Biodegradation (2009) 20:95–107

DOI 10.1007/s10532-008-9203-5

ORIGINAL PAPER

Dynamics of microbial community during bioremediation

of phenanthrene and chromium(VI)-contaminated soil
microcosms
Agustı́n Ibarrolaza Æ Bibiana M. Coppotelli Æ
Marı́a T. Del Panno Æ Edgardo R. Donati Æ
Irma S. Morelli

Received: 14 September 2007 / Accepted: 11 June 2008 / Published online: 5 July 2008
Ó Springer Science+Business Media B.V. 2008

Abstract The combined effect of phenanthrene and gel electrophoresis (DGGE) patterns of each soil micro-
Cr(VI) on soil microbial activity, community composi- cosm, showing that the presence of different Cr(VI)
tion and on the efficiency of bioremediation processes concentrations did modulate the community response to
has been studied. Biometer flask systems and soil phenanthrene and caused perdurable changes in the
microcosm systems contaminated with 2,000 mg of structure of the microbial soil community.
phenanthrene per kg of dry soil and different Cr(VI)
concentrations were investigated. Temperature, soil Keywords Bioremediation
Phenanthrene

moisture and oxygen availability were controlled to Chromium
Microbial community
support bioremediation. Cr(VI) inhibited the phenan-
threne mineralization (CO2 production) and cultivable
PAH degrading bacteria at levels of 500–2,600 mg
kg-1. In the bioremediation experiments in soil micro- Introduction
cosms the degradation of phenanthrene, the dehydro-
genase activity and the increase in PAH degrading Large quantities of organic and inorganic compounds
bacteria counts were retarded by the presence of Cr(VI) are released into the environment every year as a
at all studied concentrations (25, 50 and 100 mg kg-1). result of human activities (Viñas et al. 2005).
These negative effects did not show a correlation with Bioremediation of contaminated sites relies on the
Cr(VI) concentration. Whereas the presence of Cr(VI) immense metabolic capacities of the microbial world
had a negative effect on the phenanthrene elimination for the transformation of pollutants into essentially
rate, co-contamination with phenanthrene reduced the harmless or at least less dangerous compounds (El
residual Cr(VI) concentration in the water exchange- Fantroussi and Agathos 2005).
able Cr(VI) fraction (WEF) in comparison with the Soil contamination is a typical side-effect of
soil microcosm contaminated only with Cr(VI). Clear industrial activity (Viñas et al. 2005). Soils are
differences were found between the denaturing gradient complex, multi-component systems with a range of
different types of contaminants co-existing in different
A. Ibarrolaza (&)
B. M. Coppotelli
M. physical and chemical forms. Despite this complexity,
T. Del Panno
E. R. Donati
I. S. Morelli organic contaminants and toxic metals are frequently
Centro de Investigación y Desarrollo en Fermentaciones studied separately and their interactions, as well as the
Industriales, CINDEFI (UNLP; CCT-La Plata, effects that remediation procedures may have on both
CONICET), Calle 50 y 115, La Plata, Buenos Aires 1900,
Argentina type of contaminants, have been neglected (Amezcua-
e-mail: [email protected] Allieri et al. 2005).

123
96 Biodegradation (2009) 20:95–107

Polycyclic aromatic hydrocarbons (PAH) are pol- loam, a pH of 5.8, 3.60% organic carbon, 6.21%
lutants that are widely distributed in the ecosphere as soil organic matter, 2,960 mg kg-1 total nitrogen,
a result of fossil fuel combustion and as by-products 4.2 mg kg-1 available phosphorus, 50 mg kg-1
of industrial activities (Déziél et al. 1996). These hydrocarbons and a Cr(VI) concentration of less than
ubiquitous organic pollutants exhibit strong carcino- 0.7 mg kg-1.
genic and toxic properties (Maliszewska-Kordybach
and Smreczak 2003). It is estimated that more than Biometers
90% of the total burden of PAH resides are in the
surface soils, where most of these compounds The effects of the Cr(VI) concentration on phenan-
accumulate (Wild and Jones 1995). The microbial threne-induced mineralization and cultivable
degradation of PAH has received a great deal of bacterial populations were preliminary determined
attention as a possible strategy for the bioremediation in biometer flasks (Bartha and Pramer 1965). Six
of PAH-contaminated soils (Johnsen et al. 2002). systems contaminated with different Cr(VI) concen-
However, soils contaminated with PAH often contain trations (incorporated as K2CrO4) (0, 25, 50, 500,
high levels of other pollutants such as heavy metals, 1,300 and 2,600 mg kg-1 of dry soil) were prepared.
which are often derived from the same sources as Three replicates of each system were placed into the
PAH (Maliszewska-Kordybach and Smreczak 2003). biometer flasks (50 g of dry soil). The flasks were
Among the heavy metals, chromium is a priority incubated at 24 ± 2°C. After one week all biometer
pollutant due to the toxicity and carcinogenicity of its systems were contaminated with 2,000 mg of phen-
hexavalent form [Cr(VI)] (Kouretev et al. 2006). anthrene (Carlo Erba, Milano, Italy, [99.5% purity)
Cr(VI) is also toxic to the microbial community per kg of dry soil.
present in the soil and it could inhibit the biodegra- The CO2 production during the course of 60 days
dation of organic pollutants in co-contaminated sites of treatment was determined. The CO2 produced was
(Said and Lewis 1991). Cr(VI) in soils can be reduced trapped in 10 ml of 0.6 M KOH. Periodically the
chemically or through the activity of soil microor- KOH was replaced by fresh KOH solution. The
ganisms (Kamaludeen et al. 2003). The microbial removed KOH was titrated to the phenolphthalein
reduction of hexavalent chromium to relatively less endpoint with standard HCl.
toxic and less soluble trivalent forms seems to be a The mean and standard deviation of triplicate
potential method for the remediation of Cr(VI)- independent experiments were calculated. The mean
contaminated soils (Krishna and Philip 2005). values were compared by parametric one way
In the study described here our objectives were to ANOVA test at the level of P B 0.05. All statistical
examine the combined effect of phenanthrene and analysis were performed using the software 5.0
Cr(VI) on soil microbial activity and soil microbial SystatÒ under WindowsÒ (Evanston. IL, USA).
community composition, and to assess the influence
of each pollutant on the bioremediation processes of Soil microcosms
the other component. Soil microcosms contaminated
with 2,000 mg of phenanthrene per kg of dry soil and Soil microcosms consisted of 2 kg of sieved soil
different Cr(VI) concentrations were studied. (2 mm mesh) in a glass container with a capacity of
5 kg. The Cr(VI) concentrations for the preparation
of the microcosms were chosen according to the
Materials and methods results obtained in the biometer systems. Concentra-
tions that did not produce marked inhibitory effects
Soil on phenanthrene-induced mineralization and on the
counts of cultivable bacterial populations were cho-
The soil selected for the study was uncontaminated sen. Six soil microcosms were carried out in duplicate
soil from an area near La Plata City, Argentina. The trays: ‘‘C’’ uncontaminated soil; ‘‘F’’ contaminated
soil was analyzed in the Laboratory of Soil Science at with 2,000 mg of phenanthrene per kg of dry soil;
the University of La Plata and showed the following ‘‘Cr100’’: contaminated with 100 mg of Cr(VI) per
physicochemical properties: the texture is a clay kg of dry soil; ‘‘F-Cr25’’, ‘‘F-Cr50’’ and ‘‘F-Cr100’’

123
Biodegradation (2009) 20:95–107 97

contaminated with phenanthrene (2,000 mg kg-1) Microbial enumeration and biological activity
and 25, 50 and 100 mg kg-1 of Cr(VI), respectively.
In addition, one soil microcosm contaminated with Cultivable bacterial counts were determined after 4,
phenanthrene (2,000 mg kg-1) and Cr(VI) (100 mg 18, 38 and 120 days of treatment from soil micro-
kg-1) was amended with HgCl2 (1.5% wt wt-1) cosms and at the end of experiment (60 days) from
(Song et al. 1990) for the determination of abiotic biometer systems.
processes (abiotic control). For this purpose, 10 g (wet mass) of soil sample
Cr(VI) in solution as K2CrO4 (10 mg of Cr(VI) per suspended in 100 ml of 0.85% NaCl was homoge-
ml) was evenly dispersed in soil microcosms. The nized for 30 min on a rotary shaker (250 rpm).
phenanthrene was delivered in an acetone solution Samples (0.1 ml) of 10-fold dilutions were spread on
and mixed into the soil manually with a spatula. The plates containing R2A-agar medium (Reasoner and
microcosms were incubated at 24 ± 2°C (regional Geldreich 1985) in order to count cultivable hetero-
climate conditions) in the dark for 130 days. The trophic bacteria, and on R2A-agar supplemented with
microcosms were aerated every week by manual 500 mg l-1 of Cr(VI) as K2CrO4 to count cultivable
mixing and the moisture content of the soil was Cr(VI)-resistant heterotrophic bacteria (Bader et al.
corrected when necessary to 20 ± 2% by the addition 1999). The agar plates were incubated at 24 ± 2°C
of distilled water. for 10 days. The MPN of PAH-degrading bacteria
was determined in 96-well microtiter plates accord-
Chemical analysis ing to Wrenn and Venosa (1996). A mixture of four
PAH was used as carbon source (10 g phenanthrene,
A soil sample (25 g) was mixed with anhydrous 1 g anthracene, 1 g fluorene and 1 g dibenzothio-
sodium sulfate (25 g) and hydrocarbons were phene per l). The plates were incubated for 3 weeks
extracted for 6 h with n-hexane in a Soxhlet appa- at 20 ± 2°C.
ratus; n-hexadecane (Merck, Schuchardt, Germany) Dehydrogenase activity (reduction of 2,3,5-tri-
was added as the internal standard. During the first phenyl-2H-tetrazoliumtrichloride, TTC, to triphenyl
month of the experiment the determinations were formazan, TPF), usually related to the cell density of
performed weekly and thereafter at 50, 75 and viable microorganisms and their oxidative capability,
120 days. Three samples (25 g) from each soil was determined from the soil microcosm systems as
microcosm were analyzed at each sampling time. described by Thalman (1968). The determinations
The phenanthrene concentration in the soil samples were performed weekly during the first 34 days and
was quantified by GC-FID. A Perkin-Elmer autosys- thereafter at 66 and 125 days. Three samples (5 g)
tem gas chromatograph equipped with a flame from each microcosm were analyzed at each sam-
ionization detector was used with nitrogen as the pling time. The influence of the added phenanthrene
carrier gas. The injection port was maintained at a and/or Cr(VI) on the enzymatic activity was deter-
temperature of 280°C and the detector at a temperature mined by subtracting the TPF formation obtained in
of 300°C. The oven was set at 50°C (initial time 4 min), the control microcosm from the TPF formation
then raised to 150°C (rate 4°C min-1) and to 280°C at a obtained in the contaminated microcosms.
rate of 10 °C min-1 (final time 15 min). A fused-silica
capillary column PVMS/54 (50 m 9 0.25 mm i.d.) Genetic diversity
was used. Data acquisition and handling was com-
puter-assisted (PE NELSON Model 1022) (Vecchioli In order to investigate the changes in the genetic
et al. 1997) diversity of the soil microbial community caused by
The amount of soluble Cr(VI) was determined phenanthrene contamination, Cr(VI) contamination
spectrophotometrically using the diphenylcarbazide and co-contamination with phenanthrene and Cr(VI),
assay (Clesceri et al. 1998). Samples of 1.5 g of each DGGE was performed for the C, Cr100, F, F-Cr25,
soil microcosm contaminated with Cr(VI) were F-Cr50 and F-Cr100 soil microcosms at different
extracted by shaking for 16 h with distilled water treatment times.
(10 ml) to measure the water exchangeable Cr(VI) The total DNA was extracted from 2 g soil
fraction (WEF). aliquots from each soil microcosm after 38, 75 and

123
98 Biodegradation (2009) 20:95–107

123 days of treatment, as described by Kuske et al. the Unweighted Pair Group Method with Arithmetic
(1997). The DNA pellets obtained were suspended in mean (UPGMA) (Sokal and Michener 1958).
100 ll of TE buffer, with humic acid contaminants
removed using Genomic-tips (20/G) from Qiagen
(Qiagen Inc., Chatsworth, CA, USA). Results
Genetic diversity analysis of the soil microcosm
bacterial community was performed at every sam- Effects of Cr(VI) concentration on phenanthrene-
pling point by PCR amplification of bacterial 16S induced mineralization and cultivable bacterial
rDNA fragments followed by DGGE (denaturing populations
gradient gel electrophoresis).
The 16S rDNA was amplified using eubacteria During the first 7 days of incubation, when only Cr(VI)
primers GC-341F (50 -CGCCCGCCGCGCCCCGC solution had been added to biometer systems (B-FCr),
GCCCGGCCCGCCGCCCCCGCCCCCTCCTACGG all systems showed an increase in the CO2 production
GAGGCAGCAG-30 ) and 907R (50 -CCGTCAATTCC rate and this was followed by a decrease (Fig. 1). The
TTTGAGTTT-30 ) (Muyzer et al. 1998) cumulative CO2 evolved during this period was sig-
The PCR reactions contained 1 ll of DNA, 1 U of nificantly higher (P \ 0.05) in all Cr(VI)-contami-
AmpliTaq, the manufacturers’ recommended buffer nated systems compared with the reference system
as supplied with the polymerase enzyme, 200 mM of (B-F). The initial rates of CO2 production were
BSA, 0.2 mM dNTPs and 20 pM of each primer in a undistinguishable regardless of the level of Cr(VI)
total reaction volume of 50 ll. Amplification was contamination (Fig. 1). Only the highest Cr(VI) con-
performed on a Progene FPROGO5Y thermocycler centration (B-FCr2600 system) showed different
(Techne, Burlington, NY, USA) using a step-down dynamics, with a lag phase of 4 days before the
PCR. The programme included an initial denaturation increase in the CO2 production rate.
step for 4 min at 95°C, the first cycle step at 94°C for After 7 days of treatment, when systems were
30 s; 62°C for 40 s; and 1 min at 72°C (10 cycles), spiked with phenanthrene, the B-FCr25, B-FCr50 and
followed by a step down of 30 s at 94°C, 40 s at B-FCr500 had reached a basal respiration rate and
57°C; and 72°C for 1 min (25 cycles). The final the CO2 production rate in B-FCr1300 and
extension was carried out at 72°C for 10 min. The B-FCr2600 had started to decrease. Phenanthrene
PCR products were analyzed by agarose gel electro- mineralization was detected in B-F, B-FCr25 and
phoresis and purified using a QIAquick PCR B-FCr50 systems 18 days after phenanthrene incor-
Purification Kit (Qiagen Inc., Chatsworth, CA, USA). poration and the respiration rate of B-FCr25 and
DGGE was performed on a BioRad D GENE B-FCr50 systems was not different from that of the
System (BioRad, Munich, Germany). The purified B-F system. In the B-FCr500 system the respiration
PCR-amplicons were directly applied onto 6% (wt vol- rate did not increase until 35 days after the addition
1) polyacrylamide gels (acrylamide-N,N0 -methylen- of phenanthrene and a significant reduction in
bisacrylamide, 37.5:1). The gel contained a linear phenanthrene-induced mineralization was observed.
gradient of 30–65% denaturant (100% denaturant In the B-FCr1300 and B-FCr2600 systems phenan-
corresponds to 7 M urea and 40% (vol vol-1) form- threne mineralization was not detected at any time
amide). Electrophoresis was performed in 1 9 TAE during the experiment.
buffer (40 mM Tris (pH 8.1), 20 mM acetic acid, In accordance with the inhibitory effect on phen-
1 mM Na2EDTA) at a temperature of 60°C. A pre-run anthrene-induced mineralization, the numbers of cul-
at 50 V for 30 min was followed by the main run at a tivable bacteria populations in the B-FCr500,
constant voltage of 100 V for 16 h. The post-electro- B-FCr1300 and B-FCr2600 systems were significantly
phoresis gel was stained for 1 h with ethidium bromide lower (P \ 0.05) than those in B-F, B-FCr25 and
and analyzed using a GelComparII software package B-FCr50 (Table 1). In particular, the number of PAH-
(Applied Maths, Kortrijk, Belgium). Similarity degrading bacteria in the systems contaminated with
matrixes of the banding patterns were made with the the highest Cr(VI) concentration was below the
Dice equation and the dendrogram was calculated by detection limits of the method employed.

123
Biodegradation (2009) 20:95–107 99

Fig. 1 CO2 production rate

of F, F-Cr25, F-Cr50, F-
Cr500, F-Cr1300 and F-
Cr2600 biometers flask
systems during 60 days of
incubation. Results are
means of triplicate
independent experiments.
Bars represent standard
deviations. The time of
phenanthrene incorporation
are indicating

Table 1 Counts of different populations of cultivable bacteria of B-F, B-FCr25, B-FCr50, B-FCr500, B-FCr1300 and B-FCr2600
biometers flask systems after 60 days of incubation
Heterotrophic bacteria Cr(VI)-resistant heterotrophic bacteria PAH-degrading bacteria
log CFU g-1 dray soil log CFU g-1 dray soil (%)* log MPN g-1 dray soil

B-F 7.84 ± 0.02 5.44 ± 0.15 (0.40) 6.04 ± 1.51

B-FCr25 7.79 ± 0.10 6.78 ± 0.25 (9.77) 7.14 ± 1.21
B-FCr50 7.13 ± 0.28 6.27 ± 0.20 (9.35) 4.59 ± 1.15
B-FCr500 6.18 ± 0.05 4.64 ± 0.10 (2.89) \3
B-FCr1300 6.22 ± 0.54 4.35 ± 0.12 (1.35) \3
B-FCr2600 5.00 ± 0.20 3.10 ± 0.05 (1.26) \3
*In parenthesis: percentage of cultivable Cr(VI)-resistant heterotrophic bacteria with regard of the cultivable heterotrophic bacteria
population
Each value is the mean of triplicate independent experiments, ± standard deviations are shown

Soil microcosms The F-Cr soil microcosms showed elimination

curves that were different from that of the F soil
Chemical analysis microcosm (Fig. 2). In F-Cr soil microcosms an initial
phase with a low elimination rate (lag phase) occurred,
The concentrations of phenanthrene during the treat- but this lag phase was not correlated with the initial
ment in phenanthrene-contaminated microcosms Cr(VI) concentration. As a result, the F-Cr100 soil
are shown in Fig. 2. After 65 days of treatment the F microcosm reached a phenanthrene concentration
microcosm showed an important level of phenanthrene below the cleanup standards for soil after 85 days of
elimination, reaching a phenanthrene concentration treatment, whereas in the case of microcosms F-Cr25
below the cleanup standards for soil (50 mg kg-1) and F-Cr50 it was necessary over 100 days of
(Argentinean National law 24051), which corresponds treatment to reach that cleanup level. The abiotic
to the removal of about 98% of the initially supplied control showed an elimination level of 15.5 ± 2.7 %
phenanthrene. (data not shown), indicating that the phenanthrene was

123
100 Biodegradation (2009) 20:95–107

Fig. 2 Concentration of
phenanthrene in the
contaminated microcosms
F, F-Cr25, F-Cr50 and F-
Cr100 during
bioremediation process.
Results are means of
duplicate independent
experiments. Bars represent
standard deviations

removed mainly by microbial degradation even in the Enumeration of cultivable bacterial populations
presence of Cr.
The Cr(VI) concentration in soil (WEF) readily The addition of phenanthrene to the soil led to an
decreased in all Cr(VI)-contaminated soil microcosms early increase in the density of cultivable heterotro-
(Fig. 3). After 18 days of treatment, when the Cr(VI) phic and PAH-degrading bacteria in the F soil
concentration did not show significant changes, resid- microcosm (Fig. 4a and b) and these populations
ual Cr(VI) concentration in the WEF was 10.08 ± remained higher than in the control soil microcosm
0.06 mg of Cr(VI) kg-1 for the F-Cr100 soil micro- until the end of treatment, when more than 98% of
cosm, 1.14 ± 0.32 mg of Cr(VI) kg-1 for the F-Cr50 the phenanthrene had been eliminated.
soil microcosm, and less than 0.73 ± 0.07 mg of The contamination with 100 mg kg-1 of Cr(VI)
Cr(VI) for F-Cr25 soil microcosm kg-1, correspond- produced an extremely small initial decrease in the
ing to a decrease in the WEF of 89.92 ± 0.06%, number of cultivable heterotrophic bacteria (Fig. 4a).
97.71 ± 0.64%, and more than 97.09 ± 0.29% Furthermore, selective enrichment in cultivable
respectively. Cr(VI)-resistant heterotrophic bacteria was not
The Cr100 soil microcosm curve showed initial observed throughout the whole experiment (Fig. 4c),
Cr(VI) removal behavior that was not different to that representing only 0.1–5% of the total cultivable
of the F-Cr100 soil microcosm (Fig. 3). However, heterotrophic bacteria population. Similar percentages
after 18 days of treatment, the percentage of Cr(VI) were found in the C soil microcosm (0.2–9%).
elimination in WEF of the Cr100 soil microcosm The F-Cr soil microcosms showed a delayed
was lower (84.6 ± 2.0%) than that observed for the response in terms of the cultivable heterotrophic
F-Cr100 soil microcosm, corresponding to residual and PAH-degrading populations with respect to the
concentration of 15.4 ± 2.0 mg of Cr(VI) kg-1 F soil microcosm (Fig. 4a and b). However, and in
The presence of Cr(VI) caused a negative effect on agreement with the phenanthrene elimination
phenanthrene elimination whereas the co-contamina- results, the response of the measured cultivable
tion with phenanthrene reduced the residual Cr(VI) bacterial populations did not show a correlation
concentration in the WEF. with the initial Cr(VI) concentration. Despite the

123
Biodegradation (2009) 20:95–107 101

Fig. 3 Concentration of
Cr(VI) in the water soluble
fraction of Cr-100, F-Cr25,
F-Cr50 and F-Cr100
microcosms, during the first
30 days of treatment.
Results are means of
duplicate independent
experiments. Bars represent
standard deviations

fact that soil microcosm F-Cr100 showed an initial was observed, with the highest enzymatic activity
inhibitory effect on the cultivable heterotrophic found after 20 days of treatment. The F soil micro-
population, after 18 days of treatment showed a cosm clearly presented the highest dehydrogenase
number of cultivable heterotrophic bacteria (Fig. 4a) activity values.
and PAH-degrading bacteria (Fig. 4b) significantly In contrast, the contamination with Cr(VI) of the
higher than in the F-Cr25 and F-Cr50 soil micro- Cr100 soil microcosm caused a marked inhibitory
cosms. In addition, the number of cultivable PAH- effect on soil dehydrogenase activity throughout the
degrading bacteria for the F-Cr100 soil microcosm whole experiment, except for a short period (about
remained higher than that in the F-Cr25 and F-Cr50 20 days of treatment) when the system showed a
soil microcosms throughout the whole experiment. relative recovery of its enzymatic activity.
In the same way as the Cr100 soil microcosm, The F-Cr soil microcosms showed similar initial
the F-Cr25 and F-Cr50 soil microcosms did not show behavior to the F soil microcosm, but with an
a selective enrichment in the cultivable Cr(VI)- extended initial inhibitory phase and with lower
resistant heterotrophic population, except for F-Cr25 dehydrogenase activity values into the stimulatory
soil microcosm after 120 days of treatment. The period (Fig. 5). Interestingly, once again the response
F-Cr100 soil microcosm showed a progressive selec- of the soil microbial community did not show a
tion of Cr(VI)-resistant heterotrophic bacteria during correlation with the initial Cr(VI) concentration, and
the first 38 days of treatment (Fig. 4c). the F-Cr100 soil microcosm presented higher dehy-
drogenase activity values than the F-Cr25 and F-Cr50
soil microcosms.
Dehydrogenase activity At the end of the experiment the F soil microcosm
reached dehydrogenase activity values that were not
The incorporation of phenanthrene in the F soil significantly different to the control soil, whereas a
microcosm produced an initial inhibitory effect, with persistent inhibitory effect on dehydrogenase activity
levels below the control values during the first 10 days was observed in all Cr(VI)-contaminated soil
of treatment (Fig. 5). A subsequent stimulatory effect microcosms.

123
102 Biodegradation (2009) 20:95–107

Fig. 4 Culturable bacterial

populations in the control
and contaminated
microcosms at 4, 18, 38 and
120 days of treatment. (a)
Heterotrophic culturable
bacteria (log cfu g-1 of dry
soil). (b) PAH degrading
bacteria (log MPN g-1 of
dry soil). (c) Cr(VI)-
resistant heterotrophic
bacteria (log cfu g-1 of dry
soil). Results are means of
duplicate independent
experiments. Bars represent
standard deviations

123
Biodegradation (2009) 20:95–107 103

Fig. 5 Changes in net

dehydrogenase activity of
contaminated microcosms
during the bioremediation
process. The data are
calculated as follows: lg of
TPF (triphenyl formazan)
per g of dry contaminated
soil minus lf of TPF per g
of dry control soil. Results
are means of duplicate
independent experiments.
Bars represent standard
deviations

Genetic diversity

Two replicates per treatment and per sampling time

were analyzed for DNA extraction and there were no
difference in DGGE profiles between them, it is for
that reason that only one set of results are presented.
The DGGE patterns of the C, Cr100, F, F-Cr25, F-
Cr50 and F-Cr100 soil microcosms after 38 days of
treatment, at the end of the rapid elimination phase of
phenanthrene in the F soil microcosm, are shown in
Fig. 6. Visual inspection of the DGGE gel showed the
absence of intense bands in the fingerprint of C and
Cr100 soil microcosms, whereas contamination with
phenanthrene and co-contamination with phenan-
threne and Cr(VI) resulted in dramatic changes in
the genetic diversity of soil microbial community,
with the appearance of some bands with a very high
intensity.
Fig. 6 PCR-DGGE analysis of bacterial populations in soil
Clear differences were found between the DGGE samples of microcosms after 38 days of treatment. 1: F-Cr100;
patterns of the F and F-Cr soil microcosms, showing 2: F-Cr50; 3: F-Cr25, 4: F; 5: Cr100; 6: C
that the presence of different Cr(VI) concentrations
did modulate the community response to phenan-
threne. An increase in the Cr(VI) concentration led to The dendrogram of the UPGMA analysis of the
the disappearance of the most intense bands found in DGGE of different contaminated soil microcosms at
the fingerprint of the F soil microcosm and the different treatment times is represented in Fig. 7. The
appearance of other intense bands. patterns indicate the changes in microbial community

123
104 Biodegradation (2009) 20:95–107

Fig. 7 Drendrogram of the

clusters analysis of the
DGGE patterns of
contaminated microcosms
during the bioremediation
process, as calculated by
using Dice equation and
UPGMA. The differences
between profiles are
indicated by percentage
similarity

structure over time. On analyzing the F and F-Cr In a preliminary experiment on biometer systems we
microcosms, significant and perdurable changes in studied the effect of Cr(VI) contamination on phenan-
the microbial community can be seen. In F-Cr50 and threne-induced mineralization and cultivable bacterial
F-Cr100 microcosms these changes led to the populations in order the obtain some basis for under-
formation of clusters according to Cr (VI) concen- standing the dynamics of the community. Cr(VI)
tration, regardless of the incubation time. F-Cr50 and inhibited phenanthrene mineralization (Fig. 1) and
F-Cr100 microcosm clusters were clearly differenti- reduced drastically the number of PAH-degrading
ated from F microcosm. In contrast, the F-Cr25 bacteria (Table 1) in the range 500 to 2,600 mg kg-1.
microcosm did not different from F microcosm in the This response was similar to that observed in other
same way that the higher Cr(VI) concentrations did. studies, where heavy metals generally suppressed the
On analyzing the Cr100, F and F-Cr100 microcosms, community responses to carbon addition and led to
clusters which were clearly differentiated from each lower carbon mineralization rates and longer lag
other can be seen. phases (Nakatsu et al. 2005). Contamination with low
concentrations of Cr(VI) (25 and 50 mg kg-1) did not
show significant changes in the microbial community
Discussion response to phenanthrene (Fig. 1). These results are in
contrast to the lower Cr(VI) concentrations (10 and
The effects of PAH (Gentry et al. 2003; Castle et al. 18 mg kg-1) that were needed to inhibit the catabolism
2006) and heavy metals (Rasmussen and Sørensen of xylene (Nakatsu et al. 2005). However, it is
2001, Dai et al. 2004; Viti and Giovannetti 2005) on important to note that in our experiments on biometer
composition and activity of soil microbial community systems, the phenanthrene was added after 7 days of
have recently been studied. Maliszewska-Kordybach Cr(VI) contamination. During this 7 day period a
and Smreczak (2003) found that the deleterious significant increase in microbial activity was observed
influence on soil microorganism activity was more in all F-Cr biometer systems (Fig. 1). In the same time
marked in the case of soils contaminated with both period the soil microcosm experiments showed a fast
groups of these pollutants than in soil amended with decrease of Cr(VI) from WEF (Fig. 3). The effects of
heavy metals or PAH alone. However, the impact of metals on soil microorganisms depend upon their
the negative effects on the soil microbial community availability in soil solution (Shi et al. 2002). Cr in
in the degradation of PAH has only recently been Cr(VI)-contaminated soils is mainly present in the
emphasized (Sokhn et al. 2001; Wong et al. 2005) fraction bound to organic matter (Han et al. 2004) and
and the influence on biological remediation of heavy Cr(VI) reduction by soil organic matter and biotic
metals has not been well documented. mechanisms has been widely reported (Wittbrodt and

123
Biodegradation (2009) 20:95–107 105

Palmer 1996; Kimbrough et al. 1999, Tokunaga et al. selective shifts in the structure of the phenanthrene-
2003). It could be assumed that phenanthrene was degrading community (Fig. 7), with the most intense
incorporated when a large proportion of Cr(VI) had bands replaced by others (Fig. 6) demonstrating the
been eliminated of the WEF. functional redundancy of the soil microorganism
The increase in mineralization rate observed imme- related with the phenanthrene catabolism. Regardless
diately after Cr(VI) addition (Fig. 1) could be due of the rapid and significant reduction of the Cr(VI)
to biotic and or abiotic process. The heterotrophic concentration in the WEF and the phenanthrene
Cr(VI)-resistant microorganisms could be active at the elimination, co-contamination with phenanthrene
expense of leaked nutrients through cell lysis from and Cr(VI) caused significant and perdurable changes
Cr(VI)-sensitive microorganisms, as proposed by other in the structure of the microbial soil community
authors (Rajapaksha et al. 2004; Viti et al. 2006), and/ (Fig. 7). These changes were characteristics and dif-
or at the expense of partially oxidized organic products ferent from those produced on soil microbial com-
from the oxidation of soil organic matter by Cr(VI). In munity by the presence of only one of these pollutants
soil microcosms, an increment in cultivable Cr(VI) (Fig. 7).
resistant population during the first days of experiment The structures of microbial communities estab-
was not detected (Fig. 4c), discouraging us to doing lished in the F and F-Cr soil microcosms after
substantial inference that an early Cr(VI) resistant 38 days, i.e., the period of active phenanthrene
population was established. elimination, demonstrated the influence of Cr con-
For bioremediation experiments in soil micro- centration, with the most dramatic results obtained
cosms, when the phenanthrene and Cr(VI) (25, 50 from 50 mg kg-1. This influence was also observed
and 100 mg kg-1) were simultaneously incorporated, in the dynamics of PAH-degrading bacteria (Fig. 4b).
the degradation of phenanthrene (Fig. 2), dehydroge- The most marked increase in PAH-degrading bacteria
nase activity (Fig. 5) and the increase in PAH- was detected in F-Cr50 and F-Cr100 soil microcosms
degrading bacteria counts (Fig. 4b) were retarded. after 38 days of treatment. Moreover, the highest
Interestingly, however, these negative effects did not Cr(VI) concentration produced the progressive
show a correlation with Cr(VI) concentration and, selection of Cr(VI)-resistant heterotrophic bacteria
furthermore, the F-Cr100 soil microcosm presented (Fig. 4c) during the period of active phenanthrene
higher PAH degrading bacteria counts (Fig. 4b) and elimination. It could be assumed that a different
dehydrogenase activity (Fig. 5) than the F-Cr25 and F- phenanthrene degrading Cr(VI)—resistant commu-
Cr50 soil microcosms. It is also interesting that the nity was established at higher Cr(VI) concentration
residual Cr(VI) concentration in WEF was lower in and that community proved to have a major effi-
presence of phenanthrene than when it was incorpo- ciency on phenanthrene degradation activity. The
rated alone (Fig. 3). Organic matter enhances the lowest Cr(VI) concentration (25 mg kg-1) allowed
reduction of chromate in soil by increasing microbial the establishment of a community that was more
activities, by acting as an electron donor and by similar to the F soil microcosm (Figs. 6 and 7) but
lowering the O2 level of the soil through increased it had a smaller increase in the PAH-degrading
microbial respiration, thus creating reducing condi- population (Fig. 4b). This latter behavior could be
tions (Zayed and Terry 2003). attributable to Cr(VI) inhibitory effect, while a
The genetic diversity results showed that whereas more complex mechanism could be governing the
the DGGE profiles of the Cr100 soil microcosm did dynamic microbial community at higher Cr(VI)
not show any intense bands (Fig. 6), the DGGE concentrations.
profiles of F and F-Cr microcosms showed the The remarkable difference between the microbial
presence of bands with high intensities. Bands of community composition of the different F-Cr soil
high intensity are commonly found in samples where microcosms might be a consequence of the selective
substantial microbial activity has been detected and pressure of toxic Cr(VI) and the different environ-
represent the populations that are more competitive ments generated by the complex interaction between
under the selective conditions used (Nakatsu et al. soil organic matter, microbial activity, a heavy metal
2005). In presence of phenanthrene as a driving force with oxidizer properties and the incorporation of a
for community changes, the effect of Cr(VI) led to biodegradable molecule.

123
106 Biodegradation (2009) 20:95–107

Conclusions El Fantroussi S, Agathos SN (2005) Is bioaugmentation a

feasible strategy for pollutant removal and site remedia-
tion? Curr Opin Microbiol 8:268–275. doi:10.1016/
To our knowledge, this is the first work that studied j.mib.2005.04.011
the influence of different concentrations of heavy Gentry TJ, Wolf DC, Reynolds CM, Fuhrmann JJ (2003)
metal on the efficiency of bioremediation processes Pyrene and phenanthrene influence on soil microbial
and the bacterial community composition of soil co- populations. Biorem J 7:53–68
Han FX, Su Y, Maruthi Sridhar BB, Monts DI (2004) Distri-
contaminated with heavy metal and PAH. This bution, transformation and bioavailability of trivalent and
represents an initial study that allowed to demonstrate hexavalent chromium in contaminated soil. Plant Soil
that the presence of different Cr(VI) concentrations 265:243–252. doi:10.1007/s11104-005-0975-7
did modulate the community response to phenan- Johnsen AR, Bendixen K, Karlson U (2002) Detection of
microbial growth on polycyclic aromatic hydrocarbons in
threne. More studies are needed to elucidate the microtiter plates by using the respiration indicator WST-1.
complex mechanisms that govern the response of Appl Environ Microbiol 68:2683–2689. doi:10.1128/
microbial community to co-contamination with these AEM.68.6.2683-2689.2002
pollutants. Kamaludeen SPB, Megharaj M, Juhasz AL, Sethunathan N,
Naidu R (2003) Chromium-microorganism interactions in
soils: remediation implications. Rev Environ Contam
Acknowledgements This research was partially support by Toxicol 178:93–164. doi:10.1007/0-387-21728-2_4
the Agencia Nacional de Promoción Cientı́fica y Tecnológica Kimbrough DE, Cohen Y, Winer AM, Creelman L, Mabuni C
(PICT2004-25300). Ibarrolaza A. and Coppotelli B. are (1999) A critical assessment of chromium in the envi-
doctoral fellowships of CONICET (Argentine Research ronment. Crit Rev Environ Sci Technol 29:1–46.
Council). Donati E. is research member of CONICET. doi:10.1080/10643389991259164
Krishna KR, Philip L (2005) Bioremediation of Cr(VI) in
contaminated soils. J Hazard Mater B121:109–117.
doi:10.1016/j.jhazmat.2005.01.018
References Kouretev PS, Nakats CH, Konopka A (2006) Responses of the
anaerobic bacterial community to addition of organic C in
Amezcua-Allieri MA, Lead JR, Rodrı́guez-Vazquez R (2005) chromium(VI)- and iron(III)-amended microcosms. Appl
Impact of microbial activity on copper, lead and nickel Environ Microbiol 72:628–637. doi:10.1128/
mobilization during the bioremediation of soil PAHs. AEM.72.1.628-637.2006
Chemosphere 61:484–491. doi:10.1016/ Kuske CR, Barns SM, Busch JD (1997) Diverse uncultivated
j.chemosphere.2005.03.002 bacterial groups from soils of the arid southwestern Uni-
Bader JL, Gonzalez G, Goodell PC, Ali AS, Pillai SD (1999) ted States that are present in many geographic regions.
Chromium-resistant bacterial populations from a site Appl Environ Microbiol 63:3614–3621
heavily contaminated with hexavalent chromium. Water Maliszewska-Kordybach B, Smreczak B (2003) Habitual
Air Soil Pollut 109:263–276. doi:10.1023/A:10050758 function of agricultural soils as affected by heavy metals
00292 and polycyclic aromatic hydrocarbons contamination.
Bartha R, Pramer D (1965) Features of a flask and method for Environ Int 28:719–728. doi:10.1016/S0160-4120(02)
measuring the persistence and biological effects of pesti- 00117-4
cide in soil. Soil Sci 100:68–70. doi:10.1097/00010694- Muyzer G, Brinkhoff T, Nübel U, Santegoedes C, Schäfer H,
196507000-00011 Wawer C (1998) Denaturing gradient electrophoresis
Castle DM, Montgomery MT, Kirchman DL (2006) Effects of (DGGE) in microbial ecology. In: Akkermanns ADL, van
naphthalene on microbial community composition in the Elsas JD, de Brujin F (eds) Molecular microbial ecology
Delaware estuary. FEMS Microbiol Ecol 56:55–63 manual. Kluwer Academic Press, Dordrecht, pp 1–27
Clesceri LS, Greenberg AE, Eaton AD (eds) (1998) Standard Nakatsu CH, Carmosini N, Baldwin B, Beasley F, Kourtev P,
methods for the examination of water and wastewater, Konopka A (2005) Soil microbial community responses to
20th edn. American Public Health Association, American additions of organic carbon substrates and heavy metals
Water Works Association, and Water Environmental (Pb an Cr). Appl Environ Microbiol 71:7679–7689.
Federation, Washington, DC doi:10.1128/AEM.71.12.7679-7689.2005
Dai J, Becquer T, Rouiller JH, Reversat G, Bernhard-Reversat Rajapaksha RMCP, Tobor-Kaplon MA, Baath E (2004) Metal
F, Lavelle P (2004) Influence of heavy metals on C and N toxicity affects fungal and bacterial activites in soil dif-
mineralisation and microbial biomass in Zn-, Pb-, Cu, and ferently. Appl Environ Microbiol 70:2966–2973.
Cd-contaminated soils. Appl Soil Ecol 25:99–109. doi:10.1128/AEM.70.5.2966-2973.2004
doi:10.1016/j.apsoil.2003.09.003 Rasmussen LD, Sørensen SJ (2001) Effects of mercury con-
Déziél E, Paquette G, Villemur R, Lepine F, Bisaillon J (1996) tamination on the culturable heterotrophic, functional and
Biosurfactant production by soil Pseudomonas strain genetic diversity of the bacterial community in soil.
growing on polycyclic aromatic hydrocarbon. Appl FEMS Microbiol Ecol 36:1–9. doi:10.1111/j.1574-
Environ Microbiol 62:1908–1912 6941.2001.tb00820.x

123
Biodegradation (2009) 20:95–107 107

Reasoner D, Geldreich E (1985) A new medium for the enu- Technol Biotechnol 70:331–336. doi:10.1002/(SICI)1097-
meration and subculture of bacteria from potable water. 4660(199712)70:4\331::AID-JCTB788[3.0.CO;2-W
Appl Environ Microbiol 49:1–7 Viñas M, Sabaté J, Espuny MJ, Solanas AM (2005) Bacterial
Said WA, Lewis DL (1991) Quantitative assessment of the community dynamics and polycyclic aromatic hydrocar-
effects of metals on microbial degradation of organic bon degradation during bioremediation of heavily
chemicals. Appl Environ Microbiol 57:1498–1503 creosote-contaminated soil. Appl Environ Microbiol
Shi W, Becker J, Bischoff M, Turco RF, Konopka AE (2002) 71:7008–7018. doi:10.1128/AEM.71.11.7008-7018.2005
Association of microbial community composition and Viti C, Giovannetti L (2005) Characterization of cultivable
activity with lead, chromium and hydrocarbon contami- heterotrophic bacterial communities in Cr-polluted and
nation. Appl Environ Microbiol 68:3859–3866. unpolluted soils using Biolog and ARDRA approaches.
doi:10.1128/AEM.68.8.3859-3866.2002 Appl Soil Ecol 28:101–112. doi:10.1016/j.apsoil.
Sokal RR, Michener CD (1958) A statistical method for 2004.07.008
evaluating systematic relationships. Univ Kans Sci Bull Viti C, Mini A, Ranalli G, Lustrato G, Giovannetti L (2006)
38:1409–1438 Response of microbial communities to different doses of
Sokhn J, De Leij FAAM, Hart TD, Lynch JM (2001) Effect of chromate in soil microcosms. Appl Soil Ecol 34:125–139.
copper on the degradation of phenanthrene by soil micro- doi:10.1016/j.apsoil.2006.03.003
organisms. Lett Appl Microbiol 33:164–168. doi:10.1046/ Wild SR, Jones KC (1995) Polynuclear aromatic hydrocarbons
j.1472-765x.2001.00972.x in the United Kingdom environment: a preliminary source
Song HG, Wang X, Bartha R (1990) Bioremediation potential inventory and budget. Environ Pollut 88:91–108
of terrestrial fuel spills. Appl Environ Microbiol 56: Wittbrodt PR, Palmer CD (1996) Reduction of Cr(VI) in the
652–656 presence of excess soil fulivic acid. Environ Sci Technol
Thalman A (1968) Zur Methodik der bestimmung der dehy- 30:2470–2477. doi:10.1021/es950731c
drogenaseaktivität im boden mittels triphenyltetra- Wong KW, Toh BA, Ting YP, Obbard JP (2005) Biodegra-
zoliumchlorid (TTC). Landwirtsch Forsch 21:249–258 dation of phenanthrene by the indigenous microbial
Tokunaga TK, Wan J, Firestone MK, Hazen TC, Olson KR, biomass in a zinc amended soil. Appl Microbiol 40:50
Herman DJ et al (2003) Bioremediation and biodegrada- Wrenn BA, Venosa AD (1996) Selective enumeration of aro-
tion. In situ reduction of Chromium(VI) in heavily matic and aliphatic hydrocarbon-degrading bacteria by a
contaminated soils through organic carbon amendment. J most probable number procedure. Can J Microbiol
Environ Qual 32:1641–1649 42:252–258
Vecchioli G, Constanza O, Giorgieri S, Remmler M (1997) Zayed AM, Terry N (2003) Chromium in the environment:
Extend of cleaning achievable for bioremediation of soil factors affecting biological remediation. Plant Soil
contaminated with petrochemical sludges. J Chem 249:139–156. doi:10.1023/A:1022504826342

123