4.0 6.

Article

Application of Magnetized Ionized

Water and Bacillus subtilis
Improved Saline Soil Quality and
Cotton Productivity

Zhanbo Jiang, Quanjiu Wang, Songrui Ning, Shudong Lin, Xiaoqin Hu and Zhaoxin Song

Special Issue
Advances in Soil Fertility Management for Sustainable Crop Production
Edited by
Dr. Mohamed Ait-El-Mokhtar and Dr. Abdelilah Meddich

https://doi.org/10.3390/plants13172458
 plants
Article
Application of Magnetized Ionized Water and Bacillus subtilis
Improved Saline Soil Quality and Cotton Productivity
Zhanbo Jiang , Quanjiu Wang *, Songrui Ning * , Shudong Lin, Xiaoqin Hu and Zhaoxin Song

State Key Laboratory of Eco-Hydraulics in Northwest Arid Region of China, Xi’an University of Technology,
Xi’an 710048, China; [email protected] (Z.J.); [email protected] (S.L.); [email protected] (X.H.);
[email protected] (Z.S.)
* Correspondence: [email protected] (Q.W.); [email protected] (S.N.)

Abstract: Soil salinization, a significant global challenge, threatens sustainable development. This
study explores the potential of magnetized ionized water irrigation and Bacillus subtilis application to
mitigate this issue. The former method is hypothesized to enhance soil salt leaching, while the latter
is expected to improve soil nutrient availability, thereby increasing microbial diversity. To address the
unclear impact of these interventions on soil quality and cotton productivity, this study employs four
different experimental methods: magnetized ionized water irrigation (M), application of 45 kg ha−1 B.
subtilis (B), a combination of 45 kg ha−1 B. subtilis with magnetized ionized water irrigation (MB),
and a control treatment with no intervention (CK). This study aims to clarify the effects of these
treatments on soil bulk density (BD), field capacity (FC), salinity and alkalinity, nutrient content,
microbial activity, and cotton crop yield and quality. Additionally, it aims to evaluate the efficacy of
these methods in improving saline soil conditions by developing a soil quality index. The results
showed that using magnetized ionized water for irrigation and applying B. subtilis, either alone or
together, can effectively lower soil pH and salt levels, enhance microbial diversity and abundance,
and improve the yield and quality of cotton. Notably, B. subtilis application significantly decreased
BD and enhanced FC and nutrient content (p < 0.05). A correlation was found where soil nutrient
content decreased as pH and salt content increased. Furthermore, a strong correlation was observed
Citation: Jiang, Z.; Wang, Q.; Ning, S.; between the major soil bacteria and fungi with BD, FC, and salt content. Comparatively, M, B, and
Lin, S.; Hu, X.; Song, Z. Application of MB significantly boosted (p < 0.01) the soil quality index by 0.21, 0.52, and 0.69 units, respectively, and
Magnetized Ionized Water and
increased (p < 0.05) cotton yield by 5.7%, 14.8%, and 20.1% compared to CK. Therefore, this research
Bacillus subtilis Improved Saline Soil
offers eco-friendly and efficient methods to enhance cotton production capacity in saline soil.
Quality and Cotton Productivity.
Plants 2024, 13, 2458. https://doi.org/
Keywords: soil salinity; soil nutrient; soil microorganism; cotton yield; cotton quality
10.3390/plants13172458

Academic Editors: Mohamed

Ait-El-Mokhtar and
Abdelilah Meddich 1. Introduction
Received: 22 July 2024 Soil salinization poses a significant challenge to agricultural development worldwide.
Revised: 29 August 2024 Numerous soil-related issues, like decreased nutrient levels and salt stress, result in lower
Accepted: 31 August 2024 crop production. Saline soils currently cover ~1 billion hectares, or 10% of the earth’s land
Published: 2 September 2024 surface, with a 1% annual increase rate [1]. By 2050, salinization is predicted to affect over
half of the world’s arable land [2]. China ranks third in saline soil coverage, with nearly
99 million hectares affected [3].
Cotton is a cornerstone of the global textile industry and ranks among the most impor-
Copyright: © 2024 by the authors.
tant cash crops worldwide. It is the primary source of natural fiber for textile production
Licensee MDPI, Basel, Switzerland.
and plays a crucial role in international trade [4]. Cotton significantly contributes to the
This article is an open access article
GDP of countries such as China, where cotton farming and textile manufacturing are key
distributed under the terms and
sectors. In Xinjiang, China, cotton is the principal economic crop, cultivated over 2.4 million
conditions of the Creative Commons
Attribution (CC BY) license (https://
hectares, which constitutes 85% of the country’s cotton cultivation and accounts for 91% of
creativecommons.org/licenses/by/
national cotton production [5].
4.0/).

Plants 2024, 13, 2458. https://doi.org/10.3390/plants13172458 https://www.mdpi.com/journal/plants

Plants 2024, 13, 2458 2 of 24

However, the Xinjiang region, where saline soils comprise 40% of the national total
and saline farmland accounts for 38% of the cultivable area, is particularly affected [6].
The widespread and severe soil salinization in Xinjiang poses significant challenges to
cotton farming. The complex effects of soil salinization on soil health and crop productivity
often render single management strategies ineffective. Therefore, a multifaceted approach
employing various management techniques to address saline soils from multiple angles
and mitigate soil salinity is crucial for advancing saline tolerant agriculture.
Activated water technology, particularly magnetized ionized water (MIW), has gar-
nered significant attention for its potential to reduce soil salinity and alkalinity in agricul-
tural irrigation, owing to its environmental sustainability and effectiveness. The process
commences with the magnetization and ionization of irrigation water, which weakens
the hydrogen bonds among water molecules [7]. This disruption decreases the surface
tension and viscosity of the water [8], thereby enhancing its infiltration capacity and the
soil salinity and alkalinity leaching efficiency. Mostafazadeh et al. [9] revealed lower mean
soil cations and anions at various soil depths when using magnetized irrigation water,
compared to non-magnetized water. This indicates that magnetized ionized water can
effectively reduce soil salinity. Zhang et al. [10] found that using magnetized water for
irrigation led to a 16.6% increase in Na+ leaching and a 14.5% increase in Cl− leaching.
Moreover, Wei et al. [11] noted a decrease in salt content (12.8–65.0%) in the 40 cm soil layer
when using ionized water for irrigation instead of non-ionized water. Water is crucial for
dissolving soil minerals and organic materials and is essential for microbial activities. The
use of magnetized ionized water provides a foundation for other improvement measures
to effectively ameliorate saline soil.
To enhance the nutrient content and efficacy in saline soils, applying plant growth-
promoting rhizobacteria (PGPR) has emerged as an efficient and eco-friendly strategy.
Soil microorganisms critically influence soil ecosystems, affecting nutrient cycling, soil
quality, and plant productivity. They enhance soil fertility by decomposing organic mat-
ter, releasing essential nutrients, and participating in nutrient cycling and soil structure
formation [12]. Among them, Actinobacteria and Proteobacteria are primary contributors
to soil multi-nutrient cycling [13]. However, some microorganisms’ functionality is lim-
ited under salt–alkali stress conditions. B. subtilis, which secretes stress-resistant spores,
maintains its activity during prolonged salt–alkali stress. This bacterium significantly
contributes to soil nutrient availability by facilitating nitrogen fixation and phosphorus
solubilization. Furthermore, B. subtilis’s decomposition of organic nutrients increases the
availability of inorganic nutrients in the soil. Yang et al. [14] demonstrated that the use of
B. subtilis resulted in a notable increase in the alkaline nitrogen content in the soil. This
enhancement was positively correlated with the quantity of B. subtilis applied (p < 0.05). Li
et al. [15] further noted that the use of B. subtilis decreased soil pH by 7.3% and increased
available phosphorus content by 11.2%, compared to untreated soil. Additionally, Wang
et al. [16] noted that the use of B. subtilis increased the Olsen-P levels in the soil from 14.7
to 23.4 mg kg−1 and also made 16.4 mg kg−1 of Occluded-P soluble after a 14-day period
of incubation. Thus, B. subtilis serves as an environmentally friendly soil amendment,
enhancing soil nutrient content and diminishing the need for chemical fertilizers.
Various studies have investigated the impacts of treatments such as magnetized
ionized water irrigation and B. subtilis application on soil characteristics and crop pro-
duction [11,17–20]. However, the combined effects of multiple regulatory measures and
the interaction mechanisms between soil quality and crop production are increasingly
being recognized as crucial for sustainable agricultural development and agroecosystem
management [21]. This study concentrates on water and soil, two vital elements of the
cotton growth environment. By employing magnetized ionized water and B. subtilis, to
ameliorate saline soil, we propose that their combined application can enhance soil quality
and cotton production. This study’s objectives are as follows: (i) to examine the impact
of magnetized ionized water irrigation and B. subtilis on soil physical properties, salinity
and alkalinity, nutrient content, and microbial (bacteria and fungi) characteristics; (ii) to
Plants 2024, 13, x FOR PEER REVIEW 3 of 25

Plants 2024, 13, 2458 investigate the correlations among soil physical properties, salinity and alkalinity, 3 of 24nutri-
ents, and microorganisms, and to develop a soil quality evaluation model to assess the
improvement’s effectiveness; and (iii) to investigate the impact of the soil quality index on
co investigate
on production, taking into
the correlations account
among soil both co properties,
physical on yield and quality.
salinity and alkalinity, nutri-
ents, and microorganisms, and to develop a soil quality evaluation model to assess the
improvement’s effectiveness; and (iii) to investigate the impact of the soil quality index on
2. Results
cotton production, taking into account both cotton yield and quality.
2.1. Soil Properties
2. Results
2.1.1. Soil Physical Properties
2.1. Soil Properties
Figure
2.1.1. Soil 1 illustrates
Physical that the application of B. subtilis significantly reduced soil bulk
Properties
densityFigure
and significantly increased field capacity (p < 0.05), while magnetized ionized wa-
1 illustrates that the application of B. subtilis significantly reduced soil bulk
ter density
had noand significant effect
significantly (p > 0.05).
increased fieldCompared
capacity (p <to0.05),
the treatment without
while magnetized the application
ionized water
of B. subtilis, the average reduction in soil bulk density was 7.0% and the average
had no significant effect (p > 0.05). Compared to the treatment without the application of increase
B.
in field capacity
subtilis, was 7.7%
the average wheninB.soil
reduction subtilis was applied.
bulk density was 7.0% and the average increase in
field capacity was 7.7% when B. subtilis was applied.

1.60 37

a
36
1.55 a
a
35 a
Bulk density/ (g cm−3)

1.50
Field capacity/ %

34
1.45 b
b
b 33
b
1.40
32

1.35
31

1.30 30
CK M B MB CK M B MB

(a) (b)
Figure
Figure1. Soil physical
1. Soil physical properties.
properties.Bulk density
Bulk (a).(a).
density Field
Fieldcapacity (b).
capacity CKCK
(b). denotes
denotes untreated
untreatedirriga-
tion, M denotes magnetized ionized water irrigation, B denotes untreated water
irrigation, M denotes magnetized ionized water irrigation, B denotes untreated water irrigation withirrigation with 45
45 kgB.hasubtilis,
kg ha and MB anddenotes magnetized water irrigation
irrigationwith
with4545 kg ha B. B. subtilis. The data
−1 − 1 −1
− 1
B. subtilis, MB denotes magnetized water kg ha subtilis. The
represent
data represent the average of the three replicates. Different letters above the bars indicate significant dif-
the average of the three replicates. Different le ers above the bars indicate significant
ferences among
differences treatments
among treatmentsat pat<p0.05.
< 0.05.

2.1.2. Soil
2.1.2. Salinity
Soil Salinityand
andAlkalinity
Alkalinity
Regarding soil salinity and alkalinity, B had a greater impact than M on lowering soil pH
Regarding soil salinity and alkalinity, B had a greater impact than M on lowering soil
and salt content, with MB showing the most significant effect (Figure 2). A significant decrease
pH and salt content, with MB showing the most significant effect (Figure 2). A significant
(p < 0.05) in soil pH was observed under MB compared to CK, with a 0.14 reduction. While M
decrease (p <not
and B did 0.05) in soil pHaffect
significantly was pH
observed under MB compared
levels individually, their effectstowere
CK,noticeable.
with a 0.14Forreduc-
tion. While
soil M Band
salinity, andBMB didtreatments
not significantly
resulted affect pH levels
in significant individually,
reductions (p < 0.05)their effects
of 7.6% and were
noticeable. For soil salinity,
16.3%, respectively, compared B to
and
CK.MB
Thus,treatments
combiningresulted
B. subtilisinwith
significant
magnetized reductions
ionized (p <
0.05) of 7.6%
water and is16.3%,
irrigation respectively,
a powerful method forcompared
mitigatingtosoil
CK. Thus,and
salinity alkalinity.B. subtilis with
combining
magnetized ionized water irrigation is a powerful method for mitigating soil salinity and
alkalinity.
 Plants 2024, 13, x FOR PEER REVIEW 4 of 25
Plants 2024, 13, x FOR PEER REVIEW 4 of 25
Plants 2024, 13, 2458 4 of 24

7.95 2750 a
7.95 a 2750
a 2700 a a
7.90 2700 a
2650
7.90 2650
2600
7.85 a 2600

−2
2550

gm
7.85 a b

g m−2
2550
2500 b

content/
7.80
pH

ab
2500
2450

content/
7.80
pH

ab
2450
2400

Salt Salt
7.75
2400
2350
7.75 b
7.70 2350
2300 c
b
7.70 2250
2300 c
7.65 2200
2250
CK M B MB CK M B MB
7.65 2200
CK M (a) B MB CK M
(b) B MB

(a) 2. Soil salinity and alkalinity. Soil pH (a). Salt content (b)
Figure (b). CK denotes untreated irrigation,
M denotes magnetized ionized water irrigation, B denotes untreated water irrigation with 45 kg ha −1
Figure 2. 2.Soil
Soilsalinity and alkalinity.Soil
SoilpH
pH (a).
SaltSalt content (b). CK
−1 B.denotes untreated irrigation,
B.Figure
subtilis, and MB denotes
salinity magnetized water
and alkalinity. irrigation
(a). with(b).
content 45 kg
CKhadenotes subtilis. The data
untreated represent
irrigation, M
Mthe
denotes magnetized ionized water irrigation, B denotes untreated water irrigation
average of the three replicates. Different le ers above the bars indicate significant differences
denotes magnetized ionized water irrigation, B denotes untreated water irrigation with 45 with
kg ha45
−1 kg
B. ha
−1

B.among
subtilis, and MB
subtilis,treatments denotes magnetized
at p < 0.05.
and MB denotes water irrigation with 45 kg ha −1 B. subtilis. The data represent
magnetized water irrigation with 45 kg ha−1 B. subtilis. The data represent
thethe
average of the three replicates. Differentletters
average of the three replicates. Different le ersabove
above the
the bars
bars indicate
indicate significant
significant differences
differences
among
2.1.3.
among treatments
Soil at p <
NutrientatContent
treatments 0.05.
p < 0.05.
The treatments’ effectiveness on soil nutrients, excluding soil organic ma er content,
2.1.3. Soil
2.1.3. SoilNutrient
NutrientContent
Content
follows the following order: B > MB > CK > M (Figure 3). However, the impact on NH +4 -N
and The
totaltreatments’
The treatments’effectiveness
P content was
effectiveness on
insignificant. on soil
soilnutrients,
The nutrients,
M treatment excluding
excluding soil
soil
demonstrated organic
organic ma content,
matter
the lowest er+content,
nutrient
follows
follows thethe following
following order:
order: B
B >> MB
MB >> CK
CK > >MM (Figure
(Figure 3). However,
3). However, the impact
the on
impact NH on 4 −
NHN + -N
content,
and total yet it was not
P content wasstatistically
insignificant. different from CK,demonstrated
The M treatment except for available
the lowest phosphorus.
nutrient
4
and
This total
could P content
be due towas
the insignificant.
decrease in The
soil M treatment
salinity and demonstrated
alkalinity under the lowest
magnetized nutrient
ionized
content, yet it was not statistically different from CK, except for available phosphorus. This
content,
water yet it was
couldirrigation,
be due to the
not statistically
potentially
decrease enhancing
different
nutrient
in soil salinity
from
uptake
and alkalinity
CK,by except
co on
under
for available
plants
magnetized and phosphorus.
reducing
ionized waterre-
This
sidualcould
irrigation, be due
soil nutrient to
potentially the decrease
content. Similar
enhancing in soil
pa erns
nutrient salinity and
were by
uptake alkalinity
observed in B and
cotton plants under
andMB magnetized
treatments,
reducing ionized
with
residual
water
the irrigation,
soilB nutrient
treatment potentially
showing
content. enhancing
a significant
Similar nutrient
patternsimprovement
were uptake
observed Bby
ininsoil coMB
nutrient
and ontreatments,
plants and
content. reducing
Compared
with the Bto re-
-
sidual
CK, the soil
B nutrient
treatment content. Similar
significantly pa
increased erns(p were
< 0.05) observed
soil NO in
treatment showing a significant improvement in soil nutrient3 content. Compared to CK,K,
-N, B and MB
available treatments,
P, available with
the
and B organic
the treatment
B treatmentmashowing
er levelsaby
significantly significant
27.7%, 21.0%,
increased improvement
(p 18.6%,
< 0.05) soiland
NO in3 soil
−N,nutrient
28.6%,
−
availablecontent.
respectively. ThisCompared
K, and to
highlights
P, available
-
B.organic
CK, subtilis’s
the B matter positive
treatmentlevelseffect on soil21.0%,
significantly
by 27.7%, nutrient
increased enhancement
18.6%,(p and
< 0.05) soiland
28.6%, NOavailability,
-N,
respectively.
3 available
Thisas indicated
P, available
highlights by K,
B.
the increased
subtilis’s Available
positive effect P/Total
on soil P ratio.
and organic ma er levels by 27.7%, 21.0%, 18.6%, and 28.6%, respectively. This highlights
nutrient enhancement and availability, as indicated by the
B. increased
subtilis’s Available
positive effectP/TotalonPsoil nutrient enhancement and availability, as indicated by
ratio.
the increased Available P/Total P ratio.
8.55 38
a
a
8.50 36
ab
8.45
8.55 38
a a 34
8.40 a a
8.50 36
32 ab
) (mg kg )
NH +4 -N/ (mg kg−1)

8.35
−1

8.45 bc
a 34
30
8.30 a
8.40 a
8.25 32
3 -N/

28
NH +4 -N/ (mg kg−1)

8.35
−−1

bc
NOkg

8.20 30
8.30 26
NO3−-N/ (mg

8.15 a c
8.25 28
24
8.10
8.20
8.05 26
22
8.15 c
8.00 20
24
8.10 CK M B MB CK M B MB

8.05 22
(a) (b)
8.00 20
CK M B Cont.
Figure 3. MB CK M B MB

(a) (b)
 Plants
Plants 2024,
2024, 13, x FOR PEER REVIEW
13, 2458 5 of 25
5 of 24

22 0.68 4.0
a
21 ab a 3.8
0.66 a
20

Available P/ Total P (%)

Available P/ (mg kg−1)

a a 3.6
0.64

Total P/ (mg kg−1)

19 b a
3.4
18 0.62
a
3.2
17 0.60
c 3.0
16 b
0.58
15 2.8
0.56 c
14 2.6
13 0.54 2.4
CK M B MB CK M B MB CK M B MB
(c) (d) (e)
150 a 12.0

11.5 a
145
11.0

Soil organic matter/ (mg kg−1)

140 10.5
Available K/ (mg kg−1)

ab b
10.0
135
9.5
b
130
9.0

125 b 8.5

b 8.0
120 c
7.5

115 7.0
CK M B MB CK M B MB
(f) (g)
Figure 3. Soil nutrient content. NH+ -N content (a). NO− -N content (b). Available P content (c). To-
4+
Figure 3. Soil nutrient content. NH 4 −N content (a). 3NO3− −N content (b). Available P content (c).
tal P content (d). Available P content/Total P content (e). Available K content (f). Soil organic ma er
Total P content
content (g). CK(d). Available
denotes P content/Total
untreated P content
irrigation, M denotes (e). Available
magnetized ionizedKwater
content (f). SoilB organic
irrigation, de-
notes content
matter untreated water
(g). irrigationuntreated
CK denotes with 45 kg ha−1 B. subtilis,
irrigation, and MB
M denotes denotes magnetized
magnetized water
ionized water irri-
irrigation,
B gation
denoteswith
untreated −1 B. subtilis.
45 kg hawater Thewith
irrigation data45represent
kg ha−1the B. average of the
subtilis, and MBthree replicates.
denotes Different
magnetized water
le ers above
irrigation withthe
45 bars
kg ha indicate
− 1 significant
B. subtilis. Thedifferences among
data represent thetreatments p <three
average ofatthe 0.05. replicates. Different
letters above the bars indicate significant differences among treatments at p < 0.05.
2.2. Diversities of Bacterial Communities
2.2. Diversities of Bacterial
The regulatory measuresCommunities
significantly affected the α diversity of soil bacteria (p <
0.05) (Figure
The 4a). M measures
regulatory significantly increased (p
significantly < 0.05) the
affected the αSimpson
diversityandofShannon indices
soil bacteria (p <of0.05)
soil bacteria by 17.8% and 20.2%, respectively, compared to CK. This suggests
(Figure 4a). M significantly increased (p < 0.05) the Simpson and Shannon indices of soil that mag-
netizedby
bacteria ionized
17.8%water irrigation
and 20.2%, improves bacterial
respectively, compared community
to CK. This diversity andthat
suggests species dis-
magnetized
tribution uniformity. B. subtilis application significantly boosted soil bacterial
ionized water irrigation improves bacterial community diversity and species distribution growth and
α diversity.B.Compared
uniformity. to CK, thesignificantly
subtilis application Chao1, Simpson, Shannon
boosted indices,growth
soil bacterial and Observed fea-
and α diversity.
tures treated with B increased by 14.8%, 20.2%, 18.6%, and 15.0%,
Compared to CK, the Chao1, Simpson, Shannon indices, and Observed features treated respectively. MB pro-
cessing
with showed similar
B increased by 14.8%, increases
20.2%,of18.6%,
16.2%,and
20.2%, 19.3%,
15.0%, and 16.4%,MB
respectively. respectively.
processingThese
showed
findings suggest that B. subtilis application enhances low abundance
similar increases of 16.2%, 20.2%, 19.3%, and 16.4%, respectively. These findings species in the suggest
soil
bacterial community, thereby improving community diversity and species distribution
that B. subtilis application enhances low abundance species in the soil bacterial community,
uniformity. Using the Bray Curtis similarity coefficient, we conducted a non-metric mul-
thereby improving community diversity and species distribution uniformity. Using the Bray
tidimensional scaling (NMDS) analysis on soil bacterial communities under different reg-
Curtis similarity coefficient, we conducted a non-metric multidimensional scaling (NMDS)
ulatory measures (Figure 4b). The NMDS map showed that the four replicates of each
analysis on soil bacterial communities under different regulatory measures (Figure 4b). The
regulatory measure were clustered together, indicating good repeatability of the bacterial
NMDS map showed that the four replicates of each regulatory measure were clustered
community structure samples and a low stress coefficient (0.072). At the ASV level, the
together,
bacterialindicating
communities good in Brepeatability of the bacterial
and MB significantly differedcommunity structurethat
from CK, indicating samples
B. sub-and
a tilis
lowapplication
stress coefficient (0.072). At the ASV level, the
significantly alters soil bacterial communities. bacterial communities in B and MB
significantly differed from CK, indicating that B. subtilis application significantly alters soil
bacterial communities.
Plants 2024, 13, x FOR PEER REVIEW 6 of 25
Plants 2024, 13, 2458 6 of 24

2200 a a a
a 1.0
a
2000 ab

Simpson index
b b
Chao1 index

0.9
1800
0.8
1600

1400 0.7

10 a a a 2200
a a

Observed ASVs
b ab
Shannon index

9 b
2000

8 1800

7 1600

6 1400
CK M B MB CK M B MB
(a) (b)
Figure 4. Soil
Figure bacterial
4. Soil communities’ ααdiversity
bacterialcommunities’ diversity (a) and
(a) and NMDS NMDS analysis
analysis (b) under(b)different
under different
regulatoryregula-
torymeasures.
measures. CKCK denotes
denotes untreated
untreated irrigation,
irrigation, M denotes M magnetized
denotes magnetized
ionized water ionized water
irrigation, irrigation, B
B denotes
denotes untreated water irrigation with
− 1 45 kg ha −1 B. subtilis, and MB denotes magnetized water
untreated water irrigation with 45 kg ha B. subtilis, and MB denotes magnetized water irrigation with
irrigation with
−1 B.45 kg haThe −1 B. subtilis. The data represent the average of the four replicates. Errors bars
45 kg ha subtilis. data represent the average of the four replicates. Errors bars indicate standard
indicate standard
errors. Differenterrors. Different
letters above le indicate
the bars ers above the bars
significant indicateamong
differences significant differences
treatments among treat-
at p < 0.05.
ments at p < 0.05.
The taxonomic analysis results showed that 11,972 ASVs were obtained from 16 sam-
ples selected
The taxonomic from the four regulatory
analysis results showed measures.thatThese ASVs
11,972 ASVswere divided
were into 48from
obtained phyla,16 sam-
where the main bacterial communities in the soil under different regulatory measures
ples selected from the four regulatory measures. These ASVs were divided into 48 phyla,
were similar, yet significant differences in relative abundance were observed. Figure 5
where the main
illustrates bacterial communities
the composition in the phyla
of the top 10 bacterial soil under different
with relative regulatory
abundance measures
in the soil
were similar,
under yet significant
different differences
regulatory measures. Thein relativephyla
dominant abundance
identifiedwerewere observed. Figure 5 il-
Proteobacteria
lustrates the composition
(34.1–39.4%), Actinobacteriota of the(9.4–12.7%),
top 10 bacterial phyla(5.5–15.5%),
Firmicutes with relative andabundance
Acidobacteriota in the soil
under different The
(6.9–11.3%). regulatory
impact of measures. The dominant
various regulatory phyla
measures on identified
the relativewere Proteobacteria
abundance of
(34.1–39.4%), Actinobacteriota (9.4–12.7%), Firmicutes (5.5–15.5%), and Acidobacteriota
Proteobacteria and Actinobacteriota was insignificant. However, the introduction of B.
subtilis not only increased the relative abundance of Firmicutes, to which B. subtilis be-
(6.9–11.3%). The impact of various regulatory measures on the relative abundance of Pro-
longs, but also potentially influenced the microbial community structure. Specifically, B
teobacteria and Actinobacteriota was insignificant. However, the introduction of B. subtilis
and MB treatments increased the relative abundance of Firmicutes by 139.4% and 128.3%,
not respectively,
only increased the relative
compared abundance
to CK. This suggestsof Firmicutes,
that of B.B.
to which
the introduction subtilis
subtilis maybelongs,
have but
alsocascading
potentially influenced
effects on the overall the microbial
microbial community
composition. Thestructure.
soil bacterialSpecifically,
communityBwas and MB
treatments increased into
further categorized the 822
relative
genera. abundance of Firmicutes
Figure 6 displays by abundance
the relative 139.4% and 128.3%, respec-
composition
tively, compared
of the top 10 soilto bacterial
CK. Thisgenera
suggests underthatdifferent
the introduction
regulatory of B. subtilis
measures. Themay have cascad-
dominant
identified were Bacillus (2.0–8.1%), Pseudomonas
ing effects on the overall microbial composition. The soil bacterial community was further
genera (1.6–4.1%), Methylophaga (0.3–7.2%),
and Streptomyces (1.6–3.2%). The B treatment significantly impacted (p < 0.05) the relative
categorized into 822 genera. Figure 6 displays the relative abundance composition of the
abundance of Bacillus compared to CK, increasing it by 235.7%, while the M treatment did
top not.
10 soil bacterialthe
Additionally, genera under different
MB treatment significantly regulatory
affected (p measures. The dominant
< 0.05) the relative abundancegenera
identified
of Bacilluswere Bacillus
compared B, increasingPseudomonas
to (2.0–8.1%), it by 21.9%. These(1.6–4.1%), Methylophaga
observations indicated that (0.3–7.2%),
the ap- and
Streptomyces
plied B. subtilis successfully colonized the soil, and magnetized ionized water significantly abun-
(1.6–3.2%). The B treatment significantly impacted (p < 0.05) the relative
dance of Bacillus
promoted compared
the relative to CK,ofincreasing
abundance Bacillus. it by 235.7%, while the M treatment did not.
Additionally, the MB treatment significantly affected (p < 0.05) the relative abundance of
Bacillus compared to B, increasing it by 21.9%. These observations indicated that the ap-
plied B. subtilis successfully colonized the soil, and magnetized ionized water significantly
promoted the relative abundance of Bacillus.
 Plants 2024, 13, x FOR PEER REVIEW
Plants 2024, 13, x FOR PEER REVIEW 7 of 25
Plants 2024, 13, 2458 7 of 24

100% 25% 20%

Others Firmicutes a Acidobacteriota
100% Zixibacteria
25% 20% a a 20% 15%
90% Others Firmicutes
Planctomycetota
a ab
Acidobacteriota
Zixibacteria 20%
Myxococcota 15% a
a ab
15% b 10%
90% 80%
Planctomycetota Bacteroidota
10% b b ab
Myxococcota 15%
Gemmatimonadota
ab b
Relative abundance (Phylum)
b 10% 5%
b 5%
Bacteroidota Chloroflexi
80% 10%
70% Gemmatimonadota Acidobacteriota
Relative abundance (Phylum)

Chloroflexi 5%
Firmicutes 0% 5% 0%
Actinobacteriota Chloroflexi Bacteroidota
70% 60%
Acidobacteriota
0% 15% 0%
Firmicutes
Actinobacteriota
Proteobacteria
Chloroflexi a a Bacteroidota a 10%
60% 50%
Proteobacteria 15%
a a10% b b b ab 10%b
b 5%
10% 5% b b
50% 40% b b 5%
5% 0% 0%
40% Myxococcota Zixibacteria
30% 0% a 0%
6%
30%
Myxococcota a Zixibacteria 1.0%
20% 6% 4% a b
a a ab 1.0%
20% 10% 4% 2% b b c c
0.5%
a ab
10% 2% 0% b c c
0.5%
0.0%
0% CK M B MB CK M B MB
CK M B MB 0% 0.0%
0% CK M B MB CK M B MB
CK M B MB
Figure 5. Relative abundance of bacterial community composition at the top 10 phylum level
Figure 5. Relativedifferent
Figure 5. Relative regulatory
abundance
abundance of measures.
of bacterial
bacterial CK denotes
community
community untreated
composition
composition at irrigation,
at the
thetop M denotes
top1010phylum
phylum levelsmagnetized
levels under ioni
under
different ter irrigation,
regulatory measures. B denotes
CK untreated
denotes water
untreated irrigation
irrigation, with
M 45 kg
denotes ha −1 B. subtilis,
magnetized and
ionizedMB denot
different regulatory measures. CK denotes untreated irrigation, M denotes magnetized ionized wa-
netized water
denotes irrigation
untreated with
water 45 kg ha
irrigation B.
−1with subtilis.
45 kg The
ha
−1 data represent the average
−1 B. subtilis, and MB denotes
ter irrigation, B denotes untreated water irrigation with 45 kg ha B. subtilis, and MB denotes mag-
water irrigation, B of the fou
magnetized cates.
water Errors
irrigation bars
with mean
45 standard
−1
kg ha errors.
−1 B. subtilis. Different
The data le ers
represent above
netized water irrigation with 45 kg ha B. subtilis. The data represent the average of the four repli-
the the bars
average indicate
of the significan
four
cates.
replicates. ences
ErrorsErrors
bars meanamong
bars mean treatments
standard errors.
standard p < 0.05.
atDifferent
errors. le ersletters
Different aboveabove
the bars the indicate significant
bars indicate differ-
significant
ences amongamong
differences treatments at p < at
treatments 0.05.
p < 0.05.

(a) (b)
(a)Figure 6. Relationships between dominant bacterial
(b) genus measures
and regulatory
Figure 6. Relationships between dominant bacterial genus and regulatory (a) andmeasures
heat (a) a
Figure
map of6.dominantmap genus
of dominant
Relationships between genus
dominant
of bacterial of bacterial
bacterial
communities communities
genus
under under different
and regulatory
different regulatory regulatory
measures
measures (a)(b).
andmeasures
heat
CK (b).
map of dominant
denotes notes
untreated untreated
genus
irrigation, Mirrigation,
of bacterial M denotes
communities
denotes magnetized magnetized
under different
ionized waterionized water
regulatory
irrigation, irrigation,
Bmeasures B denotes
(b). CK de- untrea
denotes untreated
notes
wateruntreated
ter with
irrigation
irrigationirrigation,
45 kgMwith −45
denotes
ha 1 B. ha−1 B. subtilis,
kgmagnetized and MB
subtilis, and ionized
denotes
water
MB denotes
magnetized
irrigation,
magnetized Bwater
denotes water irrigation
untreated
irrigation wa-with 45
with
ter irrigation
− 1 B. subtilis.
with 45 kg ha −1 B. subtilis, and MB denotes magnetized water irrigation with 45 kg ha −1
45 kg ha B. subtilis.
B. subtilis.
2.3. Diversities2.3. Diversities
of Fungal of Fungal Communities
Communities
2.3. Diversities of
The regulatoryFungal
The Communities
regulatory
measures measuresaffected
significantly significantly
the α affected
diversitythe α diversity
of soil fungi (p of soil fungi (p
< 0.05)
(Figure 7a). M(Figure 7a). M
significantly significantly
The regulatory measures significantly affected
increased the increased
Chao1, the Chao1, Simpson, and Shannon
α diversity of soil fungi (p <soil
Simpson, and Shannon indices of 0.05)indices
(Figure 7a). M
fungi (p < fungi
0.05), (p < 0.05),increased
significantly
showing showing increases
increases of the Chao1,
36.1%, of Simpson,
30.4%,36.1%, 30.4%,
and and and
37.1%, 37.1%,indices
Shannon
respectively, respectively,
of soil comp
compared
fungi
to CK. (p This CK.showing
< 0.05), This improvement
improvement increases is ato ributable
of 36.1%,
is attributable 30.4%, and
magnetized to 37.1%,
magnetized
ionized waterionized
respectively, water
compared
irrigation, whichirrigation,
to
achieves
CK. achieves
This superior
improvement superior
fungal fungal community
iscommunity
a ributable diversity diversity
and
to magnetized species and species
water distribution
distribution
ionized uniformity.
irrigation, uniformity.
B.
which
subtilis application
achieves superior significantly
tilis application
fungal community boosted
significantly soil
diversity fungal
boosted
and soil diversity.
α fungal
species Compared
α diversity.
distribution to CK,B.the
Compared
uniformity. to CK, the
sub-
Chao1, Simpson, and
Simpson, Shannon indices
and Shannon and
indicesthe Observed
and features
the Observed treated with
features B increasedB increa
tilis application significantly boosted soil fungal α diversity. Compared to treated
CK, the with
Chao1,
Simpson, and Shannon indices and the Observed features treated with B increased by
Plants 2024, 13, x FOR PEER REVIEW 8 of 25
Plants 2024, 13, 2458 8 of 24

42.0%, 27.8%,
by 42.0%, 29.1%,
27.8%, andand
29.1%, 36.3%, respectively.
36.3%, respectively. MBMBprocessing
processingfurther augmented
further augmentedthesethesein-
creases
increasesto to
65.1%,
65.1%,26.6%,
26.6%,36.2%,
36.2%,and
and61.8%,
61.8%, respectively. These findings
respectively. These findingssuggest
suggestthatthatB.B.
subtilis
subtilisapplication
application enriches
enriches low-abundance speciesin
low-abundance species inthe
thesoil
soilfungal
fungalcommunity,
community,thereby
thereby
enhancing
enhancing community
community diversity and species
diversity and species distribution
distributionuniformity.
uniformity.TheTheNMDSNMDSmap map
(Figure
(Figure7b)
7b)illustrates
illustrates that
that the
the four
four replicates
replicates of of each
eachvegetation
vegetationreclamation
reclamationtype
typeclustered
clustered
together,
together,indicating
indicating good repeatability
repeatability ofof the
thefungal
fungalcommunity
communitystructure
structuresamples
samples inin this
this
study,
study, with
with aa minimal
minimalstress
stresscoefficient
coefficient (0.042).
(0.042). AtAt
thethe
ASVASV level,
level, thethe fungal
fungal communities
communities in
inB B and
and MBMB distinctly
distinctly separated
separated fromfrom
CK, CK, indicating
indicating that
that B. B. subtilis
subtilis application
application signifi-
significantly
alters soil fungal communities.
cantly alters soil fungal communities.

500 a
1.0
a a
b
450 b a a
Simpson index
a 0.9
Chao1 index

400
350 0.8
300
0.7
250
200 0.6

6 a 450
a
b b ab 400
Observed ASVs
Shannon index

5 a a
ab
350
4
300
3 250
200
2
150
CK M B MB CK M B MB
(a) (b)
Figure
Figure7.7.Soil
Soilfungal communities’ α
fungalcommunities’ diversity (a)
α diversity (a) and
andNMDS
NMDSanalysis
analysis(b)
(b)under
underdifferent
different regulatory
regulatory
measures. CK denotes untreated irrigation, M denotes magnetized ionized water irrigation,
measures. CK denotes untreated irrigation, M denotes magnetized ionized water irrigation, B denotes B de-
notes untreated water irrigation with 45 kg ha −1 B. subtilis, and MB denotes magnetized water irri-
untreated water irrigation with 45 kg ha−1 B. subtilis, and MB denotes magnetized water irrigation
gation with 45−kg ha−1 B. subtilis. The data represent the average of the four replicates. Errors bars
with 45 kg ha 1 B. subtilis. The data represent the average of the four replicates. Errors bars indicate
indicate standard errors. Different le ers above the bars indicate significant differences among treat-
standard errors. Different letters above the bars indicate significant differences among treatments at
ments at p < 0.05.
p < 0.05.

Taxonomic
Taxonomic analysis yielded3573
analysis yielded 3573ASVs
ASVs from
from 1616 selected
selected samples
samples acrossacross
four four regula-
regulatory
tory measures, categorized into 15 phyla. Despite similar main fungal communities
measures, categorized into 15 phyla. Despite similar main fungal communities in soil under in soil
under different regulatory measures, significant variations in relative abundance
different regulatory measures, significant variations in relative abundance were observed. were ob-
served.
The topThe top 10phyla,
10 fungal fungalasphyla,
depictedas in
depicted
Figure 8,inconstituted
Figure 8, constituted
the majoritythe majority
of the of the
soil fungal
soil fungal community.
community. The dominantThe dominant
phyla werephyla were Ascomycota,
Ascomycota, Basidiomycota,
Basidiomycota, Mortierel-
Mortierellomycota,
lomycota, and unclassified_fungi,
and unclassified_fungi, with
with relative relative abundances
abundances of 53.3–76.2%,of 53.3–76.2%, 1.7–6.8%,and
1.7–6.8%, 4.3–6.5%, 4.3–
6.5%, and respectively.
1.8–2.8%, 1.8–2.8%, respectively. Regulatory
Regulatory measures didmeasures did notimpact
not significantly significantly impact
the relative abun-the
relative
dance ofabundance
Ascomycota of and
Ascomycota and unclassified_fungi.
unclassified_fungi. However,
However, B. subtilis B. subtilis
significantly signifi-
affected
cantly affected
the relative the relative
abundance abundance of Basidiomycota,
of Basidiomycota, reducing
reducing it by 68.8% it by 68.8%
compared to CKcompared
and by
to74.1%
CK and by 74.1%
compared to compared to MB. This
MB. This suggests that suggests
B. subtilisthat B. subtilismay
application application
inhibit themay inhibit
relative
the relative abundance of Basidiomycota. The soil fungal community was further divided
abundance of Basidiomycota. The soil fungal community was further divided into 202 gen-
era. In Figure 9, the top 10 soil fungal genera’s relative abundance is shown
into 202 genera. In Figure 9, the top 10 soil fungal genera’s relative abundance is shown under various
regulatory
under measures.
various Among
regulatory them, Pseudeurotium,
measures. Among them,Botryotrichum,
Pseudeurotium,Nectria, and Hormiactis
Botryotrichum, Nectria,
were the dominant genera, with relative abundances of 13.0–37.0%, 3.5–13.6%, 2.2–7.9%,
and Hormiactis were the dominant genera, with relative abundances of 13.0–37.0%, 3.5–
and 3.3–6.2%, respectively. Notably, B and MB treatment significantly increased the relative
13.6%, 2.2–7.9%, and 3.3–6.2%, respectively. Notably, B and MB treatment significantly
abundance of Pseudeurotium compared to CK and M by an average of 235.7%, indicat-
increased the relative abundance of Pseudeurotium compared to CK and M by an average
ing a significant promotional effect of B. subtilis application on the relative abundance of
of 235.7%, indicating a significant promotional effect of B. subtilis application on the rela-
Pseudoeurotium.
tive abundance of Pseudoeurotium.
Plants 2024, 13, x FOR PEER REVIEW 9 of 25

Plants 2024, 13, x FOR PEER REVIEW 9 of 25

Plants 2024, 13, 2458 9 of 24
100% Others 100% a Ascomycota a Basidiomycota
10%
Rozellomycota
90% a a
100%
Monoblepharomycota
Glomeromycota
Others
80%
100% a a
Ascomycota a Basidiomycota 8%
10%
80%
Mucoromycota
Rozellomycota
Kickxellomycota 60% a a 6%
90% a
(Phylum)

Monoblepharomycota
Chytridiomycota
Glomeromycota
80% a 8%
70%
80%
unclassified_Fungi
Mucoromycota 40%
60% a b 4%
b 6%
Mortierellomycota
Kickxellomycota
(Phylum)

Basidiomycota
Chytridiomycota
60% Ascomycota 20% 2%
70% unclassified_Fungi
40% b 4%
abundance

Mortierellomycota
50% Basidiomycota 0% b 0%
60% Ascomycota 20% Mortierellomycota unclassified_Fungi 2%
a
abundance

8% 6%
40%
50% 0% a 0%
b
Relative

Mortierellomycota unclassified_Fungi
30% 6%
8% b a a a 6%
40% b a 4%
4% b
Relative

20% 6% b a
30% a a 4%
10%
b 2%
20% 2%
4% a
0% 2%
10% CK M B MB 0%
2% 0%
CK M B MB CK M B MB
0%
CK M B MB 0% 0%
Figure 8. Relative abundance of fungalCK M B composition
community MB CK Mat the B top MB10 phylum level under
different regulatory measures. CK denotes untreated irrigation, M denotes magnetized ionized wa-
Figure 8. Relative abundance of fungal community composition at the top 10 phylum level under
Figure 8. Relative
ter irrigation, abundance
B denotes of fungal
untreated watercommunity
irrigation withcomposition
45 kg ha −1atB.the top 10and
subtilis, phylum level under
MB denotes mag-
different regulatory measures. CK denotes untreated irrigation, M denotes magnetized ionized
different regulatory
netized water measures.
irrigation with 45CK kgdenotes
ha B. untreated
−1 subtilis. The irrigation, M denotes
data represent the magnetized
average of
−1 B. subtilis, and MB denotes
ionized
the four wa-
repli-
water irrigation, B denotes untreated water irrigation with 45 kg ha−1
ter irrigation,
cates. B denotes
Errors bars untreated
indicate standard water
errors.irrigation
Different with le 45
erskg ha
above B.
thesubtilis,
bars and
indicateMB denotes
significant mag-
dif-
magnetized water irrigation with 45 kg−1ha−1 B. subtilis. The data represent the average of the four
netized water irrigation with 45 kg ha B. subtilis. The data represent the average
ferences among treatments at p < 0.05. “Others” refers to fungal species that have been classified but of the four repli-
replicates. Errors bars indicate standard errors. Different letters above the bars indicate significant
cates.
do notErrors
belong bars indicate
to the main standard
groups oferrors.
interest Different le ers“Unclassified
in our study. above the bars indicate
fungi” significant
includes fungaldif-
se-
differences among treatments at p < 0.05. “Others” refers to fungal species that have been classified
ferences
quences among treatments
that could at p < 0.05. “Others”
not be accurately classified refers to fungal
at a finer species
taxonomic thatdue
level havetobeen classified
limitations in but
the
but do not belong to the main groups of interest in our study. “Unclassified fungi” includes fungal
do not belong
available to theormain
database groups
sequence of interest
similarity. in our
These study.
fungi could “Unclassified
not be assigned fungi”
to aincludes fungal se-
specific taxonomic
sequences that could not be accurately classified at a finer taxonomic level due to limitations in the
quences
group that could not
beyond a broad level. be accurately classified at a finer taxonomic level due to limitations in the
available database or sequence similarity. These fungi could not be assigned to a specific taxonomic
available database or sequence similarity. These fungi could not be assigned to a specific taxonomic
group beyond a broad level.
group beyond a broad level.

(a) (b)
Figure 9. Relationships
(a)
Figure 9. Relationships between
betweendominant
dominantfungal
fungal genus and regulatory
genus and regulatorymeasures
(b) measures (a)(a)
andand
heatheat map
of dominant genus of fungal communities under different regulatory measures
map of dominant genus of fungal communities under different regulatory measures (b). CK de- (b). CK denotes un-
Figure
treated 9. Relationships
notesirrigation,
untreated M between dominant
denotesMmagnetized
irrigation, fungal genus
ionized water
denotes magnetized and regulatory
ionizedirrigation, measures
B denotes
water irrigation, (a)
untreated
B denotes and heat map
water irriga-
untreated
of dominant
tionwater genus
with irrigation
45 kg of
B. fungal
ha−1with 45 kg communities
subtilis, and
ha −1 MB under
denotes
B. subtilis, different
magnetized
and MB denotesregulatory
water measures
irrigation
magnetized with
water (b).
45 kgCK
irrigation hadenotes
with un-
−1 B. subtilis.

treated
45 kgirrigation,
− 1 M denotes magnetized ionized water irrigation, B denotes untreated water irriga-
ha B. subtilis.
tion
2.4. with
Relationship B. subtilis,
45 kg ha−1between and MBand
Bacterial denotes
Fungal magnetized
Communitieswaterand
irrigation with 45 kg ha −1 B. subtilis.
Soil Properties
The examination shows intricate connections between soil properties and the com-
2.4. Relationship between Bacterial and Fungal Communities and Soil Properties
position of microbial communities (Figure 10). Soil bulk density (BD) and field capacity
(FC) The examination
are negatively shows intricate
correlated. connections
Specifically, soil pHbetween
and salt soil properties
content andan
(SC) have theinverse
com-
position of microbial communities (Figure 10). Soil bulk density (BD) and field capacity
 Plants 2024, 13, 2458 10 of 24

Plants 2024, 13, x FOR PEER REVIEW 10 of

2.4. Relationship between Bacterial and Fungal Communities and Soil Properties
The examination shows intricate connections between soil properties and the composi-
+ and field - capacity (FC) are
effect microbial
tion of on the nutrient
communitieslevels in the10).
(Figure soil,
Soilincluding
bulk densityNH 4 -N, NO3 -N, available P (AP), to
(BD)
negatively correlated. Specifically, soil pH and salt content (SC) have an inverse effect on
P (TP), available K (AK), and soil organic ma er (SOM). The top four bacterial genera
the nutrient levels in the soil, including NH4+ −N, NO3− −N, available P (AP), total P (TP),
relative abundance (Bacillus, Pseudomonas, Methylphaga, and Streptomyces) and the top fo
available K (AK), and soil organic matter (SOM). The top four bacterial genera in relative
fungal genera
abundance (Bacillus, Pseudomonas, Botryotrichum,
(Pseudeurotium, Methylphaga, andNectria, and Hormiactis)
Streptomyces) and the top were selected for t
four fungal
bacterial
genera and fungalBotryotrichum,
(Pseudeurotium, matrices in Nectria,
the Mantel test. The were
and Hormiactis) test results
selected demonstrate
for the bacterialstrong c
relations
and fungal(rmatrices
> 0.5) between dominant
in the Mantel bacterial
test. The and demonstrate
test results fungal genera andcorrelations
strong soil BD, FC, pH, S
and
(r SOM.
> 0.5) Notably,
between dominantsignificant
bacterialcorrelations (p < 0.05)
and fungal genera were
and soil BD,observed
FC, pH, SC, between
and SOM. BD, FC, S
and SOM with dominant bacterial genera, as well as between BD, FC, and SC and dom
Notably, significant correlations (p < 0.05) were observed between BD, FC, SC, and SOM
with dominant bacterial genera, as well as between BD, FC, and SC and dominant fungal
nant fungal genera (p < 0.05). These findings suggest a broader ecological phenomen
genera (p < 0.05). These findings suggest a broader ecological phenomenon where soil
where soil
structure, structure,
salinity salinity and
and alkalinity, alkalinity,
and organic and
matter organicmicrobial
influence ma er influence
abundance. microbial
The abu
dance.thus
results Theimply
results thus imply
potential potential
strategies strategies
for enhancing for enhancing
microbial microbial
activity, such as managingactivity, su
as managing soil structure and salinity and alkalinity
soil structure and salinity and alkalinity and enriching organic matter.and enriching organic ma er.

Figure10.
Figure 10.Mantel
Manteltesttest analysis
analysis of dominant
of dominant bacterial
bacterial andgenus
and fungal fungal genus
and and soil properties.
soil properties.

2.5. Soil Quality Index

2.5. Soil Quality Index
The dimensionless values of soil indicators, standardized from their determined
values,The dimensionless
underwent values yielding
PCA analysis, of soil indicators,
two principalstandardized
componentsfromwith their determined v
eigenvalues
ues, underwent
exceeding PCA analysis,
1, and accounting yielding two
for a cumulative principal
variance components
contribution rate of with
78.9%.eigenvalues
The
ceeding 1, and accounting for a cumulative variance contribution rate of 78.9%. The d
distinct distribution of four regulation measures across different quadrants suggested
tinct distribution
significant individual ofeffects
four regulation measures
on soil quality across
(Figure 11). different
Principal quadrants
component suggested
1 (PC1), with sign
a variance contribution rate of 64.8%, showed higher loadings for BD, FC, SC, AP/TP,
icant individual effects on soil quality (Figure 11). Principal component 1 (PC1), with
SOM, and bacterial and fungal ASVs. Principal component 2 (PC2), contributing 15.3%
variancerevealed
variance, contribution
higherrate of 64.8%,
loadings for pH,showed
NH4+ −higher
N, NO3−loadings for and
−N, AP, AK, BD,bacterial
FC, SC, and
AP/TP, SO
fungal Shannon index. Selecting soil indicators with high loadings in both components varian
and bacterial and fungal ASVs. Principal component 2 (PC2), contributing 15.3%
+ -
revealedvalues
(absolute higherexceeding
loadings 90%for pH, NH
of the 4 -N, NO
highest 3 -N,
factor AP, AK,
loading) ledand
to abacterial
minimal and fungal Sha
dataset
non index. Selecting soil indicators with high loadings in both components (absolute v
(MDS) of key soil quality indicators (Figure 12). These key indicators (BD, FC, SC, SOM,
−
ues3 exceeding
NO 90% of
−N, AP, bacterial the highest
ASVs, and fungal factor
ASVsloading)
and Shannonled to a minimal
index) formed dataset
the basis(MDS)
for of k
calculating the SQI (Figure 13). All regulation measures significantly impacted (p < 0.01) -
soil quality indicators (Figure 12). These key indicators (BD, FC, SC, SOM, NO3 -N, A
the SQI compared to CK, with the M, B, and MB treatments increasing it by 0.21, 0.52, and
bacterial ASVs, and fungal ASVs and Shannon index) formed the basis for calculating t
0.69 units, respectively.
SQI (Figure 13). All regulation measures significantly impacted (p < 0.01) the SQI co
pared to CK, with the M, B, and MB treatments increasing it by 0.21, 0.52, and 0.69 un
respectively.
 Plants2024,
Plants 13,2458
2024,13, x FOR PEER REVIEW 11 11
of of
2524
Plants 2024, 13,
Plants 2024, 13, xx FOR
FOR PEER
PEER REVIEW
REVIEW 11
11 of
of 25
25

Figure
Figure 11. Principal component analysis of soil properties. CK denotes untreated irrigation, M
M de-
Figure11.
Figure 11.Principal
11. Principal
Principal component
component
componentanalysis of of
analysis
analysis soil
of properties.
soilsoil CKCK
properties. denotes
properties. denotes
CK untreated
denotes irrigation,
untreated irrigation,
untreated de-
M de-M
irrigation,
−1 B.
notes
notes magnetized
magnetized ionized
ionized water
water irrigation,
irrigation, BB denotes
denotes untreated
untreated water
water irrigation
irrigation with
with 45
45 kg
kg ha
ha −1 B. −1
notes magnetized
denotes
subtilis, magnetized
and MB
ionized
denotes
water
ionized water
magnetized
irrigation,
irrigation,
water
B Bdenotes
irrigationdenotesuntreated
with untreated
45
water
water irrigation
irrigation
−1 B. subtilis.
with
with 45
45 kg
kg ha−B.
ha 1 B.
subtilis,
subtilis, and
andMBMB denotes
denotes magnetized
magnetized water
waterirrigation
irrigationwith 45 kg
with kg
45
ha
ha−1ha
kg B.−1−subtilis.
B.
1 subtilis.
subtilis, and MB denotes magnetized water irrigation with 45 kg ha B. subtilis.

Figure
Figure 12.
12. Loading vectors of soil properties.
Figure 12. Loading
Loadingvectors
vectorsofofsoil properties.
soil properties.
Figure 12. Loading vectors of soil properties.
1.0
1.0
aa
1.0
a
0.8
0.8
0.8 bb
index

b
indexindex

0.6
0.6
quality
Soilquality

0.6
0.4
Soil quality

0.4 cc
Soil

0.4 c
0.2 dd
0.2

0.2 d
0.0
0.0 CK
CK M
M B
B MB
MB
0.0 13.Effects
Figure
Figure 13.
Figure Effectsof
13. Effects
CK ofofregulatory
regulatory
regulatory
M measures
measures
measures
B on soil
onon quality
soilsoil
quality
MB index.
quality CK
CK denotes
index.
index. untreated
CK denotes
denotes irrigation,
untreated
untreated M
irrigation,
irrigation, M M
denotes magnetized
denotes magnetized ionized
magnetized ionized water
ionizedwater irrigation,
waterirrigation, B denotes
irrigation,BBdenotes untreated
denotesuntreated water
untreatedwater
waterirrigation
irrigation with
with
irrigation with45 kg
45 45 ha
kgkg
−1 −1
haha B.
−1
Figure 13. Effects of regulatory measures on soil quality index. CK denotes untreated irrigation, M
subtilis, and MB denotes magnetized water irrigation with 45 kg ha−1 B. subtilis. The data represent
denotes magnetized ionized water irrigation, B denotes untreated water irrigation with 45 kg ha −1
the average of the three replicates. Errors bars indicate standard errors. Different letters above the
bars indicate significant differences among treatments at p < 0.01.
Plants 2024, 13, 2458 12 of 24

2.6. Cotton Yield Component and Quality

This study uncovered statistically significant effects (p < 0.05) of various regulatory
measures on cotton yield and quality, emphasizing the crucial role of management strate-
gies in cotton production (Table 1). Specifically, M, B, and MB demonstrated substantial
improvements in both yield and quality, surpassing CK. Compared to CK, cotton yield
increased significantly under M, B, and MB treatments by 5.7%, 14.8%, and 20.1%, respec-
tively. Similarly, the number of bolls per plant saw significant increases of 8.7%, 6.6%, and
32.7%, respectively, under the same treatments. This suggests a synergistic effect when
employing magnetized water and B. subtilis together, thereby highlighting the potential
of integrated management practices in cotton cultivation. Moreover, cotton quality also
exhibited improvements. This was evident from the upper half mean length of cotton fibers
increasing by 0.1%, 7.8%, and 17.5% for M, B, and MB treatments, respectively. Further-
more, the uniformity index and specific breaking strength improved across all treatments.
In contrast, the micronaire value decreased across all treatments, with the MB treatment
showing a notable 6.3% reduction.

Table 1. Effects of regulatory measures on the production and quality of cotton.

Index CK M B MB
Seed cotton yield (kg ha−1 ) 6045.77 c ± 36.77 6390.49 bc ± 503.15 6941.02 ab ± 235.97 7260.63 a ± 516.86
Boll number per plant 3.91 b ± 0.20 4.25 b ± 0.25 4.17 b ± 0.11 5.19 a ± 0.41
Upper half mean length (mm) 27.16 c ± 0.53 27.19 c ± 0.39 29.27 b ± 0.51 31.92 a ± 0.43
Uniformity index (%) 77.80 d ± 0.59 80.44 c ± 0.66 82.12 b ± 0.84 85.69 a ± 0.69
Specific breaking strength (cN tex−1 ) 29.09 b ± 1.20 30.73 b ± 0.72 30.41 ab ± 1.84 32.54 a ± 1.02
Micronaire value 5.08 a ± 0.08 4.92 ab ± 0.17 4.90 ab ± 0.16 4.76 b ± 0.10
Note: CK denotes untreated irrigation, M denotes magnetized ionized water irrigation, B denotes untreated water
irrigation with 45 kg ha−1 B. subtilis, and MB denotes magnetized water irrigation with 45 kg ha−1 B. subtilis. The
data represent the average of the three replicates. Different letters within a column indicate significant differences
among all treatments at p < 0.05.

A partial least squares path analysis model incorporating variables such as soil physical
properties, salinity and alkalinity, nutrients, microorganisms, and cotton yield and quality
was developed, as illustrated in Figure 14. The analysis demonstrates that soil physical
properties, nutrients, and microorganisms exert a positive influence on both cotton yield
and quality, whereas soil salinity and alkalinity negatively affect these parameters. The
hierarchy of influence on cotton yield is as follows: soil salinity and alkalinity > soil
nutrients > soil microorganisms > soil physical properties. Conversely, the hierarchy of
influence on cotton quality is as follows: soil salinity and alkalinity > soil microorganisms
> soil nutrients > soil physical properties. A linear regression model was constructed to
elucidate the correlation between soil quality and both cotton yield and quality (Table 2). In
this model, relative cotton yield and relative quality (Equations (5) and (6)) were designated
as dependent variables, whereas the soil quality index (SQI) was defined as the independent
variable. Upon establishing the model, the slope was computed, revealing a relationship
where yield surpasses quality. This implies that the soil quality index exerts a more
significant enhancement effect on cotton yield compared to cotton quality.

Table 2. Relationship between yield and quality of cotton and soil quality index.

Cotton Production Index Linear Function Model Average Slope R2 RMSE

Seed cotton yield yY = 0.24SQI + 0.80 0.99 0.01
Yield 0.26
Boll number per plant yB = 0.28SQI + 0.70 0.66 0.08
Upper half mean length yL = 0.21SQI + 0.86 0.83 0.03
Uniformity index yU = 0.12SQI + 0.89 0.94 0.01
Quality 0.13
Specific breaking strength yS = 0.12SQI + 0.88 0.74 0.03
Micronaire value yM = 0.08SQI + 0.93 0.88 0.01
Plants 2024, 13, x FOR PEER REVIEW 13 of 25
Plants 2024, 13, 2458 13 of 24

Figure 14. Partial least squares path modeling for the interaction between soil salinity and alkalinity,
Figure 14. Partial
nutrients, least squares
microorganism, path
cotton modeling
yield, for the interaction between soil salinity and alkalinity
and quality.
nutrients, microorganism, co on yield, and quality.
3. Discussion
Table
3.1. 2. Relationship
Effects between
of Magnetized yield
Ionized andonquality
Water of co onand
Soil Properties and soilProduction
Crop quality index.
Magnetization and ionization can alter the physical properties of irrigation water, such
Co on Production as
Index
the surface tension and Linear Function
viscosity Model
coefficient. Ding etAverage Slope
al. [22] found R2
that magnetization RMSE
Seed co on yield
increases water viscosity dueyY =to0.24SQI + 0.80of a magnetic field. This alteration
the influence 0.99 stems 0.01
Yield in hydrogen ybonds
0.26
Boll number
from per plant
changes B = 0.28SQI
within +water
0.70 molecules, affecting their interaction
0.66 and 0.08
modifying water’s properties. Liu et al. [23] discovered that magnetized water can ex-
Upper half mean length yL = 0.21SQI + 0.86 0.83 0.03
perience a surface tension reduction of up to 25%. These property changes improve the
Uniformity index yU = 0.12SQI
water. Al+et0.89 that magnetized0.94
water has a 0.01
Quality infiltration capacity of irrigation al. [24] suggested0.13
Specific breaking strength
collectively beneficial impactyS =on0.12SQI + 0.88 properties of soil. Khoshravesh
the infiltration 0.74
et al. [25] 0.03
Micronaire value
observed that the total yM = 0.08SQI + 0.93
water penetration rates were 37.6 and 20 cm after 4 0.88 water 0.01
h for
treated with magnetization and untreated water in silty loam soil. The eventual infiltration
rates were 0.06 and 0.04 cm min−1 , respectively. Hamza et al. [26] showed that magne-
3. Discussion
tized water reduced leaching times and necessary water amounts to decrease soil salinity
3.1.and
Effects of Magnetized
alkalinity Ionized
to acceptable Water
levels, on Soilthat
indicating Properties and Crop
magnetized waterProduction
enhances leaching
Magnetization and ionization can alter the physical properties of irrigation
efficiency and conserves water. Abdul et al. [27] found that using magnetized water for water,
irrigation can increase the EC value and pH of soil leachate by 58.6% and 2.4%, respectively.
such as the surface tension and viscosity coefficient. Ding et al. [22] found that magneti-
This method, which employs magnetized ionized water, mitigates soil salinity stress and
zation increases water viscosity due to the influence of a magnetic field. This alteration
facilitates crop nutrient absorption. However, this promotional effect, under identical
stems from and
irrigation changes in hydrogen
fertilization bonds
conditions, maywithin
result inwater
the Mmolecules,
treatment inaffecting their
comparison to interaction
CK
and modifying water’s properties. Liu et al. [23] discovered that magnetized
(Figures 2 and 3). Magnetized ionized water augments soil moisture content, improves water can
experience a surface tension reduction of up to 25%. These property changes improve the
infiltration capacity of irrigation water. Al et al. [24] suggested that magnetized water has
a collectively beneficial impact on the infiltration properties of soil. Khoshravesh et al. [25]
observed that the total water penetration rates were 37.6 and 20 cm after 4 h for water
Plants 2024, 13, 2458 14 of 24

mineral element solubility, and reduces soil salinity and alkalinity. These conditions foster a
favorable environment for microbial communities, encouraging the proliferation of diverse
microorganisms. Furthermore, applying a magnetic field to irrigation water was found to
influence soil microbial structure and abundance. [28] Cui et al. [29] found that magnetized
water irrigation significantly enhanced the Chao1 and ACE indices by 21.4% and 23.4%,
respectively, compared to non-magnetized water treatment. This increase suggests that
magnetized water benefits the richness of soil’s bacterial community, thereby altering its
structure. Consistent with previous studies, this study demonstrated that using magnetized
ionized water for irrigation led to a notable enhancement in the abundance and variety of
soil bacteria and fungi. This improvement fosters an optimal soil environment, promoting
cotton growth and development while increasing its productivity (Table 1). Corroborating
these findings, Zhou et al. [17,30] and Wei et al. [11] demonstrated that using magnetized
and ionized water for irrigation led to an average increase in cotton yield of 22.4% and
21.5%, respectively, in field experiments spanning more than two years. To maximize the
effectiveness of the magnetized ionized treatment, this research team has summarized long-
term experimental results to propose the technical requirements for magnetized ionized
treatment [31]. The effective magnetic field strength at the center position of the agricultural
magnetic water device’s pipeline should be between 0.3 and 0.4 T, with the shell’s leakage
magnetic field strength at ≤ 2 mT and the effective magnetic length along the pipeline
being ≥ 60 cm. The magnetic water device should be installed on the main pipeline or the
trunk and branch pipelines of the irrigation system, with the front and rear ends connected
to the inlet and outlet of the water conveyance pipe, ensuring that the water is effectively
magnetized as it flows through the pipe, without the need for additional energy input.
The pipeline flow rate should be ≥ 0.5 m s−1 and the effective area used by the magnetic
device should be within 1000 m2 . Future studies should involve continuous multi-year
experiments to investigate whether long-term irrigation with magnetized ionized water
affects the magnetism of soil particles, as well as the effects of magnetized soil particles on
the behavior of conventional water in the soil, facilitating further research discoveries.

3.2. Effects of B. subtilis on Characteristics of Soil and Yield of Crops

The metabolism of the microbial community can be altered by the interactions be-
tween B. subtilis and other microbes, leading to changes in structure and function. This
suggests that B. subtilis influences the broader microbial ecosystem, contributing to micro-
bial diversity [32]. This study further demonstrates that B. subtilis application significantly
enhances bacterial and fungal community diversity, with notable differences compared to
its absence (Figures 6 and 9). At the bacterial genus level, B. subtilis significantly increases
the relative abundance of Bacillus, Pseudomonas, and Methylophaga, and, at the fungal genus
level, Pseudoeurotium (Figures 8 and 11). The increased relative abundance of Bacillus
indicates successful colonization of the soil by the applied B. subtilis. This bacterium can
produce plant hormones to stimulate crop growth and participate in nutrient cycling by
decomposing soil organic matter [19,33]. Microorganisms are required to break down soil
organic nutrients into inorganic forms so that crops can absorb and use them. However,
high salt concentrations in saline soils can stress many soil microorganisms, limiting their
growth and activity. Soil microorganisms, instrumental in decomposing organic matter
and cycling nutrients such as nitrogen, phosphorus, and sulfur, contribute to nutrient
availability. However, inhibiting these microorganisms decelerated the natural nutrient
cycling process, thereby reducing nutrient conversion rates and availability. B. subtilis,
a bacterium that generates stress-resistant spores, maintains activity under prolonged
salt stress [34]. This bacterium enhances soil inorganic nutrient content by decomposing
organic nutrients. In addition, B. subtilis secretes acidic substances, including organic
acids, which dissolve insoluble soil phosphates like calcium phosphate and iron phos-
phate [35,36], thereby increasing available phosphorus. The current study corroborates
this, showing that B. subtilis application boosts the proportion of available phosphorus in
total phosphorus (Figure 3). Additionally, B. subtilis application reportedly reduced soil
Plants 2024, 13, 2458 15 of 24

salt content by secreting extracellular polymers that bind soil particles, which facilitate
large aggregate formation, improve soil structure, and promote salt leaching [37]. Zhou
et al. [38] reported that applying B. subtilis can reduce soil salinity by 11–31% compared to
the blank control. Moreover, Bacillus species function as biocontrol agents by generating
a variety of antimicrobial compounds that target plant pathogens, thereby reducing the
requirement for chemical pesticides, lowering the environmental footprint of agriculture,
and mitigating the risk of chemical residues in food [39]. Other bacterial genera, including
Pseudomonas, Metrophaga, and Streptomyces, also contribute to crop growth promotion, soil
nutrient cycling, and biological control [40–47]. Although the fungal genus Pseudoeurotium’s
role in soil ecosystems is not explicitly defined, its potential ecological significance in soil
environments is evident [48,49]. The B. subtilis activity in soil decreases soil salinity and
pH, increases nutrient content, and fosters a favorable environment for diverse beneficial
microorganisms and increases microbial diversity, thereby improving soil quality and
cotton production (Table 1). Zhao et al. [50] reported a 6.1% cotton yield increase with B.
subtilis application. Furthermore, Zhu et al. [51] demonstrated that B. subtilis utilization
significantly enhances specific breaking strength by 6.9% and cotton fiber length by 4.3%,
indicating a significantly improved cotton quality (p < 0.05).

3.3. Soil Properties and Soil Quality

Soil salt content and pH, considered “master soil variables”, influence various proper-
ties. The phenomenon of salt leaching in this study can be explained as illustrated in Figure
S1. The soil water content in the 0–40 cm soil layer at the cotton boll stage was ranked as
MB > B > M > CK. This suggested that the treatment M alone was effective in enhancing
soil water content compared to CK, although less effective than when combined with B.
subtilis. Moreover, the increased soil water in the 0–40 cm soil layer indicated that there
was indeed sufficient water to affect chemical and physical processes in the soil, including
salt leaching, as evidenced by the reduction in soil salinity within this layer (Section 2.1.2).
Elevated soil pH and salt levels can cause deficiencies in essential nutrients due to reduced
solubility and availability. For instance, phosphorus availability decreases in highly alkaline
soils as it can form calcium phosphate precipitates [52]. Moreover, microbial processes
crucial for organic matter decomposition, nitrogen fixation, and nutrient cycling can be
inhibited or altered in saline soils, potentially impairing soil fertility and plant growth [53].
The results of this research also indicated that the levels of soil pH and salt had adverse
effects on the availability of nutrients in the soil (Figure 10). Furthermore, there is a notable
relationship (p < 0.05, Mantel’s r > 0.5) between the salt levels in the soil and the relative
abundance of microbes (bacteria and fungi) (Figure 10). In the comparative analysis, bacte-
ria exhibit a higher correlation with soil salt content than fungi. This observation may be
attributable to the enhanced ability of fungi to cope with high osmotic pressures arising
from elevated concentrations of organic substrates [54]. Rath et al. [55] revealed that fungi
were more resistant to salt exposure than bacteria, and this study also demonstrates that
fungi contribute more significantly to microbial communities than bacteria (Figure 14).
In addition, soil organic matter also significantly impacts (p < 0.05) soil microorganisms,
primarily because it serves as a major carbon, nitrogen, and energy source. Abundant
organic matter promotes microbial growth and reproduction [56] and significantly affects
the composition and structure of soil fungal and bacterial communities [57]. By stimulating
beneficial microorganisms, organic matter enhances disease suppression and plant growth
promotion, which is vital for sustainable agricultural practices [58].
The soil quality index (SQI), a comprehensive measure of soil productivity and health,
plays a crucial role in directing environmentally friendly farming techniques [59,60]. Factors
such as soil physical properties (BD and FC), salinity and alkalinity, nutrients (nitrogen,
phosphorus, potassium, and SOM), and microbial diversity (bacteria and fungi) variably
impact soil quality. These elements influence soil fertility and its ability to sustain plant
and microbial life, with microorganisms playing crucial roles in the decomposition of
organic matter and cycling of nutrients [61,62]. This study employed principal component
Plants 2024, 13, 2458 16 of 24

analysis to identify key soil quality indicators, including BD, FC, SC, SOM, bacterial
ASVs, fungal ASVs, NO3− −N, AP, and the fungal Shannon index to calculate the soil
quality index. The findings indicated that the utilization of magnetized ionized water for
irrigation along with B. subtilis had a significant impact (p < 0.01) on enhancing soil quality
(Figure 13). This enhancement may be attributable to the reduction in soil salinity and
alkalinity and the increased diversity of soil microorganisms. Notably, SQI under B. subtilis
was significantly superior to that under magnetized ionized water irrigation (p < 0.01).
This difference may be due to the increased soil nutrients observed under B. subtilis. This
outcome demonstrates the synergistic effect of the two methods, which enhanced soil health
and promoted its sustainable use. Corroborating this, Grumezescu et al. [63] underscored
the role of magnetic materials in boosting microbial activity. This study revealed that the
escalation in the SQI had a more pronounced effect on cotton yield than on cotton quality
(Table 2). This discrepancy could be attributed to the critical role of major soil nutrients,
particularly nitrogen, phosphorus, and potassium, in cotton growth. The increase in soil
microbial diversity facilitated soil nutrient cycling and availability, which reduced soil
salinity and alkalinity, thereby promoting nutrient absorption in cotton. These nutrients
play direct roles in cotton biosynthesis, such as nitrogen’s contribution to protein synthesis,
phosphorus’s role in cell division and organ differentiation, and potassium’s enhancement
of water regulation and disease resistance. The augmentation of these nutrients significantly
boosts cotton growth and boll number, consequently increasing cotton yield. Conversely,
while cotton quality also necessitates adequate nutritional support, it is more profoundly
influenced by genetic factors and pest control.

4. Materials and Methods

4.1. Description of the Experimental Site
This field study was conducted in 2023 at the 7th company of the 8th regiment in
Alar City, southern Xinjiang, China (N 40◦ 37′ 32.26′′ , E 80◦ 52′ 57.78′′ ). Alar City, known for
its warm temperate climate and extreme continental arid desert conditions, experiences
significant diurnal temperature variations. In the cotton growing season of April to Septem-
ber 2023, the average daily temperature was 23.3 degrees Celsius, and there was a total
rainfall of 13.5 mm (Figure 15). The soil properties within a 0–40 cm profile are detailed
in Table 3. Prior to sowing, the average electrical conductivity from the top 40 cm of soil
−1
Plants 2024, 13, x FOR PEER REVIEW 3.5 dS m , indicating the soil was moderately saline [64]. The average pre-sowing
was 17 of 25
soil chemical properties across the 0–40 cm profile were alkali-hydrolyzed nitrogen at
70.3 mg kg−1 , potassium available at 190.1 mg kg−1 , phosphorus available at 39.3 mg kg−1 ,
organic matter at 11.7 −1 , and pH at 8.0.
g kgpoint;
θWP is the permanent wilting θFC is the field capacity; and θs is the saturated soil water content.

35 25
Precipitation
Air temperature
30
- - - - Average air temperature 20

25
Air temperature/℃

Precipitation/mm

15
20

15
10

10

5
5

0 0
1-Apr 16-Apr 1-May 16-May 31-May 15-Jun 30-Jun 15-Jul 30-Jul 14-Aug 29-Aug 13-Sep 28-Sep

Figure15.
Figure 15.Average
Averagedaily
daily temperature
temperature and
andrainfall
rainfallthroughout
throughoutthe cocotton
the on growth season.
growth season.

4.2. Magnetized Ionized System for Irrigation Water Treatment

The canal water, originating from Tianshan Mountains’ meltwater, underwent filtra-
tion and pressurization in the pump room before flowing into the field through buried
pipelines. At the field pipeline outlet, a 90 mm polyethylene (PE) pipe connected to a mag-
 30
- - - - Average air temperature 20

25

Air temperature/℃

Precipitation/mm
15
202458
Plants 2024, 13, 17 of 24

15
10
Table 3. Physical characteristics of the soil at the test location.
10
Soil Water Content
Particle Composition Bulk 5
Soil Layer (cm3 cm−3 )
5 Soil texture Density
(cm)
Clay (%) Silt (%) Sand (%) (g cm−3 ) θWP θFC θS
0–20 0 12.18 79.11 8.60 Silty loam 1.46 0.042 0.31 0 0.41
20–40 1-Apr 12.66
16-Apr 1-May
81.9316-May 31-May
5.42 15-Jun
Silty30-Jun
loam 15-Jul 30-Jul
1.52 14-Aug 0.042
29-Aug 13-Sep0.33
28-Sep 0.41
θFigure 15.permanent
WP is the Average daily temperature
wilting point; θ FC isand
the rainfall throughout
field capacity; and θ sthe co saturated
is the on growthsoilseason.
water content.

4.2. Magnetized
4.2. MagnetizedIonized
IonizedSystem
SystemforforIrrigation Water
Irrigation Treatment
Water Treatment
The canal
The canalwater,
water,originating
originating from
from Tianshan
TianshanMountains’ meltwater,
Mountains’ underwent
meltwater, underwentfiltra-filtra-
tion and
tion and pressurization
pressurizationininthethepump
pump room
roombefore flowing
before intointo
flowing the the
fieldfield
through buried
through buried
pipelines. At the field pipeline outlet, a 90 mm polyethylene (PE) pipe connected
pipelines. At the field pipeline outlet, a 90 mm polyethylene (PE) pipe connected to a mag- to a mag-
netized ionized
netized ionized device
devicewas
wasinstalled.
installed.The magnetized
The ionized
magnetized system
ionized (Xi’an
system Wangkaiyue
(Xi’an Wangkaiyue
Metal Products Co., Ltd., Xi’an, China) comprised a magnetized device, ground electrode,
Metal Products Co., Ltd., Xi’an, China) comprised a magnetized device, ground electrode,
and conductor (Figure 16). Utilizing a permanent rubidium magnet ring with a magnetic
and conductor (Figure 16). Utilizing a permanent rubidium magnet ring with a magnetic field
field intensity of 3000 Gs, the magnetizer achieved a grounding resistance of 5 Ω, connect-
intensity of 3000 Gs, the magnetizer achieved a grounding resistance of 5 Ω, connecting the
ing the ground bolt to the ground electrode through a wire. The canal water, not passing
ground bolt to the ground electrode through a wire. The canal water, not passing through
through the magnetized ionized system, is termed non-magnetized–ionized water
the magnetized ionized system, is termed non-magnetized–ionized water (NMIW), while
(NMIW), while water passing through is magnetized ionized water (MIW) (Figure 17).
water passing through
Magnetization is magnetized
and ionization treatmentionized
altered water (MIW)
the water (Figure
surface 17).from
tension Magnetization
66.8 to 64.0 and
ionization treatment altered the water surface tension from 66.8 to 64.0 mN m −1 in this study.
mN m in this study.
−1

Plants 2024, 13, x FOR PEER REVIEW 18 of 25

Figure 16.
Figure 16. Magnetized
Magnetizedionized
ionizedsystem.
system.

Figure
Figure 17.
17.Schematic
Schematicdiagram
diagramofof
thethe
drip irrigation
drip system
irrigation arrangement
system of the
arrangement ofexperiments.
the experiments.

4.3. Field Management and Experimental Design

On 16 April 2023, co on cultivar Tahe No.2 (Gossypium hirsutum L.) was cultivated
and subsequently harvested on 20 September 2023. There were 180,000 plants per hectare,
each spaced 10 cm apart. This cultivation employed a drip irrigation system and plastic
 Plants 2024, 13, 2458 18 of 24

4.3. Field Management and Experimental Design

On 16 April 2023, cotton cultivar Tahe No.2 (Gossypium hirsutum L.) was cultivated and
subsequently harvested on 20 September 2023. There were 180,000 plants per hectare, each
spaced 10 cm apart. This cultivation employed a drip irrigation system and plastic film
mulch, as depicted in Figures 18 and 19. The drip irrigation system followed a sequential
row spacing pattern of 10 cm (outside narrow), 60 cm (wide), 10 cm (inside narrow), 60 cm
(wide), and again 10 cm (outside narrow). Two irrigation lines were placed every six rows,
beneath a 1.5 m wide plastic covering with a 50 cm space between each covering. The
1.6 cm diameter drip lines had emitters spaced 30 cm apart. The irrigation scheduling of
this experiment was regulated by the local government to ensure the reasonable allocation
of water resources in Xinjiang. The irrigation interval ranges from 7 to 10 days. There
is no specified amount of water to be used during irrigation, as each irrigation event is
restricted by local government regulations to last no longer than 5 h. In this experiment,
each irrigation lasted a full 5 h. Irrigation commenced on 6 June 2023, with a total water
Plants
Plants 2024, 13,13,
2024, x FOR
x FOR PEER
PEER REVIEW
REVIEW 1919ofof2525
application of 539 mm recorded. The irrigation scheduling of this experiment is shown in
Figure 20.

Figure18.
Figure
Figure 18.Locations
18. Locationsof
Locations ofofcocoononplanting.
cotton planting.
planting.

Figure19.
Figure
Figure 19.Experimental
19. Experimentalsite.
Experimental site.
site.

600
600
The
experiment comprised four treatments: untreated irrigation (CK), irrigation with
−1
magnetized ionized water (M), untreated water irrigation with 45 kg ha 539 B. subtilis
539
added − 1 B. subtilis added (MB).
500(B), and irrigation with magnetized water with 45 kg ha
500
482
482
ion amount/mm
ion amount/mm

424
424
400
400
365
365
300
300 307
307
Plants 2024, 13, 2458 19 of 24

The application rate of B. subtilis is determined based on the research of Jiang et al. [65].
Every experimental plot was 2 m wide and 30 m long, with each treatment repeated three
times in a randomized block layout. B. subtilis (LV-01), provided by Shandong Lvlong
Biotechnology Co., Ltd. (Weifang City, Shandong Province, China), was in wettable powder
form, containing 20 billion viable spores per gram. The initial cotton irrigation event (6 June
2023) utilized pressure fertilizer barrels for its application through the drip irrigation
Figure 19.as
system, Experimental site.
shown in Figure 17.

600

539
500
482
Irrigation amount/mm

424
400
365
300 307
246
200
187
128
100
63
0
1-June 16-June 1-July 16-July 31-July 15-August 30-August
Date/(d-M)

Figure 20.
Figure 20. Co on irrigation
Cotton irrigationscheduling.
scheduling.

4.4. Measurements and Calculations

4.4.1. The Bulk Density and Field Capacity of Soil
In drip irrigation settings, cotton roots primarily exist in the 0−40 cm soil layer [66],
thus this layer was designated as the cotton’s principal root zone for further analysis. Bulk
density and field capacity measurements were conducted in both wide and narrow rows
(Figure 18) using the cutting ring method [67]. Soil samples were collected at depths of 0,
10, 20, 30, and 40 cm below the surface during the critical boll stage of cotton growth.

4.4.2. The pH and Salinity of the Soil

The depths of soil sampling were 0, 10, 20, 30, and 40 cm. Samples were taken from
specific field locations (Figure 18) during the critical boll stage of cotton growth. The cotton
boll stage is crucial for determining the yield and quality of cotton. Soil conditions such as
soil salinity and alkalinity, nutrient availability, and microbial activity significantly influence
the success of cotton production during this stage. Effective management practices tailored
to optimize these factors can enhance cotton yield and improve fiber quality. Each extraction
hole was carefully refilled to prevent potential experimental discrepancies. Subsequently,
the soil samples were dried in a fan-assisted oven at 105 ◦ C for 24 h. Soil pH was analyzed
using a PHS-25 pH meter (Shanghai Yidian Scientific Instrument Co., Ltd., Shanghai,
China) on a 1:2.5 soil–water extract at 25 ◦ C. Additionally, the electrical conductivity of
a soil–water extract with a ratio of 1:5 was determined using a DDSJ-308A conductivity
meter under identical temperature conditions. This conductivity value (EC1:5 , dS m−1 ) was
utilized to predict the amount of salt in the soil (SC, g kg−1 ) using a linear relationship
(SC = 0.99 × EC1:5 ), supported by a coefficient of determination (R2 = 0.999, n = 30).
The amount of salt within the 0–40 cm soil layer (S, g m−2 ) was calculated in the
following formula:
 
1 4 1 1
S = 10ρ SC + SC + SC + SC (1)
3 insidenarrow 21 wide 3 outsidenarrow 7 bare

where S represents the soil salt content at the cotton boll stage. The SCinside narrow , SCwide ,
SCoutside narrow , and SCbare variables represent the salt content of the soil for the inside
Plants 2024, 13, 2458 20 of 24

narrow, wide, outside narrow, and bare soil strips (g m−2 ), respectively. Proportional
weights of 1/3, 4/21, 1/3, and 1/7 were allocated to reflect the relative widths of these
strips at their respective locations.

4.4.3. Soil Nutrient

At 10 cm intervals from the surface to a 40 cm depth, soil samples were system-
atically collected from the center of inside and outside narrow rows at the cotton boll
stage. Soil nutrient measurement index methods refer to Bao [68]. Fresh soil samples were
tested for nitrogen levels (NH4+ −N and NO3− −N) with a fully automated discrete analyzer
(Smartchem450, AMS Alliance, Paris, France). Dried soil samples were used to determine
available phosphorus content (AP) through sodium bicarbonate (NaHCO3 ) extraction
and the molybdenum antimony anti-colorimetric method. The total phosphorus content
(TP) was ascertained using the sulfuric and perchloric acid digestion method. Soil avail-
able potassium content (AK) was extracted using 1 mol L−1 NH4 OAc and quantified via
flame photometry. Lastly, soil organic matter content (SOM) was determined in dried soil
samples using the external heating method with potassium dichromate and concentrated
sulfuric acid.

4.4.4. Soil Microbial Properties

At 10 cm intervals from the surface to a 40 cm depth, soil samples were systematically
collected from the center of inside and outside narrow rows at the cotton boll stage and
combined. Four replicates of each treatment were stored in a refrigerator at −80 ◦ C. Specific
primers with barcodes were used to amplify the distinct regions of the 16S rRNA and ITS
genes (16SV4, GTGCCAGCMGCCGCGGTAA, GGACTACHVGGGTWTCTAAT; ITS1-5F,
GGAAGTAAAAGTCGTAACAAGG, GCTGCGTTCTTCATCGATGC). Each PCR reaction
comprised 15 µL of Phusion® High—Fidelity PCR Master Mix (New England Biolabs,
Beijing, China), 0.2 µM of forward and reverse primers, and ~10 ng template DNA. The
thermal cycling conditions included an initial denaturation at 98 ◦ C for 1 min, followed
by 30 cycles of denaturation at 98 ◦ C for 10 s, annealing at 50 ◦ C for 30 s, elongation at
72 ◦ C for 30 s, and a final extension at 72 ◦ C for 5 min. An equal volume of 1× loading
buffer (containing Sybgreen) was mixed with the PCR products, and electrophoresis was
performed on a 2% agarose gel for DNA detection. The PCR products were mixed in
equal proportions, and then a Qiagen Gel Extraction Kit (Qiagen, Hilden, Germany) was
used to purify the mixed PCR products. Following the manufacturer’s recommendations,
sequencing libraries were generated with NEBNext Ultra II DNA Library Prep Kit (New
England Biolabs, Beijing, China). The library quality was evaluated on the Qubit 2.0
fluorometer (Thermo Scientific, Shanghai, China) and the Agilent Bioanalyzer 2100 system
(Agilent, Beijing, China). Finally, the library was sequenced on an Illumina NovaSeq
(Shanghai, China) platform and 250 bp paired-end reads were generated.

4.4.5. Soil Quality

The soil quality index was computed for the evaluation of soil quality. First, a standard-
ized principal component analysis (PCA) was performed on soil indicators, with a focus on
extracting principal components having eigenvalues > 1, each accounting for a minimum
of 5% of the variance. The cumulative contribution rate of these principal components
exceeded 75% of the variance. Second, within each PC (principal component), key soil
quality indices were identified, characterized by absolute factor load values surpassing
90% of the highest factor load. These key indices were retained in the minimum dataset
(MDS) and subsequently converted to dimensionless values ranging from 0 to 1. For in-
dicators where higher values are preferable (e.g., NH4+ −N, NO3− −N, total P, available P,
available P/total P, available K, and soil organic matter), dimensionless processing was
applied using Equation (2). Conversely, for indices favoring lower values (soil salt content
Plants 2024, 13, 2458 21 of 24

and pH), Equation (3) was employed. The final soil quality index was determined using
Equation (4) [21].
Xi − Xmin
Ti = (2)
Xmax − Xmin
Xmax − Xi
Ti = (3)
Xmax − Xmin
where Ti , Xi , Xmin , and Xmax represent the dimensionless values, actual measured values,
minimum measured values, and maximum measured values of key soil quality indicators,
respectively.
n
SQI = ∑ Wi ·Ti (4)
i=1

where Wi represents the weight of key soil quality indicators, and n indicates the quantity
of indicators in MDS.

4.4.6. Cotton Quality

During harvest season, 50 cotton bolls were randomly collected from each experimen-
tal plot for analysis. The specific breaking strength, micronaire value, upper half mean
length, and uniformity index were evaluated by the Xinjiang academy of agricultural
sciences (Urumqi, Xinjiang, China). A cotton fiber testing instrument (1000 M 700, Uster
Technologies, Greenville, SC, USA) was utilized to assess fiber quality.

4.4.7. Calculation of Relative Yield and Relative Quality

This study develops a linear model to assess the influence of the SQI on cotton yield
and quality. Relative processing for indicators where higher values are desirable (Zi ), such
as seed cotton yield, boll number per plant, specific breaking strength, uniformity index,
and upper half mean length, was conducted using Equation (5). Conversely, for indicators
where lower values are preferable, such as the micronaire value, Equation (6) was utilized.

Zi
yi = (5)
Zi,max

Zi,min
yi = (6)
Zi
where Zi is the cotton yield and quality indicator, and Zi , max and Zi, min are the maximum
and minimum value of the above indicators; yi is the relative value of the above indicators.

4.4.8. Analysis of Data

ANOVA analysis was conducted with SAS software (version 9.2). Significant differ-
ences among treatments were identified using least significant difference (LSD) test at a
significance level of p < 0.05. Data analysis and graphical representation were executed
using Microsoft Excel 2020 and Origin 2019b, respectively.

5. Conclusions
This study focused on the effects of magnetized ionized water and B. subtilis on soil
physical properties, salinity and alkalinity, nutrient content, and microbial diversity, as
well as on a soil quality assessment. The research discovered that the levels of nutrients
in the soil, including NH4+ −N, NO3− −N, AP, TP, AK, and SOM, negatively correlate with
soil salinity and alkalinity, while the relative abundance of dominant soil bacterial and
fungal genera significantly correlates with soil salt content. Compared to CK, the M, B,
and MB treatments significantly improved (p < 0.01) the SQI by 0.21, 0.52, and 0.69 units,
respectively, with a greater promotion effect on cotton yield than cotton quality. This
research offers valuable insights into the effectiveness of combining magnetized ionized
water irrigation with B. subtilis application in saline agriculture. Future studies should
Plants 2024, 13, 2458 22 of 24

prioritize long-term experiments to validate these findings, highlighting the significant

benefits of adopting eco-friendly and effective strategies for improving soil quality and
cotton yield, thereby promoting sustainable agricultural practices.

Supplementary Materials: The following supporting information can be downloaded at: https:
//www.mdpi.com/article/10.3390/plants13172458/s1, Figure S1: Soil water content at the cotton
boll stage.
Author Contributions: Conceptualization, Z.J., Q.W. and S.N.; methodology, Z.J. and S.L.; software,
Z.J.; validation, X.H. and Z.S.; formal analysis, S.N.; investigation, Z.J., S.N. and X.H.; writing—
original draft preparation, Z.J. and S.N.; writing—review and editing, Z.J., Q.W. and S.N. All authors
have read and agreed to the published version of the manuscript.
Funding: This research was funded by the National Natural Science Foundation of China (52179042,
52339003).
Data Availability Statement: The data presented in this study are available on request from the
corresponding author.
Conflicts of Interest: The authors declare no conflicts of interest.

References
1. Cui, Q.; Xia, J.; Yang, H.; Liu, J.; Shao, P. Biochar and effective microorganisms promote Sesbania cannabina growth and soil
quality in the coastal saline-alkali soil of the Yellow River Delta, China. Sci. Total Environ. 2021, 756, 143801. [CrossRef] [PubMed]
2. Jamil, A.; Riaz, S.; Ashraf, M.; Foolad, M.R. Gene expression profiling of plants under salt stress. Crit. Rev. Plant Sci. 2011, 30,
435–458. [CrossRef]
3. Huang, J.; Kong, Y.L.; Xu, Q.S.; Zhu, C.Q.; Zhu, L.F.; Cao, X.C.; Hong, X.Z.; Zhang, J.H. Progresses for characteristics and
amelioration measures of saline soil. Soil 2022, 54, 18–23, (In Chinese with English abstract). [CrossRef]
4. Zhao, T.; Deng, X.; Xiao, Q.; Han, Y.; Zhu, S.; Chen, J. IAA priming improves the germination and seedling growth in cotton
(Gossypium hirsutum L.) via regulating the endogenous phytohormones and enhancing the sucrose metabolism. Ind. Crop. Prod.
2020, 155, 112788. [CrossRef]
5. China’s National Bureau of Statistics. Announcement on Cotton Yield in 2023 by the National Bureau of Statistics. Available
online: https://www.stats.gov.cn/sj/zxfb/202312/t20231225_1945745.html (accessed on 22 July 2024).
6. Tian, C.Y.; Mai, W.X.; Zhao, Z.Y. Study on key technologies of ecological management of saline alkali land in arid area of Xinjiang.
Acta Ecol. Sin. 2016, 36, 7064–7068, (In Chinese with English abstract). [CrossRef]
7. Wang, Y.; Zhang, B.; Gong, Z.; Gao, K.; Ou, Y.; Zhang, J. The effect of a static magnetic field on the hydrogen bonding in water
using frictional experiments. J. Mol. Struct. 2013, 1052, 102–104. [CrossRef]
8. Amiri, M.; Dadkhah, A.A. On reduction in the surface tension of water due to magnetic treatment. Colloids Surf. A Physicochem.
Eng. Asp. 2006, 278, 252–255. [CrossRef]
9. Mostafazadeh-Fard, B.; Khoshravesh, M.; Mousavi, S.F.; Kiani, A.R. Effects of magnetized water on soil chemical components
underneath trickle irrigation. J. Irrig. Drain. Eng. 2012, 138, 1075–1081. [CrossRef]
10. Zhang, R.X.; Chu, G.X.; Wang, W.B.; Ye, J. Effects of magnetized water on salt leaching under drip irrigation condition. Xinjiang
Agric. Sci. 2013, 50, 1656–1661, (In Chinese with English abstract). [CrossRef]
11. Wei, K.; Zhang, J.; Wang, Q.; Guo, Y.; Mu, W. Irrigation with ionized brackish water affects cotton yield and water use efficiency.
Ind. Crop. Prod. 2022, 175, 114244–114256. [CrossRef]
12. Hill, G.; Mitkowski, N.; Aldrich-Wolfe, L.; Emele, L.; Jurkonie, D.; Ficke, A.; Maldonado-Ramirez, S.; Lynch, S.; Nelson, E.
Methods for assessing the composition and diversity of soil microbial communities. Appl. Soil Ecol. 2000, 15, 25–36. [CrossRef]
13. Zhou, X.; Chen, X.; Qi, X.; Zeng, Y.; Guo, X.; Zhuang, G.; Ma, A. Soil bacterial communities associated with multi-nutrient cycling
under long-term warming in the alpine meadow. Front. Microbiol. 2023, 14, 1136187. [CrossRef] [PubMed]
14. Yang, C.C.; Zhu, L.S.; Li, D.Q.; Liu, H.; Gong, Z.W.; Jiang, N.; Liu, Y.Y. Effect of different amount of Bacillus subtilis on nutrients
of tobacco planting soils. Southwest China J. Agric. Sci. 2018, 31, 779–785, (In Chinese with English abstract). [CrossRef]
15. Li, W.; Wang, J.T. Effects of Bacillus subtilis and phosphobacteria on soil properties and fruit quality in apple orchards. Jiangsu
Agric. Sci. 2018, 46, 140–144, (In Chinese with English abstract). [CrossRef]
16. Wang, T.; Liu, M.-Q.; Li, H.-X. Inoculation of phosphate solubilizing bacteria Bacillus thuringiensis B1 increases available
phosphorus and growth of peanut in acidic soil. Acta Agric. Scand. Sect. B-Soil Plant Sci. 2014, 64, 252–259. [CrossRef]
17. Zhou, B.; Liang, C.; Chen, X.; Ye, S.; Peng, Y.; Yang, L.; Duan, M.; Wang, X. Magnetically-treated brackish water affects soil
water-salt distribution and the growth of cotton with film mulch drip irrigation in Xinjiang, China. Agric. Water Manag. 2022, 263,
107487. [CrossRef]
18. Alattar, E.; Radwan, E.; Elwasife, K. Improvement in growth of plants under the effect of magnetized water. AIMS Biophys. 2022,
9, 346–387. [CrossRef]
Plants 2024, 13, 2458 23 of 24

19. Mahapatra, S.; Yadav, R.; Ramakrishna, W. Bacillus subtilis impact on plant growth, soil health and environment: Dr. Jekyll and
Mr. Hyde. J. Appl. Microbiol. 2022, 132, 3543–3562. [CrossRef]
20. Blake, C.; Christensen, M.N.; Kovács, Á.T. Molecular aspects of plant growth promotion and protection by Bacillus subtilis. Mol.
Plant-Microbe Interact. 2021, 34, 15–25. [CrossRef]
21. Lin, S.; Wang, Q.; Wei, K.; Sun, Y.; Shao, F.; Lei, Q.; Deng, M. Enhancing pakchoi (Brassica chinensis L.) agriculture with
magnetized-ionized brackish water and organic fertilizers: A sustainable approach to soil quality and crop yield optimization. J.
Clean. Prod. 2024, 450, 141935. [CrossRef]
22. Zhen-Rui, D.; Ya-Jun, Z.; Feng-Ling, C.; Jin-Zhong, C.; Shu-Xing, D. Magnetization mechanism of magnetized water. Acta Phys.
Sin. 2011, 60, 432–439. [CrossRef]
23. Liu, J.; Cao, Y. Experimental study on the surface tension of magnetized water. Int. Commun. Heat Mass Transf. 2020, 121, 105091.
[CrossRef]
24. Al-Talib, A.A.; Mahmood, M.T.; Ghani, O.M.A. The effect of magnetizing irrigation water on the infiltration rate in soil. Tikrit J.
Eng. Sci. 2013, 20, 18–23. [CrossRef]
25. Khoshravesh-Miangoleh, M.; Kiani, A. Effect of magnetized water on infiltration capacity of different soil textures. Soil Use
Manag. 2014, 30, 588–594. [CrossRef]
26. Hamza, J.N. Investigation on using magnetic water technology for leaching high saline-sodic soils. Environ. Monit. Assess. 2019,
191, 519. [CrossRef] [PubMed]
27. Abdul-Raheem, L.H.; Azzubaidi, R.Z. Evaluation of using magnetized water in leaching salts in sandy loam soil. J. Eng. 2021, 27,
35–46. [CrossRef]
28. Radhakrishnan, R.; Kumari, B.D.R. Influence of pulsed magnetic field on soybean (Glycine max L.) seed germinate seedling
growth and soil microbial population. Indian J. Biochem. Biophys. 2013, 50, 312–317. [CrossRef]
29. Cui, H.R.; Liu, X.M.; Jing, R.Y.; Zhang, M.Z.; Wang, L.; Zheng, L.; Kong, L.G.; Wang, H.T.; Ma, F.Y. Irrigation with magnetized
water affects the soil microenvironment and fruit quality of eggplants in a covered vegetable production system in Shouguang
city, China. J. Soil Sci. Plant Nutr. 2020, 20, 2684–2697. [CrossRef]
30. Zhou, B.B.; Yang, L.; Chen, X.P.; Ye, S.T.; Peng, Y.; Liang, C.F. Effect of magnetic water irrigation on the improvement of salinized
soil and cotton growth in Xinjiang. Agric. Water Manag. 2021, 248, 106784. [CrossRef]
31. Zhang, J.H. Effect Mechanism Research of Drip Irrigation under Mulch with Magnetized Water on Soil Fertility and Cotton
Growth. Ph.D. Thesis, Xi’an University of Technology, Xi’an, China, 2022.
32. Benoit, I.; Esker, M.H.; Patyshakuliyeva, A.; Mattern, D.J.; Blei, F.; Zhou, M.M.; Dijksterhuis, J.; Brakhage, A.A.; Kuipers, O.P.;
Vries, R.P.; et al. Bacillus subtilis attachment to Aspergillus niger hyphae results in mutually altered metabolism. Environ.
Microbiol. 2015, 17, 2099–2113. [CrossRef]
33. Meena, V.S.; Maurya, B.R.; Meena, S.K.; Meena, R.K.; Kumar, A.; Verma, J.P.; Singh, N.P. Can Bacillus species enhance nutrient
availability in agricultural soils. In Bacilli and Agrobiotechnology; Springer: Berlin/Heidelberg, Germany, 2016; pp. 367–395.
[CrossRef]
34. Radhakrishnan, R.; Hashem, A.; Abd-Allah, E.F. Bacillus: A biological tool for crop improvement through bio-molecular changes
in adverse environments. Front. Physiol. 2017, 8, 667. [CrossRef] [PubMed]
35. Kang, S.M.; Radhakrishnan, R.; Lee, K.E.; You, Y.H.; Ko, J.H.; Kim, J.H.; Lee, I.J. Mechanism of plant growth promotion elicited by
Bacillus sp. LKE15 in oriental melon. Acta Agric. Scand. Sect. B Soil Plant Sci. 2015, 65, 637–647. [CrossRef]
36. Kang, S.M.; Radhakrishnan, R.; You, Y.H.; Joo, G.J.; Lee, I.J.; Lee, K.E.; Kim, J.H. Phosphate solubilizing Bacillus megaterium
mj1212 regulates endogenous plant carbohydrates and amino acids contents to promote mustard plant growth. Indian J. Microbiol.
2014, 54, 427–433. [CrossRef] [PubMed]
37. Zheng, W.J.; Zeng, S.Q.; Bais, H.; LaManna, J.M.; Hussey, D.S.; Jacobson, D.L. Plant growth-promoting rhizobacteria (PGPR)
reduce evaporation and increase soil water retention. Water Resour. Res. 2018, 54, 3673–3687. [CrossRef]
38. Zhou, B.B.; Hou, Y.L.; Wang, Q.J. Characteristics of water and salt migration in process of improving saline alkali soil with Bacillus
subtilis. Trans. Chin. Soc. Agric. Eng. 2018, 34, 104–110, (In Chinese with English abstract). [CrossRef]
39. Nagorska, K.; Bikowski, M.; Obuchowski, M. Multicellular behaviour and production of a wide variety of toxic substances
support usage of Bacillus subtilis as a powerful biocontrol agent. Acta Biochim. Pol. 2007, 54, 495–508. [CrossRef]
40. Selvakumar, G.; Panneerselvam, P.; Bindu, G.H.; Ganeshamurthy, A.N. Pseudomonads: Plant growth promotion and beyond. In
Plant Microbes Symbiosis: Applied Facets; Springer: Berlin/Heidelberg, Germany, 2015; pp. 193–208. [CrossRef]
41. Costa, R.; Salles, J.F.; Berg, G.; Smalla, K. Cultivation-independent analysis of Pseudomonas species in soil and in the rhizosphere
of field-grown Verticillium dahliae host plants. Environ. Microbiol. 2006, 8, 2136–2149. [CrossRef]
42. Weller, D.M. Pseudomonas biocontrol agents of soilborne pathogens: Looking back over 30 years. Phytopathology 2007, 97, 250–256.
[CrossRef]
43. Kumar, M.; Tomar, R.S.; Lade, H.; Paul, D. Methylotrophic bacteria in sustainable agriculture. World J. Microbiol. Biotechnol. 2016,
32, 120. [CrossRef]
44. Huang, K.; Chen, C.; Zhang, J.; Tang, Z.; Shen, Q.R.; Rosen, B.P.; Zhao, F.J. Efficient arsenic methylation and volatilization
mediated by a novel bacterium from an arsenic-contaminated paddy soil. Environ. Sci. Technol. 2016, 50, 6389–6396. [CrossRef]
45. Sharavin, D.; Kovalevskaya, N. Effect of halotolerant methylotrophs isolated from saline soil rhizosphere on diminution of salt
stress in wheat (Triticum Aestivum L.). J. Agric. Environ. 2017, 3, 4. [CrossRef]
Plants 2024, 13, 2458 24 of 24

46. Oskay, M. Comparison of Streptomyces diversity between agricultural and non-agricultural soils by using various culture media.
Sci. Res. Essays 2009, 4, 997–1005.
47. Vergnes, S.; Gayrard, D.; Veyssière, M.; Toulotte, J.; Martinez, Y.; Dumont, V.; Bouchez, O.; Rey, T.; Dumas, B. Phyllosphere
colonisation by a soil Streptomyces sp. promotes plant defense responses against fungal infection. Mol. Plant-Microbe Interact.
2020, 33, 233–234. [CrossRef]
48. Mahesh, A.; Sangwoo, K.; Raj, Y.; Hyun, U.; Seung, K.; Burm, L.; Su, L. A new record of Pseudeurotium bakeri from crop field soil
in Korea. Korean J. Mycol. 2016, 44, 145–149. [CrossRef]
49. Sogonov, M.V.; Schroers, H.J.; Gams, W.; Dijksterhuis, J.; Summerbell, R.C. The hyphomycete Teberdinia hygrophila gen. nov., sp.
nov. and related anamorphs of Pseudeurotium species. Mycologia 2005, 97, 695–709. [CrossRef]
50. Zhao, W.; Guo, Q.; Li, S.; Lu, X.; Dong, L.; Wang, P.; Zhang, X.; Su, Z.; Ma, P. Application of Bacillus subtilis NCD-2 can suppress
cotton verticillium wilt and its effect on abundant and rare microbial communities in rhizosphere. Biol. Control. 2022, 165,
104812–104822. [CrossRef]
51. Zhu, J.Y.; Zhang, S.L.; Guo, J.J.; Ding, F.J.; Fu, N.F.; Zhou, B.; Wang, M.H.; Li, L.Z. Effects of Bacillus subtilis AMCC 100001 on the
promotion of cotton growth. China Cotton 2013, 40, 16–18, (In Chinese with English abstract). [CrossRef]
52. Andersson, K.O.; Tighe, M.K.; Guppy, C.N.; Milham, P.J.; McLaren, T.I. Incremental acidification reveals phosphorus release
dynamics in alkaline vertic soils. Geoderma 2015, 259, 35–44. [CrossRef]
53. Neina, D. The role of soil pH in plant nutrition and soil remediation. Appl. Environ. Soil Sci. 2019, 2019, 5794869. [CrossRef]
54. Reischke, S.; Rousk, J.; Bååth, E. The effects of glucose loading rates on bacterial and fungal growth in soil. Soil Biol. Biochem. 2014,
70, 88–95. [CrossRef]
55. Rath, K.M.; Maheshwari, A.; Bengtson, P.; Rousk, J. Comparative toxicities of salts on microbial processes in soil. Appl. Environ.
Microbiol. 2016, 82, 2012–2020. [CrossRef] [PubMed]
56. Magdoff, F.; Weil, R.R. Soil Organic Matter in Sustainable Agriculture; CRC Press: Boca Raton, FL, USA, 2007; 412p. [CrossRef]
57. Sun, R.B.; Dsouza, M.; Gilbert, J.A.; Guo, X.S.; Wang, D.Z.; Guo, Z.B.; Ni, Y.Y.; Chu, H.Y. Fungal community composition in
soils subjected to long-term chemical fertilization is most influenced by the type of organic matter. Environ. Microbiol. 2016, 18,
5137–5150. [CrossRef]
58. Esmaeilzadeh, J.; Ahangar, A.G. Influence of soil organic matter content on soil physical, chemical and biological properties. Int.
J. Plant Anim. Environ. Sci. 2014, 2014, 244–252.
59. Lin, S.D.; Lei, Q.Y.; Liu, Y.; Zhao, Y.M.; Su, L.J.; Wang, Q.J.; Tao, W.H.; Deng, M.J. Quantifying the impact of organic fertilizers on
soil quality under varied irrigation water sources. Water 2023, 15, 3618. [CrossRef]
60. Mohammad, S.A.; Nicholas, M.H. Quantitative soil quality indexing of temperate arable management systems. Soil Tillage Res.
2015, 150, 57–67. [CrossRef]
61. Karlen, D.L.; Ditzler, C.A.; Andrews, S.S. Soil quality: Why and how? Geoderma 2003, 114, 145–156. [CrossRef]
62. Doran, J.W.; Zeiss, M.R. Soil health and sustainability: Managing the biotic component of soil quality. Appl. Soil Ecol. 2000, 15,
3–11. [CrossRef]
63. Grumezescu, A.M.; Cotar, A.I.; Andronescu, E.; Ficai, A.; Ghitulica, C.D.; Grumezescu, V.; Vasile, B.S.; Chifiriuc, M.C. In vitro
activity of the new water-dispersible Fe3O4@usnic acid nanostructure against planktonic and sessile bacterial cells. J. Nanoparticle
Res. 2013, 15, 1766. [CrossRef]
64. Abrol, I.P.; Yadav, J.S.P.; Massoud, F.I. Salt-Affected Soils and Their Management. FAO Soils Bulletin 39. 1988. Available online:
https://www.fao.org/3/x5871e/x5871e04.htm#3.%20SALINE%20SOILS%20AND%20THEIR%20MANAGEMENT (accessed on
1 April 2024).
65. Jiang, Z.B.; Wang, Q.J.; Ning, S.R.; Hu, X.Q.; Yuan, S. Growth and yield response and water use efficiency of cotton under
film-mulched drip irrigation to magnetized ionized water and Bacillus subtilis in saline soil in Xinjiang. Agronomy 2023, 13, 1644.
[CrossRef]
66. Chen, W.L.; Jin, M.G.; Ferré, T.P.A.; Liu, Y.F.; Xian, Y.; Shan, T.R.; Ping, X. Spatial distribution of soil moisture, soil salinity, and root
density beneath a cotton field under mulched drip irrigation with brackish and fresh water. Field Crops Res. 2018, 215, 207–221.
[CrossRef]
67. Lu, R.K. Analytical Methods for Soil and Agricultural Chemistry; China Agricultural Science and Technology Press: Beijing, China,
1999.
68. Bao, S.D. Soil Agricultural Chemistry Analysis; China Agriculture Press: Beijing, China, 2000.

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.