Chronic epithelial kidney injury molecule-1 expression causes

murine kidney fibrosis

Benjamin D. Humphreys, … , Vijay K. Kuchroo, Joseph V. Bonventre
J Clin Invest. 2013;123(9):4023-4035. https://doi.org/10.1172/JCI45361.

Research Article Nephrology

Acute kidney injury predisposes patients to the development of both chronic kidney disease and end-stage renal failure,
but the molecular details underlying this important clinical association remain obscure. We report that kidney injury
molecule-1 (KIM-1), an epithelial phosphatidylserine receptor expressed transiently after acute injury and chronically in
fibrotic renal disease, promotes kidney fibrosis. Conditional expression of KIM-1 in renal epithelial cells (Kim1RECtg) in the
absence of an injury stimulus resulted in focal epithelial vacuolization at birth, but otherwise normal tubule histology and
kidney function. By 4 weeks of age, Kim1RECtg mice developed spontaneous and progressive interstitial kidney
inflammation with fibrosis, leading to renal failure with anemia, proteinuria, hyperphosphatemia, hypertension, cardiac
hypertrophy, and death, analogous to progressive kidney disease in humans. Kim1RECtg kidneys had elevated expression
of proinflammatory monocyte chemotactic protein-1 (MCP-1) at early time points. Heterologous expression of KIM-1 in an
immortalized proximal tubule cell line triggered MCP-1 secretion and increased MCP-1–dependent macrophage
chemotaxis. In mice expressing a mutant, truncated KIM-1 polypeptide, experimental kidney fibrosis was ameliorated with
reduced levels of MCP-1, consistent with a profibrotic role for native KIM-1. Thus, sustained KIM-1 expression promotes
kidney fibrosis and provides a link between acute and recurrent injury with progressive chronic kidney disease.

Find the latest version:

https://jci.me/45361/pdf
 Research article

Chronic epithelial kidney injury molecule-1

expression causes murine kidney fibrosis
Benjamin D. Humphreys,1,2 Fengfeng Xu,1 Venkata Sabbisetti,1 Ivica Grgic,1,3
Said Movahedi Naini,1 Ningning Wang,1,4 Guochun Chen,1,5 Sheng Xiao,6 Dhruti Patel,1
Joel M. Henderson,7 Takaharu Ichimura,1 Shan Mou,1,8 Savuth Soeung,1
Andrew P. McMahon,2,9,10,11 Vijay K. Kuchroo,6 and Joseph V. Bonventre1,2
1Renal Division, Brigham and Women’s Hospital, Department of Medicine, Harvard Medical School, Boston, Massachusetts, USA.
2Harvard Stem Cell Institute, Cambridge, Massachusetts, USA. 3Department of Internal Medicine and Nephrology, Philipps University, Marburg, Germany.
4Department of Internal Medicine and Nephrology, The First Affiliated Hospital with Nanjing Medical University, Nanjing, People’s Republic of China.
5Division of Nephrology, Second Xiangya Hospital, Central South University, Changsha, Hunan, People’s Republic of China. 6Center for Neurologic Disease,

Brigham and Women’s Hospital, Harvard Medical School, Boston, Massachusetts, USA. 7Department of Pathology and Laboratory Medicine,
Boston University School of Medicine, Boston, Massachusetts, USA. 8Renal Division, Renji Hospital, Shanghai JiaoTong University School of Medicine,
Shanghai, People’s Republic of China. 9Department of Stem Cell and Regenerative Biology, Harvard University,
Cambridge, Massachusetts, USA. 10Department of Molecular and Cellular Biology, Harvard University, Cambridge, Massachusetts, USA.
11Department of Stem Cell Biology and Regenerative Medicine, Keck School of Medicine of the University of Southern California, Los Angeles, California, USA.

Acute kidney injury predisposes patients to the development of both chronic kidney disease and end-stage
renal failure, but the molecular details underlying this important clinical association remain obscure. We
report that kidney injury molecule-1 (KIM-1), an epithelial phosphatidylserine receptor expressed transiently
after acute injury and chronically in fibrotic renal disease, promotes kidney fibrosis. Conditional expression
of KIM-1 in renal epithelial cells (Kim1RECtg) in the absence of an injury stimulus resulted in focal epithelial
vacuolization at birth, but otherwise normal tubule histology and kidney function. By 4 weeks of age, Kim1RECtg
mice developed spontaneous and progressive interstitial kidney inflammation with fibrosis, leading to renal
failure with anemia, proteinuria, hyperphosphatemia, hypertension, cardiac hypertrophy, and death, analo-
gous to progressive kidney disease in humans. Kim1RECtg kidneys had elevated expression of proinflamma-
tory monocyte chemotactic protein-1 (MCP-1) at early time points. Heterologous expression of KIM-1 in an
immortalized proximal tubule cell line triggered MCP-1 secretion and increased MCP-1–dependent macro-
phage chemotaxis. In mice expressing a mutant, truncated KIM-1 polypeptide, experimental kidney fibrosis
was ameliorated with reduced levels of MCP-1, consistent with a profibrotic role for native KIM-1. Thus, sus-
tained KIM-1 expression promotes kidney fibrosis and provides a link between acute and recurrent injury with
progressive chronic kidney disease.

Introduction transmembrane protein strongly induced by ischemic and toxic

Acute kidney injury (AKI) is characterized by a rapid decline in kid- insults to kidney. It also plays diverse roles in T and B cell biology
ney function, often triggered by an ischemic or toxic insult. This clin- (11). In healthy kidney, KIM-1 is undetectable, but after injury,
ical syndrome is associated with substantial short-term morbidity, it is induced more than any other protein, in which case it local-
mortality, and cost, but it had previously been assumed that patients izes to the apical surface of surviving proximal tubule epithelial
surviving the episode made a full renal recovery (1). However, AKI cells (12). The extracellular KIM-1 Ig variable domain binds and
is now appreciated to be markedly associated with increased risk of internalizes oxidized lipid as well as phosphatidylserine exposed
future chronic kidney disease (CKD), end-stage renal disease (ESRD) on the outer leaflet of luminal apoptotic cells (13, 14), thereby
(2, 3), and long-term mortality (4). The population rate of AKI is aiding in nephron repair and tissue remodeling through phago-
increasing at greater than 7% per year (5, 6), and some estimates indi- cytosis of cells and debris (15). KIM-1 is expressed in CKD (16–20)
cate that the incidence of AKI-related ESRD is equal to the incidence where it colocalizes with areas of fibrosis and inflammation (21),
of ESRD from diabetes (7). The mechanisms that might explain the and its expression correlates directly with interstitial fibrosis in
link between AKI and future CKD/ESRD are poorly understood, human allografts (22). Increased urinary KIM-1 is an indepen-
but peritubular capillary loss, a known consequence of AKI (8), is dent predictor of long-term renal graft loss and is also elevated in
proposed to lead to chronic hypoxia and later development of tubu- human nondiabetic, proteinuric CKD (23, 24). The expression of
lointerstitial fibrosis and CKD (9, 10). How chronic ischemia might KIM-1 in chronic and progressive kidney disease, settings with-
trigger parenchymal loss at a molecular level is unresolved. out significant numbers of apoptotic cells in the tubule lumen,
Kidney injury molecule-1 (KIM-1), originally identified as hepa- the epidemiologic association of AKI with future CKD (25), and
titis A virus receptor (HAVCR1, also known as Tim-1), is a type 1 the temporal and spatial association of KIM-1 with inflammation
and fibrosis suggest that it might play a pathogenic role in link-
ing AKI to CKD and renal fibrosis.
Conflict of interest: Joseph V. Bonventre is an inventor on KIM-1 patents, which
have been licensed by Partners Healthcare to Johnson & Johnson, Genzyme, Biogen In this study, we examined the functional consequences of
Idec, and other companies. chronic KIM-1 expression in renal epithelial cells. To dissociate
Citation for this article: J Clin Invest. 2013;123(9):4023–4035. doi:10.1172/JCI45361. the effects of KIM-1 expression from the pleiotropic effects of

The Journal of Clinical Investigation   http://www.jci.org   Volume 123   Number 9   September 2013 4023

research article

Figure 1
KIM-1 is highly induced in fibrotic kidney injury adjacent to interstitial myofibroblasts. (A) KIM-1 protein is highly induced by 2 days after ureteral
ligation, with persistent expression at days 7 and 14 as assessed by Western blot. (B) Tubular KIM-1 expression in the UUO renal fibrosis model.
After fibrotic injury, KIM-1–positive epithelia are adjacent to SMA-positive interstitial myofibroblasts. Scale bar: 10 μm.

ischemic kidney injury used to induce KIM-1, we created a genetic never in podocytes (Figure 3C and data not shown). A comparison
model in which KIM-1 is expressed chronically in the absence of of the distribution of endogenous KIM-1 after UUO versus AP
any injury stimulus. Using this model, we demonstrate here that expression in Kim1RECtg kidneys is presented in Table 1.
chronic KIM-1 expression leads to inflammation, tubulointersti- Kim1RECtg mice were born at expected Mendelian ratios and
tial fibrosis characterized by elevated monocyte chemotactic pro- expressed Kim1 mRNA at birth (Figure 3A). KIM-1 protein was
tein-1 (MCP-1) levels and a murine CKD phenotype. In contrast, properly sorted to the apical membrane of cortical proximal
mice with mutant endogenous KIM-1 were protected from fibro- tubule epithelia (Figure 3, B and C). There was no difference in the
sis in a mouse model of CKD and had a reduced level of MCP-1. birth weights of transgenic versus littermate control mice (n = 3
Together, these results indicate that persistent KIM-1 expression Kim1RECtg or 7 littermate controls), but Kim1RECtg mice did not gain
after AKI promotes interstitial fibrosis and correlates with MCP-1 weight as quickly as littermate controls (Supplemental Figure 2).
expression and further suggest that KIM-1 may represent a novel At birth, kidneys from Kim1RECtg mice were 23% smaller by weight,
therapeutic target in CKD (26). The mouse model we have devel- however, than those of littermate controls (Figure 3, D and E,
oped also recapitulates the renal and extrarenal manifestations P < 0.05, n = 5 Kim1RECtg or 13 control kidneys). This was associated
of CKD seen in humans. These studies provide insight into how with 43% fewer nephrons in Kim1RECtg kidneys without significant
recurrent tubular injury, as reflected by persistent KIM-1 expres- differences in glomerular diameter at P14 (Figure 3, F and G). Kid-
sion, might facilitate progressive CKD and lead to ESRD. ney histology at P1 showed a mild reduction in cortical thickness,
with occasional microcysts that appeared to be glomerular (about
Results 10% of total glomeruli; Figure 3H) and rare large cysts (fewer than
To determine the kinetics of KIM-1 induction during fibrotic 1 per section). A detailed histologic analysis at P15 revealed nor-
disease, we examined the time course for KIM-1 expression in a mal glomeruli including foot processes, however (Figure 3, I and
rodent model of renal fibrosis, unilateral ureteral obstruction J), as well as normal interstitium and vasculature. Focal coarse
(UUO). KIM-1 protein was strongly upregulated 2 days after ure- vacuolization and focal epithelial degeneration were noted only
teral obstruction and fell thereafter, but remained significantly in Kim1RECtg mouse kidneys (n = 3 Kim1RECtg and 3 control kidneys;
elevated at day 14 (Figure 1A). KIM-1 was expressed on the api- Tables 2 and 3). These coarse vacuoles, suggestive of local inju-
cal aspect of proximal tubule epithelia, in tubules surrounded ry, were found in about 1% of tubules (Figure 3, K and L). There
by expanded interstitium with abundant interstitial smooth were no histologic differences in other organs of Kim1RECtg mice
muscle actin–positive myofibroblasts (Figure 1B). To distin- when compared with organs from littermate controls (data not
guish between KIM-1 expression as a cause or consequence of shown). Thus, P15 kidneys from Kim1RECtg mice were characterized
epithelial injury and fibrosis in vivo, we created a conditional by reduced nephron endowment and rare tubular epithelial vacu-
Z/Kim1-AP transgene enabling Cre recombinase-dependent activa- olization, but kidney histology was otherwise normal.
tion of KIM-1 and alkaline phosphatase (AP) expression (Figure 2, At 5 weeks, kidneys from Kim1RECtg mice developed a patchy
A–E). Crossing the Z/Kim1-AP mouse with Six2-GFPCre mice mononuclear interstitial infiltrate with occasional hyaline casts and
(hereafter referred to as Six2-GC) (27), generated bigenic Kim1RECtg focal tubular damage. KIM-1 continued to be expressed in a subset
(Kim1 renal epithelial cell transgenic) mice with KIM-1 and AP of tubular epithelial cells along the apical membrane (Supplemen-
expression in metanephric mesenchyme-derived kidney epithelia. tal Figure 3). By 12 weeks, interstitial inflammation was extensive,
Kim1RECtg kidneys expressed the Z/Kim1-AP transgene primarily in together with tubular dedifferentiation, microcystic tubular dila-
cortical and outer medullary epithelia, with rare transgene expres- tion, hyaline casts, and fibrosis. This inflammatory, tubular injury,
sion in inner medulla (Figure 2E and Supplemental Figure 1; sup- and fibrotic phenotype was observed in all Kim1RECtg mice older
plemental material available online with this article; doi:10.1172/ than 6 weeks that were examined (Figure 4A and Supplemental
JCI45361DS1). Mosaic transgene activity was observed with Figure 4). In the oldest mice, prominent periarterial inflammation
10%–20% of renal tubules positive for AP activity, with a similar was present resembling ectopic lymph nodes. Tubular injury scores
fraction of positive podocytes. Note, however, that despite the AP confirmed these histologic observations (Figure 4B). Serum creati-
expression pattern, KIM-1 protein was only seen in tubules and nine was equal between transgenic and control mice at P14, but

4024 The Journal of Clinical Investigation   http://www.jci.org   Volume 123   Number 9   September 2013

 research article

Figure 2
Generation and initial characterization of Kim1RECtg mice. (A) Schematic of the Z/Kim1-AP transgene used for generation of transgenic mice.
(B) Transient transfection of Cos7 cells with the Z/Kim1-AP (Z/Kim1) plasmid in the absence or presence of a plasmid directing expression
of a GFPCre fusion protein verifies that LacZ is expressed before Cre-dependent recombination, and AP after. Original magnification, ×400.
(C) KIM-1 protein is detected only in lysates of Cos7 cells cotransfected with Z/Kim1-AP and GFPCre plasmids. (D) Wholemount X-gal stain of a
Z/Kim1-AP–positive mouse and littermate control (age 4 weeks) shows mosaic LacZ activity throughout cortex. (E) WT mice express neither LacZ
nor AP, whereas Z/Kim1-AP mice (age 4 weeks) exhibit mosaic LacZ expression but no AP expression. Kidney sections from bigenic Kim1RECtg
mice show reduced LacZ expression and activation of AP expression in the cortex. Scale bar: 250 μm.

rose progressively thereafter (Figure 4C), and kidneys from aged Given the progressive kidney disease exhibited by Kim1RECtg mice,
mice were shrunken with a cobblestone appearance typical of end- we looked for extrarenal manifestations of CKD. Cardiac hypertro-
stage renal fibrosis (Figure 4D). Kim1RECtg mice died spontaneously phy often accompanies CKD in humans and is linked to the very
of progressive renal failure at a median age of 11 weeks (Figure 4E). high cardiac mortality associated with CKD (30). We performed
Immunohistochemistry and collagen stains confirmed early focal cardiac ultrasound in Kim1RECtg mice at age 10 to 12 weeks, a time
fibrosis surrounding isolated tubules beginning at 4 weeks, where- when the renal phenotype is well established. At this time point,
as older mice exhibited extensive fibrosis, with abundant αSMA- there was no increase in the systolic blood pressure (Figure 5, E–I),
positive interstitial myofibroblasts and collagen fiber deposition nor was there an increase in the interventricular septal thickness,
(Figure 5A). In Kim1RECtg mice with established fibrotic disease, AP left ventricular end-diastolic diameter, or left ventricular poster
transgene expression was expressed in some, but not all, damaged and wall dimensions in Kim1RECtg compared with littermate controls
dilated tubules, consistent with transgene expression in 10%–20% (Table 4). There was a significantly increased percentage frac-
of tubules (Figure 5B). We did not detect any interstitial cells that tional shortening, consistent with increased cardiac contractility,
expressed the AP transgene, arguing against any direct contribution which is likely a consequence of the anemia that the mice develop
of injured epithelial cells to the myofibroblast population through (Figure 5J). In contrast, Kim1RECtg mice that survived past 6 months
epithelial-to-mesenchymal transition and consistent with the of age had clear evidence of left ventricular hypertrophy, measured
notion that epithelia are not capable of contributing directly to the as ventricular wall thickness-to-diameter ratio (Figure 5, C and
interstitial myofibroblast pool (28, 29). D). If hypertension were the primary cause of the renal fibrosis in

The Journal of Clinical Investigation   http://www.jci.org   Volume 123   Number 9   September 2013 4025

research article

Figure 3
Tubular KIM-1 expression and phenotype
of Kim1RECtg kidneys. (A) Kim1 mRNA
is present in P1 kidneys only in bigenic
Kim1RECtg mice. (B and C) At P14, kidneys
from control mice do not express KIM-1
protein, whereas kidneys from Kim1RECtg
mice exhibit appropriate apical expres-
sion of KIM-1 in proximal tubules. KIM-1,
red; Dolichos biflorus lectin (DBA), green.
Scale bar: 20 μm. (D and E) At birth,
Kim1RECtg kidneys are smaller in size and
23% smaller in weight compared with
those of littermate controls. (F) Kim1RECtg
mice (n = 8) had 46% fewer nephrons
than controls at P14 (n = 9); *P = 0.0001.
(G) Glomerular diameter was not different
between controls and Kim1RECtg mice. (H)
Low- and high-power views of P1 kidneys
from control or Kim1RECtg kidneys reveal
thinned cortex and occasional cystic glo-
merular changes (*) in Kim1RECtg. Scale
bar: 25 μm. (I) At P15, glomeruli of con-
trol and Kim1RECtg kidneys were similar,
without cystic dilation. Original magnifica-
tion, ×400. (J) Electron microscopy of P14
Kim1RECtg kidneys revealed normal glo-
merular architecture. Scale bar: 2 μm. In
tubules, occasional focal coarse epithelial
vacuoles were visible (K and L), sugges-
tive of epithelial injury. Scale bars: 10 μm.

Kim1RECtg mice then cardiac hypertrophy would have been expected developed proteinuria after 4 weeks of age, subsequent to tubular
to occur by the 10- to 12-week time point when renal injury and damage and leukocyte influx (Figure 5G and Supplemental Figure
dysfunction were severe. 5). Importantly, there was no proteinuria in Kim1RECtg mice at P14,
The presence of a normal blood pressure at 10 to 12 weeks is also when podocyte foot processes and glomerular capillary endotheli-
consistent with the notion that hypertension was not simply a con- um were normal (Figure 3J). Since KIM-1 is not normally expressed
sequence of reduced nephron endowment, because it did not pre- in podocytes, we investigated whether the Kim1RECtg phenotype was
cede the renal phenotype, but rather that hypertension was a conse-
quence of severe reduction in glomerular filtration rate (Figure 5E).
The severe and progressive anemia developed by the Kim1RECtg mice Table 1
(Figure 5F) was normocytic (mean corpuscular volume was not dif- Comparison of endogenous Kim1 expression after UUO and AP
ferent between control and Kim1RECtg mice;data not shown). Late expression in Kim1RECtg mice
stages of CKD are characterized by hyperkalemia, hyperphospha-
temia, and hypoalbuminemia. Thus, Kim1RECtg mice displayed all 3 Podocytes Proximal Distal Collecting
of these characteristics in a progressive fashion over time (Table 5). tubule tubules duct
The phenotype is not a result of primary proteinuria, podocyte expres- Endogenous KIM-1 0 90%–100% 0 0
sion of KIM-1, or general toxicity of AP. Chronic proteinuria of any Kim1RECtg (AP) 10%–20% 10%–20% 10%–20% 0
cause has been proposed to drive renal fibrosis. Kim1RECtg mice

4026 The Journal of Clinical Investigation   http://www.jci.org   Volume 123   Number 9   September 2013

 research article

Table 2 4 weeks in Kim1RECtg kidneys, and they were only observed at late
Histologic analysis of Kim1RECtg or control kidney tubules at P15 stages of disease (Figure 6C and data not shown). CD3+ lympho-
cytes were located in a focal pattern at early stages, often adjacent to
Tubule histology KIM-1–positive tubules (Figure 6D), suggesting that secreted fac-
tors from KIM-1–expressing cells might be responsible for recruit-
Genotype Reabsorption Vacuolization Epithelial
granules degeneration
ing inflammatory cells to the kidney in Kim1RECtg mice.
Tubule damage is known to contribute to and be exacerbated
Control 1 1+ (focal apical) 1+ (focal apical) 0
Control 2 1+ (focal apical) 1+ (focal apical) 0
by inflammation. We therefore tested whether tubular damage
Control 3 0 ± (focal apical) 0 could be detected using urinary biomarkers at 4 weeks. Since
Transgenic 1 ± (focal) 1+ (focal coarse) ± (focal) KIM-1 itself undergoes proteolytic cleavage, resulting in release
Transgenic 2 ± (focal) 1+ (focal coarse) 1+ (focal) of the soluble ectodomain that might have the capacity to send
Transgenic 3 1+ (focal apical) 1+ (focal coarse) 1+ (focal) a proinflammatory signal itself (32), we measured urinary KIM-1
levels. Even at 4 weeks, when disease was mild, urinary KIM-1 levels
were higher in Kim1RECtg mice compared with controls, as expected
(Figure 7A). Consistent with early epithelial damage, urinary
a consequence of delayed toxicity to podocytes from glomerular N-acetyl-β-D-glucosaminidase (NAG) was also increased at 4 weeks
KIM-1 expression. Mice with KIM-1–AP expression exclusively and increased further at 8 weeks (Figure 7B). We further measured
in podocytes (bigenic Podocin-Cre;Z/Kim1-AP) had expression of the levels of cytokines and chemokines known to be activated by
AP activity in 55% of glomeruli in a focal pattern (Supplemental epithelial pattern recognition receptors that might mediate leu-
Figure 6) with histologically normal glomeruli (data not shown). kocyte recruitment. We detected a strong upregulation of mRNA
There was no effect on kidney size, and mice did not develop pro- encoding a panel of cytokines capable of being secreted by epithe-
teinuria even up to 6 months of age. Serum creatinine and hema- lial cells at 4 weeks (Figure 7C). Three of these cytokines, CXCL-1,
tocrit have the same values as in littermate controls (Figure 5, MCP-1, and TGF-β, were upregulated at 2 weeks — a time point
I and J). Taken together, these observations show that renal fibrosis without evident histologic damage.
was not a secondary consequence of abnormal glomerular devel- The inflammation observed in Kim1RECtg mice coupled with
opment, early hypertension, or podocyte expression of KIM-1. increased proinflammatory cytokine expression suggested the
We also evaluated the possibility that AP expression alone in possibility that KIM-1 might directly regulate epithelial cytokine
Kim1RECtg mice might mediate kidney damage independently of expression. To test this possibility, we stably expressed either vec-
KIM-1 (31). However, bigenic Six2-GC;Z/AP mice that expressed tor alone (pcDNA-LLC) or KIM-1 (KIM-1–LLC) in LLC-PK1 por-
the AP transgene (without KIM-1) in nearly 100% of renal epithelia cine proximal tubule cells. The supernatant from these cultures
(Supplemental Figure 5) had normal renal histology, no protein- was collected and assessed for cytokines. The supernatant from
uria, and normal serum creatinine, even in the case of aged mice KIM-1–expressing, but not control, cultures showed significant
(Figure 5I and data not shown). elevations in the levels of TGF-β, MCP-1, and IL-6 (Figure 7, D–F).
Characterization of KIM-1–induced kidney inflammation. Since early We next asked whether conditioned medium from KIM-1–LLC
inflammation was a prominent histologic feature in Kim1RECtg mice, cells might also induce chemotaxis. pcDNA-LLC and KIM-1–LLC
we next sought to characterize this infiltrate at the earliest time cells were plated in lower wells of the Boyden chamber until conflu-
that disease appeared, 4 weeks. There was no interstitial infiltrate at ency, then washed and incubated overnight with DMEM. 5 × 105
2 weeks, but CD3+ lymphocytes and F4/80+ macrophages and den- phorbol ester-activated U937 cells or primary mouse BM-derived
dritic cells migrated into Kim1RECtg kidneys by 4 weeks, and their macrophages (mBMDM) were added to the upper wells. After
appearance correlated with increased interstitial cell proliferation at 3 hours, cells that migrated through the filters were fixed, stained,
this time point (Figure 6, A–C). KIM-1 has recently been identified as and quantitated. In both cases, significantly more cells migrated in
an endogenous ligand for the activating receptor leukocyte mono- response to KIM-1–LLC medium compared with control (Figure 7,
immunoglobulin-like receptor 5 (LMIR5) (also known as CD300b), G and H). This effect could be largely abrogated by addition of a
and binding of KIM-1 to LMIR5 promotes neutrophil influx regu- neutralizing anti–MCP-1 antibody (Figure 7I), consistent with the
lated by myeloid cells (32). However, there were no neutrophils at increased expression of MCP-1 detected in KIM-1–LLC supernatant.

Table 3
Histologic analysis of Kim1RECtg or control kidney glomeruli at P15

Glomerular histology
Genotype Podocyte Vacuolization Reabsorption GBM Endo Mes
effacement granules thickening fenestration loss expansion
Control 1 ± (focal) 0 0 0 ± (focal) 0
Control 2 ± (focal) 0 0 0 ± (focal) 0
Control 3 ± (focal) 0 0 0 ± (focal) 0
Transgenic 1 0 0 0 0 ± (focal) 0
Transgenic 2 ± (focal) ± (focal) 0 0 ± (focal) ± (focal)
Transgenic 3 1+ (focal) 00 0 0 1+ (focal)

GBM, glomerular basement membrane; Mes., mesangial.

The Journal of Clinical Investigation   http://www.jci.org   Volume 123   Number 9   September 2013 4027

research article

Figure 4
Spontaneous inflammation,
tubule injury, renal failure, and
death in Kim1 RECtg mice. (A)
Periodic acid-schiff stain of
control or Kim1 RECtg kidneys
between 2 and 44 weeks of age
reveals no difference in histol-
ogy at 2 weeks, but progressive
interstitial mononuclear cell infil-
tration, tubule dilation, epithe-
lial simplification and interstitial
expansion in Kim1RECtg kidneys
only at later time points. Scale
bar, 50 μm. (B) Tubule cast and
injury scores rise with age in
Kim1RECtg kidneys (n = 3) com-
pared with littermate controls
(n = 3). *P = 0.001, **P = 0.0009,
NS (not significant). (C) Serum
creatinine begins to r ise
between 3 and 5 weeks and
rises progressively in Kim1RECtg
kidneys (n = 4–8 per time point)
compared with controls (n = 5–11
per time point), *P = 0.002,
**P = 0.006, ***P = 0.004. (D)
A Kim1RECtg kidney is markedly
reduced in size and fibrotic at
10 weeks compared with litter-
mate control kidney. (E) Kim1RECtg
mice die spontaneously at a
median age of 11 weeks (n = 20,
both groups), P < 0.0001.

Soluble fibronectin is a known inducer of proinflammatory reduced interstitial collagen deposition as well as reduced tubular
cytokines in renal epithelial cells (33), and the KIM-1–express- injury scores (Figure 8, B–D). mRNA levels of the myofibroblast
ing cell line had substantially elevated fibronectin expression marker αSMA were also reduced in Kim1Δmuc mice, in addition to
compared with control cells. Moreover, in a third cell line that levels of collagen 1α1 and fibronectin (Figure 8, E and F). Taken
expressed a point mutant of a cytoplasmic tyrosine within a together, these findings indicate that Kim1Δmuc mice are protected
consensus phosphorylation sequence (Y350F), fibronectin levels from renal fibrosis in the UUO model. Since proinflammatory
matched those of control LLC-PK1 cells (Figure 7J). cytokine levels were increased in Kim1RECtg mice and KIM-1 expres-
These findings indicate that KIM-1 expression drives proinflam- sion regulates MCP-1, TGF-β, and IL-6 secretion in vitro, we ana-
matory cytokine expression, suggesting a mechanism to explain lyzed the same panel of cytokines in Kim1Δmuc kidney samples before
enhanced leukocyte infiltration at early time points in the Kim1RECtg and after UUO. MCP-1 levels were significantly reduced in Kim1Δmuc
mouse model. KIM-1 also drives fibronectin expression in LLC- compared with control at day 10 of UUO (Figure 8H), while other
PK1 cells through a mechanism that requires cytoplasmic tyrosine cytokine mRNAs were unchanged (data not shown). This result,
Y350, suggesting that fibronectin upregulation may underlie the combined with our previous data, strongly implicates MCP-1 as a
proinflammatory cytokine expression observed. mediator of KIM-1–dependent fibrosis in the mouse kidney.
KIM-1 mutant mice are protected from renal fibrosis in the UUO model.
The Kim1RECtg phenotype suggested that mice with mutant KIM-1 Discussion
might be protected from kidney fibrosis. To test this hypothesis, Resident kidney epithelial cells play an important role in detec-
we analyzed mice carrying a deletion of exon 3 of the KIM-1 locus tion of injury, regulation of the inflammatory and tissue repair
(Kim1Δmuc), resulting in an in-frame deletion of the extracellular responses, and mediation of interstitial fibrosis through paracrine
mucin domain. This mutation results in a smaller KIM-1 poly- mechanisms (35, 36). In this study, we hypothesized that KIM-1
peptide that is defective in KIM-1–dependent phagocytic func- might regulate kidney inflammation and fibrosis when its expres-
tion (34). When subjected to UUO injury, KIM-1Δmuc protein was sion is prolonged because: (a) it is upregulated very early after kid-
upregulated, but as expected, it migrated faster on Western blot ney injury and is thus poised to serve as a sentinel of damage; (b) it
than native KIM-1, reflecting the absence of the heavily glycosyl- is expressed in chronic fibrosing kidney disease, where it colocaliz-
ated mucin domain encoded by exon 3 (Figure 8A). es with areas of fibrosis and inflammation (21, 22); (c) it is a phos-
Both control and Kim1Δmuc mice (n = 10 each) were subjected to phatidylserine receptor and may function in a manner similar to
UUO and sacrificed on day 10. Kim1Δmuc mice had significantly that of Toll-like receptors that are known to regulate innate immu-

4028 The Journal of Clinical Investigation   http://www.jci.org   Volume 123   Number 9   September 2013

 research article

Figure 5
CKD phenotype in Kim1RECtg. (A) Focal fibrotic changes at 4 weeks in Kim1RECtg that become progressively more severe with time. Scale bar: 50 μm.
(B) AP expression identifies cells that have undergone Cre-mediated recombination. No AP-positive cells were found in fibrotic interstitium. Scale
bar: 50 μm. (C) Concentric left ventricular hypertrophy in aged Kim1RECtg, trichrome stain. (D) Ventricular wall ratio (outer to inner diameter) was
increased in aged (range, 12–45 weeks) Kim1RECtg (n = 5 for each group). *P = 0.03. (E) Younger Kim1RECtg (n = 3) do not have hypertension, but
older Kim1RECtg (n = 5) do develop hypertension. *P = 0.0002. (F) Hematocrit in control (n = 10) or Kim1RECtg (n = 5) mice between 6 and 10 weeks or
control (n = 13) and Kim1RECtg (n = 7) mice measured between 10 and 20 weeks of age. *P = 0.001; **P = 0.0001. (G) Total urinary protein is elevated
in 8-week-old Kim1RECtg (n = 3–5) but not at 2 or 4 weeks compared with littermate controls (n = 4–6). *P = 0.01. (H) Urinary protein is not elevated
in mice with expression of KIM-1 in podocytes alone at either 4 or 8 weeks. (I) Serum creatinine 13- to 20-week-old mice comparing control (n = 12)
and Kim1RECtg (n = 8), control (n = 6) and Six2-GC;Z/AP (n = 7), or control (n = 4) and Podocin-Cre;Z/Kim1-AP (n = 4). *P = 0.006, NS. (J) Anemia
was seen in Kim1RECtg but not control mice or mice in which KIM-1 was expressed in podocytes. Control refers to mice with neither transgene or 1
transgene for all groups. *P < 0.0001, NS.

The Journal of Clinical Investigation   http://www.jci.org   Volume 123   Number 9   September 2013 4029

research article

Table 4 macrophages provides indirect support for a model in which

Echocardiography in Kim1RECtg mice at 2.5–3 months KIM-1 regulates inflammation (32); however, it is unclear
whether soluble KIM-1 is required in our model, since we
Control Kim1RECtg observed proinflammatory cytokine secretion from epithe-
(n = 7) (n = 3) lia themselves. Similarly, further investigation is required to
Interventricular septal thickness (mm) 0.69 ± 0.06 0.75 ± 0.04 determine whether ligation of KIM-1 by apoptotic bodies,
Left ventricular end-diastolic diameter (mm) 3.40 ± 0.33 3.37 ± 0.09 oxidized lipid, or some other unidentified KIM-1 ligand is
Left ventricular posterior wall thickness (mm) 0.76 ± 0.05 0.79 ± 0.04 required for proinflammatory signaling, analogous to the
Fractional shortening (%) 38.73 ± 3.55 46.71 ± 4.72A requirement of Toll-like receptor ligands for induction of
AP < 0.05. inflammatory responses in macrophages (47).
The stimulus for sustained KIM-1 expression after AKI or
during CKD requires further investigation. The most likely
nity (15); and (d) blockade of KIM-1 by monoclonal antibodies in explanation is that AKI itself causes peritubular capillary rarefac-
other inflammatory conditions reduces disease pathology (37–40). tion (8), leading to chronic tubular hypoxia, which is a potent
The progressive kidney inflammation and fibrosis observed in stimulus for KIM-1 expression (12). Chronic KIM-1 expression
Kim1RECtg mice are consistent with this hypothesis and, combined will promote further tubulointerstitial inflammation, capillary
with the extrarenal manifestations described here, establish the loss, and hypoxia, further inducing KIM-1 and creating a positive
Kim1RECtg mouse as what we believe to be a novel rodent model of feedback loop of hypoxia and inflammation that culminate in
progressive CKD and implicate the KIM-1 protein as a target for tubulointerstitial fibrosis.
antifibrotic therapy in man (26). Our study suggests what we believe to be a novel role for chron-
The lower nephron endowment in our Kim1RECtg mouse model ic KIM-1 expression in the pathogenesis of renal fibrosis and
most likely reflects activation of KIM-1 expression in metanephric through activation of the innate immune system and leukocyte
mesenchyme with effects on kidney development. Low nephron recruitment. In contrast, very early induction of KIM-1 after AKI
number is a recognized risk factor for the development of hyper- may serve an adaptive function to clear apoptotic and necrotic cells
tension and possibly CKD (41). However, reduction in nephron and debris and thereby decrease the early response of the immune
number by 28%–40% results in no, or very mild, interstitial fibro- system at a site of tissue damage. Persistent KIM-1 expression is
sis, even at late time points of greater than 1 year in a number of perhaps maladaptive through chronic uptake of cell toxic compo-
models (42–45). In contrast, Kim1RECtg mice described here had a nents of the tubular lumen, thereby promoting chronic inflam-
comparable degree of nephron reduction (43%), but all developed mation and ultimately renal fibrosis. Thus KIM-1 may represent
spontaneous fibrosis starting at 4 weeks of age, with progressive a novel therapeutic target in fibrotic kidney disease, and antago-
renal insufficiency, proteinuria, renal fibrosis, and death at a medi- nizing KIM-1 signaling might ameliorate renal fibrosis in CKDs.
an age of 19 weeks. Further arguing against a direct role of reduced
nephron endowment in the observed phenotype, hypertension, Methods
proteinuria, and cardiac hypertrophy did not develop until well Mouse strains. A KIM-1 cDNA was inserted into the NotI site of the Z/AP
after the onset of renal fibrosis, and directed expression of the plasmid (48), and linearized Z/Kim1-AP transgene was introduced into
Z/Kim1-AP transgene in podocytes alone had no phenotype. FVB zygotes (Charles River Laboratories) by pronuclear injection. Three
The primary finding of the current report is that chronic KIM-1 independent founder lines were obtained; all exhibited Six2-GC–dependent
expression in renal epithelial cells directly causes interstitial inflam- transgene expression, and the line with highest outer medulla and cortex
mation followed by progressive fibrotic renal disease. Our data sug- transgene expression was selected for further analysis. The Z/Kim1-AP
gest that epithelial cells that express KIM-1 chronically may act in transgenic was maintained on an FVB × C57BL/6J (Jackson Laboratory)
a paracrine fashion to recruit mononuclear cells to the renal inter- mixed background.
stitium, setting up a proinflammatory cascade, ultimately leading Z/Kim1-AP transgenic mice were crossed with the Six2-GC Cre driver line
to further tubule damage and loss of renal function. We observed (27) maintained on a CD-1 × Swiss Webster (Taconic) × C57BL/6J (Jack-
an early influx of leukocytes in the Kim1RECtg mouse model associ- son Laboratory) mixed background. In other experiments, the Z/Kim1-AP
ated with early elevation in the proinflammatory cytokine MCP-1,
a potent cytokine that mediates mononuclear cell recruitment and
parenchymal cell activation. In contrast, in the Kim1Δmuc mouse Table 5
model, in which KIM-1–induced phagocytosis is impaired, we Biochemical parameters in Kim1RECtg mice
observed reduced levels of MCP-1 and a reduction in renal fibrosis.
Finally, our observation that stable expression of KIM-1 in proxi- Control (n = 10) Kim1RECtg (n = 6)
mal tubule cells in vitro triggers MCP-1 release and macrophage
chemotaxis is consistent with a model in which chronic epithelial BUN (mg/dl) 23.4 ± 1.1 99.0 ± 25.0A
KIM-1 expression causes epithelial MCP-1 release, triggering leuko- Cr (mg/dl) 0.12 ± 0.01 0.47 ± 0.1A
cyte influx and ultimately kidney fibrosis. The results provided do Na (mM) 149 ± 0.9 148.1 ± 2.3
not offer proof that MCP-1 is most important in triggering leuko- K (mM) 5.9 ± 0.3 7.6 ± 0.8
cyte influx, though an important role for MCP-1 is supported by Cl (mM) 104.3 ± 0.7 101.0 ± 1.6
Albumin 2.9 ± 0.1 2.6 ± 0.1
the observation that mice deficient in the major MCP-1 receptor,
Calcium (mg/dl) 9.2 ± 0.1 10.2 ± 0.2A
CCR2, are protected from renal fibrosis (46).
Phosphorus (mg/dl) 7.8 ± 0.3 10.14 ± 1.0
The recent finding that soluble KIM-1 ectodomain serves as a
ligand for the LMIR5/CD300b-activating receptor on resident AP < 0.05.

4030 The Journal of Clinical Investigation   http://www.jci.org   Volume 123   Number 9   September 2013

 research article

Figure 6
Leukocyte infiltration in Kim1RECtg. (A) CD3+ lymphocyte infiltration begins at 4 weeks in Kim1RECtg and is observed in tubulointerstitium, especially
surrounding vessels in older animals. Scale bar: 50 μm. (B) F4/80-positive peritubular macrophages and dendritic cells are increased at 4 weeks
in Kim1RECtg. Scale bar: 50 μm. (C) Quantitation of infiltrating leukocytes and Ki67+ proliferating cells at 4 weeks in Kim1RECtg compared with control
kidneys (n = 3 for each). *P < 0.0001; **P = 0.0003. Neut., neutrophil; Lymph., lymphocyte; Mac., macrophage. (D) CD3-positive lymphocytes
(brown) are frequently identified adjacent to KIM-1–positive (purple, *) tubules. Scale bar: 25 μm.

transgenic mice were crossed with the Podocin-Cre driver line (49). The Z/AP Glomeruli were counted on PAS-stained sections from with the operator
reporter line was from JAX and was maintained on a 129/BL6 background. blinded to the genotype. Glomerular diameter was measured digitally, taking
The Kim1Δmuc has been described (34). The Z/AP and Z/Kim1-AP mice were the average of glomerular width and height from individual glomeruli. The
genotyped using β-Geo–specific primers. The Six2-GC allele was genotyped ventricular wall ratio was assessed by measuring both the dorsoventral and
as described (29). The Podocin-Cre allele was genotyped using Cre primers. lateral ventricle diameters and dividing by the ventricular cavity diameter.
In all cases, littermate control phenotypes were compared. Littermate con- Immunofluorescence and immunohistochemical staining. Cryosections of
trols were used for all mouse experiments. 7-μm were mounted on Fisher Superfrost Plus (Fisher) microscope slides,
Induction of renal fibrosis by UUO. Male BALB/c mice aged 8 to 10 weeks air dried, and treated for immunofluorescence as described (50). Primary
weighing 20–22 g were purchased from Charles River Laboratories. Mice antibodies against the following proteins were used: KIM-1 was detected
were anesthetized and the left kidney exposed by flank incision. The ureter with rabbit polyclonal anti-peptide antibody R9 exactly as described for
was ligated at 2 points proximal to the kidney with 6-0 silk. Sham animals both immunofluorescence and Western analysis (16); F4/80 (rat, 1:100,
had kidney exposed, but ureter was not tied. cat. no. 6640; Abcam); SMA (mouse FITC coupled, 1:200, cat. no. F3777,
Tissue preparation and histology. Mice were anesthetized, sacrificed, and Sigma-Aldrich); DBA (lectin, 1:500, cat. no. L-1030; Vector Laboratories);
immediately perfused via the left ventricle with ice-cold PBS for 2 min- Ki67 (rabbit monoclonal, 1:1000, cat. no. VP-RM04; Vector Laboratories);
utes. Kidneys were hemi-sectioned, and portions were snap frozen in liquid CD3 (rabbit monoclonal, 1:500 cat. no. VP-RM01; Vector Laboratories);
nitrogen. Other kidneys were fixed in 10% neutral buffered formalin at and neutrophil (rat monoclonal, 1:100, cat. no. sc-71674; Santa Cruz Bio-
4°C for 12 hours, processed, embedded in paraffin wax, sectioned, and technology Inc.). Secondary antibodies were obtained from Dako. Sections
stained with PAS using standard procedures. Some kidneys were prepared were mounted in Vectashield containing 4′,6-diamino-2-phenylindole (Vec-
for electron microscopy by glutaraldehyde fixation. Other kidneys were tor Labs). Images were taken with a Nikon TE2000 microscope CoolSnap
fixed in 4% PLP fixative (4% paraformaldehyde, 75 mM L-lysine, 10 mM camera (Roper Scientific) and processed using IP Lab Software (BD Biosci-
sodium periodate) for 2 hours at 4°C, cryoprotected in 30% sucrose and ences). Immunofluorescence images were obtained on a Nikon TE2000 or a
snap frozen in OCT (Sakura FineTek). PAS-stained paraffin sections were Nikon C1 D-Eclipse confocal microscope using standard procedures.
assessed by quantitative measurement of tubular injury in 10 individual Immunohistochemical stains (αSMA, CD3, neutrophil, KIM-1) were
high-power fields (magnification, ×400) per kidney. A percentage of the performed on formalin-fixed, paraffin-embedded 4-μM sections. Sections
area affected was estimated for the number of necrotic cells, loss of brush were rehydrated and antigens retrieved using heated citrate. Staining was
border, cast formation, and tubule dilation and was scored as follows: 0, 0% visualized using horseradish peroxidase–coupled secondary antibodies
to 5%; 1, 5% to 10%; 2, 11% to 25%; 3, 26% to 45%; 4, 46% to 75%, and 5, more (Vectastain Elite; Vector Labs). LacZ activity was measured by standard
than 76%. The fields analyzed in each section were selected at random, and X-gal staining protocol on 7-μM frozen kidney sections that had been
evaluations were made in a blinded fashion. fixed in PLP for 2 hours and was carried out for 12–24 hours at 37°C; then

The Journal of Clinical Investigation   http://www.jci.org   Volume 123   Number 9   September 2013 4031

research article

Figure 7
Persistent KIM-1 expression induces epithelial damage and proinflammatory cytokines in kidney epithelia in vivo and in vitro. (A) Shed KIM-1 is
detectable in urine of Kim1RECtg at 4 weeks of age compared with controls. *P = 0.03. (B) Evidence of tubular injury in Kim1RECtg is also reflected
by increasing urinary NAG in 4- and 8-week-old Kim1RECtg. *P < 0.01. (C) qPCR of kidney cortex cytokines, presented as fold increase in Kim1RECtg
(n = 3) compared with controls (n = 3) at 2 weeks (black bars) or 4 weeks of age (white bars). At 2 weeks, there is mild induction of CXCL-1, MCP-1,
and TGF-β, with much higher levels of mRNA expression for all soluble cytokines by 4 weeks of age. *P < 0.05; **P < 0.006. (D–F) Porcine proxi-
mal tubule epithelial cells stably transfected with either pcDNA3 control plasmid (pcDNA-LLC) or KIM-1 plasmid (KIM-1–LLC) spontaneously
express TGF-β, MCP-1, and IL-6 (n = 3 for each). *P < 0.05; **P < 0.01. (G and H) Boyden chamber assay with pcDNA-LLC or KIM-1–LLC seeded
on the bottom well and either U937 or mBMDM applied to top filter. Migration was measured after 3 hours. *P < 0.05. Original magnification, ×500.
(I) Neutralizing antibody against MCP-1 abrogated KIM-1–LLC–dependent migration but not control IgG. *P < 0.05; **P < 0.01. (J) Cellular lysates
from pcDNA-LLC, KIM-1–LLC, or LLC-PK1 cells transfected with KIM-1–Y350F (Y350-LLC) probed for fibronectin by Western blot demonstrate
strong induction of fibronectin in KIM-1, but not Y350F–KIM-1–transfected cells.

sections were counterstained with eosin (Sigma-Aldrich) and mounted. fuse if 50% or more of the tubule showed these changes. Semiquantitative
PAS, H&E, and Masson’s trichrome stains were performed using standard analysis of glomeruli included glomerular histology as well as foot process
techniques. AP activity was measured using NBT/BCPIP, with a standard morphology assessed by electron microscopy and was graded as follows:
protocol that included a 30-minute incubation at 60°C to inactivate minimal: 1 (involving < 5% of glomerulus); mild: 2 (5%–24%); moderate:
endogenous AP activity. 3 (25%–49%); and severe: 4 (≥ 50%). For assessment of glomerular involve-
Histologic analysis. Histological analysis was performed on paraffin-embed- ment, an average of 80–120 glomeruli per section were examined on multi-
ded and serially cut kidney sections (3 μm) stained with H&E, PAS, and ple levels. All scoring was done in a blinded manner by an experienced renal
Masson’s trichrome. Analysis of tubules included the evaluation of epithe- pathologist. Semiquantitative analysis of tubular morphology in Kim1Δmuc
lial histology. The degree of injury was scored semiquantitatively on a 0 to 4 mice was also performed in a blinded fashion exactly as described (51).
scale for reabsorption granules, vacuolization, and epithelial degeneration Electron microscopy. Portions of kidneys were fixed in Karnovsky’s fixa-
as follows: 0, no lesion; 1, minimal (minor focal changes); 2, mild; 3, mod- tive and processed for electron microscopic studies by standard proce-
erate; 4, severe. The distribution was graded as focal if 49% or less and dif- dures. Semithin sections of each block were stained with toluidine blue

4032 The Journal of Clinical Investigation   http://www.jci.org   Volume 123   Number 9   September 2013

 research article

Figure 8
The functional mutant Kim1Δmuc is protected from kidney fibrosis. (A) Control and Kim1Δmuc mice were subjected to UUO and sacrificed at day 2.
Kidney lysates reveal KIM-1 protein at 75 kDa in the control, but at 55 kDa in the Kim1Δmuc, corresponding to the deletion of exon 3 (arrows).
The arrowhead identifies a nonspecific Ig band. Proliferating cell nuclear antigen (PCNA) staining reflects increased cell proliferation after UUO.
(B) Control or Kim1Δmuc kidney sections before or after UUO. There is reduced interstitial collagen in Kim1Δmuc reflected by Masson’s trichrome
stain, and reduced tubular injury (PAS). (C and D) Quantification of tubular atrophy and fibrosis index, respectively (n = 5 kidneys each condition).
(E–G) qPCR of kidney cortex fibrosis, presented as fold increase of Kim1RECtg (n = 5) compared with control (n = 5) at 10 days after UUO. *P < 0.05.
(H) Reduced MCP-1 mRNA by qPCR in Kim1Δmuc compared with control (n = 5). *P < 0.05.

stain and examined by light microscopy to select for ultrathin sectioning. transcribed with the M-MLV reverse transcriptase kit and Oligo dT primers
Ultrathin sections were stained with uranyl acetate and lead citrate and (Promega). Real-time PCR was performed by TaqMan gene expression assays
examined by electron microscopy. (Applied Biosystems) for detection of mRNA expression using GAPDH as
Western blot analysis. Kidney tissues were lysed, and lysates were prepared the internal control. Qualitative RT-PCR was performed on 1/200th of the
as previously described (50). Membranes were incubated with 1 or more RT product using the following primer pairs (from 5′ to 3′): Cre forward:
of the following primary antibodies: rabbit antibody to LacZ (1 in 5,000; TTCCCGCAGAACCTGAAGATG, reverse: CCCCAGAAATGCCAGAT-
Cappel), chicken antibody to GFP (1 in 1,000; AVES), rabbit antibody to TACG; KIM-1 forward: ATGAATCAGATTCAAGTCTTC, reverse: TCTG-
KIM-1 (1 in 250) (12), rabbit anti-fibronectin (1 in 1,000; Abcam), pro- GTTTGTGAGTCCATGTG; GAPDH forward: TGGAGAAACCTGCCAAG-
liferating nuclear cell antigen (1 in 1,000; Abcam) and ERK (1 in 1,000; TA, reverse: AAGAGTGGGAGTTGCTGTTG. The cycling conditions were as
Cell Signaling). Horseradish peroxidase–conjugated secondary antibodies follows: Cre: melting temperature (Tm) 57°C and 35 cycles, KIM-1: Tm 55°C
were applied, and enhanced chemiluminescence (Amersham Biosciences) and 30 cycles; GAPDH: Tm 53°C and 25 cycles. PCR products were visual-
was used to detect proteins. ized on ethidium bromide containing, 2% agarose gels and photographed.
Quantification of mRNA by reverse transcription PCR. Total RNA was isolated Quantitative PCR was performed using a Bio-Rad iCycler and
from snap-frozen kidneys with RNeasy columns (QIAGEN). Five micro- the following primers (from 5′ to 3′): Col-1α1 forward: TGACTG-
grams of total RNA was treated with DNAse I (Invitrogen) and reverse GAAGAGCGGAGAGT, reverse: GTTCGGGCTGATGTACCAGT; CXCL1

The Journal of Clinical Investigation   http://www.jci.org   Volume 123   Number 9   September 2013 4033

research article

forward: CTGGGATTCACCTCAAGAACATC, reverse: CAGGGT- lected with a metabolic cage and processed in a similar fashion. MCP-1,
CAAGGCAAGCCTC; CXCL2 forward: CCAACCACCAGGCTACAGG, IL-6, and TGF-β microbead-based assays were developed and validated
reverse: GCGTCACACTCAAGCTCTG; CXCL10 forward: CCAAGT- in the lab. Approximately 6000 beads/50 μl were incubated with 30 μl
GCTGCCGTCATTTTC, reverse: GGCTCGCAGGGATGATTTCAA; of sample or recombinant proteins (R&D Systems) for 1 hour, washed 3
GAPDH forward: CATGTTCCAGTATGACTCCACTC, R: GGCCT- times with PBST, and incubated in corresponding biotinylated antibod-
CACCCCATTTGATGT; IL-1β forward: CCTTCCAGGATGAGGA- ies (R&D Systems) for 45 minutes on an orbital shaker at 300 rpm. Beads
CATGA, reverse: AACGTCACACACCAGCAGGTT; IL-6 forward: were washed again with PBST and incubated for 15 minutes with strepta-
TAGTCCTTCCTACCCCAATTTCC, reverse: TTGGTCCTTAGC- vidin-PE solution (Invitrogen). The signal from the fluorochrome, which
CACTCCTTC; MCP-1 forward: TGCATCTGCCCTAAGGTCTTC, reverse: is directly proportional to the amount of antigen bound at the micro-bead
AAGTGCTTGAGGTGGTTGTGG; TGF-β forward: GCAACAATTCCTG- surface, ws captured using the Bio-Plex 200 system (Bio-Rad). Data were
GCGTTACC, reverse: CGAAAGCCCTGTATTCCGTCT; TNF-α forward: generated and interpreted using parametric logistic regression analysis.
CCCTCACACTCAGATCATCTTCT, reverse: GCTACGACGTGGGCTA- Boyden chamber assay. Cell chemotaxis assay was performed in a modi-
CAG; αSMA forward: CTGACAGAGGCACCACTGAA, reverse: CATCTC- fied Boyden chamber using 24-well flat-bottom tissue plates with 5-μm
CAGAGTCCAGCACA; fibronectin forward: ATGTGGACCCCTCCT- polyethylenterephtylan membrane inserts (BD). The lower compartment
GATAGT, R: GCCCAGTGATTTCAGCAAAGG. of each chamber was filled with 500 μl of the conditioned medium. Mem-
Physiologic measurements. Serum creatinine was measured using a Beckman brane inserts were filled with 300 μl of cell suspension and placed in the pre-
Creatinine Analyzer 2 by the Jaffe rate method. Hematocrit was calculated filled lower compartments. The chambers were then incubated for 3 hours
after centrifugation of a hematocrit capillary tube. Proteinuria was assessed in 37°C, 5% CO2. After incubation, nonmigrated cells in the upper wells
by the micro pyrogallol red method (total protein kit; Sigma-Aldrich) or by were removed by scraping and the migrated cells were stained with eosin on
separation of 1 μl of urine on a 10% SDS-PAGE gel followed by coomassie the membrane. Adherent cells on the lower surface of the membrane were
stain. Blood pressure was assessed by tail-cuff analyzer (Visitech Systems counted from 5 high power fields by light microscopy (×40). Data are pre-
Inc.; Apex). After training conscious mice for 3 days, systolic blood pressure sented as cells per high-power field. Neutralizing antibody against MCP-1
and heart rate were collected for 3 consecutive days between 9 am and 11 am, was from Sigma-Aldrich.
with an average of 10 reads each day. KIM-1 protein in urine was measured Statistics. All results are reported as mean ± SEM. All error bars on graphs
by microsphere-based Luminex technology. NAG in urine was measured by represent SEM. Statistical tests are 2-tailed, unpaired t tests except for sur-
colorimetric assayed using a commercial kit (Roche). For serum electrolytes, vival analysis (Figure 4E), which used the log rank test, and Figures 7B and
BUN, and creatinine, mice were anesthetized and the blood samples were Supplemental Figure 2, which used a repeated measures t test.
collected from carotid artery. Analyses were assessed by a core laboratory Study approval. All animal studies were approved by the Harvard Institu-
(Children’s Hospital Boston, Boston, Massachusetts, USA). tional Animal Care and Use Committee.
Cell culture. Cos7 cells were transfected using Lipofectamine 2000
(Invitrogen). Porcine proximal tubular epithelial cells (LLC-PK1) cells were Acknowledgments
grown in DMEM supplemented with 10% FBS and maintained at 37°C in 5% We thank Corrine Lobe for the Z/AP plasmid and Jordan Kriedberg
CO2. To create stable cell lines expressing full-length KIM-1 (KIM-1–LLC), for the Podocin-Cre transgenic mice. This work was supported by NIH
LLC-PK1 cells were transfected with pcDNA3–KIM-1 or pcDNA3–KIM-1– grants DK73628, DK84316, DK088923, funds from the Harvard
Y350F plasmid and the stable population was selected using G418 treatment Stem Cell Institute, and an Established Investigator Award from the
(400 μg/ml). Control cell lines (pcDNA-LLC) stably expressing pcDNA3-neo American Heart Association to B.D. Humphreys and DK39773 and
were generated the same way. To generate mBMDM, femurs and tibias were DK72381 to J.V. Bonventre. Work in A.P. McMahon’s laboratory is
removed from 20- to 25-g BALB/c mice. BM was isolated from these by stan- supported by the National Institute of Diabetes and Digestive and
dard sterile techniques and matured for 7 days in uncoated Petri dishes using Kidney Diseases (NIDDK). N. Wang was supported by the China
DMEM/F12 medium with 10% FCS, penicillin (100 U/ml), and streptomycin Scholarship Council–Harvard University Exchange. S. Xiao was sup-
(100 mg/ml) and conditioned with M-CSF from L929 cells. The U937 cell ported by NIDDK K01 DK090105. I. Grgic was supported by a fel-
line, a human monomyelocytic cell line, was cultured in RPMI 1640 medium lowship of the Deutsche Forschungsgemeinschaft.
supplemented with 10% FCS, 1% penicillin/streptomycin, and 2 mM l-gluta-
mine. Cells were subcultured 3 times a week and maintained at a concentra- Received for publication July 25, 2012, and accepted in revised
tion of 0.5–1.0 × 106 cells/ml. Monocytic differentiation of U937 cells was form June 17, 2013.
achieved by adding 10 nM PMA for 48 hours. PMA-differentiated U937 was
washed 3 times by sterile PBS before experiments. Address correspondence to: Benjamin D. Humphreys, Brigham and
Cytokine measurement. Both KIM-1–LLC and pcDNA-LLC cells were Women’s Hospital, Harvard Institutes of Medicine, Rm 550, 4 Black-
grown to confluence, and supernatant was collected, centrifuged, and fan Circle, Boston, Massachusetts 02115, USA. Phone: 617.525.5971;
stored at –80°C until further analysis. Alternatively, mouse urine was col- Fax: 617.525.5965; E-mail: [email protected].
1. Clarkson MR, Friedewald JJ, Eustace H, Rabb H. Nephrol. 2010;21(2):345–352. 8. Basile DP, Donohoe D, Roethe K, Osborn JL.
Acute kidney injury. In: Brenner BM, ed. Brenner 5. Hsu CY, McCulloch CE, Fan D, Ordoñez JD, Cher- Renal ischemic injury results in permanent dam-
and Rector’s The Kidney. 8th ed. Philadelphia, Penn- tow GM, Go AS. Community-based incidence of age to peritubular capillaries and influences long-
sylvania, USA: Saunders Elsevier; 2008:943–986. acute renal failure. Kidney Int. 2007;72(2):208–212. term function. Am J Physiol Renal Physiol. 2001;
2. Ishani A, et al. Acute kidney injury increases risk 6. Waikar SS, Curhan GC, Wald R, McCarthy EP, Cher- 281(5):F887–F899.
of ESRD among elderly. J Am Soc Nephrol. 2009; tow GM. Declining mortality in patients with acute 9. Kang DH, et al. Role of the microvascular endothe-
20(1):223–228. renal failure, 1988 to 2002. J Am Soc Nephrol. 2006; lium in progressive renal disease. J Am Soc Nephrol.
3. Wald R, et al. Chronic dialysis and death among 17(4):1143–1150. 2002;13(3):806–816.
survivors of acute kidney injury requiring dialysis. 7. Hsu CY. Linking the population epidemiology of 10. Nangaku M. Chronic hypoxia and tubulointersti-
JAMA. 2009;302(11):1179–1185. acute renal failure, chronic kidney disease and end- tial injury: a final common pathway to end-stage
4. Lafrance JP, Miller DR. Acute kidney injury associ- stage renal disease. Curr Opin Nephrol Hypertens. renal failure. J Am Soc Nephrol. 2006;17(1):17–25.
ates with increased long-term mortality. J Am Soc 2007;16(3):221–226. 11. Rennert PD. Novel roles for TIM-1 in immunity

4034 The Journal of Clinical Investigation   http://www.jci.org   Volume 123   Number 9   September 2013

 research article

and infection. Immunol Lett. 2011;141(1):28–35. dictor of graft loss in renal transplant recipients. 2007;353(1):211–216.
12. Ichimura T, et al. Kidney injury molecule-1 (KIM-1), Transplantation. 2007;84(12):1625–1630. 39. Feng BS, et al. Disruption of T-cell immunoglobu-
a putative epithelial cell adhesion molecule con- 25. Okusa MD, Chertow GM, Portilla D. The nexus of lin and mucin domain molecule (TIM)-1/TIM4
taining a novel immunoglobulin domain, is up-reg- acute kidney injury, chronic kidney disease, and interaction as a therapeutic strategy in a dendritic
ulated in renal cells after injury. J Biol Chem. 1998; World Kidney Day 2009. Clin J Am Soc Nephrol. 2009; cell-induced peanut allergy model. J Allergy Clin
273(7):4135–4142. 4(3):520–522. Immunol. 2008;122(1):55–61.
13. Kobayashi N, et al. TIM-1 and TIM-4 glycoproteins 26. Rees AJ, Kain R. Kim-1/Tim-1: from biomarker to 40. Sonar SS, et al. Antagonism of TIM-1 blocks the
bind phosphatidylserine and mediate uptake of therapeutic target? Nephrol Dial Transplant. 2008; development of disease in a humanized mouse
apoptotic cells. Immunity. 2007;27(6):927–940. 23(11):3394–3396. model of allergic asthma. J Clin Invest. 2010;
14. Miyanishi M, Tada K, Koike M, Uchiyama Y, 27. Kobayashi A, et al. Six2 defines and regulates a 120(8):2767–2781.
Kitamura T, Nagata S. Identification of Tim4 multipotent self-renewing nephron progenitor 41. Brenner BM, Garcia DL, Anderson S. Glomeruli
as a phosphatidylserine receptor. Nature. 2007; population throughout mammalian kidney devel- and blood pressure. Less of one, more the other?
450(7168):435–439. opment. Cell Stem Cell. 2008;3(2):169–181. Am J Hypertens. 1988;1(4 pt 1):335–347.
15. Ichimura T, Asseldonk EJ, Humphreys BD, 28. Humphreys BD, et al. Fate tracing reveals the peri- 42. Dziarmaga A, Eccles M, Goodyer P. Suppression
Gunaratnam L, Duffield JS, Bonventre JV. Kidney cyte and not epithelial origin of myofibroblasts in of ureteric bud apoptosis rescues nephron endow-
injury molecule-1 is a phosphatidylserine receptor kidney fibrosis. Am J Pathol. 2010;176(1):85–97. ment and adult renal function in Pax2 mutant
that confers a phagocytic phenotype on epithelial 29. Humphreys BD, et al. Intrinsic epithelial cells mice. J Am Soc Nephrol. 2006;17(6):1568–1575.
cells. J Clin Invest. 2008;118(5):1657–1668. repair the kidney after injury. Cell Stem Cell. 2008; 43. Wintour EM, Moritz KM, Johnson K, Ricardo S, Sam-
16. Kuehn EW, Park KM, Somlo S, Bonventre JV. Kid- 2(3):284–291. uel CS, Dodic M. Reduced nephron number in adult
ney injury molecule-1 expression in murine poly- 30. Ritz E. Left ventricular hypertrophy in renal disease: sheep, hypertensive as a result of prenatal glucocorti-
cystic kidney disease. Am J Physiol Renal Physiol. 2002; beyond preload and afterload. Kidney Int. 2009; coid treatment. J Physiol. 2003;549(pt 3):929–935.
283(6):F1326–F1336. 75(8):771–773. 44. Moritz KM, Jefferies A, Wong J, Wintour EM,
17. Perez-Rojas J, et al. Mineralocorticoid receptor 31. Guo JK, et al. The commonly used beta-actin- Dodic M. Reduced renal reserve and increased
blockade confers renoprotection in preexisting GFP transgenic mouse strain develops a distinct cardiac output in adult female sheep uninephrec-
chronic cyclosporine nephrotoxicity. Am J Physiol type of glomerulosclerosis. Transgenic Res. 2007; tomized as fetuses. Kidney Int. 2005;67(3):822–828.
Renal Physiol. 2007;292(1):F131–F139. 16(6):829–834. 45. Vehaskari VM, Aviles DH, Manning J. Prenatal pro-
18. van Timmeren MM, et al. Tubular kidney injury 32. Yamanishi Y, et al. TIM1 is an endogenous ligand gramming of adult hypertension in the rat. Kidney
molecule-1 in protein-overload nephropathy. Am J for LMIR5/CD300b: LMIR5 deficiency ameliorates Int. 2001;59(1):238–245.
Physiol Renal Physiol. 2006;291(2):F456–F464. mouse kidney ischemia/reperfusion injury. J Exp 46. Kitagawa K, et al. Blockade of CCR2 ameliorates
19. Kramer AB, et al. Reduction of proteinuria in Med. 2010;207(7):1501–1511. progressive fibrosis in kidney. Am J Pathol. 2004;
adriamycin-induced nephropathy is associated 33. Ren L, et al. Soluble fibronectin induces chemokine 165(1):237–246.
with reduction of renal Kidney injury molecule-1 gene expression in renal tubular epithelial cells. 47. Lucas M, Stuart LM, Savill J, Lacy-Hulbert A. Apop-
(Kim-1) over time. Am J Physiol Renal Physiol. 2009; Kidney Int. 2005;68(5):2111–2120. totic cells and innate immune stimuli combine to
296(5):F1136–F1145. 34. Xiao S, et al. Defect in regulatory B-cell function and regulate macrophage cytokine secretion. J Immunol.
20. Waanders F, van Timmeren MM, Stegeman CA, development of systemic autoimmunity in T-cell Ig 2003;171(5):2610–2615.
Bakker SJ, van Goor H. Kidney injury molecule-1 mucin 1 (Tim-1) mucin domain-mutant mice. Proc 48. Lobe CG, Koop KE, Kreppner W, Lomeli H,
in renal disease. J Pathol. 2010;220(1):7–16. Natl Acad Sci U S A. 2012;109(30):12105–12110. Gertsenstein M, Nagy A. Z/AP, a double reporter
21. van Timmeren MM, van den Heuvel MC, Bailly 35. Yang L, Besschetnova TY, Brooks CR, Shah JV, Bon- for cre-mediated recombination. Dev Biol. 1999;
V, Bakker SJ, van Goor H, Stegeman CA. Tubular ventre JV. Epithelial cell cycle arrest in G2/M medi- 208(2):281–292.
kidney injury molecule-1 (KIM-1) in human renal ates kidney fibrosis after injury. Nat Med. 2010; 49. Ho J, Ng KH, Rosen S, Dostal A, Gregory RI, Kre-
disease. J Pathol. 2007;212(2):209–217. 16(5):535–543. idberg JA. Podocyte-specific loss of functional
22. Schroppel B, et al. Tubular expression of KIM-1 36. Grgic I, et al. Targeted proximal tubule injury trig- microRNAs leads to rapid glomerular and tubular
does not predict delayed function after transplan- gers interstitial fibrosis and glomerulosclerosis. injury. J Am Soc Nephrol. 2008;19(11):2069–2075.
tation. J Am Soc Nephrol. 2010;21(3):536–542. Kidney Int. 2012;82(2):172–183. 50. Park KM, Kramers C, Vayssier-Taussat M, Chen A,
23. Waanders F, et al. Effect of renin-angiotensin-aldo- 37. Sizing ID, et al. Epitope-dependent effect of anti- Bonventre JV. Prevention of kidney ischemia/reper-
sterone system inhibition, dietary sodium restric- murine TIM-1 monoclonal antibodies on T cell fusion-induced functional injury, MAPK and MAPK
tion, and/or diuretics on urinary kidney injury activity and lung immune responses. J Immunol. kinase activation, and inflammation by remote
molecule 1 excretion in nondiabetic proteinuric 2007;178(4):2249–2261. transient ureteral obstruction. J Biol Chem. 2002;
kidney disease: a post hoc analysis of a randomized 38. Fukushima A, et al. Antibodies to T-cell Ig and 277(3):2040–2049.
controlled trial. Am J Kidney Dis. 2009;53(1):16–25. mucin domain-containing proteins (Tim)-1 and -3 51. Sugimoto H, et al. Activin-like kinase 3 is important
24. van Timmeren MM, et al. High urinary excretion suppress the induction and progression of murine for kidney regeneration and reversal of fibrosis.
of kidney injury molecule-1 is an independent pre- allergic conjunctivitis. Biochem Biophys Res Commun. Nat Med. 2012;18(3):396–404.

The Journal of Clinical Investigation   http://www.jci.org   Volume 123   Number 9   September 2013 4035