EDUSTAR INTERNATIONAL SCHOOL

BIOLOGY
CHAPTER – 2 SEXUAL REPRODUCTION IN FLOWERING PLANTS
2 MARKS:
1. Name the organic materials of which exine nad intine of an angiosperm pollen grains are made up of.
Explain the role of exine.
2. Differentiate between the two cells enclosed in a mature male gametophyte of an angiosperm.
3. Name all the haploid cells present in an unfertilized mature embryo sac of a flowering plant. Write the total
number of cells in it.
OR
How many haploid cells are present in mature female gametophyte of a flowering plant? Name them.
4. Where is sporopollenin present in plants? State its significance with reference to its chemical nature.
5. In the TS of a mature anther given below, identify A and B and mention their functions.

6. (i) Draw a schematic diagram of TS of a mature anther. Label only the layers that help in dehiscnece of the
anther to release pollen grains.
(ii) Why is exine of the pollen grain not a continuous layer?

3 MARKS:
1. Why are angiosperm anthers called dithecous? Describe the structure of its microsporangium.
OR
Describe the structure of a mature microsporangium of an angiosperm.
2. Draw a labelled diagram of a typical anatropous ovule.
3. Draw a diagram of a male gametophyte of an angiosperm. Label any four parts. Why is sporopollenin
considered the most resistant organic material?
4. Given below is an enlarged view of one microsporangium of a mature anther

(i) Name A, B and C wall layers.

(ii) Mention the characteristics and function of the cells forming wall layer C.
5. Write briefly the role of pollination in the growth and development in an angiosperm.
6. Describe the structure of a typical/ polygonum type embryo sac found in flowering plants. Why is it called
monosporic?
7. Why is the process of fertilization in a flowering plant referred to as double fertilization?
8. What is the process of fertilization in flowering plan referred to as double fertilization?
9. The flower of Brinajal is referred to as chasmoganous while that of Bean is cleistogamous. How are they different
from each other.
10. Coconut Palm is monoecious while Date Palm is dioecious. Why are they called so?
11. Banana is a parthenocarpic fruit whereas oranges show polyembryony. How are they different from each other with
 respect to seeds?
12. Name the cell from which the endosperm of Coconut develops. Give the cahracteristic features of enedosperm of
coconut.
13. Draw a vertical section of a Maize grain and label.
(i) Pericarp (ii) scutellum (iii) coleoptile (iv) radicle
14. Fertilization is essential for production of seeds.
(i) Give one example of an angiosperm that produces seed without fertilization. Name the process.
(ii) Explain two ways by which seeds develop without fertilization.
15. Explain any two devices by which autogamy is prevented in flowering plants.
16. Mention the reasons for difference in ploidy of zygote and primary endosperm nucleus in an angiosperm.
17. How does the floral pattern of Mediterranean orchid, Ophrys, guarantee cross pollination?
18. Draw a longitudinal section of a post pollinated pistil to who entry of pollen tube into mature embryo sac. Label
filiform apparatus, chalazal end, hilum, antipodals, male gametes and secondary nucleus.
19. Where does triple fusion take place in a flowering plant. Why is it so called? Mention its significance.
20. If you squeeze a seed of orange, you might observe many embryos of different sizes. How is it possible? Explain.
21. (a) Mention any four strategies adopted by flowering plants to prevent self pollination.
(b) Why is geitogamy also referred to geneticalautogamy?
22. Explain giving two reasons why pollen grains can be best measured as fossils
23. How many haploid cells are present in a mature female gametophyte of a flowering plant. Name them.
24. Differentiate between albuminous and non-albuminous seeds, giving one example each.
25. Draw a diagram of a male gametophyte of an angiosperm. Label any four parts . Whyis sporollenin
considered the most resistant organic material ?
26. Differentiate between geitonogamy and xenogamy in plants. Which one between the two will lead to
inbreeding depression and why ?
27. Where is sporollenin present inplants ?state its significance with reference to its chemical nature
28. State one advantage and one disadvantage of cleistogamy
29. Explain the function each of 9a) Coleorhiza (b) Germ pores
30. How does the study of different parts of a flower help in identifying wind as its pollinating agent ?
31. Write the cellular contents carried by the pollen tube. How does the pollen tube gain entry into the
embryo sac ?
32. Name the product of fertilization that forms the kernel of coconut. How does the Kernel differ from
coconut water ?
33. (a) Mention the similarity between autogamy and geitonogamy.
(b) How does geitonogamy differ from xenogamy ?
34. Differentiate perisperm and endosperm giving one example of each .
35. How does pollen mother cell develop into a mature pollen grain ? Illustrate the stages with labelled
diagrams.
36. (a) Draw a labelled diagram of a mature embryo sac
(b) Why does a pollen grain possess two male gametes?
37. (a) Trace the development of embryo after synagmy in a dicot plant.
(b) Endosperm development precedes embryo development. Explain.
(c) Draw a diagram of a mature dicot embryo and label cotyledons, plumule, radical hypocotyl in it
38. Describe in sequence the events that lead to the development of a 3-celled pollen grain from microspore mother
cell in angiosperms.
39. (a) Draw a labelledlongisectional view of an alubumniousseed ?
(b) How are seeds advantageous to flowering plants ?
40. Explain double fertilization and trace the post fertilization events in sequential order leading to seed
formation in a typical dicotyledonous plant.
41. Give reasons why
(i) Most zygotes in angiosperms divide only after certain amount of endosperm is formed
(ii) Groundnut seeds are exalbuminous and Caster seeds are albuminous.
 (iii) Micropyle remains as a small pore in the seed coat of a seed.
(iv) Integuments of an ovule harden and the water content is highly reduced as the seed matures
(v) Apple and Cashew are not called true fruits.
42. (a) Draw a labelled diagram of L.S. on an embryo of grass (any six labels).
(b) Give reasons for each of the following
43. (a) Draw a diagram of an enlarged view of T.S. one microsporangium of an angiosperm and label the
following parts :
(i) Tapetum (ii) Middle layer (iii) Endothecium (iv) Microspore mother cells
(b) Mention the characteristic features and functions of tapetum.
(c) Explain the following giving reasons :
(i) Pollen grains are well preserved as fossils
(ii) Pollen tablets are in use by people these days
44. (i)Why is the process of fertilization in angiosperms termed as double fertilization. Explain.
(ii) Draw a diagram of an angiospermic embryo sac where fertilization is just completed. Label the
following (i) Micropylar and of embryo sac (ii) Part that develops into an embryo (iii) Part that develops
into an endosperm (iv) The degenerating cells at chalazal end.
(iii) Draw a labelled diagram of globular embryonic stage of an angiosperm.
45. (i) Explain the characteristic features of wind pollinated flowers. How are insect pollinated followers
different from them ?
(ii) Explain the mutually rewarding relationship between Yucca plant and species of moth.
46. How does the megaspore mother cell develop into 7-celled, 8 –nucleate embryo sac in an angiosperm ?
Draw labelled diagram of a mature embryo sac.
47. (a) Why is fertilization in an angiosperm referred to as double fertilization ? Mention the policy of the cells
involved.
(b) Draw a neat labelled sketch of L.S. of an endospermous monocot seed
48. (a)How does microspore mother cell develop into mature pollen grain inangiosperms ?
(b) Describe the structure of a mature pollen grain and draw a labelled diagram of its two celled stage
49. Why are beehives kept in a crop field during flowering period? Name any two crop fields where this is
practised.
50.Explain any three advantages that seeds offer to angiosperms.
51. (a) Why does endosperm development precede embryo development in angiosperm seeds?
State the role of endosperm in mature albuminous seeds
(b) Describe with the help of three labelled diagrams the different embryonic stages that include mature
embryo of dicot plants.

5 MARKS:
1. Draw a labelled diagram of sectional view of a mature embryo sac of an angiosperm.
2. (i) Describe the formation of mature female gametophyte within an ovule in angiosperms.
(ii) Describe the structure of cell that guides the pollen tube to enter the embryo sac.
3. How does the megaspore mother cell develop into 7 – celled and 8 – nucleate embryo sac in an
angiosperm? Draw a labelled diagram of a mature embryo sac.
OR
Explain with the help of diagram the development of mature embryo sac from a megaspore mother cell in
angiosperm.

4. (i) Draw a diagram of an enlarged view of TS of one microsporangium of an angiosperm and label the
following parts.
 Tapetum
  Middle layers
 Endothecium
 Microspore mother cell
(ii) Mention the characteristic features and function of tapetum
(iii) Explain the following giving reasons.
 Pollen grains are well preserved as fossils
 Pollen tablets are in use of people these days.
5. (i) Draw a labelled diagram of a mature embryo sac.
(ii) Why does a pollen grain possess two male gametes/ Explain.
6. Draw a labelled diagram of an anther lobe at microspore mother cell stage. Mention the roles of different
wall layers of anther.
7. How does the pollen mother cell develop into a mature pollen grain? Illustrate the stages with labelled
diagram.
8. Draw a labelled diagram of the sectional view of a mature pollen grain in angiosperm. Explain the
Functions of its two different parts.

CHAPTER – 3 HUMAN REPRODUCTION

1. Why does failure of testes to descend into scrotum produce sterility?
2. Sperms have a tail whereas eggs do not. Why so?
3. Mention the function of trophoblast in human embryo.
4. Name of embryonic stage that gets implanted in the uterine wall of a human female.
5. What stimulates pituitary to release the hormone responsible for parturition? Name the hormone.
6. List the changes the primary oocyte undergoes in the tertiary follicular stage in thehuman ovary.
7. Write the location and function of Sertoli cells in humans.
8. When do the oogenesis and spermatogenesis initiate in human females and males respectively?
9. Mention the difference between spermiogenesis and spermiation.
10. Where is acrosome present in humans? Write its functions.
11. Explain the function of umbilical cord.
12. How is the entry of only one sperm and not many ensured into an ovum during fertilization in humans?
13. Identify the given figure and the part labeled ‘A’
14. Mention the location and function of Leydig cells in humans.
15. Mention the function of mitochondria in sperm.
16. What is monospermy? How is polyspermy prevented in humans.
17. What is gynaecomastia ? What is its cause during neonatal period and during puberty?
18. What is pregnancy hormone? Why is it so called? Name two sources of the hormone in a human female.
19. Draw a labeled diagram of ovum and label its four parts.
20. Why is the human placenta referred to as haemochorial type? Explain.
21. Draw a labeled diagram of a sectional view of human ovary showing various stages of follicles growing in it.
22. Where are fimbriae present in a human female reproductive system? Give their function.
23. Name the muscular and glandular layers of human uterus. Which one of these layers undergoes cyclic
changes during menstrual cycle? Name the hormone essential for maintenance of this layer.
24. Where are Leydig cells present ? What is their role in reproduction?
25. Name the source of gonadotropins in human females. Explain the changes brought about in the ovary by
these hormones during menstrual cycle.
26. Placenta acts as an endorine tissue. Justify. (
27. Mention the fate of corpus luteum and its effects on the uterus in the absence of fertilization of the ovum
in the human female.
28. Spermatogenesis in human males is a hormone regulated process. Justify.
29. Draw a labeled diagram of the reproductive system in human female.
30. Name the hormones produced only during pregnancy in human female. Mention their source organ.
31. (a) Where do the signals for parturition originate in humans?
 (b) Why is it important to feed the new born babies on colostrum
32. (a) Oviducal fimbriae (b) Oxytocin (c) Middle piece in human sperm
(d) Seminal vesicle (e) Acrosome of human sperm
33. Give a schematic representation of of oogenesis in humans. Mention the number of chromosomes at each
stage. Correlate the life phases of the individual with the stages of the process
34. (a) Give a schematic representation of spermatogenesis in humans.
(b) At which stage of life does gametogenesis begin in human male and female respectively?
(c) Name the organs where gametogenesis gets completed in human male and female respectively.
35. (a) Draw a labeled diagram of a sectional view of human seminiferous tubule.
(b) Differentiate between gametogenesis in human males and females on the basis of (i) Time of initiation
of the process. Products formed at the end of the process.
36. Draw a diagrammatic sectional view of human ovary showing different stages of oogenesis alongwith
corpus luteum.
37. Where is morula formed in humans? Explain the process of its development from zygote.
38. (a) Draw a schematic diagram of human sperm and label the cellular components give the functions of any
three parts.
(b) Where are the sperm heads found embedded after spermatogenesis?
39. (a) When and how does placenta develop in human female?
(b) How is placenta connected to the embryo?
(c) Placenta acts as an endocrine gland. Explain.
40. When and where are primary oocytes formed in human female? Trace the development of these oocytes
till ovulation ( in menstrual cycle). How do gonadotropins influence this developmental process?
41. (a) Explain the events taking place at the time of fertilization of an ovum in a human female.
(b) Trace the development of zygote upto its implantation in the uterus.
(c) Name and draw a labeled sectional view of the embryonic stage that gets implanted.
42. (a) Give a schematic representation showing the events of spermatogenesis in human male.
(b) Describe the structure of a human sperm.
43. (a) Draw a diagrammatic labeled sectional view of a seminiferous tubule of a human
(b) Describe in sequence the process of spermatogenesis in humans.
44. Describe the post-zygotic events leading to implantation and placenta formation in humans. Mention any
two functions of placenta
45. Explain the process of fertilization in human female. Trace the post-fertilization events in sequential order
upto implantation of the embryo.
46. (a) Draw a labeled diagram of the human female reproductive system.
(b) Enumerate the events in the ovary of a human female during
(i) Follicular phase (ii) Lufeal phase of menstrual cycle.
47. (a) Write the specific location and functions of the following cells in human males.
(i) Leydig cells (ii)Sertoli cells (iii) Primary spermatocyle
(b) Explain the role of two accessory glands in human male reproductive system.
48. (a) When and where does spermatogenesis occur in a human male?
(b) Draw a diagram of a mature human male gamete. Label the following parts :
acrosome, nucleus, middle piece, tail.
(c) Mention the function of acrosome and middle piece.
49. The following is the illustration of sequence of ovarian events (a-i) in human female? DIAGRAM
(i) Identify the figure that illustrates ovulation and mention the stage of oogenesis it represents.
(ii) Name the ovarian hormone and pituitary hormone that has caused the above mentioned event.
(iii) Explain the changes that occur in the uterus simultaneously in anticipation.
(iv) Write the difference between ‘c’ and ‘h’.
(v) Draw a labeled sketch of human ovum prior to fertilization.
OR
(i) Identify the figure that illustrates corpus luteum and name the pituitary hormone that influences its
 formation.
(ii) Specify the endocrine function of corpus luteum. How does it influence uterus? Why is it essential?
(iii) What is difference between ‘d’ and ‘e’ ?
(iv) Draw a labeled sketch of Graafian follicle.
50. Study the illustration and answer the questions DIAGRAM:
(i) Identify ‘a’
(ii) Name and state the function of ‘c’
(iii) Identify ‘d’
(iv) Explain the role of hormones in the formation and release of ‘a’
(v) Draw a diagram of ‘b’ separately and label the parts : that helps its entry into ‘a’; that carries genetic
material ; that helps in its movements.
51. (a) How is 'oogenesis' markedly different from 'spermatogenesis' with respect to the growth till puberty in
the humans?
(b) Draw a sectional view of human ovary and label the different follicular stages, ovum and Corpus
luteum.
52.Name and explain the role of the inner and middle walls of the human uterus. 2014
53.Explain the ovarian and uterine events that occur during a menstrual cycle in a human female under the
influence of pituitary and ovarian hormones respectively. 2014
54 . Name and explain the role of inner and middle wall of human uterus?
Women are often blamed for producing female children. Consequently, they are ill- treated and
ostracized. How will you address the issue scientifically?
55. A) How is oogenesis markedly different from spermatogenesis with respect to growth till puberty?
B) Draw sectional view of human ovary. Label follicular stages, ovum, and corpus luteum.
56.Draw labeled diagram of sectional view of seminiferous tubule (label any six parts)
57. Explain ovarian and uterine events during menstrual cycle under the influence of pituitary and ovarian
hormones.
58. a) differentiate between: i)vas deferens and vas efferentia ii) Spermatogenesis and spermiogenesis
b) Draw labeled diagram of male reproductive system.
59. Where are fimbriae present in a human female reproductive system. Give their function.
60. Where are Leydig cells present? What is their role in reproduction?
61. Name and explain the role of inner and middle walls of human uterus.
62. Draw a labelled diagrammatic view of human male reproductive system.
63. Draw a labelled diagram of the reproductive system in human female.
64. Write the effect of high concentrations of LH on a mature Graafian follicle.
65. Differentiate between
i) Vas deferens and vasa efferentia ii) Spermatogenesis and spermiogenesis.
66. Draw and label the parts of the head region only of a human sperm.
67. Differentiate between menarche and menopause.
68. Differentiate between major structural changes in the human ovary during the follicular and luteal phase
of the menstrual cycle.
69. Mention tha fate of corpus luteum and its effect on the uterus in the absence of fertlisation of the ovum
in human female.
70. Study the sectional view of human testis showing seminiferous tubukes given below.
(i) Identify A, B and C. ii) Write the function of A and D.
71. How and at what stage of menstrual cycle is corpus luteum formed in human females? When does it regress?
72. Explain the role of sertoli cells in the development of sperms.
73. Mention the role of gonadotropins in menstrual cycle. On what day of the menstrual cycle do the
gonadotropins reach a peak?
74. Draw a labelled diagram of a human sperm.
75. Mention the sites of action of the ‘hormone GnRH and FSH during spermatogenesis in human males. Give one,
function of each of the hormones.
76. Draw a labelled diagram of the sectional view of a human seminiferous tubule (six parts to be labelled)

77. Draw a diagram of human sperm. Label only those parts along with their functions, that assist the sperm to
reach and gain entry into the female gamete.
78. Describe how the changing levels of FSH, LH and progesterone during menstrual cycle induce changes in the
ovary and the uterus in human female?
79. Spermatogenesis in human males is a hormone regulated process. Justify.
80. Mention the target cells of luteinizing hormone in human males and females. Explain the effect and the
changes which the hormone induces in each case.
81. Name the source of gonadotropins in human females. Explain the changes brought about in the ovary by these
hormones induces in each case.
82. (i) Draw a sectional view of human ovary. Label the following parts
a) primary follicle b) Ovum c) Graafian follicle d) Corpus luteum
(ii) Name the hormones influencing
a) Ovulation b) Development of corpus luteum.
OR
Draw a labelled diagram of a sectional view of human ovary showing various stages of follicles growing on it.
83. Explain the development of an ovum from an oogonium in a human female.
84. Study the figure given below
i) Pick out and name the cells that undergo spermiogenesis.
ii) Name A and B What is the difference between them with reference to the number of chromosomes?
iii) Pick out and name the motile cells.
iv) What is F cell? Mention its function.
v) Name the structure of which the diagram is a part.
85. (i) How is ‘Oogenesis’ markedly different from ‘Spermatogenesis’ with respect to the growth till puberty in the
humans?
(ii) Draw a sectional view of human ovary and label the different follicular stages, ovum and corpus luteum.
86. Explain the ovarian and uterine events that occur during a menstrual cycle ina human female under the
influence of pituitary and ovarian harmones, respectively.
87. Schematically represent and explain the events of spermatogenesis in humans.
88. Explain the different phases of menstrual cycle and correlate the phases with the different levels of pituitary
hormones in a human female.
89. (i) Draw a transverse section of a human ovary showing the sequential development of different follicles up to
the corpus luteum.
(ii) Comment on the corresponding ovarian and pituitary hormone levels during these events.
90. (i) Draw a diagrammatic sectional view of a human seminiferous tubule and label sertoli cells, primary
spermatocyte, spermatogonium and spermatozoa in it.
(ii) Explain the hormonal regulation of the process of spermatogenesis.
91. The following is the illustration of the sequence of ovarian events (A- I) in a humans female.
92. (i) Identify the figures that illustrates ovulation and mention the stage of oogenesis it represents.
(ii) Name the ovarian hormone and the pituitary hormone that have caused the above mentioned event.
(iii) Explain the changes that occur in the uterus simultaneously in anticipation.
(iv) Write the difference between C and H
(v) Draw a labelled sketch of the structure of a human ovum prior to fertilisation.
93. The following is the illustration of the sequence of ovarian events A to I in a human female.
 (i) Identify the figures that illustrates corpus luteum and name the pituitary hormone that influences its
formation.

(ii) Specify the endocrine function of corpus luteum. How does it influence the uterus? Why is it essential.
(iii) What is the difference between D and E?
(iv) Draw a neat labelled sketch of Graafian follicle.
94. (i) Describe the stages of oogenesis in human females
(ii) Draw a labelled diagram of a human ovum released after ovulation.
95. (i) When and where does spermatogenesis occur in human male?
(ii) Draw a diagram of a mature human male gamete. Label the following parts acrosome, nucleus, middle piece
and tail
(iii) Mention the function of acrosome and middle piece.
96. When and where are primary oocytes formed in a human female? Trace the development of these oocytes till
ovulation ( in menstrual cycle). How do gonadotropins influence this developmental process?
OR
Explain the different stages of oogenesis in human starting from foetal life till its completion. When and where
in the body is oogenesis completed?
97. (i) Give a schematic representation showing the events of spermatogenesis in human male,
(ii) Describe the structure of a human sperm.
98. (i) Draw a diagrammatic labelled sectional view of a seminiferous tubule of a human.
(ii) Describe in sequence the process of spermatogenesis in humans.
99. Study the following flow chart. Name the harmones involved at each stage. Explain their functions.
100. (i) Draw a schematic diagram of a human sperm and label the cellular components. Give the functions of any
three parts.
(ii) Where are the sperm heads found embedded to survive after spermatogenesis?
101. (i) Given below is the TS of human ovary. Identify the following in the diagram Corpus luteum, Secondary
oocyte Antrum, Primary follicle and Primary oocyte.

(ii) Explain the changes the primary oocyte undergoes, while in different follicular stages before ovulation.
102. Give a schematic representation of oogenesis in humans. Mention the number of chromosomes at each stage.
Correlate the life phases of the individual with the stages of the process.
103. (i) Give a schematic representation of spermatogenesis in humans.
(ii) At which stage of life does gametogenesis begin in human male and female, respectively?
(iii) Name the organs where gametogenesis gets completed in human male and female respectively.
104. (i) Draw a labelled diagram of a sectional view of human seminiferous tubule.
(ii) Differentiate between gametogenesis in human males and females on the basis of
a) Time of initiation of the process
b) Products formed at the end of the process
105. Draw a labelled sectional view of a human ovary. Explain the events of oogenesis.
106. Study the graph given below and answer the questions that follow:
 (i) Name the hormones X and Y.
(ii) Identify the ovarian phases during a menstrual cycle.
(a) 5th to 12th day of the cycle
(b) 14th day of the cycle
(c) 16th to 25th day of the cycle
(iii) Explain the ovarian events (a), (b) and (c) under the influence of hormones X and Y.
107. Where does fertilization occur in humans? Explain the events that occur during this process.
108. Explain the events that occur during fertilization of an ovum in humans. How is it that only one sperm enters
the Ovum?
109. (i) Where do the signals for parturition originate in humans?
(ii) Why is it important to feed the newborn babies on colostrum?
110. Name the hormones produced only during pregnancy in human female. Mention their source irgan.
111. Placenta acts as an endocrine tissue. Justify.
112. What is Colostrum? Why is it important to be given to the newborn infants?
113. (i) How is placenta formed in human female?
(ii) Name any two hormones which are secreted by it and are also present in a non – pregnant woman.
114. (i) Explain the events taking place at the time of fertlisation of an ovum in a human female.
(ii) Trace the development of the zygote up to its implanation in the uterus.
(iii) Name and draw a labelled sectional view of the embryonic stage that gets implanted.
115. Describe the post – Zygotic events leading to implanation and placenta formation in humans. Mention any two
functions of placenta.
OR
Explain the process of fertilization in human female and trace the post – fertilisation events in a sequential
order up to implanation of the embryo.
116. (i) Mention the event that induces the completion of the meiotic division of the secondary oocyte.
(ii) Trace the journey of the ovum from the ovary, its fertlisation and further development until the
implanation of the embryo.
117. (i) When and how does placenta develop in human female?
(ii) How is the placenta connected to the embryo?
(iii) Placenta acts as an endocrine gland, Explain.
118. Explain the steps in the formation of an ovum from an oogonium in humans.
OR
Suggest and explain any three Assisted Reproductive Technologies (ART) to an infertile couple.
119. Write the function of each one of the following
(i) Fimbriae (oviducal) (ii) Coleoptile (iii) Oxytocin
120. Write the function of each of the following
(i) Middle piece in human sperm
(ii) Tapetum in anthers
(iii) Luteinising hormone in human males.
121. Write the function of each of the following
(i) Seminal vesicle (ii) Scutellum (iii) Acrosome of human sperm
122. Give reasons for the following
(i) The humans testes are located outside the abdominal cavity
 (ii) Some organisms like honeybees are called parthenogenetic animals.
123. (i) When does oogeneiss begin?
(ii) Differentiate between the location and function of Sertoli cells and Leydig cells.
124. (i) Draw a labelled diagram of the human female reproductive system
(ii) Enumerate the events in the ovary of a human female during
a) Follicular phase b) Luteal phase of menstrual cycle
125. (i) Write the specific location and the functions of the following cells in human males
* Leydig cells * sertoli cells * Primary spermatocyte

(ii) Explain the role of any two accessory glands in human male reproductive system.
126. (i) Draw a diagrammatic sectional view of human ovary showing different stages of oogenesis along with
corpus leutum.
(ii) Where is morula formed in human? Explain the process of its development from Zygote.

CHAPTER – 4 REPRODUCTIVE HEALTH

1. Mention any two events that are inhibited by the intake of oral contraceptive pills to prevent pregnancy in
humans.
2. Why is tubectomy considered a contraceptive method?
3. A mother of one year old daughter wanted to space her second child. Her doctor suggested Cu-T. Explain its
contraceptive actions.
4. (a) Expand IUD
(b) Why is hormone releasing IUD considered a good contraceptive to space children?
5. Explain any two methods of Assisted Reproductive Technology (ART) that has helped childless couples to bear
children.
6. How does Cu T act as an effective contraceptive for human females?
7. Name the hormonal composition of oral contraception used by human females. Explain how does it act as
contraceptive?
8. Why do some women use “Saheli” pills?
9. How are assisted reproductive technologies helpful to humans? How are ZIFT and GIFT different
from intrauterine transfers ? Explain.
10. Name any two copper releasing intra-uterine devices (IUDs). List two reasons that make them
effective contraceptives.
11. How do copper and hormone releasing IUDs act as contraceptives ?Explain.
12. Explain the zygote intrafallopian transfer technique (ZIFT). How is intrauterine transfer technique (IUT) different
from it?
13. What is amniocentesis ? Why has the government imposed a statutory ban inspite of its importance in the
medical field?
14. Why is ‘Saheli’ a well accepted contraceptive pill?
15. Why is CuT considered a good contraceptive device to space children?
16. Name an oral pill used as a contraceptive by human females. Explain how does it prevent pregnancy?
17. At the time of independence, the population of India was 350 million which exploded to over 1 billion by May
2000. List any two reasons for this rise in population and any two steps taken by the government to check this
population explosion.
18. Explain how do the following act as contraceptives
(a)CuT (b)‘Saheli’
19.Women are often blamed for producing female children. Consequently, they are ill-treate and ostracised. How
will you address this issue scientifically if you were to conduct a awareness programme to highlight the values
involved?
20. Name an IUD that you would recommend to promote the cervix hostility to sperms.
21. State one reason why breast feeding the baby acts as a natural contraceptive for the mother?
22. Mention one positive and one negative application of aminocentesis.
23. Why is tubectomy considered a contraceptive method?
24. How does Cu – T act as an effective contraceptive for human females?
25. Why do some women use saheli pills?
26. Mention any two events that are inhibited by the intake of oral contraceptive pills to prevent pregency in
humans.
27. Give one reason for a statutory ban on amniocentesis.
28. What is amniocentesis? How is it misused?

29. What do oral pills contain and how do they act as effective contraceptives?
OR
Name the horinonal composition of the oral contraceptive used by human females. Explain how does it act as
contraceptive?
30. Why is Cu – T considered a good contraceptive device to space children?
OR
A mother of orie year old daughter wanted to space her second child. Her doctor suggested Cu- T. Explain its
contraceptive actions.
31. Name an oral pill used as a contraceptive by human females. Explain how does it prevent pregency?
32. Describe the lactational amenoohea method of birth control.
OR
What is lactational amenorrhea?
33. How do copper and hormone releasing IUDs act as contraceptives? Explain.
34. What is amniocentesis? Why has the government imposed a statutory ban inspite of its importance in medical
field? METHOD EXAMPLE
35. Why is A Diaphragm Saheli a well accepted contraceptive pill?
36. Name any Female sterilization B two copper – releasing Intra Uterine Devices
(IUDs). List two C Saheli reasons that make them effective
contraceptives.
D Cu - T
37. (i) Expand IUD.
(ii) Why is hormone releasing IUD considered a good contraceptive to space children?
38. How do surgical procedures prevent conception in human? Mention the way it is achieved in human males.
39. Identify A, B, C and D in the following table with reference to birth control.

40. If implementation of better techniques and new strategies are required to provide more efficient care and
assistance to people, then why is there a statutory ban on amniocentesis? Write the use of this technique and
give reason to justify the ban.
41. A woman has certain queries as listed below, before starting with contraceptive pills. Answer them.
(i) What do contraceptive pills contain and how do they act as contraceptives?
(ii) What schedule should be followed for taking these pills?
42. (i) Name any two copper releasing IUDs.
(ii) Explain how do they act as effective contraceptives in human females.
43. Name and Explain the surgical method advised to human males and females as a means of birth control.
Mention its one advantage and one disadvantage.
44. A pregenant human female was advised to undergo MTP. It was diagnosed by her doctor that the foetus, she is
carrying has developed from a zygote formed by an XX – egg fertilized by Y – carrying sperm. Why was she
advised to undergo MTP?
45. How do the following contraceptives act to prevent unwanted pregnancy in human females?
(i) Intra Uterine Devices (IUDs) (ii) Saheli
46. Intra – cytoplasmic sperm injection’ and ‘Gamete Intra Fallopian Transfer (GIFT)’ are two assisted reproductive
technologies. How is one different from the other?
47. Explain the Zygote Intra Fallopian Transfer Technique (ZIFT). How is Intra Uterine Transfer Technique (IUT)
different from it?
48. (i) Give any two reasons for infertility among young couple.
(ii) Test – tube baby programme is a boon to such couples. Explain the steps followed in the procedures.
49. A couple where both husband and wife are producing functional gametes, but the wife is still unable to
conceive, is seeking medical aid. Describe any one method that you can suggest to this couple to become happy
parents.
50. Explain any two methods of Assisted reproductive Technology(ART) that has helped childless couples to bear
children.
51. How are assisted reproductive technologies helpful to humans? How are ZIFT and GIFT different from intra
uterine transfers? Explain.

CHAPTER – 4 PRINCIPLES OF INHERITANCE AND VARIATION

1. Who developed Punnet Square?
2. Why do certain genes tend to be inherited together in a cell at the time of cell division?
3. What is sex chromosome complement of male bird..
4. Name one autosomal dominant and one autosomal recessive Mendeliandisorder in humans
5. Write the genotype of (i) An individual who is carrier of sickle-cell anaemia gene but apparently unaffected
(ii) An individual affected with the disease.
6. A human being suffering from Down’s syndrome show trisomy of 21st chromosome.Mention the cause of this
chromosomal abnormality.
7. Name the event during cell division cycle that results in gain or loss of chromosome.
8. Name the phenomenon and cell responsible for the development of new individual without fertilization as seen in
honey bees.
9. (a) A garden pea plant
(A) Produced inflated yellow pods and another plant.
(B) of the same species produced constricted green pods.
(b) A garden pea plant produced axial white flowers. Another of the same species produced terminal violet
flowers.
(c) A garden pea plant produced round green seeds. Another of the same species produced wrinkled yellow seeds.
10. Name the respective pattern of inheritance where F1phenotype
(a) Does not resemble either of the two parents and is in between the two
(b) Resembles only one of the two parents.
11. In a dihybrid cross, when would the proportion of the parental gene combinations be much higher than non-
parental type as experimentally shown by Morgan and his group
12. Why is that the father never passes on the gene for haemophilia to his sons? Explain.
13. Write the possible genotypes Mendel got when be crossed F1 tall pea plants with dwarf pea plants.
14. Why in a test cross, did Mendel cross a tall pea plant with a dwarf pea plant only.
15. Explain what do you know of criss-cross inheritance.
16. What is autopolyploidy ? How does colchicine induce polyploidy? Name an autopolyploid that has succeeded as a
variety.
17. At the time of independence, the population of India was 350 million which exploded to over 1 billion by May
2000. List any two reasons for this rise in population and any two steps taken by the government to check this
population explosion.
18. Explain how do the following act as contraciptives
(a) CuT (b) ‘Saheli’
19. The male Fruitfly and female Fowl are heterogametic while the female Fruitfly and the male Fowl are
 homogametic. Why are they called so?
20. Explain the pattern of inheritance of haemophilia in humans. Why is the possibility of a human female becoming
haemophilic extremely rare? Explain.
21. A plant of Antirrhinum majus with red flowers was crossed with another plant of the same species with white
flowers. The plants of F1 generation bore pink flowers. Explain the pattern of inheritance with the help of a cross.
22. A woman with blood group O married a man with AB group. Show the possible blood groups of the progeny. List
the alleles involved in this inheritance.
23. A tall Pea plant with yellow seeds (heterozygous for both) is crossed with a dwarf Pea plant with green seeds.
Using a Punnet square work out the cross to show the phenotypes and genotypes of F1 generation.
24. How does a test cross help in identifying the genotype of the organism? Explain.
25. During his studies on genes in Drosophila that were sex-linked T.H. Morgan found F2population phenotypic ratios
deviated from expected 9:3:3:1. Explain the conclusion he arrived at.
26. When a tall Pea plant was selfed, it produced one-fourth of its progeny as dwarf. Explain with the help of a cross.
27. Why are F2 phenotypic and genotypic ratios same in a cross between red flowered Snapdragon and white
flowered Snapdragon plants? Explain with the help of a cross.
28. (i) Why are Grass hopper and Drosophila said to show male heterogamety? Explain.
(ii) Explain female heterogematy with the help of an example.
29. Explain the sex determination mechanism in humans. How is it different in birds.
30. Explain the mechanism of sex determination in insects like Drosophila and Grasshopper.
31. Work out a cross between true breeding red and white flowered Dogflower (Snapdragon) plants up to F2progeny.
Explain the results of F1and F2 generations.
32. How are dominance, codominance and incomplete dominance patterns of inheritance different from one
another
33. (a) Sickle cell anaemia in humans is a result of point mutation. Explain.
(b) Write the genotypes of both the parents who have produced a sickle celled anaemic
offspring.
34. A Pea plant with purple flowers was crossed with plant having white flowers. The progeny produced only purple
flowers. On selfing, these plants produced 482 plants with purple flower and 162 plants with white flowers. What
genetic mechanisms accounts for these results ? Explain.
35. (a) Explain the phenomenon of multiple allelism and codominance taking ABO blood group as an example.
(b) What is the phenotype of (i) IAi (ii)ii?
36. Explain how does trisomy of 21st chromosome occur in humans. List any four characteristic features in an
individual suffering from it.
37. Given below is the representation of amino acid composition of the relevant translated portion of B chain of
haemoglobin, related to the shape of human red blood cells.
(a) Is this representation indicating a normal human or a sufferer from certain related genetic
disease? Give reason in support of your answer.
(b) What difference would be notice in the phenotype of the normal and the sufferer related to
this gene?
(c) Who are likely to suffer more from the defect related to the gene represented the males, the
females or both males and females equally? And why?
38. (a) Explain sex determination in humans.
(b) How do human males with XXY abnormality suffer?
39. Snapdragon shows incomplete dominance for flower colour. Work out a cross and explain the phenomenon. How
is this inheritance different from Mendelian pattern ofinheritance ? Explain.
40. Name the phenomenon that leads to situation like ‘XO’ abnormality in humans. How do humans with ‘XO’
abnormality suffer ? Explain.
41. A true breeding Pea plant homozygous for axial violet flowers is crossed with another Pea plant with terminal
white flowers (aavv).
(a) What would be the phenotype and genotype of F1 and F2 generation?
(b) Give the phenotypic ratio of F2 generation.
 (c) List the Mendal’sgeneralisations which can be derived from the above cross.
42. A homozygous tall Pea plant with green seeds is crossed with a drarf Pea plant with yellow seeds.
(i) What would be the phenotype and genotype of F1?
(ii) Work out the phenotypic ratio of F2 generation with the help of Punnet square.
43. A Anapdragon plant homozygous for red flowers when crossed with a white flowered plant of the same species
produced pink flowers in F1 generation.
(a) What is this phenotypic expression called?
(b) Work out the cross to show the F2 generation when F1 was self pollinated. Give the phenotypic and
genotypic ratios of F2 generation.
(c) How do you compare the F2 phenotypic and genotypic ratios with those of Mendelia monohybrid F2ratios.

44. Inheritance pattern of flower colour in Garden Pea and Snapdragon differs. Why is this difference observed?
Explain showing the crosses uptoF2 generation.
45. You are given a red flower bearing pea plant and a red flower bearing Snapdragon plant. How would you find the
genotypes of these two plants with respect to the colour of the flower. Explain with the help of crosses.
Comment upon the pattern of inheritance seen in these two plants. (Hint.Red Pea plant can be homozygous or
heterozygous. Red Snapdragon is homozygous).
46. A particular garden pea plant produces only violet (a) Is it homozygous dominant for the trait or heterozygous?
(b) How would you ensure its genotype? Explain with the help of crosses.
47 (a) How does chromosomal disorder differ from a mendelian disorder?
(b) Name any two chromosomal aberration associated disorders.
(c) List the characteristics of the disorders mentioned above that help in their diagnosis.
48. Explain the causes, inheritance pattern and symptoms of any two mendelian genetic disorders.
49. Write the symptoms of haemophilia and sickle-cell anaemia in humans. Explain how the inheritance patterns of
the two diseases differ from each other.
50. (a) State the law of independent assortment.
(b) Using Punnet square, demonstrate the law of independent assortment in a dihybrid cross involving two
heterozygous parents.
51. ABO blood grouping in human population exhibits four possible phenotypes from six different genotypes. Explain
different mechanisms of inheritance involved in exhibiting the possibility of four phenotypes and six genotypes.
52. (a) Why is haemophilia generally observed in human males? Explain the conditions under which a human female
can be haemophilic.
(b) A pregnant human female was advised to undergo MTP. It was diagnosed by her doctor that the foetus she
was carrying has developed from a zygote formed by an XX-egg fertilized by a Y- carrying sperm. Why was she
advised to undergo MTP?
53. (a) A true-breeching homozygous pea plant with green pods and axial flowers as dominant characters, is crossed
with recessive homozygous pea plant having yellow pods and terminal flowers. Work out the corssuptoF2
generation giving the phenotypic ratios of F1 and F2 generations respectively.
(b) State the Mendelian principle which can be derived from such a cross and not from monohybrid cross.
54. What is the inheritance pattern observed in the size of starch grains and seed shape in PisumSativum. Work out
the monohybrid cross showing the above traits. How does this pattern of inheritance deviate from that of
Mendelian law of dominance?
55. (a) List the three different allelic forms of gene ‘I’ in humans. Explain the different phenotypic expressions,
controlled by these three forms.
(b) A woman with blood group ‘A’ marries a man with blood group ‘O’. Discuss the possibilities of the inheritance
of the blood groups in the following starting with “Yes” or “No” for each.
(i) They produce children with blood group ‘A’ only.
(ii) They produce children some with ‘O’ boood group and some with ‘A’ blood group.
56. (a) A garden pea plant bearing terminal, violet flowers when crossed with another pea plant
bearing axial violet flowers, produced axial violet flowers and axial white flowers in the ratio
of 3:1. Work out the cross showing the genotypes of the parent pea plants and their progeny.
 (b) Name and state the law that can be derived from this cross and not from a dihybrid cross.
57. (a) Four children with four different blood groups are born to parents where the mother has blood group ‘A’ and
the father has blood group ‘B’. Work out the cross to show the genotypes of the parents and all four children.
(b) Explain the contribution of Alfred Sturtevant in chromosome mapping.
55.A colour-blind child is born to a normal couple. Work out a cross to show how it is possible. Mention the sex of
this child.
OR
Mendel published his work on inheritance of characters in 1865, but it remained unrecognised till 1900. Give
three reasons for the delay in accepting his work.

56. How does the gene 'I' control ABO blood groups in humans ? Write the effect the gene has on the structure of
red blood cells.
OR
Write the types of sex-determination mechanisms the following crosses show. Give an example of each type.
(i) Female XX with Male XO (ii) Female ZW with Male ZZ
57.A cross was carried out between two pea plants showing the contrasting traits of height the plants. The result of
the cross showed 50% parental characters.
(i) Work out the cross with the help of a Punnett square.
(ii) Name the type of the cross carried out. (C.B.S.E.2014)
58.A cross between a normal couple resulted in a son who was haemophilic and a normal daughter. In course of
time, when the daughter was married to a normal man, to their surprise, the grandson was also haemophilic.
(a) Represent this cross in the form of a pedigree chart. Give the genotypes of the daughter and her husband.
(b) Write the conclusion you draw of the inheritance pattern of this disease.
59. Women are often blamed for producing female children. Consequently, they are ill- treated and ostracised. How
will you address this issue scientifically if you were to conduct an awareness programme to highlight the values
involved?
60.A colour-blind child is born to a normal couple. Work out a cross to show how it is possible. Mention the sex of
this child.
OR
Mendel published his work on inheritance of characters in 1865, but it remained unrecognized till 1900. Give
three reasons for the delay in accepting his work.
61. How does the gene 'I' control ABO blood groups in humans? Write the effect the gene has on the structure of red
blood cells.
OR
Write the types of sex-determination mechanisms the following crosses show. Give an example of each type.
(i) Female XX with Male XO (ii) Female ZW with Male ZZ
62. What is the cross known as when the progeny of F1 and a homozygous recessive plant is crossed? State its
advantage.
63. What are the criteria for selecting organisms to perform crosses to study the inheritance of a few traits?
64. The following pedigree shows a particular trait which is absent in the parents but found in the subsequent
generation irrespective of the sexes. Analyze the pedigree and draw a conclusion.

65. Why did Mendel self – pollinate the tall F1 plants to get the F2 generation and crossed a pure breeding tall plant
 with a pure breeding dwarf plant to obtain the f1 generation?
66. How are the alleles of a gene different from each other? What is its importance?
67. How far are the genes and environment responsible for the expression of a particular trait?
68. What is the genetic basis of the wrinkled phenotype of pea seed?
69. Why does an individual have only two alleles even if a character shows multiple allelism?
70. How is a mutation induced by the mutagen? Explain with examples.
71. Differentiate between dominance, co – dominance and incomplete dominance.
72. Define the chromosomal theory of inheritance?
73. Define Linkage?
74. How is it possible for a child to have a blood group O if the parents have blood groups A and B?
75. Explain Down’s syndrome.
76. Why is it that women exceeding 40 years of age have more chances of having a child with Down’s syndrome?
77. How was it known that the genes are located on chromosomes?
78. A plant with yellow flowers was crossed with a plant with red flowers. The F1 progeny obtained had orange
flowers. What is the inheritance pattern?
79. Mention the characteristics of a true – breeding line.
80. Who had proposed the chromosomal theory of inheritance?
81. What is recombination? Mention its applications with reference to genetic engineering.
82. Why does sickle – cell anaemia persist in the human population when it is believed that the harmful alleles get
eliminated from the population after a certain time?
83. Define artificial selection. Has it affected the process of natural selection?
84. What are Sex chromosomes?
85. What are chromosomes and who discovered chromosomes?
86. What is aneuploidy? Differentiate between aneuploidy and polyploidy.
87. Describe the individuals with the following chromosomal abnormalities:
1. Trisomy at chromosome 21 2. XXY 3. XO
88. A colour – blind father has a daughter with normal vision. The daughter marries a man with normal vision. What
is the probability of her children to be colour blind? Explain with the help of a pedigree chart.
89. A tall plant with red flowers (dominant) is crossed with a dwarf plant with white flowers (recessive). Work out a
dihybrid cross and state the dihybrid ratio. What will be the effect on the dihybrid ratio if the two genes are
interacting with each other?
90. Why is Drosophilia used extensively for genetic studies?
91. List out the characteristics of the chromosomes theory of Inheritance.
92. Define autosome, hemizygous, and heterozygous?
93. What is Sex – linkage?
94. Why is colour blindness more prominent in males than females?
95. Why did scientists select fruit flies for his genetics experiments?
96. Give any two reasons for the selection of pea plants by Mendel for his experiments.
97. Name any one plant that shows the phenomenon of incomplete dominance during the inheritance of its flower
colour.
98. Name the base change and the amino acid change, responsible for sickle cell anaemia.
99. Name the disorder with the following chromosome complement.
i) 22 pairs of autosomes – X X Y ii) 22 pairs of autosomes – 21st chromosome + X Y
100. Identify the sex of organism as male or female in which the sex chromosome are found as
101. Mention two differences between Turner’s syndrome and klinefelter’s syndrome.
102. The human male never passes on the gene for haemophilia to his son. Why is it so?
103. Mention four reasons why Drosophilia was chosen by Morgan for his experiements in genetics.
104. Differentiate between point mutation and frameshift mutations.
105. Give any two similarities between behavior of genes (Mendel’s factor) during inheritance & chromosomes
during cell division.
106. Which law of Mendel is universally accepted? State the law?
107. How will you find out whether a given plant is homozygous or heterozygous?
108. Why do sons of haemophilic father suffer from this trait?
109. How is the child affected if it has grown the zygote formed by an XX – egg fertilized by Y – carrying sperm?
What do you call this abnormality?
110. The map distance in certain organism between genes A & B is 4 units, between B & C is units, & between C & D
is 8 units which one of these paves will show more recombination frequency? Give reason.
111. Give the chromosomal constitution & related sex in each of the following:
i) Turner syndrome ii) Klinefilter syndrome
112. What is pedigree Analysis? How is it useful?
113. What are multiple alleles? Give an example?
114. A woman with O blood group marries a man with AB blood group
(i) Work out all the possible phenotypes and genotypes of the progeny
(ii) Discuss the kind of dominance in the parents and the progeny in this case.
115. Explain the cause of Klinefelters syndrome. Give any four symptoms shown by sufferer of this syndrome.
116. In Mendels breeding experiment on garden pea, the offspring of F2 generation are obtained in the ratio of 25%
pure yellow pod, 50% hybrid green pods and 25% green pods state (i) Which pod colour is dominant (ii) The
Phenotypes of the individuals of F1 generation. (iii) Workout the cross.
117. In Antirrhinum majus a plant with red flowers was crossed with a plant with white flowers. Work out all the
possible genotypes & phenotypes of F1 & F2 generations comment on the pattern of inheritance in this case?
118. A red eyedmale fruitfly is crossed with white eyed female fruitfly. Workout the possible genotype & phenotype
of F1 & F2 generations. Comment on the pattern of inheritance in this case?
119. A man with AB blood group marries a woman with O group blood.

i) Workout all the possible phenotypes & genotypes of the progeny.

ii) Discuss the kind of domination in parents & progeny in this case?
120. In a cross made between a hybrid tall & red plant (TtRr) with dwarf &white flower(ttrr). What will be the
genetype of plants in F1 generation?
121. How sex is determined in human brings?
122. A smooth seeded & red – flowered pea plant (SsRr) is crossed with smooth seeded & white flowered pea plant
(Ssrr). Determine the phenotypic & genotypic ration in f1 progeny?
123. A dihybrid heterozygous round, yellow seeded garden pea (Pisum sativum) was crossed with a double recessive
plant.
(i) What type of cross is this?
(ii) Work out the genotype and phenotype of the progeny.
(iii) What principles of Mendel is illustrated through the result of this cross?
124. In dogs, barking trait is dominant over silent trait & erect ears are dominant over drooping ears. What is the
expected phenotypic ration of offspring when dogs heterozygous for both the traits are crossed?
125. Differentiate between dominance , co – dominance & Incomplete dominance with one example each.
126. A dihybrid heterozygous tall & yellow pea plant was crosse with double recessive plant.
(i) What type of cross is this?
(ii) Work out the genotype & phenotype of progeny.
(iii) What principle of Mendel is illustrated through result of thie cross?

CHAPTER-6
MOLECULAR BASIS OF INHERITANCE

1. Mention two functions of codon AUG.

2. Name the enzyme involved in the continuous replication of DNA strand. Mention the polarity of template strand.
3. Mention the role of the codons AUG and UGA during protein synthesis?
4. Mention the contribution of genetic maps in human genome project
5. The length of a DNA molecule in a typical mammalian cell is calculated to be approximately 2.2 meters. How is the
packaging of this long molecule done to accommodate it within the nucleus of the cell.
6. Explain the process of charging of tRNA. Why is it essential in translation?
7. (a) Draw the structure of the initiator tRNA adaptor molecule.
(b) Why is tRNA called an adaptor molecule?
8. Given below is part of the template strand of a structural gene: TAC CAT TAG GAT
(a) Write its transcribed mRNA strand with its polarity.
(b) Explain the mechanism involved in initiation of transcription of this strand.
9. How is the translation of mRNA terminated? Explain.
10. Draw a labeled schematic sketch of replication fork of DNA. Explain the role of the enzymes involved in DNA
replication.
11. Explain the dual function of AUG codon. give the sequence of bases it is transcribed from and its anticodon.
12. What are satellite DNAs in a genome? Explain their role in DNA finger printing.
13. (a) Draw a schematic representation of a transcription unit and show the following in it.
(i) Direction in which the transcription occurs (ii) Polarity of the two strands involved
(iii) Template strand (iv) Terminator
(b) Mention the function of promoter in transcription.
14. (a) In human genome which one of the chromosomes has the most genes and which one has the fewest?
(b) Scientists have identified about 1.4 million single nucleotide polymorphs in human genome. How is the
information of their existence going to help the scientists.
15. Name the category of codons UGA belongs to. Mention another codon of the same category. Explain their role in
protein synthesis.
16. Differentiate between a template strand and a coding strand of DNA.
17. Describe the initiation process of transcription in bacteria.
18. Describe the elongation process of transcription in bacteria.
19. Describe the termination process of transcription in bacteria.
20. Mention the role of ribosomes in peptide bond formation. How does ATP facilitate it?
21. In a series of experiments with Streptococcus and mice, F. Griffith concluded that R-strain bacteria had been
transformed. Explain.
22. Draw a schematic representation of a nucleotide. Label the following :
(i) The components of a nucleotide (ii) 5’ end
(iii) N-glycosidic linkage (iv) phosphodiester linkage
23. How do histones acquire positive change?
24. Base sequence in one of the strands of DNA is TAG CAT GAT.
(i) Give the base sequences of its complementary strand.
(ii) How are these base pairs held together in a DNA molecule?
(iii) Explain the base complementarity rule. Name the scientist who framed this rule.
25. Write the full form of VNTR. How is VNTR different from probe?
26. (i) Name the enzyme that catalyses the transcription of hn RNA
 (ii) Why does hn RNA need to undergo changes? List the changes hn RNA undergoes and where in the cell such
changes take place.
27. Unambiguous, universal and degenerate are some of the terms used for genetic code. Explain the salient features
of each one of them.
28. Answer the following questions based on Meselson and Stahl’s experiment.
(a) Write the name of the chemical substance used a source of nitrogen in the experiment by them.
(b) Why did the scientists synthesise the light and the heavy DNA molecules in the organism used in the
experiment.
(c) How did the scientists make it possible to distinguish the heavy DNA molecule from the light DNA
moledule? Explain.
(d) Write the conclusion the scientists arrived at after completing the experiment.
29. Draw a neat labeled sketch of replicating fork of DNA.
30. Draw a schematic diagram of a part of double stranded dinucleotide DNA chain having all the four nitrogenous
bases and showing the correct polarity.
33. Draw a schematic diagram of lac operon in its ‘switched off’ position. Label
(i) The Structural genes (ii) Repressor bound to its correct position
(iii) Promoter gene (iv) Regulator gene
34. It is established that RNA is the first genetic material. Explain giving three reasons.

35. (a) Name the enzyme responsible for transcription of tRNA and the amino acid to which initiator tRNA gets linked
with.
(b) Explain the role of initiator tRNA in initiation of protein synthesis.
36. (a) Construct a complete transcription unit with promoter and terminator on the basis of hypothetical template
strand given below : A T G C A T G C A T E
(b) Write the RNA strand transcribed from the above transcription unit along with its polarity.
37. How are structural genes activated / inactivated in lac operon in E. coli. Explain.
38. List the salient features of double helix structure of DNA.
39. State the functions of the following in a prokaryote:
(i) tRNA (ii) rRNA
40. Why is DNA considered a better hereditary material than RNA?
41. How is hnRNA processed to from mRNA?
42. How are the DNA fragments separated and isolated for DNA finger printing ?Explain.
43. State the conditions when genetic code is said to be
(i) Degenerate (ii) Unambiguous and specific (iii) Universal
44. Explain the process of translation / transcription in a bacterium.
45. Forensic department was given three blood samples. Write the steps of the procedure carried to get the DNA
fingerprinting done for the above samples.
46. (a) Draw a neat labeled diagram of a nucleosome.
(b) Mention what enables histones to acquire a positive charge.
47. What is semiconservative DNA replication? How was it experimentally proved and by whom?
48 . (a) Why is DNA more stable genetic material than RNA? Explain.
(b) Unambiguous degenerate and universal are some of the salient features of the genetic code. Explain.
49. Draw a labeled schematic structure of a transcription unit. Explain the function of each component of the unit in
the process of transcription.
50. (a) Who proposed the concept of lac operon?
(b) Draw a labeled schematic representation of a lac operon.
(c) Explain how does this operon get switched ‘on’ and ‘off’ (C.B.S.E. 2008)
51. Describe the experiment of Frederick Griffith on bacterium Streptococcus pneumonia. Mention the important
conclusion(s).
52. Who proposed that DNA replication is semiconservative? How did Meselson and Stahl prove it experimentally?
53 . (a) What did Meselson and Stahl observe when
(i) They cultured E.Coli in a medium containing 15NH4 CI for a few generations and centrifuged the contents?
(ii) They transferred one such bacterium to the normal medium of NH4 CI and cultured for two generations?
(b) What did Meselson and Stahl conclude from this experiment? Explain with the help of diagrams.
(c) Which is the first genetic material? Give reasons in support of your answer.
54. (a) How did Griffith explain the transformation of R-strain (non-virulent) bacteria into S-Strain (virulent)?
(b) Explain how did Avery, MacLeod and McCarty determine the biochemical nature of the molecule responsible
for transforming R-Strain bacteria into S-Strain bacteria.
55. How did Alfred Hershey and Martha Chase arrive at the conclusion that DNA is the genetic material?
56. Where do transcription and translation occur in bacteria and eukaryotes respectively?
Explain the complexities in transcription and translation in eukaryotes that are not seen in bacteria.
57. (i) Describe the role of RNA polymerases in transcription in bacteria and in eukaryotes.
(ii) Name the scientist who postulated the role of an “ adapter” in protein synthesis. Name the adapter molecule.
58. (i) DNA polymorphism is the basis of DNA finger printing technique. Explain.
(ii) Mention the causes of DNA polymorphism.
59. (a) State the arrangement of different genes that in bacteria is referred to as ‘ operon’
(b) Draw a schematic labeled illustration of lac operon in a ‘switched on’ state.
(c) Describe the role of lactose in lac operon.
60. (a) Explain the process of aminoacylation of tRNA. Mention its role in translation.
(b) How do ribosomes in the cells act as factories for protein synthesis?
(c) Describe ‘initiation’ and ‘termination’ phases of protein synthesis.
61. (a) Write the scientific name of the bacterium used by Fredrick Griffith in his experiment.
(b) How did he prove that some ‘transforming principle’ is responsible for transformation of non-virulent strains
of bacteria into the virulent form?
(c) (i) State the biochemical nature of ‘transforming principle.
(ii) Name the scientists who proved it.
62. The average length of a DNA double helix in a typical mammalian cell is approximately 2.2 m and the dimension
of a nucleus is about 10- 6 m.
(a) How is it possible that long DNA polymers are packed with in a very small nucleus?
(b) Differentiate between euchromatin and heterochromatin.
(c) Mention the role of non-histone chromosomal protein.
63. State the aim and describe Meselson and Stahl’s experiment.
64. Name the scientists who proved experimentally that DNA is the genetic material. Describe their experiment.
65. Describe Frederick Griffith’s experiment on Streptococcus pneumomiae. Discuss the conclusion he arrived at.
66. (a) Describe the process of synthesis of fully functional mRNA in a eukaryotic cell.
(b) How is this process of mRNA synthesis different from that in prokaryotes
67. Describe Hershey Chase experiment. Write the conclusion they arrived at after the experiment.
68. Answer the following questions based on Meselson and Stahl’s Experiment.
(a) Why did the scientists use 15NH4CI and 14NH4CI as sources of nitrogen in the culture medium for growing
E.Coli.?
(b) Name the molecule(s) that 15N got incorporated into.
(c) How did they distinguish between 15N labeled molecules from 14N ones?
(d) Mention the significance of taking E.coli samples at definite intervals for observations.
(e) Write the observations made by them from the samples taken at the end of 20 minutes and 40 minutes
respectively.
(f) Write the conclusion drawn by them at the end of their experiment.
69.(a) Explain the process of DNA replication with the help of a schematic diagram.
(b) In which phase of the cell cycle does replication occur in Eukaryotes? What would happen if cell-division is not
followed after DNA replication.
70. (i) Name the scientist who suggested that the genetic code should be made of a combination of three
nucleotides.
 (ii) Explain the basis on which he arrived at this conclusion.
71 .(a) Explain the process of DNA replication with the help of a schematic diagram.
(b) In which phase of the cell cycle does replication occur in Eukaryotes? What would happen if cell-division is not
followed after DNA replication.
72 .(i) Name the scientist who suggested that the genetic code should be made of a combination of three
nucleotides.
(ii) Explain the basis on which he arrived at this conclusion.
73. What will happen if DNA replication is not followed by cell division in a eukaryotic cell?
74. Name the specific components and the linkage between them that form deoxyadenosine.
75. Which one out of rho factor and sigma factor act as an initiation factor during transcription in a prokaryote?
76. Name the enzyme involved in continuous replication of DNA strand. Mention the polarity of the template strand.
77. Name the positively charged protein around which the negatively charged DNA wrapped.
78. A structural gene has two DNA strands X and Y shown below. Identify the template strand.

79. Why is hnRNA required to undergo spicing?

80. Mention the two additional processes, which hnRNA needs to undrgo after splicing so,as to become functional.
81. When and at what end does the tailing of hnRNA takes place?
82. At which ends do acpping and tailing of hnRNA occcur respectively?
83. How is the length of DNA usually calculated?
84. Name the parts A and B of the transcription unvit given below.

85. Name the components A and B in the nucleotide with a purine, given below.

86. Name the type of synthesis A and B occuring in the replication fork of DNA as shown below.

87. Explain the two factors responsible for conferring stability to double helix structure of DNA.
88. State the difference between the structural genes in a transcription unit of prokaryotets and eukaryotes.
89. Show DNA replication with the help of a diagram only.
90. A template strand is given below. Write down the corresponding coding strand and the m – RNA strand that can
be formed, along with their polarity. 3’ ATGCATGCATGCATGCATGCATGC 5’.
91. Draw a labelled diagram of a nucleosome. Whre is it found in a Cell?
OR
How do histones acquire positive charge?
92. Draw a schematic diagram of a part of double stranded dinucleotide DNA chain having alll the four nitrogenous
bases showing the correct polarity.
93. State the dual role of deoxyrinucleoside triphosphates during DNA replication.
94. Answer the questions based on the dinucleotide shown below.

i) Name the type of sugar guanine base is attached to.

ii) Name the linkage connecting the two nucleotides.
iii) Identify the 3’ end of the dinucleotide. Give a reason for your answer.
95. Make a labelled diagram of an RNA dinucleotide showing its 3’ -> 5’ polarity.
96. Differntiate between a template strand and a coding strand of DNA.
97. Give one function each of histone protein and non – histone chromosomal protein in an eukaryotic nucleus.
98. What does central dogma state in molecular biology? How does it differ in some viruses?
99. Compare the roles of the enzymes DNA polymerase and DNA ligase in the replication fork of DNA.
100. With the help of a schematic diagram, explain the location and role of the following in a transcription unit.
Promoter structural gene, terminator.
101. (i) What are the transcriptional products of RNA polymerase III?
(ii) Differentiate between ‘capping’ and ‘tailing’.
(iii) Expand ZmRNA.
102. It is established that RNA is the first genetic material. Explain giving three reasons.
103. (i) Construct a complete transcription unit with promoter and terminatoron the basis of hypothetical template
strand given below.

(ii) Write the RNA strand transcribed from the above transcription unit along with its polarity.
104. List the salient features of double helix structure of DNA.
105. How is hit RNA processed to form mRNA?
106. Why is DNA considered a better hereditary material than RNA?
107. The base sequence in one of the strands of DNA is TAGCATGAT.
(i) Give the base sequence of the complementary strand.
(ii) How are these pairs held together in a DNA molecule?
(iii) Explain the base complemetarity rule. Name the scientist who framed this rule.
108. Why do you see two different types of repliacting strands in the given DNA replication fork? Explain. Name
these strands,

109. (i) Name the enzyme that catalyses the transcription of hnRNA.
(ii) Why does the hnRNA needs to undergo changes? List the changes hnRNA undergoes ¿1 where in the cell
Such changes take place.
110. Answer the following questions based on Meselson and Stahi’s experiment.
(i) Write the name of the chemical substance used as a source of nitrogen in the experiment by them.
(ii) Why did the scientists synthesise the light and the heavy DNA molecules in the organism used in the
experiment?
 (iii) How did the scientists make it possible to distinguish the heavy DNA molecule from the light DNA
molecule? Explain.
(iv) Write the conclusion the scientists arrived at,after completing the experiment.
111. Describe the initiation process of transcription in bacteria.
112. Describe the elongation process of transcription in bacteria.
113. Describe the termination process of transcription in bacteria.
114. In a series of experiments with Streptococcus and mice, F Griffith concluded that R – Strain bacteria had been
transformed. Explain.
115. Draw a schematic representation of a dinucleotide. Label the following
(i) The component of a nucleotide (ii) 5’ end (iii) N – glycosidic linkage (iv) Phosphodiester linkage
116. (i) Draw a schematic representation of transcription unit showing the polarity of both the strands. Label the
promoter gene and the template strand.
(ii) Mention the condition when template strand becomes coding strand.
(iii) Give the function of the promoter gene.
117. (i) Why does DNA replication occur in small replication fork and not in its entire length?
(ii) Why is DNA replication continuous and discontinuous in a replication fork?
(iii) Explain the importance of origin of replication in a replication fork.
118. The length of a DNA molecule in a typical mammalian cell is calculated to be approximately 2.2 m. How is the
packaging of this long molecule done to accommodate it within the nucleus of the cell?
119. ‘DNA replication is semiconservative’. Name the scientists who proposed it and who proved it. How was it
proved experimentally?
OR

Who proposed that DNA repluication is semiconservative? How did Meselson and Stahl prove it.
OR
Describe Meselson and Stahl’s exepriment and write the conclusion they arrived at.
120. (i) Describe the various steps of Griffifth’s experiment that led to the ocnclusion of the ‘transforming principle’.
(ii) How did the chemical nature of the ‘transforming principle’ get established?
OR
(i) Write the conclusion drawn by Griffith at the end of his experiment with Streptococcus pneumoniae.
(ii) How did O Avery, C, MacLeod and M Mc Carty prove that DNA was the genetic material? Explain.
OR
Describe Frederick Griffith’s experiment on Streptococcus pneumoniae. Discuss the conclusion he arrived at.
OR
(i) Write the scientific name of the bacterium used by Frederick Griffith in his experiment.
(ii) How dis he prove that some transforming principle is responsible for transformation of the non – virulent
strains of bacteris into the virulent form?
(iii) State the biochemical nature of the transforming principle.
(iv) Name the scientists who proved it.
121. Describe the Hershey and Chase’s experiment. Write the conclusion drawn by the scientists after their
experiment.
OR
Name the scientists, who proved experimentally that DNA is the genetic material. Describe their experiment.
OR
i) Desribe the Hershey and Chase’s exepriment.
ii) Write the aim of the experiment.
122. (i) Explain the process of DNA replication with the help of a schematic diagram.
(ii) In which phase of the cell cycle does replication occur in eukaryotes? What would happen if cell division is
not followed after DNA replication.
123. Name the major types of RNAs and explain their role in the process ofprotein synthesis in a prokaryote.
 124. Describe the process of transcription in bacterium.
125. (i) Explain the role of DNA dependent RNA polymerase in initiation, elongation and termination during
transcription in bacterial cell.
(ii) How is transcription a more complex process in eukaryotic cells? Explain.
126.(i) What did Meselson and Stahl observed? When
a) They cultured coli in a medium containing 15 NH Cl for a few generations and centrifuged the
4

content?
b) They transferred one such bacterium to the normal medium of NH 4 Cl and cultured for two
generations.
(ii) What did Meselson and Stahl conclude from his experiment? Explain with the help of diagrams.
(iii) Which is the first genetic material? Give reasons in support of your answer.
127. Why is DNA molecule more stable gentic material than RNA? Explain.
128. Dra w the labelled schmatic structure of a transcription unit. Explain the function of each component of the unit
in the process of transcription.
129. (i) State the central dogma in molecular biology. Who proposed it? Is it universally applicable? Explain.
(ii) List any four properties of a molecule to be able to act as a genetic material.
130. Diagrammatically represent a portion of the double stranded polynucleotide chain sequence in a DNA molecule
involving all the four nitrogenous bases.
131. How is repetitive / satellite DNA separated from bulk genomic DNA for various genetic experiments.
132. Mention the role of the codons AUG and UGA during protein synthesis.
133. Mention the contribution of genetic maps in human genome project.
134. Mention the two ways in which Single Nucleotide Polymorphisms (SNPs) identified in human genome, can bring
out revolutionary changes in biological and medical sciences?
135. State which human chromosome has
(i) the maximum number of genes and (ii) the one which has the least number of genes
136. Given below is a schematic representation of a lac operon in the absence of an inducer. Identify ‘A’ and ‘B’ in it.

137. Write the full form of VNTR different from probe?

138. Mention the role of ribosome in peptide bond formation. How does ATP facilitate it?
139. How is the translation of mRNA terminated? Explain.
140. Study the figure and answer the questions.

i) How does the repressor molecule get inactivated?

ii) When does the transcription of lac mRNA stop?
iii) Name the enzyme transcribed by the gene ?
141. (i) Name the molecule X synthesised by i gene. How does this molecule get inactivated.
 (ii) Which one of the structural genes codes for beeta galactosidase?
(iii) When will the transcription of this gene stop?
142. Nam the category of codons UGA belongs to. Mention another codon of the same category. Explain their role in
protein synthesis.
143. (i) Differentiate between unambiguous and degenerate codons.
(ii) Write two functions of the codon AUG.
144. Genetic code is specific and nearly Universal. Justify.
145. (i) Which human chromosomes has
* maximum number of genes and
* Which one has fewest genes?
(ii) Write the specific importance of single nuclleotide plymorphism identified in human genome.
146. (i) Name the scientist who postulated the presence of an adapter molecule that can asssit in protein synthesis.
(ii) Describe its structure with the help of a diagram. Mention its role in protein synthesis.
147. Following a severe accident, many charred – disfigured bodies are recovered from the site making the
identification of the dead very difficult. Name and explain the technique that would help the authorities to
establish the identity of the dead to be able to handover the dead to their respective relatives.
148. In a maternity clinic ,for some reasons the authorities are not able to hand over the two newborns to their
respective real parents. Name the describe the technique that you would suggest to sort out the matter.

149. (i) Explain DNA plymorphism as the basis of genetic mapping of human genome.
(ii) State the role of VNTR in DNA fingerprinting.
150. Give below are the sequence of nucleosidwe in a particular mRNA and amino acids coded by it UUUAUGUU
CGAGUUAGUGUAA Phe – Met –Phe –Glu – Leu – Val
Write the properties of genetic codes that can be and that cannot be correlated from the above given data.
151. How are the structural genes activated in lac operon in coli?
152. State the conditions when genetic code is said to be
(i) Degenerate ii) Unambiguous and specific iii) Universal
OR
Unambiguous, universal and degenerate are some of the terms used for the genetic code. Explain the salient
features of each of them.
153. (i) Name the scientist who called tRNA an adapter molecule.
(ii) Draw a clover leaf structure of fRNA showing the following:
a) Tyrosine attached to its amino acid site.
b) Anticodon for this amino acid in its correct site.
(iii) What does the actual structure of tRNA look like?
154. Explain the role of regulatory geen in a lac operon Why is regulation of lac operon caleed negative regulation?
155. A considerable amount of lactose is added to the growth medium of coli. How is is the lac operon switched on in
the bacteria? Mention the state of the Operon when lactose is digested.
156. (i) How many codons code for amino acids and how many do not?
(ii) Explain the following giving one example of each.
 Unambiguous and Specific codon
 Degeneration codon
  Universal codon
 Initiator codon
157. (i) Why is fRNA called an adapter?
(ii) Draw and label a secondary structure of fRNA. How does the actual structure of fRNA look like?
158. (i) Identify the polarity from a to d, in the diagram below and mention how many more amino acids are
expected to bea dded to this polypeptide chain.

(ii) Mention the DNA sequence coding for Serine and the anticodon of fRNA for the some amino acid.
(iii) Why are some untranslated sequence of bases seen in mRNA coding for a polypeptide? Where exactly are
they present on mRNA?
159. One of the codons on mRNA is AUG. Draw the structure of fRNA adapter molecule for this codon. Explain the
uniqueness of this fRNA.
160. Study the mRNA segement given below which is complete to eb translated into a polypeptide chain.

i) Write the codons A nad

ii) What do they code for?
iii) How is peptide bond formed between two amino acids in the ribosome?

161. (i) State the arrangement of different geenes that in bacteria is referred to as operon.
(ii) Draw a schematic labelled illustration of lac operon in a switched on state.
(iii) Describe the role of lactose in the lac operon.
162. Describe how the lac operon operates, both in the presence and the absence of an inducer in coli.
163. Explain the process of translation.
164. (i) What is a genetic code?
(ii) Explain the following Degenerate code, Unambiguous code. Universal code, Initiator code.
165. (i) Write the specific features of the genetic code AUG.
(ii) Genetic codes can be universal and degenerate. Write about them, giving one example of each.
(iii) Explain aminoacylation of the tRNA.
166. DNA polymorphism is the basis of DNA fingerprinting technique. Explain.
Mention the causes of DNA polymorphism.
167. Name and describe the technique that will help in solving a case of paternity dispute over the custody of a child
by two different families.
OR
Two blood samples A and B picked up from the crime secene were handed over to the forensic department for
gentic fingerprinting. Describe how the technique of gentic fingerprinting is carried out. How it will be confirmed
whether the samples belonged to the same individual or to two different individuals?
OR
Explain the steps of DNA fingerprinting that will help in processing of the two blood samples ‘A’ and ‘B’ picked up
from the crime scene.
168. (i) Name the enzyme responsible for transcription of tRNA and the amino acid, the initiator tRNA gets linked
With
 (ii) Explain the role of initiator tRNA in initiation of protein synthesis.
169. Given below is a part of the template strand of a structural gene.
TACCATTAGGAT
(i) Write its transcribed mRNA with its polarity.
(ii) Explain the mechanism involved in initiation of transcription of thus strand.
170. Describe the role of RNA polymerases in transcription in bacteria and in eukaryotes.
171. (i) Name the enzyme responsible for the transcription of tRNA and the amino acid, the tRNA gets linked with.
(ii) Explain the role of initiator tRNA in intiation of protein synthesis.
172. Where do traanscription and translation occur in bacteria and eukaryotes respectively? Explain the complexities
in transcription and translation in eukaryotes that are not seen in bacteria?

CHAPTER - 7
EVOLUTION
1. Name any two vertebrate body parts that are homologous to human fore-limbs.
2. Mention the key concepts about mechanisms of biological evolution / speciation according to
(i) De Vriesand (ii) Darwin
3. Mention the type of evolution that has brought the similarity as seen in Potato tuber and Sweet Potato.
4. Why are the wings of a butterfly and of a bat called analogous..
5. Are the thorn of Bougainvillea and tendril of Cucurbita homologous or analogous? What type of evolution has
brought such a similarity in them?
6. According to Hardy-Weinberg principle the allele frequency of a population remains constant (p2 + 2pq + q2 = 1).
How do you interpret the change of frequency of alleles in a population?
7. Are the wings of a bird and the fore-limb of a horse homologous or analogous or analogous? Name the type of
evolution and explain the development of such structures.
8. Are flippers of penguin and dolphin homologous or analogous? What type of evolution has brought such a similarity
in them?
9. Where did Homo sapiens arise initially?
10. Name the scientist who disproved spontaneous generation theory.
11. When does a species becomes founders to cause founder effect?
12. Name the common ancestor of great apes and man.
13. Mention how is mutation theory of Hugo de Vries different from Darwin’s theory of natural selection.
14. Write the similarity between the wing of a butterfly/cockroach and the wing of a bat. What do you infer from the
above with reference to evolution.
15. State the significance of the study of fossils in evolution.
16. State the significance of biochemical similarities amongst diverse organisms in evolution.
17. State the significance of coelacanth in evalution.
18. Comment on the similarity between the flippers of dolphins and penguins with reference to evalution.
19. Write two examples of developmental evidence for evolution from plant kingdom.
20. What is chemosynthesis? Name a chemosynthetic organism.
21. How is a sickle cell carrier at an advantage over the rest of human population in a malaria ridden area?.
22. What is allopolyploidy? Name an allopolyploid that has succeeded as a crop. How does colchicine induce
polyploidy?
23. What is divergent evolution? Explain taking an example of plans.
24. How does Darwin’s finches illustrate adaptive radiation?
25. How does Darwin’s theory of natural selection explain the appearance of new forms of life on earth?
26. How is Darwin’s concept of evolution different from that of de Vries?
27. What is selection? How Artificial selection is different from natural selection?
28. Darwin observed a variety of beaks in small black birds inhabiting Galapogos islands.Explain what conclusions
did he draw and how?
29. How is mutation explained by Hugo de Vries as different from Darwinian variations?
30. Discovery of lobed fins is considered very significant by evolutionary biologists. Explain.
31. (a) What is adaptive radiation?
(b) Explain with the help of suitable example where adaptive radiation has occurred to represent convergent
evolution.
32.Explain convergent and divergent evolution with the help of example of each.
33. a) How does Hardy Weinberg expression (P2 + 2pq + q2 = 1) explain that genetic equilibrium maintained in a
population?
b) List any two factors that can disturb the genetic equilibrium.
34. Why are the wings of butterfly and bird said to be alalogous organs? Name the type of evolution analogous
organs are a result of.
35. Antropogenic action can hasten the evolution. Explain with the help of a suitable example.
36. Explain adaptive ratiations and convergent evolution by taking example of some of Australian marsup and
placental mammals.
37. In England during the post industrialised period, the count of melanic moths increased in urban area but remained
low in rural areas. Explain.
38. State the theory of biogenesis. How does Miller’s experiment support this theory?
39. How does industrial melanism support Darwin’s theory of Natural Selection? Explain.
40. a) Anthropogenic actions have caused evolution of species. Explain with the help of two examples.
b) Differentiate between divergent and convergent evolution.
41. Explain Oparin and Haldane theory of origin of life.
42. What is convergent and divergent evolution? Explain with the help of example.
43. a) Explain taking one example of vertebrate anatomy that evolution of life forms has occurred on earth.
b) “Nature selects for fitness” Explain with suitable example.
44. Fitness is the end result of the ability to adapt and get selected by nature. Explain with suitable example.
45. a) Natural Selection operates when nature selects for fitness. Explain.
b) The rate of appearance of new forms is linked to the life span of an organism. Explain with the help of a
suitable example
46. Explain the salient features of Hugo de Vries-theory of mutation. How is Darwins. Explain the salient features of
Hugo de Vries-theory of mutation. How is Darwins?
47. a) Name the primates that lived about 15 million years ago. List their characteristic features.

b) i) Where was the first man-like animal found.

ii) Write the order in which Neanderthals. Homo habilas and Homo erectus appeared on earth. State the brain
capacity of each one of them.
c) When did modern Homo Sapiens appear on this planert?
48. a) Explain Darwinian theory of evolution with the help of one suitable example. State the two key concept of the
theory.
b) Mention any three characteristics of Neanderthal man that lived in near east and central Asia.
49. a) Explain Darwinian theory of evolution with the help of one suitable example. State the two key concept of the
theory.
b) Mention any three characteristics of Neanderthal man that lived in near east and central Asia.
50. Why are analogous structures a result of convergent evolution?
51. Name the type of evolution that, has resulted in the development of structures like wings of butterfly and bird.
What are such’ structures called?
52. State the significance of the study of fossils in evolution.
53. State the significxance of biochemical similarities among diverse organisms in evolution.
54. Write the similarity between the wing of a butterfly and the wing of a bat. What do you infer from the above, with
reference to evolution?
OR
Comment on the similarity between the wings of a cockroach and the wings of a bird. What do you infer from the
above, with reference to evolution?
 OR
Comment on the similarity between the flippers of dolphin and penguins, with reference to evolution.
55. Name the scientist who disproved spontaneous generation theory.
56. Why are wings of butterfly and wings of bat called analogous?
57. Mention the type of evolution that has brought the similarity as seen in potato tuber and sweet potato.
58. Name any two vertebrate body parts that are homologous to human forelimbs.
59. Name the placental mammals corresponding to the Australian spotted Cuscus and Tasmanian tiger cat, which have
evolved as a result of convergent evolution.
60. Identify the following pairs as homologous of analogous organs:
i) Sweet potato and potato ii) Eye of Octapus and eye of mammals
iii) Thoms of Bougainvillea and ‘tendrils of cucurbits iv) Forelimbs of bat and whale.
61. What was proposed by Oparin and Haldane on origin of ife? How did SL Miller’s experiment support their
proposal?
62. List the two main propositions of Oparin and Haldane.
63. Write the Oparin and Haldane’s hypothesis about the origin of life on earth. How does meteorite analysis favour
this hypothesis?
64. Write about the ancestry and evolution of bat, horse and human on the basis of a comparative study of their
forelimbs. What are these limbs categorised as?
65. Divergent evolution leads to homologous structures. Explain with the help of an example.
66. Convergent evolution leads to analogous structures. Explain with the help of an example.
67. Mention the contribution of SL Miller’s experiments to origin of life.
68. Why are wings of butterfly and birds said to be analogous organs? Name the type of evolution the analogous
organs are a result of.
69. What is adaptive radiation? How did Darwin explained this process of evolution.
70. (i)Explain adaptive radiation with the help of suitable example.
(ii) Cite an example where more than one adaptive radiations have occurred in an isolated geographical area.
Name the type of evolution your example depicts and state why it is so named?
71. Given below is a diagrammatic representation of the experimental set –up used by SL Miller for his experiment.

i) Write the names of different gases contained and the conditions set for the reaction in the flask A.
ii) State the type of organic molecule he collected in the water at B.
iii) Write the conclusion hea rrived at.
72. State the theory of biogenesis. How does Miller’s experiment support this theory?
OR
State the views of Oparin and Haldane on evolution. How does SL Miller’s experiment support their views?
73. Convergent evolution and divergent evolution are the two concepts explaining organic evolution. Explain each one
With the help of a example.
74. Explain adaptive radiation and convergent evolution by taking example of some of Australian marsupials and
 Australian placental mammals.
OR
Australian marsupials and placental mammals are suitable examples of adaptive radiation and convergent
evolution. Explain giving reasons.
OR
i) What is adaptive radiation?
ii) Explain with the help of a suitable example, where adaptive radiation has occurred to represent convergent
evolution.
75. Anthropogenic action hasten evolution. Explain with the help of suitable example.
76. (i) Mention the specific geographical region, where these organisms are found.
(ii) Name the explain the phenomenon that has resulted in the evolution of such diverse species in the region.
(iii) Explain giving reasons the existence of placental wolf and Tasmanian wolf sharing the same habitat.

77. (i) Write your observations on the variations seen in the Darwin’s finches shown below.
(ii) How did Darwin explain the existence of different varieties of finches on Galapagos islands?
OR

Darwin observed a variety of beaks in small black birds inhabiting Galapagos islands. Explain what conclusion did he
draw and how?

78. The study of

(i) fossils of dinosaurs.
(ii) forelimbs of cheetah, bat, whale and human
(iii) thorns of Bougainvillea and tendril of Cucurbita
Show that evolution of life forms has indeed taken place on earth.
79. Explain how natural selection operates in nature by taking an example of white winged and dark winged moths of
England?
80. Rearrange the following in increasing order of evolution; Gnetales; Ferns; Zoserophyllum; Ginkgo.
81. How is Darwin’s concept of evolution different from that of de vries?
82. How mutation explained by Hugo de Vries is different from the Darwinian variations?
83. State Hardy- Weinberg principle of genetic equilibrium. Knowing that genetic drift disturbs this equilibrium
mention what does this disturbance in genetic equilibrium lead to?
84. Prior to industrialization, there were for more white – winged moths on trees than melanised moths in England.
However, after industrialization, the distribution pattern of these two kinds of moths reversed. What does the
above observation indicate? Explain giving reasons.
85. Since the origin of life on earth, there were five episodes of mass extinction of species.
(i) How is the ‘Sixth Extinction’, presently in progress, different from the previous episodes?
(ii) Who is mainly responsible for the ‘sixth extinction’?
(iii) List any four points that can help to overcome this disaster.
86. Describe the three different ways by which natural selection can affect the frequency of a heritable trait in a
population.
87. Giving three reasons, write how Hardy – Weinberg equilibrium can be affected.
88. According the Darwinian theory, the rate of appearance of new forms is linked to their life cycles. Explain.
89. Explain the increase in the numbers of melanic (dark winged) moths in the urban areas of post – industrialization
period in England .
90. Branching descent and natural selection are the two key concepts of Darwinian theory of evolution. Explain each
concept with the help of a suitable example. Explain the there ways in which natural selection operates on
different triats in nature.
91. Explain the three ways in which natural selection operates on different traits in nature.
92. (i) How does the Hardy Weinberg’s expression ( p2 +2 pq +q2 =1¿ , explain that genetic equilibrium is
maintained in a population?
(ii) List any two factors that can disturb the genetic equilibrium.
93. Discovery of lobefins is considered very significant by evolutionary biologists. Explain.
94. (i) Rearrange the following in an ascending order of evolutionary tree reptiles, salamanders, lobefin, frogs.
(ii) Name two reproductive characters that make reptiles more successful than amphibians.

95. What do these pictures A and B illustrate with reference to evolution? Explain.

96. How did Darwin’s theory of natural selection, explain the apperance of new forms of life on earth?
97. (i) Explain Darwinian theory of evolution with the help of one suitable example. State the two key concept of
theory.
(ii) Mention any thrree charcateristics of Neanderthal amn that lived in near East and Central Asia.
98. (a) Describe Hardy – Weinberg principle.
(b) List any fourfactors which affect genetic equilibrium.
 (c) Describe founder efect.
99. How does the process of natural selection affect Hardy – Weinberg equilibrium? Explain. List the other four
factors that disturb the equilibrium.
100. (i) Explain the process of natural selection that leads to speciation.
(ii) List the three ways in which the process operate in nature. Explain any one of processes.
101. (i) How does Hardy – Weinberg equation expalin genetic equilibrium?
(ii) Describe how this equilibrium gets disturbed which may lead to founser effect?
102. (i) Name the primates that lived about 15 million years ago. List their characteristic feature.
(ii) a) Where was the man – like animal found?
b) Write the order in which Neanderthals, Homo habilis and Homo erectus appeared on the earth. State the
brain capacity of each of them.
c) When did modern man Homo sapiens appear on this planet?
103. Explain the salient features of Hugo de Vries theory of mutation. How is Darwin’s theory of natural selection
different from it? Explain?
104. (i) Natural selection operated when nature selects for fitness. Explain,
(ii) The rate of apperance of new forms is linked to the life span of an organism.
Explain with the help of asuitable example.
105. (i) Write Hardy – Weinberg principle.
(ii) Explain the three different ways the natural selection can affect
the frequency of a heritable trait in a Population show in the graph
given below.

106. (i) Explain taking one example of vertebrates anatomy that evolution of
life has occurred on earth.
(ii) ‘Nature selects for fittest’. Explain with suitable examples.

CHAPTER-8
HUMAN HEALTH AND DISEASES
1. What is vaccine? Give an example of a vaccine produced by recombinant technology
2. Why are stimulants and hallucinogens categorized as psychotropic drugs? Give example of each of two types
mentioned.
3. A person has been diagnosed as HIV positive.
(i) Name the test which the person underwent.
(ii) Write full name of pathogen involved and describe its structure.
(iii) Which particular cells of this person are likely to get destroyed.
4. What is the other name of filarial? Give the scientific name of causative germ of elephantiasis.
5. Name and explain the type of barrier of innate immunity where some cells release interferons when infected.
6. What are oncogenes ? Explain
7. List any four danger signals of cancer.
8. Why is blood group identification not required for transfusing serum?
9. What are second generation vaccines?
10. Describe the structure of immunoglobin antibody. Draw a diagram showing the formation of antigen-antibody
complex and label the parts.
11. Write down the terms in expanded form
(i) AMIS (ii) CMIS (iii) NACO
12. i) How and at what stage does Plasmodium enter into human body?
ii) With the help of flow chart only show the stages of asexual reproduction in the life of the parasite in the
infected human.
iii) Why does the victim show symptoms of high fever?
13. Why do sports persons often fall victim to cocaine addiction?
14. a) Name the infective stages of Plasmodium which Anopheles mosquito takes in along the blood meal from an
infected person.
b) Why does the infection cause fever in humans?
c) Give a flow chart of the part of life cycle of this parasite passed in the insect
15. a) Name the respective forms in which the malarial parasite gains entry into
(i) Human and (ii) Body of female Anopheles.
b) Name the hosts where the sexual and the asexual reproduction of malarial parasite respectively.
c) Name the toxin responsible for the appearance of symptoms of malaria in humans. Why do these symptoms
occur periodically?
16. Name the type of cells the AIDS virus first enters into after getting inside the human body. Explain the sequence
of events that the virus undergoes within these cells to increase its progeny.
17. Name one plant and the addictive drug extracted from its latex. How does this drug affect the human body?
18. a) Explain the property that prevents normal cells becoming cancerous.
b) All normal cells have inherent characteristics of becoming cancerous Explain.
19. List the specific symptoms of pneumonia. Name the causative organism
20. How does spleen act as a lymphoid organ? Explain
21. What is colostrum? Why is it important to be given to new born infants?
22. a) Name the virus that causes AIDS in humans.
b) Explain the sequence of events that flows when this virus attacks to cause immunodeficiency in humans.
23. How is innate immunity different form the immunity that you acquire through vaccines? Describe any two ways by
which innate immunity can be accomplished.
24. a) Name the lymphoid organ in humans where all the blood cells are produced.
b) Where do the lymphocytes produced by the lymphoid organ mentioned above migrate and how do they affect
immunity.
25. Name the specific symptoms of typhoid. Name its causative agent.
26. Write the name of any two opiate narcotics and their harmful effects.
27. An antibody is represented by H2L2 . Explain
28. Name the host and the site where the following occur in the life cycle of a malarial parasite
a) Formation of gametocytes b) Fusion of gametes
29. Name the type of human cell HIV attacks at its entry into the body. Explain the events that occur in the cell which
further lead to cause immunodeficiency syndrome.
30. Define the term ‘health’. Mention any two ways of maintaining it.
31. Why does a doctor administer tetanus antitoxin and not a tetanus vaccine to a child injured in a road side accident
with a bleeding wound? Explain.
32. Name an opioid drug and its source plant. How does the drug affect the human body?
33. Mention the name of the causal organism, symptoms and the mode of transmission of the disease amoebiasis
34. a) All human beings have cellular oncogences but only a few suffer from cancer diseases. Give reason.
b) How is malignant tumour different from benign tumour?
35. Write the scientific names of the causal organisms of elephantiasis and ringworm in human. Mention the body
parts affected by them
36. Write the source and the effect of the following drugs on the human body.
(i) Morphine (ii)……….. (iii) Marijuana.
37. How do cellular barriers and cytokine barriers provide innate immunity?
38. State the functions of primary and secondary lymphoid organs in humans.
39. i) Name the stage of Plasmodium that gains entry into human body
ii) Trace the stages of Plasmodium in the body of female Anopheles after its entry
iii) Explain the cause of periodic recurrence of chill and high fever during malarial attack humans.
40. Trace the events that occur in the human body to cause immunodeficiency when HIV gains entry the body.
41. Differenctiate between benign and malignant tumours
42. i) Write the scientific names of the two species of filarial worms causing filariasis.
ii) How do they affect the body of infected persons?
iii) How does the disease spread?
43. List the two types of immunity a human body is born with. Explain the differences between the types.
44. Why is tabacoo smoking associated with rise in blood pressure and emphysema (oxygen deficiency in body)?
45. a) Name a drug used (i) as an effective sedative and pain killer (ii) for helping patients cope with mental illness like
depression but often misuse.
b) How does the moderate and high dosage of cocaine affect the human body?
46. Explain the role of the following in providing defence against infection in human body
(i) Histamines (ii) Interferons (iii) B-cells
47. a) Highlight the role of thymus as a lymphoid organ.
b) Name the cells that are released from the above mentioned gland. Mentioned gland. Mention how they help
immunity
48. Name the plant source of the drug popularly called “ smack.” How does it affect the body abuser ?
49. a) Name the protozoan parasite that causes amoebic dysentery in humans.
b) Name the protozoan parasite that causes amoebic dysentery in humans.
c) How is this disease transmitted to others?
50. Name the parasite that causes filariasis / ascariasis in humans. Mention its two diagnostic symptoms. How is this
disease transmitted to others?
51. Name the plant source of ganga. How it affects the body of abuser?
52. Name two special types of lymphocytes in humans. How do they differ in their roles in ……. response?
53. Name the bacterium that causes typhoid. Mention two diagnostic symptoms. How is this disease transmitted to
others?
54. a) Name the group of viruses responsible for causing AIDS in humans. Why are these viruses to named?
b) List any two ways of transmission of HIV infection in humans, other than sexual contact.
55. Name any two organisms that are responsible for ringworms in humans. Mention two diagnostic symptoms. Name
the specific parts of the human body which these organisms thrive and explain why?
56. Name the cells that act as HIV factory in humans when infected by HIV. Explain the events that occur in the
infected cell.
57. Name the explain the two types of immune responses in humans.
58. Describes the role of lymph nodes in providing immunity.
59. Name the plant source of cocaine. How does it affect human body.
60. Name the different types of cells providing cellular barriers responsible for innate immunity in humans
61. Trace the life cycle of malarial parasite in the human body when bitten by an infected female Anopheles.
62. How does AIDS virus enter the human body? Describe its life cycle. Why does this infection shatter the immunity
of the victim?

63. What is the basis of classifying cancer? Name and explain the different categories of cancer. Mention any two
approaches for cancer treatment.
64. (i) Name the two type of lymphocytes involved in the specific immune system. (ii) Mention the two types of
specific immunity they generate. (iii) Why is specific immunity considered to be unique in its function? Write
any three special features of it
65 . Differentiate between active immunity and passive immunity. Give any one example where passive immunization
is needed.
66. Differentiate between B-Cell and T-Cell of the immune system. How do the B-Cell respond to antigens?
67. Explain briefly the various types of disorders arising from improper immune system.
68 .(a) Cancer is one of the most dreaded diseases. Explain 'Contact inhibition' and 'Metastasis' with respect to the
disease.
(b) Name the group of genes that have been identified in normal cells that could lead to cancer. How do these
genes cause cancer?
(c) Name any two techniques that are useful in detecting cancers of internal organs.
(d) Why are cancer patients often given α-interferon as part of the treatment? (2014)
69 .Name any two types of cells that act as 'cellular barriers' to provide innate immunity in humans.
70 .(a) Cancer is one of the most dreaded diseases. Explain 'Contact inhibition' and 'Metastasis' with respect to the
 disease.
(b) Name the group of genes that have been identified in normal cells that could lead to cancer. How do these genes
cause cancer?
(c) Name any two techniques that are useful in detecting cancers of internal organs.
(d) Why are cancer patients often given α-interferon as part of the treatment?
71. Why is secondary immune response more intense than the primary immune reponse in humans?
72. Name any two types of cells that cat as ‘ Cellular barriers’ to provide innate immunity in humans.
73. Name the two intermediate hosts on which the human liver fluke depends to complete its life cycle so as to
facilitate parasitisation of its primary host.
74. How does haemozoin affect the human body when released in blood during malarial infection.
75. What is an autoimmune disease? Give an example.
76. When does a human body elicit an anamnestic response?
77. State two different roles of spleen in the human body?
78. How do interferons protect us?
79. Why do pollen grains of some trigger sneezing in some people?
80. What is it that prevent a child to suffer from a disease he / she is vaccinated against? Give one reason.
81. List the symptoms of ascarisis. How does a healthy person acquire this infection?
82. Name an allergen and write the response of human body when exposed to it.
83. Differentiate between active and passive immunity.
84. How does a vaccine for a particular disease immunize the human body against that disease?
OR
Why is a person with cuts and bruises following an accident administered tetanus antitoxin? Give reasons.
85. A patient showed symptoms of sustained high fever, stomach pain and constipation, but no blood clot in stools.
Name the disease and its pathogen. Write the diagnostic test for the disease. How does the disease gets transmited?
86. (i) Highlight the role of thymus as a lymphoid organs.
(ii) Name the cells that are released from the above mentioned gland. Mention how they help in immunity.
87. Name the parasite that causes filariasis in humans. Mention its two diagnostic symptoms. How is this transmitted
to others?
88. Name the parasite that causes filariasis in humans. Mention its two diagnostic symptoms. How is this transmitted
to others?
89. (i) Name the protozoan parasite that causes amoebic dysentery in humans.
(ii) Mention two diagnostic symptoms of the disease.
(iii) How is this disease transmitted to others?
90. Name the two special types of lymphocytes in humans. How do they differ in their roles in immune response?
91. (i) Name the group of virus responsible for causing AIDS in humans. Why are these virus so named?
(ii) List any two ways of transmission of HIV infection in humans other than sexual contact.
92. Why is an antibody represented H 2 L2?
93. Name the different types of cell providing cellular barrier responsible for innate immunity in humans.
94. List any two emergent circumstances, when a medical doctor would recommend injection of a pre – formed
antibody into the body of a patient and why?
95. How is an allergic reaction caused by an allergen? Name the drug that can reduce the symptoms of allergy?
96. Name the two types of immunity in a human body. Why are cell mediated and humoral immunities so called?
97. Write the scientific names of the casual organisms of elephantiasis and ringworm in human. Mention the body
parts affected by them.
98. Identify A,D,E and F in the diagram of a antibody molecule given below:

99. Name the host and the site, where the following occur in the life cycle of a malarial parasite
i)Formation of gametocytes ii) Fusion of gametocytes
100. Define the term health. Mention any two ways of maintaining it.
101. Why does a doctor administer tetanus antitoxin and not a tetanus vaccine to a child injured in a road side accident with a
bleeding wound?
102. (i) How does a vaccine affect immunity?
(ii) How can we get immunisation against tetanus?
103. Why do normal cells do not show cancerous growth?
104. How do macrophages in the human body act as HIV factory?
105. (i) What does the below diagram illustrate?
(ii) Name the parts labelled A and B
(iii) Name the type of cells that produce this molecule.

106. State the effect of carcinogens on human body. Name the carcinogenic ionisisng and non – ionizing radiations.
Mention their carcinogenic effect.
107.List the specific symptoms of typhoid. Name its causative agent.
108. (i) Explain the property that prevents normal cells from becoming cancerous.
(ii) All normal cells have inherent characteristic of becoming cancerous. Explain.
109. What is Colostrum? Why is it important to be given to the newborn infants?
110. How does spleen act as lymphoid organ? Explain.
111. Explain the response initiated when a dose of vaccine is introduced into the human body.
112. How do normal cells gets transformed into cancerous neoplastic cells? Mention the difference between vuiral
oncogenes and cellular oncogenes.
113. Community service department of your school plans a visit to a slum near the school with an objective educate the
slum dwellers with respect to health and hygiene.
(i) Why is there a need to organize such visits?
(ii) Write the steps you will highlight, as a member of this department , in your interactions with them to enable
them to lead a healthy life.
114. (i) Name and explain going reason, the type of immunity provided to the newborn by the colostrums and
vaccinations.
(ii) Name the type of antibody:
 Present in colostrums
 Produced in response to allergens in human body.
115. (i) Name the causative organisms for the following diseases.
a) Elephantiases b) Ringworm c) Amoebiasis
(ii) How can public hygiene help control such diseases?
116. Name the cells HIV attacks first when it gains entry into a human body. How does this vims replicate further to
cause immunodeficiency in the body?
OR
Trace the events occur in human body to cause immunodeficiency, when HIV gains entry into the body.
117. Trace the lifecycle of malarial parasite in human body, when bitten by infected female.
118. Study a part of the life cycle of malarial parasite given below.
 (i) Mention the roles of A in the life cycle of the malarial parasite.
(ii) Name the event C and the organ where this event occurs.
(iii) Identify the organ B and name the cells being released from it.

119. (i) Name the causative agent of typhoid in humans.

(ii) Name the test administered to confirm the disease.
(iii) How does the pathogen gain entry into the human body? Write the diagnostic symptoms and mention the
body organ that gets affected in severe cases?
120. Study the diagram showing replication of HIV in humans and answer the following questions accordingly.

(i) Write the chemical nature of the coat.

(ii) Name the enzyme B acting on X to produce molecule C. Name C.
(iii) Mention the name of the host cell D the HIV attacks first when it enters into the human body.
(iv) Name the two different cells the new viruses E subsequently attack.
121. Mention the name of the causal organism, symptoms and the mode of transmission of the disease amoebiasis.
122. (i) All human beings have cellular oncogenes but only few suffer from cancer disease. Give reasons.
(ii) How is a malignant tumour different from a benign tumour?
123. Trace the lifecycle of plasmodium in humans from the stage of entry until it is picked up by the female
Anopheles.
124. Give the scientific name of the parasite that causes malignant malaria in humans. At What stage does this parasite
enter the human body? Trace its life cycle in human body.
125. (i) Name the respective forms in which the malarial parasite gains entry into
a) Human body b) Body of female
(ii) Name the hosts where the sexual and asexual reproduction occur respectively.
(iii) Name the toxin responsible for the appearance of symptoms of malaria in human. Why do these symptoms
occur periodically?
126. (i) Why do the symptoms of malaria not appear immediately after the entry of sporozoites into the human body \
when bitten by female Anopheles? Explain.
(ii) Give the scientific name of the malarial parasite that causes malignant malaria in humans.
127. A person is suffering from amoebiasis. Mention the pathogen that causes it and one organ of the body that gets
 affected. Give three symptoms and one mode of its transmission.
128. How is innate immunity different from the immunity that you require through vaccines? Describe any two ways
by which innate immunity can be accomplished?
129. A person is suffering from ascariasis. Mention the pathogen causing the disease and an organs of the body
affected. Write three symptoms and one mode of transmission of the disease.
130. (i) Name the infective stage of plasmodium, which Anopheles mosquito takes in along with the blood meal from
an infected human.
(ii) Why does the infection cause fever in human?
(iii) Give a flow chart of the part of the lifecycle of this parasite passed in this insect.
131. (i) List any two situations, when a medical doctor would recommend injection of performed antibodies into the
body of a patient. Name this kind of immunization and mention its advantages.
(ii) Name the kind of immunity attained when instead of antibodies, weakened antigens are introduced into the
body.
132. Explain the process of replication of a retrovirus after it gains’ entry into the human body.
133. (i) Cancer is one of the most dreaded diseases. Explain ‘ contact inhibition’ and ‘metastasis’ with respect to
disease.
(ii) Name the group of genes that have been identified in normal cells that could lead to cancer. How do these
genes cause cancer?
(iii) Name any two techniques that are useful in detecting cancers of internal organs.
(iv) Why are cancer patients after given a – interferon as part of the treatment?
134. (i) Name and explain any four lymphoid organs present in humans.
(ii) Categorise the named lymphoid organs as primary or secondary lymphoid organs, giving reasons.
135. A person in your colony has recently been diagnosed with AIDS. People/ residents in the colony want him to
leave the colony for the fear of spread of AIDS.
(i) Write your view on the situation, giving reasons.
(ii) List the possible preventive measures that you would suggest to the residents of your locality in a meeting
organized by you so that they understand the situation.
(iii) Write the symptoms and the causative agent of AIDS.
136. Do you support ‘Dope’ test being conducted on sports persons participating in a prestigious meet? Give three
reasons in support of your answer.
137. An active member of an awareness group conducts regular programmes to sensitise public against alcoholism
amongst youth as a serious health hazard in his locality.
Identify the values this member of the group is trying to propagate amongst the people in his locality.
138. Write the source and the effect on the human body of the following drugs.
i) Morphine ii) Cocaine iii) Marijuana
139. (i) Name the drug used
a) as an effective sedative and pain killer
b) for helping patients to cope with mental illness like depression but often misused,
(ii) How does moderate and high dosage of cocaine affect the human body?

CHAPTER-9
STRATEGIES FOR ENHANCEMENT IN FOOD PRODUCTION
1.Why is bagging of the emasculated flowers essential during hybridization experiments?
2. Mention the strategy used to increase homozygosity in cattle for desired traits.
3. Which one is used in apiculture: Hilsa, Apisindica, Sonalika.
4. Which of the following is the semi-dwarf wheat that is high yielding and disease resistant ?Pusa Shubra
KalyanSona, Rana.
5. What is the major advantage of producing plants by micro propagation?
6. What is meant by biofortification?
7. How can pollen grains of wheat and rice which tend to lose viability within 30 minutes of their release be made
available months later for breeding programmes?
8. State the importance of biofertification.
9. Name the following: (a) The semi dwarf variety of wheat which is high yielding and disease resistant (b) Any one
Inter specific hybrid mammal.
10. Write the name of the following: (a) The most common species of bees suitable for apiculture (b) An improved
breed of chicken
11. Why is the South Indian Sugarcane preferred by agriculture?
12. a) How can haploid plants plants be raised in the laboratory?
b) Name the plant first used in India to produce haploid plants.
c) Can haploid plants raise their own progeny? Give reason.
13. What is haploidy? How are haploid plants raised? How are they helpful in plant breeding?
14. How is autopolyploid produced? Give an example.
15. Expand MOET. Explain the procedure of this technology in cattle improvement.
16. MOET programme has helped in increasing the herd size of the desired variety of cattle. List the involved in
conducting the programme.
17. Explain the efforts which must be put in to improve health, hygience and milk yield of cattle in a dairy farm.
18. i) Mention the property that enables the explants to regenerate into a new plant.
ii) A banana herb is virus infected. Describe the method that will help in obtaining healthy banana plant from this
diseased plant.
19. Explain the process of artificial hybridization to get improved crop variety in (i) Plants bearing bisexual flowers
(ii) Female parent producing unisexual flowers.
20. Mention the cause and effect of inbreeding depression in cattle. How can it be overcome? Explain.
21. Why should a bisexual flower be emasculated and bagged prior to artificial pollination?
22. What is inbreeding depression and how is it caused in organisms? Write any two advantages of inbreeding.
23. How can crop varieties be made disease resistant to overcome food crisis in India? Explain. One disease resistant
variety in India (a) Wheat to leaf and strips rust (b) Brassica to white rust.
24. Mention the property of plant cells that has helped them to grow into a new plant in vitro condition. Explain the
advantages of micro propagation.
25. Scientists have succeeded in recovering healthy sugarcane plants sugarcane plants from a diseased one.
a) Name the part of the plant used as explant by the scientists
(b) Describe the procedure the scientists followed to recover the healthy parts.
c) Name this technology used for crop improvement
26. Describe the technology that has successfully increased the herd size of catte in a short-time to meet the increasing
demands of growing human population.
27. How does culluringSpirulina solve the food problems of the growing human population?
28. How are biofortified Maize and Wheat considered nutritionally improved?
29. a) What is the programme called that is involved in improving success rate of production of desired hybrid and
herd size of cattle?
b) Explain the method used for carrying this programme for cows.

30. a) Name the Indian scientist whose efforts brought “ green revolution” in India.
b) Mention the steps that are essentially carried out in developing a new genetic variety of crop under plant
breeding programme.
31. What is somatic hybrid ? Give one example. Explain the steps involved in the production of such a hybrid.
32. What is somatic hybridization? Explain the steps involved in the production of a somatic hybrid.
33. a) Name the nematode that infests and damages Tobacco roots.
b) How are transgenic Tobacco plants produced to solve this problem?
34. (a) Name the technology that has helped scientists to propagate on a large scale the desired crops in a short
duration. List the steps carried out to propagate the crops by the said technique
(b) How are somatic hybrids obtained?
35. (a) Name the tropical sugar cane variety grown in South India. How has it helped in improving the sugar cane
quality grown in North India?
(b) Identify 'a', 'b' and 'c' in the following table:
No. Crop Variety Insect Pests
1. Brassica Pusa Gaurav (a)
Pusa Sem 2
2. Flat bean (b)
Pusa sem 3
Pusa Sawani
3. (c) Shoot and fruit borer
Pusa A-4
36. State the disadvantage of inbreeding among cattle. How it can be overcome?
37.What are 'true breeding lines' that are used to study inheritance pattern of traits in plants? L ION
38.(a) Name the technology that has helped scientists to propagate on a large scale the desired crops in a short duration.
List the steps carried out to propagate the crops by the said technique.
(b) How are somatic hybrids obtained?
39. How can healthy potato plants be obtained from a desired potato variety which is viral infected? Explain.

CHAPTER-10
MICROBES IN HUMAN WELFARE
1.What is the biochemical reaction of yeast fermentation of molasses for alcoholic fermentation?
2. What protects nitrogenase?
3. What is economic value of Spirulina?
4. Name the group of organisms and the substrate they act on to produce biogas.
5. Name the organism commercially used for the production of single cell protein.
6. Which of the following is a fee living bacterium that can fix nitrogen in the soil? Spirulina, Azospirillum, Sonalika.
7. Milk starts to coagulate when lactic acid bacteria (LAB) are added to warm milk as starter. Mention any other two
benefits LAB provides.
8. Which of the following is a cyanobacterium that can fix atmospheric nitrogen? Azospirillum, Ocillatoria, Spirulina.
9. Which of the following produces single cell proteins? Sonalika, Spirulina, Saccharomyces.
10. Write the scientific name of the microbe used for fermented malted cereals and fruit juices.
11. Mention the source orgsnisms of gene cry I Ac and its target pest.
12. Mention the role of cyanobacteria as biofertilizers.
13. Why should biological control of pests and pathogens be preferred to the convential use of chemical pesticides?
Explain how the following microbes act as biocontrolagents : (a) Bacillus thuringiensis (b) Nucleopolyhedrovirus
14. During the secondary treatment of the primary effluent, how does the significant decrease in BOD occur?
15.a) decrease in BOD occur?
b) Explain how this sludge is used in biogas production.
16. a) Baculoviruses are excellent candidates for integrated pest management in an ecological sensitive area. Explain
giving two reasons.
b) What is organic farming? Why is it suggested to switch over to organic farming?
17. How does addition of a small amount of curd to fresh milk help in formation of curd? Mention a nutritional quality
that gets added to the curd.
18. Mention the product and its use produced by each of the microbe listed below:
(i) Streptococcus (ii)( Lactobacillus (iii) Saccharomyces cerevisiae.

19. How do plants benefit from having mycorrhizal symbiotic association?

20. Describe how biogas is obtained from an activated sludge.
21. An organic farmer relies on natural predation for controlling plant pests and diseases. Justify giving reasons. Why
this is considered to be holistic approach.
22.a) Why do farmers prefer biofertilizers to chemical fertilizers these days?Explain.
b) How do Anabaena and mycorrhiza act as biofertilisers?
23. Name the enzyme produced by Streptococcus bacterium. Explain its importance in medical science.
24. Name the genus to which baculo viruses belong. Describe their role in the integrated pest management
programmes.
25. Why are some molecules called bioactive molecules? Give two examples of such molecules.
26. Give the scientific name of the microbes from which cyclosporine A and statin are obtained. Write one medical use
of each one of these drugs.
27. Explain the different steps involved in sewage treatment before it can be released into natural water bodies.
28. Why is Rhizobium categorized as a ‘symbiotic”?
29. Name the source of streptokinase/cyclosporine – A/Statin. How does the bioactive moledule function in our body.
30. How do mycorrhizae act as biofertilizer? Explain. Name a genus of fungi that forms a mycorrhizal association with
plants.
31. Mention the importance of lactic acid bacteria to humans other than converting milk into curd.
32. How do methanogens help in producing biogas?
33. Name the two different categories of microbes naturally occurring in sewage water.Explain their role in cleaning
sewage water into usable water.
34. Name two groups of organism which constitute ‘floes’. Write their influence on the level of BOD during biological
treatment of sewage.
35. Why is ‘Starter’ added to set the milk into curd? Explain.
36. Name the bacterium responsible for the large holes seen in swiss cheese. What are these holes due to?
37. Name the source of streptokinase. How does this bioactive molecule function in our body.
OR
Name the enzyme produced by streptococcus bacterium. Explain its importance in medical sciences.
38. Mention the importance of lactic acid bacteria to humans other than setting milk into curd.
39. Name the source of cyclosporine – A. How does this bioactive molecule function in our body?
40. Name the source of statin and state its action on the human body.
OR
Give the scientific name of the microbes from which cyclosporine – A and statin are obtained. Write one medical
use of each one of these drugs.
41. Why are some molecules called bioactive molecules? Give two examples of such molecules.
42. How does addition of a small amount of curd to fresh milk help formation of curd? Mention a nutritional quality
that gets added to the curd.
OR
Explain the change fresh milk undergoes when a small amount of curd as starter is added to it and kept as suitable
temperature.
43.During the secondary treatment of the primary effluent. How does the significant decrease in BOD occur?
44. State the use of following enzymes / acids produced by the microbes
i) Lipase ii) Lactic acid iii) streptokinase iv) Pectinase
45. How has fungus Trichoderma polysporum proved to be very essential to organ transplant patients?
46. Name the two different categories of microbes naturally occurring in sewage water. Explain their role in cleaniong
sewage water into usable water.
47. Explain the different steps involved in sewage treatment before it can be released into natural water bodies.
48. Mention the product and its use produced by each of the microbes listed below:
* Sreptococcus
* Lactobacillus
* Saccharomyces cerevisiae
49.i) How does activated sludge get produced during sewage treatment?
ii) Explain how this sludge is used in biogas production?
50. How are floes produced in the secondary treatment plant of the sewage? Explain their role
51. (i) Expand BOD.
(ii) At a particular segment of a river a sugar factory, the BOD is much higher than the normal level. What is it
indicative of? What will happen to the living organism in this part of the river?
(iii) Under what conditions will the BOD be lowered in the river? How will it affect the aquatic life?
52. Explain the process of Sewage water treatment before it can be discharged into natural water bodies. Why is this
treatment essential?
53. (i) Name the category of microbes naturally occurring in sewage and making it less polluted during the treatment.
(ii) Explain the different steps involved in the secondary treatment of sewage.
54. How do mycorrhizae act as biofertilizers? Explain. Name a genus of fungi that forms a mycorrhizal association
with plants.
55. How do methanogens help in producing biogas?
56. Why is Rhizobium categorised as a symbiotic bacterium? How does it act as biofertilisers?
57. How do plant benefit from mycorrhizal symbiotic association?
58. What are methanogens? Name the animals in which methanogens occur and the role they play there.
59. How are baculoviruses and Bacillus thuringinesis used as biocontrol agents? Why are they preferred over readily
available chemical pesticides?
60. Draw a labelled sketch of a typical biogas plant.
61.How is the Bt cotton plant created as a GM plant? How is it protected against bollworm infestation?
62. The diagram above is that of a biogas plant. Explain the sequence of events occuring in a biogas plant. Identify A,
B and C.
63.(i) Why do framers prefer biofertilisers to chemical fertilizers these days? Explain
(ii) How do Anabaena and mycorrhiza act as biofertilizers?
64. (i) Why do organic farmers not recommend eradication of insect pests? Explain giving reasons.
(ii) How do ladybird beetles and dragonflies act as bio control agents?
65.Name the genus to which baculoviruses belong. Describe their role in the integrated pest management programme.
66. An organic farmer relies on natural predation for controlling pesta and diseases. Justify giving resaons. Why this is
considered to be a holistic approach?
67. (i) Baculo viruses are excellent candidates for integrated pest management in an ecologically sensitive area.
Explain giving reasons.
(ii) What is organic farming? Why is it suggested to switch over to organic farming?
68.Why should biological control of pests and pathogens be preferred to the conventional use of chemical pesticides?
Explain how the following microbes act as bio control agents?
(i) Bacillus thuringiensis (ii) Nucleopolyhedrovirus.
69. Explain the role of baculoviruses ass biological control agents. Mention their importance in organic farming.

CHAPTER-11
BIOTECHNOLOGY : PRINCIPLES AND PROCESSES
1. How is the action of exonuclease different from that of endonuclease?
2. What is the host called that produces a foreign gene product? What is this product called?
3. How can bacterial DNA be released from the bacterial cell for biotechnology experiments?
4. Mention the uses of cloning vector in biotechnology.
5. Biotechnologists refer to Agrobacterium tumefaciens as a natural genetic engineer of plants. Give reason to support
the statement.
6. Why is it essential to have ‘selectable marker’ in a cloning vector?
7. Do eukaryotic cells have restriction endonuclease? Justify your answer.
8. What are cDNA libraries? How are they made?
9. How and why is the bacterium Thermusaquaticus employed in recombinant DNA technology. Explain.
10. a) What are “ molecular scisors”? Give one example.
b) Explain their role in recombinant DNA technology

11. Why is Agrobacterium tumefaciens a good cloning vector? Explain

12. DNA being hydrophilic cannot pass through the cell membrane of a host cell. Explain how do recombinant DNA
get introduced into host cell to transform the latter.
13. Explain the contribution of Thermusaquaticus in the amplification of a gene of interest.
14. What are recombinant proteins? How do bioreactors help in their production?
15. How is DNA isolated in purified form from a bacterial cell?
 16. Name and explain the techniques used in separation and isolation of DNA fragments to be used in recombinant
DNA technology?
17. Name the source of Taq polymerase. Explain the advantage of its use in biotechnology.
18. Name the source organism from which T1 plasmid is isolated. Explain the use of this plasmid in biotechnology.
19. What is EcoRI? What does ‘R’ represent in this?
20. EcoRI is used to cut a segment of foreign DNA and that of a vector DNA to form a recombinant DNA. Show with
the help of schematic diagrams.
i) The set of palindromic nucleotide sequence of base pairs the EcoRI will recognize in both the DNA segments.
Mark the site at which EcoRI will act and cut both the segments.
ii) Sticky end formed on both the segments where the two DNA and foreign DNA join later to form a recombinant
DNA.
21. A recombinant DNA is formed when sticky ends of vector DNA and foreign DNA A recombinant DNA is formed
when sticky ends of vector DNA and foreign DNA.
22. (i)Mention the number of primers required in each cycle of polymerase chain reaction (PCR). Write the role of
primers and DNA polymerase in PCR.
(ii) Give the characteristic feature and source of DNA polymerase used in PCR.
23. Explain the action of restriction endonuclease EcoRI.
24. How are the DNA fragments separated by gel electrophoresis visualized and separated for use in constructing
recombinant DNA?
25. Explain the process by which a bacterial cell can be made ‘Competent’ in recombinant DNA technology.
26. Why is ‘Origin of replication’ (Ori) required to facilitate cloning into a vector?
27. List the key tools used in recombinant DNA technology.
28. Explain the role of T1 plasmids in biotechnology.
29. Explain the work carried out by Cohen and Boyer that contributed immensely in biotechnology.
30. State the role of DNA ligase in biotechnology.
31. a) A recombinant vector with a gene of interest inserted within the gene of a galactosidase enzyme is introduced
into a bacterium. Explain the method that would help in selection of recombinant colonies from non-recombinant
ones.
b) Why is this method of selection referred to as “ insertional inactivation”
32. Name the source organism that possesses,Taq polymerase. What is so special about the function of this enzyme?
33. How can the following be made possible for biotechnology experiments?
a) Isolation of DNA from bacterial cell.
b) Reintroduction of recombinant DNA into a bacterial cell.
34. How is amplification of agene sample of interest carried out using polymerase chain reaction.
35. Explain with the help of a suitable example the naming of a restriction endonuclease.
36. State how has Agrobacterium tumifaciens been made a useful cloning vector to transfer DNA to plant cells
37. a) Mention the role of vector s in recombinant DNA technology. Give any two examples.
b) With the help of diagrammatic representation only, show the steps of recombinant DNA technology.
38.a) Why are engineered vectors preferred by biotechnologists for transferring the desired genes into another
organism?
b) Explain how do “ori” selectable markers” and” cloning sites” facilitate cloning into a vector?
39. What is bioreactor? Draw a labeled diagram of asparged stirred bioreactor. Explain its functioning.
40. (i) Describe the characteristics a cloning vector must possess.
(ii) Why DNA cannot passs through cell membrane? Explain. How is a bacterial cell made competent to take up
recombinant DNA from the medium
41. If a desired gene is identified in an organism for some experiments, explain the process of the following:
i) Cutting the desired gene at specific location
ii) Synthesis of multiple copies of this desired gene.

42. a) With the help of diagrams show the different steps in the formation of recombinant DNA by action of restriction
endonuclease enzyme EcoRI.
b) Name the technique that is used for separating the fragments of DNA cut by restriction endonuclease.
43. How are 'sticky ends' formed on a DNA strand? Why are they so called?
44. Write the role of Ori and 'restriction' site in a cloning vector pBR322.
 CHAPTER-12
BIOTECHNOLOGY AND ITS APPLICATIONS
1. A multinational company outside India tried to sell new varieties of turmeric without proper patent rights. What is
such an act referred to?
2. Suggest any two techniques which can help in early detection of bacterial / viral infections much before the
symptoms appears in the body.
3. How does silencing of specific mRNA in RNA interference prevent parasitic infestation?
4. Name any two techniques that serve the purpose of early diagnosis of some bacterial / viral human diseases.
5. What is genetically modified food? What are the dis-advantages of this food?
6. Write full form of ELISA. Give an example of the clinical application of ‘ELISA’ test.
7. Describe the responsibility of GEAC, set up by the Indian Government.
8. Nematode specific genes are introduced into the tobacoo plants using Agrobacterium vectors to develop resistance
in tobacco plants against nematodes. Explain the events that occur in tobacco plant to develop resistance.
9. How is a transgenic tobacco plant protected against Meloidogyne incognita? Explain the procedure.
10. Expand the name of enzyme ADA. Why is the enzyme essential in the human body? Suggest a gene therapy for its
deficiency.
11. Plasmid is a boon to biotechnology. Justify this statement quoting the production of human insulin as an example
12. Highlight any four advantages of genetically modified organisms (GMOs).
13. How did EI Lilly company go about preparing the human insulin? How is the insulin thus produced different from
that produced by the functional human insulin gene?
14. Why is introduction of genetically engineered lymphocytes into an ADA deficiency patients not a permanent cure?
Suggest a possible permanent cure.
15. How does RNA interference help in developing resistance in Tobacco plant agains nematode infection.
16. How did Eli Lilly synthesize the humun insulin? Mention one difference between this insulin and the one produced
by the human pancreas.
17. Name the insect pest that is killed by the product of cry I Ac gene. Explain how the gene makes the plant resistant
to the insect pest.
18. Why do the toxic insecticidal proteins secreted by Bacillus thurigniensis kill the insect and not the bacteria?
19. Name the fist transgenic cow developed and explain the improvement in the quality of the product produced by it
20. Explain the process of RNA interference.
21. Explain how a hereditary disease can be corrected. Give an example of first successful attempt made towards
correction of such diseases.
22. How is “Rosie” considered different from a normal cow? Explain.
23. Biopiracy should be prevented. State why and how?
24. What happens when Meloidogyneingonnita consumes cells with RNAi gene?
25. a) Mention the cause and the body system affected by ADA deficiency in humans.
b) Name the vector used for transforming ADA-DNA into recipient cells in humans. Name the recipient cells.
26. a) How does cry I Ac gene express itself in its host?
b) State the role of this gene in controlling the infestation of bollworm.
27. How has recombinant technology helped in large scale production of vaccines? Explain giving one example
28. Name the genes responsible for making Bt cotton plants resistant to bollworm attack. How do such plants attain
resistance against bolloworm attacks? Explain.
29. a) Tobacco plants are damaged severaly when infested with Meloidogyne incognita. Name and explain the strategy
that is adopted to stop this infestation.
b) Name the vector used for introducing nematode specific gene in Tobacco plant.
30. Explain the synthesis of genetically engineered human insulin.
31. What is gene therapy? Illustrate using the example of adenosine deaminase (ADA) deficiency.
32. a) What is plasmid? (b) What is meant by ADA deficiency? How is gen therapy a solution to this problem? Why is
it not a permanent cure?
33. Explain the steps involved in the production of genetically engineered insulin.
34. One of the main objectives of biotechnology is to minimize the use of insecticides on cultivated crops. Explain
With the help of suitable example how insect resistant crops have been developed using techniques of
Biotechnology.
35. a) How is mature insulin different from proinsulin secreted by pancreas in humans?
b) Explain how was human functional insulin produced using rDNA technology.
c) Why is the functional insulin thus produced considered better than the ones used earlier by diabetic patients?
36. What is ADA deficiency? Describe three methods to cure it.
37. a) Name the source from which insulin was extracted earlier. Why is this insulin no more in use by diabetic
people?
b) Why do cattle avoid browsing on Calotropis plants? Explain
38. Why do cattle avoid browsing on Calotropis plants? Explain
39. Name the important defence mechanisms in plants against harbivory.
40. How do organisms like fungi, zooplankton and bears overcome the temporary shortlived climate stressful
conditions? Explain.
41. Differentiate between the following interspecific interactions in a population
(i) Mutualism and competition (ii) Commensalism and amensalism
42. Why are small animals rarely found in the polar regions?
43. Mention four adaptive features that help cacti survive in xeric environment.
44. Name the type of interaction seen in each of the following examples.
(i) Ascaris worms living in the intestine of human. (ii) Wasp pollinating fig inflorescence.
(iii) Clown fish living among the tentacles of sea anemone. (iv) Mycorrhizae living is the roots of higher plants.
(v) Disappearance of smaller barnacles when malanus dominated in the coast of Scotland.
45. Water is very essential for life. Write any three features for plants and animals which enable them to survive in
water scarce environment.
46. How do organisms cope with stressful external environmental conditions which are localized or of short duration?
47. Explain the response of all communities to environment over time.
48. Bear hibernates whereas some species of zooplankton enter diapause to avoid stressful external conditions. How
are these two ways different from each other?
49. How does our body adapt to low oxygen availability at high altitude?
50. Why do Clown Fish and sea anemones pair up? What is their relationship called?
51. Some organisms suspend their metabolic activities to survive in unfavourable conditions. Explain with the help of
any four examples.
52. Explain brood parasitism with the help of an example.
53. Why are small birds like humming birds not found in polar regions? Explain.
54. a) List any three ways of measuring population density of a habitat.
b) Mention the essential information that can be obtained by studying the population density of an organism.
55. What is the association between bumble bee and its favourite orchid Ophrys? How would extinction or change of
one would affect the other?
56. Give an explanation of the above equation.
a) List any four abiotic components that lead to variations in the physical and chemical conditions of different
habitats.
b) Explain the impact of these component on the distribution of organisms in different habitats.
57. Draw and explain a logistic curve for a population of density (N) at a time (t) whose intrinsic rate of natural
increase is (r) and carrying capacity (k).
58. Study the graph given below and answer the questions that follow:

(i) Write the status of food and space in the curves (a) and (b).
(ii) In the absence of predators, which one of the two curves would appropriately
depict the prey population?
(iii) Time has been shown on X-axis and there is a parallel dotted line above it. Give
the significance of this dotted line.

59.Construct an age pyramid which reflects a stable growth status of human population.
60. Give an example of an organism that enters 'diapause' and why?
61. Construct an age pyramid which reflects a stable growth status of human population.
62. State how was Agrobacterium tumefaciens been made as a useful cloning vector to transfer DNA to plant cells.
63. How does silencing of specific mRNA in RNA interferenceprevent parasitic infection?
64. How are tobacco plants benefited when specific genes are introduced into them using certain vectors? Name the
vectors used.
65.What is gene therapy? Name the first clinical case in which it was used.
66. Why does Bt toxin not kill the bacterium that produces it, but kill the insect that ingests it ?
OR
Why do the toxic insecticidal proteins secreted by Bacillus thuringinesis kill the insect and not the bacteria itself.
67. Explain how Eli Lilly, an American company, produced insulin by recombinant DNA technology.
68. What do ‘cry genes’ in Bacillus thurigensis code for? State its importance for cotton crop.

69. Human insulin when synthesised in the body needs to be processed before it can act. Explain giving reasons.
70. Write any two ways how genetically modified plants are found to be useful?
71. Name the disease that was first to get the gene therapy treatment. Write the cause of the disease and the effect it has
on the patient.
72. Why is proinsulin so called? How is insulin different from it?
73. (i) State the role of DNA ligase in biotechnology.
(ii) What happens when Meloidogyne incognita consumes cells with RNAi gene?
74. (i) Mention the cause and the body system affected by ADA deficiency in humans.
(ii) Name the vector used for transferring ADA – DNA into the recipient cells in humans. Name the recipient cells.
75. Explain how a hereditary disease can be corrected. Give an example of the first successful attempt made towards
correction of such disease?
OR
How is gene therapy being used in treating ADA deficiency patients?
76. How is recombinant DNA technology help in detecting the presence of mutant gene in cancer patients?
77. Explain the process of RNA interference.
78. Why is the introduction of genetically engineered lymphocytes into an ADA deficiency patient not a permanent
cure? Suggest a possible permanent cure.
79. How did Eli Lilly synthesise the human insulin? Mention one difference between this insulin and the one produced
by the human pancreas.
80. How is Bt cotton made to attain resistance against bollworm?
81. Highlight any four advantages of Genetically Modified Organisms (GMO S ¿.
82. List the three molecular diagnostic techniques that help to detect pathogens from suspected patients, Mention one
advantage of these techniques over conventional methods.
83. How did the process of RNA interference help to control the nematode from infecting the roots of tobacco plants.
84. Name the host plant and its part that Meloidogyne incognita infects . Explain the role of Agrobacterium in the
production of ds RNA in the host plant.
85.Name the pest that destroys the cotton bolls. Explain the role of Bacillus thuringiensis in protecting the cotton crop
against the pest to increase the yield.
OR
How is the Bt cotton plant created as a GM plant? How is it protected against bollworm infestation?
86.Name the genes responsible for making Bt cotton plants resistant to bollworm attack How do such plants attain
resistance against bollworm attacks. Explain.
87. (i) Tobacco plants are damaged severely when infested with Meloidogyne incognita. Name and explain the strategy
that is adopted to stop this infestation,
(ii) Name the vector used for introducing the nematode specific gene in tobacco plant.
OR
How does RNA interference help in developing resistance in tobacco plant against nematode infection?
88. (i)How has biotechnology helped in producing Meloidogyne incognita resistant tobacco plant?
(ii) Why does this nematode die on eating such a GM plant?
89. (i)Explain the effect of deletion of the gene for ADA in an individual.
(ii) How does the gene therapy help in this case?
90. Plasmis is boon to biotechnology. Justify this statement quoting the production of human insulin as an example.
91. Name the source and the types of cry genes isolated from it for incorporation into crops by biotechnologists.
Explain how have these genes brought beneficial changes in the genetically modified crops.
92. How did Eli Lilly company go about preparing the human insulin? How is the insulin thus, produced different from
that produced by the functional human insulin gene?
93. What are Cry proteins? Name an organism that produces it. How has man exploited this protein to his benefit?
94. i)Name the source from which insulin was extracted earlier. Why this insulin no more in use by diabetic people?
ii) Explain the process of synthesis of insulin by EH Lilly company. Name the technique used by the company.
iii) How is the insulin produced by human body different from the insulin produced by tha above mentioned
company?
OR
i) How is mature insulin different from proinsulin secreted by pancreas in human?
ii) Explain how was human functional insulin produced using rDNA technology.
iii) Why is the functional insulin thus produced considered better than the ones used earlier by diabetic patients?
95. Name the process involved in the production of nematode – resistant tobacco plants, using genetic engineering.
Explain the strategy adopted to develop such plants.
96. One of the main objectives of bio technology is to minimise the use of insecticides on cultivated crops. Explain
with the help of a suitable example, how insect resistant crops have been developed using techniques of
biotechnology.
97. Expand the name of the enzyme ADA.Why is the enzyme essential in the human body? Suggest a gene therapy for
its deficiency.
98. What is ADA deficiency? Describe three methods to cure it.
99. (i) What is plasmid?
(ii) What is meant by ADA deficiency? How is gene therapy a solution to this problem? Why is it not a permanent
cure?
100. (i) Why is Bacillus thurinensis considered suitable for developing GM plants?
(ii) Explain how it has been used to develop GM crops.
101. (i) Why are certain plants called Bt cotton plants?
(ii) Explain how Bt cotton is resistant to pests.
102. What is biopiracy? State the intiative taken by the Indian parliament against it.
103. How have transgenic animals proved to be beneficial in
(i) production of biological products?
(ii) Chemical safety testing?
104. How is ‘Rosie’ considered different from a normal cow? Explain.
105. Biopiracy should be prevented. State why and how?
106. Describe the responsibility of GEAC, set – up by the Indian Government.
107. What are transgenic animals? Explain any four ways in which such animals can be beneficial for humans.

CHAPTER-13
ORGANISMS AND POPULATION
1. Rearrange the following levels in their correct organizational sequence: Landscape Organism, Ecosystem,
Population, Biosphere.
2. What does ecological niche of an organism represent?
3. Define ecotone
4. When and why do some animals like frogs hibernate?
5. Which one of the two, stenothermals and eurythermals, show wide range of distribution on earth and why?
6. List any two adaptive features evolved in parasites enabling them to live successfully on their hosts.
7. When and why do some animals like snails go into aestivation?
8. Why is the polar region not a suitable habitat for tiny humming birds?
9. Mention any two significant roles predation play in nature
10. Name the type of interaction seen between Whale and the Barnacles growing on its back.
11. An orchid plant is growing on the branch of a mango tree. How do you describe this interaction between orchid and
mango tree.
12. How does camouflage help an insect?
13. If 8 individuals in a laboratory population of 80 died in a week, what would be the death rate for population for the
said period?
14. In a pond there were 20 Hydrilla plants. Through reproduction 10 new Hydrilla plants were added in a year.
Calculate the birth rate of the population.
15. In a pond there were 200 frogs. 40 more were born in a year. Calculate the birth rate of the population
16. How do animals like fish and snails avoid summer related unfavourable conditions?
17.Why do predators avoid eating Monarch Butterfly? How does the butterfly develop the protective feature?
18. Why are green plants not found beyond a certain depth in the ocean?
19. Pollinating species of wasps show mutualism with specific fig plants. Mention the benefits the females wasps
derive from the fig trees from such an interaction.
20. Why are cattle and goats not seen browsing on Calotropis growing in the fields?
21. Why are some organisms called eurythermals and some othrs are stenohaline.
22. Write what do phytophagous insects feed on.
23. (i) Cuscuta and Shoeflower
(ii) Orchid growing on Mango tree
(iii) Whale and Barnacle growing on its back.
(iv) Sea Anemone and Hermit Crab
24. Name and explain any three adaptations of mangroves to the conditions prevailing in sunderbans.
25. Explain the relationship between biotic potential and environmental resistance
26. (i) What are tropical rain forests?
(ii) Name any two dominant plant species of such forests in India.
(iii) Why is soil in tropical deciduous forests richer in nutrients than in tropical rain forests?
27. Describe the special adaptations of xerophytes with respect to root system, stem and leaves.
28. What does S-shaped pattern of population growth represent? How is J-shaped pattern different from it and why?
29. How are ephemeral plants adapted to withsand hot and dry environment? Explain.
30. State the relationship of biotic potential and enrironmental resistance.
31. How do organisms manage the stressful conditions existing in their habitat for short duration? Explain with the
help of one example each.
32. Certain species of wasps are seen to frequently visit flowering Fig trees. What type of interaction is seen between
them and why?
33. The “Clown fish” lives among the tentacles of Sea-Anemone. What is this interaction between them called and
why?
34. Egrets are often seen alongwith grazing cattle. How do you refer to this interaction? Give a reason for this
association.
a) Give a reason for this association.
dN/dt=rN
b) How does the increase and the decrease in the value of ‘r’ affect the population size?
35. How does the Mediterranean orchid Ophrys ensure its polluation by bees.
a) How is Cuscuta adapted to be a parasitic plant?
b) Why do cattle avoid browsing on Calotropis plants? Explain
36. What is meant by replacement level? Why is it always slightly higher than two?
37. Name the important defence mechanisms in plants against harbivory.
38. How do organisms like fungi, zooplankton and bears overcome the temporary short - lived climate stressful
conditions? Explain.
39. Differentiate between the following interspecific interactions in a population
(i) Mutualism and competition (ii) Commensalism and amensalism
40. Why are small animals rarely found in the polar regions?
41. Mention four adaptive features that help cacti survive in xeric environment.
42. Name the type of interaction seen in each of the following examples.
(i) Ascaris worms living in the intestine of human. (ii) Wasp pollinating fig inflorescence.
(iii) Clown fish living among the tentacles of sea anemone. (iv)Mycorrhizae living is the roots of higher plants.
(v) Disappearance of smaller barnacles when malanus dominated in the coast of Scotland
43. Water is very essential for life. Write any three features for plants and animals which enable them to survive in
 water scarce environment.
44. How do organisms cope with stressful external environmental conditions which are localized or of short duration?
45. Explain the response of all communities to environment over time.
46. Bear hibernates whereas some species of zooplankton enter diapause to avoid stressful external conditions. How
are these two ways different from each other?
47. How does our body adapt to low oxygen availability at high altitude?
48. Why do Clown Fish and sea anemones pair up? What is their relationship called?
49. Some organisms suspend their metabolic activities to survive in unfavourable conditions. Explain with the help of
any four examples.
50. Explain brood parasitism with the help of an example.
51. Why are small birds like humming birds not found in polar regions? Explain.
a) List any three ways of measuring population density of a habitat.
b) Mention the essential information that can be obtained by studying the population density of an organism.
52. What is the association between bumble bee and its favourite orchid Ophrys? How would extinction or change of
one would affect the other?
53. Give an explanation of the above equation.
a) List any four abiotic components that lead to variations in the physical and chemical conditions of different
habitats
b) Explain the impact of these component on the distribution of organisms in different habitats
54. Draw and explain a logistic curve for a population of density (N) at a time (t) whose intrinsic rate of natural
increase is (r) and carrying capacity (k).
55. Study the graph given below and answer the questions that follow:

(i) Write the status of food and space in the curves (a) and (b).
(ii) In the absence of predators, which one of the two curves would appropriately depict the prey population?
(iii) Time has been shown on X-axis and there is a parallel dotted line above it. Give the significance of this
dotted line.
56. Construct an age pyramid which reflects a stable growth status of human population.
57. Give an example of an organism that enters 'diapause' and why.
58. Some organisms suspend their metabolic activities to survive in unfavourable condition. Explain with the help of
any four examples.
59. Explain the response of all communities to environment over time.
60. Bear hibernates whereas some species of zooplanktons enter diapauses to avoid stressful external conditions. How
are these two ways different from each other?
61. How does our body adapt to low oxygen availability at high altitudes?
62. Why are small animals rarely found in the polar regions? Explain.
63. How do seals adapt to their natural habitat? Explain.
64. Humming birds v live among the bushes in tropics, while penguins live on icebergs, They cannot survive if their
habitats are reversed. Justify
65. How does human body maintain constant temperature both in summers and winters? Explain.
66. (i) State how the constant internal environment is beneficial to organisms.
(ii) Explain any two alternatives by which organisms can overcome stressful external conditions.
67. Water is essential for life. Write any three features both for plants and animals which enable them to survive in
water scarce environment,
OR
 How do organisms cope with stressful external environmental conditions which are localized or of short duration?
68. How do organisms like fungi, Zooplanktons and bears overcome the temporary short – lived climatic stressful
conditions? Explain.
69. The following graph represents the organismic response to certain environmental condition (e.g. temperature)

(i) Which one of these A or B depicts conformers?

(ii) What does the other line graph depict?
(iii) How do these organisms differ from each other with reference to homeostasis?
(iv) Mention the category to which human being.
70. (i) Explain giving reasons why the tourists visiting Rohtang Pass or Mansarovar are advised to resume normal
active life only after a few days of reaching there.
(ii) It is impossible to find small animals in the polar regions. Give reasons.
71.List the different ways by which organisms cope or manage with abiotic stresses in nature. Explain any three ways.
72. (i) List any four abiotic components that lead to variations in the physical and chemical conditions of habitats.
(ii) Explain the impact of these components on the distribution of organisms in different habitats.
73. Describe the mutual relationship between fig free and wasp and comment on the phenomenon that operates in their
relationship.
74.Construct an age pyramid which reflects an expanding growth status of human population.
75. Construct an age pyramid which reflects as stable growth status of human population.
76. Differentiate between commensalism arid mutualism by taking one example each from plants Only.
77. Explain Verhulst – Pearl Logistic Growth of a population.
78. Why do predators avoid eating Monarch butterfly? How does the butterfly develop this protective feature?
79. Comment on the interaction between a clown fish living among the tentacles of a sea anemone.
80. Comment on the interaction between certain species of fig trees and wasps.
81. Name the type of interaction seen between Whale and barnacles growing on its back.
82. How does camouflage helps an insect?
83. Mention any two significant roles predation plays in nature.
84. List two advantages that a mycorrhizal association provides tO the plant.
85. Give one example where population estimation of an organism is done indirectly without actually counting the
organism.
86. Describe the mutual relationship between fig tree and wasp and comment on the phenomenon that operates in their
relationship.
87. Explain mutualism with the help of an example.
88. Provide two reasons that make the count of prokaryotic species difficult.
89.How does Monarch butterfly defend itself from predators? Explain.
90. Why do clown fish and sea anemone pair up? What is this relationship called?
91. Explain brood parasitism with the help of an example.
92. How does the floral pattern of mediaterranean orchid Ophrys guarantee cross – pollination?
93. How do plants benefit from having mycorrhizal symbiotic association?
94. Mention the changes the Koel must have undergone in order to achieve brood parasitism, during the course of
evolution.
95. Explain the two defense mechanisms evolved in preys to avoid overpopulation of their predator.
96. Egrets are often seen along with grazing cattle. What do you refer to this interaction? Give a reason for this
association.
97. (i) What is r in the population equation below dN/ dt = rN
(ii) How does the increase and the decrease in the value of r affect the population size?
98. (i) How is Cuscuta adapted to be a parasitic plant?
(ii) Why do cattle avoid grazing on Calotropis plants? Explain.
99. Identify the curves A and B shown in the graph given below. List the conditions responsible for growth patterns A
and B.

100. In a pond, there were 40 lotus plants. After a year, the number rose to 56. Calculate birth rate of a lotus plant.
101. Name the interaction in each of the following
(i) Cuscuta growing on a shoe flower plant.
(ii) Mycorrhizae living on the roots of higher plants.
(iii) Clown fish living among the tentacles of sea anemone
(iv) Koel laying her eggs in crow’s nest.
102. Certain species of wasps are seen to frequently visit flowering fig trees. What type of interaction is seen between
them and why?
103. Draw and explain expanding age pyramids of human population. Why is it so called?
104. Explain brood parasitism with the help of an example.
105. (i) Write the importance of measuring the size of a population in a habitat or an ecosystem.
(ii) Explain with the help of an example, how the percentage cover is a more meaningful measure of population
size than mere numbers?
106. (i) Explain death rate in a population by taking a suitable example.
(ii) Write the other two characteristics, which only a population shows but an individual cannot.
107. (i) Explain birth rate in a population by taking a suitable example.
(ii) Write the other two characteristics, which only a population shows but an individual cannot.
108. (i) List any three ways of measuring population density of a habitat.
(ii) Mention the essential information that can be obtained by studying the population density of an organism.
109.Name the type of interaction seen in each of the following examples
(i) Ascaris worm living in the intestine of human.
(ii)Wasp pollinating fig's inflorescence.
(iii)Clown fish living among the tentacles of sea anemone.
(iv) Mycorrhizae living on the roots of higher plants.
(v)Orchid growing on a branch of mango tree.
(vi) Disappearance of smaller barnacles when Balanus dominated in the coast of Scotland.
110. Study the three different age pyramids, for human population given below and answer the questions that follow

i) Write the names given to each of these age pyramids.

ii) Mention the one which is ideal for human population and why?
111. Why is predation required in a community of different organisms?
112. Study the population growth curves shown below

(i) Identify curves A and B.

(ii) Mention the conditions responsible for the curves A and B respectively.
(iii) Give the necessary equation for the curve B.
113. Study the graph below and answer the questions which follow

(i) The curve A is represented by the equation dN/dt=rN represent in the equation and what is its importance?
(ii) Which one of the two curves is considered a more realistic one for most of the animal population.
(iii) Which curve would depict the population of a species of deer if there are no predators in the habitat? Why
is it so?
114. (i) Name the population growth pattern the equation {dN/dt=rN} represents. What does ‘r’ represent in the
equation ? Write its importance in population growth.
(ii) Explain the principle of carrying capacity by using population Verhulst – Pearl logistic growth curve.
115. What is the association between the bumble bee and its favourite orchid Ophrys? How would extinction or change
of one affect he other?
116. (i) What is an age pyramid?
(ii) Explain with the help of figures, the three different types of age pyramids represented by human population.
117. (i) Explain the birth rate and death rate in the population with the help of an example each.
(ii) What is age pyramid? Draw an age pyramid of an expanding population.
118. Draw and explain a logistic curve for a population of density (N) at time (it) whose intrinstic rate of natural
increase in (r) and carrying capacity (K).
119. (i) Why are herbivores considered similar to predators in the ecological content? Explain.
(ii) Differentiate between the following interspecific interactions in a population
a) Mutualism and competition b) Commensalism and amensalism
120. (i) Explain with the help of a graph the population growth curve when resources are (A) limiting (B) not limiting.
(ii) Nature has a carrying capacity for a species. Explain.
 CHAPTER-14
ECOSYSTEM
1. What does secondary productivity in an ecosystem indicate? List any two factors by which productivity is limited
in aquatic system.
2. State the differences between the first trophic levels of detritus food chain and grazing food chain.
3. Name the pioneer species on a bare rock. How do they help in establishing the next type of vegetation? Mention
the type of climax community that will ultimately get established.
4. Construct an ideal pyramid of energy when 1,000,000 joules of sunlight is available. Label all the trophic levels.
5. Name the pioneer and climax species in a water body. Mention the changes observed in the biomass and the
biodiversity of the successive seral communities developing in the water body.
6. Construct a pyramid of biomass starting with phytophlankton. Label three trophic levels. Is the pyramid upright
or inverted? Why
7. What is primary productivity? Give the range of primary productivity in different ecosystems of the world.
8. Name the type of food chains responsible for the flow of larger fraction of energy in an aquatic and a terrestrial
ecosystem respectively. Mention one difference between the two food chains.
9. Why are herbivores considered similar to predators in the ecological context?
10. List the features that make a stable biological community
11. Explain the function of ‘reservoir’ in a nutrient cycle. List the two types of nutrient cycles in nature.
12. Explain with the help of two examples, how the pyramid of numbers and pyramid of biomass can look inverted.
13. Describe the process of decomposition of detritus under the following heads: Fragmentation, reaching, catabolism,
humification and mineralization.
14. (a) Trace the succession of plants on a dry bare rock.
(b) How does phosphorus cycle differ from carbon cycle.
15. Draw the pyramids of biomass in a sea and in a forest. Explain giving reasons why the two pyramids are different.
(b) Pyramid of energy is always upright. Explain
16. (a) Explain primary productivity and the factors that influence it.
(b) Describe how do oxygen and chemical composition of detritus control decomposition.
17. (a) Healthy ecosystems are the base of wide range of (ecosystem) services. Justify.
(b) Explain the differences and similarities between hydrarch and xerarch
18. (a) Explain the significance of ecological pyramids with the help of an example.
(b)Why are the pyramids referred to as upright or inverted Explain
19. How does primary succession start in water and lead to the climax community? Explain.
20.(i) What is primary productivity ? Why does it vary in different types of ecosystems?
(ii) State the relation between gross and net primary productivity.
21.Apart from being a part of the food chain, predators play other important roles. Mention any two such roles
supported by examples.
22.How is 'stratification' represented in a forest ecosystem?
23. Differentiate between a detritivore and a decomposer giving an example of each.
24. (i) What is primary productivity? Why does it vary in different types of ecosystem.
(ii) State the relation between gross and net primary productivity.
25. How is detritus decomposed step – by – step by different agents and made available as nutrients to the plants?
Explain.
OR
Describe the process of decomposition of detritiis under the following heads fragmentation, leaching, catabolism,
humification and mineralization.
26. (i) Explain primary productivity and the factors that influence it.
(ii) Describe how do oxygen and chemical composition of detritus control decomposition?
27. A part from being a part of food chain, predators play other important roles. Mention any two such roles supported
by examples.
28. It is possible that a species may occupy more than trophic level in the same ecosystem at the same time. Explain
with the help of one example.
29. Name the type of food chains responsible for the flow of larger fraction of energy in an aquatic and a terrestrial
ecosystem respectively. Mention one difference between the two food chains.
30. Explain standing crop in an ecosystem. Draw a pyramid of biomass when a small standing crop of phytoplanktons
supports a large standing crop of zooplankton in the sea.
31. Construct a grazing food chain and detritus food chain using the following five links each. Earthworm, bird, snake,
Vulture, grass, grasshopper, frog, decaying plant matter.
32. Differentiate between two different types of pyramids of biomass with the help of an example.
33. Name the pioneer species on a bare rock. How do they help in establishing the next type of vegetation? Mention
the type of climax community that will ultimately get established.
34. Construct a pyramid of biomass starting with phytoplanktons, label three trophic levels. Is this upright or inverted ?
Why?
35. Define a climax community. How does a sere differ from a serai community?
36. (i) Differentiate between primary and secondary ecological successions.
(ii) Explain the different steps of xerarch succession occurring in nature.
37. (i) With suitable examples, explain the energy flow through different trophic levels. What does each bar in this
pyramid represent?
(ii) Write any two limitations of ecological pyramids.
38. Explain how does a primary succession start on a bare rock and reach a climax community?
39. (i) Draw a pyramid of numbers of a situation, where a large population of insects feed upon a very big tree. The
insects in turn, are eaten by small birds which in turn are fed upon by big birds.
(ii) Differentiate giving reasons, between the pyramid of biomass of the above situation and the pyramid of
numbers that you have drawn.
40. (i) Explain the significance of ecological pyramids with the help of an example.
(ii) Why are the pyramids referred to as upright or inverted? Explain.
41. (i) Draw the pyramids of biomass in a sea and in a forest. Explain giving reason, why the two pyramids different.
(ii) Pyramid of energy is always upright. Explain.
42. (i) Explain how a hydrarch succession progresses from hydric to mesic condition from a stable community?
(ii) Why is the rate of secondary succession faster than that of primary succession?
43. Explain how succession progresses from xeric to mesic condition and form a stable climax community. You may
use a flow chart.
44. All successions proceed to a similar climax community, the mesic.
45. Explain the function of reservoir in nutrient cycle. List the two types of nutrients cycles in nature.
46. Name the two types of nutrient cycles existing in nature. Where are their reservoirs present? State the function of
reservoirs.
47. State the function of a reservoir in a nutrient cycle. Explain the simplified model of carbon cycle in nature.
48. (i) Draw a simplified model of phosphorus cycling in a terrestrial ecosystem.
(ii) Write the importance of such cycles in ecosystems.
49. Carbon cycle in nature is a biogeochemical event. Explain.
50. What does the term standing state of soil signify? How are the nutrients recycled in the ecosystem? Write a cyclic
account of carbon movement imnature.
51. (i) Healthy ecosystems are the base of wide range of (ecosystem) services. Justify
(ii) Explain the differences and the similarities between hydrarch and xerarch successions of plants.
52. (i) Trace the succession of plants on a dry bare rock,
(ii) How does phosphorus cycle differ from carbon cycle?

CHAPTER 15
BIODIVERSITY AND CONSERVATION
1. Expand IUCN
2. What does the term genetic diversity refer to ? What is the significance of large genetic diversity in a population ?
3. India has more than 50,000 strains of rice. Mention the level of biodiversity it represents
4. Write the importance of cryopreservation in conservation of biodiversity
5. Why is Eichhorniacrassipes nicknamed “Terror of Bengal”.
6. What is cryopreservation ? Give its one use.
7. What is biodiversity ? Why is it matter of concern now?
8. What is alpha/beta diversity in an ecosystem ? What is the significance of large genetic diversity in a population ?
9. What are exotic species ? Explain with the help of two examples how the exotic species disturb the native species of
an ecosystem.
10. A particular species of wild cat is endangered. In order to save it from extinction which is desirable approach, in
situ or ex situ ? Justify your answer and explain the difference between the two approaches.
11. In the biosphere immense biological diversity exists at all levels of biological organization. Explain any two levels
of biodiversity.
12. Biodiversity must be conserved as it plays an important role in many ecosystem services that nature provides.
Explain any two services of the ecosystem.
13. Why certain regions have been declared as biodiversity “ hot spot” by environmentalists of the world ? Name any
two “hot spot” regions of India.
14. Giving two reasons explain why there is more species biodiversity in tropical latitudes than in temperate ones.
15. Alien species are a threat to native species. Justify taking examples of an animal and a plant alien species.
16. Justify with the help of an example where a deliberate attempt by humans had led to the extinction of a particular
species.
17. State the use of biodiversity in modern agriculture
18. Differentiate between in situ and ex situ approaches of conservation of biodiversity.
19. Explain giving an example how extinction is one of the causes of loss of biodiversity List the three other causes
also (without description).
20. Explain ‘river popper’ hypothesis. Name the ecologist who proposed it.
21. Alien species are highly invasive and are threat to indigenous species. Substantiate this statement with any three
examples.
22. List the reasons that account for the greater biological diversity in tropics.
23. What are the two types of desirable approaches to conserve biodiversity? Explain with examples bringing out the
difference between the two types.
24. a) Taking one example each of habitat loss and fragmentation, explain how are the two responsible for biodiversity
loss.
b) Explain two different ways of biodiversity conservation.
25. List four causes of biodiversity loss.
26. What is meant by alien species invasion? Name one plant and one animal alien species that are a threat to our
Indian native species.
27. Justify with the help of an example where a deliberate attempt by humans has led to the extinction of a particular
species.
28. The given graph shows species – area relationship. Write the equation of the curve A and explain.

29. With the help of an example, explain how alien species invasion causes biodiversity loss?
OR
Alien species are a threat to native species. Justify taking examples of an animal and a plant alien species.
OR
Sometimes alien species affect the indigenous organisms leading to their extinction. Substantiate this statement
with the help of any two examples.
30. Giving two reasons explain why there is more species biodiversity in tropical latitudes than in temperate ones.
31.In the biosphere, immense biological diversity exists at all levels of biological organisation. Explain any two levels
of biodiversity.
32. List the features that make a stable biological community.
33. Write any two hypothesis put forth by ecologists explaining the existence of greater biodiversity in tropical regions
than in temperate regions.
34.Name the sociobiologist who popularized the term biodiversity. Identify the levels of biodiversity in India
represented by
 Diversity among amphibian in Eastern and Western Ghats
 50,000 strains of rice in India
 Presence of deserts, mangroves and coral reefs of India.
35. Observe the global biodiversity distribution of major plant taxa in the diagram and answer the questions that
follow.

 Which group of plants are the most endangered?

 Why are mosses/ fems so few? Give reason.
 How do fungi that are heterotrophs sustain themselves as a large population?
 Which group of plants is most advanced and which one is most primitive?

36.The following graph shows the species – area relationship. Answer the following questions as directed.

i) Name the naturalist who studied the kind of relationship in the graph. Write the observations made by him.
ii) Write the situations as discovered by the ecologists when the value of Z. (slope of the line) lies between
 1 and 0.2
 6 and 1.2
What does Z stand for?
iii) When would the slope of the line ‘b’ become steeper?
37. Explain give three reasons, why tropics show greatest levels of species diversity?
OR
List the reasons that account for the greater biological diversity in tropics.
38. Alien species are highly invasive and are a threat to indigenous species. Substantiate this statement with any three
examples.
39.Explain by giving example, how co – extinction is one of the causes of loss of biodiversity? List the three causes
also (without description).
40. Explain rivet hypothesis. Name the ecologist who proposed it.
41. Why are
* alien species invasion and
* loss of habitat and fragmentation considered to be the major cause of loss of biodiversity? Explain with the
help of one example each.
42. State the uses of biodiversity in modern agriculture.
43. Differentiate between insitua nd exsitu approaches of conversation of biodiversity.
44. Biodiversity must be conserved as it plays an important role in many ecosystem services that nature provides.
Explain any two services of the ecosystem.
45. Why certain region have been declared as biodiversity hotspots by environmentalists of the world? Name any two
hot spot regions of India.
46. There are many animals that have become extinct in the wild but continue to be maintained in Zoological parks.
* What type of biodiversity conservation is observed in this case?
* Explain any other two ways which help this type of conservation.
47. White Bengal tigers are protected in special settings in zoological parks. Tiger reserves are maintained in Western
Ghats.
 How do these two approaches differ from each other? Mention the advantages of each one.
 What is the significance of cryopreservation technique?
48. (i) Why is there a need to conserve biodiversity?
(ii) Name and explain any two ways that are responsible for the loss of biodiversity.

CHAPTER 16
ENVIRONMENTAL ISSUES
1. Name any three gases contributing to green house effect.
2. Which type of UV radiations can be lethal to organims ?
3. In which part of atmosphere is ozone layer found ?
4. Name the world’s most problematic aquatic weed. What is the nature of water body in which the weed grows
abundantly ?
5. Between amphibians and birds, which will be able to cope with global warming ? Give reason
6. BOD of two samples of water A and B were 120 mg/L respectively. Which sample is BOD of two samples of water
A and B were 120 mg/L respectively. Which sample is more polluted ?
7. Mention the information that the health workers derive by measuring BOD of a water body.
8. Name two green house gases produced by anaerobic microbes.
9. Why is the use of unleaded petrol recommended for motor vehicles equipped with catalytic converter ?
10. Write the unit used for measuring ozone thickness.
11. How do algal blooms effect the life in water bodies ?
12. Why is it desirable to use only unleaded petrol in vehicles fitted with catalytic converters?
13. Mention the effect of global warming on the geographical distribution of stenothermals like amphibians.
14. Many villagers near industrial area suffer from “blue baby syndrome”. How is this problem caused ?
15. What gases cause stratospheric ozone depletion ? What is the result of this depletion?
16. What is photochemical smog composed of ? How does this affect the plants ?
17. What is optimum percentage of forest area recommended by National Forest Policy (1988) for the plains and hills
respectively ? List any four problems caused due to be deforestation .
18. What is eutrophication ? Explain its consequences on the life of plants and animals living in such waters. Why is
oxygen depletion in eutrophicated water faster at night than during the day ?

19. Name and define the environment related terms

(i) DDT accumulated in a three step food chain will be maximum in secondary consumer
(ii) Pertaining to causing algal bloom.
20. What is biological magnification ? Explain how DDT as a water pollutant undergoes biological magnification
21. Thermal power plants are inevitable in an industrial and densely populated country like ours. What harm, do they
do to the environment ? Also mention any precaution that could be taken to save the environment.
22. It has been recorded that the temperature of the earth’s atmosphere has increased by 0.60 C
23. DDT content in the water of lake that supplies drinking water to the nearby villages, is found to be 0.003ppm. The
king fishers of that area reported to have 2.0 pm of DDT. Why has the concentration increased in these birds ? What
harm will this cause to the bird population ? Name the phenomenon.
24. A factory drains its waste water in nearby lake. It has caused algal bloom (a) How has the algal bloom been
caused? (b) What would be the consequences? (c) name the phonomenon that caused it.
25. Explain accelerated eutrophication. Mention any two consequences of this phenomenon.
26. A crane had DDT level as 5ppm in its body. What would happen to the population of such birds? Explain giving
reasons.
27. Explain the causes of global warming. Why is it a warning to making?
28. Explain the causes of algal bloom in a water body. How does it affect an ecosystem ?
29. a) Why are the colourfulpolysterene and plastic packages used for protecting the food considered an environmental
menace ?
b) Write about the remedy found for the efficient use of plastic waste by Ahmed Khan of Bangalore.
30. Explain giving reason why thermal plants are not considered ecofriendly ?
31. List any four factors which determine the amount of dissolved oxygen in water. Explain in brief the harmful effects
of nitrate, fluoride and arsenic salts in groundwater on humans.
32. a) What depletes ozone in the stratosphere ? How does this affect human life ?
b) Explain bio magnificationof DDT in an aquatic food chain. How does it affect the bird population ?
33. a) Name the green house gases. How do they affect the life on earth ?
b) Describe the causes of eutrophication of a lake
34. Write the name of the organism that is referred to as the 'Terror of Bengal'.
\