertion
3) Assertion is correct but reason is incorrect
4) Assertion is incorrect but reason is correct
41. A spherical conductor having charge q and radius r is placed at the centre of a
spherical shell of radius R and having charge Q (R>r). The potential difference
between the two is
1) Proportional to Q 2) Proportional to q
3) Dependent on both Q and q 4) Independent of both Q and q
42. An ideal gas A and a real gas B have their volumes incrased from V to 2V under
isothermal conditions. The increase in internal energy.
1) will be same in both A and B 2) will be zero in both the gases
3) of B will be more than that of A 4) of A will be more than that of B
43. The impendance of a circuit containing a resistance of 30 and an inductance of
0.4
H which are connected in series, for A.C. source of 50 Hz frequency is:

1) 100  2) 70  3) 50 2  4) 50 
44. Assertion : Two springs of force constants k1 and k2 are stretched by the same
force. If k1 > k2, then work done in stretching the first (W1) is less than work
done in stretching the second (W2).
Reason : F  k1 x1  k2 x2 (where x1 , x2 are extensions in springs)
the assertion
of the assertion

45. If 5% of the energy supplied to a bulb is irradiated as visible light, how many
quanta are emitted per second by a 100 W lamp? Assume wavelength of visible
light as 5.6 × 10 cm
1) 1.4 × 10 2) 3 × 10 3) 1.4 × 10 4) 3 × 10
46. A cube shaped block of mass m and side l is moving with velocity v on a
frictionless horizontal surface. It collides with bulged part P and then after it rolls.
Then its angular speed after the collision will be ………..
3v 3v
1) 2)
4l 2l
3l 5v
3) 4)
4v 4l
47. En and J n denote the total energy and the angular momentum of an electrons in
th
the n allowed orbit of a hydrogen like atom. Then:
1 2
1) En  J n 2) En  J n 3) En  J n 4) En  J n
2

Ans:1
.
(Electromagnetic waves) (Wavelength range)
(A) AM radio waves (I) 1 nm to 103 nm
(B) Microwaves (II) >0.1 m
(C) Infrared radiations (III) 0.1 m to 1 mm
(D) X-rays (IV) 1mm to 700 nm
(A) (B) (C) (D) (A) (B) (C) (D)
1) III II I IV 2) III IV II I
3) II III IV I 4) IV III II I
49. A p-n photodiode is fabricated from a semiconductor with a band gap of 2.5 eV.
The signal wavelength is nearly
1) 6000 Å 2) 6000 nm 3) 4000 nm 4) 5000 Å
50. Water from a tap emerges vertically downwards with an initial speed of 1.0 m/s.
3 2
The cross-sectional area of tap is 10 m . Assume that the pressure is constant
throughout the stream of water and that the flow is steady, the cross-sectional

area of stream 0.15 m below the tap is g  10 m / s :
4 4 5 5
1) 5.0  10 m 2) 1.0  10 m 3) 5.0  10 m 4) 2.0  10 m
2 2 2 2
CHEMISTRY
SECTION – A
51. Which of the following statements is correct for an electrolytic solution upon
dilution?
1) conductivity increases
2) conductivity decreases
3) molar conductance decreases but equivalent conductance increases
4) molar conductance increases while equivalent conductance decreases.
52. Which of the following forms an ideal solution?
1) Acetone + CHCl3 2) C2H5OH + H2O
3) HNO3 + H2O 4) n-hexane + n-heptane
53. In a Dumas experiment, 0.5 g of an organic compound on heating with copper
oxide liberate 112 mL of N2 at STP. The percentage of nitrogen in the compound
is:
1) 70 2) 35 3) 14 4) 28
54. The atomic numbers of elements A, B, C and D are z-1, z, z+1 and z+2
respectively. If ‘B’ is a noble gas, choose the correct statements from the
following:
(a) ‘A’ has higher electron affinity.
(b) ‘C’ is less electropositive than ‘D’
(c) ‘D’ is an alkaline earth metal.
1) (a) and (b) 2) (b) and (c) 3) (a) and (c) 4) (a), (b) and (c)

55. Boron has two stable isotopes with mass numbers 10 and 11 for which the
relative abundance is 19% and 81% respectively. Then the average atomic mass
of boron is _____
1) 10.19 2) 10.81 3) 10.56 4) 10.72
56. IUPAC name of the compound given below is
Cl CH2CH3
C=C
I
H3 C
1) E – 2 – chloro – 3 – Iodopent – 2 – ene
2) Z – 2 – chloro – 3 – Iodopent – 2 – ene
3) E – 3 – Iodo – 4 – chloro – 3 – pentene
4) Z – 3 - Iodo – 4 – chloro – 3 – pentene
57. The electronic state in which the hydrogen atom can never emit a photon is
1) 2p orbital 2) 3s orbital 3) 1s orbital 4) 4p orbital
58. In a hydrogen atom, the electron is at a distance of 4.76 Å from the nucleus. The
angular momentum of the electron is
3h h h 2h
1) 2) 3) 4)
2 2  
59. The number of asymmetric carbons and number of optical isomers of the given
compound CH 3  CHOH 2 COOH are respectively.
1) 1, 3 2) 2, 3 3) 2, 4 4) 3, 4
60. A solution of white crystals gives a light yellow precipitate with AgNO3 but no
precipitate with a solution of Na2CO3. The action of conc. H2SO4 on the crystals
yields a brown gas. The crystals are of :
1) NaNO3 2) KCl 3) Ca(NO3)2 4) NaBr
61. Through the aqueous salt solution H2S(g) is passed after adding NH4OH. Then
which of the following cation gets preicipitated?
1) Only Zn2+ 2) Only Cu2+ 3) Zn2+ or Cu2+ 4) Neither Zn2+ nor Cu2+
62. Salt with which one of the following anion produces deep blue colour with starch
and KI in the presence of dilute H2SO4.
1) Chloride 2) Nitrite 3) Carbonate 4) Bromide
 
63. Assertion (A): NO is more stable than NO .
Reason (R) : NO does not have electrons in antibonding molecular orbitals.
the assertion
64. Statement – I: Sucrose on hydrolysis give leavorotatory fructose and
dextrorotatory glucose.
Statement – II: Maltose is a non-reducing sugar.
4) Both statements-I and II are false.
65. Assertion (A): BF3 is planar while NF3 is non-planar molecule.
Reason (R) : B-F bond is more polar than N – F bond.
the assertion
66. Rank the following alkenes in order of decreasing heats of hydrogenation (largest
first)
1) 2 > 3 > 1 > 4 2) 2 > 4 > 3 > 1 3) 1 > 3 > 4 > 2 4) 1 > 4 > 3 > 2

67. Which of the following compounds will undergo tautomerism?
68. Assertion (A) : Tl(III) compounds are good reducing agents.

Reason (R) : For thalium +1 oxidation state is more stable than +3 oxidation
state due to inert pair effect.
of the Assertion
of the Assertion
69. 2nd highest electronegative element in the 14th group is
1) C 2) Si 3) Sn 4) Pb
70. Kharasch effect can be seen in the following reaction.
1) Free radical substitution of Br2 2) Electrophilic addition of HCl
3) Free radical addition of HBr 4) Nucleophilic addition of HCN
71.
72. Assertion (A) : Boiling point of n-pentane is more than neopentane.

Reason (R) : With increase in branching boiling points of alkanes decreases.
of the Assertion
of the Assertion
73. The molecular weight of a metal phosphate, M3(PO4)2 is 386 g/mol. Then the
equivalent weight of M is ____
1) 65.33 2) 98 3) 32.67 4) 49
74. The normality of orthophosphoric acid having purity of 70% by weight and
specific gravity 1.54 is :
(1) 11 N (2) 22 N (3) 33 N (4) 44 N
75. d-orbital involved in sp d(Trigonal bipyramidal) hybridized orbitals is
3
1) dxy 2) dx2-y2 3) dxz 4) d z2

Br
76. Assertion : | on reaction with alcoholic KOH gives
CH 3  CH  CH 2CH 3
CH 3CH  CHCH 3 as a major product.
Reason : Elimination reaction takes place in accordance with Markovnikov’s rule.
of the Assertion
of the Assertion

77. Arrange the compounds in increasing order of rate of reaction towards
nucleophilic substitution.
1) (I) < (II) < (III) 2) (III) < (II) < (I) 3) (I) < (III) < (II) 4) (III) < (I) < (II)
78. Oxygen exhibits positive oxidation states in its?
1) Fluorides 2) Hydrides
3) Oxyacids 4) Nitrogen containing compounds
79. Assertion (A): The bond dissociation energy of fluorine is less than that of
bromine.
Reason (R): Due to small size, in fluorine higher inter electronic repulsion results
between the electrons of two fluorine atoms due to which F-F bond becomes
weak.
80. Statement –I : -hydrogen atoms in aldehydes and ketones are acidic.
Statement –II : The anion formed after the removal of -hydrogen is stabilized by
conjugation.
N 2  g   3H 2  g  
 2 NH 3  g 
The rate of formation of NH3 is 1.7g/min. Then the rate of disappearance of H2 is
_____g/min.
1) 2.55 2) 1.13 3) 0.3 4) 0.15
82. The correct order of acidic strength of the following compounds is
(I) Phenol (II) p-Cresol (III) m-Nitrophenol (IV) p-Nitrophenol
1) III > II > I > IV 2) IV > III > I > II 3) II > IV > I > III 4) I > II > IV > III
Con. HI  excess ) 
83. C2 H 5OH Con . H 2 SO4
413 K
 A  Heat
 B 
C2 H 5ONA
C
Formation of A from C2H5OH and formation of C from B involves the same
mechanism. The mechanism is
1) SN1 2) E2 3) SN2 4) E1
84. The work done during the expansion of a gas from a volume of 4 dm3 to 6 dm3
against a constant external pressure of 3 atm is :
1) -6J 2) -608J 3) +304J 4) -304J
o
85. Consider the following reactions at 1000 C :
1
A. Zn  s   O2  g    ZnO  s  ; G o  360 kJ mol1
2
1
B. C graphite   O2  g   CO  g  ; G o  460 kJ mol 1
2
Choose the correct statement at 1000o C :
1) Zinc can be oxidised by carbon monoxide
2) ZnO can be reduced by graphite
3) Carbon monoxide can be reduced by zinc
4) Zn can be oxidised by graphite
SECTION – B
86. Which one of the following transition elements does not exhibit variable oxidation
state?
1) Zn 2) Cu 3) Fe 4) Sc

0
0 0
87. EMn3 / Mn 2 is highly positive than that of ECr 3 / Cr 2 or EFe3
/ Fe2
because:
1) Mn2+(d5) can be easily oxidized to Mn3+(d4) due to low ionization enthalpy.
2) Third ionization enthalpy of Mn is much larger due to stable half filled d5
electronic configuration of Mn2+
3) Mn3+ is more stable than Mn2+ due to higher oxidation state
4) Second ionization enthalpy of Mn is higher than its third ionization enthalpy.
88. Match the following acids in column-I with its appropriate use in column-II.
Column-I Column-II
A) Ethanoic acid (p) Soaps and detergents
B) Hexanedioic acid (q) Nylon-6,6
C) Sodium benzoate (r) Food preservative
D) Fatty acids (s) Vinegar
1) A-s, B-q, C-r, D-p 2) A-q, B-r, C-p, D-s
3) A-p, B-q, C-r, D-s 4) A-r, B-s, C-q, D-p
1
89. For the reaction, N 2O5  2NO2  O2 ; the rate of decomposition of N2O5 is
2
3 1 1
1.8  10 mol .L .min then the rate of reaction w.r.t. NO2 is ________mol.L-1.min-1
1) 1.8  103 2) 3.6  103 3) 9  104 4) 4.5  104
90. Which of the following is not optically active?
3 3  
1) Co  en  3  2) Cr  ox  3  3) cis  CoCl2  en  2  4) trans  CoCl2  en  2 
91. What is the equivalent mass of Br2 in the given reaction?
3Br2  6OH   BrO3  5 Br 
1) M/2 2) M/10 3) 5M/3 4) 3M/5
92. The energy of an octahedral high spin complex with d configuration of cation will
7
be (CFSE in an octahedral complex = 0 , Electron pairing energy =P)

3 4 9 1
1)  0  3P 2) 0  2P 3)  0  3P 4) 0  P
4 5 5 5
93. The Ksp of AgCl at 250C is 1.0 1010. Then the correct of solubility of AgCl in pure
water (S1), 0.02M BaCl2(S2), 0.03M NaCl(S3) and 0.05M AgNO3(S4) is _____
1) S1  S2  S3  S4 2) S1  S3  S2  S4 3) S1  S2  S3  S4 4) S1  S4  S2  S3
94.  PCl3 g   Cl2 g  , if degree of dissociation is  and equilibrium pressure P,
PCl5 g  
then the equilibrium constant for the reaction is :
2  2 P2  P2  2P
1) K p  2) K  3) K  4) K 
1 2P 1 2 1 2 1 2
p p p
95. 1cc of 0.01 M HCl is added to 99.9cc of 0.1M NaCl solution pH of resulting
solution will be:
1) 7 2) 4 3) 2 4) 1
96. Diazonium salt is obtained when aniline reacts with :
1) cold NaOH 2) NaNO2 and HCl (0–5°C)
3) SnCl2 at 10°C 4) N2O at (0 – 5°C)
97. In the reaction sequence
the product ‘C’ is:

1) benzonitrile 2) benzaldehyde 3) benzoic acid 4) benzylamine
98. Which of the following is always true regarding the spontaneity of reaction
occuring in a galvanic cell?
1) E cell
o
 0, G o  0 and Q  K C 2) E cell
o
 0,  G o  0 and Q  K C
3) E cell
o
 0, G o  0 and Q  K C 4) E cell
o
 0, G o  0 and Q  K C
99. At 298K, the vapour pressures of chloroform (CHCl3) and
dichloromethane(CH2Cl2) are 200mmHg and 415mm Hg respectively. 29.875g of
CHCl3 and 42.5g of CH2Cl2 are mixed at 298K. Vapour pressure of resulting
solution is _______ mm Hg.
1) 257.5 2) 203.75 3) 343.5 4) 271.7

100. Assertion (A): LiI is more soluble in water than LiF.
Reason (R) : LiI has more ionic character than that of LiF.
the assertion
BOTANY
SECTION – A
101. Identify the combination of organisms in the order of uni-nucleated, binucleated
and multinucleated respectively.
1) Amoeba, Euglena, Paramecium 2) Euglena, Paramecium, Slime mould
3) Paramoecium, Slime mould, Euglena 4) Euglena, Amoeba, Slime mould
102. Protists considered as chief producers in ocean are characterized by all of the
following except
1) Planktonic habit 2) two thin overlapping shells
3) walls embedded with Silica 4) destructible walls
(A) Sleeping sickness (I) Plasmodium
(B) Spore like stage in life (II) Aggregated slime moulds
cycle
(C) Amoebiasis (III) Trypanosoma
.
(D) Plasmodium (IV) Entamoeba
(A) (B) (C) (D) (A) (B) (C) (D)
1) III II I IV 2) III I IV II
3) IV I II III 4) II I III IV
104. Flocs in sewage are
1) Bacteria with protists 2) Bacteria with virus
3) Bacteria with protozoans 4) Mosses of aerobic bacteria with fungal filements
105. The BOD test measures
1) Directly the amount of activated sludge formed in settling tank
2) Directly the growthrate of anaerobic microbes
3) The rate of uptate of oxygen by microorganisms in a water sample.
4) The amount of organic matter present in a water sample directly.
(A) Pectinases and proteases (I) Inhibiting the enzyme responsible
for synthesis of cholesterol
(B) Cyclosporin A (II) Check the disease causing microbes
(C) LAB role (III) Bottled fruit juices clearer
.
(D) Statins (IV) Organ-transplantation
(A) (B) (C) (D) (A) (B) (C) (D)
3) IV III II I 4) IV III I II
107. Study the following statements regarding the angiosperms.
I) Within the anthers, the pollen mother cell divide by mitosis to produce
microspores which matures into pollen grains.
II) The female sex organ in a flower is the pistil.
III) Pistil consists of a swollen ovary at its base, a long slender style and stigma.
IV) Generally each ovule has a megaspore mother cell that undergoes meiosis to
form four haploid megaspores.
3) II ,III and IV are correct 4) I, II, III and IV are correct
108. How many organisms show diplontic life cycle?
Eucalyptus, Volvox, Ulothrix, Pisum, Marchantia, Cycas, Polytrichum,
Selaginella, Fucus, Pinus, Cedrus, Ectocarpus, Polysiphonia
1) Eight 2) Six 3) Seven 4) Nine

1) In Pteridophytes the main plant body is a sporophyte .
2) In Pteridophytes Sporophyte is differentiated into true root, stem and leaves
3) In Pteridophytes nonphotosynthetic thalloid sporophytes called prothallus.
4) Gametophytic stage bears sexual organs.
110. Which method is suitable for plants to introduce alien DNA?
1) Micro injection 2) Biolistics
3) Gene gun 4) Both (2) and (3)
111. Plasmids are vectors for gene cloning because they
1) Self replicate in fungal cell 2) Self replicate in bacterial cell
3) Self replicate in plant cell 4) Self replicate in animal cell
112. Restriction enzymes are used in genetic engineering because they
1) can join DNA fragments 2) cut the DNA at specific base sequences
3) cut DNA at variable sites 4) cut proteins at specific sequences
113. Statement-I: REN (Restriction Endonuclease) cuts both DNA strands at the
different sites
Statement-II: EcoRI cuts the DNA between bases G and A only when the
sequence GATTAC is present in the DNA
114. Match the following and identify the correct option:
Column-I Column-II
p) Palindrome i) Ti plasmid
q) E. coli ii) Cloning vector
r) Agrobacterium iii) pBR322
s) pBR-322 iv) Malayalam
1) p-iv, q-iii, r-i, s-ii 2) p-iv, q-i, r-iii, s-ii
3) p-iv, q-ii, r-iii, s-i 4) p-iv, q-i, r-ii, s-iii
115. When leaf lamina is incised, and incisions do not touch the mid rib, it is known
as
1) Simple leaf 2) Half compound leaf
3) Pinnately compound leaf 4) Palmately compound leaf
116. Select an incorrect statement w.r.t. fruit shown in the figure.
1) Develop from monocarpellary superior ovary

2) Epicarp is fibrous
3) Endocarp is hard and stony
4) Edible part is endosperm
S–I :Epicarp is thick and fleshy.

S–II :Mesocarp is thin and dry.
S-III : Endocarp is hard stony.
1) Both S-I and S-II are true 2) Both S-I and S-III are true
3) Both S-I and S-II are false 4) Only S-III is false

List-I (Stamens) List-II (Family)
A) Numerous (I) Cruciferae
B) 6 (II) Malvaceae
C) 5, rarely 4 (III) Fabaceae
`
D) 10 (IV) Compositae
A B C D A B C D
1) I III II IV 2) II I IV III
3) III II I IV 4) I III III IV
119. Semiconservative replication of eukaryotic genetic material was first
demonstrated by Taylor et al using root tip cells of
1) Vicia faba 2) Pisum sativum
3) Solanum tuberosum 4) Gulmohur
120. Which of the following amino acid does not show degeneracy?
1) Alanine 2) Tryptophan 3) Arginine 4) Valine
121. To initiate translation, the mRNA first binds to
1) the smaller ribosomal subunit 2) the larger ribosomal subunit
3) the whole ribosome 4) No such specificity exists
122. In prokaryotes, the predominant step of regulation of gene expression is
1) Transcriptional level 2) RNA processing
3) Translation initiation 4) RNA transfer from nucleus to cytoplasm
123. One codon codes for only one amino acid and not any other is called :-
1) Non overlapping 2) Degeneracy
3) Non-ambiguous 4) Triplet nature
124. The accessibility of the promoter regions of prokaryotic DNA is (in
many cases) regulated by the interaction of proteins with the
sequences termed as
1) regulator 2) promoter 3) operator 4) structural genes
125. In root the arrangement of xylem in T.S. of primary root.
1) Endarch arrangement is present
2) Exarch arrangement is present
3) Protoxylem lies towards the centre
4) Metaxylem lies towards the periphery
126. Assertion : The ring arrangement of vascular bundles is a characteristic of Dicot
stem.
Reason : Vascular bundle is conjoint, open and with endarch protoxylem.
127. Some vascular bundles are described as open because these :
1) Are not surrounded by pericycle
2) Are surrounded by pericycle but no endodermis
3) Are capable of producing secondary xylem and phloem.
4) Possess procambium tissue between xylem and phloem.
128. 120 plants are produed on crossing pure red and pure white flowered pea plants
then what is the ratio of F1.
1) 90 red : 30 white 2) 30 red : 90 white
3) 60 red : 60 white 4) All red
129. In Mendel’s experiments colour of seed coat, colour of flower, position of flower,
colour of pod, height of stem, are called
1) Alleles 2) Genotype 3) Phenotype 4) All of the above
130. Which cross yields red, white and pink flowers in dog flower?
1) RR × Rr 2) Rr × Rr 3) Rr × RR 4) Rr × rr
131. According to the concept of dominance the modified allele could be responsible
for the recessive trait, if it produces
I) Normal enzyme II) Less efficient enzyme
III) Non functional enzyme IV) No enzyme at all
1) I and II 2) II and III 3) I and V 4) III and IV

given
Column-I Column-II
(a) Smooth endoplasmic reticulum (i) Concentrically arranged near the nucleus
(b) Vacuoles (ii) Increases the enzyme content
(c) Golgi complex (iii) Occupies 90% of volume of plant cell
(d) Peroxisomes (iv) Photorespiration
(e) Mesosomes (v) Synthesis of steroidal hormones
1) a–v, b–iii, c–i, d–iv, e–ii 2) a–v, b–iii, c–ii, d–iv, e–i
3) a–ii, b–iii, c–i, d–iv, e–v 4) a–iii, b–v, c–i, d–iv, e–ii
133. Water soluble pigments found in plant cell vacuoles are
1) Xanthophylls 2) Chlorophylls 3) Carotenoids 4) Anthocyanins
134. Mitochondria and chloroplast are
(a) Semi-autonomous organelles
(b) Formed by division of pre-existing organelles and they contain DNA but lack
protein synthesizing machinery
Which one of the following options is correct?
1) (a) is true but (b) is false 2) Both (b) and (a) are false
3) Both (a) and (b) are correct 4) (b) is true but (a) is false
135. A typical angiosperm embryo sac at maturity is:
1) 7- nucleate and 8-celled 2) 7- nucleate and 7-celled
3) 8- nucleate and 8-celled 4) 8-nucleate and 7-celled
SECTION – B
136. Which of the following is incorrect for wind-pollinated plants?
1) Many ovules in each ovary
2) Flowers are small and not brightly coloured
3) Pollen grains are light and non-sticky
4) Well exposed stamens and stigma
137. Which one of the following statements regarding post-fertilization development in
flowering plants is incorrect?
1) Ovary develops into fruit 2) Zygote develops into embryo
3) Central cell develops into endosperm 4) Ovules develop into embryo sac
138. Persistent nucellus in the seed is known as
1) Chalaza 2) Perisperm 3) Hilum 4) Tegmen
139. In a saturated fat, you would expect to find all of the following except
1) Single bond carbon atoms
2) CH3 at one end
3) Fatty acid(s) attached with glycerol
4) Double bond carbon atoms fatty acids
140. Statement –I : Proteins are heteropolymers by repeat the 20 types of organic and
inorganic aminoacids.
Statement –II : Essential aminoacids are need for our health, non-essential
amino acids are eliminate from the living tissues.
141. What makes possible for plant to retain their capacity for unlimited growth
throughout their life?
1) Presence of fibres at certain locations in their body
2) Absence of meristems in their body delaying maturity
3) Presence of special hormones producing cambium
4) Presence of meristems at certain locations in their body.
142. Which of the following is the important function of oxygen for growth activities of
plant?
1) Releasing metabolic energy 2) Absorbing metabolic energy
3) Initiating every anabolic reaction 4) Both 2 and 3

143. Statement – I: Auxin can induce parthenocarpic fruit formation.
Statement – II : Auxin delays abscission of fruit and leaves at early and older
mature stage.
144. Statement I :“Chromosome have two chromatids” firstly seen in metaphase.
Statement II :Centriole split and chromatids separate in anaphase.
145. Which of the following phenomena is observed in first phase of meiosis – I.
A) Genetic identity B) Synapsis
C) Chromosome compaction D) Recombination
1) B & C 2) B & D 3) Except A all 4) Except B all
146. In the following table, the events and their sites are given. Identify the correct
match.
a) Regeneration of PEP Bundle sheath cell
b) Decarboxylation of C4 acid Bundle sheath cell
c) Calvin cycle Mesophyll cells
d) Formation of malic acid Mesophyll cells
1) b and d only 2) a,b and c only 3) b and c only 4) a and d only
147. RuBisCO enzyme is most abundant protein of chloroplast.
Which cells have no RuBisCO enzymes?
1) Mesophyll cells of all plants 2) Mesophyll cells of C4 plants
3) Bundle sheath cells of all plants 4) Bundle sheath cells of C4 plants
148. The enzyme involved in CO2 fixatioin in C4 plant is
1) RuBisCO in 1st fixation, PEP carboxylase in 2nd fixation.
2) PEP carboxylase in 1st fixation, RuBisCO in 2nd fixation
3) RuBP oxygenase in 1st fixation, RuBP carboxylase in 2nd fixation.
4) PEP carboxylase in 1st fixation, PEP oxygenase in 2nd fixation.
149. What is the oxidizing agent in the following reaction ?
Pyruvate + NADH + H+ Lactate + NAD+
1) Oxygen 2) NADH+H+ 3) NAD+ 4) Lactate
150. How many NADH+H+ are synthesized during one Kreb's cycle :
ZOOLOGY
SECTION – A
151. (p+q)2 = p2 + 2pq+q2 = 1 equation used in
1) Molecular genetics 2) Bioinformatics
3) Population genetics 4) Mendelian genetics
152. Appearance of antibiotic-resistant bacteria is an example of
1) Transduction 2) Adaptive radiation
3) Divergent evolution 4) Pre-existing variations in the life forms
153. Fossils are generally found in
1) Metamorphic rocks 2) Igneous rocks
3) Sedimentary rocks 4) All types of rocks
154. Animal husbandary and plant breeding programmes are the examples of
1) Artificial selection 2) Mutation
3) Genetic drift 4) Natural selection
155. The sacred groves that are the last refuges for a large number of rare and
threatened plants are found in
1) Khasi and Jaintia Hills 2) Aravalli hills
3) Chanda and Bastar areas 4) Western Ghats

156. Biodiversity is affected by
1) Latitudinal gradients and species-area relationship
2) Species-area relationship and longitudinal gradients
3) Latitudinal and longitudinal gradients
4) Both 1 and 2
157. Organisation responsible for maintaining Red Data Book is
1) IUCN 2) WHO 3) ICZN 4) ICBN
158. Assertion A: Repeated activation of the skeletal muscles can lead to fatigue.
Reason R: Anaerobic breakdown of glycogen in the skeletal muscles can lead to
the accumulation of lactic acid.
below:
1) Both A and R are true but R is NOT the correct explanation of A
159. Each ovary in cockroach is made up of how many ovarian tubules or ovarioles?
1) 6 2) 4 3) 8 4) 10
160. Stomach in frogs contains
1) Calciferous glands 2) Hepatic caecae 3) Collaterial glands 4) Gastric glands
161. Statement I: Red fibres called as aerobic muscles which contain high amount of
sarcoplasmic reticulum.
Statement II: White fibres depend on anaerobic process which contain very few
sarcoplasmic reticulum.
given below:
162. Axon is a structural and functional unit of nervous system. The conduction of
impulse mostly in human body is ______
1) Dendrites  Axon  Neurotransmitter  Next neuron
2) Dendrites  Cell body  Axon  Synaptic cleft  next neuron
3) Dendrites  Cell body  Axon  Neuro transmiter  Next synapse
4) All of the above
163. In human kidney the cortex extends between the medullary pyramids as _____
1) Renal calyces 2) Hepatic columns
3) Bertini’s columns 4) Malpighian columns
164. Lungs do not collapse between breaths and some air always remains in the lungs
which can never be expelled because
1) There is a negative pressure in the lungs
2) There is a negative intrapleural pressure pulling at the lung walls
3) There is a positive intrapleural pressure
4) Pressure in the lungs in higher than the atmospheric pressure
165. Renin- angiotensin mechanism causes all the following, except
1) Increase the glomerular blood pressure
2) Reabsorption of Na+& H2O from the distal parts of the renal tubule and vasa
recta
3) Increases GFR 4) Increases BP
166. Blood pressure in the pulmonary artery is
1) More than that in the carotid artery 2) Same as that in the aorta
3) Less than that in the vena cava 4) More than that in the pulmonary vein
167. Which one of the following statements is correct regarding blood pressure?
1) 80/120 mmHg is considered an ideal blood pressure
2) 105/50 mmHg makes a person very active
3) 190/110 mmHg may harm vital organs like brain and kidney
4) 130/90 mmHg is considered low B.P. and requires treatment
168. Compared to blood our Lymph has
1) No plasma 2) Plasma without proteins
3) With RBCs only 4) Only with eosinophils

169. How many of secondary lymphoid organs are found related to digestive system .
Thymus , Bone marrow , Peyers patches , Vermiform appendix ,Lymph nodes
1) 2 2) 1 3) 4 4) 3
170. A) IgG - Allergic reactions
B) Ig E - Smallest anti body
C) Ig A - Colostrum
1) Only A 2) A, B 3) Only C 4) A, C
171. In the life cycle of plasmodium , Parasite enters the human body as _______
through the bite of __________
1) Gametocytes/Male Anopheles mosquito
2) Sporozoites/Gemale Anopheles mosquito
3) Sporozoites/Female Culex mosquito
4) Haemozoin/Female Anopheles mosquito
A) Typhoid - X) ELISA
B)Cancer - Y) widal
C) HIV - Z) Biopsy
1) A-X, B-Y, C-Z 2) A-Y, B-Z, C-X
3) A-Z, B-Y, C-X 4) A-X, B-Z, C-Y
173. Choose the correct option w.r.t. cells in seminiferous tubules with diploid
condition:
A. Spermatogonia B. Sertoli cells C. Leydig cells
D. Sperms E. Primary spermatocyte F. Oogonia G. Primary oocyte
How many above stages are diploid condtion?
1) 3 2) 4 3) 5 4) 6
174. Select the incorrect statements
i. Lower the taxon, more are the characteristics that the members within the
taxon share.
ii. Order is the assemblage of genera which exhibit a few similar characters.
iii. Cat and dog are included in the same family Felidae.
iv. Binomial nomenclature was introduced by Carolous Linnaeus.
1) i, ii and iii only 2) ii, iii and iv only
3) ii and iii only 4) iii and iv only
175. HGP was closely associated with the rapid development of a new area in biology
called
1) Biotechnology 2) Biostatistics 3) Bioinformatics 4) Bioenergetics
176. Which one of the following groups of animals is correctly matched with its
characteristic feature without any exception?
1) Reptilia: Three chambered heart with incompletely divided ventricle
2) Chordata: Notochord is replaced by cartilaginous or bony vertebral column in
the adult
3) Aves: Oviparous and development is direct
4) Mammalia: Give birth to young ones and nourish them by milk secreted from
mammary glands
177. All the hermaphroditic animals are present in which of the following sets of
animals?
1) Pheretima, Taenia, Sycon, Ascaris
2) Euspongia, Ctenoplana, Pheretima, Nereis
3) Sycon, Physalia, Pleurobrachia, Ancylostoma
4) Spongilla, Pleurobrachia, Fasciola, Hirudinaria
178. Match Column I with Column II
Column I Column II
A. Producer I. Phytoplanktons
B. Primary consumer II. Zooplanktons
C. Secondary consumer III. Carnivores
D. Decomposer IV. Saprotrophs
1) A-II, B-I, C-III, D-IV 2) A-I, B-II, C-III, D-IV
3) A-I, B-II, C-IV, D-III 4) A-III, B-II, C-I, D-IV

179. Statement – I: Pars intermedia secretes only one hormone.
Statement – II: Pars nervosa synthesizes & secretes two hormones.
180. Which of the following hormone is not synthesized and secreted by an organized
endocrine gland?
1) Melatonin 2) Thymosin 3) GH 4) ANF
181. The blotting technique used in DNA Fingerprinting is called;
1) Northern Blot 2) Western Blot 3) Southern Blot 4) All of the above
182. The individual with Phenylketonuria (PKU), lacks enzyme ___A___ which forms
amino acid ___B___ from ___C___
1) A- Thrombokinase ,B- valine , C- Glutamic acid
2) A- Phenylalanine hydroxylase, B- Phenylalanine, C-Tyrosine
3) A- phenylalanine hydroxylase, B-Tyrosine, C-Phenylalanine
4) A- Tyrosinase, B-Phenulalanine, C-Tyrosine
183. Choose true or false from the following statements.
(a) Chromosomal aberrations are commonly observed in cancerous cells
(b) In point mutation there will be a change in single gene of DNA
(c) Deletion and Insertion of base pairs of DNA results in Frameshift mutation
(d) DNA helix runs discontinuously from one end to other in each chromatid
(a) (b) (c) (d)
(1) T T T F
(2) T F T F
(3) F T T F
(4) T F F F
184. Assertion: The possibility of female becoming haemophilic is extremely rare.
Reason: A haemophilic female should have at least normal mother and affected
father.
assertion.
185. Karyotype of Klinefelter’s syndrome is _______
1) 47, AAA 2) 47, XXY 3) 45, X0 4) 46, XY
SECTION – B
186. Consider the following statements (A-C) each with two blanks.
i. Jellyfish exhibits A symmetry whereas cuttle fish exhibits B symmetry
ii. Incomplete gut is present in C whereas complete gut is present in D .
iii. Closed circulatory system is present in E whereas open circulatory system
is present in F .
iv. Flatworms are G whereas roundworms are H .
Which one of the following options, gives the correct fill-ups for both the blank
numbers one of the above satements.
1) A : Bilateral, B : Radial
2) C : Round worms D : Flatworms
3) E : Silkworms F : Earthworms
4) G : Acoelomates, H : Pseudocoelomates
187. What type of ecological Pyramid would be obtained with the following data?
Secondary consumer: 120 g; Primary consumer: 60 g; Primary producer: 10 g;
1) Inverted Pyramid of biomass 2) Inverted Pyramid of energy
3) Upright Pyramid of numbers 4) Upright Pyramid of biomass
188. The process of mineralization by micro-organisms helps in the release of
1) Inorganic nutrients from humus
2) Both organic and inorganic nutrients from detritus
3) Organic nutrients from humus
4) Inorganic nutrients from detritus and the formation of humus

189. Which of the following is a correct statement?
2) IUDs once inserted need not be replaced
4) IUDs increase phagocytosis of sperms in the uterus
190. The hormones used for the purpose of contraception in pills and IUDs are
1) Progestogen and estrogen 2) Estrogen and testosterone
3) LH and progesterone 4) Prolactin and testosterone
191. How many meiotic divisions are required for the formation of 76 spermatids?
1) 38 2) 19 3) 76 4) 152
192. Air is breathed in through
1) Trachea—lungs—larynx—pharynx—alveoli
2) Nose—larynx—pharynx—bronchus—alveoli—bronchioles
3) Nostrils—pharynx—larynx—trachea—bronchi—bronchioles—alveoli
4) Nose—mouth—lungs
193. Tidal Volume and Expiratory Reserve Volume of an individual is 500 mL and
1000 mL, respectively. What will be his Expiratory Capacity if the Residual
Volume is 1200 mL?
1) 1700 mL 2) 2200 mL 3) 2700 mL 4) 1500 mL
194. During glomerular filtration, the glomerular capillary blood pressure causes
filtration of blood through three layers. They are arranged from inside to outside
as_____.
1) Basement membrane, endothelium of glomerular, blood vessel, epithelium of
Bowman’s capsule
2) Endothelium of glomerular blood vessel, basement membrane, epithelium of
Bowman’s capsule
3) Epithelium of Bowman’s capsule, endothelium of glomerular blood vessel,
basement membrane
4) Epithelium of Bowman’s capsule, basement membrane, endothelium of
glomerular blood vessel.
195. A single stranded Nucleic acid tagged with a radioactive molecule is called
1) Plasmid 2) Probe 3) Vector 4) Selectable marker
196. Which of the following technique is based on the principle of antigen –antibody
interaction?
1) PCR 2) ELISA
3) Recombinant DNA technology 4) Gene therapy
197. Limbic system is association of
1) Associated deep structures hippocampus and inner parts of cerebral
hemispheres
2) Associated deep structures of cerebral cortex and inner parts of pons
3) Associated deep structures of amygdala and inner part of cerebral hemispheres
4) Associated deep structures of amygdala, hippocampus and inner parts of
cerebral hemispheres
198. Match Column-I with Column-II and select the correct option.
(A) Pair of spermatheca (I) 2nd - 6th segments (abdominal)
(B) Ovary (II) 6th segment (abdominal)
(C) Mushroom shaped accessory (III) 6th — 7th segments (abdominal)
reproductive gland
(D) Anal cerci (IV) 10th segment
`
1) (a) - (ii); (b) - (i); (c) - (iii); (d) - (iv) 2) (a) - (iii); (b) - (ii); (c) - (iv); (d) - (i)
3) (a) - (iv); (b) - (iii); (c) - (i); (d) - (ii) 4) (a) - (i); (b) - (iv); (c) - (ii); (d) - (iii)
199. The levels of biological organisation in ecology are
1) Organisms, family, communications, biomes
2) Cell, organisms, community, biosphere
3) Species, populations, communications, biomes
4) Organisms, populations, communities, biomes
200. Which insect is highly distasteful to its predator bird because of a specific
chemical present in its body?
1) Apis mellifera 2) Viceroy butter fly
3) Monarch butter fly 4) Apis indica

: ANSWER KEY:
SET-2 SUB: PHYSICS
1 1 11 2 21 2 31 3 41 2
2 4 12 2 22 3 32 3 42 2
3 1 13 2 23 2 33 3 43 4
4 4 14 3 24 4 34 2 44 1
5 1 15 4 25 1 35 3 45 1
6 3 16 3 26 3 36 4 46 2
7 1 17 4 27 2 37 1 47 4
8 1 18 4 28 3 38 2 48 3
9 1 19 4 29 4 39 3 49 4
10 1 20 2 30 2 40 3 50 1
SUB:CHEMISTRY
51 2 61 3 71 1 81 3 91 4
52 4 62 2 72 1 82 2 92 2
53 4 63 3 73 3 83 3 93 2
54 3 64 2 74 3 84 2 94 4
55 2 65 2 75 4 85 2 95 2
56 1 66 4 76 3 86 4 96 2
57 3 67 4 77 3 87 2 97 4
58 1 68 4 78 1 88 1 98 4
59 3 69 4 79 1 89 1 99 3
60 4 70 3 80 1 90 4 100 3
SUB : BOTANY
101 2 111 2 121 1 131 4 141 4
102 4 112 2 122 1 132 1 142 1
103 2 113 3 123 3 133 4 143 2
104 4 114 1 124 3 134 1 144 4
105 3 115 1 125 2 135 4 145 2
106 2 116 2 126 2 136 1 146 1
107 3 117 2 127 4 137 4 147 2
108 2 118 2 128 4 138 2 148 2
109 3 119 1 129 3 139 4 149 2
110 4 120 2 130 2 140 1 150 1
151 3 161 1 171 2 181 3 191 2
152 2 162 2 172 2 182 3 192 3
153 3 163 3 173 1 183 2 193 4
154 1 164 2 174 3 184 3 194 4
155 1 165 2 175 3 185 2 195 2
156 1 166 4 176 3 186 4 196 2
157 1 167 3 177 4 187 1 197 4
158 4 168 2 178 2 188 2 198 1
159 3 169 1 179 3 189 4 199 4
160 4 170 3 180 4 190 1 200 3

NEET GRAND TEST - 6
answer sheet.
CORRECT.
Section-B;
Marking Scheme :

PHYSICS
SECTION – A
1. The period of oscillation of a simple pendulum in the experiment is recorded as
2.63 s, 2.56 s, 2.42 s, 2.71 s and 2.80 s respectively. The average absolute error
is
1) 0.1 s 2) 0.11 s 3) 0.01 s 4) 1.0 s
4 3
2. An iron rod of volume 10 m and relative permeability 1000 is placed inside a
long solenoid having 5 turns/cm. If a current of 0.5A is passed through the
solenoid, then the magnetic moment of the rod is
1) 20 Am 2 2) 25 Am 2 3) 30 Am 2 4) 35 Am 2
3. A cricketer can throw a ball to a maximum horizontal distance of 100m. With the
same effort, he throws the ball vertically upwards. The maximum height attained
by the ball is
1) 100m 2) 80m 3) 60m 4) 50m
4. A person aiming to reach the exactly opposite point on the bank of a stream is
swimming with a speed of 0.5m/s at an angle of 120o with the direction of flow of
water. The speed of water in the stream is
1) 1 m/s 2) 0.5 m/s 3) 0.25 m/s 4) 0.433 m/s
5. The amplitude of magnetic field in an electromagnetic wave propagating along y-
7
axis is 6.0  10 T . The maximum value of electric field in the electromagnetic
wave is:
1 1 1 7 1
1) 5.0  10 Vm 3) 2.0  10 Vm 4) 6.0  10 Vm
14 15
2) 180Vm
6. The mutual inductance between a primary and secondary circuits is 0.5 H. The
resistances of the primary and the secondary circuits are 20 ohms and 5 ohms
respectively. To generate a current of 0.4 A in the secondary, current in the
primary must be changed at the rate of
1) 4.0 A/s 2) 16.0 A/s 3) 1.6 A/s 4) 8.0 A/s
7. Which of the following statement is correct about non-conservative force?
1) It depends on velocity of the object
2) It depends on the particular path taken by the object
3) It depend on the initial and final positions of the object
4) Both (1) and (2)
8. Determine the charges on each of the capacitors shown in figures.
C=3F C=4F
+ –
14V
1) 12C, 12C 2) 24C, 24C 3) 6C, 8C 4) 8C, 6C
9. For a body in S.H.M. the velocity is given by relation v  144  16 x 2 m/sec . The
maximum acceleration is
1) 12 m/sec 2 2) 16 m/sec 2 3) 36 m/sec 2 4) 48 m/sec 2
10. Assertion: Two particles are moving in the same direction do not lose all their
energy in completely inelastic collision.
Reason: Principle of conservation of momentum holds true for all kinds of
collisions.
the assertion
of the assertion

11. Light of two different frequencies whose photons have energies 1eV and 2.5 eV,
respectively illuminate a metallic surface whose work function is 0.5 eV
successively. The ratio of the maximum speeds of the emitted electrons will be
1) 1:5 2) 1:4 3) 1:2 4) 1:1
12. The freezer a refrigerator is located at the top section so that
1) The entire chamber of the refrigerator is cooled quickly due to convection.
2) The motor is not heated
3) The heat gained from the environment is high
4) The heat gained from the environment is low.
13. When an ideal diatomic gas is heated at consnat pressure, the fraction of heat
energy, supplied which is used in doing work to maintain pressure constant is
1) 5/7 2) 7/2 3) 2/7 4) 2/5
14. A bar has cross-sectional area A. It is subjected to equal and opposite tensile
forces F as shown. Consider a plane through the bar making an angle  with a
plane at right angles to the bar. Find shear stress and tensile stress.
F sin 2 F cos  F sin 2 F cos 2  F sin 2 F cos 2  F sin 2 F cos 2 

1) , 2) , 3) , 4) ,
2A A A A A 2A 2A A
15. Assertion: Susceptibility is defined as the ratio of intensity of magnetization I to
magnetic intensity H.
Reason: Greater the value of susceptibility smaller the value of intensity of
magnetisation I.
the assertion
16. The mean free path and rms velocity of a nitrogen molecule at a temperature
17o C are 1.2 107 m and 5 102 m / s respectively. The time between two successive
collections
1) 2.4 1010 S 2) 1.2 1010 S 3) 3.4 1013 S 4) 3.4 1010 S
17. When a monoatomic gas expands at constant pressure, the percentage of heat
supplied that increases temperature of the gas and in doing external work in
expansion at constant pressure is
1) 100%, 0 2) 60%, 40% 3) 40%, 60% 4) 75%, 25%
18. A tension of 20N is applied to a wire of cross-sectional area 0.01 cm 2 . Find the
decrease in cross-sectional area. Young’s modulus of copper  1.1 1011 Nm 2 and
Poisson’s ratio 0.32.
1) 11.6 10 6 m 2 2) 11.6 10 4 m 2 3) 1.16 10 6 m 2 4) 1.16 10 4 m 2
19. If i  j repreents refractive index when a light ray goes from medium i into j, then
2 1  3 2  4 3 is equal to
1
1) 3 1 2) 3  2 3) 4) 4 2
4 1
20. The flow speeds of air on the lower and upper sufaces of the wing of an aeroplane
are v and 2 2v respectively. The density of air is  and surface area of wing is
A. The dynamic lift on the wing is:
7 2 2 2
1) v2 A 2) 7 2  v A
2
3) v A 4) v A
2 7
21. The satellite of mass m is orbiting around the earth in a circular orbit with a
velocity v. What will be its total energy?
1) (3/4)mv2 2) (1/2)mv2 3) mv2 4) –(1/2)mv2

22. In YDSE, if a liquid is filled between the space of screen and slit, then
1) Central bright fringe will shift upward
2) Central bright fringe will not shift
3) Central bright fringe will shift downward
4) Central fringe may shift downward or upward
23. Two plane harmonic sound waves are expressed by the equations.
 
y1  x, t   A cos  x  100 t 
2 
 46 
y2  x, t   A cos  x  92 t 
 100 
All quantities taken in MKS.
How many times does an observer hear maximum intensity in one second?
1) 4 2) 10 3) 6 4) 8
24. An electron of mass m and charge e initially at rest gets accelerated by a constant
electric field E. The rate of change of De-Broglie wavelength of this electron at
time t is -
2h 2h h h
1) 2) – 3) 2
4) –
eEt 2
eEt 2
eEt eEt 2
25. Two balls of masses 5M and M have radii 2R and R. Their centre of masses are
separated by 15R. They move towards each other under their gravitational force.
The distance moved by the centre of smaller sphere when the spheres touch each
other is
1) 2.5 R 2) 5R 3) 10 R 4) 7.5 R
26. Assertion (A): Nuclear forces arise from strong Coulombic interactions between
protons and neutrons.
Reason (R): Nuclear forces are independent of the charge of the nucleons.
27. A tank of height 5m is full of water. There is a hole of cross-sectional area 10cm2
in its bottom. The initial rate of volume of water that will come out from this in its

hole is g  10 m / s
2

3 3 4 3 3 2
1) 10 m / s 2) 10 m / s 3) 10 m / s 4) 10 m3 / s
3 4
28. The refractive indices of glass and water are and respectively. The refractive
2 3
index of glass with respect to water is
8 9 5
1) 2 2) 3) 4)
9 8 3
29. In a double slit experiment, the distance between the slit is d. The screen is at a
distance D from the slits and  is the wavelength of light used. If a dark fringe is
formed opposite to a slit on the screen, the order of fringe is
1)
d 2  D
2) 
D  d  3)
D  d
4)
D2  d 
2 D 2 2d 2
30. Match List- I and List – II
List – I List- II
(A) Gravitational constant (G) (I) [L2T-2]
(B) Gravitational potential (II) [M-1L3T-2]
energy
(C) Gravitational potential (III) [LT-2]
(D)
.
Gravitational intensity (IV) [ML2T-2]
(A) (B) (C) (D) (A) (B) (C) (D)
1) II I IV III 2) II IV I III
3) II IV III I 4) IV II I III

31. A point charge + 10 C is at a distance 5cm directly above the centre of a square
of side 10cm, as shown in figure. What is the magnitude of the electric flux
through the square?
1) 0 2) 1.8  102 Nm 2 / C 3) 1.8  104 Nm 2 / C 4) 1.8  105 Nm 2 / C

32. If light of wavelength 1 is allowed to fall on a metal, then kinetic energy of
photoelectrons emitted is E1 . If wavelength of light changes to 2 then kinetic
energy of electrons changes to E2 . Then work function of the metal is
E1 1  E 2  2
1) E1 E2 (1  2 ) 2) E11  E2 2
3) 4) 12 E1 E2
12 (1  2 ) ( 2  1 ) (2  1 )
33. To get output I at R, for the given logic gate circuit the input values must be
1) X = 1, Y = 0 2) X = 1, Y = 1 3) X = 0, Y = 1 4) X = 0, Y = 0
34. A half ring of radius ‘r’ has a linear charge density . The potential at the centre
of the half ring is
   
1) 2) 3) 4)
4 0 4  0 r
2
4 0 r 4 0 r 2
35. The equilvalent resistance and potential difference between A and B for the
circuit are respectively :
1) 4, 8V 2) 8, 4V 3) 2, 2V 4) 16, 8V
SECTION – B
36. In the circuit shown below, the reading of the voltmeter V is :-
1) 12V 2) 8V 3) 20V 4) 16V

37. A square loop of side L carries a current I. Another smaller square loop of side
l  l  L  carrying a current i is placed inside the bigger loop such that they are
coplanar with their centres coinciding. If the currents in the loops are in the
same direction, the magnitude of the torque on the smaller loop is
 Iil 2  Iil 2  Iil 2
1) 0 2) 0 3) 0 4) Zero
2 L 2 L 3 L

38. The figure shows a wire frame in xy-plane carrying a curent I. The magnetic field
at the point O is
 I 1 1
1) 0    kˆ
8 a b
 I 1 1 
2) 0    kˆ
8 b a 
 I 1 1
3) 0    kˆ
4 a b
 I 1 1 
4) 0    kˆ
4 b a 
39. A ring shaped tube contains two ideal gases with equal masses and relative molar
masses M1 = 32 and M2 = 28. The gases are separated by one fixed partition P
and another movable stopper S which can move freely without friction inside the
ring.
The angle α in equilibrium as shown in the figure ( in degrees ) is

1) 291 2) 219 3) 129 4) 192
 4MLg 
40. In the determination of Young’s modulus  Y  by using Searle’s method a
  ld 2 
wire of length L = 2m and diameter d = 0.5mm is used. For a load M = 25kg, an
extension l = 0.25mm in the length of the wire is observed. Quantities d and l are
measured using a screw gauge and a micrometer, respectively. They have the
same pitch of 0.5mm . The number of divisions on their circular scale is 100. The
contributions to the maximum probable scale is 100. The contributions to the
maximum probable error of the Y measurement
1) Due to the errors in the measurements of d and l are the same
2) Due to the error in the measurement of d is twice that due to the error in the
measurement of l
3) Due to the error in the measurement of l is twice that due to the error in the
measurement of d
4) Due to the error in the measurement of d is four time that due to the error in
the measurement of l
41. A cyclist is riding with a speed of 36km/h. As he approaches a circular turn on
the road of radius 50m he applies brakes and reduces his speed at the constant
rate of 0.5m/s every second. The magnitude and direction of the net acceleration
of the cyclist on the circular turn respectively are
3 3 1
1) m / s 2 , tan 1  4  2) m / s 2 , tan 1  
2 2  4
1 17
3) 17 m / s 2 , tan 1   4) m / s 2 , tan 1  4 
4 2
42. Which of the following is wrong statement
1) An emf can be induced between the ends of a straight conductor by moving it
through a uniform magnetic field
2) The self induced emf produced by changing current in a coil always tends to
decrease the current
3) Inserting an iron core in a coil increases its coefficient of self induction
4) According to Lenz's law, the direction of the induced current is such that it
opposes the flux change that causes it

43. Two forces of magnitudes 4N and 8N are acting on a box, when the box moves
rightward across a frictionless horizontal support. The speed of the box at time t
is 1ms-1. The change in kinetic energy of the box is
1) Zero 2) 80J 3) 8J 4) 4J
44. A series combination of resistor of resistance 100 , inductor of inductance 1 H
and capactitor of capacitance 6.25  F is connected to an ac source. The quality
factor of the circuit will be_______
1) 2 2) 4 3) 6 4) 8
45. At a given temperture the root mean square velocities of oxygen and hydrogen
molecules are in the ratio
1) 16 : 1 2) 1 : 16 3) 4 : 1 4) 1 : 4
46. In the given figure the string has mass 4.5g. Find the time taken by a transverse
pulse produced at the floor to reach the pulley.  g = 10 ms 2 
1) 0.02s 2) 0.04s 3) 0.01s 4) 0.03s

47. In a Rutherford scattering experiment when a projectile of charge z1 and M 1
approaches a target nucleus of charge z 2 and mass M 2 , the distance of closest
approach is r0 . The energy of the projectile is
1) Directly proportional z1 z2 2) Inversely proportional to z1
3) Directly proportional to mass M 1 4) Directly proportional to M 1  M 2
48. From a disc of radius R, a concentric circular portion of radius 'r' is it cut out so
as to leave an annular disc of mass M. The moment of inertia of this annular disc
about the axis perpendicular to its plane and passing through its centre of gravity
is
1 1 1 1
1) M ( R 2  r 2 ) 2) M ( R 2  r 2 ) 3) M ( R 4  r 4 ) 4) M ( R 4  r 4 )
2 2 2 2
49. The combination of NAND gates is shown in figure. The equivalent circuit is
1) AND gate 2) NOR gate 3) OR gate 4) NOT gate

50. The body is in stable equilibrium at
1) x = x1 2) x = x2 3) both x1 and x2 4) neither x1 nor x2

CHEMISTRY
SECTION – A
51. The boiling point of pure benzene is 353.4K. When 1.8g of non-volatile solute is
dissolved in 90g of benzene, the boiling point is raised to 354.3K. Kb for benzene
is 2.53 K.mol1.kg . Then the molar mass of solute is ______g/mol.
1) 48.46 2) 56.22 3) 11.56 4) 42.74
52. If the density of 20% (w/w) KI solution is 1.202g/ml, then the mole fraction of KI
in the solution is ______ [Given : Mw of KI = 166 g/mol]
1) 0.128 2) 0.225 3) 0.028 4) 0.058
53. 0.099 g of an organic compound when heated with fuming nitricacid in the
presence of silver nitrate in a Carius tube gave 0.287 g silver chloride. The
percentage of chlorine in the compound is about: (At. Wt. of Ag = 108, Cl = 35.5)
1) 28.64 2) 71.72 3) 35.45 4) 64.23
 2
54. O  2e  O ; H  560 KJ /mole
O  e  O ; H  142 KJ /mole
O  e  O2 ; H  x KJ /mole
1) -702 2) +702 3) -318 4) +318
55. Mark the correct relations.
(a) IE1 of Ca > IE1 of K (b) IE2 of Al > IE2 of Mg
(c) Electropositivity of Ba > Sr (d) Electronegativity of N > P
1) a, b, c, d are correct 2) only a, b are correct
3) only a, c are correct 4) a, b, d are correct
56. IUPAC name of CH 3  C  C  CH  3 2 is
CH
1) 4 – methylpent – 2 – yne 2) 4, 4 – dimethyl – but -2 – yne
3) Isopropyl methyl acetylene 4) 2 – methyl – pent – 3 – yne
57. The energy required to excite an electron of H – atom from 1st orbit to 2nd orbit is
3 1
1) th of its ionization energy 2) nd of its ionization energy
4 2
1 1
3) th of its ionization energy 4) th of its ionization energy
4 9
58. The electronic transition of He+ ion having same wavelength as that of 2nd line of
Balmer series of H-spectrum is _________
1) n1 = 4; n2 = 9 2) n1 = 4; n2 = 6
3) n1 = 4; n2 = 8 4) n1 = 1; n2 = 2
59. Which configuration is erythro?
1) 2) 3) 4)
60. A white salt is insoluble in cold water but soluble in hot water. Its soluiton when
treated with potassium chromate solution gives yellow precipitate. The salt may
be :
1) BaCl2 2) SrCl2 3) PbCl2 4) Hg(NO3)2
61. Which of the following is soluble only in aquaregia?
1) PbS 2) CaS 3) NiS 4) All the above
62. Colloidal solution of Fe(OH)3 is prepared by the hydrolysis of excess FeCl3
solution. This process involves.
1) Electrodispersion method 2) Peptization
3) Double decomposition 4) Bredig arc method

63. Assertion (A): Bonding molecular orbital has greater stability than corresponding
antibonding molecular orbital.
Reason (R) : The electron density in a bonding molecular orbital is located away
from the space between the nuclei while in antibonding molecular orbital it is
located between the nuclei of the bonded atoms.
the assertion
64. For which of the following, the given conditions will satisfy?
I) Bond order is 2 II) Two bonds are  -bonds
III) Diamagnetic in nature
1) O2 2) N 22 3) B2 4) C2
65. Assertion (A) : The B-F bond length in BF4 is higher than that in BF3 molecule.
Reason (R) : BF3 is planar molecule while BF4 is tetrahedral in shape.
66. Which of the following acids has lowest pKa value?
O O
1) CH 3  CH  C  OH 2) CH 3  CH 2  C  OH
NO2 NO2
O Cl O
3) CH 2  C  OH 4) CH 3  C  C  OH
Cl Cl
67. Arrange the following groups in order of decreasing m-directing strength.

 N R3 ,  CN ,  NO2 ,  COOH
 
1)  N R3   NO2  CN  COOH 2) COOH  CN   NO2   N R3
 
3) CN   NO2  COOH   N R3 4) CN   NO2   N R3  COOH
68. Aluminium chloride in Aq. acidified solution forms a complex ion A with
shape B and hybridisation C . Then A, B and C are respectively.

1)  Al  OH  4  , square planar, sp 3
3
2)  Al  H 2O 6  , octahedral, sp3d 2
3
3)  Al  H 2O 6  , trigonal bipyramidal sp3d
3
4)  Al  H 2O 6  , pentagonal bipyramidal, sp3d 2
69. Order of melting points of 15th group elements is
1) N<P<As<Sb<Bi 2) N>P>As>Sb>Bi 3) N<P<As>Sb>Bi 4) NAs<Sb<Bi
70. Consider the following two structures
Choose the correct statement

1) Both (i) & (ii) are conjugated system 2) (i) & (ii) both are aromatic
3) (i) is aromatic & (ii) is antiaromatic 4) (i) is less stable than (ii)

71.
72. Assertion (A) : on reaction with Na / NH3 gives as major product.

Reason (R) : This reaction occurs through the formation of carbocation
intermediate.
the Assertion
of the Assertion
73. The weight of lime obtained by heating 200 kg of 95% pure lime stone is :
(1) 98.4 kg (2) 106.4 kg (3) 112.8 kg (4) 122.6 kg
74. A solution of sodium sulphate contains 92 g of Na+ ions per kilogram of water.
The molality of Na+ ions in that solution in mol kg–1 is :
(1) 16 (2) 12 (3) 8 (4) 4
75. Match the redox process in Column – I with n-factor for underlined species in
Column – II.
(Redox process) (n-factor for underlined species)
 2
(A) As2S3 → AsO3  SO4 (I) 28
(B) I2 → I   IO3 (II) 4/3
(C) H3PO2 → PH 3  2 H 3 PO3 (III) 1
(D)
.
H3PO2 +NaOH→NaH2PO2+H2O (IV) 5/3
.
(A) (B) (C) (D) (A) (B) (C) (D)

1) IV I III II 2) I IV II III
3) II I IV III 4) III I IV II
76. Assertion : The order of reactivity of alkyl halides towards S N 1 reaction is
tertiary halide > secondary halide > primary halide.
Reason : The reaction follows carbocation mechanism.
of the Assertion
of the Assertion
77. Assertion : Replacement of – Cl group by – OH in chlorobenzene is easier if nitro
group is present in the ring at ortho and para position.
Reason : Nitro group leads to strengthening of the C – Cl bond in chlorobenzene.
of the Assertion
of the Assertion

78. The stability of the halides of group-16 elements decreases in the following order:
       
1) Br  I  Cl  F 2) F  I  Cl  Br
       
3) F  Cl  Br  I 4) I  Cl  Br  F
79. The correct order of bond energies of halogen molecules is
1) F2  Cl2  Br2  I 2 2) F2  Cl2  Br2  I 2
3) Cl2  Br2  F2  I 2 4) Cl2  F2  Br2  I 2
80. For a reaction, A → products; when initial conc. of reactant is 4M, the half life is
60min. For same reaction half life is 75 min when the initial conc. of reactant is
5M. Then the order of the reaction is ____
1) 1 2) 2 3) 3 4) 0
81. For a reaction A+B→ products, the rate law is given by,
Rate = K[A]2[B]. In an experiment ‘A’ is taken in excess. The order of the reaction
is__
1) 3 2) 2 3) 1 4) 0
82. Phenol on reduction with H2 in the presence of Ni catalyst gives
1) benzene 2) toluene 3) cyclohexane 4) Cyclohexanol
83. In Williamson's synthesis of ethers, which one of the following is not used?
1) Ethyl bromide 2) tert-butylchloride
3) Sodium Ethoxide 4) Sodium tert-butoxide
84. The heat of combustion of carbon to carbon dioxide is -393.5 kJ/mol. The heat
released upon the formation of 35.2g of CO2 from carbon and oxygen gas is :
1) -315 kJ 2) +315 kJ 3) -630 kJ 4) 3.15 kJ
85. For the reaction
2A  g   B  g   2D  g 
U 0 = −10.5𝑘𝐽 and S 0 = − 40𝐽𝐾
Calculate G 0 for the reaction at 120 K. ( Given that RT = 1000 Joules )
1) 6. 7 kJ mol-1 2) – 6.7 kJ mol-1 3) – 16.3 kJ mol-1 4) +16. 3 kJ mol-1
SECTION – B
86. The placement of Zn, Cd and Hg along with transition elements is not proper
because
1) Their d orbitals are completely filled 2) Their d orbitals are empty
3) They do not form complex compounds 4) They form coloured compounds
87. Assertion (A) : The spin only magnetic moment of Sc3+ is 1.73 BM.
Reason (R) : The spin only magnetic momentum in (BM) is equal to n  n  2  ,
where is number of unpaired electrons.
88. The compound :
O
HOCH 2CH 2CH 2CH 2 CH

can form a hemiacetal by reacting with itself in solution. What is the structure of
this hemiacetal?
89. Which of the following has minimum pKa value?
COOH CH2COOH
1) FCH2COOH 2) ClCH2COOH 3) 4)

90. Effective atomic number (EAN) for Mn in complex [Mn2(CO)10]
1) 35 2) 34 3) 37 4) 36
91. The correct statement/s are
1)Pentacarbonylthiocyanato-S-manganese (II) ion and pentacarbonyl thiocyanato-
N-Manganese(II) ion are linkage isomers
2) Cr  H 2O 6  Cl3 and Cr  H 2O 5 Cl  Cl2 .H 2O are solvate isomers
3) Co  NH 3 6  Cr  CN 6  and Cr  NH 3 6  Co  CN 6  are coordination isomers
4) All of these
92. Which of the following is an incorrect statement?
1) All octahedral complexes of Ni2+ ion are outer orbital complexes irrespective of
nagure of the ligand.
2) Magnitude of  t is less than half of 0
3)  PtCl4  is square planar complex whereas  NiCl4 
2 2
is tetrahedral complex
4)  EDTA
4
is a tetradentate ligand
93. The pH of a solution is 5.9. If the hydrogen ion concentration is decreased
hundred times, the solution will be :
1) more acidic 2) neutral 3) less acidic 4) slightly basic
94. On adding 20 ml of N/10 NaOH solution to 10 ml of N/10 HCl, the resulting
solution will:
1) turn blue litmus red
2) turn phenolphthalein solution pink
3) turn methyl orange red
4) pH of the resulting solution is13.
95. The pH of a 108 M solution of HCl is:
1) 8 2) 6 3) between 6 and 7 4) between 7 and 8
96. In the chemical reactions,
the compounds ‘A’ and ‘B’ respectively are

1) nitrobenzene and fluorobenzene
2) phenol and benzene
3) benzene diazonium chloride and fluorobenzene
4) nitrobenzene and chlorobenzene
97. Which of the following is the correct IUPAC name of the compound ?
1) 1, 2-dichloro-4-(N, N-dimethyl) aniline

2) Dimethyl – (3, 4-dichlorophenyl) amine
3) 3, 4-dichloro - N, N-dimethyl aniline
4) N, N-dimethylamino - 3, 4-dichlorobenzene
98. In the process of electrolysis using active metal electrodes the weight of cathode
and anode.
1) Increases, decreases 2) Decreases, decreases
3) Increases, increases 4) Decreases, increases
99. During the electrolysis of aqueous solution of sodium chloride, pH of the
resulting solution of electrolyte
1) Remains constant 2) Gradually increases
3) Gradually decreases 4) Decreases first and then increases
100. Statement – I: Glycine must be taken through diet.
Statement – II: It is essential amino acid.

BOTANY
SECTION – A
101. Identify the pair of protists that are biflagellated
1) Euglena and Pamacoecium 2) Euglena and Trypanosoma
3) Gonyaulax and Euglena 4) Gonyaulax and Amoeba
102. Most common method of reproduction in both monerans as well as protists is
1) Budding 2) Fission 3) Conjugation 4) Transformation
(A) Flagellate (I) Entamoeba
(B) Ciliate (II) Trypanosoma
(C) Amoeboid (III) Plasmodium
.
(D) Sporozoan (IV) Paramoecium
(A) (B) (C) (D) (A) (B) (C) (D)
1) II IV I III 2) II I IV III
3) III II I IV 4) IV III I II
104. Theuntreated sewage is often discharged directly into rivers leading to there B .
and increase in A .
1) (A) Pollution, (B) Soil – borne disease 2) (A) Pollution, (B) Water-borne disease
3) (A) Water-borne disease, (B) Pollution 4) (A) Soil-borne disease, (B) Pollution
105. The effluent is generally released into natural water bodies from the which plant.
1) Primary treatment plant 2) Primary sludge
3) Ecological treatment plant 4) Biological treatment plant
106. Match column- I with column – II and select the correct option.
(A) Methanogens (I) BOD
(B) Fermentors (II) Methane rich fuel gas
(C) Organic waste in water (III) Production of methane
.
(D) Bio gas (IV) Large vessels for growing microbes
(A) (B) (C) (D) (A) (B) (C) (D)
1) III IV I II 2) II I IV III
3) IV III II I 4) II IV III I
107. Study the following statements and choose the correct option.
I) Agar, one of the commercial products obtained from Porphyra, Laminaria.
II) The algae are divided into three main classes: Chlorophyceae, Phaeophyceae
and Rhodophyceae.
III) Chlorella a unicellular alga rich in proteins is used as food supplement even
by space travellers.
IV) Many species of Porphyra, Laminaria and Sargassum are among the 70
species of marine algae used as food.
108. Gymnosperms are characterised by
1) multiflagellated sperms 2) naked seeds
3) winged seeds 4) seeds inside fruits
109. Choose the Mismatched pair
1) Isogamous………… Ulothrix, Spirogyra. 2) Motile Isogametes…… Spirogyra.
3) Oogamous………… Volvox, Fucus. 4) Anisogamous…………… Eudorina.
110. Find incorrect statements regarding blue white screening
p) Recombinant colonies produces no colour in the presence of chromogenic
substrate
q) Recombinant colonies produces blue colour in the presence of chromogenic
substrate
r) Non-recombinant colonies produces no colour in the presence of chromogenic
substrate
s) Non-recombinant colonies produces blue colour in the presence of
chromogenic substrate
1) (p) and (q) 2) (q) and (s) 3) (q) and (r) 4) (r) and (s)

111. Which of the following options represent elution step of gel electrophoresis?
1) Loading of DNA sample into cells 2) Migration of DNA sample on gel
3) Separation and extraction of DNA bands from agarose gel
4) Separation and extraction of DNA from the mitochondria
112. Given below is the restriction site of a restriction endonuclease Pst-I and cleavage
sites on a DNA molecule
Choose the option that gives the correct resultant fragments by the action of the
enzyme pst-I.
1) 2)
3) 4)
113. Statement-I: The DNA fragments separate according to their size through sieving
effect provided by the agarose gel
Statement-II: The larger the fragment size, the farther it moves
Column-I Column-II
p) DNA ligase i) Isolate DNA from plant cell
q) 𝛽-galactosidase ii) DNA synthesis
r) Cellulase iii) Chromogenic substrate
s) Taq-polymerase iv) To join DNA fragments
1) p-iv, q-iii, r-i, s-ii 2) p-iv, q-iii, r-ii, s-i
3) p-i, q-ii, r-iii, s-iv 4) p-iv, q-i, r-iii, s-ii
115. Select the correct match.
Plant Phyllotaxy
1) China rose Opposite
2) Nerium Alternate
3) Guava Opposite
4) Sunflower Whorled
116. Select the wrongly matched pair.
1) Epiphyllous condition – Lilly 2) Monadelphous stamen – Pea
3) Ovary inferior – Ray florets of sunflower 4) Apocarpous condition – Rose
A) In pea and bean flowers, the standard petal ovarlaps wing petals and inturn
wing petals overlap keel petals.
B) When stamens are united into one bundle as in chinarose it is called
monoadelphous.
C) Variation in length of filaments of stamens is observed in Salvia.
D) When stamens are attached to perianth as in flowers of lily, it is called
epiphyllous.
Choose correct statements.
1) Only A and C 2) Only B and D
3) Only A, B and C 4) A, B, C and D are correct
List-I List-II
A) Petals 5, polypetalous (I) Cruciferae
B) Petals 4, gamopetalous (II) Fabaceae
C) Petals 5 (III) Malvaceae
`
D) Perianth (IV) Poaceae
A B C D A B C D
3) III I II IV 4) III II IV I

119. Which of the following is a wrong statement?
1) Histone proteins are rich in basic amino acids.
2) Positively charged DNA is wrapped around negatively charged histone octamer.
3) The nucleosomes in a chromatin are seen as 'beads-on-string' structure when
viewed under electron microscope (EM).
4) In DNA, the distance between two consecutive base pairs in 0.34 nm.
120. To prove that DNA is the genetic material, which radioactive isotopes were used
by Hershcy and Chase (1952) in their experiments ?
1) 35 S and 15 N 2) 32 P and 35 S 3) 32 P and 15 N 4) 14 N and 15 N
121. Mutation is a phenomenon which results in alteration of DNA sequences and
consequently results in changes in the :-
1) Only genotype of an organism
2) Only phenotype of an organism
3) Neither Genotype nor phenotype of an organism
4) Both Genotype and phenotype of an organism
122. In lac operon y gene code an enzyme which is responsible for :
1) Hydrolysis of lactose
2) Increases permeability of the cell to lactose (β-galactosides)
3) Transfer of acetyl group
4) Represession of lac operon
123. Consider the following four statements (a-d) and select the option which includes
all the correct:-
(a) The codon is read in mRNA in a contiguous fashion.
(b) UAG codon has dual function in protein synthesis.
(c) In actual structure, the tRNA is a compact molecule which looks like inverted
'L'.
(d) 28's' rRNA in bacteria also behave as ribozyme.
1) b, c and d 2) a, b and d 3) a, c and d 4) a and c
124. The order and sequence of amino acids during protein synthesis are defined by
the sequence of Nitrogen bases present in the :-
1) r-RNA 2) t-RNA 3) m-RNA 4) Sn-RNA
125. Read the following given statements and state them as true (T) or false (F).
A. Parenchyma forms the major component within plant organs.
B. Phellogen is a dedifferentiated tissues.
C. Phloem fibres of jute, hemp, and flax are used commercially.
D. Xylem parenchyma is absent in most of the monocots.
A B C D A B C D
1) T F T F 2) T T T F
3) F F T T 4) F T F T
126. Assertion : Heart wood is durable.
Reason : Heart wood is filled with various substances like resins, gums &
aromatic oil etc.
127. Read the different components from (a) to (d) in the list given below and tell the
correct order of the components with reference to their arrangement from outer
side to inner side in a woody dicot stem:
(a) Secondary cortex (b) Wood
(c) Secondary phloem (d) Phellem
The correct order is :
1) (d), (c), (a), (b) 2) (c), (d), (b), (a) 3) (a), (b), (d), (c) 4) (d), (a), (c), (b)
128. When a pink flowered antirrhinum plant is test crossed, then phenotypic ratio in
resulting progeny is
1) 1 Red : 1 White 2) 3 Red : 1 White
3) 2 Pink : 1 White 4) 1 Pink : 1 White
129. Heterozygous tall and violet flowered pea plants were selfed and total 512 seeds
are collected. What will be thetotal number of seeds for both heterozygous traits?
1) 128 2) 256 3) 384 4) 64

130. Mark the odd one (w.r.t. F2 generation of mendilian dihybrid cross)
1) Frequency of TtRR genotype = 12.5% 2) Frequency of TtRR genotype = 6.25%
3) Frequency of ttrr genotype = 6.25% 4) Frequency of ttRr genotype – 25%
131. In incomplete dominance
1) Dominant trait is completely expressed in F1 generation.
2) Phenotypic and genotypic rotio are different
3) Two dominant alleles are needed to express the complete dominant trait
4) F1 individuals have the equal traits of both parents.
132. Assertion (A): Dominance is not an autonomous features of a gene.
Reason (R): It depends as much on the gene product and the production of a
particular phenotype from this product.
133. Given below are two statements:
Statement-I : Ribosomes are known as organelle within organelle.
Statement-II : Peroxisomes degrade H2O2 into H2O and O2 with the help of
catalase enzyme.
1) Both Statement-I and Statement-II are correct.
2) Statement-I is correct but statement-II is incorrect.
3) Statement-I is incorrect and Statement-II is correct.
4) Both Statement-I and II both are incorrect
134. Match the column I with column II and identify the correct combination
Column I Column – II
(a) Cristae (i) Primary constriction in chromosome
(b) Thylakoids (ii) Disc-shaped sacs in Golgi apparatus
(c) Centromere (iii) Infoldings in mitochondria
(d) Cisternae (iv) Flattened membranous sacs in stroma of plastids
1) (a)–(iv), (b)–(iii), (c)–(ii), (d)–(i) 2) (a)–(i), (b)–(iv), (c)–(iii), (d)–(ii)
3) (a)–(iii), (b)–(iv), (c)–(i), (d)–(ii) 4) (a)–(ii), (b)–(iii), (c)–(iv), (d)–(i).
135. The ovule of an angiosperm is technically equivalent to:
1) Megaspore mother cell 2) Megaspore
3) Megasporangium 4) Megasporophyll
SECTION – B
136. In majority of angiosperms:
1) Reduction division occurs in the megaspore mother cell
2) A small central cell is present in the embryo sac
3) Egg has a filiform apparatus
4) There are numerous antipodal cells
137. Respiratory enzymes occur in bacterium in
1) Plasma membrane 2) Mitochondria
3) Golgi apparatus 4) Endoplasmic reticulum
138. Which one of the following statements is not true?
1) Tapetum helps in the dehiscence of anther
2) Exine of pollen grains is made up of sporopollenin
3) Pollen grains of many species cause severe allergies
4) Stored pollen in liquid nitrogen can be used in the crop breeding programmes
139. CH 3   CH 2 14  COOH . This is the formula of
1) Phospholipid 2) Palmitic acid 3) Triglyceride 4) Arachidonic acid
140. Statement –I : Cartoon structure of polysaccharide is branched present in
animals as animal starch.
Statement –II : Polymer of glucose monomers end with aldehyde and without
aldehyde gorup as food storage carbohydrates in Animals and Bacteria.

141. The growth of a pollen tube and dorsiventral leaf is measured in terms of
1) An increase in surface area and in terms of its length respectively.
2) In terms of its length and an increase in surface area respectively.
3) In terms of its surface area and an increase in volume respectively.
4) In terms of its length and decrease in area respectively.
142. Relative growth rate and absolute growth rates are two ways of
1) Quantitative comparisons between the growth of non-living system
2) Quantitative comparisons between the growth of living system
3) Qualititative comparisons between the growth of living system
4) Qualititative comparisons between the growth of non-living system
143. Statement – I: Gibberellins increase the sugarcane yield by as much as 20
tonnes per acre.
Statement – II : Sugar cane crop treated with gibberellins increases the length of
the root.
144. Read the statements.
I) The complete disintegration of nuclear envelope marks metaphase.
II) The two daughter chromatids referred as daughter chromosomes
III) condensation of chromosomes is completed.
Select correct option.
1) I and III true for metaphase 2) II is true for Anaphase – I
3) II is true for prophase 4) I and II true for metaphase
145. On X phase centrosome undergone duplication and in Y phase begins to
move opposite poles of the cell.
1) X – prophase, Y – Interphase 2) X – Interphase, Y – prophase
3) X – Interphase, Y – Metaphase 4) X – Prophse, Y – Metaphase
146. The action spectrum of photosynthesis is
1) similar to absorption spectrum of chl a but not chl b
2) similar to absorption spectrum of chl b but not chl a
3) similar to absorption spectrum of chl a and chl b both
4) similar to absorption spectrum of carotenoids
147. ATP and NADPH produced in light reaction by the movement of electrons in ETC
are used immediately for
1) oxidation of carbohydrate
2) synthesis of sugar in biosynthetic phase
3) reduction of carbon dioxide
4) Both (2) and (3)
148. Incorrect statement is:
1) Except for plants in shade or in dense forests, light is a limiting factor for
photosynthesis.
2) Internal factor of photosynthesis and respiration are dependent on the genetic
predisposition and the growth of the plant.
3) At any point, the rate of the process is determined by the factor available at
sub-optimum levels.
4) The C3 plants show saturation at about 360 ppm CO2 while C4 responds to
increased CO2 concentration and saturation is seen only beyond 450 ppm.
149. Oxidative decarboxylation is a complex set ofreaction catalysed by :
1) Pyruvate dehydrogenase 2) Lactate oxidase
3) Alcohol dehydrogenase 4) Lactate dehydrogenase
150. Number of oxidation during Kreb's cycle are :

ZOOLOGY
SECTION – A
151. For Mn- blood grouping system, the formation of M and N alleles an 0.7 and 0.3
respectivley. Expected frequency of MN-blood group bearing organisms is likely to
be
1) 49% 2) 9% 3) 58% 4) 42%
152. Which of the following is an example for link species?
1) Dodo bird 2) Sea wead 3) Stegosaurus 4) Lobe fish
(A) Abiogenesis (I) Darwin
(B) Use and disuse of organs (II) Wagner
(C) Natrual selection (III) Oparin
.
(D) Continental drift theory (IV) Lamark
(A) (B) (C) (D) (A) (B) (C) (D)
1) I IV III II 2) I III IV II
3) III IV I II 4) IV III I II
154. Rhyna type plants evolved from
1) Psilophytons 2) Tracheophyes ancestors
3) Chlorophyte 4) Progymnosperms
155. Anthropogenic extinction refers to which extinction?
1) Sixth mass extinction 2) Fourth mass extinction
3) Fifth mass extinction 4) Seventh mass extinction
156. Which are of the following is not included under in situ conservation?
1) National park 2) Botanical garden
3) Sanctuary 4) Biospehre reserve
157. Number of reptile species present in Amazonian rain forest.
1) 427 2) 378 3) 1300 4) 3000
158. In frog, heart is enclosed within two-layered sac called
1) Mesorchium 2) Pericardium 3) Pleura 4) Conus arteriosus
159. External genitalia in cockroach in represented by
1) Male gonapophysis 2) tastes
3) Ejaculatory duct 4) Both (1) and (2)
160. A pair of testes in cockroach lies in
1) 2-4 abdominal segments 2) 4-6 abdominal segments
3) 4-7 abdominal segments 4) 6-8 abdominal segments.
161. Retina of human eye contain what kind of neurons.
1) Moltspolar neuron 2) Pripolar neuron
3) Unipolar neuron 4) Pseudo unipolar neuron
162. Function of Axon is to
1) Bringing impulse into cell body 2) Take impulse away from cell body
3) Support neuroglial cells 4) From meline sheath
163. Assertion : Ecology is basically concerned with four levels of biological
organisation, organisms, population, community and biomes.
Reason : Ecology is a subject which studies the intractions among organism and
between the organisms and its physical environment.
the assertion
164. Which of the following would necessarily decrease the density of a population in a
given habitat?
1) Natality > mortality 2) Immigration > Emigration
3) Mortality & emigration 4) Natality and immigration

165. Statement – I : By haemodialysis, accumulated blood urea can be removed.
Statement – II : Inflamation of glomeruli of kidney is refered as renal failure.
166. During uring formation, tubular reabsorption is minimum at _____
1) PCT 2) Ascending limb of vasa recta
3) Collecting duct 4) Ascending limb of LH
167. The function of DCT in urine formation is ____
1) Sodium – Potassium balance in blood
2) Selective secretion of H+, K+ ions & NH3
3) Conditional reabsorption of Na+& urea
4) More than one option is correct.
168. In most simple type of canal system of Porifera, which of the following ways
exhibit water flow?
1) Ostia  Spongocoel  Osculum  Exterior
2) Spongocoel  Ostia  Osculum  Exterior
3) Osculum  Spongocoel  Ostia  Exterior
4) Osculum  Ostia  Spongocoel  Exterior
169. Cyclostomes are characterized by the
1) Presence of scales 2) Presence of jaws
3) Absence of paired fins 4) Absence of cranium
170. Identify the figures A and B and select the correct option.
1) A : Jelly fish. It is sessile 2) B : sea anemone, It is umbrella-shaped

3) A : Jelly fish. It has cnidocytes 4) B : Sea anemone. It is a medusoid form
171. In malaria disease the parasite sporozoites reach the liver through ___________
1) Gut 2) Oral cavity 3) Lungs 4) Blood
172. Select the correct statement
1) HIV virus is replicated and released while uninfected can survive
2) HIV virus is replicated and released while infected cells will die
3) HIV virus is replicated and released while infected cells can survive
4) HIV virus is replicated and released while infected cells will not infect other
cells
173. Select the correct option
i) Excessive dose of drug leads to coma and death due to respiratory failure and
cerebral hemorrhage.
ii) Drinking alcohol reduces the concentration of Haeme bound Oxygen
1) Both statements are correct 2) Only ii) is correct
3) Only i) is correct 4) Both are incorrect
174. Infections disease which is fatal is
1) Common cold 2) AIDS 3) Ring worm 4) All the above
175. During oogenesis, which of the following does not occur during second meiotic
division. (in normal condition)
1) Unequal distribution of chromosomes
2) Formation of ootid
3) Formation of polar body
4) Unequal division of secondary oocyte

176. Statement –I : Gametogenesis is initated during the embryonic development
stage in human female.
Statement –II : Gametogenesis starts at the age of puberty in human male.
177. Human genome project was co-ordinated by
1) U.S. Department of energy 2) National Institute of Health
3) Welcome Trust (Japan) 4) Both 1 and 2
178. Which one of the following is a matching pair of a body feature and the animal
possessing it?
1) Silver fish - Dorsal nerve cord
2) Devil fish - Pharyngeal gill-slits
3) Dog fish - Ventral heart
4) Hag fish - Ntochord is absent
179. In Petromyzon, metamorphosis and spawning occurs respectively in
1) Fresh water, Fresh water 2) Marine water, Fresh water
3) Fresh water, Marine water 4) Marine water, Marine water
180. Choose the INCORRECT statements from the following
I. Pila as unsegmented body
II. Asterias has an exoskeleton made of calcareous ossicles
III. Balanoglossous has well developed stomochord in collar region
1) Only I 2) I and III 3) Only II 4) II and III
181. Match the following and choose the correct option
Column – I Coulum – II
A) Peptide Hormone i) Aldosterone
B) Steroid Hormone ii) Catecholamines
C) Amino acid derivative iii) Gastrin
D) Protein Hormone iv) Calcitonin
1) A – ii, B – iii, C – i, D – iv 2) A – iv, B – i, C – ii, D – iii
3) A – iii, B – i, C – ii, D – iv 4) A – iii, B – ii, C – iv, D – i
1) Both catecholamines act on same system and produce similar effects
2) Both catecholamines act on Iris for pupillary dilation
3) Both adrenaline & testosterone promote muscle growth by anabolic effect on
proteins
4) Iodothyronines & Androgens act on CNS to developmental faculties and to
influence libido respectively.
183. Blotting process involves the transfer of DNA fragments from
1) Agarose Gel to Radio labelled probes
2) Agarose Gel to Nylon membrane
3) Nitrocellulose membrane to Agarose Gel
4) Agarose Gel to photographi plate
184. Chromosomal basis of sex determination was developed from the cytological
observations made in ________
1) Fowls 2) Humans 3) Insects 4) Pea plant

185. Choose the incorrect statement about Sickle cell anemia.
(i) It is an autosomal recessive disease.
(ii) It is caused by the substitution of valine by glutamic acid at sixth position of
beta globin chain
(iii) It is due to a frameshift mutation due to substitution of single base at beta
globin gene.
(iv) A the carrier of Sickle cell anaemia has 50% probability for transfer of mutant
gene to the progeny
1) (ii), (iii) 2) (i), (ii), (iii) 3) (iii), (iv) 4) All of the above
SECTION – B
186. Which of the following statement is true for colourblindness :-
1) It is due to mutation in certain genes present in y-chromosome
2) It occurs in about 8% of female and about 0.4 % of male
3) The son of a woman who is carrier of colourblind has 50% chance of being
colourblind
4) It is an autosomal linked disorder
187. Klinefelter syndrome will be
1) 44 + XX 2) 44 + XXY 3) 44 + XY 4) 44 + XO
188. Identify the incorrect statement about productivity
1) The annual net primary productivity of the whole biosphere is approximately
170 billion tons
2) GPP is the available biomass for the consumption of heterotrophs
3) GPP – R = NPP
4) New organic matter produced by the consumers is known as secondary
productivity
189. During decomposition, water-soluble inorganic nutrients go down into the soil
horizon and get precipitated as unavailable salts; that process is known as
1) Fragmentation 2) Catabolism 3) Humification 4) Leaching
190. Which of the following representations show the pyramid of numbers in a
grassland ecosystem and in a tree ecosystem?
1) A&B 2) A&C 3) B&C 4) C&A

191. For the effective results of contraception pills, they should be taken
1) Once every month on the day of ovulation
2) For 21 days daily, followed by a gap of seven days
3) For seven days daily, during the time of ovulation
4) Daily, without any gap
192. Select the incorrect statement regarding ‘Saheli’.
1) It was developed by CDRI, Lucknow, India.
2) It contains high amounts of progesterone and estrogen.
3) It is taken once a week.
4) It has the least side effects and a high contraceptive value.
193. Taxon is a:
1) Group of same species 2) Group of similar genera
3) Subdivision of kingdom 4) Any rank in taxonomic hierarchy
194. Intercostal muscles are found attached with
1) diaphragm 2) ribs 3) pleura 4) lungs

195. Partial pressure of oxygen in inspired and expired air is ……. and ……. mm of Hg.
1) 100, 46 2) 159, 40 3) 159, 90 4) 100, 95
196. When CO2 concentration in blood increases, breathing becomes?
1) slow and deep. 2) faster and deeper.
3) shallower and slow. 4) there is no effect on breathing.
197. _______are used in testing safety of polio vaccine before they are used on human.
1) Transgenic pig 2) Transgenic monkey
3) Transgenic rabbits 4) Transgenic mice
198. Which committee takes decision regarding the validity of GM research and the
safety of introducing GM-organisms for public services?
1) Indian Council of Medical Research (ICMR)
2) Genetic Engineering Approval committee (GEAC)
3) Indian Institute of Science Education and Research (IISER)
4) Genetic Engineering Appraisal Committee (GEAC)
199. Select the correct option :
1) Each rib is a thin flat bone connected dorsally to the vertebral column.
2) The 8th, 9th and 10th pair of ribs articulate directly with the sternum.
3) First seven pairs of ribs are only bicephalic in nature.
4) Sternum is a flat bone on the dorsal side of thorax.
200. Statement-I : Some specalised cells in our body like macrophages and
leucocytes exhibit amoeboid movement.
Statement-II : Pseudopodia is formed by the streaming of protoplasm.
1) Both statements I & II is true.
2) Statement I is true, statement II is false.
3) Statement I is false, statement II is true.
4) Both statements I & II is false.
*******

: ANSWER KEY:
SET-2 SUB: PHYSICS
1 2 11 3 21 4 31 4 41 4
2 2 12 1 22 2 32 3 42 2
3 4 13 3 23 1 33 1 43 1
4 3 14 4 24 4 34 1 44 2
5 2 15 3 25 3 35 1 45 4
6 1 16 1 26 4 36 1 46 1
7 4 17 2 27 4 37 4 47 1
8 2 18 4 28 3 38 1 48 1
9 4 19 3 29 1 39 4 49 3
10 1 20 3 30 2 40 1 50 2
SUB:CHEMISTRY
51 2 61 3 71 4 81 3 91 4
52 3 62 2 72 3 82 4 92 4
53 2 63 3 73 2 83 2 93 3
54 2 64 4 74 4 84 2 94 2
55 1 65 2 75 2 85 2 95 3
56 1 66 4 76 1 86 1 96 3
57 1 67 1 77 3 87 4 97 3
58 3 68 2 78 3 88 2 98 1
59 1 69 3 79 3 89 1 99 2
60 3 70 1 80 4 90 4 100 4
SUB : BOTANY
101 3 111 3 121 4 131 3 141 2
102 2 112 4 122 2 132 1 142 1
103 1 113 1 123 4 133 1 143 1
104 3 114 1 124 3 134 3 144 1
105 4 115 3 125 2 135 3 145 3
106 1 116 2 126 1 136 1 146 3
107 2 117 4 127 4 137 1 147 4
108 2 118 3 128 4 138 1 148 4
109 2 119 2 129 1 139 2 149 1
110 3 120 2 130 4 140 2 150 4
151 4 161 3 171 4 181 3 191 2
152 4 162 2 172 3 182 3 192 2
153 3 163 1 173 3 183 2 193 4
154 2 164 3 174 2 184 3 194 2
155 1 165 3 175 1 185 1 195 2
156 2 166 4 176 1 186 2 196 2
157 2 167 4 177 4 187 2 197 2
158 2 168 1 178 3 188 2 198 2
159 1 169 3 179 1 189 4 199 1
160 2 170 3 180 4 190 3 200 1

NEET GRAND TEST - 7
answer sheet.
CORRECT.
Section-B;
Marking Scheme :

PHYSICS
SECTION – A
1. If a lens of focal length f is divided into two equal parts and both pieces are put in
contact as shown in figure. The resultant focal length of combination is
1) f 2) 2f 3) 3f 4) 4f
2. The numerical ratio of average velocity to average speed is
1) always less than one 2) always equal to one
3) always more than one 4) equal to or less than one
3. In the following four situations charged particles are at equal distance from the
origin. Arrange them the magnitude of the net electric field at origin greatest first
1) (i) > (ii) > (iii) > (iv) 2) (ii) > (i) > (iii) > (iv)
3) (i) > (iii) > (ii) > (iv) 4) (iv) > (iii) > (ii) > (i)
4. Two cylinders A and B are made of the same material. The lengths and radii of
the two cylinders are in the ratio of 1 : 2. Both are twisted by the same extneral
torque. The ratio of the angle of twist of A and B is
1) 8 : 1 2) 1 : 8 3) 1 : 4 4) 1 : 2
5. The following figure show a logic gate circuit with two inputs A and B and the
ouput Y. The voltage waveforms of A and B and Y are as given
The logic gate is

1) NOR gate 2) OR gate 3) AND gate 4) NAND gate
l
6. The period of oscillation of a simple pendulum is given by T  2 where l is
g
about 100cm and is known to have 1mm accuracy. The period is about 2s. The
time of 100 oscillations is measured by a stop watch of least count 0.1s. The
percentage error in g is
1) 0.1% 2) 1% 3) 0.2% 4) 0.8%
7. The potential difference between the terminals of a cell is found to be 3 volts
when it is connected to a resistance of value equal to its internal resistance. The
e.m.f. of the cell is :-
1) 3 V 2) 6 V 3) 1.5 V 4) 4.5 V
8. The mass and diameter of a planet are twice that of the earth. What will be the
time period of oscillation of a pendulum on this planet, if it is seconds pendulum
on earth.
1
1) 2sec 2) 2 sec 3) sec 4) 2 2sec
2
9. The energy of a photon is equal to the kinetic energy of a proton. The energy of
the photon is E. Let 1 be the de-Broglie wavelength of the proton and  2 be the
wavelength of the photon. The ratio 1 / 2 is proportional to -
1) E0 2) E1/2 3) E–1 4) E–2

10. The relation between the gas pressure P and average kinetic energy per unit
volume E is
1 3 2
1) P  E 2) P = E 3) P  E 4) P  E
2 2 3
11. In a Young’s double slit experiment sources of equal intensities are used.
Distance between slits is d and wavelength of light used is (<<d). Angular
separation of nearest points on either side of central maximum where intensities
become half of the maximum value is
   
1) 2) 3) 4)
d 2d 4d 6d
12. The displacement-time graph for two particles A and B are straight lines inclined
at angles of 30o and 60o respectively with the time axis. The velocity ratio VA : VB
is
1) 1 : 2 2) 1: 3 3) 3 :1 4) 1 : 3
13. On the average how many neutrons are released by the fission of one uranium
atom?
1) 1 2) 2.5 3) 3 4) 4
14. a block weighing 10N travels down a smooth curved track AB joined to a rouogh
horizontal surface. The rough surface has a friction coefficient of 0.20 with the
block. If the block starts slipping on the track from a pont 1.0m above the
horizontal surface, then it would move a distance S on the rough surface.
Calculate the value of S[g = 10 m/s2]
1) 10m 2) 5m 3) 8m 4) 16m
15. n drops each of radius ‘r’ and carrying a charge ‘q’ are combined to form a bigger
drop. The ratio of potentials of bigger to that of smaller is
1) n3/ 2 :1 2) n1/ 3 :1 3) n2/ 3 :1 4) n3/ 4 :1
16. The specific heat of air at consntat pressure if 1.005 kJ/kg K and the specific
heat of air at constant volume is 0.718 kJ/kgK. Find the specific gas constant.
1) 0.287 kJ/kg K 2) 0.21 kJ/kg K 3) 0.34 kJ/kg K 4) 0.19 kJ/kg K
17. A magnetic needle suspended parallel to a magnetic field requires 3J of work to
turn it through 60o . The torque needed to maintain the needle in this position
will be
3
1) 2 3J 2) 3J 3) 3J 4) J
2
3
18. The end of a wire of length 0.5m and radius 10 m is twisted through 0.80 radian.
The shearing strain at the surface wire will be
1) 1.6 103 2) 1.6 102 3) 1.6 103 4) 1.6 106
19. Internal resistance of primary cell depends on :-
1) the nature of electrolyte
2) the area of plates immeresed in the electrolyte
3) the concentration of electrolyte and distance between the plates
4) all the above

20. A body initially at rest and sliding along a frictionless track from a height h (as
shown in the figure) just completes a vertical circle of diameter AB=D. The height
h is equal to
7 3 5
1) D 2)D 3) D 4) D
5 2 4
21. A square loop of side ‘a’ carries a curent I. The magnetic field at the centre of the
loop is
2 0 I 2  I 2 4 0 I 2 I
1) 2) 0 3) 4) 0
a a a a
22. A small drop of water falls from rest through a large height h in air. The final
velocity is:
1) Almost independent of h 2) Proportional to h
3) Proportional to h 4) Inversely proportional to h
23. A coil of resistance 10  and an inductance 5H is connected to a 100 volt battery.
Then energy stored in the coil is
1) 125 erg 2) 125 J 3) 250 erg 4) 250 J
24. In natural convection a heated portion of a liquid moves because
1) Its molecular motion becomes aligned
2) Of molecular collisions within it
3) It density is less than that of the surrounding fluid
4) of currents of the surrounding fluid
25. Calcualte the speed of sound in oxygen from the following data. The mass of 22.4
litre of oxygen at STP T  273K and p = 1.0 105 N/m 2  is 32g, the molar heat capacity
of oxygen at constant volume is Cv=2.5R and that at constant pressure is
Cp=3.5R.
1) 360 m/s 2) 380 m/s 3) 310 m/s 4) 410 m/s
26. A pendulum clock which keeps correct time at the surface of the earth is taken
into a mine, then
1) It keeps correct time 2) It gains time
3) It loses time 4) None of these
27. Four identical rods each of mass m and length ‘l’ are joined to form a rigid square,
centre is at origin and sides are parallel to x and y axis then moment of inertia
about
1) i – S, ii – P, iii – Q, iv – R 2) i – P, ii – Q, iii – R, iv – S
3) i – Q, ii – R, iii – p, iv – S 4) i – S, ii – P, iii – R, iv – Q

28. Figures shows a thermal network of five metal rods of the same cross – section
area, if the heat current from the ends A and B is 180 W. Find the heat current
through curved ( lower ) part
1) 70 W 2) 80 W 3) 90 W 4) 100 W
29. The power radiated by a black body is P and it radiates maximum energy at
wavelength o . If the temperature of the black body is now changed, so that it
3
radiates maximum energy at wavelength o , the power radiated by it becomes
4
nP. The value of n is
256 4 3 81
1) 2) 3) 4)
81 3 4 256
30. Among the following the wrong statemetns is
1) Law of gravitational is framed using Newton’s third law of motion.
2) Law of gravitation cannot explain why gravity exists
3) Law of gravitation does not explain the presence of force even when the
particles are not in physical contact
4) When the range is long, gravitational force becomes repulsive
31. Three identical linear rods of length l are arranged as shown in figure. Position of
centre of mass with respect to point O is :
5l l
1) 3l 2) 3) 4) l
6 4
32. A nucleus ruptures into two nuclear parts which have their velocity-ratio as 2 : 1.
The ratio of the their nuclear sizes (nuclear radii) is
1/ 3 1/ 2 1/ 3 1/ 2
1) 2 :1 2) 3 :1 3) 1: 2 4) 1:3
33. A positively charged particle enters at the middle as shown in figure with speed
105 m / s will bend
1) towards 1A wire 2) upwards the plane of wires

3) towards 3A wire 4) down wards the plane of wires
34. An ideal transformer with purely resistive load operates at 12 kV on the primary
side. If supplies electrical energy to a number of nearby houses at 120 V. The
average rate of energy consumption in the houses served by the transformer is 60
Kw. The value of resistive load (Rs) required in the secondary circuit will be
____________ m .
1) 240 2) 140 3) 440 4) 340

35. In YDSE, two thin transparent film of mica and glass are put in the path of two
waves from coherent sources S1 and S2. If their thickness are 3t and 2t
respectively, what should be refractive index of mica so that central maxima is
found at O(glass = 1.5)?
1) 1.25 2) 1.5 3) 1.75 4) 1.33

SECTION – B
36. A convex lens is used to form a real image of the object shown in the following
figure :
Then the real inverted image is as shown in the following figure :
1) 2) 3) 4)
37. The density of a solid ball is to be determined in an experiment. The diameter of

the ball is measured with a screw gauge, whose pitch is 0.5 mm and there are 50
divisions on the circular scale. The reading on the main scale is 2.5 mm and that
on the circular scale is 20 divisions. If the measured mass of the ball has a
relative error of 2%, the relative percentage error in the density is
1) 0.9% 2) 2.4% 3) 3.1% 4) 4.2%
38. A thin metal plate M is inserted between the plates of a parallel plate capacitor as
shown in figure. The new capacitance if initial capacitance is ‘C’.
C
1) 2) 2C 3) 0 4) infinity
2
39. A small block of mass 100g is pressed against a horizontal spring fixed at one end
to compress spring through 5cm. When released, the block moves horizonallly
till it leaves the spring. Find value of R.(  g=10m/s2)
1
1) 1m 2) 2m 3) 2m 4) m
2

40. The output of the given circuit in figure.
1) would be zero at all times

2) would be like a half wave rectifier with positive cycle in output
3) would be like a half wave rectifier with negative cycle in output
4) would be like that of a full wave rectifier
41. Sand is to be piled up on a horizontal ground in the form of a regular cone of a
fixed base of radius R. coefficient of static friction between the sand layers is  .
Maximum volume of the sand can be piled up in the form of cone without
slipping on the ground is
 R2  R3  R3  R3
1) 2) 3) 4)
3 3 3 3
42. Given that a photon of light of wavelength 10,000 Å has an energy equal to 1.23
eV. When light of wavelength 5000 Å and intensity 𝐼 falls on a photoelectric cell,
the saturation current is 0.40 × 10 A and the stopping potential is 1.36 V, then
the work function is
1) 0.43 eV 2) 0.55 eV 3) 1.10 eV 4) 1.53 eV
43. The time period of simple pendulum is ‘T’. When the length increases by 10cm,
its period is T1. When the length is decreased by 10cm, its period is T2. Then the
relation between T, T1 and T2 is
2 1 1 2 1 1
1) 2  2  2 2) 2  2  2 3) 2T 2  T12  T22 4) 2T 2  T12  T22
T T1 T2 T T1 T2
44. The electric field and magnetic field components of an electromagnetic wave going
through vaccum is described by
E x  E0 sin  kz   t 
By  B0 sin  kz  t 
Then the correct relation between E0 and B0 is given by
1) kE0   B0 2) E0 B0   k 3)  E0  kB0 4) E0  kB0
45. At which of the following temperature would the molecules of a gas have twice the
average kietic energy they have at 200C
1) 400C 2) 800C 3) 3130C 4) 5860C
46. Find out the e.m.f. produced when the current changes from 0 to 1 A in 10
second, given L = 10 H
1) 1 V 2) 1 V 3) 1 mV 4) 0.1 V
47. Two drops of equal radius are falling through air with a steady velocity of 1cm/s.
If the two drops coalesce, then its terminal velocity will be:
1 1 1 1
1) 4 3
 5 cm / s 2) 4 3
cm / s 3) 5 3  4 cm / s 4) 4 3
 5 cm / s
48. A short magnet of magnetic moment M is placed on a straight line. The ratio of
magnetic induction fields B1, B2, B3 vaules on this line at points which are at
distance 30 cm, 60 cm and 90 cm respectively from the center of the magnet is
1) 27 : 3.37 : 1 2) 37.3 : 1 : 27 3) 27 : 8 : 3.37 4) 1 : 2 : 3
49. Statement-I : Waves generated in a metal piece can be transverse or
longitudinal.
Statement-II : Waves generated depend upon the method of creating waves in
the metal.
for statement-I

50. In order to separate out two molecules from each other, the potential enrgy
between them must be
1) minimum 2) positive 3) negative 4) zero
CHEMISTRY
SECTION – A
51. 2g of acetic acid (Mwt = 60) is dissolved in 25g of benzene shows a depression in
freezing point equal to 4.62K. Kf for benzene is 4.9 K.mol1kg . Then the
percentage of dimerisation of acetic acid is ______
1) 24.8% 2) 49.6% 3) 70.7% 4) 58.6%
52. Two mole ethyl alcohol and three mole of water is made as a solution. Vapour
pressure of these liquids at 298K are 40mm Hg and 24mm Hg respectively. Then
the vapour pressure of the solution at 298K is _____mm of Hg.
1) =30.4 2) >30.4 3) <30.4 4) Zero
53. In the Kjeldahl’s method for estimation of nitrogen present in a soil sample,
ammonia evolved from 0.75 g of compound was neutralized by 10 mL of 1 M
H2SO4. The percentage of nitrogen in the soil is:
1) 37.33 2) 45.33 3) 35.33 4) 43.33
1) X g  ion is larger than X g  2) X g  ion is larger than X g 
3) X g  and X g  ions have same size 4) X g  ion is larger than X  g 
55. A sudden jump between the values of second and third ionisation energies of an
element is associated with configuration.
1) 1s 2 2s 2 2 p 6 3s1 2) 1s 2 2s 2 2 p 6 3s 2 3 p1 3) 1s 2 2s 2 2 p 6 3s 2 3 p 2 4) 1s 2 2s 2 2 p6 3s 2
CH 3 H
56. IUPAC name for the formula | | is
CH 3  C  C  COOH
1) 2-methyl but-2-enoic acid 2) 3-methyl but-3-enoic acid
3) 3-methyl but-2-enoic acid 4) 2-methyl but-3-enoic acid
57. The ratio of the wave lengths of the first line in the Lyman series of the spectrum
of Hydrogen atom and the first line in the Balmer series of the spectrum of He+ is
1) 20/27 2) 27/20 3) 27/5 4) 5/27
58. The number of radial nodes and nodal planes possible for 6dx2-y2 are
respectively.
1) 3, 0 2) 4, 0 3) 3, 2 4) 4, 2
59.
1) cis-isomer 2) trans-isomer 3) Syn-isomer 4) Anti-isomer

60. The soluiton of a chemical compound X reacts with AgNO3 solution to form a
white precipitate of Y which dissolves in NH4OH to gives a complex Z. When Z is
treated with dilute HNO3, Y reappears. The chemical compound X can be :
1) NaCl 2) CH3Cl 3) NaBr 4) NaI
61. The weight of mohr’s salt (MW= 392g/mol) that can be oxidized by 40ml of 0.4M
KMnO4 in acidic medium is ______
1) 6.272 2) 31.36 3) 3.136 4) 1.254
62. If enthalpy of solution of anhydrous CuSO4 and hydrated CuSO4 (ie,
CuSO4.5H2O) are -66.5kJ/mol and +11.7kJ/mol respectively, then the enthalpy
of hydration of anhydrous CuSO4 is __________kJ/mol.
1) -54.8 2) +54.8 3) 78.2 4) -78.2
63. Which of the following have same hybridisation but are not isostructural?
1) ClF3 and I 3 2) BrF3 and NH3 2) CH4 and NH 4 4) XeO3 and NH3

64. Assertion (A): The atoms in a covalent molecule are said to share electrons, yet
some covalent molecules are polar.
Reason (R) : In a polar covalent molecule, the shared pair of electrons will be
shifted towards more electronegative atom.
the assertion
65. Statement – I: The dipole moment helps to predict whether a molecule is polar or
non-polar.
Statement –I I: The dipole moment helps to predict geometry of molecules.
66. The correct acidic strength order is
(i) CHCl3 (ii) CHF3 (iii) CH3 – CH3
1) i>ii>iii 2) ii>i>iii 3) iii>i>ii 4) ii>iii>i

67. Electrophile N O2 attacks the following :

In which cases N O2 will attack at meta positon.
1) II and IV 2) II and III 3) I and II 4) I only
68. Which of the following liberate H2 gas with both acids & alkalies?
1) B 2) Al 3) Both B & Al 4) Tl
69. Which of the following statement is wrong?
1) Single N – N bond is weaker than single P – P bond
2) PH3 can acts as ligand in the formation of Co-ordiantion compounds with
transition elements
3) NO2 is paramagnetic while its dimer, N2O4 is diamagnetic
4) Covalency of nitrogen in N2O5 is 5
70. In sulphonation of benzene; electrophilic reagent used is
71.
1) Propanal 2) Butanal 3) 2-pentanone 4) Propanone

CH 3  CH 2  CH  CH 3
72. Assertion (A) : | on reaction with alc.KOH gives but-1-ene as
F
major product.
Reason (R) : It has poor leaving group.
of the Assertion
of the Assertion
73. A gaseous mixture contains oxygen and sulphur dioxide in the ratio of 1 : 4 by
mass. Therefore, the ratio of their respective number of molecules is :
(1) 1 : 2 (2) 1 : 4 (3) 2 : 1 (4) 4 : 1

74. From 392 mg of H2SO4, 1.204 × 10 molecules of H2SO4 are removed. How many
21
moles of H2SO4 are left:

(1) 2 × 10–3 (2) 1.2 × 10–3 (3) 4 × 10–3 (4) 1.5 × 10–3.
75. In which of the following, the oxidation state of underlined atom is given wrong?
1) CrO5 → +6 2) H2S2O8 → +6 3) HNO4 → +5 4) KO2 → −1
76. Which of the following compounds can yield only one monochlorinated product
upon free radical chlorination?
1) 2,2 – Dimethylpropane 2) 2 – Methylpropane
3) 2 – Methylbutane 4) n - Butane
Br
77. The reaction, | is
CH 2  CH  CH 3  HBr  CH 3  CH  CH 3
1) nucleophilic addition 2) free radical addition
3) electrophilic addition 4) electrophilic substitution
78. pKa values of different hydrohalic acids(Hx) in random order is 3.2, -9.5, -10
and -7. So in aqueous solution HCl has a Ka value of
6 7 8 14
1) 10 2) 10 3) 10 4) 10
79. The lowest boiling point of helium is due to its
1) Inertness 2) Gaseous nature
3) High polarisability 4) Weak Vanderwaals forces between atoms
80. If 90% of first order reaction completes in 30min. The rate constant is _____min-1
1) 7.67  102 2) 3.33  102 3) 2.31  102 4) 4.62  102
81. For a reaction, 1/2A2+1/2B2 → AB, following mechanism is proposed.
1/2A2 → A (fast)
1/2B2 → B(fast)
A + B → AB(slow)
Then the order of the reaction is ____
1) 0 2) 1 3) 2 4) 3
82. Which of the following is formed when phenol is exposed to air?
1) o-Benzoquinone 2) p-Benzoquinone
3) Phenoquinone 4) o-cresol
83. Industrially methanol can be prepared by
1) Reduction of HCHO with LiAlH4 2) Cannizaro’s reaction of HCHO
3) Heating mixture of CO+H2 with ZnO-Cr2O3 4) Stephen’s reaction
84. The bond dissociation energies of X2, Y2 and XY are in the ratio of 1 : 0.5 : 1. H
for the formation of XY is 200 kJ mol1 . The bond dissociation energy of X2 will be
1) 400 kJ mol1 2) 200 kJ mol1 3) 800 kJ mol1 4) 100 kJ mol1
85. An ideal gas expands isothermally from 103 m3 to 102 m3 at 300K against a
constant pressure of 105 Nm 2 . The work done during this process is :
1) +270 kJ 2) -900 J 3) +900 kJ 4) -900 kJ
SECTION – B
86. Arrange following ions in the decreasing order of their magnetic moment.
I) V+4 II) Mn+4 III) Fe+3 IV) Ni+2
1) II > III > I > IV 2) III > IV > II > I 3) III > II > IV > I 4) I < IV < III < II
87. Arrange (I) Ce+3, (II) La+3, (III) Pm+3 and (IV) Yb+3 in the increasing order of their
ionic radii.
1) IV < III < I < II 2) I < IV < III < II 3) IV < III < II < I 4) III < II < I < IV
88. Identify the product X in the given reaction.
H 2C  CHCH 2CN (1) PhMgBr
(2) H +
 X is
Ph Ph
1) 2)
CH 3  C  CH  CHO CH 2  CH  CH  CHO
3) H 2C  CHCH 2  COPh 4) CH 3  CH  CH  COPh

89. Arrange the following carbonyl compound in increasing order of their reactivity in
nucleophilic addition reaction.
1) Butanone < propanone < propanal < ethanal
2) Butanone < propanal < propanone < ethanal
3) Butanone < ethanal < propanone < propanal
4) Butanone < ethanal < propanal < propanone
90. The total number of possible isomers of the compound Cu ( NH 3 ) 4  PtCl4  are
1) 3 2) 5 3) 4 4) 6
91. Match the items of column – I and column – II.
(Complex ion) (Value charge on complex ion)
(A) [Ni(dmg)2] (P) Tetrahedral
(B)  ZnCl  (Q) Trigonal bipyramidal
2 
4
(C)  Co  NO2 6 
4
(R) Square planar
(D)  Fe  CO 5  (S) Square pyramidal
.
(T) Octahedral
.
(A) (B) (C) (D) (A) (B) (C) (D)

1) R T P Q 2) R P T Q
3) P R T Q 4) R P Q T
92. Assertion (A) : Optical isomerism is generally not shown by square planar
complexes.
Reason (R) : Square planar complexes possess plane of symmetry.
93. Which of the following can act as both Bronsted acid as well as Bronsted base?
1) H 2 PO2 2) Cl  3) HSO4 4) NH 4
94. The pH of 0.05 M solution of a strong dibasic acid is:
1) 0.0 2) 1.0 3) 0.2 4) 0.5
95. pOH of H2O is 7.0 at 298 K. If water is heated at 350 K, which of the following
should be true?
1) pOH will decrease 2) pOH will increase 3) pOH will remain 7.0
4) Concentration of H ions will increase but that of OH- will decrease
+
96. The reaction, ArN 2 Cl  

Cu / HCl
ArCl  N 2  CuCl is name as _____
1) Sandmeyer reaction 2) Gatterman reaction
3) Claisen reaction 4) Carbylamine reaction
97. Read the following statements and choose the correct option.
(i) Nitrogen atom in amines is sp3-hybridised.
(ii) The geometry of amines is pyramidal.
(iii) The angle C–N–C or C–N–H in simple amines is slightly more than 109.5°.
1) (i), (ii) and (iii) 2) (i) and (ii) 3) (i) and (iii) 4) (ii) and (iii)
98. The same quantity of electricity is passed through 0.1 M H2SO4 and 0.1 M HCl.
The amounts of H2 obtained at the cathodes are in the ratio
1) 1 : 1 2) 2 : 1 3) 1 : 2 4) 3 : 1
4 2
99. Al  O2   Al2O3 ; G  827 kJ mol 1 of O2. The minimum emf required for
3 3
electrolysis of Al2O3
1) 4.28 V 2) 2.14 V 3) 6.42 V 4) 8.56 V
100. During denaturation of protein which of the following does not change
1) 10 structure 2) 20 structure 3) 30 structure 4) All of the above

BOTANY
SECTION – A
101. Fungi do not show much diversity in
1) Morphology 2) Habitat 3) Types of spores 4) Nutrition
102. Fungal body is called __A__ and formed by long slender thread like structures
called ___B____. A and B are
1) Filaments and Trichomes 2) Mycelium and Hyphae
3) Hyphae and Trichomes 4) Mycelium and Fruiting body
(A) Algal fungi (I) Basidiomycetes
(B) Sac fungi (II) Deuteromycetes
(C) Club fungi (III) Ascomycetes
(D) Imperfect fungi (IV) Phycomycetes
.
(A) (B) (C) (D) (A) (B) (C) (D)

.
1) IV III II I 2) IV III I II
3) III II I IV 4) II I III IV
104. What gases are produced in anaerobic sludge digesters?
1) Methane and CO2 only 2) Methane, Hydrogen sulphide and CO2
3) Methane, Hydrogen sulphide O2 4) Hydrogen sulphide and CO2
105. Biogas is used a source of energy as it is _____
1) Flammable 2) Inflammable 3) Fire proof 4) Non-flammable
1) Ganga action plan & yamuna The Ministry of Environment and
action plan sustainable
2) Waste water BOD reduced significantly
3) Secondary treatment Biological treatment
4) Treatment of waste water heterotrophic microbes
107. Choose the incorrect statement regarding Pteridophytes.
1) gametophytes require cool, damp, shady places to grow.
2) The water required for fertilisation, the spread of living pteridophytes is limited
and restricted to narrow geographical regions.
3) The Zygote thereafter produces a unicellular ,simple thalloid sporophyte.
4) Majority of the pteridophytes are homosporous.
108. Choose the correct pattern of arrangement of reproductive structures of
gymnosperms.
1) Spores → Sporophylls → Sporangia → Strobili
2) Spores → Sporangia → Sporophylls → Strobili
3) Sporangia → Sporophylls → Spores → Strobili
4) Spores → Sporangia → Strobili → Sporophylls.
109. Study the following statements regarding the angiosperms.
I) The polar nuclei eventually fuse to produce a diploid secondary nucleus(2n).
II) Eight nucleated female gametophyte is found in Angiosperms and
gymnosperms.
III) Embryo sac consists of angiosperm has egg apparatus (one egg cell, two
synergids), three antipodal and two polar nuclei.
IV) Reproductive parts of an angiospermic plant are stamen and pistil

110. Given below is the schematic representation of the process of electrophoresis.
Identify the P, Q, R and S
1) Anode-P, Cathode-Q, Smallest fragment-R, Largest fragment-S

2) Anode-Q, Cathode-P, Smallest fragment-S, Largest fragment-R
3) Anode-Q, Cathode-P, Smallest fragment-R, Largest fragment-S
4) Anode-P, Cathode-Q, Smallest fragment-S, Largest fragment-R
111. How many fragments will be generated if you digest pBR322 plasmid with
restriction enzymes BamHI, HindIII and Pst-I at the same time?
1) 1 2) 2 3) 3 4) 4
112. DNA fragments are amplified and separated by the techniques respectively known
as
1) Polymerase chain reaction and Chromatography
2) Gel electrophoresis and polymerase chain reaction
3) Polymerase chain reaction and gel electrophoresis
4) Gel electrophoresis and chromatography
113. Statement-I: Plasmids and bacteriophages have the ability to replicate within
bacterial cellsunder the control of chromosomal DNA
Statement-II: Restriction exonuclease are used in genetic engineering to form
recombinantmolecules of DNA
1) Statement-I is true, Statement-II is false 2) Statement-I is false, Statement-true
Column-I Column-II
p) amp R i) Hind III
q) tetR ii) Bam HI
r) rop iii) Pst-I
iv) pvu II
v) Sal I
vi) Pvu I
1) p-iii, iv, q-ii, r-iv 2) p-iii, vi, q-ii, v, r-i
3) p-iii, vi, q-ii, v, r-iv 4) p-iii, iv, q-v, r-ii
115. More than two leaves arise at each node and form a whorl or a circle in
1) Hibiscus 2) Alstonia 3) Calotropis 4) Neem
116. Which type of placentation is found in tomato and lemon?
1) A 2) B 3) C 4) D
117. Statement –I :In parietal placentation, ovary is one chambered, but can become
two chambered due to the formation of false septum.
Statement –II :Fasle septum is observed in Dianthus and Primrose.

List-I (Ornamental plant) List-II (Family)
A) Hibiscus (I) Poaceae
B) Candytuft (II) Brassicaceae
C) Bermuda grass (III) Compositae
`
`
D) Helianthus (IV) Malvaceae
A B C D A B C D
1) IV II I III 2) IV III I II
3) III IV I II 4) IV I III II
119. Consider the following statements :
Statement-I : Severo ochoa enzyme helpful in polymerising DNA in a template
independent manner.
Statement-II : In prokaryotes, control of the rate of transcriptional initiation is
the predominant site for control of gene expression.
1) Both statement-I and Statement-II are incorrect
2) Statement-I is correct while statement-II is incorrect
3) Statement-I and statement-II are correct
4) Statement-I is incorrect while statement-II is correct
120. Spliceosomes are not found in cells of;
1) Fungi 2) Animals 3) Bacteria 4) Plants
121. Which is the only enzyme that has capability to catalyse initiation, elongation and
termination in the process of transcription in prokaryotes ?
1) DNA dependent DNA polymerase 2) DNA dependent RNA polymerase
3) DNA ligase 4) DNase
122. Select the correct option for transcription :
Direction of RNA synthesis Direction of reading of the template
DNA strand
1) 5' - 3' 3' - 5'
2) 3' - 5' 5' - 3'
3) 5' - 3' 5' - 3'
4) 3' - 5' 3' - 5'
123. During density gradient centrifugation the bulk DNA forms a major peak and the
other small peaks are referred a to as :
1) Alphoid DNA 2) Satellite DNA 3) Coding DNA 4) Non repetitive DNA
124. Which of the following is not a correct presentation of Chargaff's rule :
G A
1) 1 2) A  G  T  C 3) A  T  G  C 4) C  T  G  A
C T
125. Select the False statement.
1) Epidermis is usually single layered
2) Epidermal cells are parenchymatous cell with abundant cytoplasm
3) Vessel members of xylem are inter connected thorugh perforation in their
common walls
4) Sclerenchyma provides mechanical support to organs
126. Assertion : Secondary growth don’t occur in monocot stem.
Reason : Vascular bundles are closed in monocot stem.
127. Identify the wrong statement in context of heartwood:
1) It is highly durable
2) It conducts water and minerals efficiently
3) It comprises dead elements with highly lignified walls
4) Organic compounds are deposited in it

128. Match column – I with column – II and choose the correct option.
(A) First law of inheritance (I) Law of segregation
(B) Second law of inheritance (II) 3:1
(C) Monohybrid cross (III) Law of dominance
.
(D) Test cross (IV) 1:1
.
(A) (B) (C) (D) (A) (B) (C) (D)

1) III I II IV 2) II III I IV
3) I III IV II 4) IV II III I
129. The factor controlling any character is discrete and independent. It was
concluded on the basis of
1) Results of F3 generation of a cross
2) Observation of a cross between plants having 2 contrasting traits, where
offspring shows only one train without any blending.
3) Self pollination of F-1 offspring
4) Cross pollination of parental generations
130. A man with blood group ‘A’ marries a woman with blood group ‘B’. What all are
possible blood groups of their offpsrings.
1) A, B and AB only 2) A, B, AB and O 3) O only 4) A and B only
131. Mendel’s law of independent assortment is true for the genes situated on the
1) Same chromosome 2) Non-homologous chromosome
3) Homologous chromosome 4) Extra nuclear genetic element.
132. The figure below shows the structure of a mitochondrion with its four parts
labelled (A), (B),(C) and (D). Select the part correctly matched with its function.
1) Part (A) : Matrix - major site for respiratory chain enzymes

2) Part (D) : Outer membrane - gives use to inner membrane by splitting
3) Part (B) : Inner membrane - forms infoldings called cristae
4) Part (C) : Cristae - possess single circular DNA molecule and ribosomes.
133. Which of the following is an incorrect statement?
1) Mature sieve tube elements possess a conspicuous nucleus and usual
cytoplasmic organelles.
2) Microbodies are present both in plant and animal cells.
3) The perinuclear space forms a barrier between the materials present inside the
nucleus and that of the cytoplasm.
4) Nuclear pores act as passages for proteins and RNA molecules in both
directions between nucleus and cytoplasm.
134. Match the following columns and identify the correct combination.
Column-I Column-II
A. Uninculeated (i) Plasmodium
B. Binucleated (ii) Most eukaryotes
C. Multinucleated (iii) Mature mammalian erythrocyte
D. Enucleated (iv) Few fungi
1) A-ii B-i C-iv D-i 2) A-ii B-iv C-i D-iii
3) A-iii B-iv C-ii D-I 4) A-iii B-i C-iv D-ii
135. The hilum is a scar on the:
1) Fruit, where style was present 2) Seed, where micropyle was present
3) Seed, where funicle was attached 4) Fruit, where it was attached to pedicel
SECTION – B
136. Which of the following are important floral rewards to the animal pollinators?
1) Floral fragrance and calcium crystal
2) Protein pellicle and stigmatic exudates
3) Colour and large size of flower
4) Nectar and pollen grains

137. Which one of the following may require pollinators but is genetically similar to
autogamy?
1) Apogamy 2) Cleistogamy 3) Geitonogamy 4) Xenogamy
138. Perisperm differs from endosperm in:
1) Its formation by fusion of secondary nucleus with several sperms
2) Being a haploid tissue
3) Having no reserve food
4) Being a diploid tissue
139. As temperature changes from 3 o C to 45 o C , the rate of enzyme activity will
1) Decrease and then increase 2) Increase and then decrease
3) Increase only 4) Decrease only
140. Statement –I : The acid insoluble fraction of heteropolymer with three chemically
distinct compounds with three different types of bonds acts as nuclic acids and
synthesis of proteins (dsDNA, ssRNA).
Statement –II : Monosaccharide, heterocyclic ring with phosphate group as
Nucleotide and form hetero polymer and acts as genetic matieral.
141. Which of the following is not the characteristic of cell of meristematic region?
1) Rich in protoplasm and posseses large conspicuous nucleus
2) Cell walls are primary in nature
3) Increased vacuolation
4) Abundant plasmodesmatal connections
142. Choose the correct statemet from the following:
1) F.Skoog and co-workers observed intermodal segments gives collus in tomato
stems.
2) E.Kurogawa reported the symptoms of bakane
3) Charles Darwin and his son conducted experiments in tobacco
4) Miller alone crystallised the cytokinins
143. You are given a tissue with its potential for differentiation in an artificial culture.
Which of the following pairs of hormones would you add to the medium to secure
shoots as well as roots.
1) IAA & gibberellin 2) Auxin and cytokinin
3) Auxin and abscisic acid 4) Gibberellin and ABA
144. Which of the following is not true for Meiosis – II.
1) Resembles mitosis 2) initiates immediately after cytokinesis
3) Results the tetrad of cells 4) It ends with Telophase – I.
145. Statement A :Root apical meristematic tissue divide all their life.
Statement B :Mitosis in social insects results in haploid daughter cells.
Statement C :Mitosis in lower plants results in diploid daughter cells.
1) Statement A – is correct but Statement B and Statement C are incorrect.
2) Statement A and Statement B are correct but Statement C is incorrect
3) Statement A, Statement – B, Statement – C all are correct.
4) Statement A, Statement B, Statement C all are incorrect.
146. How many events are not related with photorespiration?
A) No synthesis of sugars B) No synthesis of ATP and NADPH2
C) Occurs in C4 plants D) Out of three, one organelle with two membrane
1) Two 2) Three 3) Four 4) None
147. Statement I : The efficiency of C4 plants is more than those of C3 plants.
Statement II : C4 plants are more efficient in picking up CO2.

148. Which one of the following is not true about the light reactions of photosynthesis?
1) Light energy provides energy for the photolysis of water through excitation of
the reaction centre of PS – II.
2) The flow of electrons from water to NADP in non-cyclic electron transport
produces one ATP.
3) Reactions of the two photosystems are needed for the reduction of NADP.
4) P680 and P700 are the reaction centres of PS – I and PS – II respectively.
149. The number of ATP molecule synthesised duringelectron transport chain depends
on :
1) The nature of electron donor 2) ATP synthase
3) The complex-III 4) The complex-IV
150. Lactic acid fermentation does not produce :
1) CO2 2) NADH 3) Both (1) and (2) 4) NAD+
ZOOLOGY
SECTION – A
151. Equation of Hardy-Weinberg is depicted as
1) p 2  2 pq  q 2  0 2) p 2  2 pq  q 2  1 3) p  2 pq  q  0 4) p  2 pq  q  1
152. Match the items of column-I with column-II.

1) a-ii, b-iv, c-i, d-iii 2) a-i, b-iv, c-ii, d-iii
3) a-iii, b-iv, c-i, d-ii 4) a-iv, b-ii, c-i, d-iii
153. Stratification is :
1) Parallel distribution of different species occupying different levels
2) Horizontal distribution of different species occupying different levels
3) Vertical distribution of different species occupying different levels.
4) Vertical distribution of different species occupying same level.
154. Net primary productivity is known as the :
1) Available biomass for the consumption of heterotrophs
2) Synthesis of food material by algae
3) Available biomass for the consumption of herbivores only
4) Available biomass for the consumption of decomposers only
155. Which one of the following statements is not correct?
1) The species area relationship for a wide variety of taxa turns to be a
rectangular hyperbola
2) When a host fish species becomes extinct, its unique assemblance of parasites
also extinct
3) Earth’s rich biodiversity is vital for the very survival of mankind
4) The Historic Convention on biological diversity (The world summit) held in Rio
de Janeiro
156. Leaching causes :
1) Going down of organic and inorganic nutrients in the soil
2) Going down of water soluble inorganic nutrients into the soil and getting
precipitated as unavailable salts
3) Excessive calcium accumulation in soil
4) Going down of water insoluble inorganic nutrients into the soil and getting
precipitated as unavailable salt

157. More than ________ % of the drugs currently sold in the market worldwide are
derived from plants.
1) 70 2) 25 3) 90 4) 55
158. Mosaic vision means
1) More sensitivity and less resolution 2) More sensitivity and more resolution
3) Less sensitivity and less resolution 4) Less sensitivity and more resolution
159. All the listed contraceptives are effective during emergency to avoid pregnancy,
except
1) Progestasert 2) Progestogen pills
3) Vaults 4) Progestogen-estrogen pills
160. In female frog, cloaca is used to pass out
1) Faecal matter only 2) Urine only
3) Sperms only 4) Faeces and urine
1) Nomenclature or naming is only possible when the organism is described
correctly.
2) Biologists follows universally accepted principles to provide scientific names to
known organisms.
3) When it comes to human beings, it is all the more difficult to define the living
state.
4) All organisms cannot handle chemicals entering their bodies.
162. Neuro transmitters found in
1) Receptors of post-synaptic neuron 2) Receptors of pre-synaptic neuron
3) Vessicles of pre-synoptic dendrites 4) Vesicles of pre-synaptic neuron
163. Which one of the followings statements is not correct?
1) Total volume of air a person can expire after a normal inspiration is called
expiratory capacity.
2) Binding of oxygen with haemoglobin is primarily related to partial pressure of
CO2.
3) Every 100 ml of deoxygenated blood delivers approximately 4 ml of CO2 to the
alveoli.
4) Every 100 ml of oxygenated blood can deliver around 5 ml of O2 to the tissues
under normal physiological conditions.
164. Precipitation due to annual variation in seasions includes.
1) Rain 2) Snow 3) Dew 4) Both 1 & 2
165. Find correct match.
1) DCT - Opens into vasa recta
2) Bowman’s capsule – Encloses PCT
3) Renal pelvis - Opens into Ureter
4) Cortex - With Renal pyramids
166. I) Innate immunity is a specific type of defence that is present at time of birth .
II) Auto immunity is due to genetic and some unknown reason , The body attack
self – cells
III) The lymph nodes are large flattened structures located at different points
along lymphatic system
IV) MALT constitutes about 50 % of lymphoid tissue
Select wrong statements ?
1) I, II 2) III, IV 3) Only III 4) I, III
167. During oogenesis, the 1 maturation division completed in
st
1) Primary oocyte of tertiary follicle 2) Primary oocyte of primary follicle

3) Secondary oocyte of secondary follicle 4) Primary oocyte of secondary follicle
168. The opening of right atrium into right ventricle of human heart is guarded by
1) Tricuspid valve 2) Pulmonary semilunar valve
3) Bicuspid valve 4) Aortic semilunar valve
169. Name the blood cells whose reduction in number can leads to clotting disorder,
leading to excessive loss of blood from the body
1) Thrombocytes 2) Erythrocytes
3) Neutrophils 4) Leucocytes

170. Person with blood group AB is considered a universal recipient because he has
1) Both A and B antigens in the plasma but no antibodies
2) Both anti-A and anti-B antibodies present on RBCs
3) Both A and B antigens on RBC and anti-A and anti-B antibodies are in the
plasma
4) Both A and B antigens on RBC but no antibodies in the plasma
171. Statement – I : JGA formed by cellular modifications in the PCT & afferent
arteriole.
Statement – II : Renin can stimulate the glomerular blood flow and there by GFR
decreased.
172. What is the particular type of drug that is obtained from the plant whose one
flowering branch is shown below?
1) Hallucinogen 2) Depressant 3) Stimulant 4) Pain-killer

173. The anaerobic breakdown of glycogen in skeletal muscle causes accumulation of :
1) Pyruvic acid 2) Hydrochloric acid
3) Lactic acid 4) Citric acid
174. ___________ is the most feared property of malignant tumor.
1) Contact inhibition 2) Metastasis 3) Metagenesis 4) Both 2 and 3
175. Among the following, which one decreases the blood pressure.
1) ADH 2) ANF 3) Angiotensin – II 4) Aldosterone
176. Probe is ________
1) A single stranded DNA or RNA 2) dsRNA, tagged with poly-A tail
3) Used to detect AIDS 4) All of these
177. Which of the following informations w.r.t. chromosome-1 of human genome is
incorrect?
1) It consists of 231 genes
2) It was the last of the 24 human chromosomes to be sequenced
3) It is an autosomal chromosome
4) Its sequence was completed only in may 2006
178. Select the taxa/groups among the following that represents exclusively marine
animals only:
1) Ctenophora and Cnidaria 2) Mollusca and Echinodermata
3) Protochordates and Osteichthyes 4) Chondrichthyes and Echinodermata
179. Which of the following is true about Clarias?
1) It is a marine animal 2) It is a warm blooded animal
3) It has 3 chambered heart 4) It shows external fertilization
180. Read the following
A. Warm blooded animals
B. Endoskeleton is fully ossified
C. Scales present covering the entire body
D. Airsacs are connected to digestive tract
Choose the statement related to aves
1) A, D 2) A, B 3) C, D 4) B, D
181. Which of the following is not the hormone of adrenal cortex?
1) Calcitonin 2) Cortisol 3) Aldosterone 4) Androgenic steroid
182. Choose the incorrect match from the following
1) Alpha cells-glucagon 2) Beta cells – Insulin
3) Adrenal cortex – Adrenaline 4) Adrenal medulla – Nor-adrenaline
183. The process used for amplification or multiplication of DNA during fingerprinting
is/are
1) PCR 2) Southern blotting 3) Both 1 & 2 4) Transformation

184. Pick out the correct statements:
(i) Haemophilia is a sex linked recessive disease
(ii) Down’s syndrome is due to aneuploidy
(iii) Phenylketonuria is an autosomal recessive gene disorder
(iv) Sickle cell anaemia is an X-linked recessive gene disorder
1) (ii) and (iv) are correct 2) (i) and (iv) are correct
3) (i), (iii) and (iv) are correct 4) (i), (ii), (iii) are correct
185. Aneuploidy results from :
1) Point mutations
2) Gross structural changes in chromosomes
3) Failure of cytokinesis after telophase stage of cell division
4) Failure of segregation of chromatids during cell Division
SECTION – B
186. Evolution by natural selection should have started at the time of the orgin of ____
1) Life with similarities in metabolic capability
2) Non-cellular forms of life with differences in metabolic capability
3) Cellular forms of life with differences in metabolic capability
4) Multicellular form of life with differences in metabolic capability
187. Statement I: Female with Turner’s syndrome has genotype 44 + XO and are
sterile with rudimentary ovaries
Statement II: Overall masculine development can be seen in Turner’s female
188. Match Column-I with Column-II and select the correct option
(a) Pre-historic cave art (i) 10,000 years back
(b) Agriculture (ii) 18,000 years back
(c) Neanderthal man (iii) 1.5 mya
(d) Homo erectus (iv) 40,000-1,00,000 years back
1) (a) - (i); (b) - (ii); (c) - (iii); (d) - (iv) 2) (a) - (iv); (b) - (ii); (c) - (iii); (d) - (i)
3) (a) - (ii); (b) - (i); (c) - (iv); (d) - (iii) 4) (a) - (ii); (b) - (i); (c) - (iii); (d) - (iv)
189. The biggest dinosaur was –
1) Tyrannosaurus rex 2) Ichthyosaurus
3) Ophiosaurus 4) Dryopithecus
190. A key species is are that
1) It has no chance of extinction
2) Exerts a strong influence on an ecosystem
3) Causes other species to become extinct
4) Has a weak influence on an ecosystem
191. If the head of cockroach is cut off, it will live for as long as
1) 2 weeks 2) 1 week 3) 3 weeks 4) 4 weeks
a) Emergency contraceptives are taken within 72 hours of coitus to avoid
pregnancy.
b) Sterilization is the terminal method to prevent any pregnancy as it is poorly
reversible.
1) a is true, b is false 2) Both a and b are true
3) a is false, b is true 4) Both a and b are false
193. Nodes of Ranvier are
1) Areas of swellings of axon 2) Found in the wall of stomach
3) The gap between two adjacent myelin sheath 4) Bands in striated muscles
194. The “r” value for flour beetles is ______
1) 0.5 2) 0.12 3) 0.21 4) 0.012

195. Name the blood vessels A to D –
A B C D
1. Systemic vein Pulmonary artery Pulmonary vein Systemic artery
2. Systemic artery Pulmonary artery Pulmonary vein Systemic vein
3. Pulmonary artery Systemic vein Pulmonary vein Systemic artery
4. Systemic vein Pulmonary vein Pulmonary artery Systemic artery
196. Match the column I (Organs) with column II (Functions) and choose the correct
option.
Column - I Column - II
(Organs) (Functions)
A. Nose I. Stops food from going down into lungs.
B. Epiglottis II. Produces sound.
C. Pharynx III. Traps bacteria as well as dust.
D. Larynx IV. Allows air to pass from nose to oesophagus.
1) A – II; B – III; C – I; D – IV 2) A – III; B – I; C – IV; D – II
3) A – I; B – IV; C – II; D – III 4) A – IV; B – II; C – III; D – I
197. ________was taken by Indian parliament to meet and fulfill the requirements of
patent terms and other emergency provisions in this regard?
1) Indian patents bill 2) Bioethics act
3) Bio piracy act 4) All of these
198. Arrange the events of menstrual cycle.
(i) LH surge induces the rupture of Graafian follicle.
(ii) Gonadotropins increase gradually.
(iii) Both LH and FSH attain a peak level.
(iv) Remaining parts of Graafian follicle transforms as corpus luteum.
1) iiiiiiiv 2) iiiiiivI 3) iiiiiiiv 4) iiiiiivi
199. Human adult vertebral formula is :
1) C4T8L4S8C8 2) C7T8L5S6C7 3) C7T12L2S1C2 4) C7T12L5S1C1
200. Following symptoms are found in which disease .
Stomach pain, head ache, loss of appetite, High fever (390 - 400 C), Weakness,
constipation.
1) Malaria 2) AIDS 3) Cancer 4) Typhoid
*******

: ANSWER KEY:
SET-2 SUB: PHYSICS
1 1 11 2 21 1 31 2 41 4
2 4 12 4 22 1 32 3 42 3
3 3 13 2 23 4 33 3 43 3
4 1 14 2 24 3 34 1 44 1
5 4 15 3 25 3 35 4 45 3
6 3 16 1 26 3 36 3 46 2
7 2 17 2 27 1 37 3 47 2
8 4 18 1 28 3 38 4 48 1
9 2 19 4 29 1 39 1 49 1
10 4 20 4 30 4 40 3 50 4
SUB:CHEMISTRY
51 4 61 2 71 4 81 2 91 2
52 2 62 4 72 1 82 2 92 1
53 1 63 1 73 1 83 3 93 3
54 1 64 1 74 1 84 3 94 2
55 4 65 2 75 4 85 2 95 1
56 3 66 1 76 1 86 3 96 2
57 1 67 2 77 3 87 1 97 2
58 3 68 2 78 2 88 3 98 1
59 3 69 4 79 4 89 1 99 2
60 1 70 2 80 1 90 3 100 1
SUB : BOTANY
101 4 111 3 121 2 131 3 141 3
102 2 112 3 122 1 132 3 142 2
103 2 113 3 123 2 133 1 143 2
104 2 114 3 124 3 134 2 144 4
105 2 115 4 125 3 135 3 145 2
106 1 116 2 126 1 136 4 146 1
107 3 117 2 127 2 137 3 147 3
108 2 118 1 128 1 138 4 148 1
109 1 119 4 129 2 139 2 149 1
110 2 120 3 130 2 140 4 150 3
151 2 161 4 171 2 181 1 191 2
152 3 162 4 172 1 182 3 192 2
153 3 163 2 173 3 183 1 193 3
154 1 164 4 174 2 184 4 194 2
155 4 165 3 175 2 185 4 195 1
156 2 166 4 176 1 186 3 196 2
157 2 167 1 177 1 187 3 197 1
158 1 168 1 178 4 188 3 198 3
159 3 169 1 179 4 189 1 199 4
160 4 170 4 180 2 190 2 200 4

NEET GRAND TEST - 8
answer sheet.
CORRECT.
Section-B;
Marking Scheme :

PHYSICS
1. The mass of a box is 2.3 g. Two gold pieces, each of mass 0.035 g, are placed in
it. The total mass of the box and gold pieces is
1) 2.3 g 2) 2.4 g 3) 2.37 g 4) 2.370 g
2. Two long parallel wires are separated by a distance of 8 cm carry electric currents
of 3A and 5A. The distance of null point from the conductor carrying larger
curent when currents are flowing in the same direction is
1) 3 cm 2) 5 cm 3) 12 cm 4) 20 cm
3. A ball is released from the top of a tower of height h metre. It takes T seconds to
T
reach the ground. What is the position of the ball at second from the ground?
3
8h 9h h 16h
1) m 2) m 3) m 4) m
9 9 9 18
4. Electromotive force of a cell is basically a
1) force 2) power 3) work 4) current capacity
5. A heavy weight is suspended from a spring. A person raised the weight till the
spring becomes slack. The work done by him is W. The energy stored in the
stretched spring was E. What will be the gain in gravitational potential energy?
1) W 2) E 3) W + E 4) W – E
6. A coil of N = 100 turns carries a current I = 5 A and creates a magnetic flux
  105 Tm 2 per turn. The value of its inductance L will be
1) 0.05 mH 2) 0.10 Mh 3) 0.15 mH 4) 0.20 mH
7. A randrop of mass 1g falling from a height of 1km hits the ground with a speed of
50 ms 1 . Which of the follwong statements is correct? (Take g  10 ms1 )
1) The loss of potential energy of the drop is 10J
2) The gain in kinetic energy of the drop is 1.25J
3) The gain in kinetic energy of the drop is not equal to the loss of potential
energy of the drop
4) All of these
E
8. The terminal voltage is when a current of 2A is flowing through 2 resistance,
2
the internal resistnace of the cell is :
1) 1 2) 2 3) 3 4) 4
9. Two springs of force constant 1000 N/m and 2000 N/m are stretched by same
force. The ratio of their respective potential energies is
1) 2 : 1 2) 1 : 2 3) 4 : 1 4) 1 : 4
(A) Microwaves (I) Radio active decay of the nucleus
(B) Gamma rays (II) Rapid acceleration and deceleration of electron in aerials
(C) Radio waves (III) Inner shell electrons
(D) X-rays (IV) Klystron valve
.
(A) (B) (C) (D) (A) (B) (C) (D)

1) I II III IV 2) IV I II III
3) I III IV II 4) IV III II I
11. The two ends of a metal rod are maintained at temperatures 100oC and 110oC.
The rate of heat flow in the rod is found to be 4 Js-1. If the ends are maintained
at temperatures 200oC and 210oC, the rate of heat flow will be
1) 44 Js-1 2) 16.8 Js-1 3) 8 Js-1 4) 4 Js-1
12. The potential difference between the plates of a condenser is increased by 20%.
The energy stored in the condenser increases by
1) 50% 2) 400% 3) 44% 4) 30% nearly

13. Assertion: In adiabatic process, work is independent of the path.
Reason: In adiabatic process, work done is equal to negative of change in internal
energy.
the assertion
of the assertion
11
14. If the energy released in the fission of one nucleus is 3.2  10 J, then number of
nuclei required per second in a power plant of 16 kW IS
1) 5  10 2) 5  10 3) 0.5  10 4) 0.5  10
14 12 12 14
15. The pressure exerted on the walls of the container by a gas is due to the fact that
gas molecules are
1) Losing their kinetic walls 2) Sticking to the energy
3) Changing their momenta due to collision with the walls
4) Getting accelerated towards the wall
16. The slit in a double slit interference experiment are illuminated by a light
wavelength  = 600nm. A thin transparent sheet of thicknes t is placed in front
of one of the slits. The number of fringe shifting is plotted across the refractive
index  of the sheet as given. The value of t is
1) 2.4 m 2) 24 m 3) 4.8 m 4) 48 m
17. Find the strain developed in the wire as shown in the figure when longitudinal
force F is applied. Young’s modulus is Y.
FL FL FL FL
1) 2) 3) 4)
  r  r22    r1r2Y
2
2
r r   r  r2 
2
2
 1 2   1

 2   2 
18. A bar magnet is oscillating in the Earth’s magnetic field with a period T. What
happens to its period and motion if its mass is quadrupled without changing
dimensions?
1) Motion remains simple harmonic with time period = T/2
2) Motion remains S.H.M. with time period = 2T
3) Motion remains S.H.M. with time period = 4T
4) Motion remains S.H.M. and period remains nearly constant
19. A thin liquid film formed between a U-shaped wire and a light slider supports a
weight of 3  10 N (see figure). The length of the slider is 30cm and its weight
2
negligible. The surface tension of the liquid film is:
1) 0.005 N/m 2) 0.0125 N/m 3) 0.01 N/m 4) 0.05 N/m

20. A big drop of radius R is formed by 1000 small droplets of water, then the radius
of small drop is:
R R R R
1) 2) 3) 4)
2 3 5 10
21. The PE of three objects of masses 1kg, 2kg and 3kg placed at the three vertices of
an equilateral triangle of side 20cm is
1) 25G 2) 35G 3)45G 4) 55G
22. If a lens of focal length f is divided into two equal parts and both pieces are put in
contact as shown in figure. The resultant focal length of combination are
1) 0, f,  2) f, f, 0 3) 2f, f, 0 4) f, f/2, 
23. A tuning fork of 512 Hz is used to prouce resonance in a resonace tbe

experiment. The level of water at first resonance is 30.7 cm and at second
resonance is 63.2cm. The error in calculating velocity of sound is :
1) 204.1 cm/s 2) 110 cm/s 3) 58 cm/s 4) 280 cm/s
24. An open pipe is in resonance in 2 harmonic with frequency f1. Now one end of
nd
the tube is closed and frequency is increased to f2 such that the resonance again
occurs in nth harmonic. Choose the correct option.
3 5 5 3
1) n  3, f 2  f1 2) n  3, f 2  f1 3) n  5, f 2  f1 4) n  5, f 2  f1
4 4 4 4
25. Related to photoelectric effect, in Column I, some physical quantities are given
whereas Column II indicates respective formula. Match the entries of Column I
with the entries of Column II.
Column-I Column- II
(A) Energy of photon(E) (p) h

(B) Mass of photon(m) (q) P
hc
(C) Momentum of the photon(p) (r) h
c
(D) Number of emitted photons(n) (s) 12400
 ( Å)
A B C D
1) s r p q
2) q p r s
3) r s p q
4) p q s r
26. A solid sphere, a hollow sphere and a ring are released from an inclined plane
(frictionless) of height h, which object will reach the bottom first?
1) Ring 2) Solid sphere
3) Hollow sphere 4) All of them reach the bottom at the same time
27. If the distance between two bodies is increased by 25%, then the % change in the
gravitiational force is
1) Decreases by 36% 2) Increases by 36%
3) Increases by 64% 4) Decreases by 64%
28. Assertion: Image formed by concave lens is not always virtual.
Reason: Image formed by a lens is real if the image is formed in the direction of
ray of light with respect to the lens.

29. In Young’s double slit experiment, distance between the slits is 1mm.
Wavelength of the light used is 600nm. Fringe width of interference pattern (as
shown in figure) is
1) 0.6 mm 2) 0.3 mm 3) 0.4 mm 4) 0.2 mm

30. Four coherent sources of intensity l are superimposed constructively at a point.
The intensity at that point is
1) 4l 2) 8l 3) 16l 4) 24l
31. A metallic shell has a point charge ‘q’ kept inside its cavity. Which one for the
following diagrams correctly represents the electric lines of forces.
32. Mean kinetic energy (or average energy) per gm molecule of a monoatomic gas is
given by
3 1 1 3
1) RT 2) KT 3) RT 4) KT
2 2 2 2
33. Four plates of equal area A are separated by equal distance d and are arranged as
shown in the figure. The equivalent capacity is
2 0 A 3 0 A 4 0 A  A
1) 2) 3) 4) 0
d d d d
34. Two plates of same area are placed in contact. Their thickness as well as thermal
conductivities are in the ratio 2 : 3. The outer surface of one plate is maintained
at 10oC and that of the other at 0oC. What is the temperature at the common
surface?
1) 0oC 2) 2.5oC 3) 5oC 4) 6.5oC
35. A body of mass m starting from rest from origin moves along x-axis with cosntnat
power (P). Calcualte relation between velocity and distance :
1) x  v1/ 2 2) x  v 2 3) x  v 4) x  v3
SECTION – B
36. When a resistance of 2 ohms is connected across the terminals of a cell, the
current is 0.5 A. When the resistance is increased to 5 ohms, the current
becomes 0.25 A. The e.m.f. of the cell is
1) 1.0 V 2) 1.5 V 3) 2.0 V 4) 2.5 V
37. The sides of a rectangle are 6.01 m and 12m. taking the significant figures into
account, the area of the rectangle is
1) 7.2 m2 2) 72.1 m2 3) 72.00 m2 4) 72.12 m2

38. Two particles A and B of mass mA and mB respectively and
having the same charge are moving in a plane. A uniform
magnetic field exists perpendicular to this plane. The
speeds of the particles are vA and vB respectively, and the
trajectories are as shown in the figure. Then
1) mAvA < mBvB 2) mAvA > mBvB
3) mA < mB and vA < vB 4) mA = mB and vA = vB
39. A body travels for 15 sec starting from rest with constant acceleration. If it
travels distance S1, S2 and S3 in the first five seconds, second five seconds and
next five seconds respectively then the relation between S1, S2 and S3 is
1 1 1 1
1) S1  S2  S3 2) 5S1  3S2  S3 3) S1  S2  S3 4) S1  S2  S3
3 5 5 3
40. An iron rod of susceptibility 599 is subjected to a magnetizing field of 1200 A m1 .

The permeability of the matieral of the rod is 0  4 107 T m A 1 
1) 2.4 104 T m A 1 2) 8.0 105 T m A1 3) 2.4 105 T m A 1 4) 2.4 107 T m A 1
41. A block rests on a rough horizontal surface,  is the coefficient of friction
between the block and the surface. A force mg pulls the block. This force acts an
angle  with the vertical side of the block. The mass of the block is m. The block

can be pulled along the surface, if cot
2

1)   2)   3)   4)
6
42. An inductance L and a resistance R are first connected to a battery. After some
time the battery is disconnected but L and R remain connected in a closed circuit.
Then the current reduces to 37% of its initial value in
R L 1
1) RL sec 2) sec 3) sec 4) sec
L R LR
.
(A) Microwaves (I) Physiotherapy
.
(B) UV rays (II) Treatment of cancer

(C) Infra-red rays (III) Lasik eye surgery
(D) X-rays (IV) Aircraft navigation
(A) (B) (C) (D) (A) (B) (C) (D)
1) II IV III I 2) IV I II III
3) IV III I II 4) III II I IV
44. Assertion : In equation Q = U + pV, quantities on the both sides are
intensive.
Reason : The product of an intensive variable like p and an extensive quantity V
is extensive.
the assertion
of the assertion
45. Four thin rods of same mass M and same length l, form a square as shown in
figure. Moment of inertia of this system about an axis through cetnre O and
perpendicular to its plane is :
4 Ml 2 Ml 2 2 2
1) Ml 2 2) 3) 4) Ml
3 3 6 3

46. Related to laws of photoelectric effect, match the entries of Column I with the
entries of Column II.
Column-I Column- II
(A) No time lag between incidence of (p) Intensity of incident light
photon and emission of photo electron
(B) Kinetic energy is independent of (q) Instantaneous process
(C) Threshold frequency must be greater (r) Maximum kinetic energy of
than photoelectron
(D) Stopping potential is function of (s) Frequency of incident light
A B C D
1) s r p q
2) p q r s
3) r s p q
4) q p s r
47. Assertion: Heat absorbed by the gas during an isochoric process goes entirely to
change its intenral energy and its temperature.
Reason: In an isochoric process, volume is constant.
the assertion
of the assertion
48. Choose the wrong statement:
1) The nuclear force becomes weak if the nucleus contains too many protons
compared to the number of neutrons
2) The nuclear force becomes weak if the nucleus contains too many neutrons
compared to the number of protons.
3) Nuclei with atomic number greater than 82 show a tendency to disintegrate
4) The nuclear force becomes very strong if the nucleus contains a large number
of nucleons.
49. The twisting couple per unit twist for a solid cylinder of radius 4.9 cm is 0.1N-m.
The twisting couple per unit twist for a hollow cylinder of same material with
outer and inner radii of 5cm and 4cm respectively will be
1) 0.64N-m 2) 0.64 103 N-m 3) 0.64 101 N-m 4) 0.64 102 N-m
50. Assertion: The thickness of depletion layer is fixed in all semiconductor devices.
Reason: Free charge carriers are available in depletion layer.
the assertion
CHEMISTRY
SECTION – A
51. Which of the following shows higher boiling point?
1) 10% (w/w) aq. Urea 2) 10% (w/w) aq. Glucose
3) 10% (w/w) aq. Sucrose 4) All the above show same boiling point
52. At 298 K vapour pressure of pure water is 23.8mmHg. 50g of urea
[MW = 60g/mol] is dissolved in 850g of water at 298K. Then the vapour pressure
of water for this solution is _______mmHg.
1) 23.52 2) 23.65 3) 23.38 4) 23.44
53. Fractional crystallisation is carried out to separate such mixtures:
1) Organic solids mixed with inorganic solids
2) Organic solids highly soluble in water
3) Organic solids having small difference in their solubility in suitable solvent
4) Organic solids having great difference in their solubility in suitable solvent
54. Atomic number 110 has been named by IUPAC as official name.
1) Hs 2) Mt 3) Ds 4) Sg

55. In the fifth period of the periodic table, how many elements have one or more 5d
electrons?
1) 10 2) 18 3) 6 4) 0
56. The IUPAC name of tertiary butyl chloride is
1) 4-chlorobutane 2) 2-chlorobutane
3) 1-chloro-3-methyl propane 4) 2-chloro-2-methyl propane
57. The total energy of electron in an atom is a combination of potential energy and
kinetic energy. If total energy is – E for the electron in an atom, then its K.E. and
P.E respectively are
1) 2E, ―E 2) 2E, E 3) E, ―2E 4) E, ―E
58. The radius of which of the following orbit is same as that of the first Bohr’s orbit
of hydrogen atom?
1) He+ ( n = 2 ) 2) Li2+ ( n = 2) 3) Li2+ ( n = 3) 4) Be3+ ( n = 2 )
59. Number of the geometrical isomers for the molecule.
R  CH  CH  CH  CH  CH  CH  R
1) 2 2) 4 3) 6 4) 8
60. A pale green crystalline inorganic salt (A) dissolves freely in water. It gives a
green precipitate on addition of aqueous NaOH. The solution of (A) also gives a
black precipitate on bubbling H2S in alkaline medium. An aqueous solution of
(A) decolourises the pink colour of the permanganate solution. The metal in the
salt solution is :
1) Copper 2) Aluminium 3) Lead 4) Iron
61. 50ml of 0.01molar KMnO4 is completely reduced by 40ml of given oxalic acid
solution. Then the normality of given oxalic acid solution is _____
1) 0.02 2) 0.03125 3) 0.0625 4) 0.005
62. Phenolphthalein does not act as an indicator for the titration between
1) HCl & NH4OH 2) Ca(OH)2 & HCl 3) NaOH & H2SO4 4) KOH & CH3COOH
63. Identify the incorrect statement for PCl5 from the following :
1) In PCl5 molecule orbtials of phosphorous are assumed to undergo sp3d
hybridization
2) The geometry of PCl5 is trigonal bipyramidal
3) PCl5 has two axial bonds with lower bond length than that of three equational
bonds
4) The three equatorial bonds of PCl5 lie in a plane
64. Assertion : The H – O – H bond angle in water molecule is 104.50.
Reason : Due to lone pair – bond pair repulsions, the two bond pairs come close
to each other in water molecule.
1) ‘A’ is false but ‘R’ is true
2) ‘A’ is true but ‘R’ is false
65. The potential energy curve for the H2 molecule as a function of internuclear
distance is
66. Find the correct order of electron density at benzene ring :
1) IV>III>II>I 2) I>II>III>IV 3) IV>II>I>III 4) IV>II>III>I

67. In which of the following pairs, 1st is more stable than 2nd?

68. Among the elements of group 14 the reducing power of the divalent species
decreases in the order.
1) Ge>Sn>Pb 2) Sn>Ge>Pb 3) Pb>Sn>Ge 4) Sn>Pb>Ge
69. Which of the following is correct for P4 mlecule of white phosphorous?
1) it has a total of six lone pairs of electrons
2) it has a total of six p – p single bonds
3) it has a total of three p – p single bonds
4) it has a total of three -bonds
70. Which of the following can form methane gas with methyl magnesium bromide?
71. In the reaction with HCl, an alkene reacts in accordance with the Markovnikov's
rule, to give a product 1-chloro-1-methylcyclohexane. The possible alkene is
72. Statement I : Benzene on reaction with Cl2 / h gives benzenehexachloride.

Statement II : Benzenehexachloride is aromatic.
73. The vapour density of a compound containing C,H and O is 42. If the % of C and
400 100
H are and respectively . The possible molecular formula is :
7 21
(1) C2H2O (2) C5H8O (3) C4H4O2 (4) C10H16O2
74. When Dinitrogen pentaoxide (N2O5, a white solid) is heated, it decomposes into
nitrogen dioxide and oxygen.
If a sample of N2O5 produces 1.6 g O2, then how many grams of NO2 is formed ?
1) 9.2 g 2) 4.6 g 3) 2.3 g 4) 18.4 g
75. The individual oxidation number of sulphur atoms in Na2S4O6 is
1) +2.5 2) +2 and +3 (two S have +2 and other two have +3)
3) +2 and +3 (three S have +2 and one S has +3)
4) +5 and 0 (two S have +5 and the other two S have 0)
76. Which of the following is not correctly matched with its IUPAC name?
1) CHF2CBrClF : 1 – Bromo – 1 – chloro – 1, 2,2 - trifluoroethane
2) (CCl3)3CCl : 2 – ( Trichloromethyl) – 1,1,1,2,3,3,3 – heptachloropropane
3) CH3C(p-ClC6H4)2CH(Br)CH3 : 3 – Bromo-2,2-bis(4-chlorophenyl) butane
4) o-BrC6H4CH(CH3)CH2CH3 : 2 – Bromo-1-methylpropylbenzene
77. In the reaction given below,
which of the following statements is correct?

1) The reaction proceeds via SN 2 mechanism hence inversion of configuration
takes place.
2) The reaction proceeds via SN 1 mechanism hence inversion of configuration
takes place.
3) The reaction proceeds via SN 2 mechanism hence there is no change in the
configuration.
4) The reaction proceeds via SN 1 mechanism hence there is no change in the
configuration.

78. Which of the following arrangements do not truly represent the property indicated
against it.
1) Br  F  Cl : Electron affinity 2) Br2  Cl2  F2 : Oxidising power
3) Br  Cl  F : Electronegativity 4) Br2  Cl2  F2 : Bond energy
79. When a  -ray emitting radioactive substance is kept in a vessel, the atmosphere
around it is rich with
1) Ne 2) Ar 3) Xe 4) He
80. For a zero order reaction, A →product, the conc. of A decrease from 0.8M to 0.4M
in 20sec. Then the rate constant of the reaction is _______
1) 0.02M sec-1 2) 0.02s-1 3) 0.02mol-1.L.sec-1 4) 0.05mol-1.L.sec-1
81. At 300C, the rate constant of reaction is 2  103 min1 and at 400C the rate
constant of same reactions 5  103 min1 . Then the activation energy of the
reaction is _____ K.cal/mol
1) 7.55 2) 17.383 3) 72.26 4) 26.54
82. Phenol is less acidic than
1) acetic acid 2) p-methoxyphenol 3) p-cresol 4) Ethanol
83.
84. The amount of heat released when 0.6 mole NaOH(aq.) is mixed with 0.3 mole
HCl(aq.) is :
1) 57.1 kJ 2) 28.55 kJ 3) 17.19 kJ 4) 11.42 kJ
85. Match column I with column II and select the correct answer.
Column-I (Reaction) Column-II
(Name of the H of the given
reaction)
A) C  s   2 H 2  g   CH 4  g  (I) Heat of combustion
B) CH 4  g   2O2  g  
 CO2  g   2 H 2O  l  (II) Heat of neutralization
C) NaOH  aq.  HCl  g  
 NaCl  H 2O (III) Heat of atomisation
D) H 2  g  
 2H  g  (IV) Heat of formation
1) A-IV, B-I, C-II, D-III 2) A-I, B-II, C-III, D-IV
3) A-IV, B-II, C-II, D-I 4) A-I, B-III, C-II, D-IV
SECTION – B
86. Assertion (A) : Cu2+ in water is more stable than Cu+
Reason (R) : Enthalpy of hydration of Cu2+ is higher than that of Cu+
87. Highest oxidation state of Mn is exhibited in Mn2O7. The correct statemetns
about Mn2O7 are
A) Mn is tetrahedrally surrounded by oxygen atoms.
B) Mn is octahedrally surrounded by oxygen atoms
C) Contains Mn-O-Mn bridge
D) Contains Mn-Mn bond
Choose the correct answer from the options given below
1) A and C only 2) A and D only 3) B and D only 4) B and C only

88. The methanol, ethanal and propanone are miscible with water because they
interact with water by
1) van der Waals’ forces 2) Hydrogen bonding
3) Dipole-dipole forces 4) Dispersion forces
89. Which of the following is not a use of formaldehyde?
1) Preservation of biological specimens
2) Manufacturing of bakelite
3) In dye industry
4) Both 1 and 2
90. Which of the following combinations is incorrect?
Formula IUPAC Name
1) K2[Pt(CN)4] Potassium tetracyanidoplatinate(II)
2)  Mn(CN ) 2 Pentacyanidomangnate(II)ion
5
3) K [Cr ( NH 3 )2 Cl4 ] Potassiumdiamminetetrachloridochromate(III)

4) Co  NH 3 4 ( H 2O) I  SO4 Tetraammineaquaiodidocobalt(III) sulphate
91. An octahedral complex with molecular composition M.5NH3.Cl.SO4 has two
isomers, A and B. The solution of A gives a white precipitate with AgNO3 solution
and the solution of B gives white precipitate with BaCl2 solution. The type of
isomerism exhibited by the complex is
1) Linkage isomerism 2) Ionisation isomerism
3) Coordinate isomerism 4) Geometrical isomerism
Coordination entity Wavelength of light absorbed in nm
(A) CoCl  NH  
2
(I) 301
 3 5 
(B)  Co  NH 3 6 
3
(II) 475
3
(C) Co  CN  6  (III) 535
D) Co  H 2O 6 
3 (IV) 600
.

(A) (B) (C) (D) (A) (B) (C) (D)
1) IV I III II 2) III II I IV
3) III I II IV 4) II III IV I
93. Which of the following, when mixed, will give a solution with pH greater than 7?
1) 0.01M HCl + 0.2 M NaCl
2) 100 ml of 0.2 M H2SO4 + 100 ml of 0.3 M NaOH
3) 100 ml of 0.1 M C2H4O2 + 100 ml of 0.1 M KOH
4) 25 ml of 0.1 M HNO3 + 25 ml of 0.1 M NH3
 N 2O4 g   60.0 kJ the increase in
94. For the equilibrium reaction, 2 NO2 g  
temperature
1) favours the formation of N2O4 2) favours the decomposition of N2O4
3) does not effect the equilibrium 4) stops the reaction
95. Which of the following will favour the reverse reaction in a chemical equilibrium?
1) Increasing the concentration of one of the reactants
2) Removal of atleast one of the products at regular intervals
3) Increasing the concentration of one or more of the products
4) By increasing the temperature.
Column-I Column-II
A) Ammonolysis (p) Amine with lesser number of
carbon atoms
B) Gabriel phthalimide synthesis (q) Detection test for primary amines.
C) Hoffmann bromamide reaction (r) Reaction of Phthalimide with KOH
and R–X
D) Carbylamine reaction (s) Reaction of alkylhalides with NH3
1) A – (s), B – (r), C – (p), D – (q) 2) A – (r), B – (p), C – (r), D – (s)
3) A – (q), B – (r), C – (s), D – (p) 4) A – (s), B – (p), C – (q), D – (r)

Column-I Column-II
A) Benzene sulphonyl chloride (p) Zwitter ion
B) Sulphanilic acid (q) Hinsberg reagent
C) Alkyl diazonium salts (r) Dyes
D) Aryl diazonium salts (s) Conversion to alcohols
1) A – (s), B – (q), C – (r), D – (p) 2) A – (q), B – (p), C – (s), D – (r)
3) A – (r), B – (s), C – (p), D – (q) 4) A – (s), B – (p), C – (r), D – (q)
98. If the solution of the CuSO4 in which copper rod is immersed is diluted by 10
times, then the electrode potential
1) Increases by 0.295V 2) Decreases by 0.0295V
3) Increases by 0.059V 4) Decreases by 0.059V
99. The e.m.f. of the following Daniell cell at 298K is E1
Zn/ZnSO4(0.01M)//CuSO4(1.0M)/Cu.
When the concentration of ZnSO4 is changed to 1.0 M and that of CuSO4 is
changed to 0.01 M, then the e.m.f. is E2. What is the relationship between E1 and
E2?
1) E1 > E2 2) E1 < E2 3) E1 = E2 4) E2 = 0  E1
Column – I (Enzymes) Column – II (Reactions)
(I) Invertase (P) Decomposition of urea into NH3 and CO2
(II) Maltase (Q) Conversion of glucose into ethyl alcohol
(III) Pepsin (R) Hydrolysis of maltose into glucose
(IV) Urease (S) Hydrolysis of cane sugar
(V) Zymase (T) Hydrolysis of proteins into peptides
1) S R T P Q 2) R B S P T
3) Q P R S T 4) S P T Q R
BOTANY
SECTION – A
101. Fungi in symbiotic association with algae and roots of higher plants respectively
form
1) Water blooms and nodules 2) Mycorrhiza and Lichens
3) Lichens and Mycorrhiza 4) Blooms and Fruiting bodies
102. Ascospores, basidiospores and oospores are all
1) Meiospores 2) Haploid 3) Diploid 4) Sexual spores
(A) Edible mushroom (I) Toad stools
(B) Poisonous mushroom (II) Albugo
(C) Coenocytic fungus (III) Agaricus
.
(D) Parasitic fungus on mustard (IV) Mucor
(A) (B) (C) (D) (A) (B) (C) (D)
.
3) IV I III II 4) II III I IV
104. In which of the following examples CO2 gas is produced?
I) Fermentation of dough II) Cheese making
III) Production of beverages IV) Biogasproduction
V) Alcoholic fermentation VI) Lactic acid fermentation
1) I, II, III and IV 2)I, II, III and V 3) I, II, III, IV and V 4) I, II, III, IV, V and VI
105. Assertion (A): In dihybrid F2 generation for one character the phenotypic ratio is
3 : 1.
Reason (R): In dihybrid F2 generation only parents phenotypes are produced.

1) Less cellulosic material – food of cattle present in rumen
2) Biogas – Gobar gas
3) Bacteria – Break down of cellulose
4) CH4, CO2, H2 – Bacteria grow anaerobically
107. Which one is not the feature of Cycas?
1) Unbranched stem.
2) Pinnate leaves.
3) The microsporophylls or megasporophylls may be borne on the different trees
4) Cycas coralloid roots not associated with Cyanobacteria.
108. Choose the Mismatched pair regarding cell wall of algae.
1) Green algae…….. inner layer of cellulose and an outer layer of pectose.
2) Brown algae..... cellulosic wall usually covered on the outside by a gelatinous
coating of algin
3) Red algae……… amylopectin and glycogen in structure.
4) Red algae…….. Cellulose, pectin and polysulphate esters.
109. Study the following statements regarding the diplontic lifecycle.
I) It occurs in seed bearing plants like gymnosperms and angiosperms
II) The diploid sporophyte is dominant, photosynthetic, independent phase of the
plant
III) The gametophytic, phase is represented by the single to few-celled haploid
gametophyte
IV) In plants lifecycle alternation of generations between spore producing haploid
gametophyte and gamete producing diploid sporophyte.
110. Identify A, B, C and D in the given diagram of E.coli cloning vector pBR322
1) A-EcoRI, B-Bam HI, C-Ori, D-ampR 2) A-ampR, B-ori, C-Bam HI, D-EcoRI
3) A-Ori, B-Bam HI, C-EcoRI, D-ampR 4) A-Bam HI, B-EcoRI, C-ampR, D-Ori
111. Primers used in PCR is
1) Two sets of amino acid sequences 2) Two sets of nucleoside sequences
3) Two sets of nucleotide sequences 4) Two sets of sugar sequences
112. If an alien DNA is inserted within the coding sequence of ampR gene. Then the
recombinants will be. Find the incorrect statements
P) Grow in a medium containing ampicillin
Q) Will not grow in a medium containing ampicillin
R) Grow in a medium containing tetracycline
S) Will not grow in a medium containing tetracycline
1) P and Q 2) P and R 3) P and S 4) Q and S
113. Statement-I: The native (wild type) E.coli cells do not carry resistance against
any antibiotics
Statement-II:𝛽-galactosidase gene in pBR322 is considered as useful antibiotic
resistance gene in E.coli
1) T-DNA : Normal cells into tumourous cells
2) Micro particles : Gold or Tungsten
3) Microinjection: plant cell 4) Divalent cation: Competent host

115. In the palmately compound leaf
1) Lamina is not incised
2) Leaflets are attached to common axis called rachis
3) Axil of each leaflet bear bud
4) Leaflets are attached to the top of petiole
116. Monoadelphous and polyadelphous condition is present, respectively, in
1) Pea and China rose 2) China rose and Citrus
3) China rose and Pea 4) Citrus and Pea
A) Presence of epicalyx is one of the characteristic feature of solanaceae.
B) Numerous stamens are found in members of Asteraceae.
C) Bicarpellary to multicarpellary condition observed in poaceae.
D) False septum is observed only in members showing axile placentation of
cruciferae.
1) Only A and B are true 2) Only C and D are fasle
3) A, B and D are true 4) A, B, C and D are false
List-I (Inflorescence) List-II (Family)
A) Solitary (Terminal (or) Axillary) (I) Poaceae
cymose
B) Capitulum (II) Malvaceae
C) Spike (III) Compositae
`
`
D) Racemose (IV) Fabaceae
A B C D A B C D
1) II III I IV 2) II IV I III
3) I II III IV 4) IV II I III
119. Which of the following bacteria play an important role in the recycling of
nutrients like nitrogen, phosphorus, iron and sulphur?
1) Chemoheterotrophic bacteria
2) Chemosynthetic autotrophic bacteria
3) Parasitic bacteria
4) Saprophytic bacteria
120. Caryopsis is applicable to
1) Rice 2) Chinarose 3) Wheat 4) Both 1 and 3
121. RNA being a catalyst is more reactive hence unstable because of all, except
1) Presence of methyl uracil 2) Mutation at faster rate
3) Presence of uracil 4) Presece of 2’ OH of ribose
122. Catalytic property of RNA is shown by all of the following, except
1) Telomerase 2) Heterogenous nuclear RNA
3) 23S RNA 4) Ribonuclese – P
123. Which organism was utilized by Taylor et al to prove semi conservative replication
of DNA using radioactive thymidine?
1) Viciafaba 2) E.coli 3) Drosophila 4) Neurospora
124. Absence of which of the following enzyme shall affect the formation of 16s rRNA
in Streptococcus?
1) Replicase 2) RNA polymerase II
3) RNA polymerase 4) RNA polymerase – I
125. Ground tissue includes.
1) All tissue except epidermis and vascular bundles
2) Epidermis and cortex
3) All tissues internal to endodermis
4) All tissues external to endodermis
126. Assertion : Vascular bundles of dicot stem said to be open.
Reason : Such vascular bundles contain cambium which posses ability to form
secondary xylem & phloem tissue.

127. Which of the following statements about cork cambium is incorrect?
1) It forms secondary cortex on its outerside 2) It forms a part of periderm
3) It is responsible for the formation of lenticels 4) It is a couple of layers thick
128. A monohybrid cross between two plants one having 22cm long internodes and the
other having 12cm long internode, produced F1 hybrids all of 18cm long
internodes. This is a case of
1) Incomplete dominance 2) Complete dominance
2) Co-dominance 4) Multiple allilism
129. Which one of the following crosses shown phenotypic ratio of 3 : 1?
1) AaBb×AaBb 2) aabb × AABb 3) Aabb × Aabb 4) AaBb × aabb
130. If one gametophyte of a fern plant shows characters A and B and is crossed with
another plant having a and b, then what will be the next gametophytic generation
(i.e. gametes) with respect to these two charaters?
1) 1Ab : 2Ab : 1ab 2) 3Ab : 1 ab
3) 1AB : 1Ab : 1aB : 1ab 4) 9AB : 3Ab : 3aB : 1ab
131. In a breeding experiment between two pareants showing the dominant and
recessive phenotype of the character, the offspring showed equal proportions of
the dominant and recessive phenotypes. Which one of the following statements
must be true?
1) Both the parents had equal numbr of genes for the charater.
2) Both the parents carried recessive genes
3) Both the parents were true breeding
4) All are true.
132. Identify the components labelled A, B,C and D inthe diagram below from the list
(i) to (viii) given withComponents :
(i) Cristae of mitochondria (ii) Inner membrane of mitochondria

(iii) Cytoplasm (iv) Smooth endoplasmic reticulum
(v) Rough endoplasmic reticulum (vi) Mitochondrial matrix
(vii) Cell vacuole (viii)Nucleus
The correct component are :
A B C D A B C D
1) (i) (iv) (viii) (vi) 2) (vi) (v) (iv) (vii)
3) (v) (i) (iii) (ii) 4) (v) (iv) (viii) (iii).
133. Select out the wrong statement –
1) Neutral solute can move according to concentration gradient across the
nonpolar lipid bilayer
2) Water can also move according to concentration gradient across the nonpolar
lipid bilayer.
3) Non polar molecules can not pass through non polar lipid bilayer
4) Na+ & K+ can move across membrane through active transport
Column-I Column-II
A Power house of cell i. Chlorophyll
B Photosynthesis ii. Eukaryotic cell
C Extensive compartmentalization of cytoplasm iii. Capable of growth
D Primary cell wall iv. Mitochondria
1) A-iv, B-i, C-ii, D-iii 2) A-iii, B-i, C-ii, D-iv
3) A-iii, B-ii, C-i, D-iv 4) A-i, B-ii, C-iii, D-iv

1) Pollen grains of many species can germinate on the stigma of a flower, but
only one pollen tube of the same species grows into the style.
2) Insects that consume pollen or nectar without bringing about pollination are
called pollen/nectar robbers.
3) Pollen germination and pollen tube growth are regulated by chemical
components of pollen interacting with those of the pistil.
4) Some reptiles have also been reported as pollinators in some plant species.
SECTION – B
136. Seed formation without fertilisation in flowering plants involves the process of:
1) Sporulation 2) Budding 3) Somatic hybridisation 4) Apomixis
137. The coconut water from tender coconut represents:
1) Endocarp 2) Fleshy mesocarp
3) Free nuclear proembryo 4) Free nuclear endosperm
138. In angiosperms, microsporogenesis and megasporogenesis:
1) Form gametes without further divisions 2) Involve meiosis
3) Occur in ovule 4) Occur in anther
139. Whch of the following is correct statement?
1) Aminoacids may be considered as substituted methane
2) -Amino acid have difference only in R-group
3) In serine, R-group is hydroxyl methyl
4) All the above
140. Statement –I : Two dimensional and three dimensional view of molecular
structures are formed by the peptide bonds by the catalytic activity of enzymes.
Statement –II : Polypeptide chains end with N terminal and C terminal, linear
and catalytic structures are formed.
141. Fill in the blanks
1) A-Cell division, B-Differentiation 2) A- Dfferentiation, B-maturation

3) A- Plasmatic growth, B-Differentiation 4) A- Elongation, B-Maturation
142. Statement – I: Gibberellins hastens senescence
Statement –II : GA3 is used to speed up the malting process in brewing industry.
143. Ethylene is synthesiszed in large amounts by
1) Ripening fruit 2) Tisues undergoing senescence
3) Newly developed leaves 4) More than one option is correct
144. Statement – I : “Chromosome have two chromatids” firstly seen in metaphase.
Statement – II : Centriole split and chromatids separate in anaphase.

145. Which of the following phenomena is observed in first phase of meiosis – I?
A) Genetic identify B) Synapsis
C) Chromosome compaction D) Recombination
1) B & C 2) B & D 3) Except A all 4) Except B, all
146. Photosynthesis cannot continue for long if during light reaction, only cyclic
photophosphorylation takes place. This is because
1) Only ATP is formed, NADPH+ + H+ is not formed.
2) Photosystem – I stops getting excited at a wavelength of light beyond 680 nm.
3) There is unidirectional cyclic movement of the electrons.
4) There is no evolution of oxygen.
147. During breakdown of proton gradient in chloroplast
1) pH decreases in lumen of thylakoid
2) pH increases in fluid stroma
3) pH increases in both fluid stroma and lumen of thylakoid
4) pH decreases in fluid stroma
148. If the light intensity is increased from low to high then the rate of photosynthesis.
1) initially increases and then becomes constant
2) Initially decreases and then becomes constant
3) Increases continuously 4) Show no change
149. For each ATP produced, how many H+ passesthrough F1 from the intermembrane
space to the matrix down the electrochemical proton gradient?
1) 1 2) 2 3) 3 4) 4
150. From alpha-ketoglutarate to succinyl CoA in TCAcycle which of the following
occurs.
1) 4C compound is formed 2) 5C compound is Formed
3) 6C compound is formed 4) 2C compound is regenerated
ZOOLOGY
SECTION – A
151. Study the following and identify the correctstatements.
i) The rate of evolution is inversely proportional to the life span of organisms
ii) Fitness is the end result of the ability to adapt.
iii) Natural selection is the essence of Darwinian theory.
iv) Lamarck explained that evolution of life forms had driven by use and disuse of
organs.
1) i and ii 2) ii and iii 3) iii and iv 4) i, ii, iii and iv
152. Study the following figure and identify A, B and C.
1) A - stabilising selection, B - disruptive selection, C - directional selection

2) A - stabilising selection, B - directional selection, C - disruptive selection
3) A - directional selection, B - stabilising selection, C - disruptive selection
4) A - disruptive selection, B - directional selection, C - stabilising selection
153. Which of the following is not true?
1) Small sized reptiles of Mesozoic era still exist today.
2) Climatic changes killed dinosaurs.
3) The first reptiles were like shrews
4) Fossils of first mammals are small sized

154. Match Column-I with Column-II and select the correct option.
a) Homo habilis (i) 650-800 cc
b) Homo erectus (ii) 900 Cc
c) Neanderthal man (iii) 1400 cc
1) (a) - (i); (b) - (ii); (c) - (iii) 2) (a) - (ii); (b) - (i); (c) - (iii)
3) (a) - (ii); (b) - (iii); (c) - (i) 4) (a) - (iii); (b) - (ii); (c) - (i)
155. Which of the following are the functional features of an ecosystem :
(a) Species composition (b) Energy flow
(c) Decomposition (d) Stratification
1) (a) and (d) 2) (b) and (c) 3) only (a) 4) (b), (c) and (d)
156. Increased biodiversity contributes to
1) Low productivity 2) High extinction
3) High productivity 4) Both 1 and 2
157. Assertion : Habitat loss and fragmentation is the major reason for the extinction
of mammalian species.
Reason : Mammals require a large territory to feed and reproduce.
the assertion
158. Bidder's canal in frog is found in
1) Liver 2) Testis 3) Ovary 4) Kidney
159. Haemolymph of cockroach consist of
1) Hepatocytes 2) Haemocytes 3) Both (1) and (2) 4) None of these
160. How many filamentous Malpighian tubules are found in cockroach?
1) 100-150 2) 50-100 3) 150-200 4) 200-250
161. Arrange the following in the correct sequence.
I) This binding opens ion channels allowing the entry of ions, which can generate
a new potential in the post synaptic neuron.
II) The vesslcles fuse with the plasma membrane and release their neurotrans
mitters in the synaptic claft.
III) Impulse arrived at the axon terminal.
IV) The axon terminal contain vesicles filled with these neurotransmitters.
V) The released neurotransmitters bind to their receptors present on the post-
synaptic membrane.
VI) It stimulate the movement of the synaptic vesicles towards the membrane.
1) III, IV, VI, II, V, I 2) I, II, VI, III, IV, V 3) V, III, VI, II, IV, I 4) IV, II, VI, III, V, I
162. Which of the following statements are correct regarding Na   K  pump?
(i) Needs energy (ATP) to work.
(ii) Exples 3Na  for every 2K  imported.
(iii) Works against a concentration gradient.
(iv) Maintains resting potential.
1) i and iv 2) ii and iii 3) i and iii 4) all of the above
163. Lichens are the association of
1) Bacteria and fungus 2) Algae and Bacteria
3) Fungus & algae 4) Fungus & Virus
164. Leaves become modified into spines in
1) opuntia 2) pea 3) onion 4) skin cotton
165. Select the descending order of toxity of nitrogenous wastes excreted by animals.
1) Ammonia > Urea > Uric acid 2) Ammonia > Uric acid > Urea
2) Uric acid > Urea > Ammonia 4) Urea < Uric acid < Ammonia
166. The amount of filtrate formed by the kidneys per minute is _____
1) 125 ml/min 2) 250 ml/min 3) 1100-1200ml/min 4) 180 lit/min
167. a) Glomerular blood flow (GBF) b) Glomerular blood pressure (GBP)
c) Glomerular filtration rate (6FR)
How many of above can activate the JG cells to release renin in response to their
lower levels?
1) One 2) Two 3) Three 4) All

168. To obtain a standard ECG, a patient is connected to the machine with three
electrical leads. These leads are connected to
1) one in each wrist and to the left ankle
2) one in each wrist and to the right ankle
3) one in each ankle and to left wrist
4) one in each ankle and to the right wrist
169. Match Column – I with Column – II and choose the correct option.
(A) Heart failure (I) Heart muscle is suddenly damaged by an
inadequate blood supply.
(B) Cardiac arrest (II) Chest pain due to inadequate O2 reaching
the heart muscles
(C) Heart attack (III) Atherosclosis
(D) Coronary Artery (IV) Heart not pumping blood effectively enough
to meet the needs of the body
.
(E) Angina pectoris (V) Heart stops beating
(A) (B) (C) (D) (E) (A) (B) (C) (D) (E)
1) IV V I III II 2) IV V III I II
3) IV III V II I 4) V IV II III I
170. Cardic output is
1) Stroke volume (SV) x Heart rate (HR) = 5 L min-1
2) SV x HR = 500 mL 3) SV x HR = 72 mL min-1 4) SV x HR = 70 mL min-1
171. Identify correct matching
A) Physical agents - oncogenic virus
B) Chemical agents - Tobacco smoke (nicotine)
C) Biological agents - X - rays, gamma-rays UV rays
1) A, B 2) B 3) C 4) A , C
172. ________ on our body is the main barrier which prevents entry of microorganisms
1) Mucus membrane 2) Skin 3) Saliva 4) Tears
173. The B-lymphocytes produce an army of proteins in response to pathogens into
our blood to Fight with them.These proteins are called ___________
1) Antigens 2) Monocyte s 3) Interferon's 4) Antibodies
174. ___________ which affects many people in our society is an auto - immune disease
1) Down's syndrome 2) Cretinism
3) Addison's disease 4) Rheumatoid arthritis
175. Chorionic villi and uterine tissue become interdigitated with each other and
jointly form.
1) Trophoblast 2) Inner cell mass 3) Placenta 4) Foetus
176. Statement –I : A women release out hCG in her urine during pregnancy.
Statement –II : Presence of hCG in urine is the basic for pregnancy test.
177. Following statements are related to goals of HGP, except
1) To identify all the approximately 30,000 – 35,000 genes in human DNA
2) To store genome sequence information in databases
3) To improve tools for data analysis
4) To address the ELSI that may arise from HGP
178. Match the following columns?
(A) Physalia (I) Sea anemone
(B) Meandrina (II) Brain coral
(C) Gorgonia (III) Sea fan
.
(D) Adamsia (IV) Portuguese man-of-war
(A) (B) (C) (D) (A) (B) (C) (D)
1) III II I IV 2) IV III II I
3) IV II III I 4) II III I IV

179. Consider the following features
A. Internal fertilization B. A pair of jaws
C. Mostly viviparous
Select the correct option of animal groups which posses all the above
characteristics
1) Reptilia and Mammalia 2) Chondrichthyes and Mammalia
3) Chondrichthyes and Osteichthyes 4) Amphibia and Mammalia
180. The phylum which was earlier considered as a subphylum under a Chordata
shows
1) Direct development 2) Internal fertilization
3) Open type of circulation 4) Radial symmetry
181. Statement – I: Thyroid Hormones influence maintenance of water electrolyte
balance.
Statement – II: PTH stimulates the reabsorption of Ca2+ by renal tubules.
182. Assertion(A): Adrenaline & Nor-adrenalin are hormones of Flight or Fight
Reason (R): They are rapidly secreted in response to emergency & stress
183. From the given DNA fingerprint result identify the father of the baby? Point the
correct option
1) Person – 1 (2) Person – 2 3) Both 1 & 2 4) None of the above

184. Statement I: A gene with three or more possible alleles are termed as polygenic
inheritance
Statement II: A trait controlled by three or more gene is polygenic inheritance
185. Choose the incorrectly matched pair from the following.
1) Birds- ZW-ZZ type 2) Grasshopper – XX-XY type
3) Male honey bee – Parthenogenesis 4) Humans – XX-XY type
SECTION – B
186. Assertion: Mutation results in changes in genotype and phenotype of an
organisms.
Reason: Mutation results in alteration of DNA sequences.
assertion.

187. Assertion: The chance of occurrence of colour blindness in male is 8 percent
Reason: Male have two X chromosomes as the sex chromosomes
assertion.
188. Which of the following statements regarding energy flow is/are false?
I. Detritus food chain begins with dead organic matter
II. In aquatic ecosystem, detritus food chain is the major conduit for energy flow
III. In terrestrial ecosystem a larger fraction of energy flows through grazing food
chain
IV. Producers belong to the first trophic level of the food chain
1) II and III only 2) III and IV only 3) I and IV only 4) I and II only
189. Which of the following is/are not true about "Ecological pyramids"
a) Ecological pyramids do not take into account, the same species, belonging to
two or more trophic levels
b) The food web is not considered in ecological pyramids [i.e., the only simple food
chain is considered]
c) Saprophytes are kept in the 4th trophic level in ecological pyramids.
1) a only 2) b only 3) c only 4) none of these
190. Observe the given representation of the pyramid of energy.
I. 10 Kcal/m2/yr II.100 Kcal/m2/yr

III.1000 Kcal/m2/yr IV. 100000 Kcal/m2/yr
Refer the above diagram of energy pyramid. The ecological efficiency at primary
consumer level, in comparison to that at secondary level, is
1) Same 2) More 3) Less 4) Cannot be ascertained for the data
191. The semen of male after vasectomy
1) Does not contain sperms 2) Is not produced in body
3) Lacks fructose and prostaglandins 4) Both (1) and (3)
a) One-fifth of total number of conceived pregnancies in a year, all over the India
are terminated through MTP.
b) MTP restrictions help to check illegal female foeticide in India.
1) Both a and b are false 3) a is true, b is false
3) a is false, b is true 4) Both a and b are true
193. Family is placed between:
1) Order and genus 2) Genus and species
3) Class and order 4) Phylum and class
194. Which pulmonary capacity is correctly matched with its formula and value?
Respiratory volume Formula Value
1 Functional residual capacity ERV + TV 2300 ml
2 Expiratory capacity TV + ERV 1200 ml
3 Vital capacity ERV + IRV + TV 4000 ml
4 Total lung capacity RV + IRV + ERV 5800
195. Which of the following part of respiratory system form exchange part?
1) external nostrils to terminal bronchioles. 2) alveoli and their ducts.
3) larynx to primary bronchi.
4) primary bronchi to terminal bronchioles.
196. What is the function of pleural fluid?
1) reduces friction on the lung surface.
2) protection from external shocks.
3) provide moisture. 4) all of the above.

197. Which of the following is not the function of skeleton:
1) Movement 2) Storage of minerals
3) Production of body heat 4) Both 1 and 2
198. Match List I and List II:
List I List II
A. Vertebrochondral ribs I. 12
B. Facial bones II. 6
C. Thoracic vertebrae III. 7
D. Ankle bones IV. 14
1) A – I, B – II, C – III, D – IV 2) A – IV, B – II, C – I, D – III
3) A – III, B – I, C – IV, D – II 4) A – II, B – IV, C – I, D – III
199. A regulatory body working for the release of transgenic crop is
1) ICWMI 2) IARI 3) IRRI 4) GEAC
200. Assertion: Insulin used in diabetes was earlier extracted from pancreas of
slaughtered cattle and pigs.
Reason: Insulin from an animal source caused some patients to develop allergy
or other types of reactions to the foreign protein.
1) If both assertion and reason are true and the reason is the correct explanation
of the assertion.
2) If both assertion and reason are true but reason is not the correct explanation
of the assertion.
3) If assertion is true but reason is false.
4) If both assertion and reason are false
*******

: ANSWER KEY:
SET-2 SUB: PHYSICS
1 2 11 4 21 4 31 3 41 1
2 2 12 3 22 4 32 1 42 3
3 1 13 1 23 4 33 1 43 3
4 3 14 1 24 3 34 3 44 4
5 3 15 3 25 1 35 4 45 1
6 4 16 2 26 4 36 2 46 4
7 4 17 4 27 1 37 1 47 1
8 2 18 2 28 2 38 1 48 2
9 1 19 4 29 2 39 3 49 3
10 2 20 4 30 3 40 1 50 4
SUB:CHEMISTRY
51 1 61 3 71 3 81 2 91 2
52 3 62 1 72 1 82 1 92 2
53 3 63 3 73 3 83 4 93 3
54 3 64 3 74 1 84 3 94 2
55 4 65 3 75 4 85 1 95 3
56 4 66 4 76 4 86 1 96 1
57 3 67 4 77 1 87 1 97 2
58 3 68 1 78 4 88 2 98 2
59 3 69 2 79 4 89 3 99 1
60 4 70 2 80 1 90 2 100 1
SUB : BOTANY
101 3 111 3 121 1 131 2 141 3
102 4 112 3 122 2 132 4 142 4
103 2 113 1 123 1 133 3 143 4
104 3 114 3 124 3 134 1 144 4
105 3 115 4 125 1 135 1 145 3
106 1 116 2 126 1 136 4 146 1
107 4 117 4 127 1 137 4 147 2
108 3 118 1 128 1 138 2 148 1
109 3 119 2 129 3 139 4 149 2
110 1 120 4 130 3 140 4 150 1
151 4 161 1 171 2 181 1 191 1
152 2 162 4 172 2 182 1 192 3
153 3 163 3 173 4 183 1 193 1
154 1 164 1 174 4 184 4 194 3
155 2 165 1 175 3 185 2 195 2
156 3 166 1 176 1 186 1 196 4
157 2 167 4 177 1 187 3 197 3
158 2 168 1 178 3 188 1 198 4
159 2 169 1 179 2 189 4 199 4
160 1 170 1 180 3 190 3 200 2

NEET GRAND TEST - 9
answer sheet.
CORRECT.
Section-B;
Marking Scheme :

PHYSICS
SECTION – A
1. The measured value of the length of a simple pendulum is 20cm with 2mm
accuracy. The time for 50 oscillations was measured to be 40 seconds with 1
second resolution. From these measurements, the accuracy in the measurement
of acceleration due to gravity is N%. The value of N is
1) 4 2) 8 3) 6 4) 2
List-I List-II
A) Torque (I) Nms 1
B) Stress (II) J kg 1
C) Latent heat (III) Nm
D) Power (IV) Nm2
Choose the correct answer from the options given below :
1) A-III, B-II, C-I, D-IV 2) A-III, B-IV, C-II, D-I
3) A-IV, B-I, C-III, D-II 4) A-II, B-III, C-I, D-IV
3. A man is 45m behind the bus when the bus starts accelerating from rest with
acceleration 2.5 m/s2. With what minimum velocity should the man start
running to catch the bus?
1) 12 m/s 2) 14 m/s 3) 15 m/s 4) 16 m/s
4. A body moving with a uniform acceleration crosses a distance of 65m in the 5th
second and 105m in 9th second. How far will it go in 20s?
1) 2040m 2) 240m 3) 2400m 4) 2004m
5. When the engine is switched off a vehicle of mass M is moving on a rough
horizontal road with moment p. If the coefficient of friction between the road and
tyres of the vehicle is k , the distance travelled by the vehicle before it comes to
rest is
p2 2 k M 2 g p2 p2M 2
1) 2) 3) 4)
2 k M 2 g p2 2 k g 2 k g
6. The rear side of truck is open and a box of mass 50kg is placed at 3.2m away
from the open end. The coefficient of friction between the box, and the surface is
0.2. If the truck starts from rest and moves on a straight road with acceleration
2.1ms-2, then the box falls off the truck after a time (take g = 10ms-2)
8
1)4s 2) s 3) 8s 4) 8s
41
7. A man is walking due east at the rate of 2 km/h. The rain appears to him to
come down vertically at the rate of 2 km/h. The actual velocity and direction of
rain fall with the vertical respectively are
1
1) 2 2 km/h, 45o 2) km/h, 30o 3) 2 km/h, 0o 4) 1 km/h, 90o
2
8. A thin circular ring of mass M and radius r is rotating about its axis with a
constant angular velocity  . Two objects, each of mass m are attached gently to
the opposite ends of a diameter of the ring. The ring now rotates with an angular
velocity
M   M  2m  M  M  2m 
1) 2) 3) 4)   
mM M  2m M  2m  M 
9. The incorrect statement about the property of a Zener diode is:
1) P and n regions of Zener diode are heavily doped
2) Zener voltage remains constant at break down
3) It is designed to operate under reverse bias
4) Depletion region formed is very wide
10. If a particle is executing SHM on a straight line. A and B are two points at which
its velocity is zero. It passes through a certain point P(AP < PB) at successive
intervals of 0.5sec and 1.5sec with a speed of 3m/s. The maximum speed of the
particle is
1) 3 m/s 2) 3 2 m/s 3) 3 3 m/s 4) 6 m/s

11. Two cells, each of e.m.f. E and internal resistance r, are connected in parallel
across a resistor R. The power dissipated in the resistor is maximum if :
3r r
1) R = r 2) R = 2r 3) R  4) R 
2 2
12. Two vessels A and B are of the same size and are at same temperature. A
contains 1g of hydrogen and B contains 1g of oxygen. PA and PB are the pressures
P
of the gases in A and B respectively, then A is:
PB
1) 16 2) 8 3) 4 4) 32
13. A body of weight 2kg is suspended as shown in figure. The tension T1 in the
horizontal string (in kg-wt) is
1) 2 / 3 3/2 3) 2 3
2) 4) 2
14. Two masses m1 and m2 are suspended together by a massless spring of
constant K. When the masses are in equilibrium, m2 is removed without
disturbing the system. The amplitude of oscillations is
m1 g m2 g
1) 2)
K K m1
m2
(m  m2 ) g (m  m2 ) g
3) 1 4) 1
K K
15. 10 kg of ice at – 10oC is mixed with 40 kg of water at 45oC, the final temperature
of mixture is (specific heat of ice = 2100 J / kg – K) nearly
1) 19oC 2) 17oC 3) 15oC 4) 13oC
16. A thin semicircular conducting ring of radius R is falling with its plane vertical in
a horizontal magnetic induction B. At the position MNQ, the speed of the ring is V
and the potential difference developed across the ring is

    
B N
   
    
V
    
M Q
1) Zero 2) BR 2 / 2 and M is at higher potential
3) RBV and Q is at higher potential 4) 2RBV and Q is at higher potential
17. Mass defect of an atom refers to:
1) Inaccurate measurement of mass of nucleons
2) Mass annihilated to produce energy to bind the nucleus
3) Packing fraction
4) Difference in number of neutrons and protons in the nucleus
18. Assertion (A): A heavy mass is attached to a thin wire and whirled in a vertical
circle the wire is most likely to break at the lowest point.
Reason (R) : Tension is maximum at the lowest point.
1) Both assertion and reason are correct but reason does not explain assertion
19. Eight small drops of mercury, each of radius R, coalesce to form a single large
drop. The ratio of the total surface energies before and after the change is:
1/ 3 1/ 3
1) 1: 2 2) 2 :1 3) 2 :1 4) 1: 2

20. The diameter of one drop of water is 0.02 cm. The work done in breaking one
2
drop into 100 equal droplets will be: (surface tension = 7  10 N / m )
6 6 6 6
1) 7.9  10 J 2) 5.92  10 J 3) 2.92  10 J 4) 1.92  10 J
21. Four masses ‘m’ each are orbiting in a circle of radius ‘r’ in the same direction
under gravitational force. Velocity of each particle is

Gm 1  2 2  Gm  1  2 2 
1)
r 2
2)
Gm
r
3)
Gm
r

1 2 2  4) 
2r  2 

22. An iron rod of 0.2 cm 2 cross-sectional area is subjected to a magnetising field of

1200 Am 1 . The susceptibility of iron is 599. The magnetic flux produced is
1) 0.904 wb 2) 1.81 105 Wb 3) 0.904  10 5 Wb 4) 5.43  10 5 Wb
23. Assertion: A proton, a deutron and an  -particle are accelerated by the same
potential difference. Their velocities will be in the ratio of 1 : 1 : 2 .
1
Reason: Kinetic energy, E= qV = mv2
2
3) If (A) is true but (R) is false. 4) If (A) is false but (R) is true.
24. If a diamagnetic substance is brought near the north or the south pole of a bar
magnet, it is
1) repelled by the nortm pole and attracted by the south pole
2) attracted by the north pole and repelled by the south pole
3) attracted by both the poles
4) repelled by both the poles
25. A wire of length ‘L’ meters carrying a curent ‘i’ amperes is bent in the form of a
circle of two turns. The magnitude of its magnetic moment is
iL iL2 i2 L i 2 L2
1) 2) 3) 4)
4 16 4 4
26. Wheatstone bridge principle is used to measure the specific resistance  S1  of
given wire, having length L, radius r. If X is the resistance of wire , then specific
  r2 
resistance is: S1  X   . If the length of the wire gets doubled then the value of
 L 
specific resistance will be
S S
1) 1 2) 2S1 3) 1 4) S1
4 2
27. A prism produces a minimum deviation  in a light beam. If three such prisms
are combined, the minimum deviation produced will be
1) 4 2) 2 3)  4) 0
28. When white light enters a prism, its gets splits into its constituent colours. This
is due to;
1) high density of prism material
2) because  is different for different wavelength
3) diffraction of light
4) interference of light

29. P-V diagram of an ideal gas is as shown in figure. Work done by the gas in the
process ABCD is
1) -3P0V0 2) 2P0V0 3) 3P0V0 4) -2P0V0

30. In Young’s double slit experiment, 5 dark fringe is obtained at a point. If a thin
th
transparent film is placed in the path of one of waves, then 7th bright fringe is
obtained at the same point. The thickness of the film in terms of wavelength 
and refractive index  will be
1.5 2.5
1) 2) 1.5    1 3) 2.5    1 4)
   1    1
31. 2q and 3q are two charges separated by a distance 12cm on x-axis. A third
charge q is palced at 5 cm on y-axis as shown in figure. Find the change in
potential energy of the system if q is moved from initial postion to a point on X-
axis in circular path
q2 6q 2 12q 2 3q 2
1) 2) 3) 4)
4 0 4 0  91 4 0  91 4 0
32. Infinite charges of agnitude q each are lying at x = 1, 2, 4, 8… meter on X-axis.
The value of intensity of electric field at point x= 0 due to these charges will be
1) 12  109 qN / C 2) Zero 3) 6  109 qN / C 4) 4 109 qN / C
33. If identical charges (-q) are placed at each corner of a cube of side b, then electric
potential energy of charge (+q) which is palced at centre of the cube will be
8 2q 2 8 2q 2 4 2q 2 4 q 2
1) 2) 3) 4)
4 0b  0b  0b 3 0b
34. From the circuit shown below, the maximum values of zener diode current are
1) 6mA 2) 14mA 3) 9mA 4) 3mA

35. You are provided with 48 cells, each of emf 2 volts and internal resistnce 4 ohms.
What maximum current can flow in the circuit having an extneral resistance of
12?
1) 1A 2) 1.2A 3) 0.96A 4) 1.08A

SECTION – B
36. A cylinder of radius R of thermal conductivity K1 is surrounded by a cylindrical
shell of inner radius R and outer radius 2R made of thermal conductivity K2. The
two ends of the whole system are maintained at two different temperatures T1 and
T2
( T1 < T2 ). The system is in steady state and there is no loss of heat across
cylindrical surface. The electrical thermal conductivity of the system is
K1 K 2 K  3K 2 3K  K 2
1) K  K1  K 2 2) K  3) K  1 4) K  1
K1  K 2 4 4
37. A uniform rod of mass M and length l is Pivoted at one end so that it can rotate in
vertical plane. There is negligible friction at the pivot. The free end is held
vertically above the pivot and released. The angular acceleration of the rod when it
makes an angle  with vertical is
3g 2g 3g 2g
1) cos  2) cos  3) sin  4) sin 
2l 3l 2l 3l
38. The two slits at a distance of 1 mm are illuminated by the light of wavelength
6 . 5  10  7 m . The interference fringes are observed on a screen placed at a distance
of 1m. The distance between third dark fringe and fifth bright fringe will be
1) 0.65 mm 2) 1.63 mm 3) 3.25 mm 4) 4.88 mm
39. Nickel shows ferromagnetic property at room temperature. If the temperature is
increased beyond Curie temperature, then it will show
1) anti ferromagnetism 2) no magnetic property
3) diamagnetism 4) paramagnetism
40. The centres of a ring of mass m and a sphere of mass M of equal radius R, are at
a distance 8 R apart as shown in fig. The force of attraction between the ring
and the sphere is
2 2 GmM GmM GmM 2 GmM

1) 2
2) 2
3) 2
4)
27 R 8R 9R 9 9R2
41. An electron moves along the line AB, which lies in the same plane as a circular
loop of conducting wires as shown in the diagram. What will be the direction of
current induced if any, in the loop
;
A B
1) No current will be induced 2) The current will be clockwise

3) The current will be anticlockwise
4) The current will change direction as the electron passes by
42. When the temperature of a gas in a rigid container is raised, the pressure exerted
by the gas on the walls of the container increases because
1) The molecules have higher average speed, so strike the walls more often
2) The molecules lose more KE each time they stike the walls
3) The molecules are now in contact with the walls for small intervals
4) The molecules collied with each other more often

43. A wire X of length 50cm carrying a current of 2A is placed parallel to a long wire
Y of length 5m. The wire Y carries a current of 3A. The distance between two
wires is 5cm and current flows in the same direction the force acting on the wire
Y is ______
1) 1.2 105 N directed towards wire X 2) 1.2 104 N directed away from wire X
3) 1.2 104 N directed towards wire X 4) 2.4 105 N directed towards wire X
44. The amplitude of magnetic field in an electromagnetic wave propagating along y-
7
axis is 6.0  10 T . The maximum value of electric field in the electromagnetic
wave is:
1 1 1 7 1
1) 5  10 Vm 3) 2  10 Vm 4) 6.0  10 Vm
14 15
2) 180Vm
coil of resistance wire embedded in a thermally insulated block of specific heat
capacity s and mass m. If the temperature of the block is raised by T, the
potential difference V across the capacitance is :
1) 2) 3) 4)
s s C C
46. The plots of intensity versus wavelength for three black bodies at temperatues T1,
T2 and T3 respectively are as shown. Their temperature are such that
1) T1  T2  T3 2) T1  T3  T2 3) T2  T3  T1 4) T3  T2  T1
47. Assertion (A): Breaking stress of a wire depends upon nature of the material.
Reason (R) : Breaking stress depend upon shape and area of cross-section.
1) Both assertion and reason are correct but reason does not explain assertion
48. In binding energy curve, binding enrgy per nucleon
1) Increases continuously with mass number
2) Decreased continuously with mass number
3) Remains constant with mass number
4) First increase and then decreases with increase of mass number
49. A particle makes SHM along a straight line and its velocity when passing
through points 3cm and 4cm from the mean position is 16cm/sec and 12cm/sec
respectively. Then its time period is
 3
1) sec 2)  sec 3) sec 4) 2 sec
2 2
50. The barrier potential of a p-n junction depends.
(A) type of semi conductor material.
(B) amount of doping
(C) Temperature
Which one of the following is correct?
1) (A) and (B) only 2) (B) only 3) (B) and (C) only 4) (A), (B) and (C)

CHEMISTRY
SECTION – A
51. 60ml of 0.4M Ba(OH)2 is exactly neutralised by 40ml of given H3PO4
[MW = 98 g/mol] solution. Then the weight of H3PO4 present in 500ml given
H3PO4 solution is ______g.
1) 29.4 2) 19.6 3) 39.2 4) 58.8
52. Which of the following binary mixtures will have same composition in liquid and
vapour phase?
(i) Ethanol + Chloroform (ii) Nitric acid + Water
(iii) Benzene + Toluene (iv) Ethyl chloride+Ethyl bromide
1) (i) and (iii) 2) (i) and (ii) 3) (i), (ii) and (iii) 4) (iii) and (iv)
53. To detect iodine in presence of bromine, the sodium extract is treated with NaNO2
+ glacial acetic acid + CCl4. Iodine is detected by the appearance of
1) Yellow colour of CCl4 layer 2) Violet colour of CCl4
3) Brown colour in the organic layer of CCl4 4) Deep blue colour in CCl4
54. Which of the following is a wrong combination regarding flame colouration?
1) Na → Yellow 2) Ba → Apple green
3) Mg → Crimson red 4) K → Pale violet
55. A pair of elements in which, atomic weight of second element is less than the first
element is
(A) Ar, K (B) Co, Ni (C) Te, I
1) A, B only 2) B, C only 3) A, C only 4) A, B, C
56. Which of the following compound gives similar products with HBr and
HBr/peroxide?
1) CH 3  CH  CH 2 2) CH3CH  CH  CH3
3) C2 H 5  CH  CH  CH 3 4) C2 H5  CH  CH 2
57. Find the value of wave number   in terms of Rydberg’s constant, when
transition of electron takes place between two levels of He+ ion whose sum is ‘ 4 ’
and difference is ‘2’
8RH 32 RH 3RH 5RH
1) 2) 3) 4)
9 9 4 36
58. The electrons identified by quantum numbers n and l (i) n = 4, l = 1 (ii) n = 4,
l = 0 (iii) n = 3, l = 2 (iv) n = 3, l = 1 can be placed in order of increasing energy,
from lowest to highest as
1) (iv) < (ii) < (iii) < (i) 2) (ii) < (iv) < (i) < (iii)
3) (i) < (iii) < (ii) < (iv) 4) (iii) < (i) < (iv) < (ii)
59. Assertion : Lactic acid is optically active compound.
Reason : It contains a chiral centre with plane of symmetry.
60. A white powder when strongly heated gives off brown fumes. A solution of this
powder gives as yellow precipitate with a solution of KI. When a solution of
barium chloride is added to a solution of powder, a white precipitate results.
This white powder may be
1) A soluble sulphate 2) Ba(NO3)2
3) KBr and NaBr 4) AgNO3
61. An aqueous solution containing a mixture of Al 3 , Zn 2 and Fe3 ions was treated
with excess aqueous ammonia. What precipitate was left at the end of the
reaction?
1) Al  OH 3 2) Fe  OH 3 3) Zn  OH  2 4) Only Al  OH 3 and Fe  OH 3
62. Which of the following compounds cannot used in the preparation of iodoform?
1) CH3CHO 2) CH3COCH3 3) HCHO 4) 2-propanol

63. Assertion : Pb compounds are stronger oxidizing agents than Sn4+ compounds.
4+
Reason : The higher oxidation states for the group 14 elements are more stable
for the heavier members of the group due to ‘inert pair effect’.

64. Assertion : B-F bond length in BF4 is higher than that in BF3 molecule.
Reason : BF4 is tetrahedral in shape while BF3 is trigonal planar in shape.
65. Assertion : Lattice energy of CaO is higher than that of LiCl.
Reason : Lattice energy of ionic compound is directly proportional to the product
of charges of ion.
66. Identify the correct order of stability among the following carbanions.
1) I>III>IV>II 2) I>IV>III>II 3) II>III>IV>I 4) II>IV>III>I

67. Value of pKa will be minimum for :
68. The tetrahalide that does not hydrolysed.

1) SiCl4 2) CCl4 3) SnCl4 4) GeCl4
69. Elements of group 15 form compounds in +5 oxidations state. However Bismuth
forms only one well characterised compound in +5 oxidation state. The compound
is
1) Bi2O5 2) BiF5 3) BiCl5 4) Bi2S5
70. Predict the correct intermediate and product in the following reaction
71. Which one is the correct order of acidity?

1) CH 2  CH 2  CH 3  CH  CH 2  CH 3  C  CH  CH  CH
2) CH  CH  CH3  C  CH  CH 2  CH 2  CH 3  CH 3
3) CH  CH  CH 2  CH 2  CH 3  C  CH  CH3  CH3
4) CH 3  CH3  CH 2  CH 2  CH3  C  CH  CH  CH

72. Assertion (A) : Friedel-crafts alkylation of benzene occurs in the presence of
Lewis acid.
Reason (R) : The function of Lewis acid to generate electrophile.
of the Assertion
of the Assertion
73. Find molarity of 20% w/w NaOH solution. Density of solution is 1.2 g/mL.
1) 2M 2) 6M 3) 1.2 M 4) 4.167 M
74. The normality of H+ ion in the mixture obtained by mixing 100 mL of 0.2 M H2SO4
and 200 mL of 0.2 M HCl is :
1) 0.0267 2) 0.2670 3) 0.2 4) 0.3
75. Which is(are) disproportionation reaction(s)?

a) 4 H 3 PO3   3H 3 PO4  PH 3 b) P4  KOH 
 PH 3  KH 2 PO2
c) RCHO 
KOH
 RCOOK  RCH 2OH
1) a, b 2) a, b, c 3) b, c 4) a, c
76.
X and Y in the reaction are
77. Match the column I with column II and mark the appropriate choice.
(A) Carbon tetrachloride (I) Paint remover
(B) Methylene chloride (II) Refrigerators and air conditioners
(C) DDT (III) Fire-extinguisher
(D)
.
Freons (IV) Non-biodegradable insecticide
(A) (B) (C) (D) (A) (B) (C) (D)
1) II III I IV 2) IV III II I
3) I II III IV 4) III I IV II
78. Which of the following is isostructural with XeF4?
1) ICl4 2) SCl4 3) XeO2 F2 4)  PtCl2  NH 3 2 
79. Which of the following is false?
1) 118th element is a noble gas called ununoctium
2) Helium is lightest noble gas, used in scuba diver’s cylinders to avoid bends
3) Xenon is the most reactive among the rare gases.
4) Noble gases are highly soluble in water.
80. For a second order reaction, conc. of the reactant is decreased from 0.8M to 0.4M
in 15 minutes. Then the time required for the conc. of reactant to decrease from
0.4M to 0.1M is ____ minutes
1) 90 2) 45 3) 60 4) 30
81. For a reaction, the graph drawn between log K vs 1/T gives a straight line with
negative slope and positive intercept. The magnitude of the slope is 2600 units
and intercept on Y-axis is 18. Then activation energy is _______kJ/mol
1) 49.782 2) 21.616 3) 5.2 4) 11.975

82. Assertion : Tert-butyl methyl ether on treatment with HI at 1000C gives a mixture of
methyl iodide and tert-butyl alcohol.
Reason: This reaction occur via SN2mechanism.
1) Both Assertion and Reason are correct and Reason is the correct explanation for
Assertion
2) Both Assertion and Reason are correct but Reason is not the correct explanation for
Assertion
4) Both Assertion and Reason are incorrect
83. Assertion (A) Phenols give o-and p-nitrophenol on nitration with conc. HNO3 and
H2SO4 mixture.
Reason (R) - OH group in phenol is o-,p-directing.
1) Both Assertion and Reason are correct and Reason is the correct explanation for
Assertion
2) Both Assertion and Reason are correct but Reason is not the correct explanation for
Assertion
4) Both Assertion and Reason are incorrect
84. What will be the nature of change in internal energy in case of process shown
below?
(I) (II) (III) (IV)
1) +ve in all cases 2) –ve in I and III and +ve in II and IV

3) –ve in all cases 4) zero in all cases
85. Use the bond energies to estimate H for this reaction :
H 2  g   O2  g  
 H 2O2  g 
Bond Bond energy
H–H 436 kJ mol1
O–O 142 kJ mol1
O=O 499 kJ mol1
H–O 460 kJ mol1
1) -127 kJ 2) 127 kJ 3) -484 kJ 4) 484 kJ
SECTION – B
86. Statement – I : Cu2+ iodide is not known
Statement – II : Cu2+ oxidises I  to iodine.
87. Statement – I : Separation of Zr and Hf is difficult.
Statement – II : Zr and Hf lie in the same group of the Periodic table.
1) Both Statement-I and Statement-II are true, statement II is a correct
exmplanation of Statement- I
2) Both Statement-I and Statement-II are true, statement II is a not correct
exmplanation of Statement-.

88. In the reaction

1) Though carboxyl acids contian carbonyl group, yet they are not carbonyl
compounds as they do not give characteristics reactions of carbonyl group
2) Methanal and methanoic acid are liquids while ethanal is a gas at room
temperature
3) Carboxylic acids undergo decarboxylation to form alkanes
4) PCC is mild oxidizing agent which oxidizes primary alcohol into corresponding
aldehydes.
90. [Co2(CO)8] displays:
1) one Co-Co bond, six terminal CO and two bridging CO
2) one Co-Co bond, four terminal CO and four bridging CO
3) no Co-Co bond six terminal CO and two bridging CO
4) no Co – Co bond, four terminal CO and four bridging CO
91. Which molecule/ion among the following cannot act as a ligand in complex
compounds?
1) CH4 2) CO 3) CN- 4) Ph3P
92. In Fe(CO)5, the Fe – C bond possesses
1) Ionic character 2)  -character only
3)  -character 4) Both  and  character
93. Hydrolysis constant of salt derived from strong acid and weak base is 2 x 10-5.
The dissociation constant of the weak base is
1) 5 x 10-8 2) 5 x 10-9 3) 5 x 10-10 4) 2 x 10-19
94. The pH of aqueous solution of NH4CN ( Ka of HCN is 9.2 x 10-10 & Kb of NH4OH is
1.8 x 10-5)
1) > 7 2) < 7 3) 7 4) 14
95. 2 g of NaOH per 250 ml of solution is added to a buffer solution of buffer capacity
0.2. Then the change in pH is
1) 0.5 2) 1 3) 1.5 4) 2.0
96. Assertion : Nitration of aniline can be conveniently done by protecting the amino
group by acetylation.
Reason : Acetylation of amino group increases the electron-density in the
benzene ring.
assertion.
assertion
97. Assertion : Acylation of amines gives a monosubstituted product whereas
alkylation of amines gives polysubstituted product.
Reason : Acyl group sterically hinders the approach of further acyl groups
assertion.
assertion

98. The potential of the cell containing two hydrogen electrodes as represented below
Pt, H 2 g  1 atm  H  106 M  H  10 4 M  H 2 g  1 atm  , Pt ; at 298 K is _______
1) –0.118 V 2) –0.0591 V 3) 0.118 V 4) 0.0591 V
99. As lead storage battery is charged
1) lead dioxide dissolves
2) sulphuric acid is regenerated
3) lead electrode becomes coated with lead sulphate
4) the concentration of sulphuric acid decreases
1) During denaturation 20 and 30 structrue of protein remain intact
2) Sucrose is non-reducting sugar
3) A,D,E and K are water soluble vitamins
4) Uracil is present in DNA
BOTANY
SECTION – A
101. How many male gametes are produced from 2000 microspore mother cells in an
angiospermic plant?
1) 2000 2) 8000 3) 500 4) 16,000
102. The Km value is:
(1) Enzyme concentration at half-maximal velocity
(2) Temperature co-efficient at half-maximal velocity
(3) Substrate concentration at half-maximal velocity
(4) Inhibitor constant at half-maximal velocity
103. Identify the correct statement of the following:
(1) Papaver shows multicarpellary, apocarpous pistil.
(2) The vegetative cell of a pollen grain contains a spindle-shaped nucleus.
(3) Pollen grains in some cereals lose viability within 30 min. of their release.
(4) Insect pollination is quite common in grasses.
104. Identify the incorrect match of the following:
(1) 2, 4- D …………………Kills dicot weeds.
(2) GA3 ……………………. Sprouting of potato tubers.
(3) Zeatin…………………Delay of leaf senescence.
(4) Ethylene ………………Root hair formation.
105. Karyogamy is delayed in:
(1) Phycomycetes& Basidiomycetes (2) Ascomycetes & Basidiomycetes
(3) Ascomycetes &Deuteromycetes (4) Basidiomycetes &Deuteromycetes
106. Bulliform cells are present in:
(1) Abaxial epidermis of leaves in grasses
(2) Adaxial epidermis of leaves in dicots
(3) Abaxial epidermis of leaves in dicots
(4) Adaxial epidermis of leaves in grasses
107. Prions are:
(1) Infectious proteins (2) Abnormally folded proteins
(3) Causative agents of BSE (4) All of these
108. Identify the correct statement w.r.t experiments of Morgan on linkage in
drosophila: (1) They and w genes are linked more tightly than w and min genes.
(2) The w and m genes are more tightly linked than y and w genes.
(3) The genes y and w (or) w and min showed 9:3:3:1 ratio.
(4) Recombination frequency is greater in y and w genes than in m and w genes.
109. Which of the following organelle shows cartwheel like structure?
(1) Centrosome (2) Flagellum (3) Cilium (4) Centriole
110. Parietal placentation is seen in:
(1) Sunflower (2) Pea (3) China rose (4) Mustard
111. Which of the following are electron carries / transporters in both
photophosphorylation and oxidative phosphorylation?
A) H2O B) cyst. b6f C) Fd D) ADP
E) ATP F) cyt. b – c1 G) Fo H) F1 I) cyt-a-a3
1) A,B,C,E,F 2) B,C,F,I 3) C,D,E,F,H 4) B,C,D,F,H

112. The chemical components that mediate pollen-pistil interactions are present in:
(1) Ovary (2) Pollen grains (3) Stigma (4) Both 2 and 3
113. Microbes used in the preparation of cheese are:
(1) Bacteria (2) Fungi (3) Yeast (4) More than one option
114. The C4 - plants developed a special mechanism to increase CO2- concentration at
RuBisCO enzyme site. That mechanism is:
(1) Decarboxylation of C3- acid (2) Decarboxylation of C4- acid
(3) Carboxylation of C3- acid (4) Carboxylation of C4- acid
115. Identify the correct match of the following:
(A) Sclerenchymatouspericycle (I) Dicot root
(B) Polyarch xylem bundles (II) Monocot stem
(C) Sclerenchymatous bundle sheath (III) Monocot root
(D)
.
Pith is small/inconspicuous (IV) Dicot stem
(A) (B) (C) (D) (A) (B) (C) (D)
.
1) II I IV III 2) II IV III I
3) IV III II I 4) III II IV I
116. How many genes are produced, if 10 genes are subjected to 3 PCR cycles?
(1) 40 (2) 80 (3) 160 (4) 320
117. Nitrogen fixer in paddy fields is:
(1) Rhizobium (2) Frankia (3) Glomus (4) Anabaena
118. Assertion (A): Alien DNA and Vector DNA having sticky ends are widely used in
rDNA technology.
Reason (R): This stickiness of DNA ends facilitates the action of DNA ligase.
(1) (A) is true and (R) is false.
(2) (A) and (R) are true and (R) is the correct explanation of (A).
(3) Both (A) and (R) are false.
(4) (A) and (R) are true and (R) is not the correct explanation of (A).
119. In prokaryotes, ribosomes are associated with:
(1) Plasma membrane (2) Cytoplasm
(3) mRNA (4) All of these
120. The ovary is half-inferior in the flowers of:
(1) Ray florets of sunflower (2) Brinjal
(3) Rose (4) China rose
121. S- I:Cyt- C is a mobile electron carrier attached to the outer side of inner
membrane of mitochondria.
S- II: Succinate Dehydrogenase involves in both Krebs cycle and ETS in
mitochondria.
(1) S- I is true & S- II is false (2) S- I is false & S- II is true
(3) Both S-I & S-II are true (4) Both S- I & S- II are false
122. The cell walls fit together like a soap box in ------:
(1) Diatoms (2) Dinoflagellates (3) Slime moulds (4) Euglenoids
123. Identify the correct statement of the following:
(1) Pyrenoids contain starch only.
(2) Floridian starch is similar to inulin and cellulose in structure.
(3) Red algae reproduce by non-motile spores and gametes.
(4) Agar is isolated from kelps.
124. To check the progression of restriction enzyme digestion ………. method is
employed:
(1) Agarose gel electrophoresis (2) Polymerase chain reaction
(3) Paper chromatography (4) Cscl- density gradient centrifugation
125. Read the following statements and find the correct one.
1) Protonema develops into dominant stage like sporophyte
2) Prothallus is a primitive sporophyte
3) Zygotic meiosis occurs in first archegoniates
4) Telophase – I chromosomes not similar to interphase chromosome.

(A) Tallest tree (I) Equisetum
(B) Horse tail (II) Pinus
(C) Mycorrhiza (III) Marchantia
.
(D) Gemmae (IV) Sequoia
(A) (B) (C) (D) (A) (B) (C) (D)
1) II I IV III 2) II IV I III
3) III I IV II 4) IV I II III
127. The antibiotic resistance gene gets inactivated due to the insertion of alien DNA
helps in the selection of:
(1) Transformed cells (2) Recombinant cells
(3) Non-transformed cells (4) Non- recombinant cells
128. RQ value will be less than one for:
(1) Oxalic acid (2) Tripalmitin (3) Proteins (4) Both 2 and 3
129. Haploid cells divide by mitosis in:
(1) Animals (2) Some lower plants
(3) Social insects (4) Both 2 and 3
130. Diplotene lasts months or years in………………….:
(1) Oocytes of all mammals (2) Pollen mother cells of plants
(3) Oocytes in some vertebrates (4) Insect salivary glands
131. Assertion (A): Differentiation in plants is open.
Reason (R): Meristems continuously divide and add new cells to the plant body.
(3) (A) is true and (R) is false. (4) Both (A) and (R) are false.
132. In bacteria, DNA replication occurs:
(1) Before binary fission (2) In S- phase
(3) Before S- phase (4) Duringlnterkinesis
133. The Intermediate size starch grains in pea is an example of:
(1) Codominance (2) Complete dominance
(3) Incomplete dominance (4) Polygenic inheritance
134. Which of the following characters belong to gaseous hormone?
A) Delay of senescence B) Sprouting on potato tubers
C) Xylem differentiation D) Ripening of fruits
E) Malting in Barley seeds F) Root hair formation
1) B,D,F 2) A,B,C 3) D,E,F 4) C,D,E
135. The flowers pollinated by --------- release foul odours:
(1) Lizards and Birds (2) Lemurs and Rodents
(3) Flies and Beetles (4) All of these
SECTION – B
136. Removal of introns and joining of exons occur at the level of:
(1) hnRNA (2) rRNA (3) tRNA (4) mRNA
137. Assertion (A): Dominance depends on a product of phenotypic expression.
Reason (R): Morgan experiments in Drosophila were similar to Mendel's one-gene
inheritance.
(3) (A) is true and (R) is false. (4) Both (A) and (R) are false.
(A) RER (I) Packaging and transport
(B) SER (II) Acid hydrolases
(C) Golgi complex (III) Steroid hormones
(D)
.
Lysosomes (IV) 80 S ribosomes
(A) (B) (C) (D) (A) (B) (C) (D)
1) III IV II I 2) IV III I II

139. Gametophytes do not have an independent free-living existence in:
(1) Funaria (2) Pinus (3) selaginella (4) Adiantum
140. Which of the following is an amphoteric molecule?
(1) Lecithin (2) Adenylic acid (3) Starch (4) Alanine
141. Which of the following is an example for competitive enzyme inhibition?
(1) Bacterial pathogens are killed by penicillin.
(2) Action of statins on the key enzyme of cholesterol biosynthesis.
(3) Action of malonic acid on succinate dehydrogenase (SDH).
(4) All of these
142. Amino acids are added one by one and translated into polypeptide chains. This is
represented by:
(1) tRNA (2) mRNA (3) rRNA (4) DNA
(A) Mustard (I) Epicalyx
(B) Hibiscus (II) Polyandrous condition
(C) Tridax (III) Zygomorphic flowers
(D).
Wheat (IV) Persistent pappus like calyx
(A) (B) (C) (D) (A) (B) (C) (D)
.
1) II I IV III 2) II IV III I
3) IV III II I 4) III II IV I
144. Find the ratio between heterozygous round yellow seeds and homozygous round
green seeds formed in F2 generation of dihybrid cross.
1) 1 : 8 2) 2 : 4 3) 5 : 4 4) 8 : 1
145. Observe the following
5 AUC GUA UAU AUG CAG GGG AGC UAA AGC 3
From the above mRNA strand
A) No. of start codons B) No. of stop codons
C) No. of UTR’s D) No. of amino acids coded by the strand
(A) (B) (C) (D) (A) (B) (C) (D)
1) 1 1 4 9 2) 1 1 4 4
3) 2 4 3 1 4) 1 1 3 4
146. S- I: Ori — gene in pBR322 controls DNA copy number.
S- II: rop- gene in pBR 322 controls Ori- gene by rop- protein.
(1) S- I is true & S- II is false (2) S- I is false & S- II is true
(3) Both S-I & S-II are true (4) Both S- I & S- II are false
147. Assertion (A): All living organisms on the earth are connected to one another.
Reason (R): They share the common genetic material to same level (degree).
(1) Both (A) and (R) are right (2) (A) is right but (R) is wrong
(3) Both (A) and (R) are right, (R) correctly explains (A).
(4) Both (A) and (R) are right, (R) does not correctly explains (A).
148. Bacterial flagella can be seen under a microscope at --- magnification:
(1) 1500 X (2) 50, 000 X (3) 1,00, 000 X (4) 1, 50, 000 X
149. The highest degeneracy is shown by ------ aminoacid:
(1) Tryptophan (2) Arginine (3) Methionine (4) Isoleucine
150. Which of the following is / are not applicable to family Asteraceae?
p) C pappus q) Zygomorphic ray floret
r) Basal placentation s) epipetalous stamens in ray floret
t) Fused corolla
1) p,q,r only 2) r,s,t only 3) p,s only 4) q,r,t
ZOOLOGY
SECTION – A
151. Fossils of bones discovered in Java in 1891 revealed the stage ____.
1) Ramapithecus 2) Australopithecines 3) Homohabilis 4) Homo erectus
152. Assertion: Adaptive ability (fitness) is inherited.
Reason: Adaptive ability has a genetic basis.

153. A particular population of trees lives in a place where environment is more arid.
The average surface area of leaves has been decreasing in successive generations.
This is an example of
1) Stabilizing selection 2) Directional selection
3) Diversifying selection 4) Sampling error
154. In a population of 1600 individuals of HardyWeinberg equilibrium, number of
homozogous dominant individuals are 576. Find out, how many are heterozygous
and recessive individuals respectively?
1) 256 and 768 2) 768 and 256 3) 768 and 250 4) 250 and 768
155. When plant diversity is maintained in natural habitat the conservation is known
as:
1) Ex situ 2) In vivo 3) In situ 4) In vitro
156. Statement A : Four hotspots in India are Western ghats and Sri Lanka, Indo-
Burma and Himalaya.
Statement B : India has 14 biosphere reserves, 90 national parks and 484
wildlife sanctuaries.
157. The plant and animal species will become extinct when their associated species
disappears. It is a phenomenon called :
1) Co-evolution 2) Co-existence
3) Co-extinction 4) Co-operative mechanism
158. Head of cockroach is formed by fusion of how many segments?
1) Four 2) Five 3) Six 4) Eight
159. Which one is correct about cockroach?
1) Generally black colour only 2) Pest and vectors of several disease
3) Found in dry places 4) All of these
160. Which of the following is false?
1) Fertilisation is external (in water) in frog
2) In frog, development involves larval stage called tadpole
3) Tadpole undergo metamorphosis to form the adult
4) Development in frog is direct
161. Recepor sits for neurotrons mitters are present on
1) Pre-synaptic membrane 2) Tips of axons
3) post-synaptic membrane 4) Membranes of synaptic vesicles
162. Which of the following is not a part of hind brain?
1) Medulla oblongata 2) Thalomus
3) Cerebellum 4) Pons
163. What adaptation desert ligand shows to deal with high temperature?
1) Bask in sun when body temperature drop
2) Move in shade when body temperatures drop
3) Bask in sun when ambient temperature drops
4) Move in shade when ambient, temperure drop
164. Symptoms of high altitude sickness
1) Nausea 2) Heart palpitation 3) Fatigue 4) All of these
A) Our lungs remove large amounts of CO2
B) Liver secretes biliverdin
C) Sweat containing small amounts of urea & pyruvic acid
D) Sebaceous glands eliminate waxes through sebum
Choose the options.
1) A & B are false 2) A, B & D are true
3) B, C & D are true 4) A, C & D are false
166. Select the animal who have the ability to produce a concentrated urine.
1) Pavao 2) Vipera 3) Exocoetus 4) Camelus

167. Observe the figure given below.
Which one is incorrectly labelled?

1) A 2) B 3) C 4) D
168. Which of the following is negative wave obtained in ECG?
1) P wave 2) T wave 3) R wave 4) Q wave
169. The deposition of lipids on the wall lining the lumen of large and medium sized
arteries is referred to as
1) osteoporosis 2) osteroarthritis 3) atherosclerosis 4) deep vein thrombosis
170. Maximum pressure of blood is experienced
1) When blood enters from left atrium to aorta
2) when blood enters from right atrium to aorta
3) when blood enters from left ventricle to aorta
4) when blood enters from right ventricle to aorta
171. Allergy is due to the release of chemicals like histamine and seretonin from the
______ cells
1) B-lymphocytes 2) Erythrocytes 3) Mast 4) Natural killer
172. The principal of immunization or vaccination is based on the property of memory
of the ____
1) Nervous system 2) Immune system
3) Endocrine system 4) Circulatory system
173. The more and more children in metro cities of India suffer from allergies and
asthma due sensitivity to the environment . The reason could be
1) Cell mediated immune response.
2) Failure to differentiate between self and non - self antigens
3) Due to protected environment provided early in life 4) Both 1) and 2)
174. Cannabinoids are abused by _____ and ________
1) Inhalation and oral ingestion 2) Snorting and injection
3) Injection and oral ingestion 4) Inhalation and intravenous route
175. Statement –I : Parturition is a neuroendocrine mechanism involving cortisol,
oestrogen and oxytocin.
Statement –II : Colostrum contains several antigens essential to develop
resistance for the new born babies.
176. Study the following figure and identify A, B and c correctly
A
Interstitial
Secrete
B s
Helps
C i
1) A-FSH, B-Androgens, C-Spermatogenesis
2) A-LH, B-GH, C-Spermatogenesis
3) A-FSH, B-Androgens, C-Spermiation
4) A-LH, B-Androgens, C-Spermatogenesis
177. The number of bases present in the largest human gene dystrophin are
1) 2.4 billion 2) 3.4 million 3) 2.4 million 4) 2.4 109

178. Which one of the following features of different animals is correctly expressed
with no single exception in it?
1) All sea walnuts are marine and perform sexual reproduction only
2) All mammals have mammary glands and all over oviparous
3) All reptiles are poikilotherms and have three-chambered heart
4) All of these
179. Which of the following are correctly matched with respect to their taxonomic
classification?
1) Sea cucumber, sea urchin, sea hare-Echinodermata
2) Flyging fish, dog fish, devil fish - Pisces
3) Sea pen, sea fan, Sea anemone – Cnidaria
4) Platypus, Whale, Alligator – Mammalia
180. Which of the following represents correct match of feature with the given set of
animals?
Feature Animals
1) Metameric segmentation Earthworm, Leech, Liver fluke
2) True coelom Cockroach, tapeworm, starfish
3) Bilateral symmetry Hydra, tapeworm, sea urchin
4) Jointed appendages Prawn, scorpion, Grass hopper
181. Receptors of Thyroxine and Testosterone are;
1) Membrane bound 2) Inter-cellular 3) Intracellular 4) All of these
182. Statement – I: Ovaries perform as primary sex organ as well as endocrine gland
Statement – II: Leydigcells are situated in stromal / interstitial tissue
183. Statement-I: Repetitive DNA does not code for any protein.
Statement-II : Repetitive DNA shows high degree of polymorphism and are used
in DNA fingerprinting process.
184. In a pedigree of a family given below, the trait denoted is autosomal dominant.
What will be the genotype of mother and father?
1) Father is AA and mother is aa 2) Father is Aa and mother is Aa

3) Mother is aa and father is Aa 4) None of the above
185. Assertion: In Sickle cell anaemia, the shape of the RBC changes from biconcave
disc to elongated sickle like structure.
Reason: The mutant haemoglobin molecule undergoes polymerisation under high
oxygen tension
assertion.
SECTION – B
186. Pick out the correct statements :
(a) Grasshopper is an example of ZO type of sex determination in which the male
have a pair of Z-chromosome besides the autosome
(b) Human male produce two different types of gametes some gametes with X-
chromosome and some with Y-chromosome
(c) Female heterogamety occurs in birds.
(d) In Grasshopper, females have only one X-chromosome besides the autosomes.
1) a, b and c 2) a, b, c and d 3) Only b, c 4) Only a and d
187. Absence of one sex chromosome causes
1) Turner’s Syndrome 2) Klinefelter’s syndrome
3) Down’s syndrome 4) Sickle cell anemia

188. At each successive trophic level from producers onwards, the number and size of
organisms respectively
1) Increases, Decreases 2) Decreases, Increases
3) Increases, remains constant 4) Decreases, remains constant
189. The tropic level in ecosystem is formed by
1) an individual Organism linked in food chain
2) Different Organisms linked in food chain
3) Saprophytes linked with dead organic matter
4) More than one options is correct
190. In a pyramid of number in a grassland ecosystem, the largest population is that
of
1) Producers 2) Tertiary consumers
3) Secondary consumers 4) Primary consumers
191. Government of India legalized MTP in the year
1) 1988 2) 1978 3) 1985 4) 1971
192. Among the given options, which set represents sexually transmitted infections
(STI) only?
1) Gonorrhoea, Chlamydiasis, Trichomoniasis
2) Syphilis, Giardiasis, Genital warts
3) Taeniasis Genital herpes, Leishmaniasis
4) Hepatitis B, Trichinosis, Gonorrhoea
193. Reproduction cannot be an all-inclusive defining characteristic of living
organisms because
1) All living organisms do not show growth 2) Many organisms do not reproduce
3) Non-living things show reproduction
4) All living organisms show small period of reproductive phase in their life.
194. At which thoracic vertebrae does trachea divide into right and left primary
bronchi?
1) 5 2) 6 3) 9 4) 4
195. Partial pressure of oxygen in alveolar air is
1) 45 mmHg 2) 95 mmHg 3) 104 mmHg 4) 110 mmHg
196. Statement I: Intrapulmonary pressure remains less than the atmospheric
pressure
Statement II: There is a negative pressure in the lungs than the atmospheric
pressure
In which of the above two situations inspiration takes place?
Choose the correct option accordingly?
1) Only I 2) Only II 3) Both I & II 4) None of the above
197. Given below are two statements,
Statement I: Each vertebra has a central hollow portion (spinal cord) through
which neural canal passes.
Statement II: The skull region articulates with the superior region of vertebral
column with the help of single occipital condyles.
given below:
198. Which of the following is not the function of vertebral column?
1) Supports the head 2) Protects the spinal cord
3) Protects heart and lungs 4) Serve as the point of attachment for the ribs
199. Which is the correct match?
1) Cry I Ab-Cotton bollworms 2) Cry I Ac-Cotton bollworms
3) Cry I Ac-Corn borer 4) Cry II Ab-Corn borer
200. The cry II Ab and cry I Ab produce toxins that control
1) Cotton bollworms and corn borers respectively
2) Corn borers and cotton bollworms respectively
3) Tobacco budworms and nematodes respectively
4) Nematodes and tobacco budworms respectively
*******

: ANSWER KEY:
SET-2
SUB: PHYSICS
1 3 11 4 21 4 31 3 41 4
2 2 12 1 22 2 32 1 42 1
3 3 13 3 23 4 33 4 43 1
4 3 14 2 24 4 34 3 44 2
5 1 15 1 25 2 35 1 45 4
6 3 16 4 26 4 36 3 46 1
7 1 17 2 27 3 37 3 47 3
8 3 18 1 28 2 38 2 48 4
9 4 19 3 29 3 39 4 49 1
10 2 20 1 30 4 40 1 50 4
SUB:CHEMISTRY
51 2 61 2 71 2 81 1 91 1
52 2 62 3 72 1 82 4 92 4
53 2 63 3 73 2 83 1 93 3
54 3 64 4 74 2 84 4 94 1
55 4 65 3 75 2 85 1 95 2
56 2 66 4 76 1 86 1 96 3
57 2 67 3 77 4 87 2 97 2
58 1 68 2 78 4 88 3 98 3
59 3 69 2 79 4 89 2 99 2
60 4 70 4 80 1 90 1 100 2
SUB : BOTANY
101 4 111 2 121 3 131 1 141 4
102 3 112 4 122 1 132 1 142 2
103 3 113 4 123 3 133 3 143 1
104 2 114 2 124 1 134 1 144 4
105 2 115 3 125 4 135 3 145 2
106 4 116 2 126 4 136 1 146 3
107 4 117 4 127 2 137 3 147 2
108 1 118 2 128 4 138 2 148 2
109 4 119 4 129 4 139 2 149 2
110 4 120 3 130 3 140 4 150 3
151 4 161 3 171 3 181 3 191 4
152 1 162 2 172 2 182 1 192 1
153 2 163 1 173 3 183 1 193 2
154 2 164 4 174 1 184 3 194 1
155 3 165 2 175 2 185 3 195 3
156 2 166 4 176 4 186 3 196 3
157 3 167 3 177 3 187 1 197 1
158 3 168 4 178 1 188 2 198 3
159 2 169 3 179 3 189 2 199 2
160 4 170 3 180 4 190 1 200 1

answer sheet.
CORRECT.
Section-B;
Marking Scheme :

PHYSICS
SECTION – A
1.
SECTION – B
36.

CHEMISTRY
SECTION – A
51. The amount of CaCl2 (MW = 111 g/mol) required to prepare 2.5 lit of aqueous
solution showing an osmotic pressure of 0.8 atm at 27o C is _____g.
[Given : for CaCl2, i = 2.45]
1) 7.452 2) 3.6789 3) 2.2248 4) 12.6485
52. 30g of glucose is dissolved in 450g of water at 293K. The vapour pressure of
water at 293K is 17.535mm Hg. Then the vapour pressure of resulting solution
is _____ mmHg.
1) 15.235 2) 19.056 3) 16.955 4) 17.41
53. Which of the following statement s is correct ?
1) Two solid organic substances are said to be different if their mixed melting
point is depressed below the melting points of both of these
2) Ethanol and water cannot be separated from each other completely by simple
distillation as they form azeotrpic mixture.
3) Impure glycerine can be purified by vaccume distillation
4) All of these
54. Which of the following is correct w.r.t. First (I) and second (II) ionisation
enthalpies of Na and Mg?
1) IINa < IIMg 2) INa > IMg 3) IMg > IINa 4) IINa > IIMg
55. Electronic configuration of some elements is given in Column-I and their electron
gain enthalpies are given in Column-II. Match the electronic configuration with
electron gain enthalpy.
Column-I Column-II
(Electronic configuration) (Electron gain enthalpy/ kJ mol1 )
1) 1s 2 2s 2 2 p6 (i) -53
2) 1s 2 2s 2 2 p6 3s1 (ii) -328
3) 1s 2 2s 2 2 p5 (iii) -141
4) 1s 2 2s 2 2 p 4 (iv) +48
56. IUPAC name of the following is
1) 4 – bromo – 2 – phenyl pent – 2 - ene

2) 2 – bromo – 4 – phenyl pent – 2 – ene
3) 3 – bromo – 2 – phenyl pent – 4 – ene
4) 2 – Bromo – 4 – phenyl pent – 3 – ene
57. What are the total number of orbitals and electrons for m = 0, if there are 30
protons in an atom
1) 6 orbitals, 12 electrons 2) 5 orbitals, 10 electrons
3) 7 orbitals, 14 electrons 4) 4 orbitals, 8 electrons
58. The radial probability distribution curve obtained for an orbital wave function has
3 peaks and 2 radial nodes. The valence electron of which one of the following
metals does this wave function correspond to?
1) Cu 2) Li 3) K 4) Na
59. While assigning R, S configuration the correct order of priority of groups attached
to chiral carbon atom is
1) CONH2 > COCH3 > CH2OH > CHO 2) CONH2 > COCH3 > CHO > CH2OH
3) COCH3 > CONH2 > CHO > CH2OH 4) CHO > CH2OH > COCH3 > CONH2
60. Which compound will not give positive chromyl chloride test?
1) Copper chloride CuCl2 2) Mercuric chloride, HgCl2
3) Zinc chloride, ZnCl2 4) Anilinium chloride, C6 H 5 NH 3 Cl 
61. Al 3 , Fe3 & Cr 3 are grouped together for qualitative analysis because their
1) carbonates are insoluble in NH3 2) hydroxides are insoluble in NH3
3) sulphides are soluble in acid 4) sulphides are insoluble in aicd

62. Which of the following situation exists at the equivalence point of a titration?
 
  
  H  
 
 7
1)  H   10 M 2)  H   O H 
 7
3) O H   10 M 4)   10 14
     
O H 
63. Consider the following iodides : PI3 AsI3 SbI3
102° 100.2° 99°
The bond angle is maximum in Pl3, which is :
1) due to small size of phosphorus 2) due to more bp–bp repulsion in PI3
3) due to less electronegativity of P 4) none of these
 
64. Bond angle H – N – H in NH3, NH4 and NH2 decreases in the order as :
1) NH2 > NH3 > NH4 2) NH4 > NH3 > NH2
3) NH3 > NH2 > NH4 4) NH3 > NH4 > NH2
65. The following molecules/species have been arranged in the order of their
increasing bond orders Identify the correct order.
(I) O2 ; (II) O2– ; (III) O22- ; (IV) O2+
1) III < II < I < IV 2) IV < III < II II>III>IV 2) I>II>IV>III 3) III>IV>I>II 4) I>IV>II>III
67. Which of the following carbocation will undergo favourable rearrangement?
+ + +
1) 2) 3)
68. The catenation tendency of C, Si, Ge is in the order Ge<Si<C. The bond energies
(in kJ/mole) of C – C, Si – Si, Ge – Ge bonds respectively are ____
1) 167, 180, 348 2) 180, 167, 348 3) 348, 167, 180 4) 348, 180, 167
69. Correct increasing order of basic strength of hydrides.
1) BiH3 < SbH3 < AsH3 < PH3 < NH3 2) BiH3 > NH3 > PH3 > SbH3 > AsH3
3) SbH3 < AsH3 < PH3 < NH3 < BiH3 4) AsH3 > NH3 > PH3 > SbH3 > BiH3
70. In the given reaction the product P is ( Ans Key – 3 )
71. The correct statement regarding the comparison of staggered and eclipsed
conformations of ethane is
1) The staggered conformation of ethane is more stable than eclipsed
conformation, because staggered conformation has no torsional strain
2) The staggered conformation of ethane is less stable than eclipsed conformation,
because staggered conformation has torsional strain
3) The eclipsed conformation of ethane is more stable than staggered
conformation, because eclipsed conformation has no torsional strain
4) The eclipsed conformation of ethane is more stable than staggered conformation
even though the eclipsed conformation has torsional strain
72. Assertion (A) : Addition of Br2 in trans-but-2-end in the presence of CCl4 gives
meso form.
Reason (R) : The reaction occurs through anti addition .
the Assertion
of the Assertion

73. X and Y are two elements which form X2 Y3 and X3Y4. If 0.20 mol of X2Y3 weighs
32.0 g and 0.4 mol of X3Y4 weighs 92.8 g, the atomic weights of X and Y are
respectively
(1) 16.0 and 56.0 (2) 8.0 and 28.0
(3) 56.0 and 16.0 (4) 28.0 and 8.0
74. In the reaction: Na2S2O3 + 4Cl2 + 5H2O  Na2SO4 + H2SO4 + 8HCl,
the equivalent weight of Na2 S2 O3 will be : (M = molecular weight of Na2S2O3)
(1) M/4 (2) M/8 (3) M/1 (4) M/2
(A) Mol.w.t (I) When Crl3 oxidies into Cr2O72 and IO4
Equivalent w.t =
33
(B) Mol.w.t (II) When Fe(SCN)2 oxidies in to Fe+3,
Equivalent w.t=
27 SO42 , CO32 and NO3
(C) Mol.w.t (III) When NH4SCN oxidies into SO42 , CO32 , NO3
Equivalent w.t=
28
(D) Mol.w.t (IV) When As2S3 oxidies into AsO3 and SO42
Equivalent w.t=
.
24
.
(A) (B) (C) (D) (A) (B) (C) (D)

1) IV I III II 2) I IV II III
3) II I IV III 4) III IV I II
76. Consider the following SN 2 reactions.
I. RX  Y  
 R Y  X  II. RX  Y  
 R Y   X 
III. RX   Y  
 R Y  X IV. RX   Y   R Y   X
In which reactions there is large increase and large decrease in rate of reaction
respectively with increase in polarity of the solvent?
1) II and III 2) II and IV 3) I and IV 4) IV and I
77. The fire extinguisher ‘pyrene’ contains
1) carbon dioxide 2) carbon disulphide
3) carbon tetrachloride 4) chloroform
78. Which of the following noble gases has the highest positive electron gain enthalpy
value?
1) Helium 2) Krypton 3) Argon 4) Neon
79. Standard electrode potentials of iodine depends on
I) Bond dissociation energy II) Electron gain enthalpy
III) Hydration enthalpy IV) Sublimation enthalpy
1) I, II only 2) I, II, III only 3) I, III only 4) I, II, III & IV
80. For the reaction, 2HI  g   H 2  g   I 2  g  , activation energy is 209.5KJ/mol at
581K. Then the fraction of the molecules having energy greater than or equal to
activation energy is ______
1) 1.462  1019 2) 2.465  1019 3) 1.462  1017 4) 2.465  1017
81. The rate of which of the following reaction increases with increase in
temperature?
1) Endothermic 2) Exothermic 3) Both 4) Neither endo nor exo
82. Match column I and column II and choose the correct combination from the given
options.
Column-I Column-II
1) Anhydrous ZnCl2 + conc.HCl p) Ethyl alcohol
2) Phenol q) Invertase
3) Fermentation r) Tertiary alcohol
4) Dynamite s) Lucus reagent
5) Enzyme t) Reimer-Tie-mann reaction
6) Lucus test u) Nitro glycerine
1) 1-(s), 2-(t), 3-(p), 4-(u), 5-(q), 6-(r) 2) 1-(r), 2-(u), 3-(q), 4-(t), 5-(p), 6-(s)
3) 1-(t), 2-(s), 3-(q), 4-(r), 5-(p), 6-(u) 4) 1-(p), 2-(q), 3-(s), 4-(r), 5-(t), 6-(u)

83. An organic compound X on treatment with pyridinium chloro chromate in CH2Cl2
gives compound Y. Compound Y reacts with I2/NaOH to form iodoform. The
compound X is
O
1) CH3CH2OH 2) CH3CHO 3) 4) H3C – COOH
H 3C  C  CH3
84. If enthalpy of neutralization of HCl by NaOH is – 57 kJ mol-1. When NH4OH
completely neutralizes by HCl energy released is 50 kJ mol-1. Calculate
NH4OH(aq)
ionization enthalpy
1) 7 kJ mol-1 2) 107 kJ mol-1 3) -107 kJ mol-1 4) -7 kJ mol-1
85. Lattice energy of NaCl(s) is – 790 kJ mol-1 and enthalpy of hydration is – 785 kJ
mol-1. Calculate enthalpy of solution of NaCl(s).
1) 1575 kJ mol-1 2) - 5 kJ mol-1 3) 5 kJ mol-1 4) - 1575 kJ mol-1
SECTION – B
86. Read the following statemetns.
(I) Chemistry of actinoids is complex in comparision to chemisty of lanthanoids
(II) Ce4+ is very good reducinig agent
(III) Eu2+ is a strog reducing agent
(IV) Out of all lanthanides Ce, Pr, Nd, Dy and Ho shows +4 oxidation state.
Which of the following is the correct code for the statements above?
1) TTFF 2) TFTF 3) FTFT 4) FTTF
(A) Metal of the 3d-series which (P) Manganese
does not form MO type
oxides
(B) Metal of the 3d-series which (Q) Vanadium
forms most covalent
oxide
(C) Metal of the 3d-series which (R) Scandium
forms the amphoteric
.
oxide
.
(A) (B) (C) (A) (B) (C)

1) P R Q 2) R P Q
3) R Q P 4) Q P R
Column-I Column-II
(Conversion) (Conversion can by done by)
A) O (p) H2/Pd/BaSO4
C – CH3 CH2 – CH3
B) CH3CH2COCl 
CH3CH2CHO (q) LiAlH4
C) R  C  N  R  CH 2 NH 2 (r) Wolf-Kishner reduction
D) CH3CH2CH2OH 
CH3CH2CHO (s) Clemmensen reduction
(t) PCC
1) (A)t,q; (B)p; (C)r; (D)s 2) (A)p; (B)q; (C)r; (D)s,t
3) (A)r,s; (B)p; (C)q; (D)t 4) (A)r,s; (B)t; (C)p; (D)q
89. In the reaction sequence, (X) is ketone :
CH 3
 X    HOOC   CH 2 3  CH  COOH ;  X  ;


KMnO / H / 
4
is
1) 2) 3) 4)

90. In case of high spin complex
1)  0  P 2)  0  P 3)  0  P 4)  0 .P  1
91. How many optical isomers are possible for [MABCD], where M is dsp2 hybridized?
1) 1 2) 2 3) 3 4) Zero
92. Which of the following will show optical activity?
1) cis- [Co(NH3)2(en)2]3+ 2) Trans –[Co(NH3)2(en)2]3+
3) [Co(NH3)6] 3+ 4) Trans-[Co(H2O)4Cl2]+
93. For the hypothetical reactions, the equilibrium constant (K) values are given
 B; K1  2.0; B  
A    C ; K 2  4.0; C  
 D; K3  3.0 , The equilibrium constant for
the reaction A    D is
1) 48 2) 6 3) 24 4) 12
94. The equilibrium constant for this reaction is approximately 10-3
HPO42aq   HCO3 aq     2
 H 2 PO4 aq   CO3 aq 
Which is the strongest conjugate base in this reaction?
1) HPO42aq . 2) HPO3 aq . 3) H 2 PO4 aq. 4) CO32aq .
95. What is the decreasing order of strength of the bases OH  , NH 2 , H  C  C  and
CH 3CH 2 ?
1) CH 3CH 2  NH 2  H  C  C   OH  2) H  C  C   CH 3  CH 2  NH 2  OH 
3) NH 2  H  C  C   OH   CH 3CH 2 4) NH 2  H  C  C   OH   CH 3CH 2
96. Aliphatic amines are.....basic than NH3 but aromatic amines are......basic than
NH3.
1) more, less 2) less, more 3) both (1) and (2) 4) None of these
97. In the chemical reactions :
the compounds A and B respectively are :

1) benzene diazonium chloride and benzonitrile
2) nitrobenzene and chlorobenzene
3) phenol and bromobenzene
4) fluorobenzene and phenol
98. Assertion(A) : Increase in the concentration of copper half cell in Daniel cell
increases the emf of the cell.
Reason (R(: According to Nernst equation.
0.059 Cu  
Ecell  Ecell 
o
log
2  Zn 
1) A and R are correct R is the correct explanation of A
2) A and R are correct R is not the correct explanation of A
3) A is correct, but R is wrong
4) A is wrong, but R is correct
99. I 2  s  | I   0.1M  half cell is connected to a H   aq  | H 2 1bar  | Pt half cell and e.m.f is
found to be 0.77 V. If EIo / I   0.53 V , find the pH of H  / H 2 half cell
2
 2.303 RT 
 Given :  0.06 
 F 
1) 1 2) 3 3) 5 4) 7
100. If the sequence of bases in one strand of DNA is CTGTCAGTA then the sequence
of bases in its complementary strand is
1) G U A U T G A U G 2) G A C A G T C A T
3) G U C C U G U T C 4) T A A C G C U A C


51 61 71 81 91
52 62 72 82 92
53 63 73 83 93
54 64 74 84 94
55 65 75 85 95
56 66 76 86 96
57 67 77 87 97
58 68 78 88 98
59 69 79 89 99
60 70 80 90 100

BOTANY
SECTION – A
101.
SECTION – B
136.
ZOOLOGY
SECTION – A
151.
SECTION – B
186.
*******

: ANSWER KEY:
SET-2 SUB: PHYSICS
1 11 21 31 41
2 12 22 32 42
3 13 23 33 43
4 14 24 34 44
5 15 25 35 45
6 16 26 36 46
7 17 27 37 47
8 18 28 38 48
9 19 29 39 49
10 20 30 40 50
SUB:CHEMISTRY
51 61 71 81 91
52 62 72 82 92
53 63 73 83 93
54 64 74 84 94
55 65 75 85 95
56 66 76 86 96
57 67 77 87 97
58 68 78 88 98
59 69 79 89 99
60 70 80 90 100
SUB : BOTANY
101 111 121 131 141
102 112 122 132 142
103 113 123 133 143
104 114 124 134 144
105 115 125 135 145
106 116 126 136 146
107 117 127 137 147
108 118 128 138 148
109 119 129 139 149
110 120 130 140 150
151 161 171 181 191
152 162 172 182 192
153 163 173 183 193
154 164 174 184 194
155 165 175 185 195
156 166 176 186 196
157 167 177 187 197
158 168 178 188 198
159 169 179 189 199
160 170 180 190 200

VELAMMAL BODHI CAMPUS
answer sheet.
CORRECT.
Section-B;
Marking Scheme :

GT - 11(SET-2) XII, LT & CC-NEET MODEL-02.05.2024
PHYSICS
SECTION – A
1. What is reading of vernier calipers as shown in figure below?
1) 1.15 cm 2) 1.155 cm 3) 1.15 mm 4) 1.55 mm

2. K.E. of an orbiting satellite is K. The minimum additional K.E. required so that it
goes to infinity is
1) K 2) 2K 3) 3K 4) K/2
3. A man drops a ball downside from the roof of a tower of height 400m. At then the
same time another ball is thrown upwards with velocity of 50 meter/sec from the
base of the tower, then at which height from the base of the tower they will meet
1) 100m 2) 320m 3) 80m 4) 240m
4. A football player is moving southward and suddenly turns eastward with the
same speed to avoid an opponent. The force that acts on the player while turning
is
1) Along NE 2) Along SW 3) Along East 4) Along North
5. A force F(x) is conservative, if
I. it can be derived from a scalar quantity potential energy U(x).
II. it depends only on the end points.
III. work done by F(x) in a closed path is zero.
Which of the following option is correct?
1) Only I 2) I and III 3) Only II 4) I, II and III
6. In elastic collision,
I. initial kinetic energy is equal to the final kinetic energy.
II. kinetic energy during the collision time t is constant.
III. total momentum is conserved.
Which of the above statements is/are correct?
1) Only I 2) I and III 3) Only III 4) Only II
7. When a body in SHM match the statements in column I with that in column II.
Column-I Column-II
a) Velocity is maximum (e) At half of the amplitude
b) K.E. is 3/4th of total energy (f) At the mean position
c) P.E. is 3/4 of total energy
th (g) At extreme position
d) Acceleration is maximum (h) 3
At times amplitude
2
1) a-f, b-e, c-h, d-g 2) a-e, b-f, c-g, d-h
3) a-g, b-c, c-e, d-f 4) a-h, b-e, c-f, d-e
8. A block of ice of mass 50 kg is sliding on a horizontal plane. It starts with speed
5 ms-1 and stops after moving through some distance. The mass of ice that has
melted due to friction between the block and the surface is ( Assuming that no
energy is lost and latent heat of fusion of ice is 80 calg-1, J = 4.2 J cal-1 )
1) 2.86 g 2) 3.86 g 3) 0.86 g 4) 1.86 g
9. The weight of a person is 60 kg. If he gets 10 calories heat through food and the
5
efficiency of his body is 28%, then upto how much height he can climb
(approximately)
1) 100 m 2) 200 m 3) 400 m 4) 1000 m
10. Moon has no atmosphere because
1) The r.m.s. velocity of all gases is more than the escape velocity from moon’s
surface
2) Its surface is not smooth
3) It is quite far away from the earth
4) It does not have population and plants

11. At a given temperature if Vrmsis the root mean square velocity of the molecules of
 Cp 
a gas, VS is the velocity of sound in it, then these are related as    
 Cv 
3  3
1) Vrms  VS 2) Vrms   VS 3) Vrms   VS
4) Vrms     VS
 3  
12. Calcualte the force F needed to punch a 1.46 cm diameter hole in a steel plate
1.27cm thick figure. The ultimate shear strength of steel is 345 MN/m2.
1) 100 kN 2) 200 kN 3) 400 kN 4) 800 kN

13. Find the depth of a lake at which the density of water is 1% greater than at the
surface, if compressibility of water is 50  106 / atm [take g = 10 m/s 2 and
1atm = 105 N/m 2 ]
1) 1 km 2) 2 km 3) 4 km 4) 20 km
14. Radius of a capillary is 0.2cm. A liquid of weight 6.2 N may remain in equilibrium
in the capillary. Then the surface tension of liquid will be  C  00  :
3 2
1) 5  10 N / m 2) 5  10 N / m 3) 50 N / m 4) 500 N / m
15. As shown in the figure find the moment of inertia about x x’
axis of a system (in the plane) of two rods of mass m each
and length l each placed perpendicular to each other.
ml 2 ml 2
1) 2)
6 2
ml 2
ml 2
3) 4)
12 6 2

16. The position of a particle is given by : r  iˆ  2 ˆj  kˆ 
and momentum 

 
P  3iˆ  4 ˆj  2kˆ . The angular momentum is perpendicular to :
1) X-axis 2) Y-axis 3) Z-axis
4) Line at equal angles to all the three axes
17. The maximum magnification that can be obtained with convex lens of focal length
2.5 cm is (the least distance of distanct vision is 25 cm)
1) 10 2) 0.1 3) 62.5 4) 11
18. A compound microscope is of magnifying power 100. The magnifying power of its
eyepiece is 4. Find the magnification of its objective.
1) 25 2) 20 3) 15 4) 30
19. Resolving power of a microscope can be increased by using
1) Red light 2) Blue light
3) Oil between objective lens and object 4) Both (2) & (3)
20. Monochromatic light of wavelength  in air is refracted into a glass slab of
refractive index . The wavelength of light in glass is
 
1)  2)  3) 4)
 2
21. The intensity of the electric field required to keep a water drop of radius 10-5cm
just suspended in air when charged with one electron is approximately.
1) 260 volt/cm 2)260 newton/coulomb
3) 130 volt/cm 4)130 newton/coulomb
22. Assertion (A) :If a proton and an electron are placed in the same uniform electric
field. They experience different acceleration.
Reason (R): Electric force on a test charge is independent of its mass.

23. The equivalent capacity between the points A and B in the adjoining circuit will
be
1) C 2) 2C 3) 3C 4) 4C
24. Binding energy per nucleon verses mass number curve for nuclei is shown in the
fig. W,X,Y and Z are four nuclei indicated on the curve. The process that would
release energy is
1) Y  2 Z 2) W  X  Z 3) W  2Y 4) X  Y  Z
25. In the figure, the force on the wier ABC in the given uniform magnetic field will be
(B = 2 tesla).
1) 4(3 + 2)N 2) 20N 3) 30N 4) 40N

26. The force exerted by the conductor AB on the loop CDFG shown in figure is
1) 8 104 N attraction 2) 7.2 104 N attraction

3) 7.2 104 N repulsion 4) 4 104 N repulsion
27. Light wave travelling in air along x-direction is given by
E y  540sin   10  x  ct Vm . Then, the peak value of magnetic field of wave
4 1
1
will be (Given c  3  10 ms )
8
7 7 8 8
1)18  10 T 2) 54  10 T 3) 54  10 T 4) 18  10 T
28. The maximum velocity of electrons emitted from a metal surface is V. When
frequency of light falling on it is f. The maximum velocity when frequency
becomes 4f is
1) 2 V 2) > 2 V 3) < 2 V 4) Between 2 V and 4 V
29. Binding energy of a nucleus is
1) Total kinetic energy given to its nucleus during its formation
2) Total mass of nucleus converted to energy units
3) Loss of energy from the nucleus during its formation
4) Total K.E. and P.E. of the nucleons in the nucleus

30. In a p-n junction photocell, the value of the photo-electromotive force produced
by monochromatic light is proportional to
1) the voltage applied at the p-n junction 2) the barrier voltage at the p-n junction
3) the intensity of the light falling on the cell
4) the frequency of the light falling on the cell
31. If a full wave rectifier circuit is operating from 50 Hz mains, the fundamental
frequency in the ripple will be
1) 100 Hz 2) 25 Hz 3) 50 Hz 4) 70.7 Hz
32. A person throws balls into air vertically upward in regular intervals of time of one
second. The next ball is thrown when the velocity of the ball thrown earlier
becomes zero. The height to which the balls rise is (Assume, g  10ms 2 )
1) 5m 2) 50m 3) 7.5m 4) 20m
33. Three blocks witih masses m, 2m and 3m are connected by strigns, as shown in
the figure. After an upward force F is applied on block m, the masses move
upward at constant speed v. What is the net force on the block of mass 2m? (g is
the acceleration due to gravity).
1) Zero 2) 2mg 3) 3mg

 4) 6mg 
34. The energy density associated with electric field E and magnetic field B of an
electromagnetic wave in free space is given by (0 -permittivity of free space, 0 -
permeability of free space)
E2 B2 E2 0 B 2
1) U E  ,U B  2) U E  ,U B 
2 0 2 0 2 0 2
0 E 2 0 B 2 0 E 2 B2
3) U E  ,U B  4) U E  ,U B 
2 2 2 2 0
35. A bimetallic strip is made of aluminium and steel  Al   steel  on heating, the strip
will
1) remains straight 2) get twisted
3) will bend with alumiiuim on concave side
4) will bend with steel on concave side
SECTION – B
36. A gas is allowed to expand isothermally. The root mean square velocity of the
molcuels
1) Will increase 2) Will decrease
3) Will remain unchanged 4) Depends on the other factors
37. On dipping a capillary of radius ‘r’ in water, water rises upto a height H and
potential energy of water is u1 . If a capillary of radius 3r is dipped in water, then
u1
the potential energy is u2 . The ratio is:
u2
1) 2 : 1 2) 1 : 2 3) 4 : 1 4) 1 : 1
38. In column I, the angle   between force acting on a particle and displacement are
given and in column II, the statements related to energy and work done are given.
Match the entries of column I and entries of column II
Column-I Column-II
a)   45 0
(i) KE increase
b)   90 0
(ii) KE decrease
c)   135 0
(iii) Workdone is positive
d)   180 0
(iv) Work is zero
1) a-i,iii b-iv, c-ii, d-ii 2) a-iv b-i,iii c-i,iv d-ii
3) a-ii b-ii,iii c-iv, d-i 4) a-I, ii, b-iv, c-iii, d-i

39. The acceleration due to gravity at the poles is 10ms-2 and equatorial radius is
6400km for the earth. Then the angular velocity of rotation of the earth about its
axis so that the weight of a body at the equator reduces to 75% is
1 1 1 1
1) rads 1 2) rads 1 3) rads 1 4) rads 1
1600 800 400 200
40. A source of sound emits 200W power which is uniformly distributed over a
sphere of 10m radius. What is the loudness of sound on the surface ofasphere.
1) 200 dB 2) 200  dB 3) 120 dB 4) 120  dB
41. A particle of mass m = 3kg moves along a straight line 4 y  3x  2 with constant
speed V = 5m/s. The magnitude of angular momentum of the particle about
origin is :
1) 12 kg m2/s 2) 6.0 kg m2/s 3) 24 kg m2/s 4) 8 kg m2/s
42. Ratio of angular width of principal maximum to the angular width of second
secondary maximum in single slit diffraction is
1) 4 : 1 2) 2 : 1 3) 5 : 1 4) 3 : 1
43. Assertion (A) :Electric lines of force never cross each other.
Reason (R): Electric field at a point superimpose to give one resultant electric
field.
44. In the circuit shown in the figure, each capacitor has a capacity of 3F. The
equivalent capacity between A and B is
1) 3/4F 2) 3F 3) 6F 4) 5F

45. Assertion : A current continues to follow in super-conducitng coil even after
switch is off.
Reason : Superconducting coils show Meissner effect.
3) (A) is true, but (R) is false 4) Both (A) and (R) are false
46. A 2MeV proton is moving perpendicular to a uniform magnetic field of 2.5T the
force on the proton is (mass of proton  1.6  1027 kg )
1) 10 1012 N 2) 8 1011 N 3) 2.5 1010 N 4) 8 1012 N
47. The energy of an electromagnetic wave contained in a small volume oscillates
with
1) Zero frequency 2) Half the frequency of the wave
3) Double the frequency of the wave 4) The frequency of the wave
48. Calculate the number of oscillations of simple pendulum does in 2 minutes if its
time period is 0.5 seconds.
1) 120 2) 240 3) 360 4) 480
49. Assertion:. In photoelectric effect, on increasing the intensity of light, both the
number of electrons emitted and kinetic energy of each of them get increased but
photoelectric current remains unchanged
Reason:The photoelectric current depends only on wavelength of light
1) Both (A) and (R) are true, and (R) is the correct explanation of (A).
2) Both (A) and (R) are true but (R) is not the correct explanation of (A).
3) (A) is true but (R) is false. 4) Both (A) and (R) are false
50. In the arrangement shown in figure, find the potetnail difference at the points A
and B.
1) 14V 2) 4V 3) 6V 4) 8V

CHEMISTRY
SECTION – A
51. Among the following statements,
A) Molarity depends upon temperature while molality is independent of
temperature.
B) Molefraction of solute in a 1 molal aqueous solution is 0.0177.
C) For an ideal solution of two liquids Hmix = 0.
52. A solution is made up of 2 : 3 mole ratio of n-hexane and n-heptane at 200C. The
vapour pressure of these two liquids at 200C are 120mm Hg and 90mm Hg
respectively. Then the mole fraction of hexane in vapour phase is ______
1) 0.53 2) 0.67 3) 0.33 4) 0.47
53. 0.2 g of an organic compound containing C, H and O, on combustion gave 0.147g
CO2 and 0.12 g water. The percentage of oxygen in organic compound is
1) 73.29% 2) 78.45% 3) 83.23% 4) 89.50%
54. Statement –I : The electronegativity of any given element is not constant, it
varies depending on the element to which it is bound.
Statement –II : Electronegativity is a measurable quantity.
statement-I
55. Statement –I : Helium and beryllium have similar outer electronic configuration
of the type ns2.
Statement –II : Both helium and beryllium are chemically inert.
statement-I
56. What is the IUPAC name CH3CH(CH2CH3)CHO ?
1) Butan-2-al 2) 2- methyl butanal
3) 3 – methyl isobutyraldehyde 4) 2 – ethyl propanal
57. The set of quantum numbers ‘n’ and ‘l’ possible for the orbital shown in the radial
probability curve are
1) n = 3; l =2 2) n = 4; l = 1 3) n = 2; l = 0 4) n = 3; l = 3
3h
58. The orbit angular momentum and orbital angular momentum for electron are
2
3 h
and . Then the number of radial nodes and angular nodes for that atomic
2
orbital will be
1) 1,1 2) 0,1 3) 0,2 4) 2,0
59. Which among the given molecules can exhibit tautomerism?
1) Both II and III 2) III only 3) Both I and III 4) Both I and II

60. Nessler’s reagent is used to detect the presence of
1) CrO42 2) PO43 3) MnO4 4) NH 4
61. Which of the following statement is wrong about aniline yellow?
1) it is carcinogenic 2) is also called p-amino azobenzene
3) it is an acidic dye 4) it is also called 4-(phenyl azo) aniline

62. To what state, MnO4 is to be reduced in alkaline medium.
1) +4 2) +1 3) +5 4) +6
63. Which of the following is a wrong order with respect to the property mentioned
against each ?
1) O22– > O2 > O2+ [Paramagnetic moment]
2) (NO)¯ > (NO) > (NO)+ [bond length]
3) H2 > H2+ > He2+ [bond energy]
4) NO2+ > NO2 > NO2¯ [bond angle]
64. The dipole moment of is 1.5 D. The dipole moment of will be –
1) 0 D 2) 1.5 D 3) 2.86 D 4) 2.25 D

65. Predict the correct order of replusions among the following :
1) Ione pair – bond pair > bond pair – bond pair > lone pair – lone pair
2) lone pair – lone pair > lone pair – bond pair > bond pair – bond pair
3) lone pair – lone pair > bond pair – bond pair > lone pair – bond pair
4) bond pair – bond pair > lone pair – bond pair > lone pair – lone pair
 
66. Statement –I : Me  C H 2 is less stable than Me O  CH 2 .

Statement –II : Me is a + I group where as MeO is a +M group.

statement-I

67. Statement –I : C F2 is good electrophile than : CCl2 .
Statement –II : Electronegativity of F is greater than electronegativity of Cl.
statement-I
68. Variation of density value form carbon(diamond) to lead is shown by the following
graph:
1) 2)
3) 4)
69. Which among the following is more basic?

1) NH3 2) CH3NH2 3) PH3 4) AsH3

70. When CH 3CH 2CHCl2 is treated with NaNH2, the product formed is
1) CH 3  CH  CH 2 2) CH 3  C  CH 3) 4)
71. Which one is most stable?
1) Cyclopropane 2) Cyclobutane 3) Cyclopentane 4) Cyclohexane
72. Identify Z in the sequence of reaction CH 3  CH 2  CH  CH 2 HBr
H 2O2 / h
Z
73. Suppose two elements X and Y combine to form two compounds XY2 and X2Y3
when 0.05 mole of XY2 weighs 5 g while 3.011 × 1023 molecules of X2Y3 weighs
85 g. The atomic masses of X and Y are respectively:
(1) 20, 30 (2) 30, 40 (3) 40, 30 (4) 80, 60
74. An element has three isotopes with atomic masses 24, 25 and 26 with relative
abundance of 80%, 15% and 5% respectively. The average mass of the isotope
mixture would be
(1) 25.25 (2) 25.50 (3) 24.50 (4) 24.25
75. Assertion (A) : The decomposition of hydrogen peroxide to form water and oxygen
is an example of disproportionation reaction.
Reason (R) : The oxygen of peroxide is in -1 oxidation state and it is convered to
zero oxidation state in O2 and -2 oxidation state in H2O.
4) Both A and R are incorrect.
76. Correct order for reaction with alcoholic KOH is
1) (i) > (ii) > (iii) > (iv) 2) (i) > (iii) > (ii) > (iv)
3) (iv) > (ii) > (iii) > (i) 4) (i) > (iv) > (ii) > (iii)
77. An aromatic compound C7H8 undergoes the following reactions:
3 Cl2 / 
C7 H 8  A 
Br2 / Fe
 B 
Zn / HCl
C
The product C is
1) m-bromotoluene 2) o-bromotoluene
3) 3-bromo-2,4,6-trichlorotoluene 4) p – bromotoluene
78. Which of the following statements is / are correct?
1) O2F2 is used in removing Plutonium as PuF6 from spent nuclear fuel.
2) ClO2 is used as a bleaching agent for paper pulp & textiles.
3) Oxides of bromine exist only at low temperatures.
4) All of these
79. The number of electrons in the penultimate orbit of krypton atom are
1) 8 2) 2 3) 18 4) 32
80. For a reaction, A2+B2 →2AB, mechanism is
A2 → 2A(fast)
A+B2 →AB+B(slow)
A+B →AB(fast)
Order of the reaction is
1) 1 2) 2 3) 1.5 4) 2.5

81. A first order reaction was started with a decimolar solution of the reactant, 8
minutes and 20 seconds later its concentration was found to be M/100. So the
rate constant of reaction is
1) 2.303 105 sec1 2) 2.303 104 sec1 3) 4.606 103 sec1 4) 2.606 105 sec1
82. Aniline when treated with conc. HNO3 gives
1) p-Phenylenediamine 2) m-Nitroaniline
3) p-Benzoquinone 4) Nitrobenzene
83. Values of H and S for five different reactions are given below:
Reaction H (kJmol-1) S (JK-1mol-1)
I +98.0 +14.8
II -55.5 -84.8
III +28.3 -17.0
IV -40.5 +24.6
V +34.7 0.0
On the basis of these values predict which one of these will be spontaneous at all
temperatures?
1) Reaction I 2) Reaction II 3) Reaction III 4) Reaction IV
84. A cylinder of gas supplied by Bharat Petroleum is assumed to contain 14kg of
butane. If a normal family requires 20,000 kJ of energy per day for cooking,
butane gas in the cylinder last for _____ days  H c of C4 H10  2658kJ per mole 
1) 15 days 2) 20 days 3) 32 days 4) 40 days
85. In which of the following same reaction(s), work is done on the system
accompanied by decrease in entropy.
I) 4NH 3  g   7O2  g   4NO2  g   6H 2O  g 
II) CO  g   2H 2  g   CH 3OH (l )
III) C s, graphite   H 2O  g   CO  g   H 2  g 
IV) H 2O  s   H 2O l 
1) III,IV 2) I and II 3) II, IV 4) I and II, IV
SECTION – B
(I) Interstitial compounds contain non-metal atoms trapped inside the metal
crystal whereas alloys are homogeneous blend of metals.
(II) Bronze is alloys of transition and non-transition metals
(III) Some borides containing interstitial compounds are very hard comparable to
that of diamond.
(IV) Interstitial compounds are chemically more reactive than parent metal.
1) I and III 2) II and IV 3) II and III 4) I, II and III
(A) Compound formed when yellow CrO4 is (P) Acidified MnO4
2 
acidified
(B) Reagent oxidises Fe2+ to Fe3+ (Q) Cr2 O72 
(C) Compound produced when MnO2 is (R) K2MnO4
fused with KNO3
(D) Compound having dark purple crystals (S) KMnO4
.
isostructural with KClO4
.
(A) (B) (C) (D) (A) (B) (C) (D)

1) Q P R S 2) P Q R S
3) Q R P S 4) Q P S R

88. Study the mechanism given below carefully :
Select the correct statement for the above diagram from the options given below.
1) A nucleophile attacks the electrophilic carbon of the polar carbonyl gorup form
direction parallel to the plane of sp2-hybridized orbitals of carbonyl carbon
2) The hybridization of carbon canges from sp to sp2 in this process
3) The net result is the addition of nucleophile and H  across the carbon-oxygen
double bond
4) Step (2) is rate determination step
89. The product formed in the following chemical reaction is
1) 2) 3) 4)
90. Which of the following is not a double salt but is a complex salt?
1) KCl.MgCl2.6H2O 2) FeSO4.(NH4)2SO4.6H2O
3) K2SO4.Al2(SO4)3.24H2O 4) 4KCN.Fe(CN)2
91. Which complex cannot ionize in solution?
1) [CoCl3(NH3)3] 2) K4[Fe(CN)6] 3) K2[Pt(F6)] 4) [Pt(NH3)6]Cl4
92. [Sc(H2O)6] ion is
+3
1) Colourless and diamagnetic 2) Coloured and octahedral

3) Colourless and paramagnetic 4) Coloured ad paramagnetic
93. a) N 2  2O2  2 NO2 ; K c  2  10 31 b) 2 NO  N 2  O2 ; K c  2.2  10 33
c) 2 N 2 O5  2 N 2  5O2 ; K c  3.8  10 32 d) 2 N 2  O2  2 N 2 O ; K c  4  10 32
From the above data, the most stable oxide is
1) NO2 2) NO 3) N2O5 4) N2O
94. The ionization constant of H2CO3 as an acid in aqueous solution at room
temperature is X. If the first and second ionization constants of H2CO3 are X1
and X2 respectively then
X X X X
1) X  1 2) X  2 3) X  X 1 X 2 4) X  1 2
X2 X1 2
95. Assertion : An Aqueous solution of ammonium acetate(CH3COONH4) can act as
buffer solution.
Reason : Acetic acid is weak and NH4OH is weak base
of the Assertion
of the Assertion

96.
97.
Product Z of the reaction
1) 2) 3) 4)
98. Consider the following for different oxidation states and emf values
BrO4 
1.82 V
 BrO3 
1.5 V
 HBrO 
1.595 V
Br2 
1.0652 V
 Br 
The species undergoing disproportionation is
1) Br2 2) BrO4 3) BrO3 4) HBrO
o o o
99. If E Au 
/ Au
is 1.69V and E Au 3
/ Au
is 1.40V, then E Au 3
/ Au 
will be :
1) 0.19V 2) 2.945V 3) 1.255V 4) None of these
Column – I (Vitamin) Column – II (Deficiency result)
(A) Ascorbic acid (I) Beri-Beri
(B) Retinol (II) Cracked lips
(C) Riboflovin (III) Scuvy
(D)
.
Thioamine (IV) Night-blindness
.
(A) (B) (C) (D) (A) (B) (C) (D)

1) II I III IV 2) I II III IV
3) IV III II I 4) III IV II I
BOTANY
SECTION – A
101. Dikaryotic phase is commonly seen in fungal groups like
1) Phycomycetes and Basidiomycetes 2) Basidiomycetes and Ascomycetes
3) Ascomycetes and Deuteromycetes 4) Phycomycetes and Deuteromycetes
102. The major reasons for considering Phycomycetes as algal fungi are
1) Presence of chitinous wall & glycogen as stored food.
2) Cellulosic wall and Starch as reserve food
3) Aquatic habitat and sexual reproduction by isogamy, anisogamy and oogamy
4) Asexual reproduction by zoospores and conidia
103. Study the following table and select the correct option.
Fungus Site of meiosis Dikaryophase
1) Rhizopus Zoospore Absent
2) Albugo Oospore Present
3) Penicillium Ascus Absent
.
4) Agaricus Basidium Present

104. Match column–I with column–II and select the correct option from the given
codes.
(A) Azolla (I) Symbiotic N2-fixer
(B) Baculoviruses (II) Symbiotic association with N2-fixing cyanobacteria
(C) Glomus (III) Bio-insecticide
(D) Rhizobium (IV) Symbiotic association of fungus with plants.
.
(A) (B) (C) (D) (A) (B) (C) (D)

1) II III IV I 2) II IV III I
3) II I IV III 4) I III IV II
105. Which is incorrect about the Nucleopolyhedrovirus (NPV)?
1) These are species-specific
2) These are broad – spectrum
3) They have no negative impact on plants, mammals, birds, fish and non-target
insects.
4) They aid in an overall IPM programme (or) when an ecologically sensitive area
is being treated.
106. Important part of the biological framing approach is
I) To become familiar with various life form that inhabit the field
II) Predators as well as pests and also their life cycle
III) Patterns of feeding and the habitats. Of their life
1) I and II only 2) I and III only 3) Only II 4) All the above
107. Phylogenetic classification systems developed, which were based on the followings
except.
1) Evolutionary relationships between the various organisms are acceptable
2) This assumes that organisms belonging to the same taxa have a common
ancestor.
3) These become more important when there is no supporting fossil evidence.
4) Classification for flowering plants was given by George Bentham and Joseph
Dalton Hooker.
108. Choose the incorrect statement regarding gymnosperms.
1) In Cycas the pinnate leaves persist for a few years.
2) The leaves in gymnosperms are well-adapted to withstand extremes of
temperature, humidity and wind.
3) In conifers, the needle-like leaves reduce the surface area.
4) In Pinus needles have thick cuticle and sunken stomata increasing
transpiration rate.
I) Mosses along with lichens are the first organisms to colonise rocks and hence,
are of great ecological importance.
II) Algae have simple thallus compared to Bryophytes thallus.
III) The plant body of bryophytes is more differentiated than that of algae.
IV) In algae Zygote undergo mitotic division to produced diploid embryo.
110. The technique of insertion of a desired gene into DNA of plasmid vector is
1) Gene splicing 2) Gene dressing
3) Gene cloning 4) Gene drafting

111. A ds DNA cleaved with EcoRI, and Hind III. The following agarose gel image was
observed. Based on the image find the nature of the DNA with number of
restriction site
P) DNA is circular, EcoRI has 2 sites and Hind III has 3 sites
Q) DNA is linear, EcoRI has 2 sites and Hind III has 3 sites
R) DNA is linear, EcoRI has one site and Hind III has 2 sites
S) DNA is circular, EcoRI has one site and Hind III has 2 sites
1) P and Q 2) Q and R 3) P and R 4) R and S
112. The fluid nature of the membrane is also important from the point of view of
functions like :-
(i) Cell growth (ii) Formation of intercellular junctions
(iii) Secretions (iv) Endocytosis (v) Cell division
1) i, iii, iv only 2) ii, iii, v only 3) i, iii, iv, v only 4) i, ii, iii, iv, v
113. Statement-I: Taq polymerase required deoxynucleotides during extension of DNA
Statement-II: Primers are required for the action of Taq polymerase for
elongation
1) Heterologous host: Non-recombinant protein
2) Bioreactor: Optimal condition
3) Downstream processing: Separation and purification
4) Optimal condition: Temperature, pH, oxygen etc
115. In a racemose inflorescence, the main axis
1) Bears a solitary flower 2) Has unlimited growth
3) Terminates in a flower
4) Has limited growth and flowers are born in acropetal manner
116. The given aestivation is ______ and found in _____

1) Valvate, Calotropis 2) Twisted, China rose
3) Imbricate, Cassia 4) Vexillary, Pea
117. Read the following statements and identify incorrect one.
1) The seed coat contains two layers, outer tegmen and inner testa
2) Scar present on seed coat can be called as hilum
3) Cotyledons are fleshy and contain reserve food materials
4) In plants such as maize and wheat the endosperm is present in mature seeds
List-I Vegetable (food) List-II (Family)
A) Brinjal (I) Compositae
B) Lady’s finger (II) Malvaceae
C) Cabbage (III) Solanaceae
`
`
D) Lactuca (IV) Cruciferae
A B C D A B C D
1) III IV II I 2) III II IV I
3) I II III IV 4) I IV II III

119. Identify incorrect statements in the following:
1) The ribosome consists of structural RNAs and about 80 different proteins and in
its active state it exists as two sub units
2) The UTRS are present at both 5' end and at 3' end
3) In actual structure the t-RNA is a compact molecule which looks like inverted “L”
4) There are no t-RNAs for stop codons
120. Removal of RNA polymerase III from nucleus will affect the synthesis of
1) mRNA 2) 5SrRNA 3) tRNA 4) Both 2 and 3
121. Removal of introns and joning of exons in a defined order during transcripton is
called
1) Slicing 2) Splicing 3) Looping 4) Inducting
122. What are those structures that appear as ‘beads-on- string’ in the chromosomes
when viewed under electron microscope?
1) Base pairs 2) Genes 3) Nucleotides 4) Nucleosomes
123. Griffth performed an experiment where mice was killed when injected with a
mixture of heat killed S-strain and live R-strain of Streptococcus, but mice was
alive when these strains were injected separately. Mice were killed because
1) Proteins from heat killed S strain made R strain virulent
2) RNA from heat killed S strain made R strain virulent
3) Both DNA and RNA from heat killed strain transformed the R strain and made
it pathogenic
4) DNA from heat killed S strain transformed to the R strain and made it virulent
124. The experimental proof for semiconservative mode of DNA replication was first
shown in a bacterium, by
1) Meselson and Stahl 2) Hershey and Chase
3) Jacob and Monod 4) Alec Jeffreys
125. Conjiont vascular bundles are present in
1) Monocot stem 2) Dicot stem
3) Dicot & Monocot leaves 4) All of the above
126. Assertion : In spring season cambium is produces a large number of xylary
elements having vessels with wider cavities.
Reason : In the spring season, cambium is very active.
127. Read the following statements about the vascular bundles :
(a) In roots, xylem and phloem in a vascular bundle are arranged in an alternate
manner along the different radii.
(b) Conjoint closed vascular bundles do not possess cambium
(c) In open vascular bundles, cambium is present in between xylem and phloem
(d) The vascular bundles of dicotyledonous stem possess endarch protoxylem
(e) In monocotyledonous root, usually there are more than six xylem bundles
present
Choose the correct answer from the options given below :
1) (b), (c), (d) and (e) only 2) (a), (b), (c), (d) and (e) only
3) (a), (c), (d) and (e) only 4) (a), (b) and (d) only
128. In a cross between plants having yellow round (YYRR) and green wrinkled (yyrr)
seeds, what will be the ratio between seeds having yellow and green seed colour?
1) 3 : 2 2) 3 : 1 3) 9 : 7 4) 7 : 9
129. In a cross between pure breeding pea plants having YYRR and yyrr seeds, find
out the total seeds having yellow colour in F2 generation
1) 12 2) 10 3) 14 4) 11
130. An exception (Deviatio) to mendilian law of independent assortment is
1) Crossing order 2) Incomplete dominance
3) Segregation 4) Linkage
131. Choose the odd one w.r.t. chromosomal theory of inherigance
1) Chromosomes and genes occur in pairs in haploid cells.
2) The paired condition of both chromosomes as well as mendilian factor is
restored during fertilisation
3) Seperation of a pair of chromosomes would lead to the segregation of a pair of
factors they carried
4) More than one option is correct.

132. Assertion (A): Crossing over is exchange of genetic material between non-
homologous chromosomes.
Reason (R): It produces new linkages
133. Statement I : Camillo Golgi first observed densely stained reticular structures
near nucleus.
Statement II : These structures were named golgi bodies after him.
given below:
Column-I Column-II
A Bacterial flagellum i.Cell wall formation
B Mesosomes ii. Resistance to antibiotics
C Plasmid iii. Prevents bacterium from collapsing
D Bacterial cell wall iv. Filament, hook, basal body
1) A-iv, B-i, C-ii, D-iii 2) A-iii, B-i, C-ii, D-iv
3) A-iii, B-ii, C-i, D-iv 4) A-i, B-ii, C-iii, D-iv
135. Arrange the following in a squuence of stages of microsporogenesis.
(I) Microspore tetrads
(II) Microspore Mother cell
(III) Sporogenous tissue
(IV) Microspores dissociate from each other
(V) Release of pollen grains
The correct sequence of stages is
1) III,V,I,II,IV 2) IV,III,I,V,II 3) II,I,V,III,IV 4) III,II,I,IV,V
SECTION – B
136. Pollen grains
(A) Represent gametophytic phase of plant.
(B) Can cause severe allergies like asthma and bronchitis.
(C) Are rich in nutrient.
(D) Are used as food supplements.
(E) Are available in form of tables and syrups in market of western countries.
1) Only A is correct 2) All are correct
3) All are wrong 4) Only A, B and C are correct
137. Pollens outer layer is called …a… This is made up of …B… This is absent on the
…C… Fill in the blanks A, B and C.
1) A-intine, B-organic compound, C-micropyle
2) A-exine, B-sporopollenin, C-germ pore
3) A-exine, B-intine, C-Micropyle
4) A-micropyle, B-intine, C-extine
138. Scutellum is
1) Endosperm 2) Cotyledon 3) Aleurone layer 4) Embryo
139. The ratio of phosphates, sugars and nitrogen bases in ds-DNA.
1) 1 : 2 : 1 2) 1 : 1 : 1 3) 1 : 1 : 2 4) 3 : 1 : 1
140. Statement –I : A physical change refers to a change in shape without breaking of
bonds.
Statement –II : Inorganic and organic chemical reactions occurs by breaking
bonds and form new compounds.

141. Which of the following is difficult to mesure directily?
1) Increase in protoplasm content 2) Increase in surface area
3) Increase in dry weight 4) Increase in volume
A) Auxins help in xylem differentiation and help in cell division
B) Bolting in sugarcane increase the yield by as much as 20 fonneas per acre
C) Cytokinins help to overcome apical dominance
D) Ethylene used for thinning of cotton, cherry, walnut
E) ABA plays an important role in seed development and maturation.
How many above statement is/are incorrect.
1) 4 2) 2 3) 5 4) 2
143. During embryo formation from zygote the events that occur are
1) Geometric growth only 2) Arithemetic growth only
3) Geometric followed by arithmetic 4) Arithmetic followed by geometric growth
144. How many times a microscope mother cell undergo meiotic division and DNA
Replication respectively in order to form 100 microspore cells
Meiotic division DNA replication Meiotic division DNA replication
1) 50 25 2) 25 25
3) 25 50 4) 50 50
145. Which of the following cells in exit G1 phase in cell cycle?
1) White blood cells 2) Columnar epithelial cells
3) Astracheid 4) Heart cell
146. O2 concentration in atmosphere is very high than CO2. Even then usually
RuBisCO causes carboxylation because of
1) Its very high affinity with CO2 than O2
2) O2 binding sites are usually inactive
3) Higher number of CO2 binding site than O2 sites
4) Conformation of active sites suitable to bind O2.
147. Match column-I (blood group) with column-II (genotype) and choose the correct
option from the codes given below :
Column-I Column-II
A) A (1) ii
B) O (2) IAIA
C) B (3) IAIB
D) AB (4) IB ii
Codes :
A B C D A B C D
1) 2 1 4 3 2) 4 2 1 3
3) 3 4 2 1 4) 1 3 4 2
148. Match column-I with column-II and choose the correct answer from the codes
given below.
Column-I Column-II
A) Linkage (1) Non-parental gene combination
B) Recombination (2) Genetic map
C) Sturtevant (3) Unit of distance between genes
D) Centimorgan (4) Physical association of genes
Codes :
A B C D A B C D
1) 3 2 4 1 2) 3 2 1 4
3) 4 1 2 3 4) 1 4 3 2
149. Number of copper containing proteins present in the complex IV is
1) 2 2) 3 3) 6 4) 7
150. The enzyme of aerobic respiration which will take part both in Krebs cycle and
electron transport
1) NADH - dehydrogenase 2) Succinic dehydrogenase
3) Malic dehydrogenase 4) -ketoglutaric dehydrogenase

ZOOLOGY
SECTION – A
1) The first organisms that invaded land were plants.
2) In 1938, a fish caught in South Africa happened to be a Coelacanth which was
thought to be extinct.
3) The lobed fin fishes were evolved into first reptiles that lived on both land and
water
4) Coelacanths were ancestors of modern day frogs and salamanders.
152. Assertion: Dryopithecus was more man-like.
Reason: Ramapithecus was more ape-like.
1) both the assertion and the reason are true and the reason is a correct
2) both the assertion and reason are true but the reason is not a correct
3) assertion is true but the reason is false.
4) both the assertion and reason are false.
153. Arrange the periods of Palaeozoic era in ascending order in a geological time
scale:
1) Silurian → Devonian → Carboniferous → Permian
2) Mesozoic → Silurian → Carboniferous → Permian
3) Devonian → Silurian → Carboniferous → Permian
4) Cambrian → Tertiary → Permian → Carboniferous
154. What can be said to be the success story of man in evolution?
1) Language skills 2) Self-consciousness
3) Increased cranial capacity 4) All of these
155. Biological diversity occurs at all the levels of biological organisation and includes.
1) Species diversity 2) Genetic diversity
3) Ecological diversity 4) All of these
156. “The Evil Quartet” does not include
1) Over-exploitation 2) Co-extinctions
3) Co-evolution 4) Alien species invasions
157. In the equation log S = log C + Z log A, ‘C’ represents
1) Speccies rich ness 2) Area
3) Y-intercept 4) Slope of the line
158. The female reproductive system of the cockroach consists of
1) Two large ovaries 2) Three large ovaries
3) One large ovary 4) Four large ovaries
159. Thin Malpighian tubules in cockroach are present at the junction of
1) crop and midgut 2) Midgut and hindgut
3) Foregut and hindgut 4) Midgut and gizzard
160. Which of the following is mismatched with respect to Rana tigrina?
1) Hepatic portal system - Special venous connection between liver and intestine
2) Renal portal system - Special venous connection between kidneys and lower
parts of the body
3) RBCs - Oval and nucleated
4) Lymph - Proteins and RBCs
161. When apply stimulation outside of the axonal membrane negalively charged and
inside the axonal membrane positively charged.
A) Polarity of the membrane-Depolarised.
B) Electrical difference on membrane-Action potential.
C) In fact not termed as nerve impulse
above the given options how many are correct.
1) only A 2) Both A & B 3) only B 4) all the above
162. The new potential developed in post synaptic neuron may be either excitory or
inhibitory because.
1) it receive impulse from dendrite of post synoptic neuron
2) it receive impulse from the dendrite of presynaptse neuron
3) it receive chemical signals from the pre synoptic neuron
4) it receive electrical signals from the presynoptic neuron

163. If ‘+’ sign is assigned to beneficial intaracties ‘-‘ sign to determintal and “O” sign
to neutral intraction, then the population intraction represent by ‘+’ ‘-’ refers to
1) Amensaism 2) Commensalism 3) Parasitism 4) Mutualism
164. Amensalism is an association between two species where
1) one species is harmed and other is benefited
2) one species is harmed and other is unaffected
3) one species is benefited and other is unaffected
4) both the species are harmed
165. Which of the following is the ultimate method in the correction of acute renal
failures?
1) Haemodialysis 2) Kidney grafting
3) Gene therapy 4) Oral drug intake
166. What would be true about the role of collecting duct in the concentration of urine
by the kidneys?
I. Allows passage of small amounts of urea into the medullary interstitium
II. Large amounts of water could be reabsorbed from this past to produce a
concentrated urine.
III. Conditional reabsorption of Na+& H2O.
1) Only I 2) Only II 3) Both 1 & II 4) Both 1 & III
167. Match the following electrons.
(A) Ammonotelism (I) terrestrial amphibians
(B) Ureotellism (II) Aquatic amphibians
`
(C) Uricotellism (III) Land snails
(A) (B) (C) (A) (B) (C)
1) I II III 2) II I III
3) III I II 4) III II I
168. The blood circulation which starts from and ends on capillaries is
1) renal circulation 2) portal circulation
3) hepatic circulation 4) lymphatic circulation
169. Bicuspid valve/mitral valve is found between
1) left atrium and left ventricle 2) right atrium and right ventricle
3) right atrium and left ventricle 4) right atrium and left ventricle
1) A person of ‘O’ blood group has anti ‘A’ and anti ‘B’ antibodies in his blood
plasma.
2) A person of ‘B’ blood group can’t donate blood to a person of ‘A’ blood group.
3) Blood group is designated based on the presence of antibodies in the blood
plasma.
4) A person of the AB blood group is a universal recipient.
171. Statement- I → Many cancers are curable if defected early and appropriate
therapeutic measures taken.
Statement- II → α - interferon activates nervous system and helps in destroying
tumor
1) Both are correct 2) Both are wrong
3) S-I is correct , S-II is wrong 4) S-II is correct , S- I is wrong
172. The antibodies are secreted by which of the following cells?
1) B-Lymphocyte 2) Monocyte 3) Neutrophil 4) Macrophage
173. The period between 12-18 years of age may be thought of as ________ period
1) Child hood 2) Infant 3) Adult hood 4) Adolescence.
174. Identify the molecule?
1) Morphine 2) Heroin 3) Cannabinoid 4) Cocaine

175. Assertion : Sperm cells are produced in seminiferous tubules.
Reason : The seminiferous tubules are lined by male mature germ cells
(spermatogonia).
1) Both Assertion and Reason are correct and Reason is the correct explanation of
Assertion
176. Folloiwng conditions are related to formation of ovum caeses, except.
1) If a female is pregnant 2) If a female has attained menopause stage
3) During intense lactation 4) If a female is using barrier contraceptive method
1) The chromosome-‘Y’ of male human has 231 genes
2) The human genome contains 3614.7 billion bp
3) The number of bases present in dystrophin gene are 2.4 million
4) Less than 2% genes are codes for proteins
178. Statement – I: Bilaterally symmetrical, triploblastic and acoelomate animals with
organ level of organisation
Statement – II: Fertilisation is internal and development is through many larval
stages.
Related with Platyhelminthes, how many statements are correct.
179. Incorrect match is
1) Economically important insects – Apis, Bombyx and Laccifer
2) Vectors of diseases – Anopheles, Culex and Aedes
3) Gregarious pest – Locust
4) Living fossil – Limulus, Crab
180. Which of the following animals are bilateral symmetrical and radial symmetrical
during larva shape respectively
1) Octopus – Asterias 2) Cucumaria -Obelia
3) Pennatula -Sycon 4) Asterias - Cucumaria
181. Select the hormone synthesized by the nuclei of hypothalamus;
1) Somatostain 2) Prolactin 3) TCT 4) ACTH
182. Statement – I: Portal system is a functional connection between hypothalamus
and anterior pituitary.
Statement – II: Pituitary gland is located in a bony cavity called sella tursica.
183. Assertion: For evolution and speciation polymorphisms play very important role
Reason: There is a variety of different types of polymorphisms ranging from single
nucleotide change to very large scale
184. Statement I: Thalassemia results in reduced rate of synthesis of alpha and beta
chain of haemoglobin
Statement II: An offspring can only get thalassemia from parents who are
affected forthis disease.
1) Statement I is true, Statement II is false 2) Both statement I and II are true
185. In sickle cell anemia, substitution of glutamic acid is replaced by valine for this
mutation occur at-
1) 6th codon in beta chain
2) 4th codon of alpha chain
3) 6th codon of gamma chain
4) 4th codon of betaChromosome component in the person affected from the
disease

SECTION – B
186. Thalassemia and sickle cell anaemia are caused due to a problem in globin
molecule synthesis.
Select the correct statement :-
1) Both are due to a quantitative defect in globin chain synthesis
2) Thalassemia is due to less synthesis of globin molecules
3) Sickle cell anaemia is due to a quantitative problem of globin molecules
4) Both are due to a qualitative defect in globin chain synthesis
187. In humans, sex is determined by _______
1) Sex chromosomes of the father 2) Sex chromosomes of the mother
3) Quantity of sperm in the semen 4) Size of egg to be fertilized
188. Select the mismatched pair concerning the decomposition process.
1) Leaching - Release of inorganic substances from organic matter in the soil.
2) Fragmentation- Increase in surface area of detritus by detritivores.
3) Humification - Simplified detritus is changed into a dark-coloured amorphous
substance resistant to microbial action.
4) Catabolism - Decomposers release an extracellular enzyme in their
surroundings to break down detritus into simple organic compounds and
inorganic substances.
189. The Pyramid of biomass is upright if
1) The carnivores outnumber the herbivores
2) The reproductive potential of primary consumers is more than that of the
producers
3) 10-20% of biomass is transferred to the next trophic level in a food chain
4) Small standing crop of primary consumers supports a large standing crop of
secondary consumers.
190. Standing crop is the amount of ___ present in a unit area of an ecosystem.
1) inorganic nutrients 2) living biomass
3) biotic components 4) abiotic components
191. Which among the listed ARTs are included under embryo transfer (ET) technique?
1) ICSI and IUI 2) ZIFT and IUT 3) GIFT and ZIFT 4) ICSI and GIFT
192. A childless couple can be assisted to have a child through a technique called
GIFT. The full form of this technique is
1) Germ cell internal fallopian transfer
2) Gamete inseminated fallopian transfer
3) Gamete intra fallopian transfer
4) Gamete internal fertilization and transfer
193. Modern taxonomy studies required
1) Knowledge of external and internal structure.
2) Knowledge about the structure of cell
3) Knowledge development process and ecological information of organisms
4) All the above
194. The structure which does not contribute to the breathing movements in
mammals is
1) larynx 2) ribs 3) diaphragm 4) intercostal muscles
195. Which one of the following four organs of respiratory system is correctly matched
with its characteristics?
A. Bronchi – Two branches of the trachea that brings air into the lungs.
B. Trachea – Small flap that prevents food from entering
C. Diaphragm – Dome shaped muscle that pushes on the lungs during
exhalation.
D. Alveoli – Pair of organs that inflate as you inhale and deflate as you exhale.
1) A and B only 2) C and D only 3) A and C only 4) B and D only
196. The volume of air breathed in and out during normal breathing is called
1) vital capacity 2) inspiratory reserve volume
3) expiratory reserve volume 4) tidal volume
197. Stimulation of a muscle fiber by a motor neuron occurs at :
1) The sarcoplasmic reticulum 2) The myofibril
3) The transverse tubules 4) The neuromuscular junction

198. The fascia surrounding the muscle is made up of:
1) Blood vessels 2) Squamous epithelial tissues
3) Collagenous connective tissues 4) Adipose tissues
(a) In 1997, an American company got patent rights on Basmati rice through the
International Patent and Trademark office.
(b) There are an estimated 50,000 varieties of rice in India alone.
(c) First clinical gene therapy was given in 1990 to a 4-year old girl with
adenosine diaminase deficiency.
(d) In 1983, Eli Lily Company prepared DNA sequences corresponding to A, B and
C chains of human insulin.
In these how many are incorrect statements?
1) 4 2) 3 3) 2 4) None of the above
200. Transgenic animals are those which have
1) Foreign DNA in some of its cells 2) Foreign DNA in all its cells
3) Foreign RNA in all its cells 4) DNA and RNA both in the cells
*******

: ANSWER KEY:
STD: XII, XII & CC – NEET GT - 11 DATE : 02-05-2024
SET-2 SUB: PHYSICS
1 1 11 2 21 2 31 1 41 2
2 1 12 2 22 2 32 1 42 2
3 3 13 2 23 2 33 1 43 1
4 1 14 4 24 3 34 4 44 4
5 4 15 3 25 2 35 4 45 2
6 2 16 1 26 3 36 3 46 4
7 1 17 4 27 1 37 4 47 3
8 4 18 1 28 2 38 1 48 2
9 2 19 4 29 3 39 1 49 4
10 1 20 3 30 3 40 3 50 2
SUB:CHEMISTRY
51 1 61 3 71 4 81 3 91 1
52 4 62 4 72 2 82 2 92 1
53 1 63 1 73 3 83 4 93 1
54 3 64 2 74 4 84 3 94 3
55 3 65 2 75 1 85 2 95 2
56 2 66 1 76 2 86 4 96 3
57 3 67 4 77 1 87 1 97 2
58 3 68 2 78 4 88 3 98 4
59 2 69 2 79 3 89 4 99 3
60 4 70 2 80 3 90 4 100 4
SUB : BOTANY
101 2 111 3 121 2 131 1 141 1
102 3 112 4 122 4 132 4 142 2
103 4 113 4 123 4 133 1 143 3
104 1 114 1 124 1 134 1 144 2
105 2 115 2 125 4 135 4 145 4
106 4 116 2 126 1 136 2 146 1
107 4 117 1 127 2 137 2 147 1
108 4 118 2 128 2 138 2 148 3
109 3 119 1 129 1 139 2 149 1
110 3 120 4 130 4 140 2 150 2
151 3 161 2 171 3 181 1 191 2
152 4 162 3 172 1 182 1 192 3
153 1 163 3 173 4 183 1 193 4
154 4 164 2 174 3 184 3 194 1
155 4 165 2 175 3 185 1 195 3
156 3 166 3 176 4 186 2 196 4
157 3 167 2 177 2 187 1 197 4
158 1 168 2 178 1 188 1 198 3
159 4 169 1 179 4 189 3 199 2
160 4 170 3 180 2 190 2 200 2

answer sheet.
CORRECT.
Section-B;
Marking Scheme :

PHYSICS
SECTION – A
1. The end correction of a resonance column is 1cm. If the shortest length
resonating with the tuning fork is 10cm, the next resonating length should be
1) 32 cm 2) 40 cm 3) 28 cm 4) 36 cm
2. A plano convex lens of focal length 30 cm has its plane surface silvered. An
object is placed 40cm from the lens on the convex side. The distance of the
image from the lens is
1) 18 cm 2) 24 cm 3) 30 cm 4) 40 cm
3. The velocity-displacement graph of a particle moving along a straight line is
shown as follows :
The most suitable acceleration-displacement graph will be
1) 2) 3) 4)
4. Light of wavelength 500 nm travelling with a speed of 2.0  108 ms 1 in a certain

medium enters another medium of refractive index 5/4 times that of the frist
medium. What are the wavelength and speed in the second medium?
1) 400nm,1.6  108 ms 1 2) 400nm, 2.5  108 ms 1
3) 500nm, 2.5  108 ms 1 4) 625nm,1.6  108 ms 1
5. A body of mass 500gm moves along x-axis such that its velocity varies with
displacement “x” according to the rotation V  10 x m/s. The force acting on the
body is
1)166N 2) 25N 3) 125N 4) 5N
6. A particle of charge –q & mass m moves in a circle of radius 4 around an
infinitely long line charfe of linear charge density  . Then time period will be:
m 4 2 m 1 2k  q 1 m
1) T  2 r 2) T 
2
3) T  4) T 
2k  q 2k  q 2 r m 2 r 2k  q
7. A body is moved along a straight line by a machine delivering a power
proportional to time (Pt). Then, match the following columns and mark the
correct option from the codes given below.
Column-I Column-II
A) Velocity is proportional to (p) t
B) Displacemnt is proportional to (q) t2
C) Work done is proportional to (r) t3
Codes :
A B C A B C
1) p q r 2) p p r
3) p q q 4) r p q

8. In the given figure a capacitor of plate area A is charged upto charge q. The mass
of each plate is m2. The lower plate is rigidly fixed. The value of m1 if the system
remains in equilibrium is
q2 q2
1) m2  2) m2 3) 2m2 4)  m2
0 Ag 2 0 Ag
9. Assertion: If a pendulum clock is taken to mountain top, it will gain time.
Reason: The value of acceleration due to gravity is low at the mountain top than
at the plane.
10. Two cities are 150 km apart. Electric power is sentfrom one city to another city
through copper wires.The fall of potential per km is 8 volts and theaverage
resistance per km is 0.5 . The power lossin the wires is :-
1) 19.2 W 2) 19.2 kW 3) 19.2 J 4) 12.2 kW
11. Three rods of equal length of same material are joined to form an equilateral
triangle ABC as shown in figure. Area of cross – section of rod AB is S, of rod BC
is 2S and that of AC is S. Then, match the following columns and mark the
correct option from the codes given below,
(A) Temperature of junction (p) Greater than 50oC
B
(B) Heat current in AB (q)Less than 50oC
(C) Heat current in BC (r)Is equal to heat current in BC
(s) 2
Is times heat current in AC
3
.
(t) None
(A) (B) (C) (A) (B) (C)
1) p r s 2) q r s
3) p r t 4) None of these
12. Four charged particles, (-q, m), (-3q, 4m), (+q, m) and (+2q, m) enter in uniform
magnetic field (in inward direction) with same kinetic energy as shown in figure.
Inside the magnetic field their paths are shown. Match the follwong two
columns.
Column-I Column-II
a) Particle (-q, m) (p) w
b) Particle (-3q, 4m) (q) x
c) Particle (+q, m) (r) y
d) Particle (+2q, m) (s) z
1) a-p, b-q, c-r, d-s 2) a-q, b-p, c-r, d-s
3) a-p, b-s, c-q, d-r 4) a-r, b-s, c-q, d-p

13. If Cv = 4.96 cal/mole K, then increase in internal enrgy when temperature
of 2 moles of this gas is increased from 340K to 342K.
1) 27.80 cal 2) 19.84 cal 3) 13.90 cal 4) 9.92 cal
14. What is the mutual inductance of a two-loop system as shown with centre
separation l ? 2
1
a a
 0 a 4  0 a 4
1) 2)
8l 3 4l 3 l>>a
 a 4
 a 4
3) 0 3 4) 0 3
6l 2l
15. The rms velocity of nitrogen molecule in a cylinder containing nitrogen gas at
17o C is 5 1012 m / s . If the diameter of the nitrogen molecule is roughtly 2.0 Ao . The
number of molecules per unit volume is 2.56  1025 m 3 , then the time taken for the
collision between two nitrogen molecules.
1) 2 1013 S 2) 4.4 1020 S 3) 31013 S 4) 11013 S
16. Assertion: A spark occur between the poles of a switch when the switch is
opened.
Reason:Current flowing in the conductor produces magnetic field.
1) If both assertion and reason are true and the reason is the correct explanation
of the assertion.
of the assertion.
3) If assertion is true but reason is false.
4) If the assertion and reason both are false
17. In the figure (i) an extensible string is fixed at one end and the other end is pulled
by a tension T. In figure (ii) another identical string is pulled by tension T at both
the ends. The ratio of elongation in equilibrium of string in (i) to the elongation of
string in (ii) is
1)1 : 1 2) 1 : 2 3) 2 : 1 4) 0
18. As shown in the figure, after passing through the medium 1. The speed of light v2
1
in medium 2 will be: (Given c  3  10 ms )
8
1 1 1 1
1)1.0  10 ms 2) 0.5  10 ms 3) 1.5  10 ms 4) 3.0  10 ms
8 8 8 8
19. If the work done in blowing a soap bubble of volume ‘v’ is w, then the work done
in blowing a soap bubble of volume ‘2v’ is
1/ 3 1/ 3
1) 4W 2) 8W 3) 2 W 4) 4 W
20. In a photoelectric effect measurement, the stopping potential for a given metal is
found to be V0 volt when radiation of wavelength 0 is used. If radiation of
wavelength 20 is used with the same metal then the stopping potential (in volt )
will be
V hc hc
1) 0 2) 2V0 3) V0  4) V0 
2 2e0 2e0
21. Masses 4kg and 36kg are 16cm apart. The point where the gravitational field due
to them is zero is
1) 6cm from 4kg mass 2) 4 cm from 4kg mass
3) 1.8cm from 36kg mass 4) 9cm from each mass

27 125
22. If radius of the 13 Al nucleus is estimated to be 3.6 fermi then the radius of 52 Te
nucleus be nearly
1) 4 Fermi 2) 5 Fermi 3) 6 Fermi 4) 8 Fermi
23. Equation of motion in the same direction is given by
y1  A sin  t  kx  , y2  A sin t  kx    . The amplitude of the medium particle will be
 
1) 2 A cos 2) 2 A cos  3) 2 A cos 4) 1.2 f ,1.2
2 2
24. Which of the following gates will have an output of 1?
1) D 2) A 3) B 4) C
25. Three identical spheres each of mass ‘m’ and radius ‘R’ are placed touching each
other so that their centres A, B and C lie on a straight line. The position of their
centre of mass from centre of A is
2R 5R 4R
1) 2) 2R 3) 4)
3 3 3
26. A uniform thin rod of mass M and length L is hinged by a frictionless
O
pivot at its end O, as shown fig. A bullet of mass m moving
horizontally with a velocity strikes the free end of the rod and gets
embedded in it. The angular velocity of the system about O just Rod
L
after the collision is
m 2m
1) 2)
L  M  m L  M  2 m

3m m
m
3) 4) Bullet
L  M  3m LM
27. In Scarle’s apparatus two wires are used to suspend the apparatus from rigid
support. The two wires.
1) must be identical in all respects
2) must have same thickness and length
3) must be of same material and same length
4) may be any wire as support wire of same length
28. The angle of minimum deviation measured with a prism is 30o and the angle of
prism is 60o . The refractive index of prism material is
3 4
1) 2 2) 2 3) 4)
2 3
29. A stone dropped from a balloon which is at a height h, reaches the ground after t
seconds. From the same balloon, if two stones are thrown, one upwards and the
other downwards, with the same velocity u and they reach the ground after t1 and
t2 seconds respectively, then
t t
1) t  t1  t2 2) t  1 2 3) t  t1t2 4) t  t22  t22
2
30. Two coherent light sources A and B with separation 2 are placed on x-axis
symmetrically about the origin. They emit light of wavelength . Find the
number of positions of maxima on a circle of large radius, lying on the x-y plane
with centre at the origin.
1) 2 2) 4 3) 6 4)8
31. A constant force starts acting on a body of mass ‘m’ at rest. The velocity “v”
acquired in travelling a specific distance depends on “m” as
1 1
1) v  2) v  3) v  m 4) v  m
m m

32. Three identical dipoles are arranged as shown below. What will be the net electric
 1 
field at P  k  
 4 0 
k. p 2kp 2kp
1) 3
2) 3 3) Zero 4)
x x x3
33. F-x and corresponding U-x graphs are as shown in figures. Three points A B and
C in F-x graph may be corresponding to P, Q and R in the U-x graph. Match the
following columns and mark the correct option from the codes given below.
Column-I Column-II
A) A (p) P
B) B (q) Q
C) C (r) R
(s) None
Codes :
A B C A B C
1) r s p 2) p s r
3) p r q 4) q r s
34. The effective capacity of the following capacitors is
a) (e) 2c
3
b) (f) 2C
c) (g) 3C
d) (h) 5C
2
(i) 3C
2
1) a-g, b-f, c-e, d-i 2) a-g, b-h, c-e, d-i
3) a-i, b-h, c-e, d-g 4) a-g, b-e, c-h, d-i

35. If a simple pendulum is arranged in an artificial satellite its
(a) Time period becomes infinity
(b) Frequency becomes infinity
(c) Both time period and frequency become infinity
(d) It does not oscillate
1) a and d are correct 2) a and b are correct
3) b, c correct 4) c, d are correct
SECTION – B
36. Two metal wires of identical dimensions areconnected in series. If 1 and 2 are
the conductivitiesof the metal wires respectively, the effectiveconductivity of the
combination is :-
 1 2 2 1 2  2  2
1) 2) 3) 1 4) 1
1   2 1   2 2 1 2  1 2
37. Assertion (A) :A body that is a good radiator is also a good absorber of radiation
at a given wavelength.
Reason (R) :According to Kirchhoff’s law, the absorptivity of a body is equal to its
emissivity at a given wavelength.
of the Assertion
of the Assertion
38. Equal currents are flowing in four infinitely long wires. Distance between two
wires is same and diections of currents are shown in figure. Match the following
two columns.
Column-I Column-II
a) Force on wire-1 (p) Inwards
b) Force on wire-2 (q) Leftwards
c) Force on wire-3 (r) Rightwards
d) Force on wire-4 (s) Zero
1) a-p, b-q, c-r, d-s 2) a-q, b-r, c-s, d-p
3) a-q, b-r, c-q, d-r 4) a-q, b-r, c-p, d-s
39. An ideal gas of mass m in a state A goes to another state B via three different
processes as shown in figure. If Q1, Q2 and Q3 denote the
heat absorbed by the gas along the three paths, then
1) Q1< Q2< Q3
2) Q1< Q2 = Q3
3) Q1 = Q2> Q3
4) Q1> Q2> Q3
40. A bar magnet of magnetic moment 4.0 A-m2 is free to rotate about a vertical axis
through its centre. The magnet is released from rest from east-west position.
Kinetic energy of the magnet in north-south position will be (B= 25T )
1) 102 J 2) 104 J 3) 106 J 4) 0
41. Assertion: A gas has unique value of specific heat.
Reason: Specific heat is defined as the amount of heat required to raise the
temperature of unit mass of the substance through unit degree.

42. Some magnetic flux is changed from a coil of resistance 10 ohm. As a result an
induced current is developed in it, which varies with time as shown in figure. The
magnitude of change in flux through the coil in webers is
i (amp)
4
1) 2
2) 4
3) 6
t (sec)
4) None of these 0.1
43. The potential energy U between two molecules as a function of the distance X
between them has been shown in the figure. The two molecules are
1) Attracted when x lies between A and B and are repelled when X lies between B
and C
2) Attracted when x lies between B and C and are repelled when X lies between A
and B
3) Attracted when they reach B 4) Repelled when they reach B
2
44. The intensity of the light from a bulb incident on a surface is 0.22 W / m . The
9
amplitude of magnetic field in this light-wave is _________ 10 T (Given :
12 2 1 2
Permittivity of vaccum0  8.85  10 C N m , speed of light in
2
vaccume c  3  10 ms
8
1) 23 2) 13 3) 33 4) 43
1
45. A soap bubble of radius cm is expanded to double its radius. If the surface

tension is 30dynes/cm, the work done is
1) 700 ergs 2) 720 ergs 3) 800 ergs 4) 360 ergs
46. An -particle moves in a circular path of radius in the presence of a

magnetic field of The de Broglie wavelength associated with the
particle will be
1) 2) 3) 4)
47. Two particles each of mass ‘m’ are placed at A and C are such AB=BC=L. The
gravitational force on the third particle placed at D at a distance L on the
perpendicular bisector of the line AC is
Gm 2 Gm 2 Gm 2 Gm 2
1) along BD 2) along DB 3) along AC 4) along BD
L2 2 L2 L2 L2
48. Assertion (A): Hydrogen atom consists of only one electron but its emission
spectrum has many lines.
Reason (R): Only Lyman series is found in the absorption spectrum of hydrogen
atom whereas in the emission spectrum, all the series are found.
49. To raise the pitch of a stringed musical instrument the player can
1) Loosen the string 2) Tighten the string
3) Shorten the string 4) Both (2) and (3)
50. The circuit diagram shown have corresponds to the logic gate.
1) NAND 2) NOR 3) AND 4) OR

CHEMISTRY
SECTION – A
51. The freezing point of 0.5 molal aqueous solution of CoCl3.xNH3 is found to be
2.79o C . Then the value of x is _______
[Assure all NH3 molecules act as ligands and Kf for water  1.86 K.mol1.kg ]
1) 6 2) 5 3) 4 4) 3
52. An aqueous solution of 1 molal KI is taken. By adding which of the following, the
vapour pressure of the solution increases?
1) 1 molal NaCl solution 2) 1 molal Na2SO4 solution
3) 1.5 molal KI solution 4) water
53. Which of the following compound will give blood red colour while doing the
Lassaigne’s test for N?
1) (NH2)2C=O 2) H2N(C6H4)SO3H 3) C6H5SO3H 4) CHCl3
54. Consider the following as a portion of the periodic table from Group No.13 to 17.
Group No.
13 14 15 16 17
V Z
Y
W
X
Which of the following statements is/are true about the elements shown in it?
(i) V, W, Y and Z are less electropositive than X.
(ii) V, W, X and Y are more electronegative than Z.
(iii) Atomic size of Y is greater than that of W.
(iv) Atomic size of W is smaller than that of X.
1) (i), (ii) and (iii) 2) (ii) and (iii) 3) (i) and (iv) 4) (iii) and (iv)
55. Following graph shows variation of I.P. with atomic number in second period
(Li-Ne). Value of I.P. of Na (11) will be :
1) Above Ne 2) Below Ne but above O

3) Below Li 4) Between N and O
O O
56. Give the IUPAC name for  
H 3C  CH 2  C  CH 2  CH 2  C  O  CH 3
1) Ethyl -4-oxoheptanoate 2) Methyl – 4 – oxohexanoate
3) Ethyl – 4 – oxohexanoate 4) Methyl – 3 – oxo - hexanoate
57. The total spin resulting from a d configuration is
7
1 3
1)  2)  2 3)  1 4) 
2 2
58. Statement I : Angular momentum of the electron in the orbit which has four
2h
sub-shell is .

Statement II : Angular momentum of the electron is quantized.
59. The number of nitrogen atoms present in one molecule of aniline yellow are
1) 1 2) 2 3) 3 4) 4

60. H2S gas when passed through a solution of cations containing HCl precipitates
the cations of second group of qualitative analysis but not those belonging to the
fourth group because :
1) Sulphides of group IV cations are unstable in HCl
2) Presence of HCl decreases sulphide ion concentration
3) Solubility product of group II sulphides is more then that of group IV sulphides
4) Presence of HCl increases sulphide ion concentration
61. A black sulphide is formed by the actions of H2S on
1) CuCl2 2) CdCl2 3) ZnCl2 4) NaCl
62. An organic compound gave positive iodoform and Tollen’s tests. The organic
compound is
1) CH3CH2OH 2) CH3CH2CH2CHO 3) CH3CHO 4) CH3COCH3
63. Which of the following statements is correct about N2 molecule ?
1) It has a bond order of 3
2) The number of unpaired electrons present in it is zero and hence it is
diamagnetic
3) The order of filling of MOs is [(2px) = ( (2py)], (2pz)
4) All the above three statements are correct
64. Regarding hybridisation which is incorrect?
1) BF3, C2H4, C6H6 involves sp2 hybridisation
2) BeF2, C2H2, CO2 involves sp hybridisation
3) NH3, H2O, CCl4 involves sp3 hybridisation
4) CH4, C2H4, C2H2 involves sp2 hybridisation
65. Among the following groupings which represents the collection of isoelectronic
species ?
1) NO  ,C22  ,O 2 ,CO 2) N 2 ,C22  ,CO,NO 3) CO, NO ,CN ,C2–
2 4) NO,CN ,N2 ,O 2
66. On reaction with acid, 4-pyrone gives a very stable cationic product. Which of
the following structures shows the protonation site in that product?
1) 2) 3) 4)
67. For the following two acid-base reactions, which statement is true?
 CH 3CH 3  CH 3 NH 
(I) CH3CH 2  CH 3 NH 2 
pK a 35 pK a 50
 HF  OH 
(II) F  H 2O 

pK  3.2
pK a 15.7 a
1) I is fvaoured to the right, II is favoured to the left

2) I is fvaoured to the left, II is favoured to the right
3) I is fvaoured to the right, II is favoured to the right
4) I is fvaoured to the left, II is favoured to the left
68. Bond dissociation enthalpy of E – H (E = element) bonds is given below. Which of
the following compounds will acts as strongest reducing agent.
Compound NH3 PH3 AsH3 SbH3
diss(E-H)kJ/mole 389 322 297 255
1) NH3 2) PH3 3) AsH3 4) SbH3
69. Which of the following does not form acidic aqueous solution?
1) N2O3 2) NO2 3) N2O5 4) NO

70
71. KMnO4  H 2 SO4

CH  C  CH 3    A  
NaOH
CaO
  B  ; compound (B) is :
1) C2H6 2) CH4 3) CH3COOH 4) CH3COONa
72. Assertion (A) : Heat of hydrogenation of but-2-ene is lesser than that of propene.
Reason (R) : But-2-ene is more stable than propene.
the Assertion
of the Assertion
73. Assertion: One molal aqueous solution of glucose contains 180 g of glucose
in 1 kg water
Reason: Solution containing one mole of solute in 1000 g of solvent is called one
molal solution.
1) If both assertion and reason are true and reason is the correct explanation of
assertion.
of assertion.
3) If Assertion is true but reason is false.
4) If both assertion and reason are false.
74. Decreasing order of mass of pure NaOH in each of the aqueous solution.
(I) 50 g of 40% (w/w) NaOH
(II) 50 ml of 50% (w/v) NaOH (dsol = 1.2 g/ml).
(III) 50 g of 15 M NaOH (dsol = 1 g/ml).
1) I, II, III 2) III, II, I 3) II, III, I 4) III = II = I.
75. In the disproportionation reaction.
3HClO3  HClO4  Cl2  2O2  H 2O, the equivalent mass of the oxidizing agent is
(molar mass of HClO3 = 84.45)
1) 16.89 2) 32.22 3) 84.45 4) 28.15
76. The number of possible enantiomeric pairs that can be produced during
monochlorination of 2-methylbutane is __________
1) 3 2) 2 3) 1 4) 4
77. Among the following alkyl halides, the total number of alkyl halides which react
by SN 1 mechanism are _______.
CH3 Br , CH 3CH 2 Br , CH 3CH 2CH 2 I ,  CH 3 3 C  Br , BrCH 2CH  CH 2 , C6 H5CH 2 Br ,
C6 H 5  CHBr  CH 3 , CH 3CH  CHCH 2Cl
1) 3 2) 4 3) 5 4) 6
1) OF2 is thermally stable at 298 K
2) I2O5 is used in the estimination of carbon monoxide
3) I2 is best oxidant in water
4) Among the halogens, density is highest for iodine.
79. Which of the following noble gases is not found in atmosphere?
1) Rn 2) Kr 3) Ne 4) Ar
80. 90% of a reaction is completed in 26min, while 99% of same reaction is
completed in 52min. Then the order of the reaction is
1) 0 2) 3 3) 2 4) 1
81. The rate of reaction quadruples. When the temperature changes from 293 K to
313 K. Activation energy of the reaction is _____kJ/mol.
1) 52.863 2) 26.431 3) 22.954 4) 12.716
82. Which of the following is not present in DNA?
1) Adenine 2) Guanine 3) Thymine 4) Uracil

83. Which of the following alcohol gives immediate turbidity with Lucas reagent?
1) ter-butyl alcohol 2) sec-butyl alcohol
3) iso-butyl alcohol 4) n-butyl alcohol
84. Which of the following statements are correct.
I) For an ideal gas in an isothermal process H, T, U = 0
II) In Free expansion of an ideal gas, work done (w), H, T, U & q = 0
III) Work done in clockwise manner is “–ve” & work done in Anticlockwise manner
is “+ve”
IV) In Adiabatic reversible process Ssys = 0, Ssurr  0.
1) I,II,III 2) Only III 3) II,III,IV 4) I,II,III,IV
85. 1 g of graphite is burnt in a bomb calorimeter in excess of oxygen at 298 K and 1
atmospheric pressure according to the equation C(graphite) + O2(g)  CO2(g).
During the reaction, temperature rises from 298 K to 299 K. If the heat capacity
of the bomb calorimeter is 20.7 kJ/K, what is the enthalpy change for the above
reaction at 298 K and 1 atm?
1) 50 kJ mol-1 2) 248.4 kJ mol-1 3) –248.4 kJ mol-1 4) 100 kJ mol-1
SECTION – B
86. Assertion (A) : In acid solution, permanganate is reduced to Mn2+ by an excess of
reducing agent.
Reason (R) : MnO4 reduced in Mn2+ in acidic medium and the product in the
presence of an excess of permanganate is MnO2.
87. Assertion (A) : The metals of 4d and 5d greater enthalpies of atomization than
the corresponding elements of the 3d series.
Reason (R) : The metal-metal bond in 4d and 5d series are stronger than those in
the 3d series.
88. Select the correct dissimilarities between C = O and C = C bond.
1) Carbon-oxygen double bond is polar but carbon-carbon double bond is non-
polar
2) Carbon-oxygen bond length is shorter (123 pm) than that of carbon-carbon
bond length (134 pm)
3) Carbonyl compounds undergo nucleophilic addition reactions but compounds
containing C = C double bonds undergo electrophilic addition reactions
4) All of the above
89. When propanal and propanone reacts with dil base followed by heating which of
the following is not formed.
1)  CH 3  2 C  C  CH 3  CHO 2) CH 3CH 2CH  CHCOCH 3
3)  CH 3 2 C  CHCOCH 3 4) CH 3CH 2CH  C  C2 H 5  CHO
90. Cu  aq   ' P '
2 excess
aq . NH 3
Cu  aq  
2 excess
KCl
 'Q '
The complexes P and Q are

1) Cu  OH 2 , CuCl2 2) Cu  NH 3 2  , CuCl2 
1
2
3) Cu  NH 3   , CuCl2  4) Cu  NH 3 4  , CuCl4 
2 2 2

(A) EDTA (I) Ambidentate
(B) CN  (II) Bidentate (neutral)
(C) Ethylene diamine (III) Bidentate (Two negative charge)
(D)
.
Oxalate (IV) Hexadentate
.
Choose correct option.

(A) (B) (C) (D) (A) (B) (C) (D)
1) IV I III II 2) III I II IV
92. The Crystal Field Stabilization Energy (CFSE) for CoCl6  is 18000cm-1. The
4
CFSE for CoCl4 

2
will be
1) 8000 cm-1 2) 6000 cm-1 3) 16000 cm-1 4)18000 cm-1
93. The following are some statements about chemical equilibrium.
A) The rate of forward reaction is equal to the rate of backward reaction.
B) The chemical equilibrium can be established from reactant side only
C) The concentration of the reactants and products remain constant with time.
1) A and B 2) A and C 3) B and C 4) All A,B,C
94. At certain temperature the Kw of D2O is 10-16 M. Then the pD of pure D2O at that
temperature is
1) 7 2) 16 3) 8 4) 6
95. 50 ml of H2O is added to 50 ml of 1 x 10-3 M barium hydroxide solution. What is
the pH of the resulting solution?
1) 3.0 2) 3.3 3) 11.7 4) 11.0
96. Nitration of nitrobenzence is carried out then obtained product is reduced with
Fe/HCl, product so formed on reaction with HNO2 and then with H2O, forms
1) benzene-1,3-diol 2) 4–nitrophenol
3) 2– nitrophenol 4) 1,2–dihydroxybenzene
97. In a reaction of aniline a coloured product C was obtained.
The structure of C would be :
1) 2)
3) 4)
98. If x is specific resistance  in S1cm  of the electrolyte solution and y is the molarity
of the solution, then  m  in S cm2 mol1  is given by :
1000x y 1000 xy
1) 2) 1000 3) 4)
y x xy 1000
99. Consider the reaction Cl2 g   2 Braq  
 2Claq   Br2 aq  ,  ECell
o
 2.9 V  . The emf of the
1 atm
cell will be when Cl    Br2    Br    0.01 M


1) 0.54 V 2) 0.35 V 3) 0.24 V 4) 2.959 V

1) All proteins are polymers of  - amino acids
2) Only  -amino acids are obtained on hydrolysis of proteins
3) Most naturally occurring amino acids have L-configuration
4) All the above are correct

BOTANY
SECTION – A
101. The only cellular organisms that were not classified under any of Whittaker’s five
kingdoms are
1) Viruses 2) Viroids and Prions 3) Lichens 4) All of these
1) Viruses are connecting links between living and non-living
2) Infective constituent in viruses is protein coat
3) Prions consists of abnormally folded proteins
4) Viroids lack protein capsid
(A) All cellular organisms (I) DNA / RNA
(B) Viruses (II) DNA
(C) Viroids (III) Neither DNA nor RNA
.
(D) Prions (IV) RNA
(A) (B) (C) (D) (A) (B) (C) (D)
.
1) IV I II III 2) II I IV III
104. Living organisms used to enrich the nutrient quality of the soil are known as
1) Biocontrol agents 2) Biofertilisers
3) Synthetic fertilisers 4) Natural fertilisers
105. Unicellular symbiotic organisms improve yield of legumes by
1) Fixing atmospheric nitrogen without colonizing roots of host plant.
2) Fixing atmospheric nitrogen and colonsing roots of host plant.
3) Including the host plant to absorb more phosphorus
4) Stimulating the host plant to become tolerant to drought.
106. Match column – I with column – II and select the correct option from the given
codes.
(A) Ganga action plan (I) N2 fixing cyanobacterium
(B) Bt cotton (II) Ministry of Environment and Forests
(C) Rhizobium (III) Insect resistantplant
.
(D) Nostac (IV) N2 fixing bacterium
.
(A) (B) (C) (D) (A) (B) (C) (D)

1) II III IV I 2) III II IV I
3) II IV III I 4) I III II IV
107. Choose the incorrect option for haplontic life cycle
1) Sporophytic generation is represented only by the one-celled zygote
2) There are no free-living sporophytes
3) Mitosis in the zygote results in the formation of haploid spores
4) The haploid spores divide mitotically and form the gametophyte
1) During Sexual reproduction sex organs develops on the sporophyte.
2) Vegetative reproduction in mosses is by fragmentation and budding in the
secondary protonema.
3) The sporophyte in mosses is more elaborate than that in liverworts.
4) Common examples of mosses are Funaria, Polytrichum and Sphagnum
109. Study the following statements regarding the gymnosperms?
I) The cones bearing megasporophylls with ovules or megasporangia are called
macrosporangiate or female strobili
II) The male or female cones or strobili may be borne on the same tree (Pinus).
III) In Cycas male cones and megasporophylls are borne on different trees.
IV) The seeds are enclosed with in the pericarp.

110. The basic procedure involved in the synthesis of recombinant DNA molecules is
depicted below the mistake in the procedure is
1) Enzyme polymerase
2) The mammalian DNA is shown double stranded
3) Two different restriction enzymes are used
4) only one fragment is inserted
111. The process of separation and purification of expressed protein before marketing
is called
1) Upstream processing 2) Downstream processing
3) Bio processing 4) Post production processing
112. Which one of the following equipment is essentially required for growing microbes
on a large scale for industrial production of enzymes?
1) BOD reactor 2) Sludge reactor 3) Bio reactor 4) Air flow reactor
113. Statement-I: The ultimate aim of the recombinant technology is to produce
desirable protein
Statement-II: The foreign gene gets expressed in the host under appropriate
condition.
114. What is the angle between two centriole of a centrosome?
1) 300 2) 450 3) 600 4) 900
115. Select the plants having actinomorphic symmetry in flower.
A. Mustard B. Datura
C. Bean D. Chilli
1) Only A and B 2) A, B and C only 3) A, B and D 4) A, B, C and D
116. The margin of thalamus grows upward enclosing the ovary completely and getting
fused with it. Such condition of flowers occurs in
1) Plum, Peach 2) Guava, Cucumber
3) Ray florets of sunflower 4) More than one option correct
117. Statement–I :In solitary axillary cymose inflorescence, axillary bud develops into
infloresence having only one flower.
Statement–II :In racemose inflorescence, terminal bud develops into infloresence
having only three flowers.
List-I (Fruit) List-II (Family)
A) Siliqua (or) lomentum (I) Malvaceae
B) Cypsela (II) Compositae
C) Berry (or) capsule (III) Solanaceae
`
`
D) Dry capsule (IV) Brassicaceae
A B C D A B C D
1) IV II I III 2) II III IV I
119. DNA as an acidic substance present in nucleus was first identified by ….. in
1869, he named it as ……..
1) Meischer, nuclein 2) Watson and Crick, DNA
3) Chargaff, Nuclein 4) Wilkins and Franklin, double helix

120. In split genes, the coding sequences are called
1) Exons 2) Cistrons 3) Introns 4) Operons
121. Which is soluble RNA?
1) hnRNA 2) rRNA 3) mRNA 4) tRNA
122. Portion of gene which is transcribed but not translated is?
1) Exon 2) Intron 3) Cistron 4) Codon
123. One strand of DNA (non template) has base sequence CAG, TCG, GAT. What will
be the sequence of bases in m-RNA?
1) AGC, CTA, CTA 2) GTC, AGC, CTC 3) CAG, UCG, GAU 4) GAC, TAG, CTA
124. Transcription unit in DNA is composed of :
1) Promoter 2) Structural gene 3) Terminator 4) All
125. (I) Cortex is made up of several layers of thin-walled parenchymatous cells with
intercellular spaces.
(II) Endodermis is made up of single layers of barrel-shaped cells without any
intercellular spaces.
(III) Few layers of thick-walled parenchymatous cells forms pericycle.
(IV) Pith is small or inconspicuous.
(V) 2-4 xylem and phloem patches.
The above charcters are belongs to
1) Dicot root 2) Dicot stem 3) Monocot root 4) Monocot stem
126. Assertion : Heart wood is durable and resistant to the attacks of
microorganisms.
Reason : Heart wood is filled with various organic compounds like tannins,
resins, oils, gums etc.
127. Axillary buds are derived from the activity of:
1) Secondary meristem 2) Apical meristem
3) Intercalary meristem 4) Lateral meristem
128. Fruit flies are one of the best materials for genetic studies because of all, except.
1) Ability to grow on simple synthetic medium in the laboratory
2) Short life span
3) Producton of large number of progeny in each mating
4) Presence of few externaly visible and identifiable similar traits
129. If the frequency of genes between a and c is 2%, b and c 13%, b and d 4% a and b
15%, c and d 17%. What will be the sequence of threse genes in a chromosome?
1) a, b, c, d 2) a, c, b, d 3) d, b, a, c d) a, d, b, c
130. Distance between the genes and percentage of recombination show.
1) A direct relationship 2) An inverse relationship
3) A parallel relationship 4) No relationship
131. What is the ratio of homozygous yellow with wrinkled seeds and homozygous
round with green seeds in F2 of classical dihybrid cross.
1) 2 : 1 2) 1 : 1 3) 3 : 2 4) 1 : 2
132. Assertion (A): Percentage of phenotypic recombinations in F2 generation of
mendilian dihybrid cross is 37.5.
Reason (R): In F2 generation of mendilian dihybrid cross, ratio of plants with
parental and non-parental phenotypes is 5 : 3.
133. Statement I : The membrane of the erythrocyte has approximately 52 percent
protein and 40 percent lipid.
Statement II : The ratio of protein and lipid varies considerably in different cell
types.

Column I Column II
(Cell organelles) (Functions)
A. Smooth Endoplasmic reticulum 1. Take part in cellular respiration
B. Free-ribosome 2. Take part in osmoregulation and excretion
C. Mitochondrion 3. Synthesis of lipids
D. Contractile vacuole 4. Synthesise non-secretory proteins
A B C D A B C D
1) 3 4 1 2 2) 1 2 4 3
3) 3 2 1 4 4) 3 2 4 1
135. Choose the correct sequence representing the ploidy of Nucellus; Megaspore
mother cell; Megaspore; Egg cell; Zygote; A polar nucleus of embryo sac;
Secondary nucleus and Primary endosperm nucleus.
1) n; 2n; 2n; n; 2n; n; 2n; and 2n 2) 2n; 2n; n; 2n; n; 2n; 3n; and 2n
3) 2n; 2n; n; n; 2n; n; 2n; and 3n 4) 2n; n; n; 2n; 3n; n; and 3n
SECTION – B
136. The body of the ovule is fused within the funicle at:
1) Micropyle 2) Nucellus 3) Chalaza 4) Hilum
137. Function of filiform apparatus is to:
1) Guide the entry of pollen tube 2) Recognise the suitable pollen at stigma
3) Stimulate division of generative cell 4) Produce nectar
138. Geitonogamy involves:
1) Fertilisation of a flower by the pollen from a flower of another plant belonging
to a distant population
2) Fertilisation of a flower by the pollen from another flower of the same plant
3) Fertilisation of a flower by the pollen from the same flower
4) Fertilisation of a flower by the pollen from a flower of another plant in the same
population
139. The length of DNA in one chromosome is 510 Ao . It has 20% of 6-Aminopurines.
The total number of nucleotides and hydrogen bonds in that chromosome
respectively are
1) 300 & 390 2) 150 & 390 3) 150 & 190 4) 120 & 156
140. Statement –I : Intermediate compounds of structural states are unstable.
Statement –II : Stability is something related to energy status of the molecule
(or) the structure.
141. Which of the following kinds of growth is exhibited by plants?
1) Closed –form of growth 2) The open form of growth
3) Both open and closed form of growth 4) Fused form of growth
142. Select incorrect statemete among the following.
1) Increase in growth per unit time is growth rate
2) A sigmoid growth curve is a characteristic of most living organisms in their
natural environment.
3) Rate of growth is a constant during geometrical growh
4) Exponential phase is called log phase
143. The fruits can be left on the tree longer period so as to extend the market period
this is due to which function of gibberellins
1) Internodal elongation 2) Bolting 3) Delay senescence 4) Parthenocarpy
144. Study the interpretation w.r.t of cell division
(i) The DNA content of G1 phase is always less than G2 phase in mitosis as well
meiosis.
(ii) The amount of DNA of meiosis – I product = The amount of DNA of meiosis – II
product.
(iii) The amount of DNA of meiosis – I product is less than meiosis – II product.
Choose the correct answer.
1) (i), (ii) are true 2) (i) & (iii) are true
3) (ii) & (iii) are true 4) (i), (ii), (iii) all are true

145.
No. of No. of No. of No of No of
chromosomes=48 Chromosomes Chromosomes Chromosomes chromosomes
in G1 in G2 after meiosis–I after meiosis–II
Diploid 48 48 A 24
`
meiocyte
No. of chromosomes No. of Chromosomes No. of Chromosomes in
= 36 in S – phase Anaphse
Diploid somatic cell B C
1) A – 48, B – 72, C – 36 2) A – 24, B – 36, C – 36
3) A – 24, B – 36, C – 72 4) A – 48, B – 36, C – 72
146. Read the following four statements, A, B, C and D and select the right option
having both correct statements.
Statements:
(A) Z scheme of light reaction takes place in present of PSI only.
(B) Only PSI is functional in cyclic photophosphorylation
(C) Cyclic photophosphorylation results into synthesis of ATP and NADPH(H+)
(D) Stroma lamellae lack PSII as well as NADP reductase
Options:
1) A and B 2) B and C 3) C and D 4) B and D
147. Chlorophyll is present :
1) In the grana of chloroplasts 2) On the surface of chloroplasts
3) Dispersed through out the chloroplasts 4) In the stroma of chloroplasts
148. Anoxygenic photosynthesis is characteristic of-
1) Rhodospirillum 2) Spirogyra 3) Chlamydomonas 4) Ulva
149. How many molecules of NADH are produced in one complete process of glycolysis
of one glucose molecule?
1) 1 2) 2 3) 3 3) 4
150. The range beyond which yeasts poison themselves to death in alcohol
fermentation when the concentration of alcohol reaches to:
1) 13% 2) 15% 3) 12% 4) 17%
ZOOLOGY
SECTION – A
151. The chronological order of human evolution from early to the recent is
1) Ramapithecus → Australopithecus → Homo habilis → Homo erectus
2) Ramapithecus → Homo habilis → Australopithecus → Homo erectus
3) Australopithecus → Homo habilis → Ramapithecus → Homo erectus
4) Australopithecus → Ramapithecus → Homo habilis → Homo erectus
152. Assertion: Agriculture came around 18,000 years ago.
Reason: Pre-historic cave art developed about 10,000 years ago.
3) Assertion is true but the reason is false.
153. The brain capacity of Home habilis was between:-
1) 500 – 600 CC 2) 800 – 1000 CC
3) 1100 – 1300 CC 4) 650 – 800 CC
154. Pouched mammals of Australia survived because
1) They are more adapted than placental mammals
2) Lack of competition from any other mammal.
3) They were intelligent in sensing & avoiding danger.
4) They have marsupium for parental care.
155. Which of the following country is correctly matched with the number of bird
species found in it?
1) Green land : 105 2) New York : 1200
3) India : 76 4) Colombia : 1400

156. Exploration of molecular, genetic and species level diversity for products of
economic importance is known as.
1) Bioprospecting 2) Biopiracy 3) Bioenergetics 4) Bioremediation
157. Alexander Van Humbolt described
1) Ecological diversity 2) Rivet popper hypothesis
3) Species area relationships 4) Population growth equation
158. Mark the statement which is not true regarding the reproductive system of frog.
1) Ovoid testes are adhered to the upper part of kidneys by a double fold of
peritoneum called mesorchium
2) Bidder's canal is a longitudinal canal present inside the kidneys carrying
sperms
3) Ureters of frog carry both sperms and urine
4) In female frogs the ovaries are both structurally and functionally associated
with kidneys
159. In male cockroach, genital pouch lies at the hind end of the abdomen, bounded
dorsally by ___________ and ____________ terga and ventrally by _____________
sternum
1) 6th; 7th; 7th 2) 7th; 8th; 8th 3) 9th; 10th; 9th 4) 10th; 9th; 10th
160. Hypopharynx of the cockroach acts as
1) Mouth 2) Lips 3) Tongue 4) Jaws
161. Assertion : Outer side of cerebral hemispheres is grey in colour due to
concentration of Neural cell bodies.
Reason : Inner portion of cerebral hemisphere white matter due to fibre tracts
not covered with myeline sheath.
the assertion
162. Cerebral aqueduct is
1) Canal present in cerebral hemispheres 2) Canal present in hind brain
3) Canal present in mid brain 4) Canal present in pons
163. While developing the theory of natural selection Darwin observed that each
species realise fully its innate potential to grow in the number provided in a
particular habitat.
1) Favourable environmental condations are prevalent
2) Absence of natural disasters like floods and famine
3) Avallability of unlimited resources
4) Development of mutation in certain species
164. Fill in the blanks A, B, C and D respectively.
Species-A Species-B Species-C
+ + Muaalism
- - -A-
+ - -B-
+ - Parasitism
+ 0 -C-
- 0 -D-
(+) Beneficialm, (-) Detrimental, (O) neutral
1) A-commensalism, B-predation, C-Amensalism, D-competition
2) A-predation, B-parasitism, C-commensalism, D-amensalism
3) A-competition, B-predation, C-commensation, D-amensalism
4) A-competition, B-predation, C-Amensalism, D-commensalism
165. If the renal blood flow is 1200ml/min, what would be renal plasma flow
perminute?
1) 540 ml 2) 660 ml 3) 940 ml 4)1040ml
166. A counter-current exists in the human kidneys between _____
I) The two limbs of Henle’s loop II) The two limbs of vasa recta
III) The Henle’s loop & DCT IV) Glomerulus & DCT
1) Only III is correct 2) I & II are correct
3) III & IV are correct 4) Only IV is correct

167. Which of the following structure helps in excretion and conservation of water in
terrestrial arthropods?
1) Malpighian body 2) Antennary glands
3) Malpighian tubules 4) Nephridia
168. In an open circulatory system
1) There is no heart. 2) There is not need of blood vessels
3) There is no distinction between blood and tissue fluid
4) There are no open spaces or sinuses in the body.
169. Chordae tendinae are found in
1) Joints 2) Atria of heart
3) Ventricles of heart 4) Ventricles of brain
170. Which of the following correctly explains a phase / event in the cardiac cycle in a
standard electrocardiogram?
1) QRS complex indicates atrial contraction
2) QRS complex indicates ventricular contraction
3) The time between S and T represents atrial systole
4) P-wave indicates the beginning of ventricular contraction.
171. Identify the plant and function of this flowering branch ?
1) Datura-Cardiovascular system 2) Erythroxylum- Nervous system

3) Cannabis- Cardiovascular system 4) Datura-Hallucinogen
172. Tobacco consumption is known to stimulate the secretion of adrenaline and nor-
adrenaline. The component causing this could be
1) Nicotine 2) Tannic acid 3) Curcumin 4) Acetaldehyde
173. The genes causing cancer are
1) Structural genes 2) Expressor genes
3) Oncogenes 4) Regulatory genes
174. The substance produced by a cell in viral infection that can protect other cells
from further infection is
1) Serotonin 2) Colostrum 3) Interferon 4) Histamine
175. Statement-I: After implantation, the inner cell mass gets differentiated into three
germ layers.
Statement-II: Inner cell mass has certain cells called stem cells.
1) Both statements I and II are correct 2) Both statements I and II are incorrect
3) Statement I is correct, II is incorrect 4) Statement I is incorrect, II is correct
176. The regions outside the seminiferous tubules contain
1) Leydig cells 2) Small blood vessels
3) Immunologically competent cells 4) All the above
177. The approximate gene contained in genome of a normal person
1) 30,000 2) 80,000 3) 1,40,000 4) 20,000
178. Which one of the following groups of three animals is correctly matched with their
one characteristic morphological feature?
1) Scorpion, spider, cockroach – Ventral solid central nervous system
2) Cockroach, locust, Taenia – Metameric segmentation
3) Liver fluke, sea-anemone, sea cucumber – Bilateral symmetry,
4) Prawn sea urchin – Jointed appendages
179. Amphibians share with reptiles all of the following characters except.
1) Ventral heart 2) External fertilisation and indirect development
3) Dioecious, oviparous 4) Cold blooded or poilkilotherms
180. In which of the following segmentation in the body is first observed?
1) Aschelminthes 2) Arthropoda
3) Annelida 4) Platyhelmintnes
181. Underproduction of parathyroid hormones result in,
1) Failure of blood clotting 2) Osteoporosis, renal calculi
3) Rapid spasms in muscles 4) Both (1) & (3)

182. From the given diagram, find out A, B, C & D
1) A-Hormone receptor complex, B-Nucleus, C-mRNA, D-Physiological response

2) A-Intra-cellular membrane, B-Genome, C-DNA, D-Tissue growth
3) A-Membrane bound receptor, B-Nucleus, C-mRNA, D-Physiological response
4) A-Uterine cell membrane, B-Genome, C-tRNA, D-Tissue growth
183. VNTR’s are significant in DNA finger printing because;
1) It is made up of transcriptionally active sequences
2) It is showing very low degree of polymorphism
3) It has a specific size and uniformly arranged sequences
4) It has a copy number that varies for every individual.
184. Sickle cell anemia is :-
1) Characterized by elongated sickle like RBCs with a nucleus
2) An autosomal linked dominant trait
3) Caused by substitution of valine by glutamic acid in the beta globin chain of
haemoglobin
4) Caused by a change in a single base pair of DNA
185. Identify the incorrect statement.
1) In male grasshoppers 50% of the sperms have no sex chromosome
2) Usually female birds produce two types of gametes based on sex chromosomes
3) The human males have one of their sex chromosomes much shorter than the
other
4) In domesticated fowls, the sex of the progeny depends on the type of sperm
that fertilize the egg
SECTION – B
186. The genotype of Klinefelter’s male can be represented as ___________
1) 44+XXY 2) 45+XXY 3) 47, XXY 4) Both 1 and 3
187. In pedigree analysis the following symbol represents,
1) Unrelated mating 2) Consanguineous mating

3) Affected parents 4) Non- Identical twins
188. Choose the incorrect statement/s regarding the process of decomposition?
I. Warm and moist environment favours decomposition.
II. Decomposition rate is slower if detritus is rich in chitin and lignin.
III. Water soluble inorganic nutrient go down into the soil horizon get precipitates
as salts known as mineralization.
IV. Decomposition is a complicated process that can only be finished by
detritivores.
1) I and II 2) II and III 3) III and IV 4) I and IV
189. Assertion(A):Decomposers are also known as key industry organisms of an
ecosystem.
Reason(R): They convert inorganic matter into organic matter and restores the
nutrients.
1) Both Assertion and Reason are true andReason is the correct explanation of
Assertion.
2) Both Assertion and Reason are true butReason is not the correct explanation
ofAssertion.
3) Assertion is true but Reason is false 4) Both Assertion and Reason are false.

(A) Based on the source of nutrition or food, organisms occupy a specific place in
the food chain that is known as their trophic level.
(B) The detritus food chain (DFC) begins with dead organic matter.
(C) The consumer that feed on the herbivores are carnivores or more correctly
primary carnivores.
Which of the above statements are correct?
1) Only A 2) B and C only 3) Only C 4) A, B & C
(a) Embryo formed by in-vivo fertilization could be used in intra uterine transfer.
(b) Fully formed embryo is transferred into the fundus region of uterus in ZIFT.
1) a is true, b is false 2) a is false, b is true
3) Both a and b are false 4) Both a and b are true
192. Which ART should a woman adopt if she does not ovulate or produce a viable
egg?
1) ICSI 2) AI 3) GIFT 4) IUI
Column- I Column -II
(A) Man (I) Order: Carnivora
(B) Mango (II) Family: Poaceae
(C) Housefly (III) Genus: Musca
(D) Tiger (IV) Phylum: Chordata
(E) Wheat (V) Family: Anacardiaceae
1) A : I, B : V, C : III, D : IV, E : II 2) A : IV, B : V, C : III, D : I, E : II
3) A : IV, B : II, C : III, D : I, E : V 4) A : I, B : II, C : III, D : IV, E : V
194. Assertion (A): In the alveoli, high pO2, low pCO2, lesser H+ concentration and
lower temperature favours the formation of oxyhaemoglobin.
Reason (R): Every 100 ml of oxygenated blood can deliver around 5 ml of O2 to
the tissues under normal physiological conditions.
195. Which of the following group are supported by incomplete cartilaginous rings?
1) Pharynx, primary & tertiary bronchi and initial bronchioles only
2) Trachea, primary & secondary bronchi, and initial bronchioles only
3) Larynx, primary, secondary and tertiary bronchi, and initial bronchioles.
4) Trachea, primary, secondary and tertiary bronchi, and initial bronchioles.
196. The total lung capacity is represented by
1) Tidal volume + Vital capacity 2) Tidal volume + Residual volume
3) Vital capacity + Residual volume 4) Inspiratory + Expiratory reserve volumes
197. The role of Acetyl choline in muscle contraction is:
1) To attaches the sarcoplasmic reticulum and release the calcium ions
2) Attaches to the sarcolemma and generates action potential
3) Attaches to the myosin and makes the myosin to attach with actin
4) To initiates the energy needed for the sliding filaments to move
198. Rib cage is formed by:
1) Cervical vertebrae, ribs and sternum
2) Thoracic vertebrae, ribs and sternum
3) Thoracic vertebrae, lumbar vertebrae and ribs
4) Thoracic vertebrae, sacral vertebrae and ribs.
199. Which of the following statements are correct regarding recombinant
therapeutics?
1) Induce unwanted immunological responses
2) Do not induce unwanted immunological responses
3) Induce immunological responses
4) Both 2 and 3
200. Earlier Insulin for diabetes was extracted from ________ of slaughtered _________
1) Liver, Mice and Pigs 2) Live, Cattle and Pigs
3) Pancreas, Cattle and Pigs 4) Pancreas, Mice and Pigs
******

: ANSWER KEY:
SET-2 SUB: PHYSICS
1 1 11 2 21 2 31 2 41 4
2 2 12 4 22 3 32 3 42 1
3 1 13 2 23 1 33 1 43 1
4 2 14 4 24 4 34 1 44 4
5 2 15 2 25 2 35 1 45 2
6 1 16 2 26 3 36 2 46 4
7 3 17 1 27 2 37 1 47 2
8 4 18 1 28 1 38 3 48 2
9 4 19 1 29 3 39 1 49 4
10 4 20 4 30 4 40 2 50 2
SUB:CHEMISTRY
51 2 61 1 71 2 81 1 91 3
52 4 62 3 72 1 82 4 92 1
53 2 63 4 73 1 83 1 93 2
54 3 64 4 74 2 84 1 94 3
55 3 65 3 75 1 85 3 95 4
56 2 66 3 76 2 86 2 96 1
57 4 67 1 77 3 87 1 97 4
58 3 68 4 78 3 88 4 98 3
59 3 69 4 79 1 89 4 99 4
60 2 70 2 80 4 90 4 100 4
SUB : BOTANY
101 3 111 2 121 2 131 2 141 2
102 2 112 3 122 2 132 1 142 3
103 2 113 4 123 3 133 1 143 3
104 2 114 4 124 4 134 1 144 2
105 2 115 3 125 1 135 3 145 3
106 1 116 4 126 1 136 4 146 4
107 3 117 3 127 2 137 1 147 1
108 1 118 4 128 4 138 2 148 1
109 3 119 1 129 2 139 1 149 2
110 3 120 1 130 1 140 2 150 1
151 1 161 3 171 4 181 4 191 1
152 4 162 3 172 1 182 1 192 3
153 4 163 3 173 3 183 4 193 2
154 2 164 3 174 3 184 4 194 2
155 4 165 2 175 1 185 4 195 4
156 1 166 2 176 4 186 4 196 3
157 3 167 3 177 1 187 2 197 2
158 4 168 3 178 1 188 3 198 2
159 3 169 3 179 2 189 3 199 2
160 3 170 2 180 3 190 4 200 3

Gts Qp File (Xii Neet 2023-24 Batch) - Final

Uploaded by

Copyright:

Available Formats

Gts Qp File (Xii Neet 2023-24 Batch) - Final

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Gts Qp File (Xii Neet 2023-24 Batch) - Final

Uploaded by

Copyright:

Available Formats

VELAMMAL KNOWLEDGE PARK

QUESTION PAPER FILE 2023-24

INSTRUCTIONS TO THE CANDIDATES

It is mandatory to use BALL POINT PEN to dark appropriate circle in the

Marks should be dark and should completely fill the circle.

Zoology). Each part contains 45 questions.

Part – A (Physics) : Contains 45 Questions. Each question has four

Part – B (Chemistry) : Contains 45 Questions. Each question has four

Part – C (Botany&Zoology) : Contains 90 Questions. Each question has four

******** WISH YOU ALL THE BEST ********

SUBJECT PAPER SETTER

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

13. A plane wave of wavelength 6250 Å is incident normally on a slit of width

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

1) Top, down, top, down 2) Top, down, down, top

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

1) 6 m/s 2) 3 m/s 3) 2 m/s 4) 1 m/s

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

the follwong statements is wrong?

goes sp3 hybridisation.

1) III<I<IV<II 2) II<IV<I<III 3) II<I<IV<III 4) I<IV<II<III

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

1) (I)>(II)>(III) 2) (III)>(II)>(I) 3) (II)>(I)>(III) 4) (I)>(III)>(II)

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

1) 3.72 2) 3.78 3) 3.54 4) 3.90

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

1) fully eclipsed conformation 2) partially eclipsed conformation

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

1) It is female with yellow body and red eyes

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

1) hydrogen bond; peptide bond 2) glycosidic bond; peptide bond

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

1) A - V, B - I, C - II, D - IV 2) A - IV, B - II, C - III, D - I

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

INSTRUCTIONS TO THE CANDIDATES

It is mandatory to use BALL POINT PEN to dark appropriate circle in the

Marks should be dark and should completely fill the circle.

Zoology). Each part contains 45 questions.

Part – A (Physics) : Contains 45 Questions. Each question has four

Part – B (Chemistry) : Contains 45 Questions. Each question has four

Part – C (Botany&Zoology) : Contains 90 Questions. Each question has four

******** WISH YOU ALL THE BEST ********

SUBJECT PAPER SETTER

1) 52N and 20N

unstretched position. The work required to further stretch the spring by

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

1) 0.1 amp 2) 0.01 amp 3) 1 amp 4) zero

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

25. A galvanometer of coil resistance 100  is connected to a shunt of resistance 10

1) V=100V, I=2A 2) V=100V, I=5A 3) V=50V, I=2A 4) V=50V, I=1A

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

WISH YOU ALL THE BEST

WISH YOU ALL THE BEST

Find out A & B and they are depicted in (C)__

WISH YOU ALL THE BEST