SMRT Link User Guide v11.0

SMRT® Link
user guide
Sequel® II and IIe
systems
Research use only. Not for use in diagnostic procedures.
P/N 102-278-200 Version 01 (April 2022)
© 2022, PacBio. All rights reserved.
Information in this document is subject to change without notice. PacBio assumes no responsibility for any errors or
omissions in this document.
PACBIO DISCLAIMS ALL WARRANTIES WITH RESPECT TO THIS DOCUMENT, EXPRESS, STATUTORY, IMPLIED OR
OTHERWISE, INCLUDING, BUT NOT LIMITED TO, ANY WARRANTIES OF MERCHANTABILITY, SATISFACTORY
QUALITY, NONINFRINGEMENT OR FITNESS FOR A PARTICULAR PURPOSE. IN NO EVENT SHALL PACBIO BE
LIABLE, WHETHER IN CONTRACT, TORT, WARRANTY, PURSUANT TO ANY STATUTE, OR ON ANY OTHER BASIS FOR
SPECIAL, CONSEQUENTIAL, INCIDENTAL, EXEMPLARY OR INDIRECT DAMAGES IN CONNECTION WITH (OR
ARISING FROM) THIS DOCUMENT, WHETHER OR NOT FORESEEABLE AND WHETHER OR NOT PACBIO IS ADVISED
OF THE POSSIBILITY OF SUCH DAMAGES.
Certain notices, terms, conditions and/or use restrictions may pertain to your use of PacBio products and/or third
party products. Refer to the applicable PacBio terms and conditions of sale and to the applicable license terms at
http://www.pacificbiosciences.com/licenses.html.
Trademarks:
Pacific Biosciences, the PacBio logo, PacBio, Circulomics, Omnione, SMRT, SMRTbell, Iso-Seq, Sequel, Nanobind,
and SBB are trademarks of Pacific Biosciences of California Inc. (PacBio). All other trademarks are the sole property
of their respective owners.
See https://github.com/broadinstitute/cromwell/blob/develop/LICENSE.txt for Cromwell redistribution information.
PacBio
1305 O’Brien Drive
Menlo Park, CA 94025
www.pacb.com
SMRT® Link user guide (v11.0)
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4
Contact information . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5
Module menu commands . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .6
Gear menu commands . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6
Sending information to Technical Support . . . . . . . . . . . . . . . . . . . . . . . .7
Sample Setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8
Application-based calculations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .9
Custom calculations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10
Classic mode . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .10
Editing or printing calculations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .12
Deleting calculations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .12
Importing/exporting calculations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .12
Run Design . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16
Creating a new Run Design . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .16
Custom Run Designs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .18
Advanced options . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .19
Editing or deleting Run Designs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .20
Creating a Run Design by importing a CSV file. . . . . . . . . . . . . . . . . . . . 20
Run QC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27
Table fields . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .29
Run settings and metrics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .31
Data Management . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34
What is a Data Set? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .34
Creating a Data Set . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .35
Viewing Data Set information . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 36
Copying a Data Set . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .36
Deleting a Data Set . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .37
Starting a job from a Data Set . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 37
Data Set QC reports . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .37
What is a Project? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .39
Data Sets and Projects . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 39
Creating a Project . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .39
Editing a Project . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .40
Deleting a Project . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .40
Viewing/deleting sequence, reference and barcode data . . . . . . . . . . . 41
Importing sequence, reference and barcode data . . . . . . . . . . . . . . . . .41
Exporting sequence, reference and barcode data . . . . . . . . . . . . . . . . . .42
SMRT® Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 44
Creating and starting a job . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .44
Starting a job after viewing sequence data. . . . . . . . . . . . . . . . . . . . . . . 49
Canceling a running job. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .50
Page 1
Restarting a failed job . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .50
Viewing job results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .51
Copying and running an existing job . . . . . . . . . . . . . . . . . . . . . . . . . . . . .52
Exporting a job . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .52
Importing a job . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .52
PacBio® secondary analysis applications . . . . . . . . . . . . . . . . . . . . . . . . . 54
Genome Assembly. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 55
HiFi Mapping . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .58
HiFiViral SARS-CoV-2 Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .62
Iso-Seq® Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .67
Microbial Genome Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .74
Minor Variants Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80
Structural Variant Calling . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 86
PacBio® data utilities. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 90
5mC CpG Detection . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .91
Demultiplex Barcodes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .92
Export Reads. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 98
Mark PCR Duplicates . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 100
Trim Ultra-Low Adapters . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 102
Circular Consensus Sequencing (CCS) . . . . . . . . . . . . . . . . . . . . . . . . 104
Working with barcoded data . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 107
Step 1: Specify the barcode setup & sample names in a Run Design 107
Step 2: Perform the sequencing run . . . . . . . . . . . . . . . . . . . . . . . . . . . 109
Step 3: (Optional) Run the Demultiplex Barcodes data utility . . . . . . . 110
Step 4: Run applications using the demultiplexed data as input . . . . 111
Demultiplex Barcodes details . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 112
Automated analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 115
Creating an Auto Analysis job from SMRT Analysis . . . . . . . . . . . . . . 115
Creating Auto Analysis from a Run Design . . . . . . . . . . . . . . . . . . . . . . 116
HiFiViral SARS-CoV-2: Creating Auto Analysis in Run Design. . . . . . . 116
Getting information about analyses created by Auto Analysis . . . . . 116
Getting information about Pre Analysis from SMRT Analysis . . . . . . 117
Getting information about Pre Analysis from Run Design . . . . . . . . . 117
Visualizing data using IGV. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 118
Using the PacBio® self-signed SSL certificate. . . . . . . . . . . . . . . . . . . . . 120
Sequel® II and Sequel IIe systems output files . . . . . . . . . . . . . . . . . . . . 121
Sequel IIe system output files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 121
Sequel II system output files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 124
Secondary analysis output files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 126
Configuration and user management . . . . . . . . . . . . . . . . . . . . . . . . . . . . 129
LDAP . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 129
SSL . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 129
Adding and deleting SMRT Link users . . . . . . . . . . . . . . . . . . . . . . . . . 130
Page 2
Assigning user roles . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 130
Hardware/software requirements. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 132
Appendix A - PacBio terminology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 133
Appendix B - Data search . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 136
Appendix C - BED file format for Target Regions report . . . . . . . . . . . . . 138
Appendix D - Additional information in the CCS Data Set Export report 140
Page 3
Introduction
This document describes how to use PacBio’s SMRT Link software.
SMRT Link is the web-based end-to-end workflow manager for Sequel II
systems. SMRT Link includes the following modules:
• Sample Setup: Calculate binding and annealing reactions for

preparing DNA libraries for use on all Sequel II systems. (See “Sample
Setup” on page 8 for details.)
• Run Design: Design sequencing runs and create and/or import
sample sheets. (See “Run Design” on page 16 for details.)
• Run QC: Monitor run progress, status and quality metrics. (See “Run
QC” on page 27 for details.)
• Data Management: Create Projects and Data Sets; generate QC
reports for Data Sets; view, import, or delete sequence, reference, and
barcode files. (See “Data Management” on page 34 for details.)
• SMRT Analysis: Perform secondary analysis on the basecalled data
(such as sequence alignment, variant detection, de novo assembly,
structural variant calling, and RNA analysis) after a run has
completed. (See “SMRT® Analysis” on page 44 for details.)
Note: SMRT Link v11.0 is for use with Sequel II systems and Sequel IIe
systems only. If you are using a Sequel system, use an earlier version of
SMRT Link.
This document also describes:
• The data files generated by the Sequel II system and Sequel IIe
systems for each cell transferred to network storage. (See “Sequel® II
system and Sequel IIe system output files” on page 121 for details.)
• The data files generated by secondary analysis. (See “Secondary
analysis output files” on page 126 for details.)
• Configuration and user management. (See “Configuration and user
management” on page 129 for details.)
• SMRT Link client hardware/software requirements. (See “Hardware/
software requirements” on page 132 for details.)
Installation of SMRT Link server software is discussed in the document

SMRT Link software installation guide (v11.0).
New features, fixed issues and known issues are listed in the document
SMRT Link release notes (v11.0).
When you first start SMRT Link, you must specify which system you are
using: Sequel II, or Sequel IIe. This choice affects some of the initial
values used in the Sample Setup and Run Design modules. In those
modules, you can switch between the two Sequel systems as needed.
Users with administrator access can configure SMRT Link to support all
instrument types.
Page 4
Contact information
For additional technical support, contact PacBio at [email protected] or
1-877-920-PACB (7222).
Using SMRT® Link

You access SMRT Link using the Chrome web browser.
• SMRT Link is not available on the instrument – it must be accessed

from a remote workstation.
• Depending on how SMRT Link was installed at your site, logging in
with a user name and password may be required.
• SMRT Link needs a Secure Sockets Layer (SSL) certificate to ensure a
secure connection between the SMRT Link server and your browser
using the HTTPS protocol.
If an SSL certificate is not installed with SMRT Link, the application will
use the PacBio self-signed SSL certificate and will use the HTTP protocol.
In this case, each user will need to accept the browser security warnings
described in “Using the PacBio® self-signed SSL certificate” on page 120.
After accessing SMRT Link, the home page displays.
• Click the PacBio logo at the top left to navigate back to the SMRT Link
home page from within the application.
• Click the Gear menu to sign out, configure for the Sequel II system or
Sequel IIe system, view version information, or perform administrative
functions (Admins only).
• Click a module name to access that module. Sample Setup, Run
Design, Data Management and SMRT Analysis include links to create
new Calculations, Run Designs, Data Sets, and jobs. (A Module menu
displays next to the PacBio logo, allowing you to move between
modules.)
• Click ? to view the SMRT Link online help.
• Select Sign Out from the Gear menu to log out of SMRT Link.
Page 5
Module menu commands
• Sample Setup: Displays the Sample Setup module.
• Run Design: Displays the Run Design module.
• Run QC: Displays the Run QC module.
• Data Management: Displays the Data Management module.
• SMRT Analysis: Displays the SMRT Analysis module.
Gear menu commands

• Show Alarms
– Displays SMRT Link system-level alarms. To clear alarms, select
and click Clear Alarm or Clear All Alarms.
• Configure
– To specify the Sequel II system(s) that SMRT Link will be used with,
click Instruments and check the appropriate boxe(s).
– Admin users only: Add/delete SMRT Link users and specify their
roles. See “Adding and deleting SMRT Link users” on page 130 for
details.
– To specify how numbers are formatted, click Number Formatting
and select Period or Comma as the decimal separator.
– (Sequel IIe system only) To specify whether CCS analysis output
includes kinetics information (used for epigenetics analysis), click
CCS Analysis Output and select Yes or No. This is the default
setting for all CCS analysis output, unless overwritten in individual
Run Designs. Note: Adding kinetics information can increase the
amount of storage used by the output BAM files by up to 5 times.
• About SMRT Link
– Displays software version information and available space on the
server SMRT Link is connected to.
– Click Send to send configuration information and/or analysis usage
information to PacBio Technical Support for help in troubleshooting
failed jobs.
– Admin users only: 1) Update the SMRT Link Chemistry Bundle,
which includes kit and DNA Control Complex names used in the
Sample Setup and Run Design modules. 2) Update the SMRT Link
UI Bundle, which includes changes and bug fixes to the SMRT Link
Graphical User Interface or UI for a SMRT Link module.
• Sign Out
– Logs you out and displays the initial login page.
Working with tables

• To sort table columns: Click a column title.
• To see additional columns: Click the > symbol next to a column title.
• To search within a table: Enter a unique search string into the Search
field. (For details, see “Appendix B - Data search” on page 136.)
Page 6
Sending information to Technical Support
To open a case with PacBio Technical Support, send an email to
[email protected].
Troubleshooting information can be sent to PacBio Technical Support

two ways:
• From the SMRT Link menu: About > Troubleshooting Information >
Send.
• From a SMRT Link “Failed” analysis Results page: Click Send Log
Files.
Page 7
Sample Setup
To prepare your samples for sequencing, use SMRT Link's Sample Setup
module to generate a customized protocol for primer annealing and
polymerase binding to SMRTbell® templates, with subsequent sample
cleanup. You can then print the instructions for use in the lab.
1. Access SMRT Link using the Chrome web browser.

2. Select Sample Setup.
3. Select High-Throughput mode, which provides a more streamlined
workflow to efficiently process multiple samples with similar library
properties (such as mean insert size and DNA concentration) in
parallel. You can also export the calculated values to a CSV file for
laboratory automation.
Note: Classic mode is provided for legacy support purposes only, and
is described later in this document.
4. Click + New Calculation.
5. Enter the sample name.
Page 8
Application-based calculations
6. Select a sequencing application for the sample. The following fields

are auto-populated and display in green:
– Binding Kit
– Cleanup Anticipated Yield
7. Enter the number of samples for this calculation. Samples should be
substantially equivalent to each other; all should have insert sizes and
concentrations within +/- 15% of the specified values.
8. Enter the number of SMRT® Cells to bind per sample.
9. Enter the available volume per sample, in µL. When preparing multiple
samples, this should be the minimum volume available for any
sample.
10. Specify an insert size, in base pairs. The insert size is the length of the
double-stranded nucleic acid fragment in a SMRTbell template,
excluding the hairpin adapters. This matches the mean insert size for
the sample; the size range boundaries are described in the library
preparation protocol. Enter the mean insert size of the sample(s).
11. Enter the sample concentration(s), in ng/ul. Note that the acceptable
range of input concentrations depends on insert size:
12. If necessary, edit the Cleanup anticipated yield. Adjust this percent-
age based on previous experience. (Cleanup removes excess
primers/polymerase from bound complexes, which results in higher
quality data.)
13. Specify the on-plate loading concentration (OPLC), in pM.
14. Specify the Minimum Pipetting Volume, in uL. This allows you to set a
lower limit on pipetting volumes to use in certain protocol steps, such
as sample annealing and binding. We recommend setting this to 1 uL,
though in some cases, for example if sample availability is very
limited, it may be appropriate to set a value below 1 uL. Some protocol
steps include fixed values of 1 uL that will not be affected by this
setting.
Page 9
15. Optionally, do one of the following:
– Click Copy to start a new sample group using the information
entered. Then, edit specific fields for each sample group.
– Click Automate to generate a CSV file. This exports the calculated
values to a CSV file for lab automation.
16. To print the calculation(s) and instructions, use the browser's Print
command (Ctrl-P).
Custom calculations
1. To accommodate new or unique sample types, choose Application >
Custom and enter all settings manually.
2. Click Set Custom Preset Values to save any custom application
settings you may have specified. The next time you select Application
> Custom, those settings are retrieved.
Classic mode
Note: Classic mode is provided for legacy support purposes only. We
highly recommend using High-Throughput mode even for single samples.
1. Select Classic mode.

2. Select Sequel II or Sequel IIe.
3. Click + New Calculation.
4. Enter the sample name.
5. Select a sequencing application for the sample.
6. Enter the available sample volume, in µL.
7. Enter the sample concentration, in ng/ul.
8. Specify an insert size, in base pairs.
9. Select the Internal Control version to use for this run from the list, or
type in a part number. PacBio highly recommends using the Internal
Control to help distinguish between sample quality and instrument
issues in the event of suboptimal sequencing performance. (Note:
PacBio requires the use of the Internal Control for consumables to be
eligible for reimbursement consideration.)
10. If necessary, edit the Cleanup anticipated yield. Adjust this percent-
age based on previous experience. (Cleanup removes excess
primers/polymerase from bound complexes, which results in higher
quality data.)
11. Specify the on-plate loading concentration (OPLC), in pM.
12. Enter the number of SMRT® Cells to bind, at the specified on-plate
loading concentration.
13. Rather than leave a small amount of library behind, use the entire
library volume available if desired by selecting Prepare Entire Sample
> Yes. This generates annealing, binding and cleanup instructions for
the entire available sample volume. The instructions for loading the
sample plate will still follow the scale indicated by the specified
number of SMRT Cells to run.
14. In the complex cleanup step, enter the pre- and post-cleanup sample
DNA quantitation and volume measurement results.
Page 10
15. Optionally, specify an alternative number of cells or on-plate loading
concentration (OPLC) for the final sample dilution step. Use this
feature, for example, to initially set up a single-SMRT Cell run to test a
specific loading concentration prior to conducting a multi-SMRT Cell
sequencing run, or to set up a loading titration experiment to optimize
the OPLC for your particular sample.
16. Optionally, do one of the following:

– Click Copy to start a new sample using the information entered.
Then, edit specific fields for each sample.
– Click Remove to delete the current calculation.
– Click Lock to lock the calculation. This is required before samples
can be imported into the Run Design module, and also sends a
finalized version of the instructions to the server for use in Data Set
reports. After locking, no further changes can be made to a
calculation. (Click View to see the locked instructions.) Locking
ensures that calculations are always synchronized with their run
time state if a report is generated at a later date. (Lock is only
available If there are one or more samples visible and most fields
have values entered.)
– Click the New Sample button at the top of the screen to start a new,
empty sample.
17. Specify whether to display the full instructions, or only the loading
instructions.
Page 11
Advanced options
• Specify the Minimum Pipetting Volume, in uL. This allows you to set a
lower limit on pipetting volumes to use in certain protocol steps, such
as sample annealing and binding. We recommend setting this to 1 uL,
though in some cases, for example if sample availability is very
limited, it may be appropriate to set a value below 1 uL. Some protocol
steps include fixed values of 1 uL that will not be affected by this
setting.
• Specify the % of Annealing Reaction to Use in Binding. This
accommodates pipetting underage: Due to pipetting issues, volumes
may not add up to what they should; a value below 100% helps ensure
there will be enough annealed sample for binding.
Editing or printing calculations

1. On the Sample Setup screen, select one or more calculation names.
2. Click Edit/Print. (Note: If the samples use different versions of
chemistry, a warning message displays.)
3. Edit the sample(s) as necessary.
4. Specify whether to display the full instructions, or only the loading
instructions.
5. To print the calculation(s), use the browser's Print command (Ctrl-P).
Deleting calculations
1. On the Sample Setup screen, select one or more calculation names to
delete.
2. Click Delete.
Importing/exporting calculations
Sample Setup supports importing and exporting calculations in CSV
format.
To import a new calculation, first find (or create) a calculation similar to

that you wish to import, then export it in CSV format. You can then
customize the exported CSV file as needed, then import the modified CSV
file.
Note: The content of the CSV file generated using the Export button in the
Sample Setup home screen is different from the content of the CSV file
generated using the High-Throughput mode’s Automate button used for
lab automation.

2. Select Sample Setup.
3. Select High-Throughput.
4. Select an existing calculation.
5. Click Export, then click Download.
6. Edit the exported calculation in Excel (changing sample names, con-
centrations, and so on), then save it under a new name.
Page 12
7. In Sample Setup, click Import.
8. Click Browse, then select the CSV file you previously modified in Step
6 and click Open. If everything is correct, click Continue. The imported
calculation displays.
Note:
• You can select multiple calculations to export to the same CSV file.
• You can also import multiple calculations by adding rows to the CSV
file.
Following are the fields contained in the CSV-format Calculations file.
Field name Required Description
Sample Name Yes Enter alphanumeric characters, spaces, hyphens,

underscores, colons, or periods only.
System Name Yes Must be Sequel II, or Sequel IIe.
Application Yes Enter one of the following values:
• HiFi Reads
• Microbial Assembly
• HiFiViral SARS-CoV-2
• Iso-Seq Method
• Adeno-Associated Virus
• Full-Length 16S rRNA Sequencing
• Shotgun Metagenomic Profiling or
Assembly
• <3kb Amplicons
• >=3kb Amplicons
• Custom
Available Starting Sample Volume (uL) Yes Enter a positive integer. Units are in microliters.
Starting Sample Concentration (ng/uL) Yes Enter a positive integer. Units are in nanograms per
microliter.
Insert Size (bp) Yes Enter a positive integer. Units are in base pairs.
Control Kit No Must be blank or Lxxxxx101717600123199.
Cleanup Anticipated Yield (%) No Enter a positive integer.
Note: If Application is set to Custom, this field is required.
On Plate Loading Concentration (pM) Yes Enter a positive integer. Units are in parts per million.
Cells to Bind (cells) Yes Enter a positive integer.
Prepare Entire Sample Yes Enter a Boolean value: true, t, yes, y, false, f, no,
or n. Boolean values are not case-sensitive.
Sequencing Primer Yes Enter one of the following values:
• Sequencing Primer v2
Page 13
Field name Required Description
Binding Kit Yes For Sequel II/IIe Binding Kits 2.0, 2.1, 2.2, 3.1 and 3.2:
• Lxxxxx101780500123199 (2.0)
• Lxxxxx101820500123199 (2.1)
• Lxxxxx101894200123199 (2.2)
• Lxxxxx102194200123199 (3.1)
• Lxxxxx102194100123199 (3.2)
Target Annealing Concentration (nM) No Enter a positive integer. Units are in nanomolar.
Target Binding Concentration (nM) No Enter a positive integer. Units are in nanomolar.
Target Polymerase Concentration (X) No Enter a positive integer.
Binding Time (hours) No Enter a positive integer.
Cleanup Bead Type No Must be AMPure or ProNex.
Cleanup Bead Concentration (X) No Enter a positive integer.
Minimum Pipetting Volume (uL) No Enter a positive integer. Units are in microliters.
Percent of Annealing Reaction To Use In No Enter a positive integer.
Binding (%) Note: If Application is set to Custom, this field is required.
AMPure Diluted Bound Complex Volume No Enter a positive integer. Units are in microliters.
(uL)
AMPure Diluted Bound Complex No Enter a positive integer. Units are in nanograms per
Concentration (ng/uL) microliter.
AMPure Purified Complex Volume (uL) No Enter a positive integer. Units are in microliters.
AMPure Purified Complex Concentration No Enter a positive integer. Units are in nanograms per
(ng/uL) microliter.
ProNex Diluted Bound Complex Volume No Enter a positive integer. Units are in microliters.
(uL)
ProNex Diluted Bound Complex No Enter a positive integer. Units are in nanograms per
Concentration (ng/uL) microliter.
ProNex Purified Complex Volume (uL) No Enter a positive integer. Units are in microliters.
ProNex Purified Complex Concentration No Enter a positive integer. Units are in nanograms per
(ng/uL) microliter.
Requested Cells Alternate (cells) No Enter a positive integer.
Requested OPLC Alternate (pM) No Enter a positive integer. Units are in parts per million.
CSV file general requirements

• Each line in the CSV file represents one sample.
• The CSV file may only contain ASCII characters. Specifically, it must
satisfy the regular expression /^[\x00-\x7F]*$/g
Following are the fields contained in the CSV file generated by the
Automate button in High-Throughput mode. This includes all the fields
Page 14
that display in the Sample Setup page, with the volumes listed in each
table easily accessible for liquid handling automation purposes.
Row Field name
1 Export Version
Version number of the file format specification. Allows for scripts to check
version numbers to ensure compatibility through subsequent software
releases.
2 Instructions Version
Version number of SMRT Link, chemistry bundle, and parameters.
3 Sample Group Name
4 Annealing Number of Samples
5 Annealing Sample Volume
6 Annealing Master Mix Volume
7 Annealing Incubation Temperature (C)
8 Annealing Incubation Time (minutes)
9 Polymerase Stock Volume
10 Sequel II Polymerase Dilution Buffer Volume
11 Binding Number of Samples
12 Binding Annealed Sample Volume
13 Binding Master Mix Volume
14 Binding Diluted Polymerase Volume
15 Binding Incubation Temperature (C)
16 Binding Incubation Time (minutes)
17 ICD1 Sequel Complex Dilution Buffer Volume
18 ICD1 Internal Control Stock Volume
20 ICD2 Diluted Internal Control (ICD1) Volume
22 ICD3 Diluted Internal Control (ICD2) Volume
23 Cleanup S2 Sample Input Volume
24 Cleanup S2 Diluent Volume
25 Cleanup S2 Binding Buffer
26 Cleanup S3 Bead Solution Volume
27 Cleanup S5 Elution Volume
28 Cleanup S5 Elution Buffer
28 Final Loading Number of Samples
30 Final Loading Prepared Sample Volume
31 Final Loading Diluted Internal Control (ICD3) Volume
32 Final Loading Volume (micro-liter)
Page 15
Run Design
Use SMRT Link's Run Design module to create, edit, or import Run
Designs. A Run Design specifies:
• The samples, reagents, and SMRT Cells to include in the sequencing

run.
• The run parameters such as movie time and loading to use for the
sample.
The Run Design then becomes available from the Sequel Instrument
Control Software (ICS), which is the instrument touchscreen software
used to select a Run Design, load the instrument, and then start the run.
Run Designs created in SMRT Link are accessible from all Sequel II
systems linked to the same SMRT Link server.
SMRT Link includes two different ways to create a Run Design:
• Use SMRT Link’s Run Design module to create a new Run Design.
• Create a CSV file, then import it using SMRT Link’s Run Design
module.
Note: To create a run design, either use the Run Design screen, or import
a CSV file. Do not mix the two methods.
Creating a new Run Design

2. Select Run Design.
3. Runs Designs can be sorted and searched for:
– To sort Run Designs, click a column title.
– To search for a Run Design, enter a unique search string into the
Search field.
4. To initiate a new Run Design, click + Create New Design.
Page 16
5. Specify if this Run Design is to be used with a Sequel II system or a
Sequel IIe system. This affects the initial default values.
6. Enter a Run Name. (The software creates a new run name based on
the current date and time; edit the name as needed.)
7. (Optional) Enter Run Comments, Experiment Name, and
Experiment ID as needed. (Note: Experiment ID must be
alphanumeric.)
8. (Optional) Click Select Sample to import information from a
previously-created Sample Setup entry. The following fields are auto-
populated as appropriate:
– Sample Name
– Binding Kit
– DNA Control Complex
– Insert Size
– On-Plate Loading Concentration
Application-based Run Designs
9. Select a sequencing application from the list. The following fields are
auto-populated, and display in green:
Page 17
– Template Prep Kit
– Binding Kit
– Sequencing Kit
– DNA Control Complex
– Movie Time per SMRT Cell (hours)
– Pre-Extension Time (hours)
10. Enter a Well Sample Name. (This is the name of the sequencing
library loaded into one well. Example: HG002_2019_11_02_10K)
11. Enter a Bio Sample Name. (This is the name of the biological sample
contained in the sequencing library, such as HG002. See “Working
with barcoded data” on page 107 for details.)
12. (Optional) Enter Sample Comments.
13. Specify the well position used for this sample: Click the icon to the
right of the entry field and choose a plate position.
14. Specify an insert size (500 base pairs minimum). The insert size is
the length of the double-stranded nucleic acid fragment in a SMRTbell
template, excluding the hairpin adapters. This matches the average
insert size for the sample; the size range boundaries are described in
the library preparation protocol. Note: The default insert size for
Subreads is 30,000; 10,000 for CCS reads.
15. Specify the On-Plate loading concentration (OPLC), in picomolarity.
16. (Optional) If you are using barcoded samples, see “Step 1: Specify the
barcode setup and sample names in a Run Design” on page 107 for
instructions. For details on secondary analysis of barcoded samples,
see “Demultiplex Barcodes” on page 92.
17. Sample options:
– Click Copy. This starts a new sample, using the values entered in
the first sample.
– Click Delete. This deletes the current sample.
– Click Add Sample. This starts a new, empty sample.
18. After filling in all the samples, click Save - this saves the entire Run
Design. The new Run Design displays on the main Run Design page.
19. Click View Summary to view a table summarizing the entire Run
Design. The Run Design file is now imported and available for
selection in Sequel ICS on the instrument.
20. (Optional) Auto Analysis allows a specific analysis to be
automatically run after a sequencing run has finished and the data
transferred to the SMRT Link server. See “Automated analysis” on
page 115 for details.
Custom Run Designs

To accommodate new or unique Run Designs, choose Application >
Custom and enter all parameters manually. (See here for
recommendations based on the analysis application used.)
Page 18
– Template Prep Kit, Binding Kit, or Sequencing Kit: Select one from
the list, or type in a kit part number. If the barcode is invalid, "Invalid
barcode" displays.
Note: If the Sequencing or Binding kit selected is incompatible, an
error message displays indicating the obsolete chemistry, and the
run is prevented from proceeding.
– DNA Control Complex: PacBio highly recommends using the
Internal Control to help distinguish between sample quality and
instrument issues in the event of suboptimal sequencing
performance. (Note: PacBio requires the use of the Internal Control
for consumables to be eligible for reimbursement consideration.)
– Movie time per SMRT Cell (hours): Enter a time between 0.5 and
30. Note: The SMRT Cell 8M part supports all movie times up to 30
hours.
– Use Pre-Extension: If selected, optionally specify the length of pre-
extension time in hours. This initiates the sequencing reaction prior
to data acquisition. After the specified time, the sequencing
reagents are removed from the SMRT Cell and replenished with
fresh reagents, and data acquisition starts. This feature is useful for
short inserts (such as ≤15 kb) and provides a significant increase in
read length.
– Include 5mC Calls in CpG Motifs: If selected, analyzes the kinetic
signatures of cytosine bases in CpG motifs to identify the presence
of 5mC.
– Detect and Resolve Heteroduplex Reads: Heteroduplexes are DNA
molecules where the forward and reverse strands are not perfect
reverse-complements. If the option is selected and heteroduplexes
are detected, a consensus is called for each strand separately, and
the sequence of both strands is output.
Note: This option displays only if Adeno-Associated Virus, Full-
Length 16S rRNA Sequencing, <3kb Amplicons, or >=3kb
Amplicons are selected as the application.
Advanced options
• Specify whether to use Adaptive Loading. Adaptive Loading uses
active monitoring of the ZMW loading process to predict a favorable
loading end point. Certain steps (Cleanup and Sample Dilution)
require a different buffer (Adaptive Loading Buffer) if this feature is
used. Note: Adaptive Loading requires the use of Sequel® II binding
kit 2.2. If you select Yes, fill in the following fields:
– Loading Target (P1 + P2): The fraction of ZMWs that the Adaptive
Loading routine will aim to load with at least one sequencing
complex. The default target for CCS applications is higher to
accommodate loss of complexes during pre-extension, which is
generally recommended for all CCS applications.
– Maximum Loading Time (hours): This defines the maximum time
the system will allow loading to progress before proceeding to
sequencing. (Loading time in Adaptive Loading is flexible.)
Page 19
• Specify the length of time (1, 2 or 4 hours) for immobilization of
SMRTbell templates. This is the length of time the SMRT Cell is at the
Cell Prep Station to allow diffusion of SMRTbell templates into the
ZMWs. This option is not available if Adaptive Loading is selected.
– PacBio highly recommends using the default immobilization time
of 2 hours.
• (Sequel IIe systems only) Specify, for this Run Design only, whether to
include kinetics information (used for epigenetics analysis) in the CCS
analysis output. This setting overwrites the global setting in Gear >
Configure > CCS Analysis Output. Note: Adding kinetics information
can increase the amount of storage used by the output BAM files by
up to 5 times.
• Specify, for this Run Design only, whether to include low quality reads
(non-HiFi reads) in the CCS analysis output. Note that this option
disables automatic demultiplexing, 5mC detection, and heteroduplex
insert detection, if applicable.
• Add Data to Project: Specify that Data Sets generated by SMRT
Cell(s) using this Run Design be associated with the selected Project.
(This also applies to any Data Sets generated using Auto Analysis. By
default, all Data Sets are assigned to General Project, which is
accessible to all users.)
Editing or deleting Run Designs

1. On the home page, select Run Design.
2. Click the name of the Run Design to edit or delete.
3. (Optional) Click View Summary to view a table summarizing the entire
Run Design.
4. (Optional) Click Delete to delete the current Run Design.
5. (Optional) Edit any of the fields.
6. Click Save.
Creating a Run Design by importing a CSV file

On a remote workstation, open the sample CSV file included with the
installation.
To obtain the sample CSV files

2. Click Import Run Design.
3. Click Download Template. The ZIP file containing templates (one for
Sequel II systems, and one for Sequel IIe systems) downloads to your
local machine.
To update and import the CSV file
1. Update the appropriate CSV file as necessary for the Run Design. (See
the definitions of the Run Design attributes in the table below.)
2. Save the edited CSV file.
3. Import the file into Sequel ICS using SMRT Link. To do so, first access
SMRT Link using the Chrome web browser.
Page 20
4. Select Run Design.
5. Click Import Run Design.
6. Select the saved CSV file designed for the run and click Open. The file
is now imported and available for selection in Sequel ICS on the
instrument.
CSV file structure
• Each CSV file row represents one sample.

• The first row contains run-level information such as Run Name, Run
Comments, and so on.
• For demultiplexed samples only, one additional row per barcode/Bio
Sample Name combination is added below the master sample row.
Note: Specifying cluster settings configuration is not yet supported from

the Run Design CSV
Outputting Subreads on the Sequel IIe system
The Sequel IIe system can be configured to output Subreads data in BAM
format by using the Run Design CSV import mechanism. In addition to the
other required columns, users can add the column Emitted Subreads
Percent to the CSV file, with a value of 0-100 for a given collection. This
results in the inclusion of Subreads from 0-100% of ZMWs in the Data Set
transferred from the instrument, in a BAM file separate from the HiFi
reads. Note that this will not result in the inclusion of associated scraps
data for each ZMW.
Run Design attribute Required Description
Experiment Name No Enter alphanumeric characters, spaces, hyphens, underscores, colons,

or periods only. Defaults to Run Name.
Example: Standard_Edna.1
Experiment Id No Enter a valid experiment ID. Example: 325/3250057
• Experiment IDs cannot contain the following characters:
<, >, :, ", \, |, ?, *, or ).
• Experiment IDs cannot start or end with a / and cannot have two
adjacent / characters, such as //.
• Experiment IDs cannot contain spaces.
• Specifically, Experiment IDs cannot satisfy the regular expressions:
/[<>:"\\|?\*]/g, /(?:^\/)|\/\/|(?:\/$)/, / /g
Experiment Description No Enter any ASCII string. Defaults to Run Comments.
Example: 20170530_A6_VVnC_SampleSheet
Run Name Yes Enter alphanumeric characters, spaces, hyphens, underscores, colons,
or periods only. Run name must be entered for the first cell and will be
applied to the remaining cells in the run.
Example: 20170530_A6_VVnC_SampleSheet
System Name No Must be Sequel II or Sequel IIe.
Run Comments No Enter alphanumeric characters, spaces, hyphens, underscores, colons,
or periods only. Example: ecoliK12_March2021
Page 21
Is Collection No Enter a Boolean value. (See Boolean details below.) Specifies whether
the row designates a Collection (TRUE) or a barcoded sample
(FALSE).
• Collection lines should have the Barcode Name and Bio Sample
Name fields blank.
• Barcoded Sample lines only need to include the Is Collection,
Sample Name, Barcode Name, and Bio Sample Name fields.
Sample Well Yes Must be specified in every row. Well number must start with a letter A
through H, and end in a number 01 through 12, i.e. A01 through H12.
It must satisfy the regular expression ``/^[A-H](?:0[1-9]|1[0-
2])$/`` Example: A01
Well Sample Name Yes Enter alphanumeric characters, spaces, hyphens, underscores, colons,
or periods only.
Example: A6_3230046_A01_SB_ChemKitv2_8rxnKit
Note: The Sample Name must be unique within a run.
Movie Time per SMRT Cell Yes Enter a floating point number between 0.1 and 30. Time is in hours.
(hours) Example: 5
Use Adaptive Loading No Enter a Boolean value. (See Boolean details below.)
Loading Target (P1 + P2) No Enter a floating point number between 0.01 and 1. Example: 0.4
Maximum Loading Time No Enter a floating point number between 1 and 2. Time is in hours.
(hours) Example: 1.2
Sample Comment No Enter alphanumeric characters, spaces, hyphens, underscores, colons,
or periods only.
Example: A6_3230046_A01_SB_BindKit_ChemKit
Insert Size (bp) Yes Enter an integer ≥10. Units are in base pairs. Example: 2000
On Plate Loading No Enter a floating point number. Units are in parts per million.
Concentration (pM) Example: 5
Size Selection No Enter a Boolean value. (See Boolean details below.) Default is FALSE.
Template Prep Kit Box Barcode Yes Enter or scan a valid kit barcode. (See Kit Barcode Requirements
details below.)
Working example: DM1117100259100111716
DNA Control Complex Box No Enter or scan a valid kit barcode. (See Kit Barcode Requirements
Barcode details below.)
Binding Kit Box Barcode Yes Enter or scan a valid kit barcode. (See Kit Barcode Requirements
details below.)
Sequencing Kit Box Barcode Yes Enter or scan a valid kit barcode. (See Kit Barcode Requirements
details below.)
Automation Name No Enter diffusion (not case-sensitive) or a custom script. (Sequel II
systems do not support magbead loading.)
A path can also be used, such as
/path/to/my/script/my_script.py. The path will not be
processed further, so if the full URI is required, it must be included in
the CSV, such as
chemistry://path/to/my/script/my_script.py.
Automation Parameters No To enable Pre-Extension time, enter the number of hours and set the
boolean value to TRUE. Example 2 hours:
ExtensionTime=double:2|ExtendFirst=boolean:TRUE
(Note: Leave blank when not using Pre-Extension time, or set the
boolean value to FALSE.)
Page 22
Detect and Resolve No Enter a boolean value. (See Boolean details below.) Set to TRUE to
Heteroduplex Reads allow for detection of heteroduplex reads.
Note: Only applicable if Application is set to one of the following:
• <3kb Amplicons
• >=3kb Amplicons
• Custom
Include 5mC Calls in CpG No Enter a boolean value. (See Boolean details below.) Set to TRUE to
Motifs allow for 5mC calls in CpG motifs.
Note: Only applicable if Application is set to HiFi Reads or Custom.
Sample is Barcoded No Enter a boolean value. (See Boolean details below.) Set to TRUE for a
barcoded run.
Demultiplex Barcodes No Add any of the following values: Do Not Generate, In SMRT Link, or
On Instrument.
If left blank, the default is Do Not Generate for all systems.
Note: This is available for all applications. The following values are
recommended based upon your system:
• Sequel II system: Enter one of the following values: Do Not
Generate or In SMRT Link.
• Sequel IIe system: Enter one of the following values: Do Not
Generate, In SMRT Link, or On Instrument.
CCS Analysis Output - Include No Enter a boolean value. (See Boolean details below.)
Low Quality Reads • Set to TRUE to allow for CCS analysis with --all mode activated
and produce a reads.bam file
• Set to FALSE to exclude all reads with rq < 0.99.
Barcode Set No Must be a UUID for a Barcode Set present in the database.
To find the UUID: Click Data Management > View Data > Barcodes.
Click the Barcode file of interest, then view the UUID.
Example: dad4949d-f637-0979-b5d1-9777eff62008
Note: This field is used for demultiplexed data.
Same Barcodes on Both Ends No Enter a boolean value. (See Boolean details below.) Set to TRUE if
of Sequence symmetric, FALSE if asymmetric.
Barcode Name No Enter Barcode Names one per line.
Example: bc1001--bc1001
• Use double hyphens (--) to separate the 2 barcodes of each pair.
• The barcode names must be contained within the specified
Barcode Set.
• A given barcode name cannot appear more than once in the
spreadsheet.
• A maximum of 15,000 barcodes is permitted per sample.
Bio Sample Name Yes Enter Bio Sample Names in the same row as their associated Barcode
Names. Use alphanumeric characters, spaces (allowed but not
recommended for compatibility with downstream software), hyphens,
underscores, colons, or periods only. Bio Sample Names cannot be
longer than 40 characters.
Example: sample1
Note: This field is used for collections for non-multiplexed data, and
for barcoded samples in multiplexed data.
Page 23
Pipeline ID No Note: This field is required to create an Auto Analysis.

• 5mC CpG Detection:
cromwell.workflows.pb_detect_methyl
• Demultiplex Barcodes: cromwell.workflows.pb_demux_ccs
• Export Reads: cromwell.workflows.pb_export_ccs
• Genome Assembly:
cromwell.workflows.pb_assembly_hifi
• HiFi Mapping: cromwell.workflows.pb_align_ccs
• HiFiViral SARS CoV-2 Analysis:
cromwell.workflows.pb_sars_cov2_kit
• Iso-Seq Analysis:
cromwell.workflows.pb_isoseq3_ccsonly
• Mark PCR Duplicates:
cromwell.workflows.pb_mark_duplicates
• Microbial Genome Analysis:
cromwell.workflows.pb_microbial_analysis
• Minor Variants Analysis: cromwell.workflows.pb_mv_ccs
• Structural Variant Calling: cromwell.workflows.pb_sv_ccs
• Trim Ultra-Low Adapters:
cromwell.workflows.pb_trim_adapters
Analysis Name No Enter any ASCII string. See Auto Analysis Fields below for details.
Note: This field is required for Auto Analysis, otherwise the name will
be “”.
Example: sample 1 analysis
Entry Points No Entry Points only apply to Barcode Sets and Reference Sets. In
addition, this field is required for Auto Analysis.
Enter an ASCII string in the format file_type;entry_id;uuid,

with parameters separated by | characters.
• To find the UUID: Click Data Management > View Data > HiFi
Reads or Subreads. Click the Data Set of interest, then view the
UUID.
• See the SMRT® Tools reference guide section Appendix A -
Application entry points and output files to see the entry point
names for each application.
Example: PacBio.DataSet.BarcodeSet;eid_barcode;afe89e3f-17ca-
e9b8-eae9-
b701dbb1f02d|PacBio.DataSet.ReferenceSet;eid_ref_dataset;6b8db1
44-a601-4577-ab04-ba64cadc0548
Task Options No Enter an ASCII string containing the options for the application
referred to in the Pipeline ID field, with parameters separated by “;”
characters: task_id;value_type;value.
Example: pbmm2_align.task_options.minalnlength;integer;50
Note: This field is optional for Auto Analysis - any task options not
specified will use pipeline defaults.
Page 24
Application No • HiFi Reads

• Microbial Assembly
• Iso-Seq Method
• HiFiViral SARS-CoV-2
• Full-Length 16S rRNA Sequencing
• Shotgun Metagenomic Profiling or Assembly
• <3kb Amplicon Sequencing
• >=3kb Amplicon Sequencing
• Custom
If blank or contains invalid values, default is Custom.

CCS Analysis Output - Include No Enter a boolean value. (See Boolean details below.) Set to TRUE to
Kinetics Information specify that CCS analysis output includes kinetics information (used
for epigenetics analysis.) Note: Adding kinetics information can
increase the amount of storage used by the output BAM files by up to
5 times.
CSV file general requirements

• Each line in the CSV file represents one sample.
• The CSV file may only contain ASCII characters. Specifically, it must
satisfy the regular expression /^[\x00-\x7F]*$/g
Boolean values
• Valid boolean values for true are: true, t, yes, or y.
• Valid boolean values for false are: false, f, no, or n.
• Boolean values are not case-sensitive.
Kit barcode requirements

Kit barcodes are composed of three parts used to make a single string:
1. Lot Number (Example: DM1234)

2. Part Number (Example: 100-619-300)
3. Expiration Date (Example: 2020-12-31)
For the above example, the full kit barcode would be:
DM1234100619300123120.
Each kit must have a valid Part Number and cannot be obsolete. The list
of kits can be found through a services endpoint such as:
[server name]:[services port number]/smrt-link/bundles/chemistry-pb/active/

files/definitions%2FPacBioAutomationConstraints.xml
This services endpoint will list, for each kit, the part numbers
(PartNumber) and whether it is obsolete (IsObsolete).
Page 25
Dates must also be valid, meaning they must exist in the Gregorian
calendar.
Auto Analysis fields

• The fields include Pipeline ID, Analysis Name, Entry Points, and Task
Options.
• You can define one analysis for each Collection or Bio Sample. The
Pipeline ID, Analysis Name and Entry Points fields are required to
create an Auto Analysis.
• The analysis name is a concatenation of the values of the Analysis
Name and Bio Sample Name fields.
• The Task Options field may be left blank; any task options not
specified will use pipeline defaults.
Page 26
Run QC
Use SMRT Link’s Run QC module to monitor performance trends and
perform run QC remotely.
Metrics can be reviewed in the Run QC module. All Sequel II systems

connected to SMRT Link can be reviewed using Run QC.

2. Select Run QC.
Accessing instrument status
1. Select Instrument Status. For each instrument connected to the

instance of SMRT Link, this displays the instrument name and its
current status, SMRT Cell status, when the run will be completed, any
active alarms, and how many sequencing ZMWs are active.
• A red alarm symbol displays next to the instrument status if any
errors or warnings appear during a sequencing run.
• If an instrument does not have a SMRT Cell tray loaded, the SMRT Cell
Status field will not display any icons. The icons are:
– Fully green: The SMRT Cell has completed sequencing.
– Half green: The SMRT Cell is being prepared or is currently
sequencing.
– White: The SMRT Cell is in the queue for sequencing, but cell
preparation has not started.
Page 27
• Run Completion: Displays the estimated time remaining to complete
sequencing run or the time elapsed since the sequencing run
completed. Also displays the date (in YYYY-MM-DD format) when the
last sequencing run was completed.
• Sequencing ZMWs: Displays a plot of how many ZMWs on a SMRT
Cell are actively sequencing during a movie collection. For
sequencing runs conducted with Binding kit 2.2 and 3.2, only the
number of actively sequencing singly-loaded ZMWs (P1) displays.
For sequencing runs conducted with Binding kit 2.1 and 3.1, the total
number of actively sequencing ZMWs (P1 + P2) displays.
Note: Due to terminations, not all ZMWs are singly-loaded at the same
time. Some ZMWs are singly-loaded only at or near the end of a movie
collection, whereas others are singly-loaded only at the beginning.
(Singly-loaded means that the ZMW contains only one active polymerase
instead of two or more simultaneously active polymerases.) For runs
conducted with Binding kit 2.2 and 3.2, the peak concurrent Sequencing
ZMWs value shown in the plot will always be less than the final %P1 ZMW
yield reported in the Run QC metrics table at the end of a movie collection.
(For sequencing runs conducted with Binding kit 2.1 and 3.1, the peak
concurrent Sequencing ZMWs value shown in the plot will always be
higher than the final %P1 ZMW yield reported in Run QC.)
For a SMRT Cell that achieves ≥50% P1 loading and ≥10% P0, the ZMW
Sequencing plot should typically display a peak value above 2,000,000.
See the figure below for an example comparison between the Instrument
Status report (top) and Run QC report (bottom) for a WGS sample
sequenced using Binding kit 3.2 with a 30-hour movie collection time.
The Sequencing ZMWs plot in the Instrument Status report shows that
the peak concurrent Sequencing ZMWs value for the last SMRT Cell in the
run (Well D01) is approximately 3,000,000 ZMWs, whereas the final %P1
ZMW yield reported in the corresponding Run QC metrics table for Well
D01 is 76.8% (or 6,144,000 P1 ZMWs.)
Page 28
Accessing run information
1. Select Run Status.

2. Click Sequel II or Sequel IIe to view informations on runs for a
specific instrument model.
3. Runs can be sorted and searched for:
– To sort runs, click a column title.
– To search for a run, enter a unique search string into the Search
field.
4. Click the run to view information about that run.
5. To export Run QC data in CSV format: Select one or more runs in the
table, then click Export Selected.
Table fields
Note: Not all table fields are shown by default. To see additional table
fields, click the > symbol next to a column title.
• Name: A list of all runs for the instruments connected to SMRT Link.
Click a run name to view more detailed information on the individual
run page.
• Summary: A description of the run.
• Dates
– Run Date: The date and time when the run was started.
– Completion Date: The date and time the run was completed.
– Transferred Date: The date and time the run results were
transferred to the network.
• Created By: The name of the user who created the run.
• Status: The current status of the run. Can be one of the following:
Running, Complete, Failed, Terminated, or Unknown.
• Instrument Details
– Instrument Name: The name of the instrument.
– Instrument SN: The serial number of the instrument.
– Instrument SW: The versions of Sequel Instrument Control
Software (ICS) installed on the instrument.
• Cells
– Total: The total number of SMRT Cells used in the run.
– Completed: The number of SMRT Cells that generated data for the
run.
Page 29
– Failed: The number of SMRT Cells that failed to generate data
during the run.
• Run ID: An internally-generated ID number identifying the run.
• Primary Analysis SW: The version of Primary Analysis software
installed on the instrument.
• UUID: Another internally-generated ID number identifying the run.
6. Click the Run name of interest. Following are the fields and metrics
displayed.
• Run Start: The date and time when the run was started.
• Run Complete: The date and time the run was completed.
• Transfer Complete: The date and time that the run data was
successfully transferred to the network.
• Run ID: An internally-generated ID number identifying the run.
• Description: The description, as defined when creating the run.
• Instrument: The name of the instrument.
• Instrument SN: The serial number of the instrument.
• Instrument Control SW Version: The versions of Sequel Instrument
Control Software (ICS) installed on the instrument.
• Instrument Chemistry Bundle: The version of the Chemistry Bundle
installed on the instrument when the run was initiated.
• Primary SW Version: The versions of Primary Analysis software
installed on the instrument.
7. Click the > arrow at the top of the Consumables table to see the
sample wells used, consumable type, lot number, expiration date, and
other information.
Page 30
Run settings and metrics
Note: Click Expand All to expand all of the table columns. Click Collapse
All to collapse the table columns.
• Well: The ID of an individual well used for this sample.

• Sample Information
– Name: The sample name, as defined when creating the run. Clicking
the name will take you to the corresponding entry in the Data
Management module.
– Comment: Sample comment, entered in Run Design.
• Run Settings
– Movie Time (hrs): The length of the movie associated with this
SMRT Cell.
– Loading Concentration (pM): The on-plate loading concentration, in
picomolarity.
– Pre-extension Time (hrs): The pre-extension time used in the
collection, if any.
– Workflow: The instrument robotics workflow used for the run.
– Loading Time: The time the system took for loading to progress
before proceeding to sequencing.
• Status: The current collection status for the SMRT Cell. This can be
one of the following: Complete, Collecting, Aborted, Failed, In
Progress, or Pending.
• Total Bases (Gb): Calculated by multiplying the number of productive
(P1) ZMWs by the mean polymerase read length; displayed in
Gigabases.
• Unique Molecular Yield (Gb): The sum total length of unique single
molecules that were sequenced. It is calculated as the sum of per-
ZMW median subread lengths.
• Productivity (%)
– P0: Empty ZMW; no signal detected.
– P1: ZMW with a high quality read detected.
– P2: Other, signal detected but no high quality read.
• Reads: Polymerase reads are trimmed to the high-quality region and
include bases from adapters, as well as potentially multiple passes
around a SMRTbell template.
– HiFi Reads ≥Q20 Reads: The total number of CCS reads whose
quality value is equal to or greater than 20.
– HiFi Reads Yield: The total yield (in base pairs) of the CCS reads
whose quality value is equal to or greater than 20.
– HiFi Reads Mean Length: The mean read length of the CCS reads
whose quality value is equal to or greater than 20.
– HiFi Reads Median QV: The median number of CCS reads whose
– Polymerase Read Length Mean: The mean high-quality read length
of all polymerase reads. The value includes bases from adapters as
well as multiple passes around a circular template.
Page 31
– Polymerase Read Length N50: 50% of all read bases came from
polymerase reads longer than this value.
– Longest Subread Mean: The mean subread length, considering only
the longest subread from each ZMW.
– Longest Subread N50: 50% of all read bases came from subreads
longer than this value when considering only the longest subread
from each ZMW.
• Control
– Poly RL Mean (bp): The mean polymerase read length of the control
reads.
– Total Reads: The number of control reads obtained.
– Concordance Mean: The average concordance (agreement)
between the control raw reads and the control reference sequence.
– Concordance Mode: The median concordance (agreement)
between the control raw reads and the control reference sequence.
• Local Base Rate: The average base incorporation rate, excluding
polymerase pausing events.
• Template
– Missing Adapter (%): The percent of pre-filter ZMWs that are
missing adapters.
– Adapter Dimer: The percent of pre-filter ZMWs which have
observed inserts of 0-10 bp. These are likely adapter dimers.
– Short Insert: The percent of pre-filter ZMWs which have observed
inserts of 11-100 bp. These are likely short fragment
contamination.
8. View plots for each SMRT Cell where data was successfully trans-
ferred. Clicking on an individual plot displays an expanded view.
These plots include:
• Polymerase Read Length: Plots the number of reads against the
polymerase read length.
• Control Polymerase RL: Displays the polymerase read length
distribution of the control, if used.
• Control Concordance: Maps control reads against the known control
reference and reports the concordance.
• Base Υield Density: Displays the number of bases sequenced in the
collection, according to the length of the read in which they were
observed. Values displayed are per unit of read length (i.e. the base
yield density) and are averaged over 2000 bp windows to gently
smooth the data. Regions of the graph corresponding to bases found
in reads longer than the N50 and N95 values are shaded in medium
and dark blue, respectively.
• Read Length Density: Displays a density plot of reads, hexagonally
binned according to their high-quality read length and median subread
length. For very large insert libraries, most reads consist of a single
subread and will fall along the diagonal. For shorter inserts, subreads
Page 32
will be shorter than the HQ read length, and will appear as horizontal
features. This plot is useful for quickly visualizing aspects of library
quality, including insert size distributions, reads terminating at
adapters, and missing adapters.
• HiFi Read Length Distribution: Displays a histogram distribution of
HiFi reads (QV ≥20), other CCS reads (three or more passes, but QV
<20), and other reads, by read length.
• Read Quality Distribution: Displays a histogram distribution of HiFi
reads (QV ≥20) and other CCS reads by read quality.
• Read Length vs Predicted Accuracy: Displays a heat map of CCS read
lengths and predicted accuracies. The boundary between HiFi reads
and other CCS reads is shown as a dashed line at QV 20.
• 5mC Detections: If 5mC calling in CpG motifs was performed, this
plot displays a reverse cumulative distribution of all detected CpG
motifs according to their predicted probability of methylation.
Page 33
Data Management
Use the Data Management module to:
• Create and manage Data Sets,

• View Data Set information,
• Create and manage Projects,
• View, import, export, or delete sequence, reference, and barcode data.
What is a Data Set?

Data Sets are logical collections of sequencing data (basecalled or
analyzed) that are analyzed together, and for which reports are created.
Data Sets:
• Help to organize and manage basecalled and analyzed data. This is

especially valuable when dealing with large amounts of data collected
from different sequencing runs from one or more instruments.
• Are the way that sequence data is represented and manipulated in
SMRT Link. Sequence data from the instrument is organized in Data
Sets. Data from each cell or collection is a Data Set.
• Can be used to collect data and summarize performance
characteristics, such as data throughput, while an experiment is in
progress.
• Can be used to generate reports about data, and to exchange reports
with collaborators and customers.
• Can be used to start a job. (See “Starting a job from a Data Set” on
page 37 for details.)
A Data Set can contain sequencing data from one or multiple SMRT Cells
or collections from different runs, or a portion of a collection with
multiplexed samples.
For more information on Data Sets, click here.
In SMRT Link, movies, cells/collections, context names and well samples

are all in one-to-one relationships and can be used more or less
interchangeably. That is, a Data Set from a single cell or collection will
also be from a single collection derived from DNA from a single well
sample. Data produced by SMRT Cells, however, can be used by multiple
Data Sets, so that data may have a many-to-one relationship with
collections.
Some Data Sets can contain basecalled data, while others can contain
analyzed data:
• Basecalled data Data Sets contain sequence data from one or

multiple cells or collections.
• Analyzed data Data Sets contain data from previous analyse(s).
Page 34
Elements within a Data Set are of the same data type, typically subreads
or consensus reads, in aligned or unaligned format.
Creating a Data Set

2. Select Data Management.
3. Data Sets can be sorted and searched for:
– To sort Data Sets, click a column title.
– To search for a Data Set, use the Search function. See “Appendix B -
Data search” on page 136 for details.
4. Click + Create Data Set.

5. Enter a name for the new Data Set.
6. Select the type of data to include in the new Data Set:

– HiFi reads: Reads generated with CCS analysis whose quality value
is equal to or greater than 20.
– Subreads: Reads containing the sequence from one or more single
passes of a polymerase on a single strand of an insert within a
SMRTbell template.
The Data Sets table displays the appropriate Data Sets available.
7. (Optional) Specify the Project that this new Data Set will be
associated with using the Projects menu (located at the top-right of
Page 35
the Data Management page.) General Project: This Data Set will be
visible to all SMRT Link users. All My Projects: This Data Set will be
visible only to users who have access to Projects that you are a mem-
ber of.
Note: Selecting a Project also filters the Data Sets that you can use
when creating the new Data Set.
8. In the Data Sets table, select one or more sets of sequence data.
9. (Optional) Choose how to view the Data Set table: 1) Tree Mode - A
barcoded Data Set displays as one row. 2) Flat Mode - A barcoded
Data Set and its demultiplexed subsets display as separate rows.
10. (Optional) Use the Search function to search for specific Data Sets.
See “Appendix B - Data search” on page 136 for details.
11. (Optional) If you selected one Data Set only, click the Filter Reads by
Length box above the Data Set list. Enter the minimum and/or maxi-
mum length to retain in the new Data Set.
12. (Optional) If you selected one Data Set only, click the Filter Reads by
QV≥ box above the Data Set list. Enter the minimum quality value to
retain in the new Data Set.
13. Click Save Data Set. The new Data Set becomes available for
starting analyses, viewing, or generating reports.
14. After the Data Set is created, click its name in the main Data
Management screen to see reports, metrics, and charts describing the
data included in the Data Set. See “Data Set QC reports” on page 37
for details.
Viewing Data Set information

1. On the home page, select Data Management.
2. Click View > Data and select the type of Data Set to view:
SMRTbell template.
3. (Optional) Use the Search function to search for Data Sets. See
“Appendix B - Data search” on page 136 for details.
4. Click the name of the Data Set to see information about the sequence
data included in the Data Set, as well as QC reports.
Copying a Data Set

2. Click View > Data and select the type of data to copy:
Page 36
SMRTbell template.
4. Click the name of the Data Set to copy. The Data Set Reports page
displays.
5. Click Copy. The main Data Management page displays; the new Data
Set has (copy) appended to the name.
Deleting a Data Set

Note: SMRT Link's Delete Data Set functionality deletes the Data Set from
the SMRT Link interface only, not from your server.
It is good practice to export Data Sets you no longer need to a backup

server, then delete them from SMRT Link. This frees up space in the
SMRT Link interface.

2. Click View > Data and select the type of data to delete:
SMRTbell template.
4. Click the name of the Data Set to delete.
5. Click Delete. Note that this deletes the Data Set from the SMRT Link
interface only; not from your server. To delete the Data Set from your
server, manually delete it from the disk.
6. Click Yes. The Data Set is no longer available from SMRT Link.
Starting a job from a Data Set

From the Data Set reports page, a job can be started using the Data Set.
1. Click Analyze..., then name the job and click Next.

2. Follow the instructions starting at Step 12 of “Creating and starting a
job” on page 44.
Data Set QC reports

The Data Set QC reports are generated when you create a new Data Set or
update the data contained in existing Data Sets. These reports are
designed to provide all relevant information about the data included in the
Data Set as it comes from the instrument prior to data analysis, and are
useful for data QC purposes.
Page 37
The following reports are generated by default:
Data Set Overview > Status

Displays the following information about the Data Set:
• The Data Set Name, ID, description, and when it was created and
updated.
• The number of reads and their total length in base pairs.
• The names of the run and instrument that generated the data.
• The biological sample name and well sample names of the sample
used to generate the data.
• Path to the location on your cluster where the data is stored, which
can be used for command-line navigation. For information on
command-line usage, see SMRT® Tools reference guide (v11.0).
Completed Analyses
Lists all completed analyses that used the Data Set as input. To view
details about a specific analysis, click its name.
Raw Data Report > Summary Metrics

• Polymerase Read Bases: The total number of polymerase read bases in the
Data Set.
• Polymerase Reads: The total number of polymerase reads in the Data Set.
• Polymerase Read Length (mean): The mean read length of all polymerase
reads in the Data Set.
• Polymerase Read N50: The read length at which 50% of all the bases in the
Data Set are in polymerase reads longer than, or equal to, this value.
• Subread Length (mean): The mean read length of all subreads in the Data
Set.
• Subread N50: The length at which 50% of all the subreads in the Data Set are
longer than, or equal to, this value.
• Insert Length (mean): The mean length of all the inserts in the Data Set.
• Insert N50: The length at which 50% of all the inserts in the Data Set are
longer than, or equal to, this value.
Information on loading, control reads, and adapters is also displayed.

Other information may display based on the Data Set type.
Page 38
What is a Project?
• Projects are collections of Data Sets, and can be used to restrict
access to Data Sets to a subset of SMRT Link users.
• By default, all Data Sets and data belong to the General Project and
are accessible to all users of SMRT Link.
• Any SMRT Link user can create a Project and be the owner. Projects
must have an owner, and can have multiple owners.
• Unless a Project is shared with other SMRT Link users, it is only
accessible by the owner.
• Only owner(s) can delete a Project; deleting a Project deletes all Data
Sets and analyses that are part of the Project.
Projects include:
• One or more Data Sets and associated Quality Control information.

• One or more analysis results and the associated Data Sets, including
information for all analysis parameters and reference sequence (if
used).
Data Sets and Projects

• Once created, a Data Set always belongs to at least one project; either
the General project or another project the user has access to.
• Data Sets can be associated with multiple projects.
• The data represented by a Data Set can be copied into multiple
projects using the Data Management report page Copy button. Any
changes made to a particular copy of a Data Set affect only that copy,
not any other copies in other Projects. If a Data Set is to be used with
multiple Projects, PacBio recommends that you make a separate
copy for each Project.
• Use the Projects menu (located at the top-right of the Data
Management page) to filter the Data Sets displayed; this is based on
which Projects the Data Sets are associated with.
Creating a Project
Page 39
2. Select Data Management.
3. Click + Create Project.
4. Enter a name for the new project.
5. (Optional) Enter a description for the project.
6. Click Select Data Sets and select one or more sets of sequence data
to associate with the project.
– (Optional) Use the Search function to search for Data Sets. See
7. (Optional) Share the Project with other SMRT Link users. (Note:
Unless a Project is shared, it is only visible to the owner.) There are
two ways to specify who can access the new Project, using the
controls in the Members section:
– Access for all SMRT Link Users: None - No one can access the
project other than the user who created it; View - Everyone can view
the Project; View/Edit: Everyone can see and edit the Project.
– Access for Individual SMRT Link Users: Enter a user name and
click Search By Name. Choose Owner, View, or View/Edit, then click
Add Selected User.
– Notes: A) Projects can have multiple owners. B) If you enable all
SMRT Link users to have View/Edit access, you cannot change an
individual member's access to View.
8. Click Save. The new project becomes available for SMRT Link users
who now have access.
Editing a Project
2. Click View > Projects.
3. Projects can be sorted and searched for:
– To sort Projects: Click a column title.
– To search for a Project, use the Search function. See “Appendix B -
Data search” on page 136 for details.
4. Click the name of the project to edit.
– (Optional) Edit the Project name or description.
– (Optional) Delete a Data Set associated with the Project: Click X.
– (Optional) Add one or more sets of sequence data to the Project:
Click Select Data Sets and select one or more Data Sets to add.
– (Optional) Delete members: Click X next to a Project member's
name to delete that user from access to the Project.
– (Optional) Add members to the Project: See Step 7 in Creating a
Project.
5. Click Save. The modified Project is saved.
Deleting a Project
2. Click View > Projects.
3. Click the name of the Project to delete.
Page 40
4. Click Delete. (This deletes all Data Sets and analyses that are part of
the Project from SMRT Link, but not from the server.)
Viewing/deleting sequence, reference and barcode data

2. Click View > Data, then choose the type of data to view or delete:
SMRTbell template.
– Barcodes: Barcodes from barcoded samples.
– References: Reference sequence FASTA files used when creating
certain analyses.
3. (Optional) Use the Search function to search for specific Data Sets,
barcode files or reference sequence files. See “Appendix B - Data
search” on page 136 for details.
4. Click the name of the sequence, reference or barcode file of interest.
Details for that sequence, reference sequence file or barcode file
display.
5. (Optional) To delete the sequence data, reference sequence, or
barcode file, click Delete.
Note: The Copy button is available for Subreads and HiFi reads, but not
for Reference and Barcode data.
Importing sequence, reference and barcode data

Note: If your Sequel II system or Sequel IIe system is linked to the SMRT
Link software during the instrument installation, your instrument data will
be automatically imported into SMRT Link.
Several types of sequence data, as well as barcode files, can be imported

for use in SMRT Link.

2. Click Import Data.
3. Specify whether to import data from the SMRT Link Server, or from a
Local File System. (Note: Only references and barcodes are available
if you select Local File System.)
Page 41
4. Select the data type to import:
– Subreads: XML file (.subreadset.xml) or ZIP file containing
information about subreads from Sequel II systems, such as paths
to the BAM files.
Use only ZIP files created by SMRT Link.
– HiFi reads: XML file (.consensusreadset.xml) or ZIP file
containing information about HiFi reads (reads generated with CCS
analysis whose quality value is equal to or greater than 20.)
Use only ZIP files created by SMRT Link.
– Barcodes: FASTA (.fa or .fasta), XML (.barcodeset.xml), or ZIP
files containing barcodes.
– References: FASTA (.fa or .fasta), XML (.referenceSet.xml), or
ZIP files containing a reference sequence for use in starting
analyses. (Note: If importing from a local system, Reference files
must be smaller than 15 MB.)
– Note: FASTA files imported into SMRT Link must not contain empty
lines or non-alphanumeric characters. The file name must not start
with a number. For information about the file types listed here, click
here.
5. Navigate to the appropriate file and click Import. The sequence data,
reference, or barcodes are imported and becomes available in SMRT
Link.
Exporting sequence, reference and barcode data

Two types of sequence data (HiFi reads and Subreads) can be exported,
as well as barcode files and reference files.

2. Click Export Data.
3. Select the type of data to export:
SMRTbell template.
Page 42
– Barcodes: Files containing barcodes.
– References: Files containing a reference sequence for use in
starting analyses.
4. (Optional) Use the Search function to search for Data Sets, barcode
files, or reference files. See “Appendix B - Data search” on page 136
for details.
5. Select one or more sets of data to export. (Multiple data files are com-
bined as one ZIP file for export.)
6. Click Export Selected.
7. Navigate to the export destination directory.

8. (Optional) If exporting Data Sets, click Delete data set files after
export to delete the Data Set(s) you selected from the SMRT Link
installation. (Exporting, then deleting, Data Sets is useful for archiving
Data Sets you no longer need.)
9. (Optional) If exporting Data Sets, click Export PDF Reports to create
PDF files containing comprehensive information about the Data
Set(s). Each PDF report contains extensive information about one
Data Set, including loading statistics, run set up and QC information,
analysis parameters and results including charts and histograms, and
lists of the output files generated, all in one convenient document.
10. Click Export.
Page 43
SMRT® Analysis
After a run has completed, use SMRT Link’s SMRT Analysis module to
perform secondary analysis of the data.
Creating and starting a job

2. Select SMRT Analysis.
3. Jobs can be sorted, searched for, and filtered:

– To sort jobs, click a column title.
– To search for a job, use the Search function. See “Appendix B - Data
search” on page 136 for details.)
– To filter the list of jobs based on their state: Click the funnel in the
State column header, then click one or more of the categories of
interest: Select All, Created, Running, Submitted, Terminated,
Successful, Failed, or Aborted.
Page 44
• To filter the list of jobs based on the Project(s) that they are
associated with: Click the Projects menu (located at the top-right of
the main SMRT Analysis page) and select a Project. See “What is a
Project?” on page 39 for details.
4. Click + Create New Job.
5. (Optional) Click Copy From..., choose a job whose settings you wish
to reuse, then click Select. The job name and the Data Type are filled
in. Go to Step 10 to select Data Set(s).
6. Enter a name for the job.
7. Specify the type of job to create:
– Analysis - Uses applications designed to produce biologically-
meaningful results. These applications only accept HiFi reads.
– Auto Analysis - For information on the Auto Analysis feature, see
“Automated analysis” on page 115 for details.
– Data Utility - Data processing utilities used as intermediate steps to
producing biologically-meaningful results.
8. If you selected Data Utility, select the type of data to use for the job:
SMRTbell template.
9. (Optional) Specify the Project that this job will be associated with
using the Projects menu (located at the top-right of the SMRT
Analysis page.) General Project: This job will be visible to all SMRT
Link users. All My Projects: This job will be visible only to users who
have access to Projects that you are a member of. To restrict access
to a job, make sure to select a Project limited to the appropriate users
before starting the job.
Note: Selecting a Project also filters the Data Sets that you can use
when creating the job.
10. In the Data Sets table, select one or more sets of data to be analyzed.
– (Optional) Use the Search function to search for Data Sets. See
“Appendix B - Data search” on page 136 for details.)
– (Optional) Choose how to view the Data Set table: 1) Tree Mode - A
barcoded Data Set displays as one row. 2) Flat Mode - A barcoded
Data Set and its demultiplexed subsets display as separate rows.
– (Optional) For Data Sets that include demultiplexed subsets, you
can also select individual subsets as part of your selection. To do
so:
A) Click the Demultiplexed Subsets number link:
Page 45
B) Select one or more subsets, then click Back:
C) Click the list image to view or edit the full Data Set selection.
(The small blue number specifies how many Data Sets and/or
subsets were selected):
Note: For information on the Auto Analysis feature, see “Automated

analysis” on page 115 for details.
11. If you selected multiple Data Sets as input for the job, additional
options become available:
Page 46
– One Analysis for All Data Sets: Runs one job using all the selected
Data Sets as input, for a maximum of 30 Data Sets.
– One Analysis per Data Set - Identical Parameters: Runs one
separate job for each of the selected Data Sets, using the same
parameters, for a maximum of 10,000 Data Sets. Later in the
process, optionally click Advanced Parameters and modify
parameters.
– One Analysis per Data Set - Custom Parameters: Runs one
separate job for each of the selected Data Sets, using different
parameters for each Data Set, for a maximum of 16 Data Sets. Later
in the process, click Advanced Parameters and modify parameters.
Then click Start and Create Next. You can then specify parameters
for each of the included Data Sets.
– Note: The number of Data Sets listed is based on testing using
PacBio's suggested compute configuration, listed in SMRT Link
software installation guide (v11.0).
12. Click Next.
13. Select a secondary analysis application or data utility from the drop-
down list. (Different choices display based on your initial choice of
Analysis or Data Utility in Step 7. See“PacBio® secondary analysis
applications” on page 54 or “PacBio® data utilities” on page 90 for
details.)
– Each of the secondary analysis applications/data utilities has

required parameters that are displayed. Review the default values
shown.
Page 47
– Secondary analysis applications/data utilities also have advanced
parameters. These are set to default values, and need only be
changed when analyzing data generated in non-standard
experimental conditions.
14. (Optional) Click Import Analysis Settings and select a previously-
saved CSV file containing the desired settings (including Advanced
Parameters) for the selected application or data utility. The imported
settings are set.
The Iso-Seq application will be used as an example. This application

characterizes full-length transcript isoforms.
15. Click the Reference Set field and select a reference sequence from
the dialog. (The reference sequences available in SMRT Link and dis-
played in the dialog were imported into SMRT Analysis. See “Import-
ing sequence, reference and barcode data” on page 41 for details.)
16. (Optional) Click Advanced Parameters and specify the values of the
parameters you would like to change. Click OK when finished.
(Different applications/data utilities have different advanced parame-
ters.)
– To see information about parameters for all secondary analysis
applications and data utilities provided by PacBio, see “PacBio®
secondary analysis applications” on page 54 and “PacBio® data
utilities” on page 90.
Page 48
17. (Optional) Click Export to create a CSV file containing all the settings
you specified for the application/data utility. You can then import this
file when creating future jobs using the same application/data utility.
You can also use this exported file as a template for use with later
jobs.
18. (Optional) Click Back if you need to change any of the analysis
attributes selected in Step 7.
19. Click Start to submit the job. (If you selected multiple Data Sets as
input, click Start Multiple Jobs or Start and Create Next.)
20. Select SMRT Analysis from the Module Menu to navigate to the main
SMRT Analysis screen. There, the status of the job displays. When the
job has completed, click on its name - reports are available for the
completed job.
21. (Optional) To delete the completed job: Click Delete, then click Yes in
the confirmation dialog. The job is deleted from both the SMRT Link
interface and from the server.
Starting a job after viewing sequence data

A job can be started by first viewing information about specific sequence
data:

2. Click View > Data and select the type of Data Set to use:
SMRTbell template.
Page 49
4. In the Name column, click the name of the sequence data of
interest. Details for the selected sequence data display.
5. To start a job using this sequence data, click Analyze, then

follow the instructions starting at Step 12 of “Creating and starting a
job” on page 44.
Canceling a running job

1. On the home page, select SMRT Analysis.
2. Click the funnel in the State column header, then click Running. This
displays only currently-running jobs.
3. Select a currently-running job to cancel.
4. Click Cancel.
5. Click Yes in the confirmation dialog. The cancelled job displays as
Terminated.
Restarting a failed job

You can restart a failed job; the execution speed from the start to the
original point of failure is very fast, which can save time and computing
resources. The restarted job may run to completion, depending on the
source of failure.
Note: As the restarted job uses information from the original failed job, do
not delete the original job results.
If viewing the results page for the failed job: Click Restart.
Page 50
If not viewing the results page for the failed job:

2. Click the funnel in the State column header, then click Failed. This
displays only failed jobs.
3. Select a failed job to restart.
4. Click Restart.
Viewing job results

1. On the home page, select SMRT Analysis. You see a list of all jobs.
2. (Optional) Click the funnel in the State column header, then click
Successful. This displays only successfully-completed jobs.
3. (Optional) Use the Search function to search for specific jobs. See
4. Click the job link of interest.
5. Click Analysis Overview > Status to see job information status,
including which application/data utility was used for the job, and the
inputs used.
6. Click Analysis Overview > Thumbnails or Display All to view thumb-
nails of the reports generated for the job. Click the link under a thumb-
nail to see a larger image.
7. Depending on the application/data utility used for the job, different
job-specific reports are available.
– For mapping applications only: Click Mapping Report > Summary
Metrics to see an overall summary of the mapping data.
– For information on the reports and data files produced by analysis
applications/data utilities, see “PacBio® secondary analysis
applications” on page 54 or “PacBio® data utilities” on page 90.
8. To download data files created by SMRT Link: You can use these data
files as input for further processing, pass on to collaborators, or
upload to public genome sites. Click Data > File Downloads, then click
Page 51
the appropriate file. The file is downloaded according to your browser
settings.
9. (Optional) Specify prefixe(s) used in the names of files generated by
the job. Example: Run Name can be included in the name of every file
generated by the job. Click Edit Output File Name Prefix, check the
type(s) of information to append to the file names, then click Save.
10. To view job log details: Click Data > SMRT Link Log.
11. To visualize the secondary analysis results: See “Visualizing data
using IGV” on page 118 for details.
Copying and running an existing job

If you run very similar jobs, you can copy an existing job, rename it,
optionally modify one or more parameters, then run it.
2. (Optional) Click the funnel in the State column header, then click
Successful. This displays only successfully-completed jobs.
3. (Optional) Use the Search function to search for specific jobs. See
5. Click Copy - this creates a copy of the job, named Copy of <job
name>, using the same parameters.
6. Edit the name of the job.
7. Click Next.
8. (Optional) Edit any other parameters. See “PacBio® secondary analy-
sis applications” on page 54 or “PacBio® data utilities” on page 90 for
further details.
9. Click Start.
Exporting a job
You can export the entire contents of a job directory, including the input
sequence files, as a ZIP file. Afterwards, deleting the job saves room on
the SMRT Link server; you can also later reimport the exported job into
SMRT Link if necessary.

2. Click Export Job.
3. (Optional) Use the Search function to search for specific analyses.
See “Appendix B - Data search” on page 136 for details.
4. Select one or more jobs to export. This exports the entire contents of
the job directory.
5. Click Export Selected.
6. Select the output directory for the job data and click Export.
Importing a job
Note: You can only import a job that was created in SMRT Link, then
exported.
Page 52
2. Click Import Job.
3. Select a ZIP file containing the job to import.
4. Click Import. The job is imported and is available on the main SMRT
Analysis page.
Page 53
PacBio® secondary analysis applications
Following are the secondary analysis applications provided with SMRT
Analysis v11.0. These applications are designed to produce biologically-
meaningful results. Each application is described later in this document,
including all analysis parameters, reports and output files generated by the
application.
Note: These applications accept only HiFi reads as input.
Genome Assembly
• Generate de novo assemblies of genomes, using HiFi reads.
• See “Genome Assembly” on page 55 for details.
HiFi Mapping (was Mapping)
• Align (or map) reads to a user-provided reference sequence.
• See “HiFi Mapping” on page 58 for details.
HiFiViral SARS-CoV-2 Analysis
• Analyze multiplexed viral surveillance samples for SARS-CoV-2, using
HiFi reads.
• See “HiFiViral SARS-CoV-2 Analysis” on page 62 for details.
Iso-Seq® Analysis
• Characterize full-length transcript isoforms, using HiFi reads.
• See “Iso-Seq® Analysis” on page 67 for details.
Microbial Genome Analysis
• Note: This combines and replaces the Microbial Assembly and Base
Modification Analysis applications in the previous release.
• Generate de novo assemblies of small prokaryotic genomes between
1.9-10 Mb and companion plasmids between 2 – 220 kb, and identify
methylated bases and associated nucleotide motifs.
• Optionally include identification of 6mA and 4mC modified bases and
associated DNA sequence motifs.
• See “Microbial Genome Analysis” on page 74 for details.
Minor Variants Analysis
• Identify and phase minor single nucleotide substitution variants in
complex populations.
• See “Minor Variants Analysis” on page 80 for details.
Structural Variant Calling
• Identify structural variants (Default: ≥20 bp) in a sample or set of
samples relative to a reference.
• See “Structural Variant Calling” on page 86 for details.
Page 54
Genome Use this application to generate high quality de novo assemblies of
Assembly genomes, using HiFi reads.
• The application accepts HiFi reads (BAM format) as input. HiFi reads
are reads generated with CCS analysis whose quality value is equal to
or greater than 20.
The application includes seven main steps:
1. Convert input to a compressed database for fast retrieval.

2. Overlap reads using the Pancake tool.
3. Phase the overlapped reads using Nighthawk. Nighthawk also boosts
contiguity of the assembly by removing overlaps between reads com-
ing from different instances of a genomic repeat (such as segmental
duplications.)
4. Remove chimeras and duplicate reads which do not span repeat
regions. This improves contiguity and assembly quality.
5. Construct a string graph. Extract primary contigs and haplotigs. Haplo-
types are represented by heterozygous bubbles.
6. Polish the contigs and haplotigs using phased reads. Phasing informa-
tion is preserved. Polishing is done with Racon.
7. Identify potential haplotype duplications in the primary contig set
using the purge_dups tool, and move them to the haplotig set. This
final round of assembly processing is especially useful in high hetero-
zygosity samples.
Importing/exporting analysis settings

• Click Import Analysis Settings and select a previously-saved CSV file
containing the desired settings (including Advanced Parameters) for
the selected application. The imported application settings are set.
• Click Export to create a CSV file containing all the settings you
specified for the application. You can then import this file when
creating future analyses using the same application. You can also use
this exported file as a template for use with later analyses.
Parameters
Advanced parameters Default value Description
Genome Length 0 The approximate number of base pairs expected in the genome.
This is used only for downsampling; if the value is ≤ 0,
downsampling is disabled. Enter an integer, optionally followed
by one of the metric suffixes: k, M or G. Example: 4500k means
“4,500 kilobases” or “4,500,000”. M stands for Mega and G
stands for Giga.
Downsampled coverage 0 The input Data Set can be downsampled to a desired coverage,
provided that both the Downsampled Coverage and Genome
Length parameters are specified and > 0.
Downsampling applies to the entire assembly process,
including polishing.
This parameter selects reads randomly, using a fixed random
seed for reproducibility.
Page 55
Run polishing ON Enables or disables the polishing stage of the workflow.

Polishing can be disabled to perform fast draft assemblies.
Run phasing ON Enables or disables the phasing stage of the workflow. Phasing
can be disabled to assemble haploid genomes, or to perform
fast draft assemblies.
Filters to Add to the Data NONE A semicolon-separated (not comma-separated) list of other
Set filters to add to the Data Set.
Advanced Assembly NONE A semicolon-separated list of KEY=VALUE pairs. New line
Options characters are not accepted.
Purge duplicate contigs ON Enables or disables identification of “duplicate” alternate
from the aassembly haplotype contigs which may be assembled in the primary
contig file, and moves them to the associate contig (haplotig)
file.
Cleanup intermediate Files ON Removes intermediate files from the run directory to save
space.
Min. CCS Predicted 20 Phred-scale integer QV cutoff for filtering HiFi reads. The default
Accuracy (Phred Scale) for all applications is 20 (QV 20), or 99% predicted accuracy.
Compute Settings Select (Optional) Specify the distributed computing cluster settings
configuration, if made available by the site SMRT Link
administrator.
Reports and data files
The Genome Assembly application generates the following reports:
Polished Assembly > Summary Metrics

Displays statistics on the contigs from the de novo assembly that were
corrected by Racon.
• Contig Type: Primary or Haplotigs. Primary contigs represent

pseudohaplotype assemblies, while haplotigs represent fully phased and
assembled regions of the genome. Primary contigs are usually much longer
than haplotigs due to allowed haplotype switching.
• Polished Contigs: The number of polished contigs.
• Maximum Contig Length: The length of the longest contig.
• Mean Contig Length: The mean length of the contigs.
• Median Contig Length: The median length of the contigs.
• N50 Contig Length: 50% of the contigs are longer than this value.
• Sum of Contig Lengths: The total length of all the contigs.
• E-size (sum of squares/sum): The expected contig size for a random base in
the polished contigs. Another interpretation: The area under the Nx curve (for
x in range [0, 100]).
• Number of Circular Contigs: The number of assembled contigs that are
circular.
Polished Assembly > Polished Contigs
• Contig: The name of the individual contig.
• Length (bases): The length of the contig, in bases.
• Circular: Yes if the contig is circular, No if it isn’t.
• Percent Polished: The percent of contig bases that were polished.
Page 56
• Number of Polishing Reads: The number of reads used to perform polishing
on this contig.
Data > File Downloads
The following files are available on the analysis results page. Additional
files are available on the SMRT Link server, in the analysis output
directory.
• Analysis Log: Log information for the analysis execution.

• SMRT Link Log: Server-level analysis log information. (This file is displayed
when you choose Data > SMRT Link Log.)
• Haplotigs: The final polished haplotigs assembly, in FASTA format.
• Primary Contigs: The final polished primary contigs assembly, in FASTA
format.
Page 57
HiFi Mapping Use this application to align (or map) data to a user-provided reference
sequence. The HiFi Mapping application:
• Accepts HiFi reads (BAM format) as input. HiFi reads are reads
generated with CCS analysis whose quality value is equal to or greater
than 20.
• Maps data to a provided reference sequence, and then identifies
consensus and variants against this reference.
• Haploid variants and small indels, but not diploid variants, are called as
a result to alignment to the reference sequence.
the selected utility. The imported utility settings are set.
Reference Set (Required)
• Specify a reference sequence to align the SMRT Cells reads to and to
produce alignments.
Consolidate Mapped BAMs for IGV (Default = OFF)
• By default, SMRT Link consolidates chunked BAM files for viewing in
IGV if the combined size is not more than 10 GB. Setting this option to
ON ignores the file size cutoff and consolidates the BAM files.
• Note: This setting can double the amount of storage used by the BAM
files, which can be considerable. Make sure to have enough disk space
available. This setting may also result in longer run times.
Parameters
Minimum Mapped Length 50 The minimum required mapped read length, in base pairs.
(bp)
Bio Sample Name of NONE Populates the Bio Sample Name (Read Group SM tag) in the
Aligned Dataset aligned BAM file. If blank, uses the Bio Sample Name of the
input file. Note: Avoid using spaces in Bio Sample Names as this
may lead to third-party compatibility issues.
Minimum Gap-Compressed 70 The minimum required gap-compressed alignment identity, in
Identity (%) percent. Gap-compressed identity counts consecutive insertion
or deletion gaps as one difference.
Page 58
Advanced pbmm2 Options NONE Space-separated list of custom pbmm2 options. Not all
supported command-line options can be used, and HPC settings
cannot be modified. See SMRT® Tools reference guide v11.0
for details.
Target Regions (BED file) NONE (Optional) Specifies a BED file that defines regions for a Target
Regions report showing coverage over those regions.
See “Appendix C - BED file format for Target Regions report” on
page 138 for details.
administrator.

The HiFi Mapping application generates the following reports:
Target Regions > Target Regions

Displays the number (and percentage) of reads that hit target regions
specified by an input BED file. This is useful for targeted DNA sequencing
applications. (This report displays only if a BED file is specified when
creating the analysis.)
• Coordinates: The chromosome coordinates, as specified in the input

BED file.
• Region: The name of the region, as specified in the input BED file.
• On-Target Reads: The number (and percentage) of unique reads that
map with any overlap to the target region.
Target Regions > Target Region Coverage
• Displays the number of hits per defined region of the chromosome.
Mapping Report > Summary Metrics
Mapping is local alignment of a read or subread to a reference sequence.
• Mean Concordance (mapped): The mean concordance of subreads that

mapped to the reference sequence. Concordance for alignment is defined as
the number of matching bases over the number of alignment columns (match
columns + mismatch columns + insertion columns + deletion columns).
• Number of Alignments: The number of alignments that mapped to the
reference sequence.
• Number of CCS reads (total): The total number of CCS reads in the sequence.
• Number of CCS reads (mapped): The number of CCS reads that mapped to
the reference sequence.
• Number of CCS reads (unmapped): The number of CCS reads not mapped to
• Percentage of CCS reads (mapped): The percentage of CCS reads that
mapped to the reference sequence.
• Percentage of CCS reads (unmapped): The percentage of CCS reads not
• Number of CCS Bases (mapped): The number of CCS bases that mapped to
Page 59
• CCS Read Length Mean (mapped): The mean read length of CCS reads that
mapped to the reference sequence, starting from the first mapped base of the
first mapped CCS read, and ending at the last mapped base of the last
mapped CCS read.
• CCS Read N50 (mapped): The read length at which 50% of the mapped bases
are in CCS reads longer than, or equal to, this value.
• CCS Read Length 95% (mapped): The 95th percentile of read length of CCS
reads that mapped to the reference sequence.
• CCS Read Length Max (mapped): The maximum length of CCS reads that
Mapping Report > CCS Mapping Statistics Summary
Displays mapping statistics per movie.
• Sample: The sample name for which the following metrics apply.
• Movie: The movie name for which the following metrics apply.
• Number of CCS Reads (mapped): The number of CCS reads that mapped to
the reference sequence. This includes adapters.
mapped CCS read.
• CCS Read Length N50 (mapped): The read length at which 50% of the
mapped bases are in CCS reads longer than, or equal to, this value.
Mapping Report > Mapped CCS Read Length
• Histogram distribution of the number of mapped CCS reads by read
length.
Mapping Report > Mapped CCS Reads Concordance
• Histogram distribution of the number of CCS reads by the percent
concordance with the reference sequence. Concordance for CCS
reads is defined as the number of matching bases over the number of
alignment columns (match columns + mismatch columns + insertion
columns + deletion columns).
Mapping Report > Mapped Concordance vs Alignment Length
• Maps the percent concordance with the reference sequence against
the alignment length, in base pairs.
Coverage > Summary Metrics
• Mean Coverage: The mean depth of coverage across the reference sequence.
• Missing Bases: The percentage of the reference sequence without coverage.
Coverage > Coverage Across Reference
• Maps coverage across the reference.
Page 60
Coverage > Depth of Coverage
• Maps the reference regions against the percent coverage.
Coverage > Coverage vs. [GC] Content
• Maps (as a percentage, over a 100 bp window) the number of Gs and
Cs present across the coverage. The number of genomic windows
with the corresponding % of Gs and Cs is displayed on top. Used to
check that no coverage is lost over extremely biased base
compositions.
directory.

• Mapped Reads: All input reads that were mapped to the reference by the
application.
• Coverage Summary: Coverage summary for regions (bins) spanning the
reference sequence.
• Mapped BAM: The BAM file of subread alignments to the draft contigs used
for polishing.
• Mapped BAM Index: The BAI index file for the corresponding Mapped BAM
file.
Data > IGV Visualization Files
The following files are used for visualization using IGV; see “Visualizing
data using IGV” on page 118 for details.
for polishing.
file.
Page 61
HiFiViral Use this application to analyze multiplexed samples sequenced with the
SARS-CoV-2 HiFiViral SARS-CoV-2 kit. For each sample, this analysis provides:
Analysis
• Consensus sequence (FASTA).
• Variant calls (VCF).
• HiFi reads aligned to the reference (BAM).
• Plot of HiFi read coverage depth across the SARS-CoV-2 genome.
Across all samples, this analysis provides:
• Job summary table including passing sample count at 90 and 95%

genome coverage.
• Sample summary table including, for each sample: Count of variable
sites, genome coverage, read coverage, and probability of multiple
strains, and other metrics.
• Plate QC graphical summary of performance across samples in assay
plate layout.
• Plot of HiFi read depth of coverage for all samples.
Notes:
are reads generated with CCS analysis that have a quality value equal
to or greater than Phred-scaled Q20.
• This application is for SARS-CoV-2 analysis only and is not
recommended for other viral studies. The Wuhan reference genome is
provided by default to run the application, but advanced users may
specify other reference genomes. We have not tested the application
with reference genomes other than the Wuhan reference genome.
• The application is intended to identify variable sites and call a single
consensus sequence per sample. The output consensus sequence is
produced based on the dominant variant observed. Minor variant
information that passes through a default threshold may be encoded
in the raw VCF, but does not get propagated into the consensus
sequence FASTA.
• The HiFiViral SARS-CoV-2 Analysis application can be run using the
Auto Analysis feature available in Run Design. This feature allows
users to complete all necessary analysis steps immediately after
sequencing without manual intervention. The Auto Analysis workflow
includes CCS, Demultiplex Barcodes, and HiFiViral SARS-CoV-2
Analysis.
Auto Analysis in Run Design
Users may set the analysis to begin automatically after sequencing
completes using Auto Analysis in Run Design. See “HiFiViral SARS-CoV-2:
Creating Auto Analysis in Run Design” on page 116 for details.
Page 62
HiFiViral SARS-CoV-2 application workflow
1. Process the reads using the mimux tool to trim the probe arm
sequences.
2. Align the reads to the reference genome using pbmm2.
3. Call and filter variants using bcftools, generating the raw variant calls
in VCF file format. Filtering in this step removes low-quality calls (less
than Q20), and normalizes indels.
4. Filter low-frequency variants using vcfcons and generate a consensus
sequence by injecting variants into the reference genome. At each
position, a variant is called only if both the base coverage exceeds the
minimum base coverage threshold (Default = 4) and the fraction of
reads that support this variant is above the minimum variant frequency
threshold (Default = 0.5). See here for details.
Preparing input data for the HiFiViral SARS-CoV-2 Analysis application

1. Run the Demultiplex Barcodes data utility, where the inputs are HiFi
reads, and the primers are multiplexed barcode primers. (If HiFi reads
have not been generated on the instrument, run CCS analysis first. See
“Circular Consensus Sequencing (CCS)” on page 104 for details.)
– The proper barcode sequences are provided by default:
Barcoded M13 Primer Plate.
– For the Same Barcodes on Both Ends of Sequence parameter,
specify No; the barcode pairs are asymmetric.
– Provide the correctly-formatted barcode pair-to-Bio Sample CSV file
for the Assign Bio Sample Names to Barcodes option. (For details,
see “Assign Bio Sample Names to Barcodes (Required)” on page
93.)
Running the HiFiViral SARS-CoV-2 Analysis application
1. After running the Demultiplex Barcode data utility, create a new
job using SMRT Analysis > Create New Job.
2. Name the job.
3. Select all the demultiplex samples contained in the Data Set and
choose Analysis of Multiple Data Sets > One Analysis for All Data
Sets. Click Next.
4. Select HiFiViral SARS-CoV-2 Analysis from the Analysis Application
list.
5. SARS-CoV-2 Genome NC_045512.2 (the Wuhan reference genome) is
automatically loaded; advanced users may select a different reference
if desired.
6. To generate the optional Plate QC graphical summary, click Advanced
Parameters and load a CSV file using the provided template (assay-
PlateQC_template_4by96.csv) as a guide.
7. Click OK, then Start.

Page 63
Reference Genome (Required)
• Specify the full viral genome against which to align the reads and call
variants. (The default is the Wuhan Reference genome.)
Parameters
Plate QC CSV NONE (Optional) Specify a CSV file to generate the Plate QC report,
which displays analysis results for each sample in the assay
plate. The CSV file must contain barcode (asymmetric pairs),
Bio Sample Name, assay plate IDs (can include 1-4 plates with
unique names; avoid special characters), and assay plate well
IDS in the format A01, A02,…H12. (To create a new file, click
Download Template, edit, and then save the CSV file.) The plate
and well information corresponds to the location of samples
during the SARS-CoV-2 enrichment assay.
Probes FASTA NONE Specify probe sequences in FASTA format if using probes other
than the standard probes shipped in the HiFiViral SARS-CoV-2
Kit.
Minimum Base Coverage 4 Specify the minimum read depth at each position to report
either a variant or a reference base. Positions with less than this
specified coverage will have an N base output in the consensus
sequence FASTA file. Increasing the minimum base coverage
may result in more Ns and loss of variant detection. We do not
recommend making this value lower than the default threshold
of 4, as it may increase the number of false positive variants
called.
Minimum Variant 0.5 Specify that only variants whose frequency is greater than this
Frequency value are reported. This frequency is determined based on the
read depth (DP) and allele read count (AD) information in the
VCF output file. We recommend using the default value to
properly call the dominant alternative variant while also filtering
out potential artifacts.
Advanced Processing NONE Additional options to pass to the mimux preprocessing tool for
Options trimming and filtering reads by probe sequences. Options
should be entered in space-separated format. See the HiFiViral
SARS-CoV-2 Analysis section of SMRT Tools reference guide
(v11.0) for details.
Minimum Barcode Score 80 A barcode score measures the alignment between a barcode
attached to a read and an ideal barcode sequence, and is an
indicator of how well the chosen barcode pair matches. It
ranges between 0 (no match) and 100 (a perfect match). This
parameter specifies that reads with barcode scores below this
minimum value are not included in analysis.
administrator.

The HiFiViral SARS-CoV-2 Analysis application generates the following
reports:
Page 64
Summary Report > Summary Metrics
• Samples: The count of all input samples, whether or not they passed analysis.
• Samples with Genome Coverage > 90%: The number of samples where at
least 90% of bases have at least four mapped reads overlapping their
position.
• Samples with Genome Coverage > 95%: The number of samples where at
least 95% of bases have at least four mapped reads overlapping their
position.
• Samples Failing Workflow: The number of samples for which the analysis
was unable to generate a per-sample report due to an absence of usable data.
Summary Report > Sample Summary
• Bio Sample Name: The name of the biological sample associated with the
variants. (Note: Any spaces in the name are substituted by new line
characters for consistency with output file names.)
• Substitutions: The count of all called substitutions in the consensus
sequence for the sample.
• Insertions: The count of all called insertions in the consensus sequence for
the sample.
• Deletions: The count of all called deletions in the consensus sequence for the
sample.
• Reads: The total number of HiFi reads for the sample.
• Read Coverage: The mean number of mapped reads overlapping with each
position in the reference genome.
• On-Target Rate: The mapping yield of reads; the number of unique mapped
reads divided by the total number of reads.
• Multiple Strains (Probability): Samples are flagged as having multiple strains
if the probability is at least 0.95. Samples may contain multiple strains due to
sample contamination or presence of multiple strains in the RNA extract. To
classify a sample as multi-strain, we tolerate error by using the binomial
cumulative distribution function (with a fixed probability of 0.2). This feature
is supported for samples with Ct < 26 with minor frequencies > 20%. Samples
must have > 70% genome coverage to be called Multiple Strains.
• Ns: The number of bases in the consensus sequence that are Ns.
• Genome Coverage: The percentage of bases with at least four mapped reads
overlapping their position by default. See the Advanced Parameters dialog to
adjust minimum base coverage.
Summary Report > Genome Coverage
• Coverage plot showing the per-sample mean read coverage within a
window of 100 bp. The shaded region displays the 25th to 75th
percentile in the range of coverage across all samples, and the darker
solid line displays the median coverage across all samples.
Summary Report > Plate QC
Plot showing analysis results for each plate cell used. This plot is
generated only if the user supplies a Plate QC CSV file mapping Bio
Sample Names to Well IDs in Advanced Parameters.
• Blue wells represent samples with at least 95% coverage.

• Green wells represent samples with at least 90% coverage.
• Yellow wells represent samples that passed the workflow but had
genome coverage worse than 90%.
• Red wells represent samples that failed the workflow.
Page 65
• White wells do not include a sample.
directory.

• All Samples, HiFi Reads FASTQ: HiFi reads in FASTQ format for all samples.
• All Samples, Consensus Sequence FASTA: The full consensus genomic
sequences; bases for which no consensus could be called are represented by
Ns. See the Advanced Parameters dialog to adjust the minimum base
coverage for outputting Ns.
• All Samples, Genome Coverage Plots: Plots for individual samples showing
coverage depth across the genome.
• All Samples, Variant Call VCF: VCF file containing the final variant calls per
sample.
• All Samples, HiFi Reads Mapped BAM: BAM file for each sample containing
the HiFi reads aligned to the reference genome.
• All Samples, Consensus Sequence Aligned BAM: BAM file for each sample of
consensus sequence aligned to the reference genome. The consensus
sequence is split into fragments where there are Ns and each fragment is
mapped.
• All Samples, Raw Variant Calls VCF: VCF file containing the intermediate
variant calls per patient sample.
• Sample Summary Table CSV: CSV version of the data shown in the Sample
Summary table.
• All Samples, Probe Counts TSV: Tab-delimited text file containing per-
sample, per-probe counts. This file can be used to identify samples that are
poorly sequenced or probes with high or low coverages.
• Sample Inputs CSV: CSV version of the Plate QC CSV, if supplied in the
Advanced Parameters dialog.
Page 66
Iso-Seq® The Iso-Seq application enables analysis and functional characterization
Analysis of full-length transcript isoforms for sequencing data generated on PacBio
instruments.
are reads generated with CCS analysis that have a quality value equal
to or greater than Q20.
Notes on Multiplexed Data
There are two ways in which an Iso-Seq library can be multiplexed:
1. Barcoded adapter Iso-Seq libraries

• If using the SMRTbell Barcoded Adapter with the Iso-Seq Express
protocol on or after April 21, 2022, demultiplex the Data Set prior to
running the Iso-Seq application.
• To analyze the samples in a single Iso-Seq run, select all the
demultiplexed Data Sets to combine and begin the Iso-Seq analysis.
• If following the standard Iso-Seq Express protocol, select Iso-Seq
cDNA Primers as the Primer Set.
2. Barcoded cDNA primer Iso-Seq libraries

• If following multiplexing guidelines using the Iso-Seq Express protocol
on or prior to April 21, 2022 and you ordered synthesized oligos listed
in the Appendix 3 - Recommended barcoded NEBNext single cell
cDNA PCR primer and Iso-Seq Express cDNA PCR primer sequences
section of the document Procedure & checklist - Preparing Iso-Seq®
libraries using SMRTbell prep kit 3.0, demultiplex your Data Set using
the Iso-Seq application. In other words, do not run the Demultiplexing
Barcodes utility first.
• See the Primer Set Selection column below for the correct choice of
primer sequences.
Demultiplexed before
Multiplexed method Primer set selection
Iso-Seq?
Not multiplexed NO Iso-Seq cDNA Primers

Barcoded adapters YES Iso-Seq cDNA Primers
Barcoded cDNA primer NO Iso-Seq 12 Barcoded cDNA Primers
Or
Custom cDNA Primers
The application includes three main steps:
1. Classify: Identify and remove primers (which may be cDNA primers or

barcoded cDNA primers). Identify full-length reads based on the asym-
metry of 5’ and 3’ primers. Trim off polyA tails and remove artifactual
concatemers.
2. Cluster (Optional): Perform de novo clustering and consensus calling.
Output full-length consensus isoforms that are further separated into
high-quality (HQ) and low-quality (LQ) based on estimated accuracies.
Page 67
3. Collapse (Optional): When a reference genome is selected, map HQ
isoforms to the genome, then collapse redundant isoforms into unique
isoforms.
To obtain full-length non-concatemer (FLNC) reads and not complete the

Cluster step: Ensure that the Run Clustering option is set to OFF.
Iso-Seq determines two FLNC reads to be the same isoform, and will place
them in the same cluster, if the two reads:
• Differ less than 100 bp on the 5’ end.

• Differ less than 30 bp on the 3’ end.
• Have no internal gaps that exceed 10 bp.
Iso-Seq will only output clusters that have at least two FLNC reads.

Primer Set (Required)
• Specify a primer sequence file in FASTA format to identify cDNA
primers for removal. The primer sequence includes the 5’ and 3’ cDNA
primers and (if applicable) barcodes.
• Primer IDs must be specified using the suffix _5p to indicate 5’ cDNA
primers and the suffix _3p to indicate 3’ cDNA primers. The 3’ cDNA
primer should not include the Ts and is written in reverse complement
(see examples below).
• Each primer sequence must be unique.
Example 1: The Iso-Seq cDNA Primer primer set, included with the SMRT
Link installation.
Users following the standard Iso-Seq Express protocol without

multiplexing, or running a Data Set that has already been demultiplexed
(either using Run Design or the SMRT Analysis application) should use this
default option.
>IsoSeq_5p
GCAATGAAGTCGCAGGGTTGGG
>IsoSeq_3p
GTACTCTGCGTTGATACCACTGCTT
Example 2: The Iso-Seq 12 Barcoded cDNA Primers set, included with the
SMRT Link installation.
Page 68
Users using barcoded cDNA primers listed in the Appendix 3 -
Recommended barcoded NEBNext single cell cDNA PCR primer and Iso-
Seq Express cDNA PCR primer sequences section of the document
Procedure & checklist - Preparing Iso-Seq® libraries using SMRTbell
prep kit 3.0, should select this option.
>bc1001_5p
CACATATCAGAGTGCGGCAATGAAGTCGCAGGGTTGGGG
>bc1002_5p
ACACACAGACTGTGAGGCAATGAAGTCGCAGGGTTGGGG
…
(There are a total of 24 sequence records, representing 12 pairs of F/R

barcoded cDNA primers.)
Example 3: An example of a custom cDNA primer set. 4 tissues were

multiplexed using barcodes on the 3’ end only.
>IsoSeq_5p
GCAATGAAGTCGCAGGGTTGGG
>dT_BC1001_3p
AAGCAGTGGTATCAACGCAGAGTACCACATATCAGAGTGCG
>dT_BC1002_3p
AAGCAGTGGTATCAACGCAGAGTACACACACAGACTGTGAG
>dT_BC1003_3p
AAGCAGTGGTATCAACGCAGAGTACACACATCTCGTGAGAG
>dT_BC1004_3p
AAGCAGTGGTATCAACGCAGAGTACCACGCACACACGCGCG
Example 4: Special Handling for the TeloPrime cDNA Kit
The Lexogen TeloPrime cDNA kit contains As in the 3’ primer that cannot
be differentiated from the polyA tail. For best results, remove the As from
the 3’ end as shown below:
>TeloPrimeModified_5p
TGGATTGATATGTAATACGACTCACTATAG
>TeloPrimeModified_3p
CGCCTGAGA
Reference Set (Optional)
• Optionally specify a reference genome to align High Quality isoforms
to, and to collapse isoforms mapped to the same genomic loci.
Run Clustering (Default = ON)
• Specify ON to generate consensus isoforms.
• Specify OFF to classify reads only and not generate consensus
isoforms. The Reference Set will also be ignored.
Page 69
Cluster Barcoded Samples Separately (Default = OFF)
• Specify OFF if barcoded samples are from the same species, but
different tissues, or samples of the same genes but different
individuals. The samples are clustered with all barcodes pooled.
• Specify ON if barcoded samples are from different species. The
samples are clustered separately by barcode.
• In either case, the samples on the results page are automatically
named BioSample_1 through BioSample_N.
Parameters
Require and trim Poly(A) ON ON means that polyA tails are required for a sequence to be
Tail considered full length. OFF means sequences do not need polyA
tails to be considered full length.
Minimum Mapped Length 50 The minimum required mapped HQ isoform sequence length (in
(bp) base pairs) for the Iso-Seq mapping-collapse step.
Note: This is applicable only if a reference genome is provided.
Minimum Mapped 99 The minimum required HQ transcript isoform sequence
Coverage (%) alignment coverage (in percent) for the Iso-Seq mapping-
collapse step.
Maximum Fuzzy Junction 5 The maximum junction difference between two mapped
Difference (bp) isoforms to be collapsed into a single isoform. If the junction
differences are all less than the provided value, they will all be
collapsed. Setting to 0 requires all junctions to be exact to be
collapsed into a single isoform. Applicable only if a reference
genome is provided.
Accuracy (Phred Scale) for Iso-Seq Analysis is 20 (QV 20), or 99% predicted accuracy.
Advanced pbmm2 Options NONE Space-separated list of custom pbmm2 options. (pbmm2 is
already running with --preset ISOSEQ.) Not all supported
command-line options can be used, and HPC settings cannot be
modified. See SMRT® Tools reference guide v11.0 for details.
administrator.

The Iso-Seq application generates the following reports:
CCS Analysis Read Classification > Summary Metrics

• Reads: The total number of CCS reads.
• Reads with 5’ and 3’ Primers: The number of CCS reads with 5’ and 3’ cDNA
primers detected.
• Non-Concatemer Reads with 5’ and 3’ Primers: The number of non-
concatemer CCS reads with 5’ and 3’ primers detected.
Page 70
• Non-Concatemer Reads with 5’ and 3’ Primers and Poly-A Tail: The number
of non-concatemer CCS reads with 5’ and 3’ primers and polyA tails detected.
This is usually the number for full-length, non-concatemer (FLNC) reads,
unless polyA tails are not present in the sample.
• Mean Length of Full-Length Non-Concatemer Reads: The mean length of the
non-concatemer CCS reads with 5' and 3' primers and polyA tails detected.
• Unique Primers: The number of unique primers in the sequence.
• Mean Reads per Primer: The mean number of CCS reads per primer.
• Max. Reads per Primer: The maximum number of CCS reads per primer.
• Min. Reads per Primer: The minimum number of CCS reads per primer.
• Reads without Primers: The number of CCS reads without a primer.
• Percent Bases in Reads with Primers: The percentage of bases in CCS reads
in the sequence data that contain primers.
• Percent Reads with Primers: The percentage of CCS reads in the sequence
data that contain primers.
CCS Analysis Read Classification > Primer Data
primer.
• Primer Name: A string containing the pair of primer indices associated with
this biological sample.
• CCS Reads: The number of CCS reads associated with the primer.
• Mean Primer Quality: The mean primer quality associated with the primer.
• Reads with 5’ and 3’ Primers: The number of CCS reads with 5’ and 3’ cDNA
primers detected.
• Non-Concatemer Reads with 5’ and 3’ Primers: The number of non-
concatemer CCS reads with 5’ and 3’ primers detected.
• Non-Concatemer Reads with 5’ and 3’ Primers and Poly-A Tail: The number
of non-concatemer CCS reads with 5’ and 3’ primers and polyA tails detected.
This is usually the number for full-length, non-concatemer (FLNC) reads,
unless polyA tails are not present in the sample.
CCS Analysis Read Classification > Primer Read Statistics
• Number Of Reads Per Primer: Maps the number of reads per primer, sorted
by primer ranking.
• Primer Frequency Distribution: Maps the number of samples with primers by
the number of reads with primers.
• Mean Read Length Distribution: Maps the read mean length against the
number of samples with primers.
CCS Analysis Read Classification > Primer Quality Scores
• Histogram of primer scores.
CCS Analysis Read Classification > Length of Full-Length Non-
Concatemer Reads
• Histogram of the read length distribution of non-concatemer CCS
reads with 5' and 3' primers and polyA tails detected.
Transcript Clustering > Summary Metrics
• Sample Name: The sample name for which the following metrics apply.
• Number of High-Quality Isoforms: The number of consensus isoforms that
have an estimated accuracy above the specified threshold.
• Number of Low-Quality Isoforms: The number of consensus isoforms that
have an estimated accuracy below the specified threshold.
Page 71
Transcript Clustering > Length of Consensus Isoforms
• Histogram of the consensus isoform lengths and the distribution of
isoforms exceeding a read length cutoff.
Transcript Mapping > Summary Metrics
• Sample Name: Sample name for which the following metrics apply.
• Number of mapped unique isoforms: The number of unique isoforms, where
each unique isoform is generated by collapsing redundant HQ isoforms (such
as those have very minor differences from one to one another) to one
isoform. Each unique isoform may be generated from one or multiple HQ
isoforms.
• Number of mapped unique loci: The number of unique mapped genomic loci
among all unique isoforms. Multiple unique isoforms may map to the same
genomic location, indicating these unique isoforms are transcribed from the
same gene family, but spliced differently.
Transcript Mapping > Length of Mapped Isoforms
• Histogram of mapped isoforms binned by read length and the
distribution of mapped isoforms exceeding a read length cutoff.
directory.

• Primers Summary: Text file listing how many ZMWs were filtered, how many
ZMWs are the same or different, and how many reads were filtered.
• Inferred Primers: Inferred primers used in the analysis. The algorithm looks at
the first 35,000 ZMWs, then selects primers with ≥10 counts and mean scores
≥45.
• Full-Length Non-Concatemer Read Assignments: Full-length reads that have
primers and polyA tails removed, in BAM format.
• Full-Length Non-Concatemer Report: Includes strand, 5’ primer length, 3’
primer length, polyA tail length, insertion length, and primer IDs for each full-
length read that has primers and polyA tail, in CSV format.
• Low-Quality Isoforms: Isoforms with low consensus accuracy, in FASTQ and
FASTA format. We recommend that you work only with High-Quality isoforms,
unless there are specific reasons to analyze Low-Quality isoforms. When the
input Data Set is a ConsensusReadSet, a FASTA file only is generated.
• High-Quality Isoforms: Isoforms with high consensus accuracy, in FASTQ
and FASTA format. This is the recommended output file to work with. When
the input Data Set is a ConsensusReadSet, a FASTA file only is generated.
• Cluster Report: Report of each full-length read into isoform clusters.
• Isoform Counts by Barcode: For each isoform, report supportive FLNC reads
for each barcode.
• Mapped High Quality Isoforms: Alignments mapping isoforms to the
reference genome, in BAM and BAI (index) formats.
• Collapsed Filtered Isoforms GFF: Mapped, unique isoforms, in GFF format.
This is the Mapping step output that is the recommended output file to work
with.
Page 72
• Collapsed Filtered Isoforms: Mapped, unique isoforms, in FASTQ format.
This is the Mapping step output that is recommended output file to work with.
When the input Data Set is a ConsensusReadSet, only a FASTA file is
generated.
• Collapsed Filtered Isoforms Groups: Report of isoforms mapped into
collapsed filtered isoforms.
• Full-length Non-Concatemer Read Assignments: Report of full-length read
association with collapsed filtered isoforms, in text format.
• Collapsed Filtered Isoform Counts: Report of read count information for each
collapsed filtered isoform.
• Mapped High Quality Isoforms: Alignments mapping isoforms to the

reference genome, in BAM and BAI (index) formats.
Note: For details on custom PacBio tags added to output BAM files by the
Iso-Seq Application, see page 54 of SMRT Tools reference guide (v11.0),
or see here for details.
Page 73
Microbial Use this application to generate de novo assemblies of small prokaryotic
Genome genomes between 1.9-10 Mb and companion plasmids between 2 – 220
Analysis kb. This application can optionally include analysis of 6mA and 4mC
modified bases and associated DNA sequence motifs. (This requires
kinetic information.)
Note: This combines and replaces the Microbial Assembly and Base
Modification Analysis applications in the previous release.
The Microbial Genome Analysis application:
than 20.
• Includes chromosomal- and plasmid-level de novo genome assembly,
circularization, polishing, and rotation of the origin of replication for
each circular contig.
• Performs base modification detection to identify 4mCm and 6mA and
associated DNA sequence motifs. (This requires kinetic information.)
• Facilitates assembly of larger genomes (yeast) as well.
Run Base Modification Analysis (Default = ON)
• Run Base Modification analysis on the final assembly. This only
applies if the assembly is not empty, and the input data contains the
correct kinetic tags.
Find Modified Base Motifs (Default = ON)
• Perform motif detection on the results of base modification analysis.
Parameters

Options for chromosomal characters are not accepted. See Appendix C in SMRT Tools
stage reference guide (v11.0) for details.
Options for plasmid stage characters are not accepted. See Appendix C in SMRT Tools
reference guide (v11.0) for details.
Maximum plasmid length, 300,000 Value that should be set higher than the maximum size of a
bp plasmid in the input sample. The default value should work well
in most cases.
Page 74
Run secondary polish ON Specify that an additional polishing stage be run at the end of
the workflow.
Base modifications to m4C,m6A Specify the base modifications to identify, in a comma-
identify separated list.
Cleanup intermediate files ON Removes intermediate files from the run directory to save
space.
Minimum Qmod Score 35 Specify the minimum Qmod score to use in motif-finding.
administrator.
The Microbial Genome Analysis application generates the following

reports:
Mapping Report > Summary Metrics

Mapping is local alignment of a read or subread to a reference sequence.

• Number of Alignments: The number of alignments that mapped to the
reference sequence.
• Number of CCS reads (total): The total number of CCS reads in the sequence.
• Number of CCS reads (mapped): The number of CCS reads that mapped to
• Number of CCS reads (unmapped): The number of CCS reads not mapped to
• Percentage of CCS reads (mapped): The percentage of CCS reads that
• Percentage of CCS reads (unmapped): The percentage of CCS reads not
mapped CCS read.
• CCS Read N50 (mapped): The read length at which 50% of the mapped bases
are in CCS reads longer than, or equal to, this value.
• CCS Read Length 95% (mapped): The 95th percentile of read length of CCS
reads that mapped to the reference sequence.
• CCS Read Length Max (mapped): The maximum length of CCS reads that
Page 75
Mapping Report > CCS Mapping Statistics Summary
Displays mapping statistics per movie.
• Sample: The sample name for which the following metrics apply.
• Movie: The movie name for which the following metrics apply.
• Number of CCS Reads (mapped): The number of CCS reads that mapped to
the reference sequence. This includes adapters.
mapped CCS read.
• CCS Read Length N50 (mapped): The read length at which 50% of the
mapped bases are in CCS reads longer than, or equal to, this value.
the number of matching bases over the number of alignment columns (
match columns + mismatch columns + insertion columns + deletion
columns).
Mapping Report > Mapped CCS Read Length
• Histogram distribution of the number of mapped CCS reads by read
length.
Mapping Report > Mapped CCS Reads Concordance
• Histogram distribution of the number of CCS reads by the percent
concordance with the reference sequence. Concordance for CCS
reads is defined as the number of matching bases over the number of
alignment columns (match columns + mismatch columns + insertion
columns + deletion columns).
Mapping Report > Mapped Concordance vs Read Length
• Maps the percent concordance with the reference sequence against
the CCS read length, in base pairs.
Polished Assembly > Summary Metrics
Displays statistics on the contigs from the de novo assembly that were
corrected by Arrow.
• Polished Contigs: The number of polished contigs.

• Maximum Contig Length: The length of the longest contig.
• N50 Contig Length: 50% of the contigs are longer than this value.
• Sum of Contig Lengths: Total length of all the contigs.
• E-size (sum of squares/sum): The expected contig size for a random base in
the polished contigs.
Polished Assembly > Polished Contigs from Microbial Assembly HiFi
Displays a table of details about all assembled contigs.
• Contig: The contig name.

• Length: The length of the contig, in base pairs, after polishing.
Page 76
• Circular: Marks whether circularity of the contig was detected. Output values
are yes and no.
• Coverage: The average coverage across the contig, calculated by the sum of
coverage of all bases in the contig divided by the number of bases.
Coverage > Summary Metrics
Displays depth of coverage across the de novo-assembled genome, as
well as depth of coverage distribution.
• Mean Coverage: The mean depth of coverage across the assembled genome
sequence.
• Missing Bases: The percentage of the genome’s sequence that have zero
depth of coverage.
Coverage > Coverage across Reference
• Displays coverage at each position of the draft genome assembly.
Coverage > Depth of Coverage
• Histogram distribution of the draft assembly regions by the coverage.
Coverage > Coverage vs. [GC] Content
• Maps (as a percentage, over a 100 bp window) the number of Gs and
Cs present across the coverage. The number of genomic windows
with the corresponding % of Gs and Cs is displayed on top. Used to
check that no coverage is lost over extremely biased base
compositions.
Base Modifications > Kinetic Detections
• Per-Base Kinetic Detections: Maps the modification QV against per-
strand coverage.
• Kinetic Detections Histogram: Histogram distribution of the number of
bases by modification QV.
Modified Base Motifs > Modified Base Motifs
Displays statistics for the methyltransferase recognition motifs detected.
• Motif: The nucleotide sequence of the methyltransferase recognition motif,

using the standard IUPAC nucleotide alphabet.
• Modified Position: The position within the motif that is modified. The first
base is 0. Example: The modified adenine in GATC is at position 2.
• Modification Type: The type of chemical modification most commonly
identified at that motif. These are: 6mA, 4mC, or modified_base
(modification not recognized by the software.)
• % of Motifs Detected: The percentage of times that this motif was detected
as modified across the entire genome.
• # of Motifs Detected: The number of times that this motif was detected as
modified across the entire genome.
• # of Motifs In Genome: The number of times this motif occurs in the genome.
• Mean QV: The mean modification QV for all instances where this motif was
detected as modified.
• Mean Coverage: The mean coverage for all instances where this motif was
detected as modified.
Page 77
• Partner Motif: For motifs that are not self-palindromic, this is the
complementary sequence.
• Mean IPD Ratio: The mean inter-pulse duration. An IPD ratio greater than 1
means that the sequencing polymerase slowed down at this base position,
relative to the control. An IPD ratio less than 1 indicates speeding up.
• Group Tag: The motif group of which the motif is a member. Motifs are
grouped if they are mutually or self reverse-complementary. If the motif isn’t
complementary to itself or another motif, the motif is given its own group.
• Objective Score: For a given motif, the objective score is defined as
(fraction methylated)*(sum of log-p values of matches).
Modified Base Motifs > Modification QVs

• Maps motif sites against Modification QV for all genomic occurrences
of a motif, for each reported motif, including “No Motif”.
Modified Base Motifs > ModQV Versus Coverage by Motif
• Maps coverage against Modification QV for all genomic occurrences
of a motif, for each reported motif.
directory.

• Per-Base Kinetics: CSV file containing per-base information.
• Per-Base IPDs for IGV: BigWig file containing encoded per-base IPD ratios.
• Motif Annotations: GFF file listing every modified nucleotide sequence motif
in the genome.
• Modified Base Motifs: CSV file containing statistics for the methyltransferase
recognition motifs detected.
for polishing.
file.
• Modified Bases: GFF file listing every detected modified base in the genome.
• Final Polished Assembly: The polished assembly before oriC rotation is
applied, in FASTA format.
• Final Polished Assembly Index: The BAI index file for the polished assembly
before oriC rotation is applied.
• Final Polished Assembly for NCBI: The final polished assembly with applied
oriC rotation and header adjustment for NCBI submission, in FASTA format.
• Coverage Summary: Coverage summary for regions (bins) spanning the
reference sequence.
for polishing.
Page 78
file.
• Final Polished Assembly: The polished assembly before oriC rotation is
applied, in FASTA format.
• Final Polished Assembly Index: The BAI index file for the polished assembly
before oriC rotation is applied.
• Per-Base IPDs for IGV: BigWig file containing encoded per-base IPD ratios.
Page 79
Minor Variants Use this application to identify and phase minor single nucleotide
Analysis substitution variants in complex populations. This application is powered
by the juliet algorithm:
than 20.
• Includes reference-based codon amino acid-calling (indel variants not
called) in amplicons ≤4kb, fully spanned by long reads.
• Includes extensive application reports for the HIV pol coding region,
including drug resistance annotation from publicly-available
databases.
• Includes reliable 1% minor variant detection with 6000 high-quality
CCS reads with predicted accuracy of ≥0.99 per sample.
• The current version of this application provides additional reports for
the HIV pol coding region, but it can be configured for any target
organism or gene.
• Specify a reference sequence to align the SMRT Cells reads to and to
produce alignments.
Target Config (Required)
• Defines genes of interest within the reference and, optionally, drug
resistance mutations for specific variants. Minor Variants Analysis
contains one predefined target configuration for HIV HXB2. To specify
this target configuration, enter HIV_HXB2 into the Target Config field.
To specify a custom target configuration for any organism or gene
other than HIV HXB2: Enter either the path to the target configuration
JSON file on the SMRT Link server, or the entire content of the JSON
file.
Parameters
Maximum Variant 100 Specify that only variants whose percentage of the population is
Frequency to Report (%) less than this value be reported. Lowering this value helps to
(Required) phase low-frequency variants when the highest frequency
variant is different from the reference.
Minimum Variant 0.1 Specify that only variants whose percentage of the population is
Frequency to Report (%) greater than this value be reported. Increasing this value helps
(Required) to reduce PCR noise.
Page 80
Phase Variants ON Specify whether to phase variants and cluster haplotypes.
Only Report Variants in OFF Specify whether to only report variants that confer drug
Target Config resistance, as listed in the target configuration file.
Region of Interest NONE Specify genomic regions of interest; reads will be clipped to that
region. If not specified, specifies all reads.
Target Config Override NONE If defined (and the main Target Config option is set to NONE),
this string is interpreted as either a file system path to a JSON
file, or the actual JSON content.
administrator.

The Minor Variants Analysis application generates the following reports:
Minor Variants > Summary

• Barcode Name: The pair of barcode indices for which the following metrics
apply. If this was a single-sample analysis, this section of the report displays
NA.
• Median Coverage: The median read coverage across all observed variant
positions.
• Number of Variants: The number of variants found in the sample.
• Number of Genes: The number of genes observed in the sample.
• Number of Affected Drugs: The number of drugs to which resistance is
conferred by variants in the sample.
• Number of Haplotypes: The number of haplotypes with different co-occurring
variants found in the sample.
• Maximum Frequency Haplotypes (%): The maximum haplotype frequency
reconstructed from the sample.
Minor Variants > Details
• Barcode Name: The pair of barcode indices for which the following metrics
apply. If this was a single-sample analysis, this section of the report displays
NA.
• Position: The amino acid position of the minor variant, with respect to the
current gene.
• Reference Codon: The reference codon of the minor variant.
• Variant Codon: The mutated codon for the minor variant.
• Variant Frequency (%): The frequency of the minor variant, in percent.
• Coverage: The read coverage at the position of the codon.
• ORF: The name of the open reading frame/gene.
• Affected Drugs: Drugs to which resistance is conferred by the minor variant,
according to a database specified in the configuration file.
• Haplotypes: The haplotypes associated with this variant.
• Haplotype Frequencies (%): The cumulative haplotype frequencies
associated with the variant.
Page 81
directory.

• Variants Summary: Data from the Minor Variants Details report, in CSV
format.
• Mapped Reads: All input reads that were mapped to the reference by the
application.
• Detailed Reports: Minor variants report information generated, as a ZIP-
compressed HTML file. This includes the full report, in human-readable
format, and contains four sections:
1. Input Data
Summarizes the data provided, the exact call for juliet, and juliet
version for traceability purposes.
2. Target Config
Summarizes details of the provided target configuration for traceability.

This includes the configuration version, reference name and length, and
annotated genes. Each gene name (in bold) is followed by the reference
start, end positions, and possibly known drug resistance mutations.
3. Variant Discovery
For each gene/open reading frame, there is one overview table.
Each row represents a variant position. Each variant position consists of

the reference codon, reference amino acid, relative amino acid position in
Page 82
the gene, mutated codon, percentage, mutated amino acid, coverage, and
possible affected drugs.
Clicking the row displays counts of the multiple-sequence alignment

counts of the -3 to +3 context positions.
4. Drug Summaries
Summarizes the variants grouped by annotated drug mutations:
Page 83
Phasing
The default mode is to call amino-acid/codon variants independently.
Setting the Phase Variants parameter to On, variant calls from distinct
haplotypes are clustered and visualized in the HTML output.
• The row-wise variant calls are "transposed" onto per-column

haplotypes. Each haplotype has an ID: [A-Z]{1}[a-z]?.
• For each variant, colored boxes in this row mark haplotypes that
contain this variant.
• Colored boxes per haplotype/column indicate variants that co-occur.
Wild type (no variant) is represented by plain dark gray. A color palette
helps to distinguish between columns.
• The JSON variant positions has an additional haplotype_hit boolean
array with the length equal to the number of haplotypes. Each entry
indicates if that variant is present in the haplotype. A haplotype block
under the root of the JSON file contains counts and read names. The
order of those haplotypes matches the order of all haplotype_hit
arrays.
There are two types of tooltips in the haplotype section of the table.
The first tooltip is for the Haplotypes % and shows the number of reads
that count towards (a) actually reported haplotypes, (b) haplotypes that
have less than 10 reads and are not being reported, and (c) haplotypes
that are not suitable for phasing. Those first three categories are mutually
exclusive and their sum is the total number of reads going into juliet.
For (c), the three different marginals provide insights into the sample
Page 84
quality; as they are marginals, they are not exclusive and can overlap. The
following image shows a sample with bad PCR conditions:
The second type of tooltip is for each haplotype percentage and shows the
number of reads contributing to this haplotype:
Page 85
Structural Use this application to identify structural variants (Default: ≥20 bp) in a
Variant Calling sample or set of samples relative to a reference. Variant types identified
are insertions, deletions, duplications, copy number variants (CNVs),
inversions, and translocations.
are reads generated with CCS analysis whose quality value is equal to
or greater than 20.
• Specify a reference genome against which to align the reads and call
variants.
Parameters
Minimum Length of 20 The minimum length of structural variants, in base pairs.

Structural Variant (bp)
(Required)
Minimum % of Reads that 10 Ignore calls supported by <P% of reads in every sample.
Support Variant (any one
sample) (Required)
Minimum Reads that 3 Ignore calls supported by <N reads in every sample.
Support Variant (any one
sample) (Required)
Minimum Reads that 3 Ignore calls supported by <N reads total across samples.
Support Variant (total over
all samples) (Required)
Minimum Mapped Length 50 The minimum required mapped read length, in base pairs.
(bp)
Bio Sample Name of NONE Populates the Bio Sample Name (Read Group SM tag) in the
Aligned Dataset aligned BAM file. If blank, uses the Bio Sample Name of the
input file. Note: Avoid using spaces in Bio Sample Names as this
may lead to third-party compatibility issues.
Page 86
Advanced pbmm2 Options NONE Space-separated list of custom pbmm2 options. Not all
supported command-line options can be used, and HPC settings
cannot be modified. See SMRT® Tools reference guide v11.0
for details.
Advanced pbsv Options NONE Additional pbsv command-line arguments. See SMRT® Tools
reference guide v11.0 for details.
administrator.
To launch a multi-sample analysis

2. Enter a name for the analysis.
3. Select all the Data Sets for all the input samples.
4. In the Analysis of Multiple Data Sets list, select One Analysis for All
Data Sets.
5. Click Next.
6. Select Structural Variant Calling from the Analysis Application list.
Note: The Data Set field Bio Sample Name identifies which Data Sets
belong to which biological samples.
• If multiple Data Sets with the same Bio Sample Name are selected and
submitted, the Structural Variant Calling application merges those
Data Sets as belonging to the same sample.
• If any input Data Sets do not have a Bio Sample Name specified, they
are merged (if there are multiple such Data Sets) and their Bio Sample
Name is set to UnnamedSample in the analysis results.
The Structural Variant Calling application generates the following reports:
Report > Count by Sample (SV Type)

This table describes the type of called variants broken down by individual
sample. For each sample, only variants for which the sample has a
heterozygous (“0/1”) or homozygous alternative (“1/1”) genotype are
considered.
• Insertions (total bp): The count and total length (in base pairs) of all called
insertions in the sample.
• Deletions (total bp): The count and total length (in base pairs) of all called
deletions in the sample.
• Inversions (total bp): The count and total length (in base pairs) of all called
inversions in the sample.
• Translocations: The count of all called translocations in the sample.
• Duplications (total bp): The count and total length (in base pairs) of all called
duplications in the sample.
• Total Variants (total bp): The count and total length (in base pairs) of all
variants in the sample.
Page 87
Report > Count by Sample (Genotype)
This table describes the genotype of called variants broken down by
individual sample. For each sample, only variants for which the sample
has a heterozygous (“0/1”) or homozygous alternative (“1/1”) genotype
are considered.
• Homozygous Variants: The count of homozygous variants called in the

sample.
• Heterozygous Variants: The count of heterozygous variants called in the
sample.
• Total Variants: The count of all called variants in the sample.
Report > Count by Annotation
This table describes the called variants broken down by a set of repeat
annotations. Each variant is counted once (regardless of sample
genotypes) and assigned to exactly one annotation category. Only
insertion and deletion variants are considered in this report.
• Tandem repeat: Variant sequence is a short pattern repeated directly next to

itself.
• ALU: Variant sequence matches the ALU SINE repeat consensus.
• L1: Variant sequence matches the L1 LINE repeat consensus.
• SVA: Variant sequence matches the SVA LINE repeat consensus.
• Unannotated: Variant sequence does not match any of the above patterns.
• Total: The sum of variants from all annotations.
Report > Length Histogram
• Histogram of the distribution of variant lengths, in base pairs, broken
down by individual. For each individual, separate distributions are
provided for variants between 10-99 base pairs, 100-999 base pairs,
and ≥ 1 kilobase pairs. Each variant is counted once, regardless of
sample genotypes.
directory.

• Aligned Reads (per sample): Aligned reads, in BAM format, separated by
individual.
• Index of Aligned Reads (per sample): BAM index files associated with the
Aligned Reads BAM files.
• Structural Variants: All the structural variants, in VCF format.
Page 88
• Aligned Reads (per sample): Aligned reads, in BAM format, separated by
individual.
• Index of Aligned Reads (per sample): BAM index files associated with the
Aligned Reads BAM files.
• Structural Variants: All the structural variants, in VCF format. (See here for
details.)
Page 89
PacBio® data utilities
Following are data processing utilities provided with SMRT Analysis
v11.0. These utilities are used as intermediate steps to producing
biologically-meaningful results. Each utility is described later in this
document, including all parameters, reports and output files generated by
the utility.
Note: The following data utilities accept only HiFi reads as input.
5mC CpG Detection

• Analyze the kinetic signatures of cytosine bases in CpG motifs to
identify the presence of 5mC.
• See “5mC CpG Detection” on page 91 for details.
Demultiplex Barcodes
• Separate reads by barcode.
• See “Demultiplex Barcodes” on page 92 for details.
Export Reads
• Export HiFi reads that pass filtering criteria as FASTA, FASTQ and
BAM files.
• For barcoded runs, you must first run the Demultiplex Barcodes
application to create BAM files before using this application.
• See “Export Reads” on page 98 for details.
Mark PCR Duplicates
• Remove duplicate reads from a HiFi reads Data Set created using an
ultra-low DNA sequencing protocol.
• See “Mark PCR Duplicates” on page 100 for details.
Trim Ultra-Low Adapters (was Trim gDNA Amplification Adapters)
• Trim PCR Adapters from a HiFi reads Data Set created using an ultra-
low DNA sequencing library.
• See “Trim Ultra-Low Adapters” on page 102 for details.
Note: The following data utility accept only Subreads as input.
Circular Consensus Sequencing (CCS)

• Identify consensus sequences for single molecules.
• See “Circular Consensus Sequencing (CCS)” on page 104 for details.
Page 90
5mC CpG Use this utility to analyze the kinetic signatures of cytosine bases in CpG
Detection motifs to identify the presence of 5mC.
• The utility accepts HiFi reads (BAM format) as input. HiFi reads are
reads generated with CCS analysis whose quality value is equal to or
greater than 20. The utility also requires kinetics information.
specified for the utility. You can then import this file when creating
future jobs using the same utility. You can also use this exported file
as a template for use with later jobs.
Parameters
Keep Kinetics in Output OFF If ON, specifies that the IPD and PulseWidth records are included
in the output BAM file.
administrator.

The 5mC CpG Detection utility generates the following reports:
5mC CpG Report > Methylation Probability

• CpG Methylation in Reads: The cumulative of percentage of CpG sites in the
sample mapped against the predicted probability of methylation.
• CpG Methylation in Reads (Histogram): Histogram displaying the
percentage of CpG sites in the sample versus the predicted probability of
methylation.
directory.

• HiFi reads with 5mC Calls: BAM file containing all the HiFi reads in the
sample that include 5mC calls.
• <Input Data Set>(5mC): Output Data Set with the 5mC calls.
Page 91
Demultiplex Use this utility to separate sequence reads by barcode. (See “Working
Barcodes with barcoded data” on page 107 for more details.)
greater than 20.
• Barcoded SMRTbell templates are SMRTbell templates with adapters
flanked by barcode sequences, located on both ends of an insert.
• For symmetric and tailed library designs, the same barcode is
attached to both sides of the insert sequence of interest. The only
difference is the orientation of the trailing barcode. For asymmetric
designs, different barcodes are attached to the sides of the insert
sequence of interest.
• Barcode names and sequences, independent of orientation, must be
unique.
• Most-likely barcode sequences per SMRTbell template are identified
using a FASTA-format file of the known barcode sequences.
Given an input set of barcodes and a BAM Data Set, the Demultiplex
Barcodes utility produces:
• A set of BAM files whose reads are annotated with the barcodes;
• A ConsensusReadSet file that contains the file paths of that
collection of barcode-tagged BAM files and their related files.
Notes on Iso-Seq Multiplexed Data
There are two ways in which an Iso-Seq library can be multiplexed:
1. Barcoded adapter Iso-Seq libraries

• If using the SMRTbell Barcoded Adapter with the Iso-Seq Express
protocol on or after April 21, 2022, demultiplex the Data Set prior to
running the Iso-Seq application.
• To analyze the samples in a single Iso-Seq run, select all the
demultiplexed Data Sets to combine and begin the Iso-Seq analysis.
2. Barcoded cDNA primer Iso-Seq libraries

• If following multiplexing guidelines using the Iso-Seq Express
protocol prior to April 21, 2022 and you ordered synthesized oligos
listed in the Appendix 2 - Recommended barcoded NEBNext single
cell cDNA PCR primer and Iso-Seq Express cDNA PCR primer
sequences section, demultiplex your Data Set using the Iso-Seq
application. In other words, do not run the Demultiplexing Barcodes
utility first.
• See “Iso-Seq® Analysis” on page 67 for choices on Primer Sets to
use.
Page 92
Run Demultiplex
Multiplexed method Barcodes utility?
Not multiplexed NO
Barcoded adapters YES
Barcoded cDNA primer NO

Barcode Set (Required)
• Specify a barcode sequence file to separate the reads.
Same Barcodes on Both Ends of Sequence (Default = Yes)
• Specify Yes to retain all the reads with the same barcodes on both
ends of the insert sequence, such as symmetric and tailed designs.
(See “Working with barcoded data” on page 107 for information on
barcode designs.)
• Specify No to specify asymmetric designs where the barcodes are
different on each end of the insert sequence.
Assign Bio Sample Names to Barcodes (Required)
SMRT Link automatically creates a CSV-format Autofilled Barcoded
Sample File. The barcode name is populated based on your choice of
barcode set, and if the barcodes are the same at both ends of the
sequence. The file includes a column of automatically-generated Bio
Sample Names 1 through N, corresponding to barcodes 1 through N, for
the biological sample names. There are two different ways to specify
which barcodes to use, and assign biological sample names to barcodes:
Interactively:
1. Click Interactively, then drag barcodes from the Available Barcodes
column to the Included Barcodes column. (Use the checkboxes to
select multiple barcodes.)
2. (Optional) Click a Bio Sample field to edit the Bio Sample Name
associated with a barcode. Note: Avoid spaces in Bio Sample Names
as they may lead to third-party compatibility issues.
3. (Optional) Click Download as a file for later use.
4. Click Save to save the edited barcodes/Bio Sample names. You see
Success on the line below, assuming the file is formatted correctly.
Page 93
From a file:
1. Click From a File, then click Download File. Edit the file and enter the
biological sample names associated with the barcodes in the second
column, then save the file. Use alphanumeric characters, spaces
(allowed but not recommended for compatibility with third-party
downstream software), hyphens, underscores, colons, or periods only
- other characters will be removed automatically, with a maximum of
40 characters. If you did not use all barcodes in the Autofilled Barcode
Name file in the sequencing run, delete those rows.
– Note: Open the CSV file in a text editor and check that the columns
are separated by commas, not semicolons or tabs.
2. Select the Barcoded Sample File you just edited. You see Success on
the line below, assuming the file is formatted correctly.
Demultiplexed Output Data Set Name (Required)

• Specify the name for the new demultiplexed Data Set that will display
in SMRT Link. The utility creates a copy of the input Data Set, renames
it to the name specified, and creates demultiplexed child Data Sets
linked to it. The input data set remains separate and unmodified.
Parameters
Minimum Barcode Score 80 A barcode score measures the alignment between a barcode
attached to a read and an ideal barcode sequence, and is an
indicator of how well the chosen barcode pair matches. It
ranges between 0 (no match) and 100 (a perfect match).
Specifies that reads with barcode scores below this minimum
value are not included in the analysis. This affects the output
BAM file and the output demultiplexed Data Set XML file.
Advanced lima Options NONE Space-separated list of custom lima options. Not all supported
command-line options can be used, and HPC settings cannot be
modified. See the Demultiplex Barcodes section of the
document SMRT® Tools reference guide v11.0 for information
on lima.
administrator.

The Demultiplex Barcodes utility generates the following reports:
Barcodes > Summary Metrics

• Unique Barcodes: The number of unique barcodes in the sequence data.
• Barcoded Reads: The number of correctly-barcoded reads in the sequence
data.
• Mean Reads: The mean number of reads per barcode combination.
• Max. Reads: The maximum number of reads per barcode combination.
• Min. Reads: The minimum number of reads per barcode combination.
• Mean Read Length: The mean read length of reads per barcode combination.
Page 94
• Unbarcoded Reads: The number of reads without barcodes in the sequence
data.
• Percent Bases in Barcoded Reads: The percentage of bases in sequence
data reads that contain barcodes.
• Percent Barcoded Reads: The percentage of reads in the sequence data that
contain barcodes.
Barcodes > Barcode Data
barcode combination.
• Barcode Name: A string containing the pair of barcode indices for which the
following metrics apply.
• Polymerase Reads: The number of polymerase reads associated with the
• Bases: The number of bases associated with the barcode combination.
• Mean Read Length: The mean read length of reads associated with the.
• Mean Barcode Quality: The mean barcode quality associated with the
Barcodes > Inferred Barcodes
• Barcode Name: The barcode name.
• Number of ZMWs: The number of ZMWs out of the first 50,000 that are
inferred to be assigned to the barcode combination.
• Mean Barcode Score: The mean barcode score associated with the reads
inferred to be associated with the barcode combination.
• Selected: Yes if the number of ZMWs is at least 10, No otherwise.
Barcodes > Barcoded Read Statistics
• Number of Reads per Barcode: Line graph displays the number of sorted
reads per barcode.
– Good performance: The Number of Reads per Barcode line (blue) should
be mostly linear. Note that this depends on the choice of Y-axis scale. The
mean Number of Reads per Barcode line (red) should be near the middle
of the graph and should not be skewed by samples with too many or too
few barcodes.
– Questionable performance: A sharp discontinuity in the blue line, followed
by no yield, with the red line way far from the center. Check the output file
Inferred Barcodes, note the correct barcodes used, and consider
reanalyzing the multiplexed samples with the correct Bio Sample names
for the barcodes actually used. If you reanalyze the data, ensure that the
Barcode Name file includes only the correct barcodes used.
• Barcode Frequency Distribution: Histogram distribution of read counts per
barcode.
– Good performance: A uniform distribution, which is most often a fairly
tight symmetric normal distribution, with few barcodes in the tails.
– Questionable performance: A large peak at zero. This can indicate use of
incorrect barcodes. Check the output file Inferred Barcodes, note the
correct barcodes used, and consider reanalyzing the multiplexed samples
with the correct Bio Sample names for the barcodes actually used. If you
reanalyze the data, ensure that the Barcode Name file includes only the
correct barcodes used.
• Mean Read Length Distribution: Histogram distribution of the mean
polymerase read length for all samples.
– Good performance: The distribution should be normal with a relatively
tight range.
Page 95
– Questionable performance: A spread out distribution, with a mode
towards the low end.
Barcodes > Barcode Quality Scores

• Barcode Quality Score Distribution: Histogram distribution of barcode
quality scores. The scores range from 0-100, with 100 being a perfect match.
Any significant modes or accumulation of scores <60 suggests issues with
some of the barcode analyses. The red line is set at 80 – the minimum
default barcode score.
– Good performance: HiFi demultiplexing runs should have >90% of reads
with barcode quality score ≥95.
– Questionable performance: A bimodal distribution with a large second

peak usually indicates that some barcodes that were sequenced were not
included in the barcode scoring set.
Barcodes > Barcoded Read Binned Histograms

• Read Length Distribution By Barcode: Histogram distribution of the
polymerase read length by barcode. Each column of rectangles is similar to a
read length histogram rotated vertically, seen from the top. Each sample
should have similar polymerase read length distribution. Non-smooth
changes in the pattern looking from left to right might indicate suboptimal
performance.
• Barcode Quality Distribution By Barcode: Histogram distribution of the per-
barcode version of the Read Length Distribution by Barcode histogram. The
histogram should contain a single cluster of hot spots in each column. All
barcodes should also have similar profiles; significant differences in the
pattern moving from left to right might indicate suboptimal performance.
– Good performance: All columns show a single cluster of hot spots.
– Questionable performance: A bimodal distribution would indicate missing
barcodes in the scoring set.

directory.

• All Barcodes (FASTA): All barcoded reads, in FASTA format.
Page 96
• Barcode Files: Barcoded subread Data Sets; one file per barcode.
• Barcoding Summary CSV: Data displayed in the reports, in CSV format. This
includes Bio Sample Name.
• Barcode Summary: Text file listing how many ZMWs were filtered, how many
• Inferred Barcodes: Inferred barcodes used in the analysis. The barcoding
algorithm looks at the first 35,000 ZMWs, then selects barcodes with ≥10
counts and mean scores ≥45.
• Unbarcoded Reads: BAM file containing reads not associated with a
barcode.
• demultiplex.<barcode>.hifi.reads.fastq.gz: Gzipped HiFi reads in FASTQ
format, one file per barcode.
Page 97
Export Reads Use this utility to export HiFi reads that pass filtering criteria as FASTA,
FASTQ and BAM files.
greater than 20.
• For barcoded runs, you must first run the Demultiplex Barcodes utility
to create BAM files before using this utility.
• This utility does not generate any reports.
Output FASTA File (Default = ON)
• Outputs a single FASTA/FASTQ file containing all the reads that
passed the filtering criteria.
Output BAM File (Default = OFF)
• Outputs a single BAM file containing all the reads that passed the
filtering criteria.
Min. CCS Predicted Accuracy (Phred Scale) Default = 20
• Phred-scale integer QV cutoff for filtering HiFi reads. The default for
all applications is 20 (QV 20), or 99% predicted accuracy.
Parameters
administrator.

directory.

• hifi_reads.fasta.gz: Sequence data that passed filtering criteria, converted to
Gzipped FASTA format.
Page 98
• hifi_reads.fastq.gz: Sequence data that passed filtering criteria, converted to
Gzipped FASTQ format.
• <Reads>.bam: Sequence data that passed filtering criteria.
Page 99
Mark PCR Use this utility to remove duplicate reads from a HiFi reads Data Set
Duplicates created using an ultra-low DNA sequencing protocol.
greater than 20.
Note: If starting with a very low-input DNA sample using the SMRTbell
gDNA sample amplification kit, you must run this utility (preceded by the
Trim Ultra-Low Adapters utility) on the resulting Data Set prior to running
any secondary analysis application.

Parameters
Identify Duplicates Across ON Duplicate reads are identified per sequencing library. The library
Sequencing Libraries is specified in the BAM read group LB tag, which is set using the
Well Sample Name field in Run Design. By convention, different
LB tags correspond to different library preparations. Use this
option when the LB tag does not follow this convention to treat
all reads as from the same sequencing library.
administrator.

The Mark PCR Duplicates utility generates the following reports:
PCR Duplicates > Duplicate Rate (table)

• Library: The name of the library containing duplicate molecules.
• Unique Molecules: The number of unique molecules in the library.
• Unique Molecules (%): The percentage of unique molecules in the library.
• Duplicate Reads: The number of duplicate reads in the library.
• Duplicate Reads (%): The percentage of duplicate reads in the library.
PCR Duplicates > Duplicate Rate (chart)
• Duplicate Rate: Displays the percentage of duplicate reads per library.
• Duplicate Reads per Molecule: Displays the percentage of duplicated
molecules per library; broken down by the number of reads per duplicated
molecule.
Page 100
directory.

• PCR Duplicates: BAM file containing duplicate reads with PCR adapters.
• <Data Set> (deduplicated): Output Data Set, with duplicate reads with PCR
adapters removed.
Page 101
Trim Ultra-Low Use this utility to trim PCR Adapters from a HiFi reads Data Set created
Adapters using an ultra-low DNA sequencing library.
greater than 20.
Note: If starting with a very low-input DNA sample using the SMRTbell
gDNA sample amplification kit, you must run this utility (followed by the
Mark PCR Duplicates utility) on the resulting Data Set prior to running any
secondary analysis application.

PCR Adapters (Required)
• Specify the file of PCR adapters used during library preparation of an
ultra-low DNA sequencing library to be trimmed from the sequenced
data.
Parameters
administrator.

The Trim Ultra-Low Adapters utility generates the following reports:
PCR Adapters > Summary Metrics

• Unique PCR Adapters: The number of unique PCR adapters in the sequence
data.
• Reads with PCR Adapters: The number of reads in the sequence data that
contain PCR adapters.
• Mean Reads Per Adapter: The mean number of reads per PCR adapter in the
sequence data.
• Max. Reads Per Adapter: The maximum number of reads per PCR adapter in
the sequence data.
• Min. Reads Per Adapter: The minimum number of reads per PCR adapter in
the sequence data.
• Mean Read Length: The mean read length of reads per PCR adapter in the
sequence data.
Page 102
• Reads Without PCR Adapters: The number of reads without PCR adapters in
the sequence data.
• Percent Bases in Reads with Adapters: The percentage of bases in reads in
the sequence data that contain PCR adapters.
• Percent Reads with Adapters: The percentage of reads in the sequence data
that contain PCR adapters.
PCR Adapters > PCR Adapter Data
PCR adapters.
• PCR Adapter Name: A string containing the pair of PCR adapter indices for
which the following metrics apply.
• Polymerase Reads: The number of polymerase reads associated with the
PCR adapter.
• Bases: The number of bases associated with the PCR adapter.
• Mean Read Length: The mean read length of reads associated with the PCR
adapter.
• Mean PCR Adapter Quality: The mean PCR adapter quality associated with
the PCR adapter.
PCR Adapters > PCR Adapter Read Statistics
• Number of Reads Per PCR Adapter: Histogram distribution of the mean
number of reads per PCR adapter.
• PCR Adapter Frequency Distribution: Histogram distribution of reads with
PCR adapter mapped to the number of barcoded samples.
• Mean Read Length Distribution: Maps the mean read length against the
number of barcoded samples.
PCR Adapters > PCR Adapter Quality Scores
• Histogram distribution of PCR adapter quality scores. The scores
range from 0-100, with 100 being a perfect match.
PCR Adapters > PCR Adapter Read Binned Histograms
• Read Length Distribution By PCR Adapter: Histogram distribution of the read
length by PCR adapter. Each column of rectangles is similar to a read length
histogram rotated vertically, seen from the top.
• PCR Adapter Quality Distribution By Barcode: Histogram distribution of the
per-barcode version of the Read Length Distribution by PCR Adapter
histogram.
directory.

• Reads Missing Adapters: Reads Missing Adapters: BAM file containing the
reads with missing PCR adapters from the input Data Set.
• PCR Adapter Data CSV: Includes the data displayed in the PCR Adapter Data
table.
• <Data Set> (trimmed): Output Data Set, with the PCR adapters removed.
Page 103
Circular Use this utility to identify consensus sequences for single molecules.
Consensus
Sequencing • The utility accepts Subreads (BAM format) as input.
(CCS)
Detect 5mC Sites (Default = OFF)
• If set to ON, kinetics analysis to identify 5mC CpG sites will be
performed.
Parameters
Minimum CCS Read Length 10 The minimum length for the median size of insert reads to
generate a consensus sequence. If the targeted template is
known to be a particular size range, this can filter out alternative
DNA templates.
Maximum CCS Read 50,000 The maximum length for the median size of insert reads to
Length generate a consensus sequence. If the targeted template is
known to be a particular size range, this can filter out alternative
DNA templates.
Generate a Consensus for OFF Generate a consensus for each strand. Warning: This is an
Each Strand experimental option for the CCS algorithm, and may not be
compatible with all downstream applications. We recommend
using command-line analysis for this feature.
Process All Reads OFF Specifies behavior identical to on-instrument CCS reads
generation, overriding all other cutoffs. This setting writes a CCS
read for every ZMW in the input Data Set. Set to OFF to specify
more restrictive settings.
Include Kinetics OFF If ON, include kinetics per-base data required for methylation
Information with CCS DNA analysis. Note: This results in a BAM file that is 3-4 times
Analysis output larger. This option applies only when Process All Reads is set to
ON.
Advanced CCS Options NONE Space-separated list of additional command-line options to CCS
analysis. Not all supported command-line options can be used,
and HPC settings cannot be modified. See SMRT® Tools
reference guide v11.0 for details.
Minimum Predicted 0.99 The minimum predicted accuracy of a read, ranging from 0 to 1.
Accuracy (Deprecated) (0.99 indicates that only reads expected to be 99% accurate are
emitted.) Note: This setting is ignored if the Process All Reads
advanced parameter is set to ON.
Minimum Number of 3 The minimum number of full passes for a ZMW to be used. Full
Passes (Deprecated) passes must have an adapter hit before and after the insert
sequence and so do not include any partial passes at the start
and end of the sequencing reaction. Note: This setting is
ignored if the Process All Reads advanced parameter is set to
ON.
Detect And Split OFF Specifies that any detected heteroduplexes are separated into
Heteroduplex Read separate reads.
Page 104
administrator.

The Circular Consensus Sequencing (CCS) utility generates the following
reports:
CCS Analysis Report > Summary Metrics

Note: CCS reads with quality value equal to or greater than 20 are called HiFi
reads.
• HiFi Reads: The total number of CCS reads whose quality value is equal to or
greater than 20.
• HiFi Yield (bp): The total yield (in base pairs) of the CCS reads whose quality
value is equal to or greater than 20.
• HiFi Read Length (mean, bp): The mean read length of the CCS reads whose
• HiFi Read Quality (median): The median number of CCS reads whose quality
value is equal to or greater than 20.
• HiFi Number of Passes (mean): The mean number of passes used to
generate CCS reads whose quality value is equal to or greater than 20.
CCS Analysis Report > HiFi Read Length Summary
• Read Length (bp): The HiFi read length, ranging from ≥ 0 to ≥ 40,000 base
pairs.
• Reads: The number of HiFi reads with the specified read length.
• Reads (%): The percentage of HiFi reads with the specified read length.
• Yield (bp): The number of base pairs in the HiFi reads with the specified read
length.
• Yield (%): The percentage of base pairs in the HiFi reads with the specified
read length.
CCS Analysis Report > HiFi Read Quality Summary
• Read Quality (Phred): Phred-scale quality values, ranging from QV ≥20 to QV
≥50.
• Reads: The number of HiFi reads with the specified read quality.
• Reads (%): The percentage of HiFi reads with the specified read quality.
• Yield (bp): The number of base pairs in the HiFi reads with the specified read
quality.
• Yield (%): The percentage of base pairs in the HiFi reads with the specified
read quality.
CCS Analysis Report > Read Length Distribution
• HiFi Read Length Distribution: Histogram distribution of HiFi reads by read
length.
• Yield by HiFi Read Length: Histogram distribution of the cumulative yields of
CCS reads by read length.
• Read Length Distribution: Histogram distribution of all reads by read length.
Page 105
CCS Analysis Report > Number of Passes
• Histogram of the number of complete subreads in CCS reads, broken
down by number of reads.
CCS Analysis Report > Read Quality Distribution
• Histogram distribution of the CCS reads by the Phred-scale read
quality.
CCS Analysis Report > Predicted Accuracy vs. Read Length
• Heat map of CCS read lengths and predicted accuracies.
directory.

• CCS Analysis Per-Read Details: Summary of CCS analysis performance and
yield.
• hifi_reads.fastq.gz: Gzipped HiFi reads in FASTQ format.
• hifi_reads.fasta.gz: Gzipped HiFi reads in FASTA format.
• hifi_reads.bam: HiFi reads in BAM format.
• All Reads (BAM): BAM file containing one CCS read per ZMW, including the
following types of reads:
– HiFi reads (Q20 or higher)
– Lower-quality but still polished consensus reads (Q1-Q20)
– Unpolished consensus reads (RQ=-1)
– 0- or 1-pass subreads unaltered (RQ=-1)
Page 106
Working with barcoded data
This section describes how to use SMRT Link to work with barcoded data.
Demultiplex Barcodes analysis is powered by the lima SMRT Analysis
tool.
The canned data provided with SMRT Link v11.0 includes 7 barcode sets:
• gDNA Amplification Adapter

• Iso-Seq 12 Barcoded cDNA Primers
• Iso-Seq cDNA Primers
• Barcoded Overhang Adapter Kits 8A and 8B
• Sequel 384 barcodes v1
• Barcoded M13 Primer Plate
• SMRTbell Barcoded Adapter Plate 3.0
SMRT Link v11.0 supports sample traceability through the various

modules in the application by using the Bio Sample Name.
Run Design in SMRT Link v11.0 contains a required Bio Sample Name
field for both single and multiplexed samples.
• For multiplexed experiments, SMRT Link provides default names for

one Bio Sample Name per barcode, which can be edited as needed in
the Barcoded Sample Names file.
• For multiplexed Iso-Seq Analysis only, Bio Sample Names are not
required.
Well Sample Name and Bio Sample Name entered in Sequel II systems,
and in Run Designs for multiplexed runs:
• Display as column values in the Data Management and SMRT

Analysis modules.
• Display as Data Set attributes in the Data Set details page in Data
Management.
• Populate the LB and SM tags in read group headers of BAM files
containing basecalled data.
Example Well Sample Names and Bio Sample Names
• Non-barcoded Well Sample Name: HG002_2019_11_2_10K

• Non-barcoded Bio Sample Name: HG002
• Barcoded Well Sample Name: My Multiplexed Set of Bugs
• Barcoded Bio Sample Name:
Unknown Microbe 1,...,Unknown Microbe N
Step 1: Specify Note: If you specified the barcode setup in Run Design, the demultiplexing
the barcode is performed automatically after the data is transferred to the SMRT link
setup and server. You can also specify the barcode setup manually by selecting
sample names in SMRT Analysis > Create New Job and then selecting the Demultiplex
a Run Design Barcodes data utility.
Page 107
1. In SMRT Link, create a new Run Design as described in “Creating a
new Run Design” on page 16. Before you finish the new Run Design,
perform the following steps.
2. Click Barcoded Sample Options and then click Yes for Sample is
Barcoded. Additional fields related to barcoding display.
3. Specify a Barcode Set using the dropdown list.
Note: You can specify up to 10,000 samples. Specifying more than
10,000 samples may cause a delay of several minutes in analysis
submission.
4. Specify if the same barcodes are used on both ends of the
sequences.
– Selecting Yes specifies symmetric and tailed designs where all the
reads have the same barcodes on both ends of the insert sequence.
Barcode analysis of such experiments retains only data with the
same barcode identified on both ends.
– Selecting No specifies asymmetric designs where the barcodes are
different on each end of the insert. Barcode analysis of such
experiments retains any barcode pair combination identified in the
Data Set.
5. SMRT Link automatically creates a CSV-format Autofilled Barcode
Name file. The barcode name is populated based on your choice of
Sample Names 1 through N, corresponding to barcodes 1 through N,
for the biological sample names. There are two different ways to
specify which barcodes to use, and assign biological sample names
to barcodes. (Note: Bio Sample Names are hardcoded and can be
traced through secondary analysis using SMRT Analysis.)
Interactively:
• Click Interactively, then drag barcodes from the Available Barcodes
column to the Included Barcodes column. (Use the check boxes to
Page 108
• (Optional) Click a Bio Sample field to edit the Bio Sample Name
associated with a barcode. Note: Avoid using spaces in Bio Sample
Names as they may lead to third-party compatibility issues.
• (Optional) Click Download as a file for later use.
• Click Save to save the edited barcodes/Bio Sample names. You see
From a File:
• Click From a File, then click Download File. Edit the file and enter the
• Note: Open the CSV file in a text editor and check that the columns are
separated by commas, not semicolons or tabs.
• Select the Barcoded Sample file you just edited. You see Success on
6. Specify if and where to automatically generate HiFi reads (reads gen-
erated with CCS analysis whose quality value is equal to or greater
than 20):
– On Instrument (available only for the Sequel IIe system): HiFi reads
are automatically generated on the instrument, before transfer to
the compute cluster where SMRT Link is installed.
– In SMRT Link: HiFi reads are automatically generated after transfer
to the compute cluster where SMRT Link is installed.
– Do Not Generate: HiFi reads are not generated for this run. Only
subread data are transferred to the local compute cluster where
SMRT Link is installed.
7. Click Save.
Step 2: Perform Load the samples and perform the sequencing run, using the Run Design
the sequencing you created in Step 1. The demultiplexing analysis is performed
run automatically on the SMRT Link server once the data is transferred from
the Sequel II systems. This creates an analysis of type Demultiplex
Barcodes (Auto) in the SMRT Analysis module. You can click to select
this analysis and review the reports and data created. If everything looks
fine, you can continue to Step 4 and use the demultiplexed Data Set(s)
created by the run as input to further analysis.
Note: By default, Demultiplex Barcodes (Auto) creates one Data Set

per autodetected barcode within the selected barcode set. It also applies
a Data Set filter of a minimum barcode score greater than 26 for optimal
results in secondary analysis. If used, the analysis parameter Filters to
add to the Data Set overrides other barcode filtering, even if the barcode
score set with it is lower than 26.
Page 109
Step 3: If instead you did not specify the barcode setup in the Run Design, or if
(Optional) Run you need to change any of the parameters used in the Demultiplex
the Demultiplex Barcodes analysis automatically launched from Run Design, run the
Barcodes data Demultiplex Barcodes data utility. This separates reads by barcode and
utility creates a new demultiplexed Data Set that you can then use as input to
other secondary analysis applications.

3. Select Data Utility as the workflow type.
4. Select HiFI reads as the data type to use. The Data Sets table displays
the appropriate Data Sets available for the job.
5. In the Data Sets table, select one or more Data Sets to be analyzed
together.
6. Click Next.
7. Select Demultiplex Barcodes from the Applications list.
8. Specify a Barcode Set (barcode sequence file.)
Note: You can specify up to 10,000 samples. Specifying more than
10,000 samples may cause a delay of several minutes in analysis sub-
mission.
9. Specify if the same barcodes are used on both ends of the
sequences.
– Selecting Yes specifies symmetric and tailed designs where all the
reads have the same barcodes on both ends of the insert sequence.
Barcode analysis of such experiments retains only data with the
same barcode identified on both ends.
– Selecting No specifies asymmetric designs where the barcodes are
different on each end of the insert. Barcode analysis of such data
retains any barcode pair combination identified in the Data Set.
10. SMRT Link automatically creates a CSV-format Autofilled Barcoded
Sample file. The barcode name is populated based on your choice of
Sample Names 1 through N, corresponding to barcodes 1 through N,
for the biological sample names. There are two different ways to
specify which barcodes to use, and assign biological sample names
to barcodes:
Interactively:
• Click Interactively, then drag barcodes from the Available Barcodes
column to the Included Barcodes column. (Use the check boxes to
• (Optional) Click a Bio Sample field to edit the Bio Sample Name
associated with a barcode. Note: Avoid using spaces in Bio Sample
Names as they may lead to third-party compatibility issues.
• (Optional) Click Download as a file for later use.
• Click Submit to save the edited barcodes/bio sample names. You see
Page 110
From a File:
• Click From a File, then click Download File. Edit the file and enter the
• Note: Open the CSV file in a text editor and check that the columns are
separated by commas, not semicolons or tabs.
• Select the Barcoded Sample file you just edited. You see Success on
11. Specify the name for the new demultiplexed Data Set that will display
in SMRT Link. The application creates a copy of the input Data Set,
renames it to the name specified, and creates demultiplexed child
Data Sets linked to it. The input Data Set remains separate and
unmodified.
12. (Optional) Specify any advanced parameters.
13. Click Start. After the analysis is finished, a new demultiplexed Data
Set is available.
Note: For information about the reports generated by the Demultiplex

Barcodes data utility, see “Demultiplex Barcodes” on page 90.
Step 4: Run All secondary analysis applications except Demultiplex Barcodes can use
applications demultiplexed Data Sets as input.
using the
demultiplexed Note: For Iso-Seq analysis with barcoded samples, use the Iso-Seq
data as input application instead of the Demultiplex Barcodes data utility, as the Iso-
Seq application already includes the demultiplexing step as part of the
pipeline. When performing multiplexed Iso-Seq analysis, ensure that the
Run Design Sample Is Barcoded option is set to No (the default setting).
Then, in SMRT Analysis, go straight to the Iso-Seq application and, in the
parameters section, select a Primer Set containing multiple primers, such
as IsoSeq_Primers_12_Barcodes_v1.
1. Select the secondary analysis application/data utility to use.

2. Click the number in the Demultiplexed Subsets column, then select
the demultiplexed Data Set to use as input:
Page 111
– You can select the entire Data Set as input, or one or more specific
outputs from selected barcodes, to a maximum of 16 sub-Data
Sets, 12 for Iso-Seq.
3. Additional Analysis Type options become available. You can select

from the following options:
– One Analysis for All Data Sets: Runs one job using all the selected
barcode Data Sets as input, for a maximum of 30 Data Sets.
– One Analysis per Data Set - Identical Parameters: Runs one
separate job for each of the selected barcode Data Sets, using the
same parameters, for a maximum of 10,000 Data Sets. Optionally
click Advanced Parameters and modify parameters.
– One Analysis per Data Set - Custom Parameters: Runs one
separate job for each of the selected barcode Data Sets, using
different parameters for each Data Set, for a maximum of 16 Data
Sets. Click Advanced Parameters and modify parameters. Then
click Start and Create Next. You can then specify parameters for
each of the included barcode Data Sets.
– Note: The number of Data Sets listed is based on testing using
PacBio's suggested compute configuration, listed in SMRT Link
software installation guide (v11.0).
4. Click Start to submit the job.
Demultiplex The Demultiplex Barcodes data utility identifies barcode sequences in

Barcodes details PacBio single-molecule sequencing data.
Page 112
Demultiplex Barcodes can demultiplex samples that have a unique per-
sample barcode pair and were pooled and sequenced on the same SMRT
Cell. There are four different methods for barcoding samples with PacBio
technology:
1. Barcoded target-specific primers

2. Barcoded universal primers
3. Barcoded overhang adapters
4. Barcoded linear adapters (target capture)
In addition, there are three different barcode library designs.
The Demultiplex Barcodes application in SMRT Link supports

demultiplexing of subreads.
Demultiplexing of CCS reads is possible using the command line. (See

SMRT® Tools reference guide (v11.0) for details.)
Page 113
Symmetric mode
For symmetric and tailed library designs, the same barcode is attached to
both sides of the insert sequence of interest. The only difference is the
orientation of the trailing barcode. For barcode identification, one read
with a single barcode region is sufficient. Symmetric barcoding is used
for samples constructed using Barcoded overhang adapters, Barcoded
universal primer and target enrichment (linear). This is also the default
scoring mode in SMRT Link v10.2 and later.
Asymmetric mode
Barcode sequences are different on the ends of the SMRTbell template.
Asymmetric mode is used with the M13 barcoding procedure. (See the
document Procedure & checklist - Preparing SMRTbell libraries using
PacBio barcoded M13 primers for multiplex SMRT sequencing for
details.) PacBio using this mode only for small inserts (up to 5 kb) where
both ends of the insert are expected to be sequenced. Both barcodes
must be detected.
Note: For both Symmetric and Asymmetric modes, the limit for unique
individual barcode sequences is 768, and the limit for the number of
different barcode pairs is 10,000.
When running the Demultiplex Barcodes data utility in SMRT Link, set the
Same Barcodes on Both Ends of the Sequence option to Off.
Mixed mode
Libraries with combined symmetric and asymmetric barcoding are not
supported.
Page 114
Automated analysis
Auto Analysis and Pre Analysis allow a specific analysis to be
automatically run after a sequencing run has finished and the data is
transferred to the SMRT Link server. The analysis can include
demultiplexed output.
• Auto Analysis can be set up in Run Design or SMRT Analysis after the
Run Design is saved and before the run is loaded on the instrument.
• Auto Analysis can be run on HiFi reads, and includes all analysis
applications available.
• Auto Analysis works with all Sequel II systems.
Pre Analysis is the process of CCS analysis and/or demultiplexing of

Sequel basecalled data. Pre Analysis occurs before Auto Analysis, and is
defined when you create a Run Design and specify one or more of the
following:
• Read Type = HiFi reads and Generate HiFi reads = On Instrument or In

SMRT Link.
• Read Type = HiFi reads and Sample is Barcoded = Yes.
Note: Pre Analysis works with all Sequel II systems.
Creating an Auto Analysis job from SMRT Analysis

This procedure includes only the basic steps - for more detailed
information on creating jobs, see “Creating and starting a job” on page 44.

2. Select SMRT Analysis.
5. Specify Auto Analysis as the workflow type. The table displays
available runs. (Note: Runs display here only if they are in the Created
state - not if they are already running or have completed.)
6. Click a Collections link associated with a specific run in the table.
7. Select one sample, or drill down further and select from the barcoded
samples of a single collection by clicking the Barcoded Samples link.
You can select multiple barcoded samples at this level.
Note: You cannot select a mix of samples and barcoded samples, or
select barcoded samples from multiple samples. In addition, samples
or barcoded samples will not be selectable if they have a Job Id.
8. Click Next.
9. Select a secondary analysis application from the dropdown list.
Note: Only analysis applications, not data utilities, are available for
use with Auto Analysis.
parameters to change. Click OK when finished. (Different applications
have different advanced parameters.)
Page 115
– To see information about parameters for all secondary analysis
applications provided by PacBio, see “PacBio® secondary analysis
applications” on page 54.
11. Click Start to submit the Auto Analysis job.
Creating Auto Analysis from a Run Design

1. Create a new Run Design (See “Creating a new Run Design” on page
16 for details) and save it. The Auto Analysis button is enabled only
after you save the Run Design.
2. Click Auto Analysis. This takes you into SMRT Analysis, where you
create the new job that will be associated with the collection.
3. Name the new job.
4. Click the numbered Collections link (Column 2 of the Runs table)
associated with the run that you defined in Step 1. (Note: Runs
display here only if they are in the Created state - not if they are
already running or have completed.)
5. Select a collection for analysis.
6. Click Next.
7. Select a secondary analysis application to use for the analysis.
parameters to change. Click OK when finished. To see information
about parameters for all secondary analysis applications provided by
PacBio, see “PacBio® secondary analysis applications” on page 54.
9. Click Create.
HiFiViral SARS-CoV-2: Creating Auto Analysis in Run Design

The HiFiViral SARS-CoV-2 Application includes a streamlined version of
Auto Analysis as part of creating a Run Design.
1. In Run Design, click Create New Design.

2. From the Application list, select HiFiViral SARS-CoV-2. Preloaded
default values display in green.
3. Enter the Well Sample Name.
4. By default, Auto Analysis is set to Yes for Automatic Launch of SARS-
CoV-2 Analysis.
5. Enter the Analysis Name.
6. By default, Yes is selected for Sample Is Barcoded and No for Same
Barcode on Both End of Sequence.
7. By default, the barcode set HiFiViral SARS-CoV-2 M13barcodes is
selected.
8. For Assign Bio Sample Names to Barcodes, select From a File and
then click Download File.
9. Open the downloaded file (assayPlateQC_template_4by96.csv) in a
text editor. See “HiFiViral SARS-CoV-2 Analysis” on page 54 for details
on modifying this file for your samples.
Getting information about analyses created by Auto Analysis

There are several ways to obtain information on the state of an analysis
created using the Auto Analysis feature.
Page 116
From SMRT Analysis:
2. To filter the jobs, click the funnel in the State column header, then
click Created. This displays only jobs in the Created state.
3. Click the job of interest.
4. Click the From Multi-Job link.
5. Click Analysis Overview > Status of Individual Analyses. This
displays information about the analysis, including the application
used.
From Run Design:

2. Click the Run Design of interest.
3. Click the From Multi-Job link.
4. Scroll all the way to the right in the table. This displays information
about the samples included in the run.
5. Click the Auto Analysis ID link for a sample. This displays information
about the analysis, including the application used.
Getting information about Pre Analysis from SMRT Analysis

2. To filter the jobs, click the funnel in the State column header, then
click Created. This displays only jobs in the Created state.
3. Click the job of interest.
4. Click the Pre Analysis link.
5. Click Analysis Overview > Status of Individual Analyses. This
displays information about the Pre Analysis, including the application
used.
Getting information about Pre Analysis from Run Design

2. Click the Run Design of interest.
3. On the left side (above the consumables list), click the Pre Analysis ID
link. This displays information about the Pre Analysis, including the
application used.
Page 117
Visualizing data using IGV
Once an analysis has successfully completed, visualize the results using
the Integrative Genomics Viewer (IGV).
• See here for further installation instruction and usage details.

• See here for PacBio-specific settings and visualizations.
You can visualize data generated by the following secondary analysis

applications:
• Iso-Seq Analysis
• HiFi Mapping
• Microbial Genome Analysis
• Structural Variant Calling
IGV requires the following files for visualization:
• One consolidated alignment BAM file

• BAM index file
• Genome reference file
If an analysis generates multiple alignment BAM files, those files must

first be combined into one consolidated alignment BAM file for
visualization with IGV.
SMRT Link defaults to combining chunked alignment BAM files if the

combined file sizes are 10 GB or less.
• When creating an analysis, you can specify that SMRT Link combines
alignment BAM files for IGV visualization by setting the Consolidate
Mapped BAMs for IGV option to ON.
Note: This setting doubles the amount of storage used by the BAM
files, which can be considerable. Make sure to have enough disk
space available. This setting may also result in longer run times.
To visualize data using IGV
1. Create and run the analysis.

2. After the analysis has finished successfully, go to the Data > IGV
Visualization Files section of the analysis report page.
3. Open IGV and select the reference genome used for the analysis. (See
here for instructions on how to load a genome.)
4. Copy a BAM file link from the Data > IGV Visualization Files section of
the analysis report page.
Note: If you are performing de novo assembly, you must use links to
the draft assembly BAM files, which are clearly labeled.
Page 118
5. In IGV, choose File > Load from URL… and paste the link into the File
URL input field. Click OK.
6. Repeat for the remaining links.
If you ran an analysis and there are no Data > IGV Visualization Files links,
the analysis generated multiple alignment BAM files over 10 GB, but did
not consolidate the files. Click the Launch BAM Consolidation button to
consolidate them.
Page 119
Using the PacBio® self-signed SSL certificate
SMRT Link v11.0 ships with a PacBio self-signed SSL certificate. If this is
used at your site, security messages display when you try to login to
SMRT Link for the first time using the Chrome browser. These messages
may also display other times when accessing SMRT Link.
1. The first time you start SMRT Link after installation, you see the
following. Click the Advanced link.
2. Click the Proceed... link. (You may need to scroll down.)
3. Close the window by clicking the Close box in the corner.
The Login dialog displays, where you enter the User Name and Password.
The next time you access SMRT Link, the Login dialog displays directly.
Page 120
Sequel® II system and Sequel IIe system output files
This section describes the data generated by the Sequel IIe system and
Sequel II system for each SMRT Cell transferred to network storage.
Sequel IIe system output files

Following is a sample of the file and directory structure output by the
Sequel IIe system (not including low-quality reads):
<your_specified_output_directory>/r64012_211206ee_183753/1_A01/
|--m64012ee_211206_183753.baz2bam_1.log
|--m64012ee_211206_183753.ccs.log
|--m64012ee_211206_183753.ccs_reports.json
|--m64012ee_211206_183753.ccs_reports.txt
|--m64012ee_211206_183753.consensusreadset.xml
|--m64012ee_211206_183753.hifi.reads.bam
|--m64012ee_211206_183753.hifi.reads.bam.pbi
|--m64012ee_211206_183753.sts.xml
|--m64012ee_211206_183753.zmw_metrics.json.gz
|--m64012ee_211206_183753.transferdone
If 5mC CpG Detection is performed, the following additional files are

output:
|-- m64012ee_211206_183753.5mc_report.json
|-- m64012ee_211206_183753.primrose.log
If on-instrument demultiplexing is performed, the following additional

files are output. Note: The undemultiplexed hifi_reads.bam file is not
transferred; it is partitioned into the file structure shown below:
|-- bc1001--bc1001/m64012e_211206_183753.bc1001--bc1001.consensusreadset.xml
|-- bc1001--bc1001/m64012e_211206_183753.hifi_reads.bc1001--bc1001.bam
|-- bc1001--bc1001/m64012e_211206_183753.hifi_reads.bc1001--bc1001.bam.pbi
|-- m64012e_211206_183753.barcodes.fasta
|-- m64012e_211206_183753.lima.log
|-- m64012e_211206_183753.lima_counts.txt
|-- m64012e_211206_183753.lima_guess.json
|-- m64012e_211206_183753.lima_guess.txt
|-- m64012e_211206_183753.lima_reports.txt
|-- m64012e_211206_183753.lima_summary.txt
|-- m64012e_211206_183753.unbarcoded.consensusreadset.xml
|-- m64012e_211206_183753.unbarcoded.hifi_reads.bam
|-- m64012e_211206_183753.unbarcoded.hifi_reads.bam.pbi
In these examples:
• r64012ee_211206_183753 is a directory containing the output files

associated with one run.
• r64012ee is the instrument ID number.
Page 121
The run directory includes a subdirectory for each collection/cell
associated with a sample well - in this case 1_A01. The collection/cell
subdirectory can include the following output files:
• ccs.log: Log file from the CCS analysis. Informative for debugging
and performance tracking by PacBio.
• ccs_reports.json, ccs_reports.txt: Contains processing metrics
summarizing how many ZMWs generated HiFi reads, and how many
ZMWs failed to generate CCS reads. These files contain the same
information, and are used internally by PacBio Technical Support.
• hifi.reads.bam: Contains the HiFi reads in BAM format.
Note: If low-quality reads are included in the Run Design, the Sequel
IIe system will output a reads.bam file, which contains HiFi reads and
non-HiFi reads:
– HiFi reads (QV 20 or higher)
– Lower-quality but still polished consensus reads (QV 1 - QV 20)
– Unpolished consensus reads (RQ=-1)
– 0- or 1-pass subreads unaltered (RQ=-1)
The reads.bam file should not be used by itself as input for non-SMRT
Link tools that expect ≥QV 20. The BAM format is a binary,
compressed, record-oriented container format for raw or aligned
sequence reads. The associated SAM format is a text representation
of the same data. The BAM specifications are maintained by the
SAM/BAM Format Specification Working Group. BAM files produced
by all Sequel II systems are fully compatible with the BAM
specification. For more information on the BAM file format
specifications, click here.
• hifi.reads.bam.pbi: Index file that allows for random access of
HiFi reads in the BAM file.
• sts.xml: Contains summary statistics about the collection/cell and
its post-processing.
• zmw_metrics.json.gz: Contains processing information used to
generate RunQC plots.
• 5mc_report.json, primrose.log: Contains information about 5mC
CpG Detection analysis (using the primrose tool), if performed.
• <Barcode Name>.consensusreadset.xml: Contains reads
associated with a specific barcode.
• <Barcode Name>.bam: Contains HiFi reads associated with a specific
barcode, in .bam format.
• <Barcode Name>.bam.pbi: Index file that allows for random access
of HiFi reads in the BAM file.
• <Barcode Name>.fasta: Contains reads associated with the specific
barcode, in FASTA format.
• lima.log: Log file from the demultiplexing analysis, if performed.
Informative for debugging and performance tracking by PacBio.
• lima.counts.txt: Contains the counts of each observed barcode
pair. Only passing ZMWs are counted.
Page 122
• lima.guess.json, lima.guess.txt: Describes the barcode
subsetting process activated using the --peek and --guess options.
These files contain the same information, and are used internally by
PacBio Technical Support.
• lima.reports.txt: A tab-separated file describing each ZMW,
unfiltered. This is useful information for investigating the
demultiplexing process and the underlying data. A single row contains
all reads from a single ZMW.
• lima.summary.txt: Lists how many ZMWs were filtered, how many
• unbarcoded.consensusreadset.xml,unbarcoded.hifi_reads.bam
unbarcoded.hifi_reads.bam.pbi: Contains information on HiFi
reads not associated with any barcode.
Note: The Sequel IIe system runs CCS on-instrument by default and the
subreads.bam, subreads.bam.pbi, scraps.bam and scraps.bam.pbi
files are no longer generated and are not available. Even though the
subreads.bam and subreads.bam.pbi files are not accessible by
default, there is a mechanism available to enable their output. For
detailed instructions on how to enable the output of these files, contact
your Field Applications Support team members.
HiFi reads generation
A standard Run Design performs on-instrument CCS analysis without

including low-quality reads and generates a hifi_reads.bam file and
transfers it to the network server. If low-quality reads are included in the
Run Design, the Sequel IIe system will produce a reads.bam file, which
contains HiFi reads and non-HiFi reads, and should not be used unfiltered
as input for tools that expect ≥QV 20. SMRT Link automatically launches
an Export Reads job on the reads.bam to filter out the HiFi reads, and
generates the following HiFi data files by default:
• <Movie_Name>.hifi_reads.fastq.gz - Gzipped FASTQ file

containing HiFi reads.
• <Movie_Name>.hifi_reads.fasta.gz - Gzipped FASTA file
containing HiFi reads.
• <Movie_Name>.hifi_reads.bam - BAM file containing HiFi reads.
If not using SMRT Link for subsequent analysis, use these three files as
input with any third-party analysis tools.
Finding the hifi_reads files generated using On-Instrument CCS
1. In Run QC, click the desired run, then click the sample name to view
the CCS Data Set.
2. Click Analyses in the left-side panel.
3. Click the Export Reads analysis.
Page 123
4. To locate the directory containing the three hifi_reads files, append
/outputs to the path shown.
Sequel II system output files

Following is a sample of the file and directory structure output by the
Sequel lI system:
<your_specified_output_directory>/r64008_20160116_003347/1_A01
|-- m64008_160116_003634.baz2bam_1.log
|-- m64008_160116_003634.scraps.bam
|-- m64008_160116_003634.scraps.bam.pbi
|-- m64008_160116_003634.subreads.bam
|-- m64008_160116_003634.subreads.bam.pbi
|-- m64008_160116_003634.subreadset.xml
|-- m64008_160116_003634.sts.xml
|-- m64008_160116_003634.transferdone
Files output by the Sequel II system include:
• scraps.bam and scraps.bam.pbi: These files contain sequence data

outside of the high-quality region, rejected subreads, excised adapter
and possible barcode sequences, as well as spike-in control
sequences. (The basecaller marks regions of single molecule
sequence activity as high-quality.) Note: This applies to files
generated by Sequel Instrument Control Software (ICS) v3.1.0 or later.
• subreads.bam:The Sequel II system output one subreads.bam file
per collection/cell, which contains unaligned base calls from high-
quality regions. This file is transferred from the instrument to network
storage, then is used as input for secondary analysis by PacBio’s
SMRT Analysis software. Data in a subreads.bam file is analysis-
ready; all of the data present should be quality-filtered for analyses.
Subreads that contain information such as double-adapter inserts or
single-molecule artifacts are not used in secondary analysis, and are
excluded from this file and placed in scraps.bam.
Page 124
• subreads.bam.pbi: Provides backwards-compatibility with the APIs
enabled for accessing the cmp.h5 file.
• subreadset.xml: This file is needed to import data into SMRT Link.
• sts.xml: Contains summary statistics about the collection/cell and
its post-processing.
• transferdone: Contains a list of files successfully transferred.
Frequently asked questions

What are the minimum files needed to analyze data on SMRT Link?
• .bam file
• bam.pbi file
• subreadset.xml or consensusreadset.xml file
What is the average size of the file bundle for a 30-hour movie of HiFi reads?
Approximately 50 Gb.
What is the difference between a regular .bam file and an aligned.bam file?
The subreads.bam file contains all the subreads sequences, while the aligned.bam file additionally
contains the genomic coordinates of the reads mapped to a reference sequence.
The subreads.bam file is created by the Sequel II systems, while the aligned.bam file is created by
SMRT Link after running mapping analysis applications.
Page 125
Secondary analysis output files
This is data produced by secondary analysis, which is performed on the
primary analysis data generated by the instrument.
• All files for a specific job reside in one directory named according to
the job ID number.
• Every job result has the following file structure. Example:
$SMRT_ROOT/userdata/jobs_root/0000/0000000/0000000002/
├── cromwell-job -> $SMRT_ROOT/userdata/jobs-root/cromwell-executions/
pb_demux_subreads_auto/24e691c8-8d0d-4670-9db3-c7cb1126e8f8
├── entry-points
│ └── ae6f1c2c-b4a2-41cc-8e44-98b494f12a57.subreadset.xml
├── logs
│ ├── pb_simple_mapping
│ │ └── 24e691c8-8d0d-4670-9db3-c7cb1126e8f8
│ │ ├── call-mapping
│ │ │ └── execution
│ │ │ ├── stderr
│ │ │ └── stdout
│ └── workflow.24e691c8-8d0d-4670-9db3-c7cb1126e8f8.log
├── outputs
│ ├── mapping.report.json -> $SMRT_ROOT/userdata/jobs-root/cromwell-executions/
pb_simple_mapping/24e691c8-8d0d-4670-9db3-c7cb1126e8f8/call-mapping/execution/
mapping.report.json
│ └── mapped.bam -> $SMRT_ROOT/userdata/jobs-root/cromwell-executions/
pb_simple_mapping/24e691c8-8d0d-4670-9db3-c7cb1126e8f8/call-mapping/execution/
mapped.bam
├── pbscala-job.stderr
├── pbscala-job.stdout
└── workflow
├── analysis-options.json
├── datastore.json
├── engine-options.json
├── inputs.json
├── metadata.json
├── metadata-summary.json
├── task-timings.metadata.json
└── timing-diagram.html
• logs/: Contains log files for the job.

– workflow.<UUID>.log: Global log of each significant step in the
job and snippets from a task’s stderr output if the job failed.
– The same directory contains stdout and stderr for individual
tasks.
• cromwell-job/: Symbolic link to the actual Cromwell execution
directory, which resides in another part of the jobs-root directory.
Contains subdirectories for each workflow task, along with
executable scripts, output files, and stderr/stdout for the task.
– call-tool_name/execution/: Example of an individual task
directory (This is replaced with <task_id> below.)
– <task_id>/stdout: General task stdout log collection.
– <task_id>/stderr: General task stderr log collection.
Page 126
– <task_id>/script: The SMRT Tools command for the given
analysis task.
– <task_id>/script.submit: The JMS submission script wrapping
run.sh.
– <task_id>stdout.submit: The stdout collection for the
script.submit script.
– <task_id>/stderr.submit: The stderr collection for the
script.submit script.
• workflow/: Contains JSON files for job settings and workflow
diagrams.
– datastore.json: JSON file representing all output files imported
by SMRT Link.
• outputs/: A directory containing symbolic links to all datastore files,
which reside in the Cromwell execution directory. This is provided as
a convenience and is not intended as a stable API; note that external
resources from dataset XML and report JSON file are not included
here. Demultiplexing outputs are nested in additional subdirectories.
• pbscala-job.stderr: Log collection of stderr output from the
SMRT Link job manager.
• pbscala-job.stdout: Log collection of stdout output from the
SMRT Link job manager. (Note: This is the file displayed as Data >
SMRT Link Log on the analysis results page.)
A SMRT Link job generates several types of output files. You can use
these data files as input for further processing, pass on to collaborators,
or upload to public genome sites. Depending on the analysis application
being used, the output directory contain files in the following formats:
• BAM: Binary version of the Sequence Alignment Map (SAM) format.

(See here for details.)
• BAI: The samtools index file for a file generated in the BAM format.
• BED: Format that defines the data lines displayed in an annotation
track. (See here for details.)
• CSV: Comma-Separated Values file. Can be viewed using Microsoft
Excel or a text editor.
• FASTA/FASTQ: Sequence files that contains either nucleic acid
sequence (such as DNA) or protein sequence information. FASTA/Q
files store multiple sequences in a single file. FASTQ files also include
per-base quality scores. (See here or here for details.)
• GFF: General Feature Format, used for describing genes and other
features associated with DNA, RNA and protein sequences. (See here
for details.)
• PBI: PacBio index file. (This is a PacBio-specific file type.)
• VCF: Variant Call Format, for use with the molecular visualization and
analysis program VMD. (See here for details.)
Page 127
To download data files created by SMRT Link:
3. Click Data > File Downloads, then click the appropriate file. The file is
downloaded according to your browser settings.
• (Optional) Click the small icon to the right of the file name to copy the
file’s path to the Clipboard.
Page 128
Configuration and user management
LDAP
SMRT Link supports the use of LDAP for user login and authentication.
Without LDAP integration with SMRT Link, only one user (with the login
admin/admin) is enabled. You can add new users after SMRT Link is
integrated and configured to work with LDAP; you can also add new users
using WSO2 API Manager or Keycloak without LDAP integration.
• For details on integrating LDAP and SMRT Link, see the document
SMRT Link software installation guide (v11.0).
SSL
SMRT Link requires the use of Secure Sockets Layer (SSL) to enable
access via HTTP over SSL (HTTPS), so that SMRT Link logins and data
are encrypted during transport to and from SMRT Link. SMRT Link
includes an Identity Server (WSO2 API Manager or Keycloak), which can
be configured to integrate with your LDAP/AD servers and enable user
authentication using your organizations’ user name and password. To
ensure a secure connection between the SMRT Link server and your
browser, the SSL certificate can be installed after completing SMRT Link
installation.
It is important to note that PacBio will not provide a signed SSL

certificate, however – once your site has obtained one – PacBio tools can
be used to install it and configure SMRT Link to use it. You will need a
certificate issued by a Certificate Authority (CA, sometimes referred to as
a certification authority). PacBio has tested SMRT Link with certificates
from the following certificate vendors: VeriSign, Thawte and digicert.
Note: PacBio recommends that you consult your IT administrator about

obtaining an SSL certificate.
Alternatively, you can use your site’s self-signed certificate.
SMRT Link ships with a PacBio self-signed SSL certificate. If used, each
user will need to accept the browser warnings related to access in an
insecure environment. Otherwise, your IT administrator can configure
desktops to always trust the provided self-signed certificate. Note that
SMRT Link is installed within your organization’s secure network, behind
your organization’s firewall.
• For details on updating SMRT Link to use an SSL certificate, see the
document SMRT Link software installation guide (v11.0).
Page 129
The following procedures are available only for SMRT Link users whose
role is Admin.
Adding and deleting SMRT Link users

1. Choose Gear > Configure, then click User Management.
2. There are two ways to find users:
• To display all SMRT Link users: Click Display all Enabled Users.
• To find a specific user: Enter a user name, or partial name, and click
Search By Name.
3. Click the desired user. If the user status is Enabled, the user has
access to SMRT Link; Disabled means the user cannot access SMRT
Link.
• To add a SMRT Link user: Click the Enabled button, then assign a role.
(See below for details.)
• To disable a SMRT Link user: Click the Disabled button.
4. Click Save.
Assigning user roles

SMRT Link supports three user roles: Admin, Lab Tech, and
Bioinformatician. Roles define which SMRT Link modules a user can
access. The following table lists the privileges associated with the three
user roles:
Tasks/privileges Admin Lab Tech Bioinformatician

Add/delete SMRT Link users Y N N
Assign roles to SMRT Link users Y N N
Update SMRT Link software Y N N
Access Sample Setup module Y Y N
Access Run Design module Y Y N
Access Run QC module Y Y Y
Access Data Management module Y Y Y
Access SMRT Analysis module Y Y Y
1. Choose Gear > Configure, then click User Management.

2. There are two ways to find users:
• To display all SMRT Link users: Click Display all Enabled Users.
• To find a specific user: Enter a user name, or partial name, and click
Search By Name.
3. Click the desired user.
4. Click the Role field and select one of the three roles. (A blank role
means that this user cannot access SMRT Link.)
Page 130
• Note: There can be multiple users with the Admin role; but there must
always be at least one Admin user.
5. Click Save.
Page 131
Hardware/software requirements
Client hardware requirements

• SMRT Link requires a minimum screen resolution of 1600 by 900
pixels.
Client software requirements

• SMRT Link requires the Google® Chrome web browser, version 90 or
later.
Note: SMRT Link server hardware and software requirement are listed in
the document SMRT Link software installation guide (v11.0).
Page 132
Appendix A - PacBio terminology
General terminology
• SMRT® Cell: Consumable substrates comprising arrays of zero-mode
waveguide nanostructures. SMRT Cells are used in conjunction with
the DNA sequencing kit for on-instrument DNA sequencing.
• SMRTbell® template: A double-stranded DNA template capped by
hairpin adapters (i.e., SMRTbell adapters) at both ends. A SMRTbell
template is topologically circular and structurally linear, and is the
library format created by the DNA template prep kit.
• collection: The set of data collected during real-time observation of
the SMRT Cell; including spectral information and temporal
information used to determine a read.
• Zero-mode waveguide (ZMW): A nanophotonic device for confining
light to a small observation volume. This can be, for example, a small
hole in a conductive layer whose diameter is too small to permit the
propagation of light in the wavelength range used for detection.
Physically part of a SMRT Cell.
• Run Design: Specifies
– The samples, reagents, and SMRT Cells to include in the
sequencing run.
– The run parameters such as movie time and loading to use for the
sample.
• adaptive loading: Uses active monitoring of the ZMW loading process
to predict a favorable loading end point.
• unique molecular yield: The sum total length of unique single
molecules that were sequenced. It is calculated as the sum of per-
ZMW median subread lengths.
Read terminology
• polymerase read: A sequence of nucleotides incorporated by the DNA
polymerase while reading a template, such as a circular SMRTbell
template. They can include sequences from adapters and from one or
multiple passes around a circular template, which includes the insert
of interest. Polymerase reads are most useful for quality control of
the instrument run. Polymerase read metrics primarily reflect movie
length and other run parameters rather than insert size distribution.
Polymerase reads are trimmed to include only the high-quality region.
Note: Sample quality is a major factor in polymerase read metrics.
• subreads: Each polymerase read is partitioned to form one or more
subreads, which contain sequence from a single pass of a
polymerase on a single strand of an insert within a SMRTbell template
and no adapter sequences. The subreads contain the full set of
quality values and kinetic measurements. Subreads are useful for
applications such as de novo assembly, base modification analysis,
and so on.
• longest subread length: The mean of the maximum subread length
per ZMW.
Page 133
• insert length: The length of the double-stranded nucleic acid fragment
in a SMRTbell template, excluding the hairpin adapters.
• circular consensus (CCS) reads: The consensus sequence resulting
from alignment between subreads taken from a single ZMW.
Generating CCS reads does not include or require alignment against a
reference sequence but does require at least two full-pass subreads
from the insert. CCS reads are generated with CCS analysis. CCS
reads with quality value equal to or greater than 20 are called HiFi
reads.
• HiFi reads: Reads generated with CCS analysis whose quality value is
equal to or greater than 20.
Read length terminology

• mapped polymerase read length: Approximates the sequence
produced by a polymerase in a ZMW. The total number of bases along
a read from the first adapter of aligned subread to the last adapter or
aligned subread.
• mapped subread length: The length of the subread alignment to a
target reference sequence. This does not include the adapter
sequence.
Secondary analysis terminology

• secondary analysis: Follows primary analysis and uses basecalled
data. It is application-specific, and may include:
Page 134
– Filtering/selection of data that meets a desired criteria, such as
quality, read length, and so on.
– Comparison of reads to a reference or between each other for
mapping and variant calling, consensus sequence determination,
alignment and assembly (de novo or reference-based), variant
identification, and so on.
– Quality evaluations for a sequencing run, consensus sequence,
assembly, and so on.
– PacBio’s SMRT Analysis contains a variety of secondary analysis
applications including RNA and Epigenomics analysis tools.
• secondary analysis application: A secondary analysis workflow that
may include multiple analysis steps. Examples include de novo
assembly, RNA and epigenomics analysis.
• consensus: Generation of a consensus sequence from multiple-
sequence alignment.
• filtering: Removes reads that do not meet the Read Length criteria set
by the user.
• mapping: Local alignment of a read or subread to a reference
sequence.
• Auto Analysis: Allows a specific analysis to be automatically run after
a sequencing run has finished and the data is transferred to the SMRT
Link server. The analysis can include demultiplexed outputs.
– Auto Analysis works with all Sequel II systems.
• Pre Analysis: The process of CCS analysis and/or demultiplexing of
Sequel basecalled data. Pre Analysis occurs before Auto Analysis.
– Pre Analysis works with all Sequel II systems.
Accuracy terminology
• circular consensus accuracy: Accuracy based on consensus
sequence from multiple sequencing passes around a single circular
template molecule.
• consensus accuracy: Accuracy based on aligning multiple
sequencing reads or subreads together.
• polymerase read quality: A trained prediction of a read’s mapped
accuracy based on its pulse and base file characteristics (peak signal-
to-noise ratio, inter-pulse distance, and so on).
Page 135
Appendix B - Data search
Use this function to search for jobs, Data Sets, barcode files, or reference
files.
To search the entire table

1. Enter a text query into the Search box. This searches every field in the
table, and displays all table rows containing the search
characters.
To search for a value within a column

1. Click the small filter icon at the right of the column name.
2. Enter a value; all table rows meeting the search criteria display.
(To select a different search operator, click the droplist and select
another search operator. Different search operators are available,
based on the column’s data type.)
• For the Analysis State column only, click one or more of the job states
of interest: Select All, Created, Running, Submitted, Terminated,
Successful, Failed, or Aborted.
• For Date fields only, click the small calendar and select a date.
Numeric field operators

– Equals, Not equal
– Greater than, Greater than or equals
Page 136
– Less than, Less than or equals
– In range
Text field operators

– Contains, Not contains
– Starts with, Ends with
Date field operators

– Greater than, Less than
– In range
Page 137
Appendix C - BED file format for Target Regions report
With the HiFi Mapping application, an optional Target Regions report can
be generated that displays the number (and percentage) of reads and
subreads that hit specified target regions.
The BED file required to generate the Target Regions report includes the
following fields; with one entry per line:
1. chrom: The name of the chromosome (such as chr3, chrY,

chr2_random) or scaffold (such as scaffold10671).
2. chromStart: The starting position of the feature in the chromosome
or scaffold. The first base in a chromosome is numbered 0.
3. chromEnd: The ending position of the feature in the chromosome or
scaffold. The chromEnd base is not included in the display of the
feature, however, the number in position format is represented. For
example, the first 100 bases of chromosome 1 are defined as
chrom=1, chromStart=0, chromEnd=100, and span the bases num-
bered 0-99 (not 0-100), but will represent the position notation
chr1:1-100.
4. (Optional) Region Name.
Example: lambda_NEB3011 15000 25000 Region2
• Fields can be space- or tab-delimited.

• See here for details of the BED format.
• For details on the BED format’s counting system, see here and here.
Page 138
Appendix D - Additional information included in the CCS Data Set Export
report
When you export a Data Set and select Export PDF Reports, a report is
produced which includes additional fields, listed below.
– See “Exporting sequence, reference and barcode data” on page 42

for details on exporting Data Sets.
– The other fields and plots in this report are described in the
appropriate Reports sections of “PacBio® secondary analysis
applications” on page 54.
• ZMWs input: The total number of ZMWs used as input in the Data Set.
• ZMWs pass filters: The number of ZMWs that passed all the filters.
• ZMWs fail filters: The number of ZMWs that failed any of the filters.
• ZMWs shortcut filters: The number of low-pass ZMWs skipped using
the --all filter.
• ZMWs with tandem repeats: The number of ZMWs that did not
generate CCS reads due to repeats larger than --min-tandem-
repeat-length.
• Below SNR threshold: The number of ZMWs that did not generate
CCS reads due to SNR below --min-snr.
• Median length filter: The number of ZMWs that did not generate CCS
reads due to subreads that are <50% or >200% of the median subread
length.
• Lacking full passes: The number of ZMWs that did not generate CCS
reads due to having fewer than --min-passes full-length subreads.
• Heteroduplex insertions: The number of ZMWs that did not generate
CCS reads due to single-strand artifacts.
• Coverage drops: The number of ZMWs that did not generate CCS
reads due to coverage drops that would lead to unreliable polishing
results.
• Insufficient draft cov: The number of ZMWs that did not generate
CCS reads due to not having enough subreads aligned to the draft
sequence end-to-end.
• Draft too different: The number of ZMWs that did not generate CCS
reads due to having fewer than --min-passes full-length reads
aligned to the draft sequence.
• Draft generation error: The number of ZMWs that did not generate
CCS reads due to subreads that don't agree enough to generate a
draft sequence.
• Draft above --max-length: The number of ZMWs that did not generate
CCS reads due to a draft sequence longer than --max-length.
• Draft below --min-length: The number of ZMWs that did not generate
CCS reads due to a draft sequence shorter than --min-length.
• Reads failed polishing: The number of ZMWs that did not generate
CCS reads due to too many subreads dropped while polishing.
Page 139
• Empty coverage windows: The number of ZMWs that did not generate
CCS reads because at least one window had no coverage.
• CCS did not converge: The number of ZMWs that did not generate
CCS reads because the draft sequence had too many errors that
could not be polished in time.
• CCS below minimum RQ: The number of ZMWs that did not generate
CCS reads because the predicted accuracy is below
--min-rq.
• Unknown error: The number of ZMWs that did not generate CCS
reads due to rare implementation errors.
Page 140

SMRT Link User Guide v11.0

Uploaded by

Copyright:

Available Formats

SMRT Link User Guide v11.0

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

SMRT Link User Guide v11.0

Uploaded by

Copyright:

Available Formats

SMRT® Link

P/N 102-278-200 Version 01 (April 2022)

© 2022, PacBio. All rights reserved.

See https://github.com/broadinstitute/cromwell/blob/develop/LICENSE.txt for Cromwell redistribution information.

• Sample Setup: Calculate binding and annealing reactions for

This document also describes:

Installation of SMRT Link server software is discussed in the document

Using SMRT® Link

• SMRT Link is not available on the instrument – it must be accessed

After accessing SMRT Link, the home page displays.

Gear menu commands

Working with tables

Troubleshooting information can be sent to PacBio Technical Support

1. Access SMRT Link using the Chrome web browser.

5. Enter the sample name.

6. Select a sequencing application for the sample. The following fields

1. Select Classic mode.

16. Optionally, do one of the following:

Editing or printing calculations

To import a new calculation, first find (or create) a calculation similar to

1. Access SMRT Link using the Chrome web browser.

Following are the fields contained in the CSV-format Calculations file.

Field name Required Description

Sample Name Yes Enter alphanumeric characters, spaces, hyphens,

CSV file general requirements

Row Field name

• The samples, reagents, and SMRT Cells to include in the sequencing

SMRT Link includes two different ways to create a Run Design:

Creating a new Run Design

1. Access SMRT Link using the Chrome web browser.

Application-based Run Designs

Custom Run Designs

Editing or deleting Run Designs

Creating a Run Design by importing a CSV file

To obtain the sample CSV files

1. On the home page, select Run Design.

To update and import the CSV file

CSV file structure

• Each CSV file row represents one sample.

Note: Specifying cluster settings configuration is not yet supported from

Outputting Subreads on the Sequel IIe system

Run Design attribute Required Description

Experiment Name No Enter alphanumeric characters, spaces, hyphens, underscores, colons,

Pipeline ID No Note: This field is required to create an Auto Analysis.

Enter an ASCII string in the format file_type;entry_id;uuid,

Application No • HiFi Reads

If blank or contains invalid values, default is Custom.

CSV file general requirements

Kit barcode requirements

1. Lot Number (Example: DM1234)

[server name]:[services port number]/smrt-link/bundles/chemistry-pb/active/

Auto Analysis fields

Metrics can be reviewed in the Run QC module. All Sequel II systems

1. Access SMRT Link using the Chrome web browser.

Accessing instrument status

1. Select Instrument Status. For each instrument connected to the

1. Select Run Status.

• Well: The ID of an individual well used for this sample.

• Create and manage Data Sets,