4.6 6.

Article

Biosynthesis of Silver Chloride

Nanoparticles by Rhizospheric
Bacteria and Their Antibacterial
Activity against Phytopathogenic
Bacterium Ralstonia solanacearum

Iman Sabah Abd Alamer , Ali Athafah Tomah, Temoor Ahmed, Bin Li and Jingze Zhang

Special Issue
Green Synthetic Nanomaterials: Preparation, Mechanism, and Application
Edited by
Prof. Dr. Xiaoying Wang

https://doi.org/10.3390/molecules27010224
 molecules
Article
Biosynthesis of Silver Chloride Nanoparticles by Rhizospheric
Bacteria and Their Antibacterial Activity against
Phytopathogenic Bacterium Ralstonia solanacearum
Iman Sabah Abd Alamer 1,2 , Ali Athafah Tomah 1,3 , Temoor Ahmed 1 , Bin Li 1 and Jingze Zhang 1, *

1 State Key Laboratory of Rice Biology, Institute of Biotechnology, Zhejiang University,

Hangzhou 310058, China; [email protected] (I.S.A.A.); [email protected] (A.A.T.);
[email protected] (T.A.); [email protected] (B.L.)
2 Plant Protection, Agriculture Directorate, AL-Amarah 62001, Iraq
3 Plant Protection, College of Agriculture, University of Misan, AL-Amarah 62001, Iraq
* Correspondence: [email protected]; Tel.: +86-571-88982267

Abstract: Ralstonia solanacearum is the most destructive pathogen, causing bacterial wilt disease
of eggplant. The present study aimed to develop green synthesis and characterization of silver
chloride nanoparticles (AgCl-NPs) by using a native bacterial strain and subsequent evaluation of
their antibacterial activity against R. solanacearum. Here, a total of 10 bacterial strains were selected
for the biosynthesis of AgCl-NPs. Among them, the highest yield occurred in the synthesis of
AgCl-NPs using a cell-free aqueous filtrate of strain IMA13. Ultrastructural observation revealed
that the AgCl-NPs were spherical and oval with smooth surfaces and 5–35 nm sizes. XRD analysis



studies revealed that these particles contained face-centered cubic crystallites of metallic Ag and


AgCl. Moreover, FTIR analysis showed the presence of capping proteins, carbohydrates, lipids,
Citation: Abd Alamer, I.S.;
and lipopeptide compounds and crystalline structure of AgCl-NPs. On the basis of phylogenetic
Tomah, A.A.; Ahmed, T.; Li, B.;
analysis using a combination of six gene sequences (16S, gyrA, rpoB, purH, polC, and groEL), we
Zhang, J. Biosynthesis of Silver
identified strain IMA13 as Bacillus mojavensis. Three kinds of lipopeptide compounds, namely,
Chloride Nanoparticles by
Rhizospheric Bacteria and Their
bacillomycin D, iturin, and fengycin, forming cell-free supernatant produced by strain IAM13, were
Antibacterial Activity against identified by MALDI-TOF mass spectrometry. Biogenic AgCl-NPs showed substantial antibacterial
Phytopathogenic Bacterium Ralstonia activity against R. solanacearum at a concentration of 20 µg/mL−1 . Motility assays showed that the
solanacearum. Molecules 2022, 27, 224. AgCl-NPs significantly inhibited the swarming and swimming motility (61.4 and 55.8%) against R.
https://doi.org/10.3390/ solanacearum. Moreover, SEM and TEM analysis showed that direct interaction of AgCl-NPs with
molecules27010224 bacterial cells caused rupture of cell wall and cytoplasmic membranes, as well as leakage of nucleic
Academic Editor: Xiaoying Wang acid materials, which ultimately resulted in the death of R. solanacearum. Overall, these findings will
help in developing a promising nanopesticide against phytopathogen plant disease management.
Received: 7 December 2021
Accepted: 28 December 2021
Keywords: Bacillus mojavensis; taxonomy; molecular interaction; Ralstonia solanacearum; antibacterial activity
Published: 30 December 2021

Publisher’s Note: MDPI stays neutral

with regard to jurisdictional claims in
published maps and institutional affil- 1. Introduction
iations.
Ralstonia solanacearum is a soilborne Gram-negative bacterium that causes plant dis-
eases mainly in tropical and subtropical climates [1]. R. solanacearum has a wide plant hosts
range and it is capable of infecting more than 450 plant species in 54 different botanical
families, such as brinjal, tomato, potato, and chili [2–5]. Bacterial wilt disease caused
Copyright: © 2021 by the authors.
Licensee MDPI, Basel, Switzerland.
by R. solanacearum is the most infectious soil-borne bacterial disease of eggplant [6]. In
This article is an open access article
addition to the polar flagella responsible for swimming motility, the pathogen produces
distributed under the terms and
type IV pili (TFP) that govern twitching motility, which is required for plant colonization
conditions of the Creative Commons and full Virulence [7]. These characters have contributed to the ranking of R. solanacearum
Attribution (CC BY) license (https:// as one of the most destructive plant-pathogenic bacterial species worldwide [8].
creativecommons.org/licenses/by/ Current resistant cultivars are limited due to the pathogen’s extensive genetic diversity
4.0/). and difficulty in transferring a high number of genes into cultivars with undesirable traits

Molecules 2022, 27, 224. https://doi.org/10.3390/molecules27010224 https://www.mdpi.com/journal/molecules

Molecules 2022, 27, 224 2 of 18

to develop new resistant cultivars [9]. In the last few decades, conventional pesticides in the
form of numerous chemicals and antibiotics have been used for the treatment of bacterial
wilt disease. However, the long-term use of chemical pesticides leads to resistant strains,
environmental pollution, cost increase, and little effectiveness in the field. The biological
control methods have been investigated widely for this disease, but many products are
just under controlled conditions but not confirmed in the field. In addition, some of the
biocontrol products in use were limited by geographical location due to the properties of
biocontrol agents. These invited researchers to devise a new strategy to treat the plant
diseases that plant pathogens caused, known as the biosynthesis of green nanoparticles [10].
Nanotechnology is the use of matter on an atomic, molecular, and supramolecular
scale for industrial purposes, which is considered one of the cutting edge trends successful
in many areas, including agriculture. In the last few years, various physicochemical meth-
ods have been used to produce metallic NPs; however, they also produce environmentally
hazardous residues that are finally released into the environment [11]. To overcome these
challenges, biological synthesis that involves the use of living systems (bacteria, fungi,
plants, and microalgae) as nanofactories, has emerged as a promising alternative to conven-
tional methods due to their non-toxic, eco-friendly, and more stable nature [12,13]. Among
the microorganisms, bacteria occupied the center stage in the nanoparticles synthesis field
due to their growing success, ease of handling, and genetic modification [14], and recently,
Bacillus sp., such as B. pumilus, B. persicus, and B. licheniformis, have received great attention
due to their ability in nanoparticles synthesis [15]. The mechanisms of action for nanopar-
ticles against microorganisms is still not entirely clear; however, many researchers have
identified some mechanisms, including, most notably, penetration and accumulation of
nanoparticles in the cytoplasm, severe damage of cell wall and cytoplasmic membrane [16],
generation of reactive oxygen species (ROS) and free radicals, and modulation of microbial
signal transduction pathways [17].
The present work aims to screen and identify bacterial strains for efficient synthesis and
characterize the AgCl-NPs using scanning electron microscopy (SEM), energy dispersive
spectroscopy (EDS), X-ray diffraction (XRD), transmission electron microscope (TEM) and
Fourier transform infrared spectroscopy (FTIR), and to assess the in vitro antibacterial
activity of biosynthesized AgCl-NPs against phytopathogenic bacterium R. solanacearum.

2. Results
2.1. Bacteria Strains and Biosynthesis of AgCl-NPs
On the basis of characteristics of bacterial colonies such as shape, color, and size,
we selected nine strains, named IMA12, IMA13, IMA14, IMA15, IMA16, IMA17, IMA18,
IMA19, and IMA20, for the biosynthesis of AgCl-NPs after they were purified.
The AgCl-NPs formation was observed by visual color change during incubation
(Figure 1a,b) and confirmed by UV-visible spectroscopy. The experimental results showed
that the obvious color change appeared only in the solution with the CFCS produced by
strain IMA13 and AgNO3 (Figure 1b), indicating the formation of AgCl-NPs after incuba-
tion for 48 h. Subsequently, the repeated assay confirmed that the biosynthesis of AgCl-NPs
using the CFCS produced by strain IMA13 was stable and repeatable. No AgCl-NP synthe-
sis was observed in control flasks containing 25 mL of nutrient broth (instead of bacterial
supernatant) and AgNO3 at 1.0 mM, confirming that extracellular agents of bacterial origin
mediated AgCl-NPs synthesis. Analysis of the UV-visible spectra revealed that the sharp
surface plasma resonance peaks were at 427 nm after incubation for 48 h (Figure 1c).
Molecules 2022, 27, 224 3 of 18

Figure 1. Synthesis of nanoparticles using cell-free culture supernatant (CFCS) of nine bacteria strains
and UV-visible spectra of synthesized AgCl-NPs after incubation at 30 ◦ C and 200 rpm for 48 h:
(a) visual color change before incubation; (b) visual color change after incubation for 48 h; (c) the
absorption spectrum of AgCl-NPs synthesized using IMA13 CFCS, showing a strong peak at 430 nm
after 48 h.

2.2. Characterizations of AgCl-NPs

The synthesized AgCl-NPs were characterized by scanning electron microscopy (SEM),
energy-dispersive spectroscopy (EDS), transmission electron microscopy (TEM), X-ray
diffraction (XRD), and Fourier transform infrared (FT-IR) spectroscopy analysis.
The SEM micrographs showed that the external surfaces of spherical AgCl-NPs syn-
thesized by cell-free culture supernatant of strain IMA13 were smooth (Figure 2a). The
EDS analysis of AgCl-NPs revealed the pure silver (46.36%) was the uppermost major
constituent element at 3 keV, while carbon was the second major element at 0.5 keV com-
pared to Na, Cl, S, Al, and Cu between 0 and 9 keV (Figure 2b), confirming the existence
of the silver element in the synthesized AgCl-NPs (including AgClNPs). The TEM micro-
graph showed that the different sizes and shapes of AgCl-NPs ranged from 5 to 35 nm
(Figure 2c,d). The micrograph also showed that the majority of AgCl-NPs were spherical,
while others were oval-shaped (Figure 2c).

Figure 2. Morphology of silver nanoparticles synthesized using cell-free culture supernatant (CFCS)
of strain IMA13: (a) SEM; (b) EDS; (c) TEM; (d) distribution frequency (%) of AgCl-NPs particle size.
Molecules 2022, 27, 224 4 of 18

The XRD analysis of AgCl-NPs produced had recorded the diffraction five peaks in the
θ of a rounded 38.17◦ , 44.37◦ , 64.55◦ , 77.54◦ , and 81.69◦ corresponded to the silver
2θ range
crystal planes (111), (200), (220), (311) and (222) (Figure 3), respectively. All these diffraction
peaks are well matched to the face-centered cubic (FCC) phase with the quality value to
the Silver by Inorganic Crystal Structure Database (ISCD) with the silver file (no. 64994).
Moreover, the XRD analysis also showed nine peaks at 27.84◦ , 32.25◦ , 46.26◦ , 54.86◦ , 57.52◦ ,
67.49◦ , 74.51◦ , and 85.75◦ (Figure 3). These peaks showed a proper match with the reference
peak positions of the face-centered cubic (FCC) structure of AgCl through comparing it
with (ISCD no. 56538). Because AgCl-NPs account for 95.7% compared with Ag-NPs 5.3%
in XRD analysis, the content became the synthesis of AgCl-NPs.

Figure 3. X-ray diffraction patterns of the biosynthesized AgCl-NPs by CFCS extract of bacterium
strain IMA13.

The FTIR spectra were recorded for identifying the functional groups involved in the
AgCl-NP reduction (Figure 4). The broad and strong bands at 3444 cm−1 were − due to the
bonded amine groups (–NH) in the interaction of bacterial extract with AgCl-NPs powder.
The peaks that appeared at 2923 cm−1 were attributed
− to symmetric and asymmetric CH2 ,
stretching modes of carbohydrates and fatty acids. The stronger peaks at 1646 cm−1 were
attributed
− to the C=O (carboxylic group) and amide I group stretching vibrations. The peak

at 1385 cm−1 was assigned to the− methyl rocking vibrations (CH3 of hydrocarbons). The
peak near 1080 cm−1 was attributed to −P=O stretching vibrations in phospholipids and
C=O stretching vibrations in polysaccharides (glycosidic bonds and pyranoid rings) [18].
The peak at 516 cm−1 in the low wavenumber− was considered to be the presence of Van der
Waals forces of interaction between oxygen groups in protein structures and in the CFCS
extract on the surface of AgCl-NPs [19].
Molecules 2022, 27, 224 5 of 18

Figure 4. Characterization of the biosynthesized AgCl-NPs using cell-free culture supernatant

extract of bacterial strain IMA13. FTIR of biosynthesized AgCl-NPs (red color), and cell-free culture
supernatant of bacterium strain IMA13 dry (black color).

On the basis of characteristics of FTIR spectra (Figure 4), we analyzed the shift changes
between AgCl-NPs powder and the CFCS extract of bacterial strain IMA13. The peak at
3444 cm−1 with a− shift change (−2 cm−1 ,− compared−
to bacterial extract) revealed that the
AgCl-NPs interacted with the proteins of the CFCS extract. The peak at 1646 cm−1 with a large−
shift change (−14 cm−1 ) showed− that− the AgCl-NPs strongly bonded with negatively charged
carboxylic or amide I groups in proteins. The stronger peak at 1080 cm−1 with a largest shift
−
change − AgCl-NPs
(−51 cm−1 ) revealed that the − strongly interacted with lipids and carbohy-
drates. In addition, the peak at 516 cm with a shift change (−7 −cm−1 ) could also display
−1 −
the −electrostatics interactions of nanoparticles with oxygen from hydroxyl groups. These
biological components may play a significant role in forming and stabilizing nanoparticles.

2.3. Identification of Strain

The strain IMA13 was firstly identified by sequence analysis of 16S rRNA gene. The
result of a BLAST search showed that the strain IMA13 had identities of 100% for the
Bacillus sp. (GenBank no. MG470688.1) and Bacillus halotolerans (GenBank no. MN330417.1).
To delineate species boundaries, we amplified five genes (gyrA, rpoB, purH, polC, and groEL)
(Table 1); all six gene sequences were deposited in the GenBank database (Table 2), and a
phylogenetic tree was constructed by using combination of six gene sequences (16S, gyrA,
rpoB, purH, polC, and groEL) and the B. cereus ATCC 14579T was used as the outgroup.
The phylogenetic tree showed that all studied isolates were separated into was different clades
(Figure 5). The relationship of almost all reference isolates could be clearly distinguished on
the level of species. The strain IMA13 clustered with B. mojavensis B-14698T as a clade with
100% bootstrap support. In addition, the topology of ML tree analysis was congruent with
the results that reported by [20]. Therefore, strain IMA13 was identified as B. mojavensis.
Molecules 2022, 27, 224 6 of 18

Table 1. Primers used for PCR amplification.

Genes Primers Primer Sequence (5′ –3′ )

27f AGAGTTTGATCMTGGCTCAG
16S
1492r GGYTACCTTGTTACGACTT
42f CAGTCAGGAAATGCGTACGTCCTT
gyrA
1066r CAAGGTAATGCTCCAGGCATTGCT
2292f GACGTGGGATGGCTACAACT
rpoB
3354r ATTGTCGCCTTTAACGATGG
70f ACAGAGCTTGGCGTTGAAGT
purH
1013r GCTTCTTGGCTGAATGAAGG
1505f TTGTCGCTCAYAATGCAAGC
polC
2337r YTCAAGCATTTCRTCTGTCG
550f GAGCTTGAAGTKGTTGAAGG
groEL
1497r TGAGCGTGTWACTTTTGTWG

Table 2. The Bacillus strains used for the phylogenetic analysis.

Species of GenBank No.

Strain
Bacillus 16S gyrA rpoB purH polC groEL
Bacillus sp. IMA13 MZ310441.1 MZ338583.1 MZ338584.1 MZ338585.1 MZ338586.1 MZ338587.1
B. sonorensis B-23154 NR_116189.1 EU138611.1 EU138818.1 EU138749.1 EU138680.1 EU138542.1
B. pumilus NRS-272 NR_116191.1 EU138655.1 EU138862.1 EU138793.1 EU138724.1 EU138586.1
B. atrophaeus NRS-213 NR_116190.1 EU138654.1 EU138861.1 EU138792.1 EU138723.1 EU138585.1
B. subtilis NRS-744 NR_116192.1 EU138658.1 EU138865.1 EU138796.1 EU138727.1 EU138589.1
B. subtilis subsp.
B-23049 NR_116187.1 EU138602.1 EU138809.1 EU138740.1 EU138671.1 EU138533.1
spizizenii
B. subtilis
B-23052 NR_116188.1 EU138605.1 EU138812.1 EU138743.1 EU138674.1 EU138536.1
subsp.inaquosorum
B. vallismortis B-14890 NR_116186.1 EU138601.1 EU138808.1 EU138739.1 EU138670.1 EU138532.1
B. mojavensis B-14698 NR_116185.1 EU138598.1 EU138805.1 EU138736.1 EU138667.1 EU138529.1
B. subtilis subsp. NC_000964.3: NC_000964.3: NC_000964.3: NC_000964.3: NC_000964.3: NC_000964.3:
168
subtilis 30279-31832 6994-9459 121919-125500 708594-710132 1727133-1731446 650234-651868
NC_004722.1: NC_004722.1: NC_004722.1: NC_004722.1: NC_004722.1: NC_004722.1:
B. cereus ATCC 14579
9187-10741 6475-8946 113908-117441 309016-310551 3794523-3790222 257826-259460
B. NC_014551.1 NC_014551.1: NC_014551.1: NC_014551.1: NC_014551.1: NC_014551.1:
ATCC 23350
amyloliquefaciens 9765-11318 7010-9469 122979-126560 668235-669773 1728311-1732624 572972-574606
NC_006322.1: NC_006322.1: NC_006270.3: NC_006322.1: NC_006322.1: NC_006322.1:
B. licheniformis ATCC 14580
9713-11250 6900-9368 120951-124532 707082-708620 1832492-1836808 626726-628360
B.
NC_009725.1: NC_009725.1: NC_009725.1: NC_009725.1: NC_009725.1: NC_009725.1:
amyloliquefaciens FZB42
9760-11314 7081-9462 122626-126216 670548-672086 1642186-1646499 619805-621439
subsp. plantarum
B.
Mito-5-13 AB610829.1 AB612173.1 AB615267.1 AB615405.1 AB612200.1 AB611006.1
amyloliquefaciens
Molecules 2022, 27, 224 7 of 18

Figure 5. Maximum likelihood (ML) tree generated from a combination of gyrA, rpoB, purH, polC,
and groEL gene sequences of 15 taxa. The tree is rooted with B. cereus. The type strains are indicated
with T. Strains in this study are showed in bold.

2.4. Analysis of Lipopeptide Compound

The MALDI-TOF MS was applied to detect and identify lipopeptide compounds
from whole cells of the IAM13 strain. The MALDI-TOF analysis results showed the major
peaks revealed the presence of bacillomycin D, iturin, and fengycin (Figure 6). The peaks at
m/z 1053.5, 1067.5, 1081.5, and 1095.6 were contributed to by bacillomycin D corresponding
to C14–17 bacillomycin D [M + Na]+ , respectively (Table S1) [21]. The peaks at m/z 1065.5,
1079.6, 1095.6, 1109.6, 1123.6, and 1152.7 corresponded to C14–15 iturin [M + Na]+ , C15–17
iturin [M + K]+ , and C20 iturin [M + Na]+ , respectively [22,23]. Moreover, the peaks at
m/z 1435.9, 1449.9, 1463.9, 1473.8, 1477.9, 1485.9, 1487.8, 1501.8, and 1515.9 corresponded
to C14–16 fengycin [M + H]+ , C14 fengycin [M + K]+ , C16 fengycin [M + Na]+ , and C16–17
fengycin [M + K]+ , respectively [24,25].

Figure 6. MALDI-TOF MS analysis of lipopeptide compounds produced by IMA13 strain.

Molecules 2022, 27, 224 8 of 18

2.5. Antibacterial Activity of AgCl-NPs

The antibacterial activity of AgCl-NPs synthesized using a CFCS extract of bacterial
B. mojavensis IMA13 against phytopathogenic bacterium R. solanacearum YY06 was investi-
gated by agar well diffusion assay. The result showed the biggest percentage
− inhibition of
radial growth was 75.8% at concentration of 20 µg/mL −1 , followed by 47.6% and 37.1% at
−
the concentrations of 10 and 5 µg/mL−1 , respectively (Figure 7a). The statistical analysis
confirmed that the antibacterial activity of AgCl-NPs among different treatments was strik-
ingly different (p < 0.05) (Figure 7b). In addition, CFCS extract of bacterial strain IMA13
also had markedly inhibitory activity compared to control.

Figure 7. Antibacterial activity of the biosynthesized AgCl-NPs against phytopathogenic bacterium

strain YY06: (a) inhibitory activity of different concentrations of AgCl-NPs against bacterial growth
on LB agar; (b) percentage of bacterial growth inhibition of different concentrations of AgCl-NPs.
Vertical bars represent standard errors of the means (n = 3). The bars with different letters are
significantly different (p < 0.05). CFCS: cell-free culture supernatant.

To determine effects of synthesized AgCl-NPs on R. solanacearum motility, we per-

formed the swarming and swimming motility assay in the media with agar of different
concentrations. As shown in Figure 8, the results showed the percentage inhibition of
swarming motility were 61.43, 58.93, and 52.98% at concentrations of 20, 10, and 5 µg/mL−1
AgCl-NPs, respectively, after 72 h. Although the highest inhibitory activity was at a
−
concentration of 20 µg/mL−1 AgCl-NPs, there was no significant difference between
10 and 20 µg/mL−1 AgCl-NPs (p <− 0.05). Moreover, the results were showed the ability of
AgCl-NPs on inhibition
− of the swimming motility of R. solanacearum, where the percentage
inhibition of swimming motility reached to 55.8, 46.6, and 37.1% at concentrations of 20, 10,
and 5 µg/mL−1 AgCl-NPs, respectively. In addition, The CFCS extract of strain IMA13 also
displayed obviously inhibitory activity
−
against R. solanacearum swarming and swimming
motility compared to control (ddH2 O) (Figure 8).
Molecules 2022, 27, 224 9 of 18

Figure 8. Effect of biosynthesized AgCl-NPs on the motility of R. solanacearum after incubation for
96 h. Vertical bars represent swimming (red color) and swarming (blue color). Vertical bars represent
standard errors of the means (n = 3). The bars with different letters are significantly different (p < 0.05).
CFCS: cell-free culture supernatant.

In vitro MIC results indicated that the AgCl-NPs significantly inhibited the growth
of phytopathogenic strain YY06 after incubation of 48 h (Figure 9). The five varying
concentrations of AgCl-NP suspension of 2.5, 5, 10, 20, and 40 µg/mL−1 caused a reduction
−
in the OD600 values of bacterium strain YY06 to 23.32, 38.16, 77.15, 90.95, and 92.87%,
respectively, compared to the CFCS, which was 22.99% (Figure 9a,b). The AgCl-NPs
exhibited the lowest MIC against strain YY06 5 µg/mL−1 , suggesting good antibacterial
potential against the bacterium studied. −

2.6. Ultrastructural Characteristics of AgCl-NPs Interaction with Pathogen

To observe the interaction of the AgCl-NPs with bacteria cells, we observed mor-
phological changes on the surfaces of the cells of R. solanacearum YY06 by SEM after cells
were treated at a concentration of the 20 µg/mL−1 of AgCl-NPs for 4 and 8 h. The micro-
graphs of SEM showed that the small lamellar fragments appeared on the surfaces of some
cells, whereas the sunken sites around micropores or fissures on the surfaces were also
observed after treatment for 4 h (Figure 10a). After treatment for 8 h, deeply rounded holes
with different sizes formed on the surfaces of some cells, resulting in the cell deformation
(Figure 10d), compared to control (Figure 10b,e). The energy-dispersive spectroscopy (EDS)
analysis indicated the presence and accumulation of Ag as well as O, N, C, and S elements
on the surfaces of bacterial cells after on samples treated for 4 or 8 h (Figure 10c,f).
 −

Molecules 2022, 27, 224 − 10 of 18

Figure 9. Determination of minimum inhibition concentration of biosynthesized AgCl-NPs by CFCS

of bacterium strain IMA13 against bacterium phytopathogenic strain YY06: (a) the visible bacterial
concentration decreased from left to right on one row of the 96-well microtiter plate; (b) inhibitory
activity of different concentrations of AgCl-NPs. Vertical bars represent standard errors of the means
(n = 3). The different letters are significantly different (p < 0.05) by LSD test; values are average of
three replicates.

Figure 10. The micrographs of scanning electron microscopy and energy-dispersive spectroscopy
(a,b,d,e): (a,b) SEM analysis; (a) treatment by AgCl-NPs and (b) CFCS extract for 4 h; (c) EDS analysis in
(a); (d,e) SEM analysis; (d) treatment by AgCl-NPs and (e) CFCS extract for 8 h; (f) EDS analysis in (d).

The TEM micrographs showed that the response of R. solanacearum to AgCl-NPs varied
in different cells, including damage of cell walls and cytoplasmic membrane, as well as
cell deformation. After treatment by AgCl-NPs for 4 h, interruption of the local cell walls
occurred in most bacterial cells, which looked perforated, or the other cell walls became
wavy (Figure 11a). During this period, partial degradation of cytoplasmic membranes was
surrounded by a few cells (Figure 11a). After 8 h, enhancement of morphological changes
was observed. The lesser cell shapes were deformed with the decreased sizes, and most
remained unchanged (Figure 11b). However, the structural components of the cytoplasm
aggregated in clumps of high electron density located in electron-lucent cytoplasm. These
Molecules 2022, 27, 224 11 of 18

changes could be related to the disintegration of bacterial cells. Figure 11c demonstrated
that the electron-dense cell walls and cytoplasm became very electron-lucent in some
cells. During this period, widening of some cell walls with blurred outlines was especially
marked compared to control in Figure 11d.

Figure 11. Ultrastructural characteristics of interaction of Ag-NPs with cells of R. solanacearum;

(a) interruption (*) of the local cell walls and partial degradation (arrows) of cytoplasmic membranes
in some cells after treatment by AgCl-NPs (b) for 4 h; (b,c) treatment by AgCl-NPs for 8 h; (b) change
of structural components of the cytoplasm in some cells; (c) change of cell walls and the cytoplasm in
some cells; (d) treatment by CFCS extract (control) for 8 h.

3. Discussion
Recently, a new approach using microbes, such as bacteria, has attracted the atten-
tion of the scientific community for NP fabrication owing to their eco-friendly, non-toxic,
and stable nature as compared with previously available expensive and environmentally
corrosive physico-chemical methods. Biologically synthesized AgCl-NPs are promising
application prospects in the control of pathogenic microorganisms in the areas of health
and agriculture [26]. Although several nanoparticles have been biosynthesized using bac-
teria for their ability to inhibit plant pathogens, the investigation for new nanoparticles
with specific physicochemical and biological properties remains at the forefront of nan-
otechnological research [15]. The biological components of strain IMA13 extract, such as
proteins, lipids, carbohydrates, and lipopeptide compounds, were involved in interaction
with AgCl-NPs for stabilization of nanoparticles. The formation of these AgCl particles
could be due to the interaction of the NaCl content of nutrient broth with silver ions,
which resulted in formation of AgCl-NPs. However, synthetic yield is involved in com-
ponents of secondary metabolites secreted by microorganisms and synthesis mechanisms
of AgCl-NPs [27]. In this study, among the nine bacterial strains, only Bacillus mojavensis
IMA13 from rhizospheric soil of eggplants indicated the formation of Ag/AgClNPs after
incubation for 48 h (Figure 1b). AgCl-NPs were produced due to presence of NaCl in
medium. Synthesis of AgCl-NPs from a silver nitrate precursor as mediated by supernatant
of several microbes has been reported as the fungi such as Macrophomina phaseolina [28],
yeasts such as Meyerozyma guilliermondii KX008616 [29], and bacteria such as Raoultella
planticola and Pantoea agglomerans [30]. However, the silver chloride nanoparticles synthesis
by supernatant of bacteria B. mojavensis was first reported.
Few studies show biogenic AgCl-NPs have antibacterial activity [31]. Therefore, in this
study, we provided an example of the activity of Ag/AgClNP against bacterial pathogen.
Molecules 2022, 27, 224 12 of 18

Moreover, biosynthesized AgCl-NPs were characterized with standard material characteri-

zation techniques, viz., XRD, FTIR, SEM, TEM, and EDS. In the present study, the crystallo-
graphic planes peaks in the XRD pattern (Figure 3) showed that the prepared crystalline
structure of biogenic AgCl-NPs is a mixture of metallic Ag and AgCl [32,33]. Previous
research had shown that B. mojavensis was for the synthesis of AgCl-NPs [34,35], but the
size and shape of synthesized AgNPs depended on the different strains. The B. mojavensis
BTCB15 produced AgNPs of 105 nm size [35], and the 32A produced AgNPs ranging in
size from 6 to 72 nm with hexagonal and cubic crystal configurations [34]. In this study, the
strain IMA13 produced the spherical and oval AgNPs with 5–35 nm sizes, being different
in previous reports. However, the difference in size and shape of AgNPs synthesized
using different strains of the same species could be related to that of metabolites among
different strains.
In Bacillus, lipopeptides are the most known due to their antimicrobial and antiviral
properties. On the basis of analysis of B. mojavensis RRC101 genome, it was found to pos-
sess biocontrol-relevant secondary metabolism pathways, including fengycins, surfactins,
subtilosin, bacilysin, bacillomycin D, and bacillibactin [36]. This characterization of lipopep-
tides has been confirmed [37–39]. The researcher found that the strain B. mojavensis B0621A
produced a new iturinic lipopeptide called mojavensin A, but species identification could
need to be verified further [39]. In this study, cell-free culture supernatant (CFCS) secreted
by B. mojavensis IMA13 only found three types of lipopeptide compounds: bacillomycins D,
iturins, and fengycins. Although the peak of the FTIR spectra at 1646 cm−1 showed that the
AgCl-NPs strongly bonded with a negatively charged carboxylic group or amide I group in
proteins, lipopeptide compounds possibly took part in the synthesis of AgCl-NPs due to
the presence of the carboxylic group and carbonyl group. Lipopeptide compounds possibly
took part in the formation of the AgCl-NPs due to amino acid residues with C=O groups
in fengycins (Glu), bacillomycin D (Asn), and iturins (Asn and Glu), as well as the larger
shift change on peak at 1646 cm−1 . Similarly, the largest shift in the peak at 1029 cm−1
towards lower frequency compared to peak in 1080 cm−1 was attributed to the binding of
C–C–O and C–C–H groups with nanoparticles [19]. This was very likely, except with lipids
and carbohydrates, lipopeptide compounds were involved in formation of the AgCl-NPs
due to the AgCl-NPs binding with hydroxyl group on amino acid residues from fengycins
(Thr and Tyr), bacillomycin D (Ser, Thr, and Tyr), and ba Iturins (Ser and Tyr). However,
it is well known that the proteins bind with nanoparticles through cysteine residues or
free amino groups [40]. Electrostatic interactions of negatively charged carboxyl groups in
proteins or in heterocyclic compounds also bind with nanoparticles [41].
In addition, some studies show the antibacterial effect of AgCl-NPs depended strongly
on the size and the shape of the particles [42], while spherical AgCl-NPs were more stable
and had a higher antibacterial activity compared to other shapes [43,44]. Thus, presumably,
the AgCl-NPs synthesized by strain IMA13 have higher antibacterial activity. However, due
to differences of different test methods, antibacterial effectiveness against different pathogens
among strains still cannot be well evaluated only on the basis of data from the literature;
however, this study provides important information for biosynthesis of the AgCl-NPs.
The AgNPs exhibit their antimicrobial potential through multifaceted mechanisms
due to their antimicrobial activity against a diverse and broad range of plant pathogens [45].
In this study, the biosynthesized AgNPs exhibited high inhibitory activity against growth,
swarming, and swimming motility of R. solanacearum and indicted its potential applications
against bacterial wilt disease, which is similar to a previous report [46]. Meanwhile, the
mode of AgNPs action on bacterial cells was characterized by SEM on the basis of the
morphological changes of cells, and the presence of nanoparticles was confirmed by EDS,
providing evidence of direct physical interaction between nanoparticles and bacterial cells
(Figure 10a,d). Similarly, TEM micrographs revealed that the AgNPs caused damage to
cell walls and the cytoplasmic membrane, as well as cell deformation, finally leading
to the disintegration of bacterial cells (Figure 11a–d). Therefore, this study extends our
Molecules 2022, 27, 224 13 of 18

understanding of nanoparticles that could potentially be used as an effective strategy for

preventing diversified bacterial diseases.

4. Materials and Methods

4.1. Sample Collection and Bacterial Isolation
The soil samples were collected from rhizospheric soil of eggplants in different fields in
Hangzhou city, Zhejiang Province, China, on 20 June 2017 by Abd Alamer et al. [45], wherein
eggplant plants had been grown in fields that were heavily infected by R. solanacearum for
many years. The annual average temperature in this area is 15.9–17 ◦ C, and average humidity
is 76–81%. The bacterial strains isolated previously were stored in 20% glycerol. For this study,
they were cultured and purified using the streaking plate method on Luria Broth (LB) agar
plates at 28 ± 2 ◦ C, as described by Abd Alamer et al. [45].

4.2. Biosynthesis of AgCl-NPs

For the cell-free culture supernatant (CFCS) of each strain, nine pure bacterial strains
were cultured in nutrient broth (10 g tryptone, 3 g beef extract, 2.5 g glucose, and 5 g
NaCl per liter; pH 7.2) in a ZWY-211B rotary shaker at 30 ◦ C and 200 rpm for 24 h, and the
CFCS was obtained by centrifugation and filtration with a millipore membrane with 0.22 µm
pore size. For biosynthesis of AgCl-NPs, 35 mL of the CFCS was mixed with 65 mL (1.0 mM)
of AgNO3 solution (Sinopharm Chemical Reagent Co., Ltd., Shanghai, China) prepared
with double-distilled water (ddH2 O) in a 250 mL Erlenmeyer flask, as described by [15].
The flasks were kept in the dark rotary shaker at 30 ◦ C and 200 rpm for 48 h, and color
change in each flask was observed. If the flasks had a strong color change (for example, from
yellowish to red-brown color), the corresponding strains were used to re-synthesize the
AgCl-NPs. To confirm the formation of AgCl-NPs, we measured synthesized solution using
a UV2550 UV–VIS spectrophotometer (Shimadzu, Kyoto, Japan) from 200 to 800 nm at 1 nm
resolution. The experimental flasks without the silver ion but with bacterial metabolites
were used for control, and the experiments were conducted in triplicate. The brown-reddish
solution was centrifuged at 20,000 rpm for 15 min, and precipitate was washed twice with
ddH2 O, and they were freeze-dried by Alpha 1–2 LDplus dryer (Osterode, Germany) into
AgCl-NPs powder for characterization study.

4.3. Characterizations of AgCl-NPs

A characterization of the synthesized AgCl-NPs was examined, as described by [10].
Surface characteristics and size of AgCl-NPs were observed using scanning electron mi-
croscopy (SEM) (Zeiss Gemini SEM 300, Jena, Germany). The nano-silver element density
was confirmed using an energy dispersive spectroscopy (EDS) detector (Oxford Instru-
ments, Oxford, United Kingdom) at 20 keV. The shape and size of AgCl-NPs were detected
by transmission electron microscopy (TEM) (JEM-1200EX, Tokyo, Japan). In addition, the
crystalline nature of AgCl-NPs was detected by X-ray diffraction (XRD) analysis using a
Siemens D5000 diffractometer in the 2θ range from 10◦ to 90◦ with Cu-K radiation at an
operating voltage of 45 kV and a current of 0.8 mA (Munich, Germany). The dried CFCS
extract with or without AgCl-NPs was analyzed using a Fourier transform infrared (FTIR)
spectrometer (Bruker Vector 22, Ettlingen, Germany) in the mid-infrared light region of
490–4000 cm−1 with a resolution of 4 cm−1 .

4.4. Identification of Bacterium Strain IMA13

To identify the bacteria strain with effectively synthesized AgCl-NPs, we synthesized
the six primer pairs in Table 1. The bacterial strain was cultured on LB at 30 ◦ C for 24 h,
and the chosen primers were amplified in an automated thermal cycler (Eppendorf AG,
Hamburg, Germany). The 16S rRNA gene amplification was carried out according to the
method described by [47]. The sequences of gyrase subunit A (gyrA), RNA polymerase
subunit B (rpoB), phosphoribosylaminoimidazolecarboxamide formyltransferase (purH), DNA
polymerase III subunit alpha (polC), and 60 kDa heat-shock protein (groEL) genes were
Molecules 2022, 27, 224 14 of 18

amplified, as described by [20]. The amplified products were checked on a 1% agarose

gel under an ultraviolet transilluminator (GenoSens 1850, Clinx Science Instruments Co.,
Ltd., Shanghai, China), and the eligible products were submitted to the Sangon Biotech
Company Limited (Shanghai, China) using the Sanger method for sequencing of both strands
on automated DNA sequencer (ABI 3730xl, Applied Biosystems, Foster City, CA, USA).

4.5. Phylogenetic Analysis

For phylogenetic analysis, sequences of six genes (16S, gyrA, rpoB, purH, polC, and
groEL) were assembled and edited using BioEdit software [48], and they were deposited in
the GenBank sequence database. The closely related genes downloaded and Bacillus cereus
strain ATCC 14579 was used as the outgroup (Table 2).
Sequences of each gene were aligned with MAFFT 7.273 [49], and the resulted align-
ment was put into Gblocks 0.91b to eliminate the ambiguously aligned positions and
divergent regions before phylogenetic analyses [50]. Molecular phylogenies with maxi-
mum likelihood (ML) were constructed by RaxmlGUI v. 1.5 [51]. ML bootstrap analysis for
each ML tree was performed with 1000 fast bootstrap replicates with the same parameter
settings using the GTR+I+G model of nucleotide substitution. A threshold of ≥50% was
used as the cut-off for significantly supported nodes.

4.6. Lipopeptide Identification

To identify the lipopeptides compounds produced by strain IAM13, we used the
method described previously [45]. Briefly, the strain IMA13 was grown on an LB agar plate
at 30 ◦ C for 24 h. Then, the colony was transferred to an Eppendorf tube containing a
matrix solution composed of cyano-4-hydroxycinnamic acid in 70% water, 30% acetonitrile,
and 0.1% trifluoroacetic acid (v/v). Bacterial cells were shaken for their homogeneity and
then centrifuged at 5000 rpm. A total of 1 µL of the cell-free supernatant was put onto the
targeted plate of MALDI-TOF MTP 384 (Bruker ultra flextreme instrument) and allowed to
dry. The spectra analysis was conducted using an ultra-extreme instrument MALDI-TOF
(Bruker, Bremen, Germany) with a Scout-mtp ion source equipped with a 337 nm nitrogen
laser. All spectra were acquired in the reflector positive ion mode and the acceleration and
reflector voltages were 25 kV and matrix suppression in deflex-ion mode at m/z 750. The
laser power was set to just above the ionization threshold (around 35%). The resulting
sample spectra from 1000 laser shots per m/z segment were displayed in 10 groups of
50 shots distributed in three different locations on the surface of a matrix spot. Spectra
were detected in the positive and reflector mode in 500 to 5000 Da.

4.7. Antibacterial Activity of AgCl-NPs

4.7.1. Agar Well Diffusion Assay
To determine antibacterial activity of synthesized AgCl-NPs, we used agar well dif-
fusion technique, as described by [52], to test activity against bacterial pathogen Ralstonia
solanacearum YY06 (a highly aggressive) from the Plant Pathology Department, Zhejiang
University, China. Briefly, 1.0 mL of strain YY06 (about 1 × 108 CFU/mL) grown in LB
broth at 200 rpm and 30 ◦ C for 24 h was mixed with 15 mL LB agar at 45 ◦ C in a 9 cm Petri
dishes. After solidification under fume hood, a well was prepared using a sterile cork borer
of 5 mm diameter on the center of a Petri dish, and 30 µL of AgCl-NPs solution at concen-
trations of 5, 10, and 20 µg/mL−1 was added into wells. The 30 µL of the CFCS or ddH2 O
was used as controls. Antibacterial activity was determined by diameter measurement
of inhibition zone around the each well and then calculated as percentage inhibition of
radial growth (PIRG %) by using the formula following (PIRG (%) = [(treatment − control
(CFCS))/control] × 100%). Each treatment was replicated three times.

4.7.2. Motility Assay

The effect of synthesized AgCl-NPs solution on the swarming motility of cells of
strain YY06 was examined in the LB broth supplemented with 0.7% (w/v) agar [53], and on
Molecules 2022, 27, 224 15 of 18

swimming motility of the test bacteria in LB broth containing 0.3% agar [27]. Briefly, 5, 10,
and 20 µg/mL−1 of synthesized AgCl-NP solution was mixed with both all LB media at
45 ◦ C in separate petri plates, and 30 µL of the CFCS or ddH2 O was used as controls. After
solidification of media under fume hood, 5 µL of cell suspension of strain YY06 (about
1 × 108 CFU/mL) grown in LB broth at 200 rpm and 30 ◦ C for 24 h was dropped to the
center of each plate and then incubated for 3 days at 30 ◦ C. The swarming and swimming
motility of cells of strain YY06 was determined by measuring the colony diameters [54].
Percentage inhibition was calculated by using the formula, as described previously [55].
Each treatment was replicated three times.

4.7.3. Determination of Minimum Inhibitory Concentration (MIC)

To determine the lowest concentration of the AgCl-NPs synthesized by the CFCS
extract of strain IMA13 for inhibiting the visible growth of plant pathogenic bacterium
strain YY06, we carried out the MIC assay using the 96-well microtiter plate method,
as described by [56]. Briefly, 200 µL of the synthesized AgCl-NPs (in LB broth) were
added in 96-well plates with decreasing concentrations (2.5, 5, 10, 20, and 40 µg/mL−1 ). A
total of 200 µL of LB broth with 30 µL of ddH2 O or with 30 µL of CFCS extract of strain
IMA13 was used as controls. Each well of the microtiter plates were inoculated with 10 µL
suspension (about 1 × 108 CFU/mL) of strain YY06 grown in LB broth at 200 rpm and
30 ◦ C for 24 h, and then the microtiter plates were incubated in a rotary shaker at 30 ◦ C and
200 rpm for 48 h. The optical density of bacterial cells was measured using a Spectra Max
spectrophotometer (Molecular Devices, Sunnyvale, CA, USA) at 600 nm (OD600 ). Three
replicates for each treatment were used, and the experiment was performed three times.

4.8. Ultrastructural Characteristics of the AgCl-NP Interaction with Pathogen

To observe the interaction of the AgCl-NPs with pathogenic bacterium cells, we ob-
served morphological changes on the surfaces of bacterial cells by SEM after the AgCl-NPs
treated bacterial cells with final concentration of 2.0 µg/mL−1 with shaking (200 rpm) at
30 ◦ C for 4 and 8 h. Briefly, suspensions of the treated bacteria were centrifuged at 6000 rpm
for 10 min at 4 ◦ C, washed with PBS at pH 7, post-fixated in 1% (w/v) osmium tetroxide,
and dehydrated in a graded ethanol series (50%, 70%, 80%, 90%, 95%, and 100%), as de-
scribed by [53]. The samples were attached to an aluminum stub and sputter-coated with
gold, and then examined and photographed in an SEM (Zeiss Gemini SEM 300, Germany).
Suspensions of the bacteria treated by the CFCS extract with final concentration of the
2.0 µg/mL−1 were used as another control.
To observe the effect of the AgCl-NPs on the inner of pathogenic bacterial cells, we
observed ultrastructural characteristics by using a JEM-1200EX transmission electron mi-
croscope (JEM-1200EX, Tokyo, Japan). Suspensions of the bacteria treated by the AgCl-NPs
as described above and bacterial cells were fixed with glutaraldehyde (2.5%, v/v) in 0.1 M
sodium phosphate buffer (pH 7.0) for 18 h at 4 ◦ C. After centrifugation at 5000× g for
10 min, bacterial cells were embedded in potato dextrose agar (PDA). Afterward, samples
were washed three times with phosphate-buffered saline (PBS) and fixed with (1% w/v,
osmium tetroxide) for one hour at room temperature. The specimens were dehydrated
for 15 min in a series of gradients ethanol concentrations (30 to 100%). After dehydrating
in a graded ethanol series, samples were embedded in Spurr’s epoxy resin, as described
by [57]. After the samples were cut with a Reichart-Jung Ultracute E ultramicrotome with a
diamond knife, ultrathin sections collected on formvar-coated one-slot copper grids were
stained with 2% uranyl acetate for 10 min and lead citrate for 5 min.

4.9. Statistical Analysis

All data reported in this study are the means of three replicates (n = 3). The analysis
of the data was carried out using Statistic (version 8.1) software, and the means were
compared by least significant difference (Fisher’s LSD) at the probability level (p ≤ 0.05)
according to Steel and Torrie [58].
Molecules 2022, 27, 224 16 of 18

5. Conclusions
In the present study, we reported the biological, eco-friendly, and non-toxic method
for the synthesis of AgCl-NPs using cell-free culture supernatant of bacterial strain IMA13.
The biosynthesized AgCl-NPs were characterized by XRD analysis. The spherical and
oval nanoparticles with 5–35 nm sizes were obtained. The strain IMA13 was identified
as B. mojavensis on the basis of phylogenetic analysis using a combination of six gene se-
quences. MALDI-TOF analysis showed the lipopeptides compounds produced by strain
IAM13 were attributed to the bacillomycin D, iturins, and fengycins. The antibacterial activ-
ity of the AgCl-NPs displayed the significant inhibition activity against growth, swarming,
and swimming motility of phytopathogenic bacterium R. solanacearum, showing their po-
tential application against bacterial wilt. The mode of AgCl-NPs action was characterized
by SEM and TEM examinations according to AgCl-NP accumulation and hole formation
on the surface of bacterial cells, as well as damage of cell walls and cytoplasmic membrane
against bacterial cells, and on the basis of the morphological changes of bacterial cells inside
and outside and the presence of nanoparticles confirmed by EDS, providing evidence of
direct physical interaction between nanoparticles and bacterial cells. Overall, our findings
suggest that biogenic AgCl-NPs could be considered as promising nanopesticides for dis-
ease management in eggplants. However, future investigations are needed to assess the
antimicrobial potential of biogenic AgCl-NPs in realistic agricultural conditions such as
field trials.

Supplementary Materials: The following supporting information can be downloaded online. Table S1:
Lipopeptide compounds detected using MALDI-TOF mass spectrometry from bacterial strain IAM13.
Author Contributions: Conceptualization, I.S.A.A. and J.Z.; performing the experiments, collecting
data, and writing the manuscript, A.A.T. and T.A.; conducting statistical analysis and editing figures,
review and editing, B.L. and T.A.; supervision of the student, and reading, correcting, and revision of
the manuscript, J.Z. All authors have read and agreed to the published version of the manuscript.
Funding: This work was supported by the Key Science and Technology Project of Zhejiang Province
(no. 2015C02023), the Special Fund for Agro-scientific Research in the Public Interest of China
(no. 201503109), and the National Natural Science Foundation of China (31501342).
Institutional Review Board Statement: Not applicable.
Informed Consent Statement: Not applicable.
Conflicts of Interest: The authors declare no conflict of interest.

References
1. Peeters, N.; Guidot, A.; Vailleau, F.; Valls, M. Ralstonia solanacearum, a widespread bacterial plant pathogen in the post-genomic
era. Mol. Plant Pathol. 2013, 14, 651–662.
2. Elphinstone, J.G.; Allen, C.; Prior, P.; Hayward, A.C. The current bacterial wilt situation: A global overview. In Bacterial Wilt the
Disease & the Ralstonia Solanacearum Species Complex; APS Press: Saint Paul, MN, USA, 2005; pp. 9–28.
3. Genin, S. Molecular traits controlling host range and adaptation to plants in Ralstonia solanacearum. New Phytol. 2010, 187, 920–928. [CrossRef]
4. Hayward, A.C. Biology and Epidemiology of Bacterial Wilt Caused by Pseudomonas Solanacearum. Annu. Rev. Phytopathol. 1991,
29, 65–87. [CrossRef]
5. Wicker, E.; Grassart, L.; Coranson-Beaudu, R.; Mian, D.; Guilbaud, C.; Fegan, M.; Prior, P. Ralstonia solanacearum
Strains from Martinique (French West Indies) Exhibiting a New Pathogenic Potential. Appl. Environ. Microbiol. 2007,
73, 6790–6801. [CrossRef] [PubMed]
6. Álvarez, B.; López, M.M.; Biosca, E.G. Survival strategies and pathogenicity of Ralstonia solanacearum phylotype II subjected to
prolonged starvation in environmental water microcosms. Microbiology 2008, 154, 3590–3598. [CrossRef]
7. Corral, J.; Sebastià, P.; Coll, N.S.; Barbé, J.; Aranda, J.; Valls, M. Twitching and swimming motility play a role in Ralstonia
solanacearum pathogenicity. Msphere 2020, 5, e00740-19. [CrossRef]
8. Mansfield, J.; Genin, S.; Magori, S.; Citovsky, V.; Sriariyanum, M.; Ronald, P.; Dow, M.; Verdier, V.; Beer, S.V.; Machado, M.A.; et al.
Top 10 plant pathogenic bacteria in molecular plant pathology. Mol. Plant Pathol. 2012, 13, 614–629. [CrossRef] [PubMed]
9. Denny, T. Plant pathogenic Ralstonia species. In Plant-Associated Bacteria; Springer: Dordrecht, The Netherlands, 2007; pp. 573–644.
10. Tomah, A.A.; Alamer, I.S.A.; Li, B.; Zhang, J.-Z. Mycosynthesis of Silver Nanoparticles Using Screened Trichoderma Isolates and
Their Antifungal Activity against Sclerotinia sclerotiorum. Nanomaterials 2020, 10, 1955. [CrossRef] [PubMed]
Molecules 2022, 27, 224 17 of 18

11. Narayanan, K.B.; Sakthivel, N. Biological synthesis of metal nanoparticles by microbes. Adv. Colloid Interface Sci. 2010, 156, 1–13. [CrossRef]
12. Schabes-Retchkiman, P.; Canizal, G.; Herrera-Becerra, R.; Zorrilla, C.; Liu, H.; Ascencio, J. Biosynthesis and characterization of
Ti/Ni bimetallic nanoparticles. Opt. Mater. 2006, 29, 95–99. [CrossRef]
13. Singh, P.; Kim, Y.J.; Singh, H.; Wang, C.; Hwang, K.H.; Farh, M.E.A.; Yang, D.C. Biosynthesis, characterization, and antimicrobial
applications of silver nanoparticles. Int. J. Nanomed. 2015, 10, 2567–2577.
14. Velusamy, P.; Kumar, G.V.; Jeyanthi, V.; Das, J.; Pachaiappan, R. Bio-Inspired Green Nanoparticles: Synthesis, Mechanism, and
Antibacterial Application. Toxicol. Res. 2016, 32, 95–102. [CrossRef] [PubMed]
15. Elbeshehy, E.K.F.; Elazzazy, A.M.; Aggelis, G. Silver nanoparticles synthesis mediated by new isolates of Bacillus spp., nanoparticle
characterization and their activity against Bean Yellow Mosaic Virus and human pathogens. Front. Microbiol. 2015, 6, 453. [CrossRef]
16. Jalal, M.; Ansari, M.A.; Alzohairy, M.A.; Ali, S.G.; Khan, H.M.; Almatroudi, A.; Siddiqui, M.I. Anticandidal activity of biosynthe-
sized silver nanoparticles: Effect on growth, cell morphology, and key virulence attributes of Candida species. Int. J. Nanomed.
2019, 14, 4667–4679. [CrossRef]
17. Dakal, T.C.; Kumar, A.; Majumdar, R.S.; Yadav, V. Mechanistic Basis of Antimicrobial Actions of Silver Nanoparticles. Front.
Microbiol. 2016, 7, 1831. [CrossRef] [PubMed]
18. Jain, N.; Bhargava, A.; Majumdar, S.; Tarafdar, J.C.; Panwar, J. Extracellular biosynthesis and characterization of silver nanoparti-
cles using Aspergillus flavusNJP08: A mechanism perspective. Nanoscale 2010, 3, 635–641. [CrossRef]
19. Shameli, K.; Bin Ahmad, M.; Jazayeri, S.D.; Sedaghat, S.; Shabanzadeh, P.; Jahangirian, H.; Mahdavi, M.; Abdollahi, Y. Synthesis
and Characterization of Polyethylene Glycol Mediated Silver Nanoparticles by the Green Method. Int. J. Mol. Sci. 2012,
13, 6639–6650. [CrossRef] [PubMed]
20. Rooney, A.P.; Price, N.P.J.; Ehrhardt, C.; Swezey, J.L.; Bannan, J.D. Phylogeny and molecular taxonomy of the Bacillus subtilis
species complex and description of Bacillus subtilis subsp. inaquosorum subsp. nov. Int. J. Syst. Evol. Microbiol. 2009,
59, 2429–2436. [CrossRef] [PubMed]
21. Soussi, S.; Essid, R.; Hardouin, J.; Gharbi, D.; Elkahoui, S.; Tabbene, O.; Cosette, P.; Jouenne, T.; Limam, F. Utilization of Grape
Seed Flour for Antimicrobial Lipopeptide Production by Bacillus amyloliquefaciens C5 Strain. Appl. Biochem. Biotechnol. 2018,
187, 1460–1474. [CrossRef]
22. Pathak, K.; Keharia, H. Characterization of fungal antagonistic bacilli isolated from aerial roots of banyan (Ficus benghalensis)
using intact-cell MALDI-TOF mass spectrometry (ICMS). J. Appl. Microbiol. 2013, 114, 1300–1310. [CrossRef]
23. Lin, L.-Z.; Zheng, Q.-W.; Wei, T.; Zhang, Z.-Q.; Zhao, C.-F.; Zhong, H.; Xu, Q.-Y.; Lin, J.-F.; Guo, L.-Q. Isolation and Characterization
of Fengycins Produced by Bacillus amyloliquefaciens JFL21 and Its Broad-Spectrum Antimicrobial Potential against Multidrug-
Resistant Foodborne Pathogens. Front. Microbiol. 2020, 11, 3319. [CrossRef]
24. Vater, J.; Kablitz, B.; Wilde, C.; Franke, P.; Mehta, N.; Cameotra, S.S. Matrix-Assisted Laser Desorption Ionization-Time of Flight
Mass Spectrometry of Lipopeptide Biosurfactants in Whole Cells and Culture Filtrates of Bacillus subtilis C-1 Isolated from
Petroleum Sludge. Appl. Environ. Microbiol. 2002, 68, 6210–6219. [CrossRef]
25. Hanif, A.; Zhang, F.; Li, P.; Li, C.; Xu, Y.; Zubair, M.; Zhang, M.; Jia, D.; Zhao, X.; Liang, J.; et al. Fengycin Produced by Bacillus
amyloliquefaciens FZB42 Inhibits Fusarium graminearum Growth and Mycotoxins Biosynthesis. Toxins 2019, 11, 295. [CrossRef]
26. Saklani, V.; Suman, J.V.K.; Jain, K. Microbial synthesis of silver nanoparticles: A review. J. Biotechnol. Biomater. 2012, 13, 2718–2725. [CrossRef]
27. Al-Shabib, N.A.; Husain, F.M.; Nadeem, M.; Khan, M.S.; Al-Qurainy, F.; Alyousef, A.A.; Arshad, M.; Khan, A.; Khan, J.M.;
Alam, P.; et al. Bio-inspired facile fabrication of silver nanoparticles from in vitro grown shoots of Tamarix nilotica: Explication of
its potential in impeding growth and biofilms of Listeria monocytogenes and assessment of wound healing ability. RSC Adv.
2020, 10, 30139–30149. [CrossRef]
28. Spagnoletti, F.N.; Spedalieri, C.; Kronberg, M.F.; Giacometti, R. Extracellular biosynthesis of bactericidal Ag/AgCl nanoparticles
for crop protection using the fungus Macrophomina phaseolina. J. Environ. Manag. 2018, 231, 457–466. [CrossRef]
29. Alamri, S.A.; Hashem, M.; Nafady, N.A.; Sayed, M.A.; Alshehri, A.M.; Alshaboury, G.A. Controllable biogenic synthesis of intracellular
silver/silver chloride nanoparticles by Meyerozyma guilliermondii KX008616. J. Microbiol. Biotechnol. 2018, 28, 917–930. [CrossRef]
30. Ghiuta, I.; Croitoru, C.; Kost, J.; Wenkert, R.; Munteanu, D. Bacteria-Mediated Synthesis of Silver and Silver Chloride Nanoparticles
and Their Antimicrobial Activity. Appl. Sci. 2021, 11, 3134. [CrossRef]
31. Sharifi-Rad, M.; Pohl, P. Synthesis of biogenic silver nanoparticles (Agcl-NPs) using a pulicaria vulgaris gaertn. aerial part extract
and their application as antibacterial, antifungal and antioxidant agents. Nanomaterials 2020, 10, 638. [CrossRef] [PubMed]
32. Maldonado-Muñiz, M.; Luna, C.; Mendoza-Reséndez, R.; Barriga-Castro, E.D.; Soto-Rodriguez, S.; Ricque-Marie, D.;
Cruz-Suarez, L.E. Silver nanoparticles against acute hepatopancreatic necrosis disease (AHPND) in shrimp and their depuration
kinetics. Environ. Boil. Fishes 2019, 32, 2431–2445. [CrossRef]
33. Siddiqui, M.R.H.; Adil, S.; Nour, K.; Assal, M.; Al-Warthan, A. Ionic liquid behavior and high thermal stability of silver chloride
nanoparticles: Synthesis and characterization. Arab. J. Chem. 2013, 6, 435–438. [CrossRef]
34. Zaki, S.; Eltarahony, M.; Elkady, M.; Abd-El-Haleem, D. The Use of Bioflocculant and Bioflocculant-Producing Bacillus mojavensis
Strain 32A to Synthesize Silver Nanoparticles. J. Nanomater. 2014, 2014, 1–7. [CrossRef]
35. Iqtedar, M.; Aslam, M.; Akhyar, M.; Shehzaad, A.; Abdullah, R.; Kaleem, A. Extracellular biosynthesis, characterization,
optimization of silver nanoparticles (AgNPs) using Bacillus mojavensis BTCB15 and its antimicrobial activity against multidrug
resistant pathogens. Prep. Biochem. Biotechnol. 2019, 49, 136–142. [CrossRef]
Molecules 2022, 27, 224 18 of 18

36. Blacutt, A.A.; Mitchell, T.R.; Bacon, C.W.; Gold, S.E. Bacillus mojavensis RRC101 Lipopeptides Provoke Physiological and Metabolic
Changes During Antagonism Against Fusarium verticillioides. Mol. Plant-Microbe Interact. 2016, 29, 713–723. [CrossRef]
37. Ben Ayed, H.; Hmidet, N.; Béchet, M.; Chollet, M.; Chataigné, G.; Leclère, V.; Jacques, P.; Nasri, M. Identification and biochemical
characteristics of lipopeptides from Bacillus mojavensis A21. Process. Biochem. 2014, 49, 1699–1707. [CrossRef]
38. Snook, M.E.; Mitchell, T.; Hinton, D.M.; Bacon, C.W. Isolation and Characterization of Leu7-Surfactin from the Endophytic Bacterium
Bacillus mojavensis RRC 101, a Biocontrol Agent for Fusarium verticillioides. J. Agric. Food Chem. 2009, 57, 4287–4292. [CrossRef]
39. Ma, Z.; Wang, N.; Hu, J.; Wang, S. Isolation and characterization of a new iturinic lipopeptide, mojavensin A produced by a
marine-derived bacterium Bacillus mojavensis B0621A. J. Antibiot. 2012, 65, 317–322. [CrossRef]
40. Bahrami-Teimoori, B.; Nikparast, Y.; Hojatianfar, M.; Akhlaghi, M.; Ghorbani, R.; Pourianfar, H.R. Characterisation and antifungal
activity of silver nanoparticles biologically synthesised by Amaranthus retroflexus leaf extract. J. Exp. Nanosci. 2017, 12, 129–139. [CrossRef]
41. Prabhu, S.; Poulose, E.K. Silver nanoparticles: Mechanism of antimicrobial action, synthesis, medical applications, and toxicity
effects. Int. Nano Lett. 2012, 2, 32. [CrossRef]
42. Amany, A.; Kheshen, E.; Sanaa, F.; Rab, G.E. Effect of reducing and protecting agents on size of silver nanoparticles and their
anti-bacterial activity. J. Pharm. Chem. 2012, 4, 53–65.
43. Krutyakov, Y.A.; Kudrinskiy, A.A.; Olenin, A.Y.; Lisichkin, G.V. Synthesis and properties of silver nanoparticles: Advances and
prospects. Russ. Chem. Rev. 2008, 77, 233–257. [CrossRef]
44. Xu, R.; Wang, D.; Zhang, J.; Li, Y. Shape-Dependent Catlytic Activity of Silver Nanoparticles for the Oxidation of Styrene. Chem.
Asian J. 2006, 1, 888–893. [CrossRef]
45. Abd Alamer, I.S.; Tomah, A.A.; Li, B.; Zhang, J.-Z. Isolation, Identification and Characterization of Rhizobacteria Strains for
Biological Control of Bacterial Wilt (Ralstonia solanacearum) of Eggplant in China. Agriculture 2020, 10, 37. [CrossRef]
46. Sotoodehnia, P.; Mazlan, N.; Mohd Saud, H.; Samsuri, W.A.; Habib, S.H.; Soltangheisi, A. Minimum inhibitory concentration
of nano-silver bactericides for beneficial microbes and its effect on Ralstonia solanacearum and seed germination of Japanese
Cucumber (Cucumis sativus). PeerJ 2019, 7, e6418. [CrossRef] [PubMed]
47. Zhang, F.; Li, X.-L.; Zhu, S.-J.; Ojaghian, M.R.; Zhang, J.-Z. Biocontrol potential of Paenibacillus polymyxa against Verticillium dahliae
infecting cotton plants. Biol. Control 2018, 127, 70–77. [CrossRef]
48. Hall, T. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic
Acids Symp. 1999, 41, 95–98.
49. Katoh, K.; Standley, D.M. Mafft multiple sequence alignment software version 7: Improvements in performance and usability.
Mol. Biol. Evol. 2013, 30, 772–780. [CrossRef]
50. Katoh, K.; Kuma, K.; Toh, H.; Miyata, T. MAFFT version 5: Improvement in accuracy of multiple sequence alignment. Nucleic
Acids Res. 2005, 33, 511–518. [CrossRef] [PubMed]
51. Silvestro, D.; Michalak, I. raxmlGUI: A graphical front-end for RAxML. Org. Divers. Evol. 2011, 12, 335–337. [CrossRef]
52. Sanchooli, N.; Saeidi, S.; Barani, H.K.; Sanchooli, E. In vitro antibacterial effects of silver nanoparticles synthesized using Verbena
officinalis leaf extract on Yersinia ruckeri, Vibrio cholera and Listeria monocytogenes. Iran. J. Microbiol. 2018, 10, 400–408.
53. Ali, K.A.; Yao, R.; Wu, W.; Masum, M.I.; Luo, J.; Wang, Y.; Zhang, Y.; An, Q.; Sun, G.; Li, B. Biosynthesis of silver nanoparticle from
pomelo (Citrus Maxima) and their antibacterial activity against acidovorax oryzae RS-2. Mater. Res. Express 2020, 7, 015097. [CrossRef]
54. Liu, H.; Tian, W.-X.; Ibrahim, M.; Li, B.; Zhang, G.-Q.; Zhu, B.; Xie, G.-L. Characterization of pilP, a gene required for twitching motility,
pathogenicity, and biofilm formation of Acidovorax avenae subsp. avenae RS-1. Eur. J. Plant Pathol. 2012, 134, 551–560. [CrossRef]
55. Saminu, S.; Saleh, M.I.A.; Abdulwahab, A.; Farra’u, U.; Babale, A.I. Evaluation of anti-diarrhoeal activity of L-citrulline in mice. J.
Afr. Ass. Physiol. Sci. 2018, 6, 104–109.
56. Ahmed, T.; Shahid, M.; Noman, M.; Niazi, M.B.K.; Zubair, M.; Almatroudi, A.; Khurshid, M.; Tariq, F.; Mumtaz, R.; Li, B.
Bioprospecting a native silver-resistant Bacillus safensis strain for green synthesis and subsequent antibacterial and anticancer
activities of silver nanoparticles. J. Adv. Res. 2020, 24, 475–483. [CrossRef] [PubMed]
57. Zhang, F.; Li, X.-L.; Zhu, S.-J.; Ojaghian, M.R.; Zhang, J.-Z. Data on the ultrastructural characteristics of Paenibacillus polymyxa
isolates and biocontrol efficacy of P. polymyxa ShX301. Data Brief 2018, 21, 259–262. [CrossRef] [PubMed]
58. D’Steel, R.G.; Torrie, J.H. Principles and Procedures of Statistics: A Biometrical Approach; McGraw-Hill: New York, NY, USA, 1986.