Plus Two Zoology Notes Navas-2024-25 - Hssreporter - Com

SOHSS-AREEKODE NAVAS CHEEMADAN
Chapter-01  All these reproductive events occur only

after puberty.
Human Reproduction  There are remarkable differences
between the reproductive events in the
male and in the female, The sperm
Introduction formation (Spermatogenesis) continues
 Humans are sexually reproducing and in old men, but formation of ovum
viviparous organisms. (Oogenesis) ceases in women around the
 Reproduction is ability to reproduce age of 50 years.
individuals of same species. The main
events in reproduction include-
The Male Reproductive System
Gametogenesis-------> Insemination----->
Fertilsation----> Implanation----> Gestation
----> Delivery / Parturition.
a)Gametogenesis:-
 It is the formation of gametes.
 Male gametes are sperms
 Female gametes are egg/ovum.
 Formation of sperm is called
spermatogenesis
 Formation of egg is called
oogenesis
b)Insemination:-
 it is the transfer of sperms into the
female genital tract
c)Fertilisation:-
 it is the fusion of male and female
gamete. It results in the formation of
zygote
d)Implantation:-
 Attachment of Blastocyst on the The male reproductive system is located in
inner wall of uterus (Endometrium) is the pelvis region. It consists of
called implantation a) A pair of testis
e)Gestation:- b) Accessory ducts
 Embryonic development within the c) Glands
uterus of mother is called gestation. d) External genitalia.
 Human gestation period is 9 month. a)Testes
Or  The testes are situated outside the
 The duration between fertilization abdominal cavity (Extra abdominal ) within
and parturition is called gestation. a pouch called scrotum.
f)Parturition:-  The scrotum helps in maintaining the
 Delivery of the baby is the parturition low temperature of the testes (2–2.5oc
lower than the normal internal body
NAVAS CHEEMADAN/2024 [email protected]
Downloaded from hssreporter.com

temperature) necessary for  The functions of male sex accessory
spermatogenesis. ducts and glands are maintained by the
testicular hormones (androgens).
Shape of Each Testis: Oval
Length: 4 to 5 cm b)Accessory Duct
Width: 2 to 3 cm  The male sex accessory ducts include
Position: Within scrotum  Rete testis,
 Vasa efferentia,
 Epididymis and
 The testis is covered by a dense covering.  Vas deferens.
 Each testis has about 250 compartments  The seminiferous tubules of the testis
called testicular lobules. open into the vasa efferentia through
 Each Testicular lobule contains one to rete testis (They are irregular cavities
three highly coiled seminiferous tubules present in testes ).
in which sperms are produced.  The vasa efferentia leave the testis and
 Each seminiferous tubule is lined on its open into epididymis.
inside by two types of cells called  The epididymis leads to vas deferens.
i) Male germ cells (spermatogonia)  Vasdeferens ascends to the abdomen and
ii) Sertoli cells. loops over the urinary bladder
 Vas deferens receives a duct from
i)The male germ cells seminal vesicle and opens into urethra as
/Spermatogonia/Male germ cells the ejaculatory duct .
The male germ cells undergo meiotic  These ducts store and transport the
divisions finally leading to sperm formation, sperms from the testis to the outside
ii)Sertoli cells/Nursing cells through urethra.
Sertoli cells (Nursing cells ) provide  The urethra originates from the urinary
nutrition to the germ cells. bladder and extends through the penis to
its external opening called urethral
meatus.
Seminiferous tubules Rete testis Vasa

efferentia  EpididymisVas deferens
Ejaculatory duct  Urethra  Urethral
meatus
c)External Genitalia
 The penis is the male external genitalia .
 It is made up of special tissue ( Spongy
erectile tissue ) that helps in erection of
the penis to facilitate insemination.
 The enlarged end of penis called the
glans penis is covered by a loose fold of
 The regions outside the seminiferous skin called foreskin.
tubules called interstitial spaces, contain
small blood vessels and interstitial cells d) Accessory Glands
or Leydig cell.
 It include
 Leydig cells synthesise and secrete
testicular hormones called androgens. i)Paired seminal vesicles,
Other immunologically competent cells ii)A prostate and
are also present. iii)Paired bulbourethral glands
(Cowper’s gland).

 Secretions of all these glands constitute The Female Reproductive System
the seminal plasma
 Seminal plasma is rich in fructose,
calcium and certain enzymes.
 The secretions of bulbourethral gla
glands
also helps in the lubrication of the
penis.
 Secretions of epididymis, vas deferens,
seminal vesicle and prostate are
essential for maturation and motility of
sperms
 Seminal plasma along with sperm is
called Semen
Seminal Plasma + Sperm = Semen
 The female reproductive system is located

in pelvic region and
 it consists of
a)A pair of ovaries,
b)Accessory
ccessory ducts and
c)External
xternal genitalia
These parts of the system along with a pair
of the mammary glands are integrated
structurally and functionally to support the
processes of ovulation, fertilisation,
pregnancy, birth and child care.
a)Ovary
 Ovaries are the primary female sex
organs
 Ovaries produce the fem female gamete
(ovum) and several steroid hormones
(ovarian hormones--Estrogen and
progesteron).
 The ovaries are located one on each side
of the lower abdomen
 Each ovary is about 2 to 4 cm in length
and is connected to the pelvic wall and
uterus by ligaments.
 Each ovary is covered by a thin epithelium
which encloses the ovarian stroma.
 The stroma is divided into two zones –
a peripheral cortex and an inner
medulla

[email protected]

b) Accessory ducts c) External genitalia
 Accessory ducts include The female external genitalia include
 The oviducts (fallopian tubes), i)Mons pubis,
 Uterus and ii)Labia majora,
 Vagina iii)Labia minora,
iv)Hymen and
Oviduct : v)Clitoris
 Each fallopian tube is about 10-12 cm
long), the part closer to the ovary is the i)Mons pubis:
funnel-shaped infundibulum. It is a cushion of fatty tissue covered
 The edges of the infundibulum by skin and pubic hair.
possess finger-like projections called ii)The labia majora:
fimbriae, which help in collection of They are fleshy folds of tissue, which
the ovum after ovulation. extend down from the mons pubis and
 The infundibulum leads to a wider surround the vaginal opening.
part of the oviduct called ampulla. iii)The labia minora:
 The last part of the oviduct, isthmus They are paired folds of tissue under
has a narrow lumen and it joins the the labia majora.
uterus iv)Hymen :
Uterus (Womb) ; The opening of the vagina is often
 The shape of the uterus is like an covered partially by a membrane called
inverted pear. hymen.
 It is supported by ligaments attached
to the pelvic wall.
[The hymen is often torn during the first
 The uterus opens into vagina
coitus (intercourse). However, it can also be
through a narrow cervix.
broken by a sudden fall or jolt, insertion of a
 The cavity of the cervix is called
vaginal tampon, active participation in some
cervical canal which along with
sports like horseback riding, cycling, etc. In
vagina forms the birth canal.
some women the hymen persists even after
coitus. In fact, the presence or absence of
Cervial canal+Vagina= Birth Canal
hymen is not a reliable indicator of
virginity or sexual experience]
 The wall of the uterus has three layers of
tissue.
i) Perimetrium:-
v)Clitoris :
 It is the The external thin membranous
The clitoris is a tiny finger-like
layer of uterus
structure which lies at the upper junction of
the two labia minora above the urethral
ii) Myometrium:-
opening.
 It is the middle thick layer of uterus. It
contains smooth muscle.
 The myometrium exhibits strong
Mammary Gland
contraction during delivery of the  A functional mammary gland is
baby. characteristic of all female mammals
 The mammary glands are paired
iii)Endometrium structures (breasts) that contain
 Glandular tissue and
 It is the inner most layer of uterus and
 Variable amount of fat.
is a glandular layer.
 The glandular tissue of each breast is
 The Endometrium undergoes cyclical
divided into 15-20 mammary lobes
changes during menstrual cycle
containing clusters of cells called alveoli .

 The cells of alveoli secrete milk, which is
stored in the cavities (lumens) of
Reproductive events
The main events in reproduction include-
alveoli.
 The alveoli open into mammary tubules. A)Gametogenesis
 The mammary tubules of each lobe join to B)Insemination
form a mammary duct. C)Fertilisation
 Several mammary ducts join to form a D)Implantation
wider mammary ampulla which is E)Gestation
connected to lactiferous duct through F)Parturition/Delivery
which milk is sucked out.
Gametogenesis-------> Insemination ------->
fertilsation-----> implanation----> gestation-
---> delivery/Parturition.
A) GAMETOGENESIS
 The process of formation of gamete is
called gametogenesis.
 The gametes of male is called Sperm
and of female is called Egg/Ovum
 The process of formation of sperm is
called spermatogenesis.
 The process of formation of egg/Ovum is
called Oogenesis.
a)Spermatogenesis
Alveoli  Mammary tubules 
 The process of formation of sperm is
Mammary ducts  Mammary ampulla
called spermatogenesis.
 lactiferous duct
 It takes place at testis.
 Each testis has about 250 compartments
 The mammary glands of the female called testicular lobules.
undergo differentiation during pregnancy  Each Testicular lobule contains one to
and starts producing milk towards the three highly coiled seminiferous tubules
end of pregnancy by the process called in which sperms are produced.
lactation. This helps the mother in  Each seminiferous tubule is lined on its
feeding the newborn. inside by two types of cells called male
 The milk produced during the initial few germ cells (spermatogonia/Sperm
days of lactation is called colostrum mother cells) and Sertoli cells
which contains several antibodies (IgA)
absolutely essential to develop
resistance for the new-born babies.
Breast-feeding during the initial period
of infant growth is recommended by
doctors for bringing up a healthy baby.
 Milk synthesizing hormone is =PRL
(Prolactin)
 Milk ejecting hormone is =OT(Oxytocin)
 Pregnancy hormone =Progesterone

 Each spermatogonium is diploid
loid and  From a single Primary spermatocyte 4
contains 46 chromosomes. sperms are produced
 From a single secondary Spermatocyte 2
Steps in Spermatogenesis sperms are produced
 The spermatogonia (sing.
spermatogonium) present on the inside
wall of seminiferous tubules multiply by Qn.. How many sperms are produced from
mitotic division and increase in numbers 100 primary spermatocyte ?
 Some of the spermatogonia called Ans:
primary spermatocytes periodically
undergo meiosis. Qn.. Which of the following is haploid cell/s ?
 A primary spermatocyte completes the Spermatogonia,
rmatogonia, Primary spermatocyte,
first meiotic division (reduction division) secondary spermatocyte,
leading to formation of two equal
equal, haploid spermatid, Sperm
cells called secondary spermatocytes,
which have only 23 chromosomes each. Ans:
 The secondary spermatocytes ocytes undergo
the second meiotic division to produce Hormonal Control of Spermatogenesis
four equal, haploid spermatids / Male reproductive system
 The spermatids are transformed into
spermatozoa (sperms) by the process
called spermiogenesis.
Ie: Spermiogenesis is the conversion of
spermatid into sperm is called
spermiogenesis
 Spermatogenesis starts at the age of

puberty due to significant increase in
the secretion of gonadotropin
gonadotropi releasing
 After spermiogenesis,, sperm heads hormone (GnRH-GnRHGnRH is secreted by
become embedded in the Sertoli cells,
cells Hypothalamus).
and are finally released from the  The increased levels of GnRH then acts
seminiferous tubules by the process at the anterior pituitary gland
called spermiation. (Adenohypophysis ) and stimulates
 The release of sperm after secretion of two gonadotropins –
spermatogenesis from seminiferous luteinising hormone e (LH) and follicle
tubule is called spermiation stimulating hormone (FSH
e (FSH).

[email protected]

LH (luteinising hormone ) The middle piece:
 LH acts at the Leydig cells and Middle Piece possesses numerous
stimulates synthesis and secretion of mitochondria,, which produce energy for the
androgens. movement of tail that facilitate sperm motility
 Androgens, in turn, stimulate the essential for fertilization
process of spermatogenesis. Tail :
it helps in sperm movement
FSH (follicle stimulating hormone)
 FSH acts on the Sertoli cells and  The human male ejaculates about 200 to
stimulates
lates secretion of some factors 300 million sperms during a coitus of
which help in the process of which, for normal fertility, at least 60 per
spermiogenesis cent sperms must have normal shape
and size and at least 40 per cent of
 The functions of male sex accessory them must show vigorous motility.
ducts and glands are maintained by the
testicular hormones (androgens)  The seminal plasma along with the
Structure of sperm sperms constitute the semen
It is a microscopic structure composed of b)Oogenesis
 A head,  The process of formation of a mature
 Neck, female gamete is called Oogenesis.
 A middle piece  Oogenesis is initiated during the
 A tail. embryonic development stage when a
 A plasma membrane envelops the whole couple of million gamete mother cells
body of sperm. (oogonia) are e formed within each fetal
ovary; no more oogonia are formed and
added after birth.
 These cells start division and enter into
prophase-II of the meiotic division and
get temporarily arrested at that
called primary oocytes
stage,called oocytes.
 Each primary oocyte then gets
g
surrounded by a layer of granulosa cells
follicle.
and is called the primary follicle
 A large number of these follicles
degenerate during the phase from birth to
puberty. Therefore, at puberty only
60,000-80,000 primary follicles are left in
each ovary.
 The primary
rimary follicles get surrounded by
more layers of granulosa cells and a new
theca and are called secondary follicles.
 The secondary follicle soon transforms
The sperm head: into a tertiary follicle which is
The head contains an elongated characterised by a fluid filled cavity called
haploid nucleus,, the anterior portion of which antrum. The theca layer ayer is organised into
is covered by a cap-like structure,, acrosome.
acrosome an inner theca interna and an outer
The acrosome is filled with enzymes theca externa..
(Hyaluronidase) that help fertilisation of the  At this stage that the primary oocyte
ovum. within the tertiary follicle grows in size and
completes its first meiotic division

[email protected]

Difference between Spermatogenesis and
Oogenesis
Spermatogenesis Ooogenesis
It is the production of It is the production of
the sperms the ovum
It takes place in the It take place in the
testis. Ovary and last stage in
oviduct
It takes place every day It takes place once per
month.
It is a continuous It is a discontinudiscontinuous
process process. The early
stages take place in the
foetus and the rest in
later stages of life.
No polar body Polar body is formed
formation
No temporary arrest temporary arrest stage
stage in any phase of present
spermatogenesis
. A single primary A single primary oocyte
 First meiotic division an unequal spermatocyte produces produces only one egg
division resulting in the formation of a 4 sperms
large haploid secondary oocyte and a Spermatogenesis Formation of ovum
tiny first polar body continues in old men, ceases in women
 The secondary oocyte retains bulk of the around the age of 50
nutrient rich cytoplasm of the primary years.
oocyte. (The advantage for nutrient rich
cytoplasm is, the secondary oocyte further
develops into ovum that undergoes
fertilization and formation of the zygote
where the nutrition in bulk is required for
growth.
healthy development and growth.)
 The tertiary follicle further changes into
the mature follicle or Graafian follicle.
follicle
 The secondary oocyte forms a new
membrane called zona pellucid
surrounding it.
 The Graafianafian follicle now ruptures to
release the secondary oocyte (ovum) (ovum
from the ovary by the process called
ovulation.

[email protected]

follicular phase and stimulates
Menstrual Cycle follicular development as well as
secretion of estrogens by the growing
The reproductive cycle in the female follicles.
primates (e.g. monkeys, apes and human  FSH (Follicle stimulating hormone)
beings) is called menstrual cycle. stimulate the growth of ovarian follicle to
 The first menstruation begins at puberty become mature ovarian follicle (graffian
and is called menarche. follicle).During the growth of ovarian
 Menstrual cycles ceases around 50 years follicle, the growing ovarian follicle secrete
of age; that is termed as menopause. Steroid hormone called Estrogen.
 Cyclic menstruation is an indicator of  Estrogen helps in the proliferation of
normal reproductive phase and endometrium. Hence this phase of
extends between menarche and menstrual cycle is also called Proliferative
menopause phase.
 In human females, menstruation is  Follicular phase or menstrual phase lasts
repeated at an average interval of about for about 8-12 days.
28/29 days, and the cycle of events
starting from one menstruation till the next c) Ovulatory phase
one is called the menstrual cycle.  Both LH and FSH attain a peak level in
 The menstrual cycle may be said to be a the middle of cycle (about 14th day).
combination of ovarian cycle and uterine  Rapid secretion of LH leading to its
cycle. maximum level during the mid-cycle called
LH surge induces rupture of Graafian
a)Bleeding phase/Menstrual phase follicle and thereby the release of ovum
 This phase lasts for 3-5 days. (ovulation).
 The menstrual flow results due to  Ovulatory phase is the shortest phase in
breakdown of endometrial lining of the the menstrual cycle.
uterus and its blood vessels which forms
liquid that comes out through vagina. d)Luteal phase/Secretory phase
 Menstruation only occurs if the released The ovulation (ovulatory phase) is
ovum is not fertilised. followed by the luteal phase during which the
remaining parts of the Graafian follicle
 Lack of menstruation may be indicative transform as the corpus luteum.
of pregnancy. However, it may also be  The corpus luteum secretes large
caused due to some other underlying amounts of progesterone which is
causes like stress, poor health etc. essential for maintenance of the
endometrium. Such an endometrium is
b)Follicular phase/proliferative phase necessary for implantation of the fertilized
The menstrual phase is followed by ovum and other events of pregnancy.
the follicular phase.  During pregnancy all events of the
 During this phase, the primary follicles menstrual cycle stop and there is no
in the ovary grow to become a fully menstruation.
mature Graafian follicle and  This phase lasts for about 14 days
simultaneously the endometrium of  In the absence of fertilisation, the
uterus regenerates through corpus luteum degenerates (and become
proliferation. corpus albican). This causes
 These changes in the ovary and the disintegration of the endometrium
uterus are induced by changes in the (because level of progesterone
levels of pituitary and ovarian decreased) leading to menstruation,
hormones. marking a new cycle
 The secretion of gonadotropins (LH and
FSH) increases gradually during the

 10-17 days of menstrual cycle is called C) Fertilisation

fertile period (The remaining days are  The process of fusion of a sperm with an
called safety period ). because chance of ovum is called fertilization.
fertilization is very high during this period.  Fertilisation can only occur if the
ovum and sperms are transported
Menstrual hygiene simultaneously to the ampullary
region.. This is the reason why not all
 Maintenance of hygiene and sanitization copulations lead to fertilisation and
during menstruation is very important. pregnancy.
 Take bath and clean yourself regularly.
Use sanitary napkins or clean home mad How Polyspermy is prevented ?
pads.  During fertilisation, a sperm comes in
 Change sanitary napkins or homemade contact with the zona pellucida layer of
pads after every 4-5 5 hrs as per the the ovum and induces changes in the
requirement. membrane that block the entry of
 Disopose of the used sanitary napkins additional sperms (Prevent poly
properly warpping it with a used paper. spermy ). Thus, it ensures that only one
 Do not throw the used napkins in the drain sperm can fertilise an ovum. The
pipe of toilet or in the open area. secretions of the acrosome help the
 After handling the napkin wash hands with sperm enter into the cytoplasm of the
soap ovum through the zona pellucida and the
B) Insemination plasma membrane.
 This induces
uces the completion of the
 During copulation (coitus) semen is i
meiotic division of the secondary
released by the penis into the vagina
oocyte.( Second meiotic division for
(insemination).
secondary oocyte is completed only after
 The motile sperms swim rapidly, pass sperm).
the penetration of sperm).The second
through the cervix, enter into the uterus meiotic division is also unequal
un and
and finally reach the Ampullary
mpullary region result in the formation of a second
of the fallopian tube polar body
ody and a haploid egg.
 The ovum released by the ovary is also
transported to the ampullary region
where fertilisation takes place.
[email protected]

 Soon the haploid nucleus of the sperm
and that of ovum fuse together to form
diploid zygote (46 chromosome)
Implantation
 Attachment of Blastocyst on the inner
wall of uterus (Endometrium) is called
implantation
 The trophoblast layer of blastocyst
gets attached to the endometrium and
the inner cell mass gets differentiated
as the embryo.
 After attachment, the uterine cells divide
b
rapidly and covers the blastocyst. As a
result, the blastocyst becomes embedded
in the endometrium of the uterus . This is
called implantation and it leads to
Clevage
pregnancy.
 After fertilzation zygote starts mitotic
 Immediately after implantation, the
division .
inner cell mass (embryo) differentiates
 The mitotic division starts as the zygote
into
moves through the isthmus of the
I. An n outer layer called ectod
ectoderm
oviduct called cleavage towards the
II. An inner layer called endoderm
uterus and forms 2, 4, 8, 16 daughter cells
III. A mesoderm soon appears
called blastomeres.
between the ectoderm and the
 The embryo with 8 to 16 blastomeres is endoderm.
called a morula .
 These three layers give rise to all
adults
tissues (organs) in adults.
Inner cell mass contains certain cells

called stem cells which have the potency
to give rise
se to all the tissues and organs
 The morula continues to divide and

transforms into blastocyst as it moves
further into the uterus.
 The blastomeres in the blastocyst are
arranged into two layers
I. An n outer layer called trophoblast
II. An n inner group of cells attached
to trophoblast called the inner
cell mass.

[email protected]

Placenta  5 month= 1st movement of foetus,
th
 After implantation, finger-like

like projections appearance of hair on head
appear on the trophoblast called  By the end of 24th week (2nd
chorionic villi which are surrounded by trimsester)= Body
dy covered with fine
the uterine tissue and maternal blood. hairs, eye lids separate, eye lashes
 The chorionic villi and uterine tissue formed
become interdigitated with each other and  By the end of 9 months of pregnancy,
jointly form a structural and functional =the foetus is fully developed and is
unit between developing embryo ready for delivery
(foetus) and maternal body called
placenta
 The placenta is connected to the embryo During
uring pregnancy the levels of hormones like
through an umbilical cord which helps in estrogens, progestogens, cortisol,
the transport of substances
bstances to and from prolactin, thyroxine,
yroxine, etc., are increased
the embryo several folds in the maternal blood. blood
Increased production of these hormones is
Functions of placenta essential for supporting the fetal growth,
1 The placenta facilitate the supply of metabolic changes in the mother and
oxygen and nutrients to the embryo maintenance of pregnancy.
2 It helps in the removal of carbon
dioxide and excretory/waste materials
produced by the embryo.
3 Placenta also acts as an endocendocrine
tissue and produces several
hormones like human chorionic
gonadotropin (hCG), human
placental lactogen (hPL), estrogens,
progestogens, etc.
 hCG, hPL and relaxin are produced

in women only during pregnancy.
 In the later phase of pregnancy, a

hormone called relaxin is also secreted
by the ovary.
D) Gestation
The human foetus within the uterus
 The duration between fertilization and
parturition is called gestation.
E) Parturition
 The average duration of human
 1st month of pregnancy=Heart
Heart is
pregnancy is about 9 months.
months
formed
 Vigorous contraction of the uterus at the
 1st sign of growing foetus may be
end of pregnancy causes
noticed by the listing to the heart
expulsion/delivery of the foetus. This
sound
process of delivery of the foetus
 By the end of second month-Limbs
month
(childbirth) is called parturition.
and digits formed
 Parturition is induced by a complex
com neuro
 By the end of 12 weeks (1st
endocrine mechanism.
trimester)= major organs formed
 The signals for parturition originate
(Limbs and external genital organs
from the fully developed foetus and the
formed)
placenta which induce mild uterine
[email protected]

contractions called foetal ejection SCAN QR CODE FOR VIDEO LESSON
reflex. This triggers release of oxytocin
from the maternal pituitary.
 Oxytocin acts on the uterine muscle and
causes stronger uterine contractions,
which in turn stimulates further secretion
of oxytocin. The stimulatory reflex
between the uterine contraction and
oxytocin secretion continues resulting in Click here to view the video lesson
stronger and stronger contractions. This
leads to expulsion of the baby out of the
uterus through the birth canal (Cervical
canal along with vagina is called birth
canal) – parturition.
 Soon after the infant is delivered, the
placenta is also expelled out of the uterus.
Lactation
 The mammary glands of the female

undergo differentiation during pregnancy
and starts producing milk towards the
end of pregnancy by the process called
lactation. Ie: The process of making and
secreting milk from the mammary glands
to feed the infant is known as lactation.
This helps the mother in feeding the
newborn.
 The milk produced during the initial few
days of lactation is called colostrum
which contains several antibodies (IgA)
absolutely essential to develop
resistance for the new-born babies.
Breast-feeding during the initial period
of infant growth is recommended by
doctors for bringing up a healthy baby.
 Milk synthesizing hormone is =PRL
(Prolactin)
 Milk ejecting hormone is =OT(Oxytocin)
 Pregnancy hormone =Progesterone

Chapter 4 Strategies for Reproductive Health
R H
01-Counseling and creative awareness
 With the help of audio-visual and the print-
EPRODUCTIVE EALTH media governmental and non-
governmental agencies have taken
various steps to create awareness among
REPRODUCTIVE HEALTH
the people about reproduction-related
According to the World Health aspects
Organisation (WHO),
02-Sex education
Reproductive health means a total well-
 Introduction of sex education in schools
being in all aspects of reproduction, i.e.,
should also be encouraged to provide
physical, emotional, behavioural and
right information to the young so as to
social.
discourage children from believing in
myths and having misconceptions about
 The term ‘Reproductive health’ simply
sex-related aspects
refers to healthy reproductive organs
 Proper information about reproductive
with normal functions
organs, adolescence and related
 Therefore, a society with people having
changes, safe and hygienic sexual
physically and functionally normal
practices, sexually transmitted diseases
reproductive organs and normal emotional
(STD), AIDS, etc., would help people,
and behavioural interactions among them
especially those in the adolescent age
in all sex-related aspects might be called
group to lead a reproductively healthy life.
reproductively healthy
REPRODUCTIVE HEALTH – PROBLEMS AND
03-family welfare information
STRATEGIES  Fertile couples and those in marriageable
 India was amongst the first countries in age group must be educated in the
the world to initiate action plans and following aspects.
programmes at a national level to attain I-Available birth control options,
total reproductive health as a social ii- Care of pregnant mothers,
goal iii-Post-natal care of the mother and child,
Iv-Importance of breast feeding,
Programmes involved in maintaining v- Equal opportunities for the male and
Reproductive health the female child, etc.
1. Family Planning Programme (Initiated in Vi-Desired size of the family
1951)
2. ‘Reproductive and Child Health Care 04-Social evils
Social evils like sex-abuse and sex-
(RCH) programmes’ related crimes, etc., need to be created to
enable people to think and take up
necessary steps to prevent them and
Major Task under Family planning thereby build up a socially responsible
Programme and RCH and healthy society
01-Create awareness among people about
05-Statutory ban on amniocentesis
various reproduction related aspects
 Amniocentesis is the pre-natal diagnostic
02-Provide facilities and support for building
technique of foetal sex determination and
up a reproductive healthy society determination of genetic disorder of the
foetus based on the chromosomal pattern in
the amniotic fluid surrounding the
developing embryo

 In amniocentesis, some of the amniotic POPULATION EXPLOSION AND BIRTH
fluid of the developing foetus is taken to CONTROL
analyze the foetal cells and dissolved  The world population which was
substances around 2 billion (2000 million) in 1900
rocketed to about 6 billion by 2000 and
Uses of Amniocentesis 7.2 billion in 2011
 This procedure is used to test for the  Indian population which was
presence of approximately 350 million at the time of
01-Genetic disorder (Down’s syndrome, our independence reached close to the
Hemophilia, sickle cell anemia etc.), billion mark by 2000 and crossed 1.2
02-Determine the survivability of the foetus. billion in May 2011.
03-This technique also gives sex of the  WORLD POPULATION DAY-JULY-11
baby before birth  According to the 2011 census report, the
.
population growth rate was less than 2 per
Misuses of Amniocentesis
 It is used to determine the sex of the cent, i.e., 20/1000/year, a rate at which
child, and to kill normal female foetus. our population could increase rapidly
Hence determination of sex by  Such an alarming growth rate could lead
amniocentesis has been legally banned to an absolute scarcity of even the basic
to avoid female foeticides requirements, i.e., food, shelter and
clothing, in spite of significant progress
06-Medical assistance and care
made in those areas.
 Medical assistance and care must be
provided to people in reproduction related  Therefore, the government was forced to
problems like the following take up serious measures to check this
I-Pregnancy population growth rate.
Ii-Delivery
Iii-STD’S Reason for population explosion
Iv-Abortion 1. A rapid decline in death rate.
V-Contraception 2. Decline in maternal mortality rate
Vi-Menstrual Problems (MMR) .
Vii-Infertility 3. Decline in infant mortality rate
07-Research (IMR) .
 Research on various reproduction related 4. Increase in number of people in
areas are helped and supported by reproducible age.
government and non government
agencies to find out new methods or to  Population growth rate can be checked
improve upon the existing methods. by
 Saheli’–a new oral contraceptive for the 1. Motivate smaller families by using
females–was developed by scientists at various contraceptive methods.
Central Drug Research Institute (CDRI) 2. Showing advertisements in the media
in Lucknow as well as posters/bills, etc., showing
 Saheli –the new oral contraceptive for the a happy couple with two children with
females contains a non-steroidal a slogan ‘Hum Do Hamare Do’ (we
preparation. It is a ‘once a week’ pill with two, our two).
very few side effects and high 3. Statutory raising of marriageable age
contraceptive value of the female to 18 years and that of
males to 21 years,
4. Incentives given to couples with small
families.

Contraceptive methods occur during the period of intense
lactation following parturition.
It helps to prevent unwanted
 Therefore, as long as the mother breast-
pregnancies.
feeds the child fully, chances of
conception are almost nil.
Qualities of a good contraceptive method
 However, this method has been reported
An ideal contraceptive should be
to be effective only upto a maximum
1. User-friendly,
period of six months following parturition.
2. Easily available,
3. Effective and
1. Adventages of Natural methods :
4. Reversible
No medicines or devices are used in
5. No or least side-effects.
natural , side effects are almost nil.
6. It should not interfere with the sexual
2. Disdventage of Natural methods:
drive, desire and/or the sexual act of
Chances of failure by this method are
the user.
also high
 A wide range of contraceptive methods
are presently available which could be
broadly grouped into the following
B) Barrier method
categories, namely
In barrier methods, ovum and sperms
are prevented from physically meeting with
A) Natural/Traditional method
the help of barriers. Such methods are
B) Barrier method
available for both males and females. Barrier
C) IUDs
methods include
D) Oral contraceptives
E) Injectables
i) Condoms :
F) Implants
 they are barriers made of thin rubber/
G) Surgical methods
latex sheath
 It is used to cover the penis in the male
A) Natural methods
or vagina and cervix in the female,
Natural methods work on the principle of
 It is used just before coitus so that the
avoiding chances of ovum and sperms
ejaculated semen would not enter into the
meeting.
female reproductive tract. This can
prevent conception.
i)Periodic abstinence :
 It is one of natural method in which the
couples avoid or abstain from coitus from
‘ Nirodh’ is a popular brand of condom
day 10 to 17 (Fertile period-Because
for the male.
chances of fertilization re very high
during this period ) of the menstrual
cycle when ovulation could be expected.
 Therefore, by abstaining (Avoiding)
from coitus during this period,
conception could be prevented
ii) Withdrawal or coitus interruptus :

 Here the male partner withdraws his penis
from the vagina just before ejaculation
so as to avoid insemination.
iii)Lactational amenorrhea :
(Absence of menstruation)
 This method is based on the fact that
ovulation and therefore the cycle do not

Advantages of Condoms
1. Use of condoms protecting ng the user
from contracting STIs/STDs STDs and
AIDS.
2. Both the male and the female
condoms are disposable,
3. It can be self-inserted
4. It gives privacy to the user
ii) Diaphragms, cervical caps and vaults

 They are also barriers made of Cu-T
rubber
 They are inserted into the female
reproductive tract too cover the cervix
during coitus.
Mechanism of action :
 They prevent conception by blocking
the entry of sperms through the cervix.
 Spermicidal creams, jellies and foams
are usually used along with these
barriers to increase their
contraceptive efficiency
 They are reusable.
C) IUDs (Intra Uterine Devices)

IUDs are ideal contraceptives for the
 These devices are inserted by doctors or
females who want to delay pregnancy
expert nurses in the uterus through
and/or space children. It is one of
vagina.
most widely accepted methods of
 IUDs increase phagocytosis of sperms
contraception
eption in India.
within the uterus
 These Intra Uterine Devices are presently
Qn. Find the odd one and write the reason
available are
for selection
CuT, Cu7, Lippes loop,
loop Multiload 375
i) Non-medicated IUDs
E.g., Lippes loop
Ans:
ii)Copper releasing IUDs
Eg.CuT, Cu7, Multiload 375
Mechanism of action :
 Cu ions released suppress sperm D) Oral contraceptive (Oral Pills )
motility and
d the fertilising capacity of  Oral administration of small doses of
sperms. either progestogens or progestogen
progestogen–
estrogen combinations is another
iii) Hormone releasing IUDs contraceptive method used by the
Eg:Progestasert, LNG-20 females.
Mechanism of action :  They are used in the form of tablets and
 It make the uterus unsuitable for hence are popularly
arly called the pills.
implantation  Pills have to be taken daily for a period of
 It make and the cervix hostile to the 21 days starting preferably within the first
sperms. five days of menstrual cycle. After a gap
of 7 days (during which menstruation
[email protected]

occurs) it has to be repeated in the same
pattern till the female desires to prevent
conception.
Emergency Contraceptive method
Mechanism of action:
 Administration of progestogens or
 They inhibit ovulation and implantation
 It alter the quality of cervical mucus to progestogen-estrogen combinations or
prevent/ retard entry of sperms. IUDs within 72 hours of coitus have been
found to be very effective as emergency
Advantage of pills contraceptives as they could be used to
 Pills are very effective avoid possible pregnancy due to rape or
 It has lesser side effects casual unprotected intercourse.
 They are well accepted by the females.
G) Surgical Methods (sterilisation)

Saheli-Once a Week Pill
 Surgical methods, also called
 Saheli –the new oral contraceptive for
sterilisation,
the females contains a non-steroidal
 They are generally advised for the
preparation. It is a ‘once a week’ pill
male/female partner as a terminal
with very few side effects and high
method to prevent any more
contraceptive value.
pregnancies.
 ‘Saheli was developed by scientists at
 Mchanism of action:Surgical intervention
Central Drug Research Institute (CDRI)
blocks gamete transport and thereby
in Lucknow
prevent conception.
 The two types of surgical methods are
E) Injectabale and Implants
Vasectomy and tubectomy
 Progestogens alone or in combination
with estrogen can also be used by
i)Vasectomy :
females as injections or implants under
 Sterilisation procedure in the male is
the skin
called ‘vasectomy’.
 Their mode of action is similar to that of
 In vasectomy, a small part of the vas
pills and their effective periods are
deferens is removed or tied up through a
much longer.
small incision on the scrotum.
ii)Tubectomy
 Sterilisation procedure in the Female is
called tubectomy.
 In tubectomy, a small part of the fallopian
tube is removed or tied up through a small
incision in the abdomen or through
vagina.
These techniques are highly effective but

their reversibility is very poor.
Qn. Note the relationship between the first

two words and suggest a suitable word for
the 4th place,
Female:Tubectomy,
Male :….?.................

number of conceived pregnancies in a
year (20%)
 Obviously, MTP has a significant role in
decreasing the population though it is not
meant for that purpose. Whether to
accept /legalise MTP or not is being
debated upon in many countries due to
emotional, ethical, religious and social
issues involved in it.
 Government of India legalised MTP in
1971 with some strict conditions to avoid
its misuse. Such restrictions are all the
Difference between vasectomy and more important to check indiscriminate
Tubectomy and illegal female foeticides which are
Vasectomy Tubectomy reported to be high in India.
Sterilisation Sterilisation
procedure in the procedure in the WHY MTP….??
male is called Female is called MTP is –
‘vasectomy’. tubectomy. i) To get rid of unwanted pregnancies
either due to casual unprotected
In vasectomy, a small in tubectomy, a small intercourse or failure of the
contraceptive used during coitus or
part of the vas part of the fallopian
rapes.
deferens is removed tube is removed or
ii) MTPs are also essential in certain
or tied up through a tied up through a
small incision on small incision in the cases where continuation of the
pregnancy could be harmful or
the scrotum. abdomen or
even fatal either to the mother or to
through vagina.
the foetus or both.
Passage of sperm is Passage of egg is
MTPs are considered relatively safe during
prevented prevented
the first trimester, i.e., upto 12 weeks of
pregnancy. Second trimester abortions are
Ill-Effect of the usage of contraceptive
much more riskier.
methods /Birth Controls
Ill-effects
 Nausea,
Why MTP legalized in India…?
 Abdominal pain,
Dangerous trend is the misuse of
 Breakthrough bleeding,
amniocentesis to determine the sex of the
 Irregular menstrual bleeding
 Breast cancer,
unborn child. Frequently, if the foetus is found
Though not very significant, should not be totally
to be female, it is followed by MTP- this is
ignored. totally against what is legal. Such practices
should be avoided because these are
MEDICAL TERMINATION OF PREGNANCY dangerous both for the young mother and the
(MTP) foetus.
 Intentional or voluntary termination of One disturbing trend observed is that a
pregnancy before full term is called majority of the MTPs are performed illegally
medical termination of pregnancy by unqualified quacks which are not only
(MTP) or induced abortion. unsafe but could be fatal too.
 Nearly 45 to 50 million MTPs are
performed in a year all over the world Remedies from MTP
which accounts to 1/5th of the total  Effective counseling on the need to avoid
unprotected coitus

 Awareness of Risk factor involved illegal completely curable if detected early and
abortions treated properly.
 Providing more health care facilities to
avoid illegal abortions Hepatitis–B and HIV can also be transmitted
by sharing of injection needles, surgical
instruments, etc., with infected persons,
The Medical Termination of Pregnancy transfusion of blood, or from an infected
(Amendment) Act, 2017 mother to the foetus too
 The Medical Termination of Pregnancy

(Amendment) Act, 2017 was enacted by the Symptoms of STIs
government of India with the intension of- Early symptoms of most of these are
reducing the incidence of illegal abortion and minor and include
consequent maternal mortality and morbidity.
 Itching,
 According to this Act, a pregnancy may be
 Fluid discharge,
terminated on certain considered grounds
within the first 12 weeks of pregnancy on  Slight pain,
the opinion of one registered medical  Swellings, etc., in the genital region.
practitioner. If the pregnancy has lasted
more than 12 weeks, but fewer than 24 Infected females may often be asymptomatic
weeks, two registered medical and hence, may remain undetected for long.
practitioners must be of the opinion,
formed in good faith, that the required ground Complications of STIs
exist. The grounds for such termination of  Absence or less significant symptoms in
pregnancies are: the early stages of infection and the
(i) The continuation of the pregnancy would
social stigma attached to the STIs, deter
involve a risk to the life of the pregnant woman or
of grave injury physical or mental health; or the infected persons from going for timely
(ii) There is a substantial risk that of the child detection and proper treatment.
were born, it would suffer from such physical or  This could lead to complications later,
mental abnormalities as to be seriously which include
handicapped.  Pelvic inflammatory diseases (PID),
 Abortions,
 Still births (Birth of dead foetus)
SEXUALLY TRANSMITTED INFECTIONS  Ectopic pregnancies (Tubular
(STIs) pregnanacy ),
Diseases or infections which are  Infertility
transmitted through sexual intercourse  Cancer of the reproductive tract
are collectively called sexually All persons are vulnerable to these infections,
transmitted infections (STIs) or their incidence are reported to be very high
venereal diseases (VD) or reproductive among persons in the age group of 15-24
tract infections (RTI). years-the age group to which you also
Eg : belongs
 Gonorrhoea
 Syphilis STD can be prevented by
 Genital herpes 1. Avoid sex with unknown partners/multiple
 Chlamydiasis partners
 Genital warts 2. Always use condoms during coitus.
 Trichomoniasis 3. In case of doubt, one should go to a
 Hepatitis-B qualified doctor for early detection and get
complete treatment if diagnosed with
 AIDS (HIV infections)
disease.
 Except for hepatitis-B, genital herpes
and HIV infections, other diseases are

Infertility development. (This step is called Embryo
 Inability to produce children inspite of transfer)
unprotected sexual co-habitation is called  Embryos formed by in-vivo fertilisation
infertile. (fusion of gametes within the female) also
could be used for such transfer to assist
The reasons for this could be many– those females who cannot conceive
 Physical
b) GIFT (Gamete Intra Fallopian Transfer)
 Congenital,
Transfer of an ovum collected from a
 Diseases,
donor into the fallopian tube (GIFT – gamete
 Drugs, intra fallopian transfer) of another female
 Immunological who cannot produce one, but can provide
 Psychological suitable environment for fertilisation and
further development .
 In India, often the female is blamed for the
couple being childless, but more often c) Intra cytoplasmic sperm injection (ICSI)
than not, the problem lies in the male it is another specialised procedure to
partner. form an embryo in the laboratory in which a
 Specialised health care units called sperm is directly injected into the ovum.
infertility clinics could help in diagnosis
and corrective treatment of some of these d)AI (Artificial insemination ):
disorders and enable these couples to infertility cases either due to inability
have children. However, where such of the male partner to inseminate the
corrections are not possible, the couples female or due to very low sperm counts in
could be assisted to have children through the ejaculates, could be corrected by
certain special techniques commonly artificial insemination (AI) technique.
known as assisted reproductive In this technique, the semen collected
technologies (ART). The ART includes either from the husband or a healthy donor is
the following artificially introduced either into the vagina or
into the uterus (IUI – intra-uterine
a) In vitro fertilization and Embryo transfer insemination) of the female.
(IVF-ET)
 Fertilisation outside the body is called
Invitro fertilisation.  The ultimate aim of ART is to have children
 Invitro fetilisation is done in almost similar  Though options are many, all these
conditions (as that in the body) followed techniques require extremely high
by embryo transfer. This method is precision handling by specialised
popularly known as test tube baby professionals and expensive
programme. instrumentation. Therefore, these
Steps/Procedure in IVF-ET facilities are presently available only in
 Ova/Egg from the wife/donor (female) and very few centres in the country. Obviously
sperms from the husband/donor (male) their benefits is affordable to only a
are collected limited number of people.
 Both sperm and egg are induced to form  Since the ultimate aim of all these
zygote under simulated conditions in the procedures is to have children, in India we
laboratory (This step is called IVF) have so many orphaned and destitute
 The zygote or early embryos thus formed children, who would probably not survive
(with upto 8 blastomeres) could then be till maturity, unless taken care of. Our laws
transferred into the fallopian tube (ZIFT– permit legal adoption and it is as yet, one
zygote intra fallopian transfer) and of the best methods for couples looking for
embryos with more than 8 blastomeres, parenthood.
into the uterus (IUT – intra uterine
transfer), to complete its further

NAVAS CHEEMADAN SOHSS-AREEKODE
HUMAN REPRODUCTION a)Identify ‘A’ and ‘B’ in graph (1)
(b) Identify the structure ‘C’ and write its function.
AND
(1½)
REPRODUCTIVE HEALTH (c) Which pituitary hormone is secreted in its
maximum level during the time of ovulation ? (1/2)
HSE-March 2024
1. Name an oral contraceptive for females developed

HSE-June 2023
by scientists at Central Drug Research Institute (1)
2. The enlarged end of penis called the glans penis is 7. The first menstruation is called ________ (1)
covered by a loose fold of skin called _______.(1) 8. “Scientifically it is correct to say that the sex of the
3. Observe the given diagram of male reproductive baby is determined by the father and not by the
system, and identify the parts labelled as A, B, C mother !” Do you agree with this statement ?
and D (2) Justify your answer (2)
9. Distinguish between
(a) Myometrium and Endometrium
(b) Spermatogenesis and Oogenesis (2)
10. (a) What is STIs (3)
(b) Cite any two example for STIs.
(c) Suggest any two preventive measures for STIs
HSE-March 2023
11. Select the odd one. Justify your selection. (1)

(Rete testis, Vasa efferentia, Fallopian tube,
Vas deferens)
4. Infections or diseases which are transmitted 12. Placenta also acts as an endocrine tissue and
through sexual intercourse are collectively called produces several hormones. (2)
sexually transmitted infections. (A) Name any two placental hormones.
(a) Name any two STIs. (1) (B) Write two functions of Placenta.
(b) Suggest any two methods to prevent STIs. (1) (other than endocrine function)
5. A wide range of contraceptive methods are 13. The graph given below shows the ovarian events
presently available. and ovarian hormone levels during menstrual
(a) Name two surgical methods advised for male cycle. (2)
and female partner as a terminal method to
prevent any more pregnancies. (1)
(b) Give two examples for copper releasing IUDs (1)
6. Observe the diagrammatic presentation of various
events during a menstrual cycle.
(i) Name hormones A and B.

(ii) Write the ovarian events during luteal phase.
14. What are IUDs ? Name one copper releasing and
one hormone releasing IUDs (2)
Previous year Question/+2/2024 [email protected]

15. (A) What are STIs ? (3) (a) Identify the parts labelled as (A), (B), (C) and (D)
(B) Give two examples. and name the part which is cut or tied up during male
(C) Write any two preventive measures of STIs sterilisation.
(b) Mention the surgical contraceptive methods in
HSE- July 2022 (SAY/IMP.) male and female.
16. First menstruation in a female begins at puberty HSE-March- 2022
and is called _______. (1)
20. Expand the term ZIFT (1)
17. Expand the term IUD. (1)
21. Mitotic division of zygote results in the formation
18. Identify the figure and label the parts marked as of blastomeres is called ________ (1)
(A), (B) and (C) (2)
22. Write the functions of the following structures in
human reproduction : (2)
(a) Leydig cells (b) Corpus luteum
23. (a) Name the cap-like structure present in sperm
head.
(b) Write its function. (2)
24. “Sex of a child is determined by father.”
Substantiate the statement. (3)
25. ‘Incidents of STDs are very high among the age
group of 15-24 years.’
(a) What is STD ? (b) Name any four STDs. (3)
HSE-August 2021
26. Expand the following terms (1)

a)MMR b)IMR
27. Identify the odd one (1)
(hPL, Androgen, Relaxin, hCG )
28. Disease or infections which are transmitted
through sexual intercourse are called sexually
transmitted disease (STDs)
a)Give any two examples for STDs
b)Write any two preventive measures to avoid
19. Diagrammatic view of male reproductive system is STDs ? (2)
given below : (5) 29. Identify the two types of cells lined on the inside of
seminiferous tubule. Distinguish their function (2)
30. Mention two programmes implemented in India to
attain total reproductive health? (2)
31. How many spermatozoa and ova are produced
from 25 primary spermatocyte and 25 primary
oocytes ? (2)
32. Distinguish between spermiogenesis and
spermiation ? (2)
33. Fill in the blanks with suitable terms given in
bracket
(Progestogen, Multiload-375, Vaults, Periodic
abstinence, Tubectomy, Saheli) (2)

Barrier Copper Natural Surgical 44. Match the following (2)
method releasing method method
IUDs
Condom (B) Coitus (D)
interrupts
(A) Cu-T (C) Vasectomy
34. The wall of uterus has 3 layers of tissues (2)

a)Name the three layers of uterine wall 45. Match the following (2)
b)Among these 3 layers, which layer is glandular
and undergo cyclic changes during menstrual cycle
?
35. Identify the pars of oviduct (fallopian tue) from
below description :
a)Finger like projection of oviduct that helps in
collection of the ovum after ovulation 46. ‘LH and FSH play significant role in
b)The part of oviduct with narrow lumen that joins spermatogenesis.’ (3)
the uterus (a) Write the functions of LH and FSH in
c)Funnel shaper part of oviduct that is closer to the spermatogenesis.
ovary (3) (b) Write a single term used to denote LH and FSH
36. Explain different types of Intra uterine devices with together.
their example (3) 47. Sexually Transmitted Diseases (STDs) are seen to
be high among people with age group 15 – 24 yrs.
HSE-March 2021 (a) Write the names of any 4 STDs.
(b) Mention the measures to be taken to prevent
37. Name the oral contraceptive for female developed STDs. (3)
by CDRI. (1)
38. During luteal phase of menstrual cycle, Graafian HSE –July-2020
follicle transforms into ____ (1)
39. Expand the following terms related with Assisted 48. The embryo with 8 to 16 blastomeres is called a
Reproductive Technologies : (2) ________. (1)
(a) ICSI (b) GIFT (a) Gastrula (b) Morula
(c) Blastula (d) Trophoblast
40. Fill in the blanks to complete the schematic
representation (2) 49. Observe the diagrammatic view of male
reproductive system given below and name
theparts labeled ‘a’, ‘b’, ‘c’ and ‘d’.
(2)
41. Write any four objectives of Reproductive and

Child Health Care (RCH) programmes (2)
42. Write any four differences between
Spermatogenesis and Oogenesis. (2)
43. In women, some hormones are secreted only
during pregnancy. Name any such hormones (2)

50. Rearrange the following human reproductive (a) Name ‘A’ and ‘B’.
events in the correct order of theiroccurrence (2) (b) Reconstruct the graph showing the level of
hormones in luteal phase.
(c) Name the hormone secreted by Corpus Luteum
and mention its function.
51. (a) Expand ART. (2) HSE-June-2019

(b) Suggest the ART which may be successful in the
following condition : 57. Find out the correct sequence : (1)
(i) Inability of the male partner to inseminate (a) Fertilisation- zygote - Blastula - Morula -
the female. cleavage - Implantation
(ii) Female cannot produce ovum but can (b) Fertilisation- zygote - cleavage - Morula -
provide suitable environment for Implantation - Blastula
(c) Fertilisation- zygote - Morula - cleavage -
fertilisation and further development. Implantation - Blastula
(d) Fertilisation- zygote - cleavage - Morula -
52. Observe the diagrams A and B given below related
Blastula – Implantation
to contraceptive methods. (3)
58. 'LH Surge' induces the rupture of Graffian follicle
(a) Which gland produces LH and in which day LH
Surge happens?
(b) Write the role of LH in males. (2)
59. There are several method of in vitro fertilisation to
(a) Identify A and B. assist couples who lack the ability of fertilisation.
(b) Explain this surgical method. (a) Give the popular name of the programme
(c) Why this method is generally advised as a (b) Suggest two techniques of in vitro fertilisation
terminal method of contraception ? and their conditions of transfer to assist these
people (3)
HSE –March-2020
HSE-March-2019
53. Name the technique of transferring embryos up to
8 blastomeres into the fallopian tube. (1) 60. The milk produced during the initial few days of
a)GIFT b)ZIFT c)ICSI d) IUI lactation is called…………………. (1)
54. “All copulations lead to fertilization and 61. "The sex of the baby is determined by the father
pregnancy”. Do you agree with this statement? and not by the mother. Do you agree with this
Justify your answer. (2) statement ? Substantiate your answer. (2)
55. Amniocentesis for sex determination is legally 62. Observe the diagram given below showing the
banned now. (2) reproductive system of the female and name the
(a) What is amniocentesis ? parts labeled 'A', sectional view 'B', C' &'D' (2)
(b) Why it is banned ?
56. The graph given below shows the level of the
ovarian hormones in a normally menstruating
woman during the follicular phase. (3)

63. A wide range of contraceptive methods are 71. In a class room discussion, a student said that
presently available. If so, (HSE-March-2019)(2) sex of the baby is determined by the father.
(a) Name one contraceptive method having least Analyse the statement and give reason for it ?
side effect. (2)
(b) Which contraceptive method is generally
72. Different contraceptive methods are used to
advised for females as a termination method to
control population explosion. Summarise the
prevent any more pregnancies?
natural method and barrier method of
(c) List out any two possible ill-effects of the usage
of contraceptive methods.
contraception ? (2)
64. (a) Expand STDs. 73. Sexually transmitted disease (STD) are mainly
(b) Cite any two examples for STD. transmitted through sexual contact (3)
(c) Suggest any two methods for the prevention of a)Name any two examples of STD?
STDs. (3) b)Explain any two methods adopted to prevent
STD ?
HSE-June-2018
65. Number of spermatids produced from 25

primary spermatocytes are ........... (1) HSE-March-2018-Model Exam
a) 25 b)50 c)100 d)250
74. The middle layer of uterus is called……… (1)
66. Select the relationship between the first two
75. Vasectomy and tubectomy are said to be
words and fill the lank space with a suitable
effective and irreversible contraceptive
word (1)
methods. Differentiate between these two
Sterilization in male : Vasectomy
methods. (2)
Sterilization in female :.............
76. From an infertility clinic a doctor advised a
67. The incidence of STDs are reported more
childless coupleto undergo GIFT.
among the age groupbetween 15-24
l. Expand GIFT
years.(2nci)
2. Mention the steps involved in this
(a) What are STDs?
procedure (2)
(b) Suggest methods to prevent STDs,
68. Match the column B&C with column A (3) HSE-JUNE-2017
77. Human female possess 44+XX chromosome

number. The chromosome number of
secondary oocyte is (1)
a)44+XX b)22+X c)44+XX d)22+XX
78. Observe the diagram and answer the question
(2)
HSE-March-2018
69. Name the cells in testis which synthesize and

secrete androgens? (1)
70. Different contraceptive methods are given
below. Pick out the odd one (1)
a)Cu T b)Saheli
c)Multiload 375 d)Lippes loop

a) Identify A and B Suggest a suitable assisted reproductive
b) Write the function of B technology (ART) for each problem in
79. Prepare a brief notes to be presented in an expanded form.
awareness programme for adolescent about HSE-March-2016
AIDS, their causes and preventive measures? 88. Breast feeding during initial period of infant growth
(3) is necessary to develop immunity of new born
babies. Why ? (1)
HSE-March-2017 89. Categorise the given birth control methods into
three groups with proper heads.
80. Which of the following pairs of STDs is
(Cervical caps, Vasectomy, Cu T, Tubectomy,
completely curable ? (1)
Diaphragms, Condoms, LippesLoop ) (3)
a)HIV, Hepatitis B 90. match the columns A and B (2)
b)Hepatitis B, Gonorrhoea A B
c)Symphils, Gonorrhoea Corpus Luteum Embryo
d)Chlamydomonas, Genital Herpes Leydig cells Implantation
81. Feeding...................in the first few days is Blastocyst Progesterone
essential for preventing infection in a newly Inner cell mass Androgens
born baby (1) Prolactin
82. LH and FSH are gonadotrophins. Distinguish
HSE-June-2015
their roles in male and female? (2)
83. What is ART ? Categorize the following ART’s 91. Choose the odd one from the following and
based on their application in male sterility and write common features of others. (1)
female sterility: a)Estrogen b)Anrogen c)Relaxin
GIFT, AI d)Progesterone
92. Some techniques commonly used for
HSE-June-2016
infertility treatment are given below. Read
84. The process of fusion of sperm with ovum is them carefully and answer the question
called......................... (1) ZIFT,GIFT,ICSI,IUI,IVF (3)
85. Match the column A and B (2) a)which of the above techniques is used
for the collection of sperm from the
husband or a healthy donor and artificially
introduced into the vagina or uterus of
the female?
b)Distinguish between ZIFT and GIFT
c)Write the common term used to denote
the techniques given below ?
93. Complete the flow chart showing
spermatogenesis by filling A and B and answer
86. Select the odd one and justify your selection? the question (2)
Malaria, Gonorrhoea ,Amoebiasis, filariasis (1)
87. Diagnostic report of two couples having
infertility problem are given below : (2)
1) The Women cannot produce ovum
2) The man has very low sperm count in a)what is the chromosome number of
semen. primary spermatocyte?

b)what is the significance of reduction 99. Schematic representation of Gametogenesis
division in spermatognenesis? is given below . Identify A. Write one
difference between A and B (1)
HSE-March-2015
94. Foetal sex can e determined by a test based

on chromosomal pattern from the amniotic
fluid (2)
a)What is this test?
b)Revealing of sex determination through this
test is banned. Is this ban is necessary ?
c) invitro fertilisation followed by embryo HSE-June-2014
transfer is known as .......
100. ........... and ..........are two surgical
95. 1)In which part of human reproductive
contraceptive methods in male and female
system the following events occur? (2)
respectively (1)
a)Fertilisation b)Implantation
101. Diagram of mammalian sperm is given
2)Diagram of a Human blastocyst is given
below. Label the parts marked
below .Identify A and B
(1)
96. It is evident that, it is the genetic makeup of

the sperm that determine the sex of the child
in human being. Substantiate. (2)
97. Identify the diagram and write how it acts (1)
102. Sex of the bay is determined by the father,
not by the mother. Substantiate? (2)
103. Amniocentesis for sex determination is
banned in our country? Is this Ban necessary?
Comment one use of amniocentesis? (2)
HSE-MARCH-2014
104. Observe the diagram and answer the
question
(3)
98. Mothers milk is considered essential for new a) Identify A and B
born infants (1) b) What is the function of C
a)Name the fluid secreted by mother from c) In which of the marked part reduction
breast during the initial days of lactation division takes place? What is the significance
b)What type of immunity it provides of it?

109. The following statements compare the
process of Oogenesis and spermatogenesis.
Which one is not true
a)Production of ovum ceases at certain age,
but sperm production continues even in old
men
b)Oogenesis begins in the embryonic stages,
but spermatogenesis starts at the oneset of
puberty.
c)Meiotic arrest occurs both in Oogenesis and
spermatogenesis.
d)Polar bodies are formed in Oogenesis (1)
105. One of our neighbour is suffering from 110. Suggest the ART which may be successful
itching, fluid discharge, slight pain and in the following conditions (3)
swelling in the genital region (2) a)A female cannot produce an ovum, but can
a)What do you think the disease he is provide suitable environment for fertilization
suffering from? and further development
b)What measures are to be taken to prevent b)Male partner is unable to inseminate the
such disease female or has very poor sperm count
106. Expand the following abbreviations which c)Fusion of gamete and zygote formation
are commonly used in reproductive health doesnot occur within the body of female
a)ART b)ZIFT (1) 111. The diagram represents a process of
gametogenesis. Closely observe it and answer
HSE-SAY-2013 the following (2)
107. Though one ovum is produced from a a)Is it spermatogenesis or Oogenesis?
primary oocyte it can result into a male or b)What does smaller shaded circle represent?
female child after fertilisation. But in these c)Write down two significance of production
case of spermatocyte though 4 sperms are of same?
produced only two of the can result to a
female child after fertilisation justify? (1)
108. Sterilization and IUDs are effective birth
control measures, but lactational
amenorrhoea may not be so effective
a)How the sterilization procedure of male
differ from that of female in preventing
pregnancy? (2)
b) Which part of the female reproductive
organ is utilized for the IUD procedure? How
this procedure prevents pregnancy? (2)
c)Why the lactationalamenrrhoea is not so
effective? (1) HSE-SAY-2012
HSE-MARCH-2013

112. Find out the odd one from the following,
write the reason
(1)
a)Cu T, b)Cu 7 c)LNG-20 d)Multiload-375
113. One couple came to know that they have a
a)What is A and B?
girl child during fourth month of pregnancy
b)Name the two types of cells found in the
and they decided to do MTP (2)
Blastocyst?
a)What is MTP?
c)Which layer of blastocyst is attached to the
b)At which stage of pregnancy MTP relatively
endometrium? And Name the process?
safe?
c)How will you respond to the decision of
HSE-SAY-2011
female foeticide by the couple?
117. Note the relationship between first two
114. Observe the diagram provided (do not copy
terms and suggest a suitable terms for the
the picture) (3)
fourth place (1)
a)Progesteron : Corpus luteum
HCG : ........................
b)GIFT : Gamete
ZIFT : ........................
118. Observe the Graph provided
a)Label A and B
b)On which day of menstrual cycle Graffian
follicle rupture?
c)Name the process induces the rupture of
graffian follicle
a)What do A and B stands for? (1)
d)Write the name and function of the
119. Nalini is four month pregnant at the
structure forming inside the ovary after
insistence of her mother in law, she
rupture of Graffian follicle?
underwent an illegal diagnostic procedure by
which the sex of the baby was determined to
HSE-March-2012
be female .Nalini’s mother in law cursed her
115. “STDs present a major health concern in
for conceiving a girl child.
both industrialization and developing
a)What is the diagnostic procedure used
countries”(3)
here?
a) What you meant by STD?
b) “scientifically, Nalini is not responsible for
b) Name two STDs?
conceiving a girl child”. How will you
c) Suggest two preventive measures?
substantiate this statement? (1)
116. Some stages of embryonic development are
120. Observe the diagram provided and
given below. Observe these diagram and
identify the process: (2)
answer the question (3)

124.
The above graph shows the level of ovarian
hormones in a normally menstruating women
during follicular phase (3)
a)Name A and B
b)Mention the role of pituitary hormones in
maintaining this condition
a)Label; A,B,C and D c)Reconstruct the graph for luteal phase?
b)Why the gametes produced are haploid
even though the gamete mother cells are HSE-SAY-2010
diploid? 125. Select the ART that uses an early embryo
121. Raju has lost his mother at birth. He is with upto 8 blastomeres (1)
unhealthy and contract diseases easily. In his a)ZIFT )IUT c)GIFT d)IUI
Doctor’s opinion, Raju’s ill health is due to his 126. The total population in India is alarmingly
not drinking mother’s milk. increased to 1 billion according to 2001
How will you justify the doctor’s opinion in censes. The population growth rate was still
the light of your knowledge of immunity? (2) around 1.7%, a rate at which our population
could be double in 33 years
HSE-MARCH-2011 Cite the probable reasons for such an
122. One among the contraceptive method is increase in population growth rate? (2)
peculiar. Find the odd one and what is the 127. The graph shown below shows the levels
common among others? (1) of LH and FSH at various stages of menstrual
a)Periodic abstinence cycle. (3)
b)coitusinterruptus
c)Lactational amenorrhea
d)IUDs
123. The treatment facility advertised on the

brochure of a private clinic is shown below
a)Can you suggest what type of clinic is?
b)Make a brief note on any three of the
treatment procedure? (2) a)Name the source of LH and FSH
IVF ZIFT GIFT IUI b)The level of LH is maximum during the
middle day of cycle. Mention its effect?
c)Note the function of LH in male?
HSE-March-2010
128. Given below is the diagrammatic
representation of Human blastocyst. Observe

the diagram and answer the following
questions. (2)
a)Identify A and B
b)Write the function of A and B
129. When the urine sample of a lady is tested,
presence of Human chorionic gonadotropin
(HCG) was detected (2)
a)What does the presence of HCG indicate?
b)Which is the source of HCG?
130. Diagram shown below is a surgical
method used for female sterilization
(2)
a) What is the method shown in the diagram?
b) Mention any two IUDs to prevent
conception?
c)what is surgical method of male sterilization
called?
Click here to watch video lesson/Scan the QR
Human Reproduction
Reproductive Health

NAVAS CHEEMADAN SOHSS AREEKODE

Chapter-03 True breeding line
 A true breeding line is one that, having
undergone continuous self-pollination, shows
PRINCIPLES OF INHERITANCE the stable trait inheritance and expression for
several generation.
AND VARIATION  Genotype
The complete genetic constitution of an
organism is called Genotype.
Genetics Eg: Tt,TT,RR,Rr,YY,Yy
 It deals with the inheritance, as well as the
Variation of characters from parents to  Homozygous (True breeding/Pure line)
offspring. An organism with 2 identical allele of a gene
 It is the study of genes and chromosomes Eg:TT,RR,YY,YY,rr,tt
Inheritance
 Inheritance is the process by which characters  Heterozygous
are passed on from parent to progeny. it is the An organism with 2 different allele of a gene
basis of heredity Eg:Tt,Rr,Yy
 Heredity is the tendency of offspring to
resemble their parents Character and Trait
Variation  A character is a heritable feature that varies
 It is the tendency of offspring to differ from among individuals.
their parents Eg:Flower color,Plant Height,seed shape, Eye
 The main reason for variations are colour.
 Crossing over  A trait is a variant for character,
 Mutation Eg: white or purple colors for flowers, Dwarf
 Human knew from as early as 8000-1000BC that plant, Round seed, Blue eye.
one of the cause of variation was hidden in
sexual reproduction .They exploited variation Qn. An elephant always gives birth to a baby
seen in nature (Plants and animal) to select elephant and not some other animal, why ?
organism with desirable characters. However, Ans:
early humans had very little idea about the
scientific basis of variation. Qn. A mango seed forms only a mango plant and
Eg: Well-known Indian breeds, Sahiwal cow (Punjab) not any Other plant why ?
(through artificial selection and domestication from Ans:
ancestral wild cows)
GENETIC TERMS
 Allele : GREGOR JOHANN MENDEL
 They are alternative form of a gene  He was an Austrian monk.
 Genes which code for a pair of contrasting
 He is known as father of genetics.
traits are known as alleles.
 He conducted hybridisation experiment on
Eg: T,t,R,r,Y,y
garden pea plant (Pisum sativum ) for 7 years
 Phenotype
 The physical appearance of an organism is (1856-1863)
called Phenotype  Based on his experiment , he proposed ‘laws
 The visible/observable characteristics of an of inheritance’ in living organisms .
organism is called phenotype  During Mendel’s investigations into
Eg: Tall plant, blue eye, round seed inheritance patterns , it was for the first time
Principles of inheritance and variation/2024

that statistical analysis and mathematical
logic were applied to problems in biology Reason for selecting Garden Pea plant
 Mendel selected 14 true-breeding pea plant 1. It has short life cycle so it gives quick
varieties, as pairs which were similar except for results.
one character with contrasting traits. 2. Plants shows clear contrasting character
 The garden pea plant contains number of 3. Being a herb, it is Easy to cultivate
characters. Out of these, he selected and studied 4. It has bisexual flower
only 7 characters. Each of these 7 characters has 5. It is generally self-pollinated and so self
fertilised. However, it can be Cross
2 verities. The 7 characters are given below.
pollination is easy if self-pollination is
prevented.
Sl Character Contrasting traits
No. Dominant Recessive Monohybrid cross-
1 Height of the plants Tall Dwarf Inheritance of one gene
2 Seed shape Round Wrinkled  It is the cross involving two forms of a
3 Seed colour Yellow Green
single character.
4 Pod shape Inflated Constricted
(full)  It is the simplest cross performed by
5 Pod colour Green Yellow Mendel
6 Flower position Axial Terminal  Mendel conducted artificial pollination/cross
7 Flower color Violet White pollination experiments using several true-
Contrasting traits studied by Mendel in Pea breeding pea lines.
 Mendel crossed tall plants and dwarf pea
plant to study the inheritance of one gene.
 He collected seed produced as a result of
above cross and grew them to generate F1
(Filial 1 Progeny ).

 Mendel observed that all the F1 progenies
were tall (Like one of its parent and none
were dwarf )
He made similar observations for the

other pairs of traits – he found that the F1
always resembled either one of the
parents, and that the trait of the other
parent was not seen in them.
 He then self pollinated the F1 progeny (Tall

plants ) to generate F2. He observed thatth Monohybrid genotypic ratio= 1:2:1
75% of the F2 progenies were tall and Monohybrid phenotypic ratio =3:1
25% were dwarf (Ie: 3:1)
Ie: characters that was not seen in the F1 Similar results were obtained with the
generation expressed in the F2 (dwarf) other traits that he studied (Seed
 He also found that ,The tall and dwarf traits shape,flower colour etc.)
etc.): only one of the
were identical to their parental type and parental traits was expressed in the F1
did not show any blending,, that is all the generation while at the F2 stage both the
offspring were either tall or dwarf, none traits were expressed in the proportion
were of in between height, No blending of 3:1. The contrasting traits did not show
characters in offsprings. any blending at either F1 or F2 stage
 Based on this observation ,Mendel
proposed that something being was being Example-2
stably passed down unchanged from
parents to offspring
ffspring through gametes over
successive generation. Mendel called it as
factors. Now we called them as genes.
 Genes, therefore, are the units of
inheritance. They contain the
information that is required to express a
particular trait in an organism. Genes is a
chemically a segment
ment of DNA (RNA in some
virus .
Example-1
Monohybrid genotypic ratio= 1:2:1

Monohybrid phenotypic ratio =3:1

Monohybrid genotypic ratio= 1:2:1

Monohybrid phenotypic ratio =3:1
BACK CROSS & TEST CROSS

Back cross
 It is the cross of F1 progeny with one of its
parent
PUNNET SQUARE
 It was developed by British geneticist
Reginald C Punnet
 It is the graphical representation to
calculate the probability of all possible
genotype of an offspring in a genetic
cross .
 The possible gametes are written on 2
sides, usually on the top row and left
column. All possible combinations are
written in boxes below in square, which
generates a square output form
Example
Test Cross
 It is the crossing of (F1) progeny with its
recessive parent.
 It is used to find unknown genotype of an
individual.

Mendel’s Laws on Inheritance
(Principles of inheritance)
Based on his observations on
monohybrid crosses, Mendel proposed two
general rules to consolidate his understanding
of inheritance in monohybrid crosses. Today
these rules are called the Principles or Laws
of Inheritance:
1-The
The First Law or Law of Dominance
2- Second Law or Law of Segregation
1. Law Of Dominance (1st law)

The main points are …
Monohybrid Test cross ratio= 1:1 I. The characters are controlled by
Dihybrid test cross ratio=1:1:1:1 factor
discrete units called factors.
II. Factors occur in pair..
Qn. What will be the genotype of a tall plant ,If III. In a dissimilar pairs of factors
it produce tall plant and dwarf plant in (Heterozygous) ,one
one member of pairs
the ratio 1:1 during test cross.? dominates over the other. (The
Ans: dominated one is called Dominant ,
and other character is called
Recessive)
 This law is used to explain the expression of

characte in the F1
only one of the parental character
of monohybrid cross and expression of both
in F2
 This law explains the proportion of 3:1
obtained at the F2
2. Law of segregation
(2nd law/law of purity of gamete)
 This law is based on the fact that the alleles
Diagrammatic representation of a test crosses do not show any blending and that both
the characters are recovered as such in the
F2 generation though one of these is not
seen at the F1 stage.
 This law states that,

“During gamete formation 2 factors for
a trait present in an individual will
separate from each other and enter
into each gamete”

Dihybrid phenotypic ratio=9:3:3:1
Dihybrid genotypic ratio = 1:2:1:2:4:2:1:2:1
Example-2
 Thus, a homozygous parent produces all

gametes that are similar.
 while a Heterozygous one produces two
kinds of gametes each having one allele
with equal proportion.
 Both 1st and 2nd law of Mendel obtained

from monohybrid cross.
Dihybrid cross-Inheritance
Inheritance of 2 genes
“It is a cross involving 2 characters
characters/a cross
involving plants differing in 2 characters”
characters
Example-1
 Dihybrid phenotypic ratio=9:3:3:1

 Dihybrid genotypic ratio
=1:2:1:2:4:2:1:2:1
 Ratio b/w parent and nonparent
non
(recombinant) =10:6
 Number of different phenotype in the
F2 dihybrid cross = 4
 Number of different Genotype in the F2
dihybrid cross = 9

Qn. Write the different gametes produced

from the plant with genotype TtRr ?
Ans:
3. Law of Independent assortment

 This law is formulated from Dihybrid cross
 This law states that
 “‘when
‘when two pairs of traits are combined in a
hybrid, segregation of one pair of
characters is independent of the other pair
of characters”
 This means that the inheritance of one trait
is not dependent
dent on the inheritance of
another trait
 This law is not applicable for the

genes located on the same
chromosome
Ie: Linked gene.
 Linked genes are exception to
mendelian principle

DEVIATION FROM MENDLIAN PRINCIPLE /  When the F1 was self self-pollinated, the F2
NON MENDELIAN INHERITANCE resulted in the following ratio
 Non-Mendelian
Mendelian inheritance is any pattern
of inheritance in which traits do not 1(RR)
(RR) Red: 2 (Rr) Pink: 1 (rr) White.
segregate in accordance with Mendel's
laws  Here the genotype ratios were exactly as
1. Incomplete dominance we would expect in any mendelian
monohybrid cross, but the phenotype
 It is the inheritance in which the
ratios had changed from the 3:1
heterozygous offspring show
dominant: recessive ratio.
intermediate character between 2
 What happened was that R was not
parents.
completely dominant over r and this
Example-1
made it possible to distinguish Rr as
 Inheritance of flower colour in the dog
pink from RR (red) and rr (white) .This
. is
flower (snapdragon or Antirrhinum
due to incomplete dominance. So the
sp.) and Mirabilis jalapa (4 o’ clock plant-
plant
heterozygous off
offsprings shows
not mentioned in text book ) is a good
intermediate character (Pink) between 2
example to understand incomplete
parents.
dominance. It was studied by Carl
Correns of Germany .
Phenotypic ratio=1:2:1
Genotypic ratio=1:2:1 Example-2
Starch grain size in Pea seed
 When crossed a true-breeding red
breeding red-  Starch
tarch synthesis in pea seeds is controlled
flowered (RR) Antirrhinum and true by one gene. It has two alleles (B and b)
b
breeding white-flowered Antirrhinum  BB------starch
starch synthesized effectively
plants (rr), the F1 (Rr) was pink (Large sized starch grains)

 bb-------- lesser efficiency in starch 3. Multiple alleles
synthesis (Small sized starch grains)
 Some genes have more than 2 alleles. This
 Bb------ Intermediate sized starch
phenomenon is called multiple allelism .
grains
 Here we can see that there are more than
2. Co Dominance two alleles (IA ,IB, I ), governing the same
 Here both alleles of gene are expressed character (Blood group )
in heterozygous condition. Example
 In the case of co-dominance, the F1 ABO Blood group
generation resembles both parents  ABO blood group is controlled by the gene
Example-1 ‘I’
ABO Blood group  ‘I’ gene has 3 alleles –IA ,IB, i
 ABO blood group is controlled by the gene  These alleles are located at the same locus
‘I’ in a given pair of homologus chromosome .
 ‘I’ gene has 3 alleles –IA ,IB, i 4. Pleiotropy
 The allele IA and,IB produce slightly  Multiple effect of a gene is called
different form of the sugar . pleiotropy. Such genes are called
 This sugar are protrudes from the plasma Pleiotropic gene
membrane of RBC.  Here single gene may produce more
 ‘i’ donot produce sugar than one effect.
 When ‘IA’ and ‘i’ are present in an  The underlying mechanism of Pleiotropy in
organism (IAi), only IA expressed because most case is the effect of a gene on
‘i’ donot produce any sugar . metabolic pathway-which produce different
 When ‘IB’ and ‘i’ are present in an phenotype.
organism (IBi), only IB expressed because Example-1
‘i’ donot produce any sugar .  Starch synthesis in pea seeds
 When IA and IB are present in an  It has two alleles (B and b).
organism (IAIB), they both express their Genotype Phenotype
own type of sugars. This is due to co Starch Seed
dominance. Such RBC contains both grain size shape
sugar ‘A’ and ‘B’ type of sugars. BB Large Round
Blood Group Genotype bb Small Wrinkled
(Phenoype) Bb Intermediate Round
A IAIA,IAi  Here a single gene control both starch
B IBIB,IBi grain size and seed shape
AB IA IB Example-3
O ii PKU (Phenykenonuria)
 The disease is caused by the mutation in
 There are 4 different phenotype the gene that code for the enzyme
present in ABO blood group phenylalanine hydroxylase (Single
 There are 6 different genotype present gene mutation)
in ABO blood group  It result mental retardation, reduction
in hair, pigmentation in skin in
Qn. Find out the genotype of children/s born patients.
to Parents with blood group ‘AB ‘and ‘O’ ?
Ans:

5. Polygenic inheritance
 A character whose expression is
controlled by number of genes is called
polygenic inheritance .
 Besides the involvement of multiple
genes, polygenic inheritance also takes
into account the influence of
environment.
 In a polygenic trait the phenotype
reflects the contribution of each allele,
i.e., the effect of each allele is additive
Example-1
Human Height
Example-2
Human Skin Colour
 Skin color is controlled by 3 pairs of gene
(A,B,C)
 AABBCC--Darkest Skin color
 AaBbCc--Intermediate skin color
 Aabbcc--Lightest skin color
 The number of each type of alleles in
the genotype would determine the
darkness or lightness of the skin in an
individual.

Publication Of Rediscovery of
Mendel’s Work Mendelian Principle
 Mendel published his work his work in  In 1900, three scientist namely
1865.  Carl correns
 But scientists of his time did not accept his  Hugo De Vries
theory because  Von Tschermak
Reason for non-acceptance of Mendel’s independently rediscovered mendel’s
work results on the inheritance of characters.
i. Communication was not easy (as it is  By this time microscope are advanced.
now) in those days and his work  Scientist observed cell division.
could not be widely publicised.  This lead to the discovery of a structure in
ii. He used maths to explain biological the nucleus that appeared to double and
phenomenon was totally new and divide just before cell division, these were
unacceptable to many of the called chromosome (Colored body-
biologists of his time because that can be visualised only by
iii. He could not provide any physical staining )
proof for the existence of factors or  By 1902 chromosomal movement during
what they were made of. meiosis had been worked out.
iv. His concept of genes (or factors, in Chromosomal theory
Mendel’s words) as stable and
discrete units that controlled the of Inheritance
expression of traits and, of the pair
 Proposed by Walter Sutton and Theodore
of alleles which did not ‘blend’ with
Bovery In 1902
each other, was not accepted by his
 Walter Sutton and Theodore Boveri noted
contemporaries as an explanation
that the behavior of chromosomes was
for the apparently continuous
parallel to the behavior of genes. (The
variation seen in nature..
important things to remember are that
chromosomes as well as genes occur in
Reason for Mendel’s success
pairs. The two alleles of a gene pair are
1. Gradual planning
located on homologous sites on
2. Attention was focused only on one
homologous chromosomes)
character at a time
 They used chromosome movement to
3. Maintenance of accurate record of result
explain Mendel’s law.
obtained
 They studied behavior of chromosome
4. Careful experimentation and
during mitosis and meiosis.
observation
 Paring and separation of a pair of
5. His experiments had a large sampling
chromosome will lead to segregation of a
size, which gave greater credibility to
pair of factor they carried”
the data that he collected
6. He was a lucky person (didn’t find  Sutton united chromosomal segregation
linkage phenomenon with Mendelian principles and called it as
chromosomal theory of inheritance. It
states that “Genes are located on

chromosomes and they later segregate and to the dihybrid crosses carried out by
independently assort during meiosis” Mendel in peas.
 The chromosomal theory of inheritance  Morgan hybridised yellow-bodied,
yellow white-
provided a physicall explanation for eyed females to brown
brown-bodied, red-eyed
Mendel's laws of inheritance and males (Wild type) and intercrossed their
revolutionized our understanding of F1 progeny. He observed that the two
genetics genes did not segregate independently of
Experimental verification of each other and the F2 ratio deviated very
significantly from the 9:3:3:1 ratio
chromosomal theory of inheritance (expected when the two genes are
 The experimental verification of the independent).
chromosomal theory of inheritance by  Morgan and his group knew that the genes
Thomas Hunt Morgan and his colleagues, were located on the X chromosome and
led to discovering the basis for the saw quickly that when the two genes in a
variation that sexual reproduction dihybrid cross were situated on the
produced same chromosome, the proportionof
 He conducted his experiment on tiny Fruit parental gene combinations
inations were much
fly (Drossophila melanogaster ) higher than the non-parentaltype
parentaltype.
Reason for selecting fruit fly
i. It can grown on simple synthetic
medium in the laboratory
ii. They complete their life cycle in about
two weeks,
iii. A single mating produceoduce large number
of progeny flies
iv. There is clear difference between male
and female. (females are larger than
male ).
v. It has many types of Hereditary
variations, that can be seen with low
power microscopes.
6. LINKAGE  In the cross A , F2 ratio is deviated from

 Morgan carried out several dihybrid normal Mendelian dihybrid ratio (10:6). It
crosses in Drosophila to study genes that is due to linkage.
were sex-linked.. These crosses were similar

 The physical association of genes in a
chromosome is called linkage, such
genes are called Linked genes .
 The term linkage and recombination
coined by. T H Morgan.
 Linked genes are exception to law of
independent assortment .
 Morgan found that the genes white and
yellow were very tightly linked and showed
only 1.3 per cent recombination while
white and miniature wing showed 37.2 per
cent recombination
 Ie: In the above cross, the genes for yellow
body, white eye and gene for brown body
,red eye are located on X chromosome (Sex
linked/X linked genes) and are tightly
linked genes
 Tightly linked genes shows low
recombination (Non parent type)
 Loosely linked genes show high
recombination
Mapping of genes
 Proposed by Alfred Sturtevant (Student

of T.H Morgan)
 He mapped position of genes in a
chromosome
 He used frequency of recombination
between gene pairs on the same
chromosome as a measure of distance
between genes.
 Today genetic maps are used as a starting
point in the sequencing of whole genomes
as was done in the case of the Human
Genome Sequencing Project (HGP)

Sex Determination  If the sperm containing ‘X’ chromosome
enter into egg female baby is produced
 The chromosome involved in the sex
determination is called sex chromosome  If the sperm containing ‘Y’ chromosome
(Allosome). It include ‘X’ and ‘Y’ enter into egg, male baby is produced.
chromosome.  So sex of the baby is determined by the
 Autosomes are chromosome present in an father not the mother in XX-XY
XX mechanism.
organism other than sex chromosome.
 The number of autosomes are same in both
male and female of same species.
 The initial clue about the
genetic/chromosomal mechanism of sex
determination can be traced back to some
of the experiments carried out in insects
 Henking (1891) studied spermatogenesis
in some insects.
 He observed that 50% of sperm received a
nuclear structure after spermatogenesis,
other 50% of sperm did not received it .
 Henking called these nuclear structure as ‘X
body’, (now it is called as X-chromosome
chromosome ).
but he could not explain its significance
Mechanism of sex determination

 Various types of sex determinations are
given below
a)XX-XY mechanism–Human
Human being,
drosophila
b)ZZ-ZW mechanism-Birds
c)XX-XO mechanism-Insects
d)Haplo-Diplody mechanism-Honey
Honey bee b)ZZ-ZW mechanism
ZW mechanism-Birds
 Here both male and female have same
a)XX-XY mechanism –HumanHuman being, number of chromosomes.
drosophila  Females (ZW) produce
roduce 2 types of gametes
 Here both male and female have same (Eggs-Heterogametic) containing ‘Z’ or
number of chromosomes. ‘W’ chromosomes besides Autosomes.
 Males (XY) and produce
duce 2 types of gametes  Males (ZZ) produce only one type of gamete
(Sperms-Heterogametic) containing ‘X’ (Sperms) containing only ‘Z’ chromosomes
Or ‘Y’ chromosomes , besides
ides Autosomes. besides Autosomes.
 Females are homozygoys (XX) and produce  Sex of the baby is determined by the type of
only one type of gamete (egg/ovum) Egg into which sperm enter
containing only ‘X’ chromosomes
chromosomes, besides  If the Egg containing ‘Z’ chromosome
Autosomes. Receives a sperm, male baby is produced
 Sex of the baby is determined by the type of  If the Egg containing ‘W’ chromosome
Sperm entering into the egg Receives a sperm, Female
male baby is produced

 So sex of the baby is determined by the d)Haplo-Diplody mechanism
Diplody mechanism-Honey bee
Mother not the Father in ZZ-ZW
mechanism.
 The sex determination in honey bee is

based on the number of sets of
chromosomes an individual receives
 Here an offspring formed from the union of
c)XX-XO mechanism-Insects
Insects a sperm and an egg develops as a female
(Grasshopper) (queen or worker), and an unfertilized egg
 Here males are one chromosome less than develops as a male (drone) by means
mean of
(Sex chromosome )that of females parthenogenesis.
 Females are homozygous (XX) and produce  Here females are diploid (32
only one type of gamete (Egg/Ovum) chromosomes) and males are Haploids
containing only ‘X’ chromosome besides (16 chromosomes), this type of sex
autosomes. determination is called haplo
haplo-diploidy sex
 males (XO) produce two types of gametes determination
(Sperms).50% of sperms contains ‘X’
chromosomes besides autosomes, the other  Here males (Drone) produce sperms by
50% sperms contains
ontains only autosomes (Sex mitosis. They do not have father and thus
chromosome absent ) cannot have sons, but have grandfather and
 So sex of the insect is determined by the have grandsons.
type of sperm enter in to the egg.
Ie: Male insect will determine the sex of
the baby

Qn. in our society women are blamed for giving birth MUTATION
to female children , Evaluate this statement
 Mutation is a phenomenon which results in
Ans: Humans have 23 pairs of chromosomes, with one
pair determining sex (XX for females, XY for
alteration of DNA sequences and
males).The sperm contributes the deciding factor. consequently results in changes in the
Sperm cells carry either an X or a Y chromosome. genotype and the phenotype of an organism.
When a sperm fertilizes an egg (which always carries  In addition to recombination, mutation
an X chromosome), the outcome determines the is another phenomenon that leads to
baby's sex: variation in DNA.
 X sperm + X egg (XX): This
his results in a  The substance that cause mutation is called
female child. Mutagen
 Y sperm + X egg (XY): This results in a
male child.
Therefore, the father's sperm determines the baby's
sex, not the mother's egg. Blaming women for the
child's gender is not only scientifically inaccurate.
 Loss
oss (deletions) or gain
(insertion/duplication) of a segment of
DNA, result in alteration in chromosomes.
Since genes are known to be located on
chromosomes,, alteration in chromosomes
results in abnormalities or aberrations
aberrations
(Chromosomal aberrations).
 Chromosomal aberrations are seen in
cancer cells.
 Mutations are of 2 types
a)Point mutation
b)Frame shift mutation

PEDIGREE ANALYSIS GENETIC DISSORDERS
 It is the analysis of trait in a several
generations of a family is called pedigree
analysis.
 Here inheritance of a particular trait is
represented in the family tree (Chart
showing family history) over generation.
 This analysis is used to trace the
inheritance of a specific trait or
abnormality or a disease
 In human genetics, pedigree study provides
a strong tool, which is utilised to trace the
inheritance of a specific trait,
abnormality or disease
 The symbols used in pedigree analysis is
given below A)Mendelian dissorder
 It is due to mutation or alteration in the
single gene.
 This disorder are transmitted to the
offspring as we studied in the principles of
inheritance
 This disorder can be traced in a family
using pedigree analysis.
 Mendelian disorders may be dominant or
recessive. By pedigree analysis one can
easily understand whether the trait is
dominant or recessive
1.HAEMOPHILIA/BLEEDER’S
DISEASE/ROYAL DISEASE
 It is a sex linked (X-linked) recessive
disease
 Here a single protein that is a part of chain
(cascade) of protein involved in clotting of
blood is affected. Due to this, in affected
individual a simple cut will result nonstop
bleeding
Genotypes are
 Normal male XHY
 Normal female XHXH
 Hemophilic male X hY
 Hemophilic female XhXh
 Hemophilic carrier (Female-) XHXh

 The disease is transmitted from an 3.PKU (PHENYLKETONURIA)
unaffected carrier female (XHXh)to some of  This is the autosomal linked recessive
male progeny trait.
 The possibility of a female becoming  PKU is an inborn error in amino acid
hemophilic is extremely rare, because metabolism
mother of such female has to be at least  The affected individual lacks an enzyme
carrier and father should be hemophilic (He (phenylalanine hydroxylase) that
is unviable in the later stage of life) converts the amino acid phenylalanine
 The family pedigree of Queen Victoria into tyrosine.
shows number of hemophilic descends.  As a result of this phenylalanine is
she was a carrier for this disease. accumulated and converted into
phenylpyruvic acid and other
2. COLOUR BLINDNESS derivatives.
 It is a sex linked (X-linked )recessive  Accumulation of these in brain results in
disease mental retardation. These are also excreted
 It is due to defect in either red or green through urine because of its poor
cone of eye resulting in failure to absorption by kidney.
discriminate between red and green
colour The genotypes are
 This defect is due to mutation in certain  Normal AA
gene present in the X- Chromosome  Carrier Aa
The genotypes are  Affected aa
 Normal male XCY  This disease is transmitted from parents to
the offspring when both parents are carried
 Normal female XCXC (Heterozygous)
 Color blind male XcY
4.SICKLE CELL ANAEMIA
 Color blind female XcXc
 This is an autosome linked recessive
 Color blind carrier (Female) XCXc trait
 It occurs 8% of male and 0.4% of female  This can be transmitted from parents to the
 This is due to gene mutation for red and offspring when both the partners are
green colour. They are located on X- carrier for the gene (or heterozygous).
Chromosome. Males have only one X-  The disease is controlled by a single pair of
Chromosome and female s have two X- allele, HbA and HbS .
chromosome. Genotypes are
 The son of a woman who carries the gene  Normal HbA HbA
has a 50 % chance of being colour blind.  Un affected Carrier HbAHbS
 A daughter will not be normally colour  Affected HbsHbs
blind unless her mother is a carrier and  This disease is transmitted from parents to
father is a color blind. the offspring when both parents are carrier
 X-linked recessive trait shows (Heterozygous)
transmission from carrier female to  The defect is caused by the substitution
male progeny. of Glutamic acid (Glu) by Valine (Val) at
the sixth position of the beta globin
chain of the haemoglobin molecule.

 The substitution of amino acid in the globin 5.THALASSEMIA
THALASSEMIA
protein results due to the single base  This is the autosomal linked recessive
substitution at the sixth codon of the beta trait.:
globin gene from GAG to GUG. The genotypes are
 The mutant haemoglobin molecule  Normal AA
undergoes polymerisation under low  Carrier Aa
oxygen tension causing the change in the  Affected aa
shape of the RBC from biconcave disc to  This disease is transmitted from parents to
elongated sickle like structure the offspring
ng when both parents are carrier
(Heterozygous)
 The defect could be due to either mutation

or deletion which ultimately results in
reduced rate of synthesis of one of the
globin chains (α and β chains) that make
up haemoglobin. This causes the formation
of abnormal haemoglobin molecules
resulting into anaemia which is
characteristic of the disease
 Thalassemia can be classified according to
which chain is affected
a)α-thalassemia
b)β-Thalassemia
a)α-thalassemia
thalassemia
Pedigree analysis-Sickle
Sickle cell anaemia
 Here production of alpha globin chain is
affected
 α-thalassemia
thalassemia is controlled by 2 closely
linked gene-HBA-1, HBA
1, and HBA-2
 These
hese genes are loca located on the
chromosome number 16 of each parent
 Mutation or deletion of one or more of the 4
genes results alpha thalassemia
 The more gene is affected , less alpha globin
molecule is produced
b)β-Thalassemia
Thalassemia
 Here production of Beta globin chain is
affected

 α-thalassemia is controlled by a single gene  The total number of chromosomes in a
HBB gene. normal human cell is 46 (23 pairs). Out of
 this genes are located on the chromosome these 22 pairs are autosomes and one pair
number 11 of each parent of chromosomes are sex chromosome.
chromosome
 Mutation or deletion of one or both genes  Sometimes, though rarely, either an
result Beta thalassemia additional copy of a chromosome may be
Thalassemia differs from sickle-cell
cell anaemia in included in an individual this situation is
that the Thalassemia is a quantitative problem of called Trisomy .
synthesizing too few globin molecules while the  Sometimes though rarely an individual
sickle cell anaemia is a qualitative problem of may lack one of any one pair of
synthesizing an incorrectly functioning globin. chromosomes, this situation is called
monosomy .
1. Down’s Syndrome(45+XX or 45A+XY)
6.MYOTONIC
MYOTONIC DYSTROPHY
 This is due to an additional copy of the
 This is an autosomal dominant trait chromosome number 21 (trisomy of 21).
Pedigree analysis-Myotonic
Myotonic dystrophy  This disorder was first described by
Langdon Down (1866).
Symptoms
 The affected individual is
 short statured
 with small round head,
 with furrowed tongue and with partially
open mouth
 Their Palm is broad with characteristic
B)chromosomal dissorder palm crease.
 Physical, psychomotor and mental
 It is due to absence or excess or
development is retarded.
abnormal arrangement of one or more
chromosome
2. Klinefelter’s Syndrome (44A+XXY)

 This genetic disorder is also caused due to
the presence of an additional copy of X- X
chromosome resulting into a karyotype of
47, XXY.

Symptom Example :
 Such an individual has overall masculine  The normal allele (functioning allele or
development, however, the feminine unmodified allele )of a gene produce a
development (development of breast, i.e., normal enzyme that is needed for
Gynaecomastia) is also expressed. Such transformation of substrate into product
individuals are sterile  The modified allele responsible for
production of
i)Normal or less efficient enzyme
ii)A non functional enzyme
iii)No enzyme at all
 In the first case,, the modified allele
produce same phenotype like
unmodified allele, so it become
dominant
 In the 2nd and 3rd case,
case the phenotype
will depend only on the functioning of
Klinfelter’s syndrome un modified allele.
Ie:Modified allele become recessive
3. Turner’s Syndrome : (44A+XO)
 It is due to the absence of one of the X
chromosomes, i.e., 45 with X0,
Symptoms
Such females are
 sterile
 ovaries are rudimentary
 lack of other secondary sexual characters  Hence, in the heterozygous condition, the
recessive trait is seen due to non-functional
non
enzyme or because no enzyme is produced.
Turner’s syndrome
Concept of Dominance
 Every gene contains the information to
express a particular trait.
 A gene that contains the information for
Click here/Scan QR to watch video lesson
producing an enzyme
 In a diploid organism, there are two copies
of each gene, i.e., as a pair of alleles.
 In heterozygous conditions (Tt), there are
dominant and recessive alleles.

Navascheemadan SOHSS-AREEKODE
HSE-June 2023
PRINCIPLES OF INHERITANCE 5. The tiny insect selected by Thomas Hunt Morgan

as his experimental material is _________. (1)
AND VARIATION 6. “Scientifically it is correct to say that the sex of
the baby is determined by the father and not by
the mother !” Do you agree with this statement ?
HSE-March 2024
Justify your answer (2)
1. Genes which code for a pair of contrasting traits 7. Given below are some symbols generally used in
are known as ______. (1) human pedigree analysis. Identify it. (2)
2. Complete the following table :
8. Match the following : (2)
3. In a cross between true breeding red-flowered

(RR) and true breeding white-flowered (rr) plants,
the F1 (Rr) was pink coloured.
(a) Name the inheritance pattern mentioned here.
(½) HSE-March 2023
(b) F1 was self-pollinated and F2 was obtained.
9. Match the following (2)
What is the genotypic ratio and phenotypic ratio
of F2. (1)
(c) Mention a plant which shows this inheritance.
(½)
4. Pedigree analysis of two Mendelian disorders are
shown below :
10. Cross between Red flower (RR) and white flower

(rr) bearing plants of Snapdragon produced all
plants with pink flowers in F1 generation. (3)
(A) Name the genetic phenomenon of this cross.
(B) Illustrate F2 generation of this cross using
Punnet square
(a) Identify the trait represented as A and B (1) HSE- July 2022 (SAY/IMP.)
(b) Which is the symbol for consanguineous
mating used in pedigree analysis ? (1) 11. Various symbols are used in human pedigree
(c) What do you mean by pedigree analysis ? analysis. Identify the following symbols
(1) (2)
Previous year Question Paper/+2/2024 [email protected]

HSE-March 2021
19. Name the genetic disorder in which a blood

clotting protein is affected leading to non-stop
bleeding even through a simple wound. (1)
20. Presence of an additional copy of chromosome 21
was observed in a person during diagnosis. (2)
(a) Identify the genetic disorder
(b) Write the characteristic features of this
12. TH Morgan carried out several dihybrid crosses in disorder
Drosophila. Mention two reasons for selecting 21. If a father is with ‘O’ blood group and mother is
Drosophila as an experimental organism? with ‘B’ blood group, write the possible blood
(2) groups of their children. (2)
13. Characters of certain genetic disorders are given 22. Micrograph of Red blood cells of two persons
below. Identify the given disorders (A) and (B) are shown below. Person B is affected
(3) with a specific genetic disorder.
a) Sex linked recessive disorder that affect the (i) Identify the genetic disorder.
clotting of blood (ii) Write reason for this disorder.
b)The disorder caused by the substitution of
Glutamic acid by Valine at the sixth position of
beta globin chain of Haemoglobin
c)The inborn error metabolism and affected
individual lacks an enzyme that converts Phenyl
alanine to Tyrosine.
HSE- March 2022 23. ‘Incomplete Dominance’ is an example for
deviation from Mendelian Inheritance. Illustrate
14. (a) Distinguish between Male heterogamety and with example (3)
Female heterogamety. (2) 24. Consider the two statement regarding the
(b) Write one example for each. haemophila disorder
15. “Sex of a child is determined by father.” a)It is an autosome linked dominant disease
Substantiate the statement (3) b)The heterozygous female (carrier) for
HSE- August 2021 haemophilia may transmit the disease to son
Select the wrong statement and correct it
16. Identify the symbol used in pedigree analysis(1)
25. A monohybrid cross is given below :
17. T.H Morgan selected Drosophila melanogaster as

a suitable experimental organism. Mention any
two reason for selecting Drosophila as
experimental organism (2)
Find the F2 phenotype and genotype ratio (2)
18. Consider the two statements regarding the
haemophilia disorder (2)
26. Distinguish male heterogamety and female
(i) It is an autosome linked dominant disease.
heterogametywith example (3)
(ii) The heterozygous female (carrier) for
HSE-July-2020
haemophilia may transmit the disease to son.
Select the wrong statement and correct it.
27. Select a female heterogametic animal from the
following : (1)
(a) Human beings (b) Drosophila
(c) Birds (d) Grasshopper

28. Complete the table using appropriate terms : (2)
(1)
34. Observe the cross of a pure violet and white
flower (2)
29.
In a cross between a true breeding red flowered
and a true breeding white floweredplants, the F1
generation was pink coloured flowers. From this
cross – (2)
(a) Identify the Inheritance.
(b) Give an example for this type of Inheritance.
(c) Write the F2 phenotypic and genotypic ratio.
HSE-March-2020
30. From the following, find out the symbol used in a) By using the F, progeny design a test cross.
the human pedigree analysis representing male. b) Mention the significance of test cross
(1) 35. Each symptom of two chromosomal disorders are
given below : (2)
 Gynaecomastia
 Rudimentary ovary and lack of secondary
sexual characters
31. Observe the figure given below showing Mendel’s
(a) Identify the disorders.
experiment using pea plants. (2)
(b) Give the reason for these disorders
HSE-March-2019
36. Find the odd one out. Justify your answer.

Down's syndrome, Turner's syndrome,
phenylketonuria, Klinefelter’s syndrome (2)
37. The amino acid composition of the relevant
portion of β chain of two haemoglobin molecule
molecules (A & B) are shown below (3)
(a) Identify the cross

(a)Which one of the polypeptide chain is
(b) Which are the laws proposed by Mendel based on
abnormal?
this observations ? (2)
(b) Name the disorder caused by it.
32. Correct the following statements, if there is any (c) What is the reason for this abnormality?
mistake :
(d) What is the effect of this abnormality in such
(a) Haemophilia is a autosome linked recessive
individuals?
disease.
(b) Turner’s syndrome is due to the presence of an
additional copy of X chromosome
HSE-June-2018
HSE-June-2019
38. Observe the following cross between
33. Identify the following symbols in pedigree Analysis
heterozygous dominant progeny and homozygous
recessive parent. Answer the following questions
(2)

a) Identify the cross?

b) Mention the significance of this cross?
39. The following diagram shows amino acid
sequences of a part of β chain of haemoglobin of
2 individuals. Observe the amino acid sequence
and answer the following questions : (2)
a) Observe the above cross and name this

a) Which among the above indicate sickle cell phenomenon?
anemic condition? b)Write down the theoretically given
b) Justify your answer? explanation of the phenomenon (2)
c) Describe what is single base substitution? 43. Haemophilia, Sickle cell anaemia and Phenyl
40. The blood group of a child is 'O'. His father is with Ketonurea are Mendelian disorders
'A' blood group and mother with‘B' blood group. (a)What do you mean by mendelian disorder
Write, down the genotype of the child and
(b) which one of the above is an example of in
genotypes of parents.(2)
born error of metabolism? Mention the cause
of disorder? (2)
HSE-March-2018
HSE-Model Exam -2018
41. ln a classroom discussion, a student said that the 44. Construct a monohybrid cross between
sex of the baby is determined by father. Analyze homozygous violet and white coloured flowers of
the statement and give reason for it ? (2) a pea plant How can one determine whether the
42. F1 Progenies are homozygous or heterozygous?
(2)
45. From a clinical laboratory, Ramu's blood group
was identified as 'AB' goup. But his father has 'A'
blood group and mother has is 'B’ blood group.
a) Is Ramu's blood group identification correct?
b) Substantiate your answer using co dominance
principle. (2)
46. Identify the syndromes ’A' and 'B' (2)

b) Diagrammatically represent a monohybrid
cross between Tall and dwarf pea plant
HSE-MARCH-2017
49. The following table shows the F2 generation
of a Dihybrid cross. Identify the phenotype
with homozygous recessive genotype. Find
out A:B:C:D (2)
HSE-JUNE-2017
47. Observe the diagrammatic representation of

following pedigree analysis and answer the 50. Which of the following do not have similar sex
question. (3) chromosome? (homogametic ) (1)
(1) Human female
(2) Drosophila female
(3) Bird female
(4) Bird male
51. Examine the following fragment of beta globin

chain in human haemoglobin and identify the
hereditary disease with reason(2)
a) Describe the type of inheritance shown in the

diagram
b)Distinguish between Mendelian disorder and HSE-June-2016
chromosomal disorder with example?
52. Observe the figure below and answer the
question following : (2)
48. Observe the following diagram and answer the
question
(Hint: step in making a cross in pea plant ) (2)
a)Identify the figure?

b)what show the shaded symbols used?
a) Name the process marked as A and writes its
significance?

53. a)Complete the flow chart of chromosomal
disorder by filling the blank boxes (A and B)
(3)
a) Identify the syndromes A and B.?

b)What is the chromosome numbers in A and
B?
HSE-SAY-2015
57. Diagrammatic representation of the pedigree
analysis of the inheritance of sickle cell
anaemia is shown below. (3)
b)What is aneuploidy ?
HSE-March-2016
54. Which of the following is not a

Mendeliandisorder
(1)
Colourblindness, Down's syndrome,
Haemophilia, Thalassemia
55. Study the following cross and answer the a)Name the type of inheritance shown in the
questions. figure ?
[Hint: ABO blood group in man is controlled b) Write the genotype of A and B?
by three alleles IA, IB and i.] (Hint : Disease is controlled by a pair of allele
HbAand Hbs)
c)Represent pedigree analysis of an X linked
Recessive Inheritance diagrammatically
58. Observe the inheritance shown in A and B
a)Write the genotypes of Father, Mother and

Son.
b)The type of dominance of human blood
group inheritance is………………… (2)
a)Name the type of inheritance shown in A
and B?
56. Observe the figure and answer the question b)What is the difference between the two
(2) types of inheritance? (2)

HSE-March-2015 67. a)Paternity or maternity can be determined by
certain scientific methods. What is it? Define
59. b)Briefly write the methodology involved in the
technique ?
c)comment on its other application (3)
HSE-March-2014
68. Explain the phenomenon shown in the following

figure and the reason for difference in the
production of recombinant in Cross A and cross B
as explained by Morgan. (3)
a)Identify the syndrome from the diagram, and

write the genotype?
b)It occurs in both sexes (Male and female)? Write
the reason (2)
60. Fill in the blanks: (1)
a)...............is a metabolic disorder that occurs due
to the lack of an enzyme that converts phenyl
alanine to tyrosine.
b)...............is a disease caused by the substitution
of glutamic acid by valine at the 6th position
61. It is evident that, it is the genetic make of a sperm

that determine the sex of the child in human
beings. Substantiate (2)
69. Difference in chromosome number of some
HSE-SAY-2014
human being A,B,C, and D is given below:
A)22 pairs of Autosome
62. Correct the amino acid sequence of sickle cell
B)22 pairs of Autosome +XO
hamemoglobin (1)
C)22 pairs of Autosome+ 1 autosome
D)22 pairs of Autosome+ XXY
a) Identify the person with who suffers from
Klinfelter’s syndrome. Write its symptoms
b)Differentiate between aneuploidy and
polyploidy ? (3)
63. Identify they syndrome from the genotype given
70. Gopalan argues that if the father is of ‘A’ blood
below: (1)
group, Mother is of ‘B’ blood group. Their children
a)44 Autosome + XXY
can be only be ‘A’ group, ‘B’ group or ‘AB’ group.
b) 44 Autosome +XO
a) Do you agree with Gopalan’sarguement?
64. Sex of the Baby is determined by the father, not b) Give reason for your argument? (2)
by the mother. Substantiate (2)
65. a)Define mutation (1) HSE-SAY-2013
b)What are the different types of mutation? (1)
66. The family of Queen Victoria shows a number of 71. In the given pedigree the shaded figure denotes
Haemophilic descendants as she was the carrier of individuals expressing a specific trait (2)
the disease. Name the pattern of inheritance of
this Royal disease. (1)

Which of the following is the most probable mode

of inheritance of this trait
A-Simple mendalian recessive inheritance
B-Co dominant Relationship of a single pair of
allele
C-X linked recessive transmission
D-X linked dominant transmission
E-Polygenic inheritance
HSE-March-2013 a) From the above give an example for genotype

and phenotype?
72. Identify the trait from pedigree chart. Give one b) Complete the work using the punnet square
example each. (2) and find out the phenotypic ratio in the F2
generation?
HSE-March-2012
76. Complete the tale using suitable term (2)
73. A poultry farm manager was cursing his hens for Turner’s syndrome ..........a........
Sterile female
producing lion share of cocks in its progeny. ---------b-------- 44A+XXY ..........c.........
Hearing this, Kumar-farm manager starts to lame --------d--------- Trisomy-21 Mental
his wife for delivering consecutive girl children. retardation
Analyse the situation scientifically and state 77. In Pea plant the gene for yellow seed colour is
whether you agree with kumar? (3) dominant over green and round seed shape is
HSE-SAY-2012 dominant over wrinkled. Write the four types of
gametes formed in heterozygous pea plant with
74. Diagrammatic representation of chromosome Yellow and round seeds (YyRr) (1)
map of Drosophila is given below (2) 78. The first child of a couple is affected with
Phenyketonuria. During the second pregnancy
they visited a genetic counsellor and Prepared a
pedigree chart of their family. (2)
a)What is pedigree analysis?
Y- Yellow
b)Draw the symbols for
W- White i) Affected female
M- Miniature ii) Sex unspecified
a)Which genes are more linked? iii)Consanguineous mating
b)Who mapped chromosome firstly?
c)Tightly linked genes show low
HSE-say-2011
recombination. Why?
75. Work of a student is given below: (3) 79. Symbols used in human pedigree analysis and
their meanings are provided in the table. Fill in the
blanks with suitable meaning or symbols (1)

Answer the following question (2)
a)Addition or deletion of chromosome generally
result in.............
b)What may be the possible syndrome or disorder
of the above person should suspected to be?
c)Suggest two or more morphological peculiarity
to confirm the chromosome disorder in that
person?
84. A couple has 2 daughters. The blood group of
husband and wife is O (2)
a)What is possible blood groups of the children
80. Certain facts related to human disorder are given: should have?
1)It is inborn error in metabolism b)Whether any change in blood group will occur if
2)It is inherited as an autosomal recessive trait they have two sons instead of daughters?
3)The affected person is mentally retarded
a)name the disorder HSE-SAY-2010
b)What are the physiological processes behind
this mental retardation (2) 85. Some genetic abnormalities, their genotype and
81. A genetic cross is represented below (2) features are distributed in Column A,B and C
respectively . Match them correctly (1.5 mark)
Column A Column B Column B
Down’s 44A+XO Rudimentary
syndrome ovary and
sterility
Turner’s 44A+XXY Furrowed
syndrome tongue and
partially opened
mouth
Klinfelter’s 45A+XX/XY Gynaecomastia
a) Identify the given cross? syndrome and sterility
b) Elaborate upon the significance of such cross?
86. The flow chart A and B given below represents the
HSE-March-2011 inheritance of normal haemoglobin and sickle cell
haemoglobin (3.5)
82. The frequency of occurring Royal disease or
Haemophilia is high in the pedigree of Royal
families of Queen Victoria. Which of the following
cannot be generally inferred from this? (1)
a)Queen Victoria was not homozygous for the
disease
b)Many heterozygous families were there in the
Royal family
c)Non-Royal families were not affected with
haemophilia
d)There is less possibility to become a female a) Observe the Flow chart A and complete the
diseased flow chart B
e)Generally a diseased female cannot survive b) Note down the genotype of a sickle cell
after the first menstruation anaemia patient and mention the symptom of
f)Pedigree analysis is the study of inheritance the disease
patterns of traits in human female. c) Mention the peculiarity of HbAHBs phenotype
83. After analyzing the karyotype of a short statured
Round headed person with mental retardation, a
general physician noticed an addition of
autosomal chromosome .

HSE-March-2010
87. To findout the unknown genotype of a violet

flowered pea plant a researcher done the
flowering cross. Observe the diagram and answer
the following question:
(Hint :Violet flower colour in pea plant is
dominant over white )
a)What would be the above cross called?

b)can you determine the unknown genotype of
violet flowered parent by drawing Punnet square?
88. Polypeptide chains of two haemoglobin molecules
are shown below. One of the chains shows an
abnormality. Observe the diagram and answer the
following questions
a) Which of the polypeptide chain in the

haemoglobin is abnormal leading to a disease?
b)What is the reason for this abnormality ?
c)What will be the effect of this change in
polypeptide chain ?

SOHSS-Areekode [email protected]
MOLECULAR BASIS OF INHERITENCE 1-Transforming
Transforming principle/
Griffith effect (1928)
 This experiment is conducted by Frederick
Introduction Griffith in 1928.
 There are 2 types of nucleic acids  He conducted experiment on Streptococcus
 DNA (Dexoy ribonucleic acid ) pneumoniae (Pneumococcus-It
(Pneumococcus is a coccus
 RNA (Ribo nucleic acid ) bacteria that cause pneumonia ).
)
 DNA is the genetic material in most of the  During the course of his experiment, a living
organism including human being organism (bacteria) had changed in physical
 But there are some viruses (Retrovirus)
Retrovirus) in form.
which genetic material are RNA.  There are 2 strains of pneumococcus bacteria
Examples
 S-Strain
Strain
 HIV,
 R-Strain
Strain
 TMV,
 QB Bacteriophage,
 DNA is acidic substance present in the nucleus

was first identified by Friedrich Meischer
(1869). He called it as Nuclein.
 Due to technical limitation he could not
isolate such a long polymer  S- strain bacteria:
The Search for the Genetic The bacteria produce smooth and shiny
colony in culture plate. This is because the S
Material strain bacteria has mucous
muco (Polysacharide )
 The discovery of nuclein by Meischer (1869) Coat. This strain of bacteria
acteria is virulent and
and the proposition for principles of cause pneumonia
inheritance by Mendel (1865) were almost at  R strain :
the same time, but that the DNA acts as a It produce rough colonies when grown on
genetic material took long to be discovered culture plate. The rough appearance is due to
andproven. the lack of mucous coat. This type of bacteria
 By 1926, the quest to determine the is non virulent and do not cause pneumonia
mechanism for genetic inheritance had Experiment
reached the molecular level.  When Griffith injected S strains (Virulent) into
 Previous discoveries by Gregor Mendel, mice, they killed them byy causing pneumonia
Walter Sutton, Thomas Hunt Morgan and  When mice were injected with R strain (Non
numerous other scientists had narrowed the virulent ) there was no effect (Mice was alive )
search to the chromosomes located in the  Then, mice were injected with heat killed S strain.
There was no effect.
nucleus of most cells. But the question of
what molecule was actually the genetic
material, had not been answered.

 He then injected a mixture of Heat killed S strain  They concluded that DNA is the hereditary
and Live R strain bacteria, the mice died due to material, but not all biologists were
pneumonia, moreover , he recovered living S convinced.
bacteria from died mice Qn: Write any difference between DNAs and DNase?

Ans : DNA is deoxyribonucleic acid which is the
hereditary material in all organisms except few
viruses. DNAse is a deoxyribonuclease, it is an
 He concluded that the R strain bacteria had
enzyme that catalyzes the hydrolytic cleavage of
somehow been transformed by the heat-
phosphodiester linkages in the backbone of DNA
killed S strain bacteria. Some ‘transforming
principle’, transferred from the heat-killed S
strain, had enabled the R strain to synthesise
2-Hershey-Chase experiment (1952)
a smooth polysaccharide coat and become  The unequivocal proof that DNA is the
virulent. genetic material came from the experiments
Ie. R strain were converted into S strain of Alfred Hershey and Martha Chase (1952).
 This must be due to the transfer of the  They worked with viruses that infect bacteria
genetic material. However, the biochemical called bacterio phages.
nature of genetic material was not defined
Life cycle of Bacteriophage
from his experiments.
 The bacteriophage attaches to the bacteria
Biochemical Characterisation of  Bacteriophage introduce its genetic material
into the bacterial cell.
Transforming Principle  The bacterial cell treats the viral genetic
material as if it was its own and subsequently
 Prior to the work of Oswald Avery, Colin manufactures more virus particles.
MacLeod and Maclyn McCarty (1933-44), the
genetic material was thought to be a protein.
 They worked to determine the biochemical
nature of ‘transforming principle’ in Griffith's
experiment.
 They purified biochemicals (proteins, DNA,
RNA, etc.) from the heat-killed S cells to see
which ones could transform live R cells into S
cells. They discovered that DNA alone from S
bacteria caused R bacteria to become
transformed.
 They also discovered that protein-digesting
Hershey and Chase worked to discover
enzymes (proteases) and RNA-digesting whether it was protein or DNA from the
enzymes (RNases) did not affect viruses that entered the bacteria
transformation, so the transforming
substance was not a protein or RNA. Experiment
 Digestion with DNase did inhibit  Hershey and chase grew some viruses in a
transformation, suggesting that the DNA medium containing radioactive phosphorus
caused the transformation. (32P). Viruses grown in the presence of
radioactive Phosphorus (32P) contain
radioactive DNA but not radioactive protein,

because DNA contains phosphorus but This indicates that proteins did not enter the
protein does not bacteria from the viruses. DNA is therefore
 They also grew some viruses (bacteriophages) the genetic material that is passed from virus
on a medium containing radioactive Sulphur to bacteria
(35S). Viruses grown in the presence of
radioactive sulphur (35S) contains radioactive
protein but not radioactive DNA because
protein contains sulphur but DNA does not.
 These Radioactive phages were allowed to
attach to E. coli bacteria. This step is called
Infection
 Then, as the infection proceeded, the viral
coats were removed from the bacteria by
agitating them in a blender.. This process is
called Blending
 The virus particles were separated from the
bacteria by spinning them in a centrifuge.
centrifuge This
process is called centrifugation
 Bacteria which was infected with viruses that

had radioactive DNA were radioactive,
indicating that DNA was the material that
passed from the virus to the bacteria.
 Bacteria that were infected with viruses that
had radioactive proteins were not radioactive.

DNA (Deoxy Ribonucleic acid)  Cytosine is common for both DNA and RNA
 It is an acidic substance present in the and Thymine is present in DNA. Uracil is
nucleus present in RNA at the place of Thymine.
 It was first identified by Friedrich meischer in SUGAR IN NUCLEIC ACIDS
1869
 He named it as Nuclein. However due to
technical limitation in isolating such a long
polymer, the elucidation of structure of DNA
remains elusive
 In 1953, James Watson and Francis Crick
proposed a very simple but famous Double
Helical Structure of DNA. They proposed this
model based on X ray diffraction data NUCLEOSIDES
proposed by Maurice Wilkins and Rosalind  A nitrogenous base is linked to the OH of 1' C
Frankiln pentose sugar through a N-glycosidic linkage
 One of the hallmarks of their proposition to form a nucleoside
was base pairing between the two strands of Eg. Nucleosides
polynucleotide chains. Sugar+ DNA RNA
 The length of DNA is usually defined as the Nitrogen base
S+Adenine Deoxyadenosine Adenosine
number of nucleotides (Or Base pairs: a pair
S+Guanine Deoxyguanosine Guanosine
of nucleotides)
S+Thymine Deoxythymidine -
Eg: Man = 6.6×109 BP
6 S+Cytosine Deoxycytidine Cytidine
E.Coli =4.6×10 BP
S+Uracil - Uridine
Lambda phage =48502 BP
Ø X 174 phage =5386 nucleotides
(Single stranded DNA) NUCLEOTIDES
 When a phosphate group is linked to OH of 5'
C of a nucleoside through phosphoester
Structure of DNA linkage, a corresponding nucleotide (or deoxy
 DNA=2 Polynculeotide nucleotide depending upon the type of sugar
 Polynucleotides= (Nucleotides)n present) is formed.
 Nucleotide=Nucleside+Phosphate Eg. Nucleotides
 Nucleoside=Sugar+Nitrogen base Nucleoside+ DNA RNA
 Sugar in DNA= Deoxy ribose (5C-Pentose ) Phosphate
S+Adenine+P Deoxyadenylic Adenylic acid
 Sugar in RNA =Ribose (5C-Pentose ) acid
S+Guanine+P Deoxyguanylic Guanylic acid
acid
S+Thymine+P Deoxythymidylic -
acid
S+Cytosine+P Deoxycytidylic Cytidylic acid
acid
S+Uracil+P - Uridylic acid

DI AND POLY NCULEOTIDES 03- The bases in two strands are paired
 Two nucleotides are linked through 3'-5' through hydrogen bond (H-bonds)
forming base pairs (bp). Adenine forms
phosphodiester linkage to form a
two hydrogen bonds with Thymine from
dinucleotide. opposite strand and vice-versa.
vice Similarly,
 More nucleotides can be joined in such a Guanine is bonded with Cytosine with
manner to form a polynucleotide chain three H-bonds.
bonds. As a result, always a
purine comes opposite to a pyrimidine.
This generatess approximately uniform
distance between the two strands of the
helix (20AO)
04- The two chains are coiled in a right -
handed fashion.. The pitch of the helix is
3.4 nm (a nanometre is one billionth of a
metre, that is 10-9 m) and there are roughly
5’ and 3’ end of polynucleotide chain 10 bp in each turn. Consequently, the
 A polynucleotide has at one end a free distance between a bp in a helix is
phosphate moiety at 5' -end
end of sugar, which is approximately equal to 0.34 nm.
referred to as 5’-end of polynucleotide chain. 05- The plane of one base pair stacks over the
other in double helix. This ,in addition to
 The other end of the polynulceotide the sugar
H-bonds,
bonds, confer stability of the helical
has a free OH of 3'C group which is referred to structure
as 3' -end of the polynucleotide chain.
 The backbone of a polynucleotide chain is
formed due to sugar and phosphates
phosphates. The
nitrogenous bases linked to sugar moiety
Chargaff Rule
 Proposed y Erwin Chargaff
project from the backbone.
DNA the ratios between
 For a double stranded DNA,
 The base pairing confers a very unique Adenine and Thymine, and Guanine and Cytosine
property
erty to the polynucleotide chains are constant and equal one.
 They are said to be complementary to each other, Ie: A+G=T+C
and therefore if the sequence of bases in one (or)
strand is known then the sequence in other strand A+G/T+C=1
can be predicted.
Qn Predict the sequence of nucleotides in the
other strand of DNA.
3’-A
A T G C A T G C A A A G G G T T A T C G-
G 5’
Ans :
The salient features of the

Double-helix
helix structure of DNA
01- It is made of two polynucleotide chains,
chains
where the backbone is constituted by
sugar -phosphate,
phosphate, and the bases project
inside.
02- The two chains have anti anti-parallel
polarity.. It means, if one chain has the
polarity 5'3', the other has 3'
5'.

Qn.. A double stranded DNA contains 20% Adenine

nucleotides. What will be the percentage Guanine,
Gu
Cytosine and Thymine nucleotides in this DNA ?
Ans :

Packaging of DNA  The nucleosomes in chromatin are seen as

‘beads-on-string’ structure when viewed
under electron microscope (EM)
Helix
a)Packaging of DNA in Eukaryote
Length of DNA =Total number of Base pair × distance
between adjacent base pair
= 6.6 × 109BP × 0.34×10-9
= 2.2m
 This length that is far greater than the  A typical nucleosome contains 200 bp of DNA
dimension of a typical nucleus (approximately helix.
10–6 m). There for total number of nucleosome in
 The negatively charged DNA is wrapped human
around the positively charged histone
octamer to form a structure called
nucleosome.
 The beads-on-string structure in chromatin is
packaged to form chromatin fibers that are
further coiled and condensed at metaphase
stage of cell division to formchromosomes.
 The packaging of chromatin at higher level
requires additional set of proteins that
collectively are referred to as Non-histone
Chromosomal (NHC) proteins.
 In Eukaryotes there is a set of +vely charged

basic proteins called Histones.
 A protein acquires charge depending upon
the abundance of amino acids residues with
charged side chains.
 Histones are rich in +vely charged basic
amino acids (Amino acids are Lysine and
arginine )
 The +ve charge is due to the presence of +ve
charge on both the amino acid residues.
 Histones are organised to form a unit of eight b)Packaging of DNA in Prokaryote
molecules called as histone octamer. Eg :E.coli
 In prokaryotes, such as, E. coli, though they
 Nucleosomes constitute the repeating unit of
do not have a defined nucleus, the DNA is not
a structure in nucleus called chromatin,
scattered throughout the cell.
thread-like stained (coloured) bodies seen in
 -vely charged DNA is held with +vely charged
nucleus.
proteins in a region termed as ‘nucleoid’.

 The DNA in nucleoid is organised in large  RNA being a catalyst was reactive and hence
loops held by proteins. unstable. Therefore, DNA has evolved from
NA with chemical modifications that make
RNA
it more stable.
Properties of Genetic Material

Qn. If the length of E. coli DNA is 1.36 mm, can
you calculate the number of base pairs in E.coli? (i) It should be able to generate its
replica (Replication).
Ans:  Both the nucleic acids (DNA and RNA) have
the ability to direct their duplications/
Replication
 But protein do not replicate
(ii) It should chemically and

RNA (Ribo nucleic acid) Structurally be stable.
 It is formed of a single polynucleotide chain  The genetic material should be stable enough
 Sugar in RNA is Ribose. not to change with different stages of life
 In RNA, every nucleotide
ucleotide residue has an cycle, age or with change in physiology of the
additional –OHOH group present at 2' -position organism.
in the ribose sugar. properties of genetic
 Stability as one of the proper
 In RNA the uracil is found at the place of material was very evident in Griffith’s
thymine (5’-methyl
methyl uracil, another chemical ‘transforming principle’ itself that heat, which
name for thymine). killed the bacteria, at least did not destroy
 RNA acts as the genetic material in some some of the properties of genetic material.
 The presence of thymine at the place of uracil
viruses. (Retroviruses)
DNA.
also confers additional stability to DNA
Eg: HIV, TMV, QB Bacteriophage.
 Further, 2'-OH group present at every nucleotide
 RNA was the first genetic material.
in RNA is a reactive group and makes RNA labile
and easily degradable.
Functions of RNA  RNA is also now known to be catalytic, hence
i. RNA used to act as a genetic material (eg.in reactive. Therefore, DNA chemically is less
Retro virus ) cturally more stable when
reactive and structurally
ii. It can act a catalyst (there are some important compared to RNA. Therefore, among the two
biochemical reactions in living systems that are nucleic acids, the DNA is a better genetic material.
catalyzed by RNA catalysts (RIBOZYME
RIBOZYME) and  DNA being double stranded and having
complementary strand further resists changes by
not by protein enzymes).
evolving a process of repair.
iii. It can perform dynamic functions of a
messenger.
iv. It can functions as adapter ,structure molecule

(iii) It should provide the scope for
slow changes (mutation) thatare
required for evolution.
 Both DNA and RNA are able to mutate.
 RNA being unstable, mutate at a faster rate.
Consequently, viruses having RNA genome
and having shorter life span mutate and
evolve faster
(iv) It should be able to express itself in

the form of 'Mendelian Characters’.
 For the storage of genetic information, DNA is
better due to its stability.
 But for the transformation of genetic
information RNA is better. Because RNA can
directly code for the protein synthesis. Hence
can easily express the character. But DNA
depend on RNA for protein synthesis.
Qn- Among two nucleic acid, DNA is better

genetic material. Explain
Ans : DNA is stable and less reactive.
For the storage of genetic information,
DNA is better due to its stability.
Qn- What is the reason for the stability of
DNA?
Ans: -DNA is double stranded
-Presence of thymine
-Absence of 2’ OH in sugar
Qn- Why retrovirus mutates and Evolve
faster?
Ans : Retroviruses are viruses in which
genetic material is RNA. RNA is
unstable,. Hence retrovirus mutate
faster rate.
Qn-What makes RNA Labile and easily
degradable ?
Ans:Presence of 2’-OH
Q- Difference between DNA and RNA ?

DNA RNA
-It is formed of 2 poly -It is formed of single
nucleotide chain poly nucleotide chain
-The sugar in DNA is -The Sugar in RNA is
dexoy ribose Ribose
-The nitrogen base in -The nitrogen base in
DNA is A,T,G,C RNA is A,U,G,C
-Stable -Unstable and catalytic
Navas cheemadan Molecular basis of inheritance/2024

CENTRAL DOGMA IN MOLECULAR ‘‘It has not escaped our notice that the specific
BIOLOGY Pairing we have postulated immediately suggests
apossible copying mechanism for the genetic
 Proposed by Francis Crick
Watson and Crick, 1953).
material’’ (Watson
 It is the unidirectional
tional flow of
information from DNA-RNA-Protein
Protein
 DNA replication takes place in the S phase of
cell division cycle.
 Failure of cytokinesis after DNA replication
Increase in the wholes set
results Polyploidy (Increase
of chromosome).
 Polyploidy is common in plant cells
 In some viruses the flow of information is in
reverse direction
Experimental verification of semiconcervative
method of DNA replication
 It is an exception to central dogma of molecular  It was first shown in E.coli and later in higher
biology. organisms such as plants and Human cell.
1) Meselson-Stahl
Stahl experiment (1958)
DNA REPLICATION  Proposed by Matthew Meselson and Franklin
 DNA replication is the copying for DNA from
Stahl performed the following experiment in
parent DNA 1958
 Watson and crick proposed Semiconcervative  They grew E. coli in a medium containing
method of DNA replication 15
NH4Cl (15N is the heavyisotope of
 According to this 2 daughter DNA are produced nitrogen).15N was incorporated in to both
from parent DNA. Each daughter DNA consists of strand of bacterial DNA and the DNA
2 strands, one strand is newly synthesised and become heavier. This DNA is called Heavy
other strand belongs to parent. DNA.
Ie: Parent’s strand is conserved  They also made medium containing
14
NH4Cl (14N is the normal isotope of
nitrogen).
 They took E.coli from 15N medium (Heavy
DNA) and transferred into 14N medium.
After one generation ((20 minutes), they
isolated and centrifuged the DNA. Its
(hybrid). This
density was intermediate (hybrid)
shows that , in the newly formed DNA,
one strand is newly formed (14N) and
other strand belongs to parent (15N).This
method DNA
confirms semi conservative met
replication.
 After second generation ((40 minutes),
Watson-Crick model for
there was equal amount of hybrid DNA
semiconservative DNA
replication and light DNA.
 While proposing the double helical structure for
DNA,Watson and Crick had immediately proposed Heavy DNA can be distinguished from light DNA
chloride)
by centrifugation in CSCl (cesium chloride
a scheme for replication of DNA.
density gradient.
To quote their original statement that is as
follows:

c) DNA Dependent DNA polymerase
 It is the main enzyme in DNA replication
 It uses a DNA template to catalyse
polymerisation of dexoy nucleotides
 These enzymes are highly efficient enzymes
as they have to catalyse polymerisation of a
large number of nucleotides in a very short
time. E. coli that has only 4.6 ×106 bp
(compare it with human whose diploid
content is 6.6 × 109 bp), completes the
process of replication within 18 minutes; that
means the average rate of polymerisation has
to be approximately 2000 bp per second.
Qn: If E. coli was allowed to grow for 80 minutes then  This enzyme has high accuracy (Any mistake
what would be the proportions of light and hybrid during replication would result into
densities DNA molecule? mutations)
Ans:  It polymerise the nucleotides in 5’ 3
direction
Deoxy Ribonucleoside Triphsophate
2) Taylor’s Experiment (1958)

 Conducted by Taylor and Colleague
 It has 2 functions,
 He used Vicia faba (Faba beans) as
i)It act as substrate.
experimentallmaterial .
ii)It provide energy for polymerisation
 He used Radioactive thymidine to detect
presence of newly synthesised DNA
 The experiments proved that the DNA in
chromosomes also replicate The 2 terminal phosphate in a dexoyribo nucleoside
semiconservatively. triphosphates are high energy phosphate. It provides
energy for polymerisation.
Enzymes in DNA Replication
Replication Fork
a) Helicase
For long DNA molecules, since the two strands of
 During replication, the 2 strands unwind and
DNA cannot be separated in its entire length (due
separated by breaking the H bond in the
to very high energy requirement), the replication
presence of Helicase enzyme
occur within a small opening of the DNA helix,
 DNA Replication is energetically expensive
referred to as replication fork
that is why during replication 2 strands of
DNA cannot be separated in its entire length
origin of replication
b) RNA Primase
The DNA polymerases on their own cannot initiate
 It synthesise RNA Primer (Small stretch of
the process of replication. Also the replication does
RNA) not initiate randomly at any place in DNA. There is a
definite region in E. coli DNA where the replication

originates. Such regions are termed as origin of  The strand with polarity 3’—5’ act as a
replication template (For mRNA synthesis), the other
Template strand with polarity 5’— —3’ is called coding
During DNA replication, the 2 strands separate strand (It do not code for anything).
and act as a template for the synthesis of new
strand. New strands are synthesised based on
template sequence.
Leading strand and Lagging strand Q-Why

Why Both strands of DNA are not copied into
(Continous and discontinuous strand) RNA during transcription?
 The DNA-dependent
dependent DNA polymerases catalyse Ans : If both strand act as a template
polymerisation only in one direction, that is 5'-3'.
5'
i)Two RNA molecule will be produced
This creates some additional complications at the
with different sequences . It results in
replicating fork. Consequently, on one strand (the
the formation of 2 different
template with polarity 3'-5'), 5'), the replication is
continuous, while on the other (the template with proteins and this would complicate the
polarity 5'-3'), it is discontinuous genetic information transfer machinery.
d) DNA Ligase ii)Two RNA molecule
olecule will be produced,
 The discontinuously synthesised fragments are they are complementary to each
ea other,
later joined by the enzyme DNA ligase hence it may form double
doub stranded RNA.
This would prevent RNA from being
translated into protein and the exercise of
transcription would become a futile one..
Transcription Unit
 A transcription
tion unit in DNA is defined by 3 regions
a) A promoter
b) The structural gene
c) A terminator
DNA transcription
 The process of copying genetic information
from one strand of DNA (Template) into RNA
is called transcription.
 The enzyme involved in transcription is DNA a) A promoter
dependent RNA polymerase.  It is the site where DNA dependent RNA
 In DNA transcription only a segment of DNA polymerase bind
(Gene,A gene is defined as the functional  Transcription starts from promoter site.
unit of inheritance) and only one of the  Promoter is located towards the 5’ end
strand (Template strand, 3’—5’)
5’) is copied to (Upstream) of the structural gene (The
RNA reference is made with respect to the polarity
of Coding strand )

 it is the presence of a promoter in a so also the RNA polymerase. This results in
transcription unit that defines the template termination of transcription.
and coding strands  The RNA Produces as a result of transcription
 By switching its position with terminator, the in prokaryote is called mRNA (Messenger
definition of coding and template strands RNA).
could be reversed.  The RNA Produces as a result of transcription
b) The structural gene in Eukaryote is called hnRNA (Heterogeneous
 The promoter and Terminator flank the nuclear RNA).
structural gene in transcription unit.  Both transcription and translation are
 RNA is produced from the structural gene coupled in bacteria. Many times translation
c) Terminator can begin much before the m RNA is fully
 It is the site at which transcription stops. transcribed
 It is located towards the 3’ end (Down stream
) of coding strand Transcription in Eukaryotes
 The process of transcription is same in both
Steps in DNA Transcription prokaryotes and eukaryotes.
 It consist of 3 steps  In Eukaryotes, there are 2 additional
i)Initiation complexities
ii)Elongation
i) There are at least 3 RNA polymerease in
iii)Termination
the nucleus
i)Initiation
RNA Pol I : it transcribe r RNA
 The sigma factor (σ factor/initiation factor) (28S,18S,5.8S)
bind transiently with RNA polymerase. RNA Pol II : It transcribe hnRNA
 This RNA polymerase bind to the promoter of (Heterogenous nuclear RNA/
Transcription unit and initiate transcription Precursor of mRNA )
ii) Elongation RNA Pol III : It transcribe tRNA
 The DNA dependent RNA polymerase uses ,5srRNA, and snRNAs (small
nucleoside triphosphates as substrate, and nuclearRNAs)
polymerase in a template dependent ii) The hnRNA Produced as a result of
manner in 5’-3’ direction. transcription contains both Exons
 RNA polymerase somehow also facilitates (Coding sequences) and Introns(non
opening of the helix codingsequences ),such RNA are non
 Only a short stretch of RNA remains bound to functional. This hnRNA is subjected to
the enzyme processing (Splicing, capping, tailing ) to
iii) Termination become mRNA . Hence hnRNA is called
 Terminator is located towards the 3’ end of precursor of mRNA .
coding strand, it usually defines the end
process of transcription.
 The Rho factor (termination factor)
terminates the process of transcription (by
Splicing : It is the process by which
binding transiently with RNA polymerase )
Introns (Non coding sequences) are
 Once the RNA polymerases reaches the
removed and Exons are join together in a
terminator region, the nascent RNA falls off,
defined order

Capping : Here an unusual nucleotides Difference between DNA replication and

m
GPPP (methyl guanosine triphosphate) is Transcription
added to the 5'-end of hnRNA. DNA REPLICATION DNA TRANSCRIPTION
DNADNA DNARNA
Enzyme in DNA Enzyme in DNA transcription
Tailing: In tailing, adenylate residues replication is DNA is DNA dependent RNA
(200-300) are added at 3'-end in a dependent DNA polymerase
template independent manner. polymerase
The entire DNA is Only one of the strand
 The fully processed hnRNA, now called duplicated (Template) and a segment
mRNA, Itis then transported out of the (Gene) DNA is copied into
nucleus for translation. RNA
Difference between Prokaryotic and Eukaryotic

transcription
Prokaryotic transcription Eukaryotic transcription
Both transcription and They are separate
translation are couple in
prokaryotes
The RNA contains only The RNA contains exons
exons, this RNA is called and Introns ,hence this
mRNA RNA is called hnRNA
No processing required HnRNA Undergo
for mRNA processing
(Splicing,capping, tailing)
to become mRNA
A single DNA dependent At least 3 types of RNA
RNA polymerase is polymerase is involved
involved in synthesizing
all types of RNA
What is a gene?
 A gene is defined as the functional unit of
inheritance.
 The DNA sequence coding for tRNA or rRNA
molecule also define a gene.
 A cistron is a segment of DNA coding for a
polypeptide. (coding region within a gene)
 A gene can be monocistronic (containing one
cistron) or polycistronic (containing multiple
cistrons) depending on the organism
Monocistronic
 The structural gene in a transcription unit
could be said as monocistronic
 It is present in mostly in eukaryotes
 Monocistron codes for a single polypeptide chain
(protein).

 In eukaryotes, the monocistronic structural Scientists
ientists involved in cracking/Deciphering
cracking
genes have interrupted coding sequences
sequences– the Genetic code
Several scientists belongs to several branches
the genes in eukaryotes are split.
of science involved in cracking the genetic code
 The coding sequences or expressed
such as it physicists, organic chemists,
sequences are defined as exons.
geneticists Some of the
biochemists and geneticists.
 The exons are interrupted by introns (Non
scientists are given below
coding sequences )
 Introns or intervening sequences do not George Gamow (Physicist ) :he argued that
1-George
appear in mature or processed RNA. since there are only 4 bases and if they have to
code for 20 amino acids, the code should
Polycistronic constitute a combination of bases. He suggested
that in order to code for all the 20 amino acids,
 The structural gene in a transcription unit
the code should be made up of three nucleotides
could be said as Polycistronic (Triplet codon). This was a very bold proposition,
 It is present in mostly in mostly in bacteria or because a permutation combination of 43 (4 × 4 × 4)
prokaryotes would generate 64 codons; generating many more
 Polycistron codes for multiple polypeptide chain codons than required.
(protein).
2-Har GobindKhorana :
Providing proof that the codon was a triplet, was a
more daunting task. The chemical me method
developed by HarGobind Khorana was
instrumental in synthesising RNA molecules with
defined combinations of bases (homopolymers
and copolymers).
3-Marshall Nirenberg : He developed cell free
system for protein synthesis
4-Severo Ochoa :SeveroSevero Ochoa enzyme
(polynucleotide phosphorylase) was also helpfulin
polymerising RNA with defined sequences in a
template independent manner (enzymatic
synthesis of RNA).
 Finally a checker-board
board for genetic code
was prepared which is given below .
Genetic Code
 It is the sequence of nucleotides (Nitrogen
base) in the mRNA that containing
information for Protein synthesis (Translation
)

The salient features of genetic code are as tRNA (Transfer RNA)/Adapter
/Adapter molecule
follows:  Proposed by Francis crick
i) The codon is triplet. 61 codons code for  From the very beginning of the proposition of
aminoacids and 3 codons do not code for code, it was clear to FrancisCrick that there
any amino acids, hence they function as has to be a mechanism to read the code and
stop codons. (UAA,UGA,UAG) also to link it to the amino acids, because
ii) One codon codes for only one amino acid, amino acids have no structural specialities to
hence, it is unambiguous and specific. (Not read the code uniquely
mentioned in text book )  The tRNA, then called sRNA (soluble RNA),
iii) Some amino acids are coded by more than was known before the genetic code was
one codon, hence the code is degenerate
degenerate. postulated. However, its role as an adapter
Non degenerate codon molecule was assigned much later.
later..
AUG :Methionine
UGG: tryptophan
 tRNA has
iv) The codon is read in mRNA in a contiguous  Anticodon loop : That has bases
fashion. There
re are no punctuations
punctuations. (Anticodon)) complementary to the triplet
v) The code is nearly universal: for example, codon on the mRNA
from bacteria to human UUU would code  Aminoacid acceptor end to which it bind
for Phenylalanine (phe). Some exceptions to specific amino acids.
to this rule have been found in
mitochondrial codons, and in some
protozoans.
vi) AUG has dual functions.
-It codes
des for Methionine (met) ,
- it also act as initiator/startcodon
vii) UAA, UAG, UGA are stop terminator
codons.
Genetic code Amino acids tRNA-The
The Adapter Molecule
AAA Lysine
CCC Proline  tRNA has specific for each amino acids
GGG Glycine  there are no tRNA for STOP codon
UUU Phenyl alanine  For initiation of translation process, there
GAG Glutamic acid involved initiator tRNA
GUG Valine  The secondary structure of tRNA looks like
AUG Methionine Clover Leaf structure
AGU Serine
 In actual structure, the tRNA is a compact
UAC Tyrosine
molecule which looks like ‘inverted L’
UAA STOP
UGA (do not code for
UAG any amino acid) Ribosome
Qn. If following is the sequence of nucleotides in
mRNA, predict the sequence of amino acid coded  Ribosome is the cellular factory for protein
by it (take help of the checkerboard): synthesis.
 The ribosome consists of structural RNA and
-AUG
AUG UUU UUC UUC UUU UUU UUC
UUC- 80 different proteins.
Ans:  In its inactive state, it exists as two subunits;
a large subunit and a small subunit
 The large sub units has 2 sites (P and A site ).
MUTATION
(Refer principles of inheritance notes-Mutation
Mutation and Types)

 The tRNA with methionine (Inititator tRNA)
enter to the P site , then another t RNA acids
nter to the A site
with Amino enter site.
 If 2 such charged tRNA are brought close
enough, the formation of peptide bond
between them would be favoured
energetically. The Presence of a catalyst
(Ribozyme) would enhance the rate of peptide
bond formation.
 The ribosome also acts as catalyst (23srRNA)
in Bacteria is the enzyme Ribozyme.It
Ribozyme. helps in 3-Elongation
for the formation of peptide bond.  During this linkage 1st amino acid and 2nd
amino acid, 1st amino acid’s tRNA linkage is
Qn-Why tRNA is called adapter molecule?
Ans : A tRNA can read triplet codon on the mRNA broken. This tRNA is removed from the P site.
with one hand and can carry a specific amino And the 2nd tRNA at the A site is pulled to the
acids with other hand hence tRNA is called P site along with mRNA . this process is known
Adapter molecule. as translocation
Qn-mRNA : Triplet codon  It result the 3rd codon coming into the A site
tRNA : Anticodon and appropriate tRNA with amino acid bind to
the A site. This process is repeated result in
the elongation of Protein chain
DNA Translation
 The process of polymerisation
erisation of amino acids 4-Termination
to form
m Polypetide chain (Protein) is called  When the ‘A site’ reaches on to the stop
Translation. codon termination of translation occur
 The order and sequence of amino acids in a because there is no tRNA for stop codon
protein is defined by the sequence of triplet (UAA,UGA,UAG)
codon in the mRNA  Release factor binds to Stop codon also helps
 A translational unit in mRNA is the sequence in termination
of RNA that is flanked by the start codon
(AUG) and the stop codon and codes for a
polypeptide.
 The process of translation consists of 4 steps

1-Charging
Charging Of Trna/ Aminoacylation of tRNA
 In a Protein, amino acids are joined by
Peptide bond .Formation of a peptide
bond requires energy
 In the first steps amino acids are
activated in the presence of ATP UTR (Untranslated region)
Ie: Aminoacid+ATP=
id+ATP= Activated amino acids  An mRNA also has some additional sequences that
 Such charged Amino acids are linked are not translated and are referred as
to specific tRNA (Bind to amino acid untranslated regions (UTR).
binding site of tRNA ).. This process is  The UTRs are present at both 5' -end (before start
called charging of tRNA / Aminoacylation end (after stop codon).
codon) and at 3' -end
of tRNA  They are required for efficient translation
2-Inititation process.
 Small sub unit of ribosome bind to the mRNA

REGULATION OF GENE EXPRESSION by the interaction of proteins with sequences
Considering that gene expression results in the termed operators.
formation of a polypeptide, it can be regulated at  The operator region is adjacent to the
several levels promoter elements in most operons and in
A. Regulation of gene expression in most cases the sequences of the operator
Eukaryotes bind a repressor protein.
 Each operon has its specific operator and
 In eukaryotes, the regulation could be exerted at
specific repressor.
i) Transcriptional level (formation of primary
For example, lac operator is present only in
transcript)
the lac operon and it interacts specifically
ii) Processing level (regulation of splicing)
with lac repressor only
iii) Transport of mRNA from nucleus to the
cytoplasm, LAC OPERON
iv) Translational level.  Proposed by a geneticist, Francois Jacob and
 The development and differentiation of a biochemist, Jacque Monod
embryo into adult organisms are also a result  They were the first to elucidate a
of the coordinated regulation of expression of transcriptionally regulated system
several sets of genes  Here lac refers to lactose
 The operon controlling lactose metabolism is
B. Regulation of gene expression in called Lac Operon. It consists of
Prokaryotes 1-A regulator gene (i gene/ inhibitor gene) :
 The metabolic, physiological and It code for repressor protein
environmental conditions regulate 2-Three structural gene
expression of genes in Prokaryotes a)Lac Z gene :It code for Beta
 Eg: In E coli the enzyme, beta galactosidase galactosidase (β-gal . It hydrolyze
hydrolyses lactose into glucose and galactose. lactose to glucose and galactose)
In the absence of lactose, the synthesis of b)Lac y gene : It code for Permease
beta galactosidase stops. (Increase permeability of cell to-
galactosides/ Lactose)
OPERON c)Lac a gene :it code for Transacetylase
 Operons are cluster of genes responsible for
controlling metabolic reaction within a living
system.
OR In the Absence of Lactose (Inducer)
 All the genes regulating a metabolic reaction  If there is no inducer (Lactose ), lac operon
constitute an Operon. remains switched off.
Eg: Lac operon  The regulator gene synthesizes mRNA to
Trp Operon produce the repressor protein. This protein
Ara Operon binds to the operator gene and blocks RNA
His Operon polymerase movement. So structural genes
Val Operon are not expressed.
 In a transcription unit, the activity of RNA
polymerase at a given promoter is in turn
regulated by interaction with accessory
proteins, which affect its ability to recognise
start sites. These regulatory proteins can act
both positively (activators) and negatively
(repressors).
 The accessibility of promoter regions of
prokaryotic DNA is in many cases regulated

In the presence of Lactose (Inducer) lac operon. whereas lactose acts as an inducer
 If lactose is provided in the growth medium, because it binds with the repressor
the lactose is transported into E.coli cells by
the action of permease.
 Lactose (Inducer) binds with repressor
protein and become inactive. So Repressor
protein cannot bind to operator gene.
 The operator gene become free and induces
the RNA polymerase to bind with promoter
gene. Then RNA polymerase transcribe the
structural RNA , results in lac mRNA
formation.
 The lac mRNA translated to produce beta
galactosidase, permease and trans acetylase
 Regulation of lac operon by repressor is referred

to as negative regulation.
 Each operon has its specific operator

and specific repressor.
 For example, lac operator is present only
in the lac operon and it interacts
specifically with lac repressor only.
Qn. Why lactose is called as an Inducer in Lac

Operon ?
Ans. Lactose is the substrate for the enzyme beta-
galactosidase and it regulates switching on and
off of the operon. Hence, it is termed as inducer
Qn. how long the lac operon would be expressed

in the presence of lactose?
Ans.The Lactose operon expresses as long as
the Lactose is present. When all lactose is
converted into glucose and galactose, the
Expression stops
Qn. Why glucose or galactose cannot act as

inducers for lac operon ?
Ans. Glucose structures are not sufficient to bind
with repressor ,so they cannot acts as inducer for

Human Genome Project (v) Transfer related technologies to other sectors,
 Genetic make-up of an organism or an such as industries;
(vi) Address the Ethical, Legal, and Social issues (ELSI)
individual lies in the DNA sequences.
that may arise from the project.
 If two individuals differ, then their DNA
sequences should also be different, at least at
some places. These assumptions led to the Methodologies in Human genome project
quest of finding out the complete DNA
The methods involved two major approaches.
sequence of human genome.
a)Expressed sequence tags(ESTs).
 HGP is the Finding out the complete DNA
Here we focused on identifying all the genes that
sequence of human genome.
are expressed as RNA
 It is launched in 1990
b)Sequence Annotation
 Completed in 2003
This is a blind approach of simply sequencing the
 It was a 13 year project
whole set of genome that contained all the
 But the sequence of chromosome 1 was coding and non-coding sequence
completed onlyin May 2006 (This was the last
of the human chromosomes – 22 Autosomes
Steps in HGP
and X and Y – to be sequenced).
For sequencing,
 The project was coordinated by
1. The total DNA from a cell is isolated
 The U.S. Department of Energy and
2. Convert DNA into random fragments of
 The National Institute of Health
relatively smaller sizes (because DNA is a very
 During the early years of the HGP, the
long polymer, and there are technical
Wellcome Trust (U.K.) became a major
limitations in sequencing very long pieces of
partner;
DNA)
 Additional contributions came from Japan,
3. Clone each piece of DNA in suitable host using
France, Germany, China and others.
specialized vectors. The cloning resulted into
amplification of each piece of DNA fragment
Why HGP is called a Mega project...? so that it subsequently could be sequenced
with ease. The commonly used hosts were
 Human genome is said to have approximately
bacteria and yeast, and the vectors were
3 x 109bp, and if the cost of sequencing
called as BAC (bacterial artificial
required is US $ 3 per bp (the estimated cost
chromosomes), and YAC (yeast artificial
in the beginning), the total estimated cost of
chromosomes).
the project would be approximately 9 billion
4. The fragments were sequenced using
US dollars.
automated DNA sequencers that worked on
 Further, if these sequences were to be stored
the principle of a method developed by
in typed form in books, and if each page of
Frederick Sanger. (Sanger is also credited for
the book contained 1000 letters and each
developing method for determination of
book contained 1000 pages, then 3300 such
amino acid sequences in proteins).
books would be required to store the
5. These sequences were then arranged based
information of DNA sequence from a single
on some overlapping regions present in them.
human cell.
This required generation of overlapping
fragments for sequencing.
Goals of HGP
6. Alignment of these sequences was humanly
(i) Identify all the approximately 20,000-25,000 not possible. Therefore, specialized computer
genes in human DNA; based programs were developed (HGP was
(ii) Determine the sequences of the 3 billion closely associated with the rapid
chemical base pairs thatmake up human DNA; development of a new area in biology called
(iiii) Store this information in databases; Bioinformatics. It is the application of
(iv) Improve tools for data analysis; computer science and information
Navas cheemadan Molecular basis of inheritance/2024

technology to the field of biology and associated sequences and tracing
for disease-associated
medicine.). human history.
7. These sequences were subsequently Application
annotated and were assigned to each 1- it can study all the genes in a genome
genome, for
chromosome. example, all the transcripts in a particular tissue
or organ or tumor, or how tens of thousands of
genes and proteins work together in
interconnected networks to orchestrate the
chemistry of life.
They can also study how thousands of genes
2-They
work together in networks to make a system
function.
A representative diagram of human 3- Knowledge about the effects of DNA variations
genome project among individuals cann lead to revolutionary new
ways to diagnose, treat and someday prevent
Salient Features of Human Genome the thousands of disorders that affect human
beings.
I. The human genome contains 3164.7 million
Besides providing clues to understanding
4-Besides
nucleotide bases.
human biology, learning about non non-human
II. The average gene consists of 3000 bases,
bases but
organisms DNA sequences can lead to an
sizes vary greatly, with the largest known
anding of their natural capabilities that
understanding
human gene being dystrophin at 2.4 million
can be applied toward solving challenges in
bases.
health care, agriculture, energy production,
III. The total number of genes is estimated at
environmental remediation
30,000–much
much lower than previous estimates
of 80,000 to 1,40,000 genes. Almost all (99.9
Genome sequencing in other organisms
per cent) nucleotide bases are exactly the Genome Sequencing also done in
same in all people.  Bacteria,
IV. The functions are unknown for over 50 per
 Yeast,
cent of the discovered genes.
 Caenorhabditiselegans
V. Less than 2 per cent of the genome codes
pathogenic nematode),
(a free living non-pathogenic
for proteins.
 Drosophila (the fruit fly),
VI. Repeated sequences make up very large
 Plants (rice and Arabidopsis
Arabidopsis),
portion of the human genome.
VII. Repetitive sequences are stretches
tretches of DNA
Repetitive DNA
sequences that are repeated many times,
 These are sequences, a small stretch of DNA is
sometimes hundred to thousand times. They
repeated many times.
are thought to have no direct coding
 These repetitive DNA can be separated from
functions, but they shed light on
bulk genomic DNA as different peaks during
chromosome structure, dynamics and
centrifugation. The bulk DNA
density gradient centrifugation
evolution.
forms a major peak an the other small peaks
VIII. Chromosome 1 has most genes (2968), and
are referred to as satellite DNA.
the Y has the fewest (231).
IX. Scientists have identified about 1.4 million
Depending on
locations where singlebase DNA differences
 Base
ase composition (A : T rich or G:C rich),
(SNPs – single nucleotide polymorphism,
pronounced as ‘snips’) occur in humans. This  Length of segment
information promises to revolutionise the  Number
umber of repetitive units (Copy
processes of finding
inding chromosomal locations number)
the satellite DNA is classified into many
categories, such as

a)micro-satellites, very high degree of polymorphism. It was
b)mini-satellites called as Variable Number Tandem
Repeats.(VNTR)
The VNTR (Variable NumberTandem Repeats)
 The technique, as used earlier, involved
 It belongs to a class of satellite DNA referred
Southern blot hybridisation using
to as mini-satellite.
radiolabelled VNTR as a probe
 A small DNA sequence is arranged tandemly
in many copy numbers.
 The copy number varies from chromosome to • Different steps of DNA fingerprinting are:-
chromosome in an individual (this number  Isolation of DNA.
varies from person to person ).  Digestion of DNA by restriction
 The size of VNTR varies in size from 0.1 to 20 endonucleases.
kb  Separation of DNA fragments by gel
electrophoresis.
Functions of repetitive DNA
 Transferring (blotting) of separated DNA
 It normally do not code for any proteins,
fragment to synthetic membranes, such
 These sequence show high degree of
as nitrocellulose or nylon.
polymorphism (Variation at genetic
 Hybridization using labeled VNTR probe.
levels).
 Detection of hybridized DNA fragments
 DNA Polymorphism means any difference
by autoradiography
in the nucleotide sequence observed in a
 After hybridization with VNTR probe the
population.( Eg SNPs)
autoradiogram gives many bands of
 It is inheritable and arises due to
different sizes
mutation and form the basis of DNA
 These bands give a characteristic pattern
fingerprinting. for an individual DNA. It differs from
 Since DNA from every tissue (such individual to individual in a population except
asblood, hair-follicle, skin, bone, saliva, in the case of monozygotic (identical) twins
sperm etc.), from an individual show the Applications:
same degree of polymorphism, they • Test of paternity.
become very useful identification tool in • Identify the criminals.
forensic applications • Population diversity determination.
• Determination of genetic diversity.
Polymorphism in DNA sequence is the basis of
genetic mapping of human genome as well as of
DNA fingerprinting,
DNA FINGERPRINTING
 DNA fingerprinting was initially developed
by Alec Jeffreys.
 DNA finger printing is a very quick way to
compare the DNA sequences of any two
individual.
 The DNA from a single cell is enough to
perform DNA fingerprinting.
 DNA fingerprinting involves identifying
differences in some specific regions in
DNA called repetitive DNA, because in
these sequences, a small stretch of DNA is
repeated many times
 Alec Jeffrey used satellite DNA as the
basis of DNA fingerprinting that shows

(a) What is the result of experiment in each step
(A, B, C and D) ?
MOLECULAR BASIS OF INHERITANCE (b) Write the scientific name of the micro-
organism used in this experiment.
6. Observe the given figure. (2)
HSE-March 2024
1. The process of copying genetic information from

one strand of the DNA into RNA. (1)
2. The following diagram shows central dogma in
molecular biology. Write the name of process
represented as A and B. (2)
(a) Identify the experiment.

(b) Mention the significance of the experiment.
3. What are the six steps involved in DNA finger-
7. “DNA fingerprinting involves identifying
printing ? (3)
differences in some specific regions in DNA
HSE-June 2023 sequence.” (3)
(a) Who initially developed DNA fingerprinting
4. The diagrammatic representation of the Central technique ?
Dogma in molecular biology is given below. (b) What is VNTR ?
Identify ‘A’ and ‘B’. (1) (c) Write any two applications of DNA
fingerprinting
HSE-March 2023
8. Write the Central dogma in Molecular biology. (1)

9. Schematic representation of a transcription unit is
5. Different steps in Griffith’s Transformation
given : (2)
experiment is given below : (2)
(i) Fill up the missing parts A and B.

(ii) Write the role of template strand in
transcription.
10. Explain the transformation experiments
performed by Frederick Griffith with bacteria
Streptococcus Pneumoniae. (3)
NAVAS CHEEMADAN [email protected]

HSE- July 2022 (SAY/IMP.) 19. Observe the diagram of lac operon (2)
11. Mention the triplet codon acts as initiator codon

during translation. (1)
12. Describe the different stages or steps in the
process of transcription. (3)
13. Flow chart showing the various steps of DNA
finger-printing is provided :
a)Complete the flow chart (5)
a)Write the name of enzymes labeled as A,B and C

b)Which act as the inducer in Lac operon
20. Observe the diagram below
(b) Write any two applications of DNA finger-printing.
a) Identify the type of RNA Molecule

HSE-March 2022
b) Write the base sequence complementary to
14. Name the enzyme that joins the DNA fragments in the anticodon loop ? (2)
dis-continuous strand during replication. (1)
15. ‘Codon AUG is known as initiator codon. (a) Name
HSE-March 2021
the amino acid coded by AUG. (b) Write any two
21. Under microscope, chromatin is seen as ‘beads-
stop codons (2)
on-string’ like structure. Here, ‘beads’ represent
16. (a) Expand the term DNA. Who proposed double the structures called _____. (1)
helical model of DNA ? (b) List out the nitrogen
22. ‘In a cell, euchromatin and Heterochromatin can
bases in DNA.
be observed under microscope.’ Distinguish
(3)
between euchromatin and Heterochromatin. (2)
17. Schematic diagram of a transcription unit is given 23. In eukaryotes, gene expression can be regulated
below : (5)
at several levels. Write different levels at which
gene expression can be regulated. (2)
24. Figure of ‘lac operon’ in the absence of lactose
(inducer) is given below. Draw the diagram of ‘lac
operon’ in the presence of lactose and label it. (3)
(a) Identify the parts A and B.
(b) What is transcription ?
(c) Write the complementary DNA strand by observing
the strand given below : 5'-ATGCATGCAT-3'
HSE-August 2021
18. Fill in the Blanks (1)
YAC: Yeast artificial chromosome 25. The diagram represent DNA Replication process
BAC :…………………………………….

(a) Identify ‘P’.

(b) Draw the diagram in the presence of inducer.
(c) Write the enzymes produced by the structural
genes ‘z’, ‘y’ and ‘a’.
HSE-March-2020
a)Re draw the diagram, rectifying if any mistakes
b)Name the two enzymes involved in DNA 29. One of the salient features of genetic code is
Replication process (3) “Universal”. (2)
(a) Write any other two salient features of Genetic
HSE-July-2020 code
b) Which is the initiator codon ? And name the
26. (a) Complete the flow chart given below showing
amino acid it codes.
DNA finger-printing technique. (2)
30. Observe the figure given below : (3)
(b) Who developed the DNA finger-printing (a) Identify the process in the picture.
technique ? (b) Name any two enzymes needed for this
(c) Write the full form of VNTR. process.
27. Schematic structure of a transcription unit is given (c) Write the peculiarities of the newly
below : (2) synthesized daughter strands
31. A DNA sequence is provided below. 5' –
ATGCATGCATGCATGCATGCATGCAT – 3' (3)
(a) Write down the sequence of its
complementary strand.
(b) Name the enzyme involved in transcription of
(a) Identify a, b and c. DNA.
(b) The coding sequences/expressed sequences in (c) What would happen if both the strands of the
eukaryotes are known as ________. DNA act as templates for transcription
28. Lactose catabolism in the absence of inducer in E.
Coli is given below (3)

HSE-June-2019 correct. make necessary corrections
and redraw it (1)
32. In a double stranded DNA, the ratios
between Adenine and Thymine,
Guanine and Cytosine are constant and
equal one. Who observed this fact ? (1)
33. Observe the diagram of a double 37. Observe the figure given below :
stranded DNA strand : (2)
a) Identify the figure.

Identify the bonds A, B, C & D. b)How many histone molecules are
present in the Histone core ?
34. The following diagram shows a process c)Distinguish betweenEuchromatin and
in the Ribosome : (2) Heterochromatin.(2)
38. The diagrammatic representation of
the DNA fingerprint from a crime scene
and that of a suspected persons are
give below (3)
Identify the Process and explain
35. Transcription of eukaryotes is more

complicated than that of prokaryotes.
Explain any two additional
complexitiesfound in the transcription a)What is your conclusion about the
of eukaryotes. suspects based on DNA Fingerprint
(3) given ?
HSE March 2019 (b) What is VNTR ?
36. Diagrammatic representation of the (c) Who developed this technique first?
central dogma given below is not 39. The diagrammatic representation of a
process in bacteria is given below (3)

43. Expand the following (3)
a)SNP b)BAC c)YAC
HSE MARCH 2018
44. Expresses sequence in the gene is

called (1)
a)Introns b)Muton
c)Exons d)Cistron
45. DNA is tightly packed structure and is
found as units called nucleosomes
a) Identify the process. (a) Explain the concept of nucleosomes
b) Name the enzyme involved in this (b)Differentiate between euchromatin
process. and hetero chromatin (2)
c) Explain the three major steps in this 46. Identify the disadvantages of RNA over
process. DNA as a genetic material and explain

it ? (2)
HSE JUNE 2018 47. a) In Lac-operon lactose act as inducer
40. “Human genome project is a mega molecule. Evaluate the statement and
project” give two reason to explain explain it (3)
this? (2) b) Observe the diagram of Lac –Operon
41. Observe the diagram and answer the and Identify Labelled part A,B,C and
following (2)
HSE-Model-2018
48. Complete the flow chart of Southern

blot hybridization (2)
a)Identify the diagram ?

b)Name the enzymes A,B, and C
42. “Genetic code is universal in nature”
a)Substantiate this statement ?
b)mention any two other salient
features of genetic code (2)

c)Mention two uses of DNA fingerprinting. a) Name 'A' and ‘B' from the above
diagram.
49. Read the following statements and
b. Describe the following terms
answer the following questions
i) Capping ii)Tailing
1-A genetic material should be able to
generate its replica
HSE-JUNE-2017
2-A genetic material should not provide
52. Find the odd one and write the
scope for mutation
common feature of the other(1)
3- A genetic material should be able to
Cytidine,adenine,Thymine,guanine
express itself in the form of mendelian
53. Observe the diagram(2)
characters.
a. Choose the correct statements from
the above. b. Rewrite the wrong
statement to correct one (2)
50. Observe the given diagram and answer
the following questions. (2)
a)Redraw the diagram correctly if any

mistake is there ?
b)what does the diagram indicate?
b)What is the function of DNAL ligase in
this process ?
54. Read the codon sequence in the mRNA
unit which is undergone translation
(3)
a)Identify the above process.
b) Name the enzyme required to
polymerise the DNAstrand.
a)What will happend if the nitrogen
c) Name the enzyme required to join the
base ‘U’ in the 6th position is replaced
discontinuous strands
by ‘A’ by point mutation
d) In eukaryotes replication of DNA occurs
b)Name and define this type of
at ……………phase ofcell cycle.
mutation
51. c)draw the base sequence in the coding
DNA strand from which the above
mRNA is transcribed ?

HSE-March 2017 a)Find the start codon and stop
55. Which of the following combinations codon?
do not apply to DNA ?(1) b)How many amino acids will be
present in the protein translated
from this Mrna ?
c)The additional sequences that are
not translated in the mRNA is
called......
56. Examine the diagram of Mrna given 60. a) The hints of lac Operon is given
below . Mark the 5’ end 3’ end of Mrna below (HSE-June-2016) (3)

by giving reason(2)
57. A small fragment of a skin of different

person was extracted from nails of a
a)which substance is acting as
murdered person. This fragment of skin
inducer in this operon ?
led the crime investigators to the
b)explain the working of operon in
murder. Ased on this incident answer
the presence of inducer ?
the following questions (3)
OR
(1) What technique was used by the
61. b)With the help of the figure given,
investigators
explain the processing of hnRNAmRNA
(2) What is the procedure involved
in eukaryotes(3)
in this technique
Or
58. In an E.coli cultre lactose is used as
food instead of glucose. If So, answer
the following questions(3)
(1) How do the bacteria respond to
the above situation at genetic
level?
(2) If lactose is removed from the
medium what will happen?
HSE-June 2016
59. Observe the figure of mRNA and
answer the following question (3)

HSE-March 2016 a)which one of the suspected
62. Results of a famous experiment is given individual may involve in the crime ?
in the figure .Answer all (2) b)write any other use of DNA figure
a)Identify the experiment ? print ? (2)
b)which property of DNA is proved HSE-June -2015
by experiment ? 65. Observe the following diagram and
answer the question?(3)
a) Diagrammatically represent changes

takes place when lactose is added to
medium?
b) What is the role of z,y, and a gene in
63. Read carefully the sequence of codon
this metabolic pathway ?
in the mRNA unit and answer the
question (2)
question? (3)
a)what changes is needed in the

first codon to start the translation
process ?
b)if translation starts by that
change, till which codon it can be
continues ?
64. Schematic representation of DNA a)what is the difference in the
finger prints as shown below replication process ins strand A and
strand B ?
b)what is the role of DNA ligase in
the replication process in B strand ?
c)what is meant by replication fork ?
HSE-March-2015
67. Explain Transcription. A transcription
unit in a DNA is defined by 3

regions.Write the name of any 2 b)Briefly write the methodology
regions? (2) involved in the technique ?
68. a) The steps in DNA Finger printing are c)Comment on its other application?
given below. Complete the flow chart (3)
(A and B) 73. a)Define mutation ?
b)Mention the application of DNA b)What are the different types of
finger printing (3) mutation ? (2)
HSE-March-2014
74. “Prediction of the sequence of
aminoacids from the nucleotide
sequence in mRNA is very easy, but the
69. The flow of genetic information is
exact prediction of nucleotide
shown below. Name the process of A
sequence in mRNA from the sequence
and B (1)
of amino acids coded by mRNA is
difficult”
a)Which property of genetic code is the
reason for the above condition ?
HSE-June-2014
Explain
70. Diagrams of components of DNA are b)Which are the stop codons in DNA
given below: (1) transcription ? (3)
Identify and differentiate the two 75. Diagrammatic representation of
diagrams I and II ‘Central Dogma’ is given below :
Observe the diagram carefully and
redraw it making appropriate
corrections (1)
71. a)Identify the diagram and explain

question (2)
a)Identify the process shown in the
b)In some cases DNA is produced from figure and define it ?
RNA. Name this process and give b)Identify the structure ‘B’, write any
example ? (2) one function of it in the process shown
72. a)Paternity and maternity can be in the diagram ?
determined by certain scientific
methods. What is it? Define?

79. Draw the flow chart showing the steps
of southern blot hybridisation using
radiolabelled VNTR ?(3)
HSE-March 2013
80. The flow of genetic information is

shown below (2)
HSE-Sept-2013
77. Presence of lactose enhances the

production of beta galactosidase and a)Name the process a,b,c and d
other enzymes in bacteria . How will 81. Given below is the figure showing the
you explain this phenomenon ?(1)
functioning of lac operon in presence
78. A DNA sequence for coding a peptide is
of lactose. Redraw the figure and label
given below the parts numbered 1 to 6 (3)
82. RNA is not an ideal molecule as genetic

a)Write the complementary mRNA coding material because (1)
sequence for it ?
b)Find out the amino acids sequence of

peptide chain using the codon given in the
hints
c)if a mutation causes a change in the

sixth codon CTC to CAC. It leads to a
HSE-June-2012
mendelian disorder. Identify the disease
and write the specific characteristic of the 83. Following are the first two steps in
disease ?(4) Griffiths transformation experiment

c)what would happened if both strand of
DNA act as template for transcription ?
87. In E.coli Lactose catabolism is
a)If there is any mistake correct it
b)write the remaining steps ? (1.5) controlled by Lac Operon. Lac operon
in the absence of inducer (Lactose) is
84. DNA is the better genetic material than
given below. (3)
RNA, Do you agree with this
statement? Substantiate (1.5)
85. Given below is the diagrammatic
representation of first stage of a
process in a bacteria
a)What is ‘P’?
b)Name the enzyme produced by the
structural gene ‘Z’,’Y’, and ‘A’ ?
a)Identify the process c)Re draw the diagram in the presence of
b)Name the enzyme catalyses this process an Inducer
c)What are the additional complexities in
eukaryotes in this process ? (3)
HSE-March-2012
86. A transcription unit is given below.
Observe it and answer the question (3)
a)How can you identify the coding strand ? Click here/Scan to watch video lesson
b)Write the sequence of RNA formed from
this unit ?

Navas cheemadan SOHSS-Areekode
 The UV rays from the sun broke up
Chapter-5 water into Hydrogen and Oxygen and
the lighter H2 escaped.
EVOLUTION  Oxygen combined with ammonia and
methane to form water, CO2 and
Evolutionary biology : others.
 It is the study of history of life forms on  The ozone layer was formed. As it
earth. cooled, the water vapor fell as rain, to fill
all the depressions and form oceans.
 Stellar distances are measured in light years
 What we see today is an object whose
Origin of life
emitted light started its journey millions of  The origin of life is considered a unique
event in the history of universe Life
year back and from trillions of kilometres
appeared 500 million years after the
away and reaching our eyes now. formation of earth,
 The origin of life is considered a unique i.e., almost four billion years back.
event in the history of universe.  There are several theories to explain the
origin of life. Some of the theory are
Universe given below
 The universe is very old – almost 20
billion years old. 1.Theory of panspermia/ cosmozoic theory
 Huge clusters of galaxies comprise the Early Greek thinkers thought units of
universe. life called spores (Cosmozoa) were
 Galaxies contain stars and clouds of gas transferred to different planets including
and dust. Considering the size of universe, earth. ‘Panspermia’ is still a favourite idea for
earth is indeed a speck. some astronomers
 The Big Bang theory attempts to explain 2. Spontaneous generation of life/
to us the origin of universe. It talks of a /theory of abiogenesis
singular huge explosion unimaginable in For a long time it was also believed
physical terms. that life came out of decaying and rotting
 The universe expanded and hence, the matter like straw, mud, etc. This was the
temperature came down. Hydrogen and theory of spontaneous generation.
Helium formed sometime later. The gases Louis Pasteur by careful
condensed under gravitation and formed experimentation demonstrated that life
the galaxies of the present day universe. comes only from pre-existing life. He showed
that in pre-sterilised flasks (Swann necked
Earth flask ), life did not come from killed yeast
 In the solar system of the milky way while in another flask open to air, new living
galaxy, earth was supposed to have organisms arose from ‘killed yeast’.
been formed about 4.5 billion years Spontaneous generation theory was
back. dismissed once and for all. However, this did
 There was no atmosphere on early
not answer how the first life form came on
earth.
earth.
 Water vapour, methane ,
3. Theory of biogenesis
carbondioxide and ammonia
According to theory living organisms are
released from molten mass covered the formed from pre existing life.
surface.
Evolution/2024 [email protected]

Navas cheemadan SOHSS
SOHSS-Areekode
evidence, chemical evolution was more or
4. Theory of special creation less accepted
Religious literature tells us about the The first non-cellular
cellular forms of life could
theory of special creation. This theory has have originated 3 billion years back. It
three connotations. would have been giant molecules (RNA,
i) All living organisms (species
species or types) Protein, Polysaccharides,
s, etc.).
that we see today were created as
such.  The first cellular form of life did not
ii) The diversity was always the same since possibly originate till about 2000 million
creation and will be the same in future years ago.. These were probably single single-
iii) The earth is about 4000 years old cells. All life forms were in water
environment only. This version of a
5. Chemical evolution/Organic
Organic evolution biogenesis, i.e., the first form of life arose
 Oparin of Russia and Haldane of slowly
wly through evolutionary forces from
England proposed Chemical evolution. non-living
living molecules is accepted by
majority.
 According to this theory the first form
of life could have come from pre-
existing non-living
living organic molecules
(e.g. RNA, protein, etc.) and that
formation of life was preceded by
chemical evolution,
i.e., formation of diverse organic
molecules from inorganic
constituents.
 The conditions on primitive earth
were – high temperature, volcanic
storms, reducing atmosphere
containing CH4, NH3, etc.
Experimental proof of chemical

hemical evolution
 In 1953, S.L. Miller,an American scientist
created similar conditions in a laboratory
Evidences of evolution.
scale similar to that of primitive earth. Evidences Supporting evolution is given
 He created electric discharge in a closed below .
flask (Sparkle discharge apparatus) 1.Paleontological
Paleontological evidence
containing CH4, H2, NH3 (2:2:1)) and water 2.Comparative
Comparative anatomy and morphology
vapour at 8000C.He He observed formation of 3. Biochemical evidence
amino acids. 4. Embryological
ogical evidence
 In similar experiments others observed, 1. Paleontological evidence
formation of sugars, nitrogen bases, Study of fossils is called paleontology.
pigment and fats. Fossils are remains of hard parts of life
life-forms
 Analysis of meteorite content also found in rocks.. They represent extinct
revealed similar compounds indicating organisms (e.g., Dinosaurs).
that similar processes es are occurring  Different-aged
aged rock sediments contain
elsewhere in space. With this limited fossils of different life
erent life-forms who

probably died during the formation of the  Such organs are developed due to
particular sediment. divergent evolution. Homology indicates
 Some of them appear similar to modern common ancestry
organisms. They represent extinct Eg:1) whales, bats, Cheetah and human
organisms (e.g., Dinosaurs). (all mammals) share similarities in the
 A study of fossils in different sedimentary pattern of bones of forelimbs
layers indicates the geological period in Though these forelimbs perform
which they existed (epochs, periods and different functions in these animals, they
eras). have similar anatomical structure – all of
 The study showed that life-forms varied them have humerus, radius, ulna, carpals,
over time and certain life forms are metacarpals and phalanges in their forelimbs.
restricted to certain geological times Hence, in these animals, the same structure
pans. Hence, new forms of life have developed along different directions due to
arisen at different times in the history of adaptations to different needs. This is
earth divergent evolution and these structures are
 The age of the fossils are calculated by homologous
radioactive dating Eg;2)The thorn and tendrils of Bougainvillea
and Cucurbita represent homology
2. Embryological evidence Eg;3) Vertebrate hearts or brains
 It is proposed by Earnst Heckel.
 According to his observation certain
features are common to all vertebrates
during their embryological stage. It is
absent in their adult (Ontogeny repeats
phylogeny/ re capitulation theory)
 Eg: appearance of vestigial gill slit behind
the head during embryological
development in all vertebrates. But it is
functional only in fishes
 This observation was disproved by Von
Baer. He noted that embryos never pass
through the adult stage of other animal
3.Comparative anatomy and morphology
Comparative anatomy and morphology
shows similarities and differences among
b) Analogous organ
organisms of today and those that existed
 Organs having same function but different
years ago. Such similarities can be interpreted
structure and origin. This phenomenon is
to understand whether common ancestors
called Analogy.
were shared or not.
 Such organs are developed due to
a)Homologous organs
Convergent evolution.(Different
 Homologus organs are organs having
structures evolving for the same function
same structure and origin but different
and hence having similarity )
functions. This phenomenon is called
Eg;1)Wings of butterfly and of birds look
homology.
alike. They are not anatomically similar
 Homology indicates common ancestry.
structures though they perform similar
functions.

Eg;2) The eye of the octopus and of Charles Darwin
mammals
 Theory of special creation were strongly
Eg;3) The flippers of Penguins and Dolphins.
challenged during the nineteenth century.
Eg;4) Sweet potato (root modification) and
 Based on observations made during a sea
potato (stem modification)
voyage in a sail ship called H.M.S. Beagle
 So one can say that it is the similar
round the world, concluded that existing
habitat that has resulted in selection of
living forms share similarities to varying
similar adaptive features in different
degrees not only among themselves but
groups of organisms but toward the same
also with life forms that existed millions of
function. It results in the formation of
years ago. Many such life forms do not
analogous organs.
exist anymore.
3. Biochemical evidence
 There had been extinctions of different
Similarities in proteins and genes
life forms in the years gone by just as new
performing a given function among diverse
forms of life arose at different periods of
organisms give clues to common ancestry.
Horticulutre: The art or practice of garden
history of earth.
cultivation and management  There has been gradual evolution of life
forms. Any population has built in
Lamarck variation in characteristics. Those
characteristics which enable some to
 He was a French Naturalist. survive better in natural conditions
 Even before Darwin, he proposed that (climate, food, physical factors, etc.)
evolution of life forms had occurred but would outbreed others that are less-
driven by use and disuse of organs. endowed to survive under suh natural
conditions.
 Lamarckism consist of 4 main points
 Another word used is fitness of the
 New needs
 Use and disuse theory individual or population. The fitness,
 Inheritance of acquired character according to Darwin, refers ultimately and
 Origin of new species only to reproductive fitness. Hence, those
who are better fit in an environment,
 He gave the examples of Giraffes who in leave more progeny than others. These,
an attempt to forage leaves on tall trees therefore, will survive more and hence are
had to adapt by elongation of their necks. selected by nature.
As they passed on this acquired character  He called it natural selection and implied
of elongated neck to succeeding it as a mechanism of evolution.
generations, Giraffes, slowly, over the  The essence of Darwinian Theory about
years, came to acquire long necks. evolution is natural selection.
 Nobody believes this conjecture any more.  The main features of Darwinian’s theory
of natural selection is as follows
1. Over production
2. Variation
3. Survival of fittest/Natural selection
4. Origin of new species
 The work of Thomas Malthus (His book
name : Principles of populations) on
populations influenced Darwin

SOHSS-Areekode
 Alfred Wallace,, a naturalist who worked in
Malay Archipelago o had also come to similar
conclusions around the same time
Adaptive radiation/
Divergent evolution
 The process of evolution of different species
in a given geographical area starting from a
point and literally radiating to other areas of
geography (habitats)
tats) is called adaptive
radiation.
Eg:1) : Galapogos finches
 Darwin went to Galapagos Islands.
There he observed an amazing diversity Convergent evolution
of creatures. Of particular interest, small a
When more than one adaptive
black birds later called Darwin’s radiation appeared to have occurred in an
Finches amazed him. isolated geographical area (representing
 He realised that there were many different habitats), one can call this
varieties of finches in the same island. convergent evolution
All the varieties, he conjectured, evolved Eg: Placental mammals in Australia appears to
on the island itself. be ‘similar’ to a corresponding marsupial
 From the original seed-eating features, olf and Tasmanian wolf
e.g.,Placental wolf
many other forms with altered beaks
arose, enabling them to become
insectivorous and vegetarian finches.
nches.
Eg:2) Australian marsupials.

A number of marsupials, each different from
the other evolved from an ancestral stock,
but all within the Australian island continent.
Eg:3) Placental mammals in Australia

Industrial Melanism Evolution by anthropogenic action
 Interesting observation supporting  Evolution by anthropogenic action refers
evolution by natural selection comes to how human activities can influence the
from England. process of evolution in other species. This
is a relatively recent phenomenon
 In a collection of moths made in 1850s,
compared to the vast timescale of natural
i.e., before industrialisation set in, it was
evolution.
observed that there were more white-
Eg:1
winged moths on trees than dark-winged
The excess use of herbicides, pesticides,
or melanised moths.
etc., has only resulted in selection of
 However, in the collection carried out
resistant varieties in a much lesser time
from the same area, but after
scale.
industrialisation, i.e., in 1920, there were
Eg:2
more dark-winged moths in the same
 microbes against which we employ
area, i.e., the proportion was reversed.
antibiotics or drugs against eukaryotic
 The explanation put forth for this
organisms / cell. Hence, resistant
observation was that ‘predators will spot a
organisms /cells are appearing in a time
moth against a contrasting background’.
scale of months or years and not
During post industrialization period, the
centuries.
tree trunks became dark due to industrial
 This also tells us that evolution is not a
smoke and soots. Under this condition
directed process in the sense of
the white-winged moth did not survive
determinism. It is a stochastic process
due to predators, dark-winged or
based on chance events in nature and
melanised moth survived.
chance mutation in the organisms
 Before industrialisation set in, thick
growth of almost white-coloured lichen
 Branching descent and natural
covered the trees - in that background the
selection are the two key concepts of
white winged moth survived but the dark-
Darwinian Theory of Evolution
coloured moth were picked out by
predators. the lichens can be used as
industrial pollution indicatorsThey will
not grow in areas that are polluted.
Hence, moths that were able
tocamouflage themselves, i.e., hide in the
background, survived. This understanding
is supported by the fact that in areas
where industrialisation did not occur e.g.,
in rural areas, the count of melanic moths
was low.
 This showed that in a mixed population,
thosethat can better-adapt, survive and
increase in population size

Types of Natural selection
 Natural selection is a process in which
heritable variations enabling better
survival are enabled to reproduce and
leave greater number of progeny.
 A critical analysis makes us believe that
variation due to mutation or variation due
to recombination during gametogenesis,
or due to gene flow or genetic drift results
in changed frequency of genes and alleles
in future generation.
 Natural selection can lead to stabilization,
Directional or disruptive
a)Stabilsing selection/Normalizing selection
 Here more individuals acquire mean
character value. This occurs when the
environment does not change.
 Fossil evidence shows that , many species
remain unchanged for long period of
geological time. Hugo deVries
 One of the most stable environment on  Darwin either ignored or kept silence
earth is the deep sea. about the factors Mendel talked about.
Eg: Birth weight of human. The heaviest and  In the first decade of twentieth century,
lightest babies have the highest mortality Hugo DeVries based on his work on
evening primrose brought forth the idea
of mutations – large difference arising
suddenly in a population.
b)Directional selection  He believed that it is mutation which
Here more individuals acquire value causes evolution and not the minor
other than the mean character variations (heritable) that Darwin talked
Eg:Industrial melansim about.
 Mutations are random and directionless
c)Disruptive selection
while Darwinian variations are small and
Here more individuals acquire
directional.
peripheral character value at both ends of the
 Evolution for Darwin was gradual while
distribution curve
Devries believed mutation caused
Eg: adaptive radiation
speciation and hence called it saltation
(single step large mutation).
 Studies in population genetics, later,
brought out some clarity on this.

HARDY-WEINBERG Genetic drift
 Change in gene frequency occurs by
PRINCIPLE chance, it is called genetic drift.
 Proposed by G.H Hardy and Wilhelm
Weinerg.
 This principle says that
‘Allele frequencies in a population are
stable and is constant from generation to
generation’.
 The gene pool (total gene sand their
alleles in a population) remains a
constant. This is called genetic
equilibrium.
 Sum total of all the allelic frequencies is 1.
P+q=1
Disturbance in genetic equilibrium, or

Hardy- Weinberg equilibrium, i.e., change Qn. If the frequency of ‘A’ is 0.4 then find
of frequency of alleles in a population out the frequency of ‘B’ Allele and
would then be interpreted as resulting in heterozygous genotype in a random mating
evolution. population at equilibria
Ans:
Qn.A gene locus has two alleles A and a. If

the frequency of dominant allele A is 0.4,
then the frequency of homozygous
dominant, heterozygous and homozygous
Five factors are known to affect Hardy recessive individuals in the population is ?
Weinberg equilibrium. These are Ans:
i) Gene migration or gene flow,
ii) Genetic drift,
iii) Mutation,
iv) Genetic recombination and Qn. 360 out of 1000 individuals in a
v) Natural selection. population have a genotype of AA while 480
have Aa genotype. The rest 160 belong to aa.
Gene migration or gene flow, Frequency of allele A in this population is
 When migration of a section of population Ans:
to another place and population occurs,
gene frequencies change in the original as
well as in the new population.
 New genes/alleles are added to the new
population and these are lost from the old
population. There would be a gene flow if
this gene migration, happens multiple
times.

Qn. A sampled “a” population has 36% of
homozygous recessive genotype (aa). Then
the frequency of allele “a” is
Ans: A brief account of evolution
 About 2000 million years ago (mya) the
first cellular forms of life appeared on
earth
 The mechanism of how non-cellular
aggregates of giant macromolecules could
evolve into cells with membranous
envelop is not known
The Founder Effect  Some of these cells had the ability to
release O2.
 The founder effect is change in allele  The reaction periods could have been
frequency that occurs when a new similar to the light reaction in
population is established by a very small photosynthesis where water is split with
number of individuals from a larger the help of solar energy captured and
population. channelised by appropriate light
 Here the change in allele frequency is so harvesting pigments.
different in the new sample of population  Slowly single-celled organisms became
that they become a different species. The multi-cellular life forms.
original drifted population becomes  By the time of 500 mya, invertebrates
founders and the effect is called founder were formed and active.
effect.  Jawless fish probably evolved around 350
mya.
 Sea weeds and few plants existed
probably around 320 mya.
 The first organisms that invaded land
were plants. They were widespread on
land when animals invaded land.
 Fish with stout and strong fins could move
on land and go back to water. This was
about 350 mya. In 1938, a fish caught in
Hugo de
South Africa happened to be a Coelacanth
Darwinian Vries
theory on (Mutation which was thought to be extinct. These
Feature evolution Theory) animals called lobefins evolved into the
Mechanism Gradual change Sudden large first amphibians that lived on both land
of through natural mutations and water. These were ancestors of
Evolution selection (saltations) modern day frogs and salamanders.
Large,  The amphibians evolved into reptiles.
Small, heritable sudden
They lay thick shelled eggs which do not
Variations variations mutations
Gradual process Immediate dry up in sun unlike those of amphibians.
over many formation of  In the next 200 millions years or so,
Speciation generations new species reptiles of different shapes and sizes
dominated on earth. Giant ferns

(pteridophytes) were present but they all  Ramapithecuswas more man-like while
fell to form coal deposits slowly. Dryopithecuswas more ape-like.
 Some of these land reptiles went back into  Few fossils of man-like bones have been
water to evolve into fish like reptiles discovered in Ethiopia and Tanzania .
probably 200 mya (e.g. Ichthyosaurs). These revealed hominid features leading to
 The land reptiles were, of course, the the belief that about 3-4 mya, man-like
dinosaurs. The biggest of them, i.e., primates walked in eastern Africa. They
Tyrannosaurus rexwas about 20 feet in were probably not taller than 4 feet but
height and had huge fearsome dagger walked up right.
like teeth.  Two mya, Australopithecinesprobably
 About 65 mya, the dinosaurs suddenly lived in East African grasslands. Evidence
disappeared from the earth. We do not shows they hunted with stone weapons
know the true reason. Some say climatic but essentially ate fruit. Some of the
changes killed them. Some say most of bones among the bones discovered were
them evolved into birds.Small sized different. This creature was called the first
reptiles of that era still exist today. human-like being the hominid and was
 The first mammals were like shrews. Their called Homo habilis. The brain capacities
fossils are small sized. Mammals were were between 650-800cc. They probably
viviparous and protected their unborn did not eat meat.
young inside the mother’s body.  Fossils discovered in Java in 1891 revealed
Mammals were more intelligent in sensing the next stage, i.e., Homoerectusabout 1.5
and avoiding danger at least. mya.Homo erectus had a large brain
 When reptiles came down mammals took around 900cc.Homo erectus probably ate
over this earth. meat.
 There were in South America mammals  The Neanderthal man with a brain size of
resembling horse, hippopotamus, bear, 1400cc lived in near east and central Asia
rabbit, etc. Due to continental drift, when between 1,00,000- 40,000 years back. They
South America joined North America, used hides to protect their body and
these animals were overridden by North buried their dead.
American fauna. Due to the same  Homo sapiens arose in Africa and moved
continental drift pouched mammals of across continents and developed into
Australia survived because of lack of distinct races.
competition from any other mammal.  During ice age between 75,000-10,000
 Some mammals live wholly in water. years ago modern Homo sapiens arose.
Whales, dolphins, seals and sea cows are  Pre-historic cave art developed about
some examples. 18,000 years ago. Agriculture came around
 The most successful story is the evolution 10,000 years back and human settlements
of man with language skills and self- started.
consciousness.
ApeDrypithecusRamapithecus
ORIGIN AND EVOLUTION OF MAN AustralopithecusHomo habilisHomo
erectus Neanderthal manHomo sapiens
 About 15 mya, primates called
Dryopithecus and Ramapithecuswere
existing. They were hairy and walked like
gorillas and chimpanzees.

SOHSS-Areekode

(a) Identify the experiment.
EVOLUTION (b) Who conducted this experiment ?
(c)Write the importance of this
1. Differentiate between analogous organs
experiment in evolution.
and homologous organs and mention
5. Complete the flow-chart given below
one example each (HSE-March-2024)(2)
showing the evolution of man.
2. Complete the following flow chart
(HSE-JUNE-2023)(2)
which shows the origin and evolution of
man. (HSE-March-2024)(2)
3. The process of evolution of different

species in a given geographical area
starting from a point and literally
radiating to other areas of geography
(habitats) is called __________.
(HSE-JUNE-2023)(1)
4. Diagrammatic representation of an
experiment is given below :
(HSE-JUNE-2023)(2)
6. (A) Define Analogous organs.

(B) Identify analogous organs from the
given examples : (HSE-March 2023)(2)
(i) Eyes of octopus and mammals
(ii) Vertebrate hearts
(iii) Wings of butterfly and bird
(iv) Forelimbs of Cheetah and Human
Using the given terms in brackets,
complete the following evolutionary
stages of man : (HSE-March 2023)(2)
Previous Year Question/+2/2024 [email protected]

(Homo sapiens, Homo habilis, Homo 14. Identify the relationship and fill the
erectus, Australopithecines) blank (HSE August 2021)(1)
Dryopithecus  Ramapithecus ……A…- a)Homologus organs : Divergent
……….B…….. ………..C…--> Neanderthal man
evolution
…….D……..
7. Allele frequencies in a population ................................: Convergent
represented as p2 + 2pq + q2 = 1. Name evolution
15. The original seed eating finches in
the evolutionary principle.
Galapagos island evolved into many
(HSE- July 2022) (1) (SAY/IMP.)
other forms with altered beaks. Identify
8. Who proposed the ‘rivet popper
the evolutionary phenomenon and
hypothesis’ ?
define it (HSE August 2021)(2)
16. a) Define Hardy-Weinberg principle
9. Mention any two theories that explain
b)Mention any four factors that affect
origin of life.
Hardy-Weinberg equilibrium
10. Write any three factors that affect (HSE August 2021)(3)
17. Select an example for homologous
Hardy-Weinberg equilibrium.
organs. (HSE March 2021)(1)
11. Homologous organ : Divergent (a) Eyes of octopus and mammals
(b) Forelimbs of Whales and Bats
evolution :: Analogous organ : ________
(c) Flippers of Penguins and Dolphins
(HSE March 2022)(1)
(d) Wings of Birds and Butterflies
12. “Allele frequencies in a population are
stable and is constant from generation 18. Evolution of Darwin finches is an
example for ‘Adaptive radiation’.
to generation.” (HSE March 2022)(3)
(a) Name the principle. (a) What is meant by ‘Adaptive
(b) Mention any four factors those radiation’ ?
(b) Give two other example for
affect this principle
organisms those exhibit Adaptive
13. Choose the correct terms from the
radiation. (HSE March 2021)(2)
bracket to fill in the blanks and
19. (a) Identify the equation related with
complete the table :
genetic equilibrium given below :
(HSE March 2022)(2)
p2 + 2pq + q2 = 1
(Bigbang theory, Miller’s experiment,
(a) Write the factors affecting genetic
Lamarkism, Darwinism)
equilibrium resulting in evolution.
(HSE March 2021)(3)
20. Which among the following is an
example for homology ?(HSE JULY 2020)(1)
(a) The eye of the Octopus and of
Mammals

(b) Sweet potato and potato
(c) Thorns and tendrils of Bougainvillea
and Cucurbita
(d) Wings of butterfly and of birds
21. Define Hardy – Weinberg principle.
(b) List out any two factors affecting
Hardy – Weinberg Equilibrium.
(HSE JULY 2020)(2)
22. Diagrammatic representation of the
operation of natural selection on 25. p2 + 2pq + q2 = 1 denotes an
different traits isshown below :’ evolutionary principle.
(HSE JULY 2020)(2) (HSE March 2020)(2)
(a) Name the principle.
(b) Mention any three factors affecting
this.
26. Based on evolution in the geological
period arrange the plants and animals in
the correct order in various million
years ago. Choose the appropriate
organisms from the bracket.
[Reptiles, Plants, Sea-weeds, Jawless
fish, Fish with stout fin]
(i) Identify ‘a’, ‘b’ and ‘c’.

(ii) What is the evolutionary significance of ‘b’
?
23. Which of the following human ancestor

(HSE-June-2019)(2)
is more ‘ape’ like? (HSE March 2020)(1) 27. Make a flow chart using the following
(a) Homo habilis
terms : (HSE-June-2019)(2)
(b) Dryopithecus
(Natural selection, Struggle for
(c) Australopithecines
existence, Variation, Origin of species,
(d) Homo erectus
'Over production, Survival of the
24. Fill the blanks in Column A and B using
fittest]
appropriate terms. (HSE March 2020)(2)
28. Prepare a flow chart showing the
evolution of modern man in the

hierarchical order of their evolution b)enlist any three factors affecting this
using the details given below : principle (HSE-June 2018)(2)
Homo erectus, Homo habilis, Dryopithecus, 32. Prepare a flow chart of evolution of
Australopithecines, Homo sapiens, Rama pithecus,
man in descending order by choosing
Neanderthalnman (HSE-March-2019)(2)
the names given below
29. Some examples of evolutionary
(HSE-June 2018) (3)
structures are given below. Classify
them under suitable headings:
(a) Forelimb of Man, Cheetah, Whale,
Bat.
(b) Wings of Butterfly, Bird.
(c) Thorns and tendrils of Bougainvillea 33. Complete the boxes with the suitable
and cucurbita. words given below, :
(d) Vertebrate hearts or brains. [Analogus, Homologus. Convergent
(e) Eye of the Octopus and Mammals. evolution. Divergent evolution]
(f)Flippers of penguins and Dolphins. (HSE-March 2018)(2)
(HSE-March-2019)(2)
30. Above homologous organs provide
evidence of a particular type of
evolution. (HSE-June 2018) (2)
(a) identify the type of evolution. 34. Explain the factors affecting hardy-
(b) What do you mean by Weinberg equilibrium
Homologousorgans ? (HSE-March 2018)(2)
Diagrammatic representation of Miller
experiment is given below. Answer the
following questions(HSE-Model 2018)(2)
31. p2+2pq+q2=1 is the gene frequency of 1. Name A and B

the population showing an 2.From those given below chose the
evolutionary principle new molecules obtained by the other
a)Name the principle scientists from similar experiment.

(Amino acid, sugar, fat, Alkaloid, a) What do B and C represent
pigment , flavanoid ) b) Explain the process shown in B and C
35. A collection of moths made in England 39. Z value of a frugivorousspecies are
during 1850, supported evolution by given below . which value is not
natural selection' applicable to continents
Write anote onthe process ofnatural (HSE-March-2017)(1)
selectionon moths influenced by (1) 0.6 (2) 0.65 (3) 0.20 (4)0.68
industrialisation .(HSE-Model 2018)(2) 40. A population of 208 people of MN
36. Arrangethe following names in blood group was sampled and it was
ascending orderofevolution. found that 119 were MM group, 76MN
Homo sapiens, Ramapitrecus, blood group, 13NN group. Answer the
Australopithecines,Homohabilis, following questions
Neanderthal, Homo erectus (HSE-March-2017)(3)
(HSE-Model 2018)(3) a) Determine the gene frequencies of
37. Rearrange the following in the order of M and N alleles in the population
their evolution period b) How does the above frequency
(HSE-JUNE-2017)(1) affect evolution?
-Australopithecines Or
-Neanderthal man Examine the pictures of Darwin’s
-Homo sapiens finches given below and answer the
-Homo erectus following questions
-Dryopithecus a)What phenomenon in evolution is
38. Diagrammatic representation of the represented in the picture ?
operation of Natural selection on b)explain the phenomenon with the
different trait is given. Observe it and help of an additional example ?
answer the questions :
(HSE-JUNE-2017)(3)
41. Which of the following sets of gases

were used in Miller’s experiment?
(HSE-March-2017)(1)

42. Observe the diagram and answer the b)mention any two factors affecting
questions given below equilibrium ?
(HSE-June-2016) (1) c)what is the significance of
disturbance occur in genetic
equilibrium ?
47. Observe the diagrammatic
representation and answer the
question (HSE-June 2015)(4)
a)Identify the type of evolution in the
concept diagram A and B ?
b)write example pair each for
homologous and analogous organs ?
43. Statement below show features of
some human fossils. Read carefully and
identify the fossil (HSE-June 2016)(2)
a)Human like being with brain capacity
650-800cc
b)Lived in east and central asia with
a)Explain the phenomenon shown in
brain capacity 1400 cc
the figure ?
44. Which theory talks about huge
b)How can it consider as an evidence of
explosion that lead to origin of
evolution?
universe ? (HSE-March 2016)(1)
c)Write any other example for this
45. ‘Natural selction can lead to
phenomenon. Explain
stabilisation ,directional change and
48. Four groups of organs are given below:
disruptive change’
Read them carefully and answer the
Explain the term stabilization,
questions (HSE-June 2015)(4)
directional and disruptive change
mentioned above ?
(HSE-March 2016)(3)
46. Read the principle and answer the a)Categorize the four groups of organs
question:(HSE-March 2016)(3) as homologous and analogous organs ?
“Allele frequency in a population are b)Based on each group of organs
stable and constant from generation differentiate convergent evolution and
to generation called genetic divergent evolution ?
equilibrium” c)illustrate homologous and analogous
a)Name the principle mentioned here? organ as evidences of evolution ?

49. Match the following
(HSE-March-2015)(2)
50. The above shown pictures are beaks of 53. Given below is the diagrammatic
a particular type of bird seen in an representation of operation of natural
island during Darwin’s journey selection on different traits
(HSE-March 2015)(2) a)Identify the type of natural selection
a)identify the bird and name the A,B, and C with explanation of each.
island? b)Define Hardy-weinberg principle?
b)write the significance of this process (HSE-March 2014)(4)
in evolution ?
51. Arrange the following in a hierarchical
manner in ascending order based on
their period of evolution.
(HSE-June 2014)(1)
52. a)The diagram given below shows a

particular type of evolutionary process
in Australian marsupials. Identify the
54. A specific rat population was controlled
evolutionary phenomenon and
for about decade by a poison. After
comment on
population decline for about 10 years,
b)Give another example for such type
the rat population was increased and
of evolutionary process and explain
stabilized.
?(HSE-June 2014)(3)

Resistance to poison is governed by a c)what is the trend observed in the
dominant autosomal gene ‘R’. In 1975 evolution of amphibians?
majority of the resistant animals are 56. Arrange the following examples under
heterozygous at this locus (Rr) two heads viz-Homologous organ and
a)What was the major genotype of rat analogous organ(HSE-March 2013)(2)
population before 1961  Fore limb of whale and bat
A)RR B)Rr C)rr  Wings of butterfly and bat
D)R is absent as it produced by a  Heart of man and cheetah
mutation  Eye of octopus and mammal
b)What explanation you give for the
development of resistance against 57. Theory of chemical evolution is a
poison in these rats ? version of theory of abiogenesis.
c) “This illustration can be used to Analyze the statement.
explain theory of evolution” (HSE March -2013)(2)
Substantiate(HSE May-2013)(2) 58. Diagrammatic representation of the
55. The diagram shows how the number of operation of the natural selection in a
species in different group of population is given (june-2012)(1)
vertebrates has changed between 400
million years ago and 5 million years
ago. The wider a block indicate the
more species there are
(HSE-May 2013)(3)
Redraw the diagram when nature

select large sized and small sized
individuals
59. Complete the flow chart showing the
evolution of man using age, name and
brain capacities of fossils
(June-2012)(3)
a)Which is the species found most at

200 million years ago ?
b)Birds are most close relative to which
group of organism?

60. Note the relationship between the first a)Name this evolutionary process?
pair and complete second pair b)suggest another example for this
(March-2012)(1) phenomenon ?
a)Natural selection : Darwin
Inheritance of acquired character
:.......................
b)Heart of vertebrate : Homologous
organ
flipper of penguin and Dolphin
:..............
61. A collection of peppered moths made
in England during different period is
given below (March-2012)(1.5)
a)What is your observation ?

b)Name the evolutionary process
behind this process?
c)write the reason for decreased
number of white winged moth in 1920
?
62. An evolutionary process occurred in
the evolution of marsupial mammals in
Australia is given below ?
(March-2012)(1.5)

HUMAN HEALTH AND DISEASE

Good Humor Hypothesis How to achieve Good health
 Health, for a long time, was considered as a 1. Balanced diet,
state of body and mind where there was a 2. personal hygiene
balance of certain ‘humors’. This is what 3. Regular exercise
early Greeks like Hippocrates (Father of 4. Practice Yoga to achieve physical and mental
medicine ) as well as Indian Ayurveda health.
system of medicine asserted. 5. Awareness about diseases and their effect on
 It was thought that persons with ‘blackbile’ different bodily functions,
belonged to hot personality and would have 6. Vaccination (immunisation) against infectious
fevers. diseases.
 The discovery of blood circulation by William 7. Proper disposal of wastes.
Harvey using experimental method and the 8. Control of vectors .
demonstration of normal body temperature 9. Consumption of hygienic food and water
in persons with blackbile using thermometer resources .
disproved the ‘good humor’ hypothesis of
health
 In later years, biology stated that mind DISEASE
influences, through neural system and When the functioning of one or more
endocrine system, our immune system and organs or systems of the body is adversely
that our immune system maintains our affected, characterised by various signs and
health. Hence, mind and mental state can symptoms, we called it as disease.
affect our health.
 Health is affected by Diseases can be broadly grouped into
infectious and non-infectious.
(i) Genetic disorders – deficiencies with which a
child is born and deficiencies/defects which the 1-Infectious disease
child inherits from parents from birth; Diseases which are easily transmitted
(ii) infections from one person to another are called infectious
(iii) life style including food and water we take, diseases.
rest and exercise we give to our bodies, habits Eg : AIDS
that we have or lack etc. 2-Non infectious disease
Diseases which are not easily transmitted
HEALTH from one person to another
Eg : cancer ,Goitr,ulcer
Health is a state of complete physical, mental and
social well-being. Pathogens
Advantage of good health The disease causing organisms are called
1. Good Health increases longevity of pathogens.
people Eg: Bacteria, Virus,Protozoan, Helminthes, Fungus
2. It reduces infant and maternal mortality.  Pathogens as they cause harm to the host by
3. A Person with good health possesses a living in (or on) them. The pathogens can
good and pleasing personality enter our body by various means, multiply
4. Healthy people are more efficient to work and interfere with normal vital activities,
as compared to others. This increases the resulting in morphological and functional
productivity and economic prosperity damage
Human Health and disease/2024 [email protected]

Adaptations of pathogens b)Pneumonia
 Pathogens have to adapt to life within the
environment of the host.
 Pathogen :
 For example, the pathogens that enter the
Streptococcus pneumonia
gut must know a way of surviving in the Haemophilus influenza
stomach at low pH and resisting the various  Part of the body it infect:
digestive enzymes. Alveoli (air filled sacs) of the lungs. As a
result of the infection, the alveoli get filled
with fluid leading to severe problems in
COMMON DISEASES IN HUMANS respiration.
 Symptoms:
A)Bacterial disease  Fever,
It include  Chills,
 Typhoid fever,  Cough
 Pneumonia,  Headache.
 Dysentery,  In severe cases, the lips and finger
 Plague, nails may turn gray to bluish in
 Diphtheria, colour.
 Spread:
It can be spread by
a)Typhoid fever  Inhaling the droplets/aerosols
 Pathogen : released by an infected person
Salmonella typhi  By sharing glasses and utensils with an
 Part of the body it infect : infected person.
These pathogens generally enter the
small intestine through food and water
contaminated with them and migrate to other
B) Viral disease
organs through blood. It include
 Symptoms :  Common cold,
 Sustained high fever (39° to 40°C),  AIDS
 weakness,
 Stomach pain, a)Common cold
 Constipation,  Pathogen :
 Headache Rhino viruses (It represent group of viruses
 Loss of appetite. which cause common cold).
 Intestinal perforation and death may  Part of the body it infect :
occur in severe cases. Nose and respiratory passage but not
 Spread : the lungs.
Contaminated food and water
 Test :  Symptoms:
Typhoid fever could be confirmed by Widal  Nasal congestion and discharge,
test.  Sore throat,
 Hoarseness,
Mary Mallon :  Cough,
A classic case in medicine, that of Mary Mallon  Headache,
nicknamed Typhoid Mary, is worth mentioning  Tiredness, etc.,
here. She was a cook by profession and was a These symptoms usually last for 3-7 days.
typhoid carrier who continued to spread typhoid
for several years through the food she prepared

 Spread :  Spread :
 Droplets resulting from cough or Transmission of HIV-infection Generally
sneezes of an infected person are occurs by
either inhaled directly (a) Sexual contact with infected person,
 Transmitted through contaminated (b)By transfusion of contaminated blood
objects such as pens, books, cups, and blood products,
doorknobs, computer keyboard or (c) By sharing infected needles as in the case
mouse, etc., and cause infection in a of intravenous drug abusers
healthy person. (d)From infected mother to her child
through placenta.
b)Acquired Immuno Deficiency
Syndrome (AIDS) Following individual are at high risk of getting
Introduction HIV infections
 AIDS means, Deficiency of immune 1. Individuals who have multiple sexual
system, acquired during the lifetime of an partners,
individual indicating that it is not a 2. Drug addicts who take drugs
congenital disease. ‘Syndrome’ means a intravenously,
group of symptoms. 3. Individuals who require repeated blood
 AIDS was first reported in 1981 in USA transfusions and
and in the last twenty-five years or so, it 4. Children born to an HIV infected mother.
has spread all over the world killing more Test :
than 25 million persons. Enzyme linked immune sorbent assay (ELISA)
 Pathogen : Confirmatory test :
HIV (Human immuno deficiency virus ). A Western Blot
member of a group of viruses called
retrovirus, which have an envelope enclosing HIV/AIDS is not spread by mere touch or
the RNA genome physical contact; it spreads only through body
 Part of the body it infect : fluids. It is, hence, imperative, for the physical
Helper T lymphocyte/Immune system and psychological well-being, that the HIV/AIDS
 Symptoms : infected persons are not isolated from family
 Progressive decrease in the number of and society.
helper T lymphocytes.
 During this period, the person suffers
from bouts of fever, diarrhoea and Life cycle of HIV
weight loss..  HIV is a retro virus (RNA virus)
 Due to decrease in the number of helper  After getting into the body of the person the
T lymphocytes, the person starts virus enters into macrophages
suffering from infections that could have  Where RNA genome of the virus replicates to
been otherwise overcome such as those form viral DNA with the help of the enzyme
due to bacteria especially reverse transcriptase (RNA dependent dna
Mycobacterium, viruses, fungi and even polymerase)
parasites like Toxoplasma.  This viral DNA gets incorporated into host
 The patient becomes so immuno- cell’s DNA and directs the infected cells to
deficient that he/she is unable to protect produce virus particles
himself/herself against these infections.  The macrophages continue to produce virus
 There is always a time-lag between the and in this way acts like a HIV factory.
infection and appearance of AIDS symptoms.  Simultaneously, HIV enters into helper T-
This period may vary from a few months to lymphocytes (TH), replicates and produce
many years (usually 5-10 years). progeny viruses.

SOHSS-Areekode
 The progeny viruses released in the blood  In our country the National AIDS Control
attack other helper T-lymphocytes.
lymphocytes. This is Organisation (NACO
(NACO) and other non-
repeated leading to a progressive decrease in governmental organisation (NGOs) are
the number of helper T lymphocytes
hocytes in the doing a lot to educate people about AIDS.
body of the infected person. WHO has started a number of
 During this period, the person suffers from programmes to prevent the spreading of
bouts of fever, diarrhoea and weight loss
loss. HIV infection.
1. Making blood (from blood banks) safe

from HIV,
2. Ensuring
nsuring the use of only disposable
needles and syringes in public and
private hospitals and clinics,
3. Free
ree distribution of condoms, controlling
drug abuse,
4. Advocating
vocating safe sex and promoting
regular check-ups
ups for HIV in susceptible
populations, are some such steps taken
up. but cannot prevent death, which is
inevitable.
C)Protozoan
rotozoan disease
It include Malaria and Amoebiasis
A
a)Malaria
 Pathogen :
 Plasmodium (aa tiny protozoan
protozoan)
 Different species of Plasmodium ((P. vivax,
P. malaria and P. falciparum)
fa are
responsible for different types of malaria.
 Of these, malignant malaria caused by
Plasmodium falciparum is the most
Treatment of AIDS : serious one and can even be fatal.
Treatment of AIDS with anti-retroviral
retroviral drugs  Part of the body it infect :
is only partially effective. They can only prolong Liver, RBC
the life of the patient but cannot prevent death,  Symptoms :
which is inevitable.  The rupture of RBCs is associated
asso with
Prevention of AIDS : release of a toxic substance,
As AIDS has no cure, prevention is the haemozoin, which is responsible for
best option. Moreover, HIV infection, more often, the chill and high fever recurring every
spreads due to conscious behavior patterns and is three to four days
not something that happens inadvertently, llike  Spread :
pneumonia or typhoid. Of course, infection in Female
emale Anopheles mosquitoes
blood transfusion patients, new-borns borns (from transmitting agent
mother) etc., may take place due to poor
monitoring. The only excuse may be ignorance
and it has been rightly said – “don’t die of
ignorance”.

Life cycle of Plasmodium b)Amoebiasis
1 Plasmodium enters the human body as
sporozoites (infectious form) through the (Amoebic dysentery).
bite of infected female Anopheles  Pathogen :
mosquito. Entamoeba histolytica
2 The parasites initially multiply within the  Part of the body it:
liver cells and then attack the red blood Large intestine of human
cells (RBCs) resulting in their rupture.  Symptoms :
3 The rupture of RBCs is associated with  Constipation,
release of a toxic substance, haemozoin,  Abdominal pain
which is responsible for the chill and high  Cramps
fever recurring every three to four days.  Stools with excess mucous and blood
4 When a female Anopheles mosquito bites clots.
an infected person, these parasites enter  Spread :
the mosquito’s body and undergo further Houseflies act as mechanical carriers and
development. The parasites multiply serve to transmit the parasite from faeces of
within them to form sporozoites that are infected person to food and food products,
stored in their salivary glands. thereby contaminating them. Drinking water
5 When these mosquitoes bite a human, and food contaminated by the faecal matter
the sporozoites are introduced into his/ are the main source of infection
her body, thereby initiating the events
mentioned above.
 It is interesting to note that the malarial
D) Helminth disease
It include
parasite requires two hosts –
 Human  Ascariasis
 Mosquitoes –  Filariasis
to complete its life cycle the female
Anopheles mosquito is the vector a)Ascariasis
(transmitting agent) too.  Pathogen :
 Malaria day=20th august Ascaris, ( round worm)
 Part of the body it infect :
Intestine
 Symptoms :
 Internal bleeding,
 Muscular pain,
 Fever,
 Anemia
 Blockage of the intestinal passage.
 Spread :
The eggs of the parasite are excreted along
with the faeces of infected persons which
contaminate soil, water, plants, etc. A healthy
person acquires this infection through
contaminated water, vegetables, fruits, etc

b)Fliariasis/Elephantiasis  These lesions are accompanied by
intense itching.
 Pathogen :
 Heat and moisture help these fungi to
Wuchereria (W. bancrofti and W. malayi),
grow, which make them thrive in skin
 Part of the body it infect ;
folds such as those in the groin or
The lymphatic vessels of the lower limbs .
between the toes.
The genital organs are also often affected
 Spread :
 Symptoms :
Ringworms are generally acquired from
The filarial worms cause a slowly developing
 Soil
chronic inflammation of the organs in which
 By using towels,
they live for many years, usually the
 Clothes
lymphatic vessels of the lower limbs and the
 Comb of infected individuals.
disease is called elephantiasis or filariasis The
genital organs are also often affected,
resulting in gross deformities. PREVENTION AND CONTROL OF
 Spread: INFECTIOUS DISEASES
The pathogens are transmitted to a healthy Maintenance of personal and public
person through the bite by the female hygiene is very important for prevention and
mosquito vectors (Culex) control of many infectious diseases
Personal hygiene
Measures for personal hygiene include
 Keeping the body clean;
 Consumption of clean drinking water,
food, vegetables, fruits, etc.
Public hygiene
Public hygiene includes
 Proper disposal of waste and excreta;
 Periodic cleaning and disinfection of water
reservoirs, pools, cesspools and tanks and
observing standard practices of hygiene in
public catering.
These measures are particularly essential where
the infectious agents are transmitted through
food and water such as typhoid, amoebiasis and
E) Fungal disease ascariasis
.
For air Borne disease
Ring worms In cases of air-borne diseases such as
 Pathogen : pneumonia and common cold, in addition to the
Many fungi belonging to the genera above measures, close contact with the infected
Microsporum, Trichophyton and persons or their belongings should be avoided
Epidermophyton
For vector borne disease
Part of the body it infect : For diseases such as malaria and filariasis
Skin, nails and scalp that are transmitted through insect vectors, the
 Symptoms : most important measure is to control or
 Appearance of dry, scaly lesions on eliminate the vectors and their breeding places.
various parts of the body such as skin, This can be achieved By
nails and scalp are the main symptoms
of the disease.

 Avoiding stagnation of water in and around  just continue to divide giving rise to masses of
residential areas, cells called tumors.
 regular cleaning of household coolers, use  Tumors are of two types:
of mosquito nets, a)Benign tumors
 introducing fishes like Gambusia in ponds b)Malignant tumors,
that feed on mosquito larvae,
 spraying of insecticides in ditches, drainage
areas and swamps, etc. a)Benign tumors
 Doors and windows should be provided It normally remain confined to their
with wire mesh to prevent the entry of original location and do not spread to other
mosquitoes. Such precautions have become parts of the body and cause little damage.
all the more important especially in the light b)Malignant tumors,
of recent widespread incidences of the This is a mass of proliferating cells called
vector-borne (Aedes mosquitoes-dengue neoplastic or tumor cells. These cells grow
fever and chikungunya) diseases like very rapidly, invading and damaging the
dengue and chikungunya in many parts of surrounding normal tissues. As these cells
India. actively divide and grow they also starve the
normal cells by competing for vital nutrients.
Immunization Cells sloughed from such tumors reach
 The use of vaccines and immunisation distant sites through blood, and wherever
programmes has enabled us to completely they get lodged in the body, they start a new
eradicate a deadly disease like smallpox. tumor there. This property called metastasis
 A large number of other infectious is the most feared property of malignant
diseases like polio, diphtheria, pneumonia tumors.
and tetanus have been controlled to a
large extent by the use of vaccines. Causes of cancer :
 Biotechnology is at the verge of making Transformation of normal cells into
available newer and safer vaccines. cancerous neoplastic cells may be induced by
 Discovery of antibiotics and various other physical, chemical or biological agents. These
drugs has also enabled us to effectively agents are called carcinogens.
treat infectious diseases
I. Physical Factor
Ionising radiations ( X-rays and gamma
CANCER rays), non-ionizing radiations (UV ) cause
DNA damage leading to neoplastic
 Cancer is one of the most dreaded diseases of
transformation.
human beings and is a major cause of death
II. Chemical Factor
all over the globe.
The chemical carcinogens present in
 More than a million Indians suffer from
tobacco smoke have been identified as a
cancer and a large number of them die from it
major cause of lung cancer.
annually
III. Biological agents
 In our body, cell growth and differentiation is
 Cancer causing viruses called oncogenic
highly controlled and regulated. In cancer
viruses have genes called viral oncogenes.
cells, there is breakdown of these regulatory
 Furthermore, several genes called cellular
mechanisms.
oncogenes (c-onc) or proto oncogenes
 Normal cells show a property called contact
have been identified in normal cells which
inhibition by virtue of which contact with
when activated under certain conditions,
other cells inhibits their uncontrolled growth.
could lead to oncogenic transformation
Cancer cells appears to have lost this
of the cells.
property. As a result of this, cancerous cells

Cancer detection and diagnosis : for particular tumors. Majority of drugs have
 Early detection of cancers is essential as it side effects like hair loss, anemia, etc.
allows the disease to be treated successfully  Most cancers are treated by combination of
in many cases. surgery, radiotherapy and chemotherapy.
a) Biopsy and Histopathology  Tumor cells have been shown to avoid
Cancer detection is based on biopsy and detection and destruction by immune system.
histopathological studies of the tissue and Therefore, the patients are given substances
blood and bone marrow tests for increased called biological response modifiers such as
cell counts in the case of leukemias (blood α-interferon which activates their immune
cancer) system and helps in destroying the tumor.
In biopsy, a piece of the suspected tissue cut
into thin sections is stained and examined
under microscope (histopathological studies)
by a pathologist.
b) Computed tomography (CT)
Computed tomography uses X-rays to
generate a three-dimensional image of the
internals of an object.
c) Magnetic resonance imaging (MRI)
MRI uses strong magnetic fields and non
ionising radiations to accurately detect
pathological and physiological changes in the
living tissue.
d) Antibodies
Antibodies against cancer-specific antigens
are also used for detection of certain cancers.
e) Molecular Biology Techniques
Techniques of molecular biology can be
applied to detect genes in individuals with
inherited susceptibility to certain cancers.
Identification of such genes, which predispose
an individual to certain cancers, may be very
helpful in prevention of cancers. Such
individuals may be advised to avoid exposure
to particular carcinogens to which they are
susceptible (e.g., tobacco smoke in case of
lung cancer).
Treatment of cancer :
 The common approaches for treatment of
cancer are surgery, radiation therapy and
immunotherapy.
 In radiotherapy, tumor cells are irradiated
lethally, taking proper care of the normal
tissues surrounding the tumor mass.
 Several chemotherapeutic drugs are used to
kill cancerous cells. Some of these are specific

IMMUNOLOGY ii) Acquired immunity/adaptive
 The overall ability of the host to fight the immunity/specific immunity
disease-causing organisms, conferred by the  It is pathogen specific.
immune system is called immunity. Immunity  It is characterised by memory. This means
is of two types: that our body when it encounters a pathogen
for the first time produces a response called
(i) Innate immunity and primary response which is of low intensity.
(ii) Acquired immunity. Subsequent encounter with the same
pathogen elicits a highly intensified
i) Innate immunity/Inborn immunity secondary or Anamnestic response. This is
/Non specific immunity ascribed to the fact that our body appears to
 This type of immunity is present at the time have memory of the first encounter.
of birth.
 This is accomplished by providing different B-lymphocytes and T lymphocytes
types of barriers to the entry of the foreign The primary and secondary immune
agents into our body. Innate immunity consist responses are carried out with the help of
of four types of barriers. These are two special types of lymphocytes present in
our blood,
(a) Physical barriers : i.e., B-lymphocytes and T lymphocytes
 Skin on our body is the main barrier which
prevents entry of the micro-organisms. B-Lymphocytes
 Mucus coating of the epithelium lining  Certain cells of bone marrow produce
the respiratory, gastrointestinal and lymphocytes (Haematopoiesis). These cells
urogenital tracts also help in trapping mature in the bone marrow called B
microbes entering our body. lymphocytes.
 The B-lymphocytes produce an army of
(b) Physiological barriers : proteins called in response to pathogens into
 Acid in the stomach, our blood to fight with them. These proteins
 Saliva in the mouth, are called antibodies.
 Tears from eyes–all prevent microbial  Immune response by the B-cells by
growth. production of antibody is called Antibody
 Saliva and tear contain antibacterial agent mediated immune response (AMI) or
called Lysozyme humoral immune response
(c) Cellular barriers : T-Lymphocytes

 Certain types of leukocytes (WBC) of our  Some stem cells in the Bone marrow give rise
body like to immature lymphocytes.
 Polymorpho-nuclear leukocytes  These Immature lymphocytes migrate via the
(PMNL-neutrophils) blood to the thymus, where they mature as T
 Monocytes cells. In the thymus, these cells mature as T
 Natural killer (type of lymphocytes) lymphocytes. The T-cells themselves do not
in the blood as well as macrophages in tissues secrete antibodies but help B cells produce
can phagocytose and destroy microbes. them.
 Immune response by T-cells which detects
(d) Cytokine barriers : and destroys the foreign cells and also
 Virus-infected cells secrete proteins called cancerous cells called cell mediated immune
interferons which protect non-infected response.(CMI)
cells from further viral infection.  Rejection of organs in transplantation is due
to T-lymphocytes.

SOHSS-Areekode
 Tissue matching, blood group matching
atching arare
essential for organ transplantation. Vaccines
 Immune-suppressants is required before and  1st vaccination was carried out by British
after transplantation Physician Edward Jenner to protect people
 The body is able to differentiate
ate ‘self ’ and from small pox
‘nonself’ and the cell-mediated
mediated immune  The principle of immunisation or vaccination
vac
response is responsible for the graft rejection is based on the property of ‘memory’
‘ of the
immune system.
Structure of Antibody  In vaccination, a preparation of antigenic
 Each antibody molecule has four peptide proteins of pathogen or
chains, two small called light chains and two inactivated/weakened pathogen (vaccine)
longer called heavy chains. are introduced into the body. The antibodies
 Hence, an antibody is represented as H2L2. produced in the body against these antigens
 Different types of antibodies are produced in would neutralise the pathogenic agents
our body. IgA, IgM, IgE, IgG are some of them during actual infection.
 The vaccines also generate memory – B and
T-cells
cells that recognize the pathogen quickly
on subsequent exposure and overwhelm the
invaders with a massive production of
antibodies.
 So thee principle of immunisation or
vaccination is based on the property of
‘memory’ of the immune system
 Examples for vaccines
Live BCG vaccine Tuberculosis
Killed TAB vaccine Enteric fever
MMR Rubella,mumps,measles
Salk vaccine Poliomyelitis
DPT Diphtheri Pertusis and
Diphtheria,
tetany
 Recombinant DNA technology has allowed

the production of antigenic polypeptides of
pathogen in bacteria or yeast. Vaccines
produced using this approach allow large
Active and Passive Immunity scale production and hence greater
Active immunity: availability for immunisation,
 When a host is exposed to antigens,
antigens which e.g., Hepatitis B vaccine produced from yeast
may be in the form of living or dead ad microbes
or other proteins, antibodies are produced in Passive immunity
the host body. This type of immunity is called  When ready-made made antibodies are directly
active immunity. given to protect the body against foreign
 Active immunity is slow and takes time to agents, it is called passive immunity.
give its full effective response.  Eg:The yellowish fluid colostrum secreted by
 Injecting the microbes deliberately during mother during the initial dadays of lactation has
immunisation orr infectious organisms gaining abundant antibodies (IgA) to protect the
access into body during natural infection infant
induce active immunity.  Eg: The foetuss also receives some antibodies
Eg: Vaccines (IgG) from their mother, through t the
placenta during pregnancy.

 If a person is infected with some deadly Difference between active immunity and
microbes to which quick immune response is passive immunity
required as in tetanus, we need to directly
Active Immunity Passive immunity
inject the preformed antibodies, or antitoxin
When a host is When ready-made
(a preparation containing antibodies to the
exposed to antigens, antibodies are directly
toxin).
which may be in the given to protect the
 Eg:in cases of snakebites, the injection which
form of living or dead body against foreign
is given to the patients, contain preformed
microbes or other agents, it is called
antibodies (Anti venom ) against the snake
proteins, antibodies passive immunity
venom
are produced in the
Passive
host body. This type of
Active Immunity Immunity immunity is called
Antibodies are active immunity
It takes time to It is used when
Mechanism
Body produces its own introduced into

antibodies in response the body from develop immunity immune response has
to an antigen (foreign an external to be faster
substance) source Memory cells are No memory cells
Requires exposure to a formed formed
weakened or inactive Does not Allergies/Hypersensitivity
Exposure
form of the pathogen require

Antigen
 The exaggerated response of the immune

(vaccine) or the actual exposure to the system to certain antigens present in the
pathogen itself antigen environment is called allergy.
Takes time for the Provides  The substances to which such an immune
Immunity
Develop
body to develop an immediate

ment of
response is produced are called allergens.

immune response protection  Examples of allergens are
(days to weeks) (hours to days)  Mites in dust,
Can be long-lasting  Pollens,
Duration of
(years or even  Animal dander

Immunity
lifetime) depending on Short-lived  Certain drugs

the vaccine or (weeks to  Certain food, etc.
exposure months)  The antibodies produced to these are of IgE
Injection of type.
antibodies Symptoms
(immunoglobuli It include
Examples
n), breast milk  Sneezing

Vaccination, natural from mother to  Watery eyes,
infection (usually) infant  Running nose
Develops  difficulty in breathing.
immunological  Allergy is due to the release of chemicals like
memory, allowing for No histamine and serotonin from the mast cells.
Memory
a faster and stronger immunological  For determining the cause of allergy, the
response upon future memory is patient is exposed to or injected with very
exposure developed small doses of possible allergens, and the
reactions studied.
 The use of drugs like anti-histamine,
adrenalin and steroids quickly reduce the
symptoms of allergy.
 Modern-day life style has resulted in
lowering of immunity and more sensitivity to

allergens – more and more children in metro small size. Hence thymus gland is called
cities of India suffer from allergies and juvenile gland.
asthma due to sensitivity to the
environment. This could be because of the Both bone-marrow and thymus provide micro-
protected environment provided early in life. environments for the development and
maturation of T-lymphocytes
Auto Immunity
 Memory-based acquired immunity evolved in Secondary lymphoid organ
higher vertebrates based on the ability to  After maturation the lymphocytes migrate to
differentiate foreign organisms (e.g., secondary lymphoid organs like spleen, lymph
pathogens) from self cells. nodes, tonsils, Peyer’s patches of small
 Due to genetic and other unknown reasons, intestine and appendix.
the body attacks self-cells. This results in  The secondary lymphoid organs provide the
damage to the body and is called auto- sites for interaction of lymphocytes with the
immune disease. antigen, which then proliferate to become
Eg: Rheumatoid arthritis effector cells.
Mysthenia gravis The spleen:
 it is a large bean shaped organ.
 It mainly contains lymphocytes and
Immune System in the Body
phagocytes.
The human immune system consists of
 It acts as a filter of the blood by trapping
 Lymphoid organs,
blood-borne microorganisms.
 Tissues,
 Spleen also has a large reservoir of
 Cells
erythrocytes.
 Soluble molecules like
antibodies. The lymph nodes:
Immune system is unique in the sense that it  They are small solid structures located at
recognises foreign antigens, responds to these different points along the lymphatic system.
and remembers them, The immune system also  Lymph nodes serve to trap the micro-
plays an important role in allergic reactions, auto- organisms or other antigens, which happen to
immune diseases and organ transplantation. get into the lymph and tissue fluid.
Lymphoid organs:  Antigens trapped in the lymph nodes are
These are the organs where origin and/or responsible for the activation of lymphocytes
maturation and proliferation of lymphocytes present there and cause the immune
occur. response.
The primary lymphoid organs
Mucosal associated Lymphoid Tissue (MALT)
/central lymphoid organ
Lymphoid tissue located within the lining of the
 It include Bone marrow and Thymus
major tracts (respiratory, digestive and urogenital
 Here immature lymphocytes differentiate into tracts) called mucosa associated lymphoid tissue
antigen-sensitive lymphocytes. (MALT). It constitutes about 50 per cent of the
The bone marrow: lymphoid tissue in human body.
it is the main lymphoid organ where all
blood cells including lymphocytes are produced.
The thymus:
 It is a lobed organ located near the heart and
beneath the breastbone.
 The thymus is quite large at the time of birth
but keeps reducing in size with age and by the
time puberty is attained it reduces to a very


SOHSS-Areekode
DRUGS 3. Coca alkaloid or cocaine

 Any substance,
tance, other than food, used in the  It is obtained from coca plant Erythroxylum
prevention , diagnosis, or treatment of a coca,, native to South America.
disease is called drug  It interferes with the transport of the neuro-
neuro
 The drugs, which are commonly abused are transmitter dopamine.
opioids, cannabinoids and coca alkaloids.  Cocaine,, commonly called cokec or crack is
Majority of these are obtained from usually snorted.
flowering plants.. Some are obtained from  It has a potent stimulating action on central
fungi. nervous system, producing a sense of
1.Opioids, euphoria and increased energy.
 Opioids are the drugs, which bind to specific  Excessive dosage of cocaine causes
opioid receptors present in our central hallucinations.
nervous system and gastrointestinal tract.  Other well-known
known plants with hallucinogenic
Examples properties are Atropa belladona and Datura
 a)Heroin commonly called smack is These days cannabinoids are also being
chemically diacetylmorphine which is a abused by some sports persons
white, odourless, bitter
ter crystalline compound.
 This is obtained by acetylation of morphine
which is extracted from the latex of poppy
plant Papaver somniferum .
 Generally taken by snorting and injection,
heroin is a depressant and slows down body
functions.
 b)Morphine is a veryy effective sedative and
painkiller, and is very useful in patients who
have undergone surgery
4. Drugs used as medicines

Drugs like
 Barbiturates(Sleeping
(Sleeping pills),
 Amphetamines (Anti sleep drugs),
drugs)
 Benzodiazepines(Anti-anxiety
anxiety drugs)
drugs), and
2.Cannabinoids other similar
ilar drugs, that are normally used as
 They are a group of chemicals which interact medicines to help patients cope with mental
with cannabinoid receptors present illnesses like depression and insomnia
insomnia, are
principally in the brain. often abused.
 Natural cannabinoids are obtained frfrom the  Several plants, fruits and seeds having
inflorescences of the plant Cannabis sativa hallucinogenic properties have been used for
 The flower tops, leaves and the resin of hundreds of years in folk-medicine,
folk religious
cannabis plant are used in various ceremonies and rituals all over the globe.
combinations to produce marijuana,  When these are taken for a purpose other
hashish, charas and ganja. than medicinal use or in amounts/frequency
 Generally taken by inhalation and oral that impairs one’s physical, physiological or
ingestion, these are known for their effects psychological functions, it constitutes drug
on cardiovascular system of the body abuse.
 LSD is obtained d from fungus

SMOKING  Experimentation,
 Tobacco has been used by human beings for  To Escape for stress
more than 400 years. It is smoked, chewed or  Peer pressure
used as a snuff.  Unsupportive family structure
 Tobacco contains a large number of chemical
substances including nicotine, an alkaloid. Addiction and Dependence
Harmful effects of smokong  Addiction is a psychological attachment to
 Nicotine stimulates adrenal gland to certain effects such as euphoria and a
release adrenaline and nor-adrenaline temporary feeling of well-being –associated
into blood circulation, both of which raise with drugs and alcohol.
blood pressure and increase heart rate.  These drive people to take them even when
 Smoking is associated with increased these are not needed, or even when their use
incidence of cancers of lung, urinary becomes self-destructive.
bladder and throat, bronchitis,  With repeated use of drugs, the tolerance
emphysema, coronary heart disease, level of the receptors present in our body
gastric ulcer, etc. increases. Consequently the receptors
 Tobacco chewing is associated with respond only to higher doses of drugs or
increased risk of cancer of the oral cavity. alcohol leading to greater intake and
 Smoking increases carbon monoxide (CO) addiction. However, it should be clearly borne
content in blood and reduces the in mind that use of these drugs even once,
concentration of haem bound oxygen. can be a fore-runner to addiction.
This causes oxygen deficiency in the  Thus, the addictive potential of drugs and
body. alcohol, pull the user into a vicious circle
leading to their regular use (abuse) from
Adolescence which he/she may not be able to get out. In
 Adolescence means both ‘a period’ and ‘a the absence of any guidance or counselling,
process’ during which a child becomes the person gets addicted and becomes
mature in terms of his/her attitudes and dependent on their use.
beliefs for effective participation in society.  Dependence is the tendency of the body to
 The period between 12-18 years of age may manifest a characteristic and unpleasant
be thought of as adolescence period. withdrawal syndrome if regular dose of
 In other words, adolescence is a bridge drugs/alcohol is abruptly discontinued. This
linking childhood and adulthood. is characterised by anxiety, shakiness,
nausea and sweating, which may be relieved
Characterstics of adolescence when use is resumed again.
Adolescence is accompanied by several  In some cases, withdrawal symptoms can be
biological and behavioural changes. severe and even life threatening and the
Adolescence, thus is a very vulnerable phase person may need medical supervision.
of mental and psychological development of  Dependence leads the patient to ignore all
an individual. social norms in order to get sufficient funds to
satiate his/her needs. These result in many
social adjustment problems.
Alcoholism
 Continous heavy consumption of Alcoholic
Effects of Drug/Alcohol
products is called alcoholism.
 Reckless behaviour,
 Vandalism
Causes of Alcohol or Drug Abuse
 Violence.
 Curiosity,
 Excessive doses of drugs may lead to
 Need for adventure
coma and death due to respiratory
 Excitement

failure, heart failure or cerebral certain hormones in sports to increase muscle
hemorrhage. strength and bulk and to promote
 A combination of drugs or their intake aggressiveness and as a result increase
along with alcohol generally results in athletic performance.
overdosing and even deaths. The side-effects of the use of anabolic steroids in
Warning signs of drug/alcohol abuse females
 Drop in academic performance,  Masculinisation (features like males)
 Unexplained absence from  Increased aggressiveness, mood swings
school/college,  Depression, abnormal menstrual cycles
 Lack of interest in personal hygiene,  Excessive hair growth on the face and
 withdrawal,,isolation from family and body
friends  Enlargement of clitoris
 Deepening of voice
 Depression,
 Fatigue,
The side-effects of the use of anabolic steroids in
 Aggressive and rebellious behaviour,
Males
 Loss of interest in hobbies,
 Acne
 Change in sleeping and eating habits  Increased aggressiveness
 Fluctuations in weight, appetite, etc.  Mood swings
 Depression
 If an abuser is unable to get money to buy  Deduction of size of the testicles
drugs/alcohol he/she may turn to stealing.  Decreased sperm production
The adverse effects are just not restricted to  Potential for kidney
the person who is using drugs or alcohol.  Liver dysfunction
 a drug/alcohol addict becomes the cause of  Breast enlargement
mental and financial distress to his/her entire  Premature baldnes
family and friends.  Enlargement of the prostate gland.
 Those who take drugs intravenously (direct
injection into the vein using a needle and Prevention and Control
syringe), are much more likely to acquire ‘Prevention is better than cure’ holds true here
serious infections like AIDS and Hepatitis B. also.
 The viruses, which are responsible for these  (i) Avoid undue peer pressure - Every child
diseases, are transferred from one person to has his/her own choice and personality, which
another by sharing of infected needles and should be respected and nurtured. A child
syringes. Both AIDS and Hepatitis B infections should not be pushed unduly to perform
are chronic infections and ultimately fatal. beyond his/her threshold limits; be it studies,
Both can be transmitted through sexual sports or other activities.
contact or infected blood.
 (ii) Education and counselling - Educating and
 The use of alcohol during adolescence may counselling him/ her to face problems and
also have long-term effects. It could lead to stresses, and to accept disappointments and
heavy drinking in adulthood. The chronic use failures as a part of life. It would also be
of drugs and alcohol damages nervous system worthwhile to channelize the child’s energy
and liver (cirrhosis). into healthy pursuits like sports, reading,
 The use of drugs and alcohol during music, yoga and other extracurricular
pregnancy is also known to adversely affect activities.
the foetus.  (iii) Seeking help from parents and peers -
 Another misuse of drugs is what certain Help from parents and peers should be
sportspersons do to enhance their sought immediately so that they can guide
performance. They (mis)use narcotic appropriately. Help may even be sought from
analgesics, anabolic steroids, diuretics and close and trusted friends. Besides getting

proper advise to sort out their problems, this
would help young to vent their feelings of
anxiety and guilt.
 (iv) Looking for danger signs - Alert parents
and teachers need to look for and identify the
danger signs discussed above. Even friends, if
they find someone using drugs or alcohol,
should not hesitate to bring this to the notice
of parents or teacher in the best interests of
the person concerned. Appropriate measures
would then be required to diagnose the
malady and the underlying causes. This would
help in initiating proper remedial steps or
treatment.
 (v) Seeking professional and medical help - A
lot of help is available in the form of highly
qualified psychologists, psychiatrists, and
deaddiction and rehabilitation programmes to
help individuals who have unfortunately got
in the quagmire of drug/alcohol abuse. With
such help, the affected individual with
sufficient efforts and will power, can get rid of
the problem completely and lead a perfectly
normal and healthy life.

(B) Typhoid – Streptococcus
(C) Malaria – Plasmodium
HUMAN HEALTH AND DISEASE
(D) Ascariasis – Entamoeba
1 Innate immunity is non-specific type of 7 Differentiate between Active immunity
defence, that is present at the time of and Passive immunity.
birth. Which are the four types of (HSE March-2023)(2)
barriers involved in innate immunity 8
and mention one examples for each.
(HSE-March-2024)(2)
2 In a debate conducted in school, your
Write some important measures that
friend said that AIDS can be transmitted
would be useful for the prevention and
through touch or physical contact.
control of alcohol and drug abuse
(a) Do you agree with that statement ?
among adolescents. (Write relevant
(½)
four points) (HSE March-2023)(2)
(b) Name the clinical test used to
9 Mention any four measures useful for
diagnose AIDS. (½)
prevention and control of alcohol and
(c) How do HIV infect human body ? (1)
drug abuse (HSE July 2022)(2)
(HSE-March-2024)(2)
10 Match the column (A) with column (B)
3 Expand the following :
(HSE July 2022)(2)
(HSE June-2023)(2)
a)MALT b)ELISA c)NACO d)CMI
4 Mention any four measures helpful for
the prevention and control of Drugs and
Alcohol abuse among adolescents in
your locality. (HSE June-2023)(2)
5 Some commonly occurring diseases in
man are given below :
11 Match the Column (A) with Column (B)
(HSE June-2023)(3)
and (C) : (HSE July 2022)(2)
(a) Select a bacterial disease from it.

(b) Write any 3 symptoms of it.
(c) Mention any two possible preventive
and control measures for the same.
6 Pick out the correct pair of disease and
its pathogen : (HSE March-2023)(1)
12 Write any four ill-effects of
(A) Filaria – Rhino virus
Drug/Alcohol abuse.

(HSE March 2022)(2) 18 Drug/Alcohol abuse results in
13 (a) Expand the term AIDS. Mention the immediate and far reaching effects.
name of virus that causes AIDS. Write some effects you have studied.
(b) Name the widely used diagnostic (HSE March 2021)(2)
test for AIDS. (HSE March 2022)(5) 19 Vaccines are given to children at various
(c) List out any four practices for the stages of their development. (a) What is
prevention of AIDS meant by ‘vaccine’ ?
14 Innate immunity is characterised by (b) Write the principle of vaccination.
providing different types of barriers. (HSE March 2021)(2)
Name the four types of barriers of 20 Observe the list of certain common
innate immunity (HSE August 2021)(2) diseases in human given below and
15 World Health Organisation has started a answer thefollowing :(HSE-July-2020)(2)
number of programmes to prevent the
spreading of HIV Infection. Mention any
(a) Identify the bacterial disease among
four preventive measures against HIV
the enlisted.
infection (HSE August 2021)(2)
(b) Name its causative organism.
16 Which is the causative organism for
(c) Mention any two symptoms of it.
malaria disease ? Name the two hosts
21 Prepare a pamphlet as part of an
required for the malarial parasites to
awareness programme in your school
complete its life cycle
regarding the“Prevention and control of
(HSE August 2021)(2)
Alcohol and Drug abuse in adolescents”.
17 Observe the figure
(HSE March 2021)(2) [Hint :Prevention and control measures]
(HSE-July-2020)(3)
22 Name any two protozoan diseases, its
causative organism and any two
symptoms. (HSE-March-2020)(2)
23 Complete the illustration chart given
below. (HSE-March-2020)(2)
24 Explain the measures useful for
prevention and control of alcohol and
drugs abuse among adolescents.
(HSE-March-2020)(3)
(a) Identify the molecular structure 25 'Don't die of ignorance.'
given in the figure. (a) About which it is mentioned ?
(b) Name the regions labelled as A, B (b) List two measures taken by WHO to
and C. prevent it (HSE-June-2019)(2)

26 Observe the figure and answer the Pneumonia, Ring worm, Amoebiasis
following questions (HSE-June-2019)(2) (HSE-March-2019)(2)
a) Identify the given molecule. Bacteria Fungus Virus Protozoan
b)Mention two types of immune
responses in human body.
30 Identify the bacterial disease from the

following (HSE-June 2018)(1)
a)Typhoid b)Amoebiasis
c)Malaria d)Filariasis
31 Classify the following barriers of innate
immunity under 3 suitable heading
(HSE-June 2018)(3)
27 Write the effect of the following drugs

in human body (HSE-June-2019)(3) 32 Innate immunity is a non-specific type
(a) Ophiods (b) Cannabinoids of defense and consists of four types of
(c) Coca alkaloids barriers. Categorize the barriers and
28 Complete the flow chart given below give one example for each.
(HSE-March 2018)(2)
33 Complete the table given below
(HSE-March 2018)(2)
(HSE-March-2019)(2)
34 Consumption of drug and alcohol affect
29 List of some diseases commonly
the person’s mental and physical
occurring in man are given below.
health very badly. List the warning sign
Arrange them based on causative
of alcohol or drug abuse
organism in the table. Malaria,
(HSE-March 2018)(2)
Common cold, Typhoid, Ascariasis.

35 Study the relationship between the first d)Rheumatoid arthritis-.......D......
twowords and fill the blank space with a
40 Morphine is said to be an abused drug.
suitable word
Discriminate the term ‘use’ and ‘abuse’
Pnemonia : Streptococcus
of the drugs based on this example ?
pneumonae
(HSE-March-2017)(2)
Typhoid:..................
41 Differentiate active immunity from
(HSE-Model 2018)(1)
passive immunity. Give an example for
36 Prepare a hand out to educate
passive immunity ?
students aboutthe symptoms ofthe
(HSE-March-2017)(2)
dreaded disease cancer, itsdetection
42 Complete the table by filling a,b,c and d
and treatment (HSE-Model 2018)(3)
(HSE-June 2016)(2)
37 Prepare a brief note to be presented in
an awareness programme for
adolescents about AIDS, their causes
and preventive measures
(HSE-June-2017)(3)
38 Fill the box A,B,C and D (HSE-JUNE-2017)(2)
43 Answer the question about the given

figure (HSE-June 2016)(2)
39 Fill the blanks A,B,C and D using correct

terms given in the box
(HSE-JUNE-2017)(2)
Passive immunity
Sensitivity to some particles
Metastasis
Active immunity a)Identify the part X and Y ?
Autoimmune deficiency b)Name any two type of this
Immune deficiency disease
molecules ?
a)....A............ – Cancer 44 Select odd one out and justify your
selection (HSE-June 2016)(1)
b)Allergy -..B......... Malaria, Gonorrhoea, Amoebiasis,
C).....C.......-AIDS filariasis.

45 Identify the disease shown in the 49 Cancer is one of the most dreaded
following figure and write the diseases of human beings, and is major
causative organism of the disease cause of death all over the globe
(HSE-March 2016)(1) (HSE-March-2015)(3)
a)what are the causes of cancer?
b)what are the methods for
detection of cancer?
c) What are the types of treatment
of cancer?
50 Briefly describe the characteristic of
cancer cells ? (HSE-June 2014)(2)
51 It is said that “Chikunguniea” once
affected will not a person in next half
of his life. Justify this statement
46 “Blood of a man is tested positive for (HSE-June 2014)(2)
cannainoid” 52 Classify the diseases given in the box
a)what are these? as two groups based on their
b)from where there are extracted causative organism. Specify the type
naturally ? of causative organism for each group
c)which part of the body is affected (HSE-March-2014)(2)
by these ? (HSE-March 2016)(3)
Typhoid,
47 Match the terms given in three
Malaria, Pneumonia
coloumn of table correctly Diphtheria
(HSE-June 2015)(2) Amoebiasis
53 Prepare a pamphlet for an awareness

programme in your school about the
measures to prevent and control
alcohol and drug abuse in adolescents
(HSE-March-2014)(2)
54 The meaning of ‘antibiotics’ is
48 “If proper care and attention is not ‘against life’, where as with reference
given by adults, adolescent may to human being is is ‘pro life’
become addicted to drug or alcohol”. (HSE-March-2014)(2)
What is your opinion about this Substantiate this statement with
statement ?substantiate your answer ? suitable example ?
(HSE-June 2015)(2)

55 Prepare a pamphlet for adolescent
children to make them aware of
alcohol and drug abuse?
(HSE-May 2013)(2)
56 “Prevention is better than cure” . This
statement is true in the case of AIDS
as well as immunisation .
Substantiate (HSE-May 2013)(2) 62 In a class room discussion a student
57 Most often HIV Infection occur due to argues that allergic reaction are more
conscious behaviour patterns. Do you common in metro cities than in
agree with this statement ? villages.(March-2012)(2)
Substantiate your answer? a)Do you agree with this statement ?
(HSE-March 2013)(2) b) Which type of immunoglobulin is
58 Nature has as many verities of plants responsible for allergic reactions?
which give drugs for abuse, as there c) suggest two drugs which reduce
are medicinal plants which give allergic symptoms ?
medicines. Substantiate with two
examples (HSE March 2013)(2)
59 Note the relationship between first two
terms and suggest a suitable term for
the fourth place (HSE-june-2012(1)
a)Erythroxylum coca : Cocaine
Papaversomniferum :...............
b)salmonellatyphi : Typhoid fever
plasmodium falciparum :............
60 One of your Friend Argued that anti-
retroviral drugs are effective
medicine to treat AIDS
(HSE-June-2012)(3)
a)What is your opinion about it?
b)How HIV affect our immunity ?
61 Arrange the following diseases in the

following coloumn in correct order
(HSE-March-2012) (2)
Typhoid,Ring worm, Amoebiasis,
AIDS, Malaria, Pneumonia, Common
Cold

Navas cheemadan
CHAPTER-10  The dough, which is used for making dosa and idli
MICROBES IN HUMAN WELFARE is also fermented by bacteria. The puffed-up
 Microbes are present everywhere – in soil, appearance of dough is due to the production
water, air, inside our bodies and that of other of carbon dioxide (Fermentation results in
animals and plants. They are present even at the formation
sites where no other life-form could possibly  The dough, which is used for making bread, is
exist–sites such as deep inside the geysers fermented using baker’s yeast-
(thermal vents) where the temperature may Saccharomyces cervisiae
be as high as 1000C, deep in the soil, under  ‘Toddy’, a traditional drink of some parts of
southern India is made by fermenting sap from
the layers of snow several metres thick, and
in highly acidic environments. palms.
 Various microbes are also used to ferment
 Microbes are diverse–protozoa, bacteria,
fish, soyabean and bamboo shoots to make
fungi and microscopic plant viruses, viroids
food.
and also prions that are proteinacious
 Large holes in ‘swiss cheese’ are due to
infectious agents
production of a large amount of CO2 by a
bacterium Propionibacterium sharmanii.
 The ‘Roquefort cheese’ are ripened by
growing a specific fungi on them, which gives
them a particular flavor
2. Microbes in Industrial products
Even in industry, microbes are used to
synthesise a number of products valuable to human
beings. Beverages and antibiotics are some
Microbes like bacteria and many fungi can be examples.
grown on nutritive media to form colonies (Figure Fermentors; are large vessels used for growing
10.3), that can be seen with the naked eyes.
microbes in very large scale in Industries.
1. Microbes in Household products
 LACTIC ACID BACTERIA (LAB)
 Micro-organisms such as Lactobacillus and
others commonly called Lactic acid bacteria
(LAB) grow in milk and convert it into curd.
 During the growth, LAB produces acids that
coagulate and partially digest the milk
proteins. A small amount of curd added to the
fresh milk as inoculums or starter contains
millions of LAB, which at suitable temperature
multiply and convert milk into curd.
(a)Fermented Beverages
 LAB improves nutritional quality by increasing
 Microbes (Yeast) are used for the production
vitamin B12 (Cyanocobalamine).
of beverages like wine, beer, whisky, brandy
 In our stomach LAB check the disease causing
microbes.

Navas cheemadan
or rum. For this purpose Saccharomyces chemical produced by the mould and he
cervisiae is used (Brewer’s yeast) named it Penicillin after the mould Penicillium
 This yeast is used for fermenting malted notatum
cereals and fruit juices to produce ethanol  Full potential effective antibiotic (Pencillin)
 Depending upon the type of raw material was established by Ernest Chain and Howard
used for fermentation and the type of Florey
processing (With or without distillation)  This antibiotic was extensively used to treat
different types of alcoholic drinks are American soldiers wounded in World war II.
obtained. Felmming, Chain, and Florey were awarded
 Wine, and beer are produced without Nobel Prize in 1945, for this discovery.
distillation of fermented broth  Antibiotics are now widely used against deadly
 Whisky ,Brandy and Rum are produced by diseases like Plaque, whooping cough (kali
distillation of fermented broth khansi), diphtheriaa (gal ghotu), and leprosy
(kusht rog) ,which used to kill millions all over
Qn. Find the Odd one and write the reason for the globe.
selection ?
(c). Microbes for the production of
Wine, Whisky ,Brandy , Rum
Ans: acids and Alcohol
Some microbes are used for the commercial
(b)Antibiotics and industrial production of certain chemicals like
 Discovery of antibiotics is regarded as the one organic acids, alcohol and enzymes
of the most significant discoveries of the 20th
Aspergillus niger(Fungus)--------- Citric acid
century
Acetobacter aceti(Bacteria)------- Acetic acid
 Anti is a Greek word that means ‘against’, Clostridium butylicum (Bacteria)--- Butyric acid
and bio means ‘life’, together they mean Lactobacillus (Bacteria) ------------- Lactic acid
‘against life’ (in the context of disease Saccharomyces cervisiae---------- Ethanol
causing organisms); whereas with reference
to human beings, they are ‘pro life’ and not
against. (d) Microbes for the production of
 Antibiotics are the chemical substances, which Enzymes
are produced by the some microbes and can  Lipase are used in Detergent formulations for
kill or retard the growth of other (Disease removing oily stains in laundry
causing) microbes.  Bottled fruit juices bought from market are
 Pencillin was the first antibiotic to be clearer as compared to those made at home.
discovered. Alaxander Fleming discovered This is because the bottled juices are clarified
Pencillin. (Un expected discoveries/ chance by the use of Pectinase and Protease
discovery are called Serendipity). Pencillin is
(e) Microbes used as
produced by a mould called Pencillium
notatum Bioactive molecule
 Alexander Fleming while working on  Bioactive molecules are substance that can be
Staphylococci bacteria, once observed a acted on a living organism or an extract from
mould growing in one of his unwashed culture a living organism. It can be extracted from
plates around which Staphylococci could not micro organism.
grow. He found out that it was due to a
Microbes in Human welfare/2024 [email protected]

Navas cheemadan
 A bioactive molecule is a naturally occurring 3. Microbes in Sewage Treatment
chemical compound found in living organisms  Municipal waste-water is called Sewage.
that can have a significant effect on biological
 A major component of this water is human
processes, either positive or negative
excreta. It also contains large amounts of
 Streptokinase organic matter and microbes.
It is produced by the bacterium
 Many of which are pathogenic. Before
Streptococcus and modified by genetic
disposal of this sewage water into natural
engineering is used as a ‘CLOT BUSTER’ for
waterbodies like river and Streams, they
removing clots from blood vessels of patients
undergo treatment in sewage treatment
who have undergone myocardial infarction
plants (STPs).
leading to heart attack
 Treatment of waste water is done by the
 Cyclosporin A
heterotrophic microbes naturally present in
Trichoderma polysporum (fungus)
the sewage.
produces Cyclosporin A . It is used as a
 Sewage treatment consists of two stages.
immunosuppressive agent in organ
a)Primary treatment
transplantation
It include the Physical removal of particles
 Statin
(Large and small) from the sewage through
Monascus purpureus (Yeast) Produce
filtration and sedimentation .These are removed
Statins. It is used as blood cholesterol
in stages
lowering agent. Statin act on enzyme
 Initially, floating debris is removed by
responsible for synthesis of cholesterol. It acts
sequential filtration.
by competitively inhibiting the enzyme
 Then the grits ( soil and small pebbles) are
responsible for synthesis of cholesterol.
removed by sedimentation.
 All the solids that settle form the primary
Microbe Bioactive Function sludge. The supernatant forms the Effluent.
molecule  The Effluent from primary settling tank is
Streptococcus Streptokinase It is used as a ‘CLOT taken for secondary treatment.
(Bacteria) BUSTER’ for
b) Secondary treatment/Biological
removing clots from
blood vessels of treatment
patients  The primary Effluent is passed into Large
Trichoderma Cyclosporin A immunosuppressive aeration tank, where it is constantly agitated
polysporum agent in organ
(fungus) transplantation mechanically and air is pumped into it. This
allows vigorous growth of useful aerobic
Monascus Statins. blood cholesterol microbes into flocs (Masses of bacteria
purpureus lowering agent associated with fungal filaments to form
(Yeast)
mesh like structure).
 While growing, these microbes consume the
major part of the organic matter in the
Effluent. This reduces BOD( Biochemical
oxygen Demand-It is the amount of oxygen
that would be consumed if all the organic
matter in one liter of water were oxidized by

Navas cheemadan
bacteria) of the Effluent. Here Sewage water 4 Microbes in production of Bio Gas
is treated till the BOD is reduced. Biogas is a mixture of gas (Mainly
 The BOD test measures the rate of uptake of Methane)) produced by the microbial activity.
oxygen by the microorganism in a sample of Certain bacteria, which grow anerobically on
water.Thus indirectly it is a measure of organic cellulosic material, produce large amount of
matter present in the water. methane along with CO2 and H2. These bacteria is
 The greater the BOD of waste water Once the collectively called Methanogens
BOD of sewage is reduced , the Effluent is then (Eg; Methanobacterium).
passed to a settling tank where bacterial ‘Flocs’ Methanogens are found in Anerobic
are allowed to sediment. This Sediment is called sludge digester (In sewage treatment), in the
Activated Sludge. Rumen of cattle.. In the Rumen, these bacteria
 A small part of activated Sludge is pumped back help in the breakdown of cellulose and play
to aeration tank to serve as inoculum.. important role in nutrition of cattle. Thus, the
 The remaining major part of the sludge is excreta (dung) of cattle , commonly called Gobar,
pumped into large tanks called Anerobic is rich in these bacteria. So Dung can be used in
sludge digesters. Here, other kinds of bacteria for generation of Biogas, commonly
common called Gobar
(Eg:Methanobacterium), which grow gas.
anerobically, digest the bacteria and the fungi
BIOGAS PLANT
in the sludge.
The technology of Biogas production was
 During this Digestion bacteria produce a
developed in India due to the efforts of Indian
mixture of gases such as methane, Hydrogen
Agricultural Research Institute (IARI) and Khadi
sulphide and carbon dioxide. These gases form
and Village Industries Commission (KVIC).
BIOGAS and can be sued as source of energy as
The Biogas plant consist of a concrete
it is inflammable.
tank of 10-15 feet deep in which bio-waste
bio are
 Then the effluent from secondary treatment is
collected and a slurry of dung is fed. A floating
generally released into natural water bodies
cover is placed over the slurry, which keeps on
like rivers and streams.
rising as the gas is produced in the tank due to
 The Ministry of Environment and Forests
the microbial activity. The biogas plant has an
has initiated Ganga Action Plan and Yamuna
outlet, which is connected to a pipe to supply
Action Plan to save these major rivers of our
biogas to nearby house. The spent slurry is
country from pollution. Under these plans, it
removed through another outlet and may be
is proposed to build a large number of STPs so
used as fertilizer . Cattle dung is available in large
that only treated sewages may may be
quantities in rural areas where cattle are used for
discharged in the rivers.
a variety of purposes. Biogas produced thus
Difference between primary treatment and
secondary treatment produced is used for cooking and lighting.
Primary treatment Secondary treatment
It is a physical process It is a biological
iological process
It remove both grits It remove small sized
and large piece of organic matter
Organic matter
It doesnot requires It requires aeration
aeration
It involve filtration It involve microbial
and sedimentation digestion of organic matter

Navas cheemadan
5. Microbes as Biological control of These viruses play a vital role for conserving
the beneficial insects in Integrated pest
pests and diseases: management (IPM) programme.
 It refers to the use of biological methods for
controlling plant diseases and pests.
8. Microbes as Biofertilisers
 Biocontrol can be simply defined as the
 The thoughtless use of chemical fertilizers
control of the growth of an insect or pest by
has contributed much to the environment
using a biological agent or living organism.
pollution.
This process is also referred to as biological
control  The realization of this problem problem
compelled us to switch to the Organic
 Ie: It is a method of controlling pests that
farming –to use of Biofertilisers.
relies on natural predation rather than
introduced chemicals.  Biofertilisers are organism that enriches the
nutrient quality of the soil.
 So Biocontrol measures greatly reduce our
dependence on toxic chemicals and  The main sources of Biofertilisers are
pesticides. Bacteria, Fungi and Cyanobacteria.
Eg: (1)-The beetle with red and black  Currently, in our country, a number of
marking-)-Ladybird and dragonflies are useful biofertilisers are available commercially in the
to get rid of aphids and mosquitoes market and farmers use these regularly in
respectively their fields to replenish soil nutrients and to
Eg:(2)-Introduction of Bacillus thuringiensis reduce dependence on chemical fertilisers.
(Bt) is used to control butterfly catterpiller is  Eg: (1)-The roots of Leguminous plants contains
an example for microbial Biocontrol. These Rhizobium, it fix atmospheric nitrogen into
are available in sachet as dried spores which organic forms which is used by the plant as
are mixed with water and sprayed onto nutrient
vulnerable plants such as Brassicas and fruit  Eg: (2)-Azospirillum and azobacter (Both are free
trees, where these are eaten by insect larvae. living bacteria in the soil) are able to fix
The bacterial disease will kill the caterpillars atmospheric Nitrogen
but leave the other insects unharmed.  Eg: (3)-Certain Fungi such as Mycorrhizae forms
Eg: (3)-Using genetic engineering skills, symbiotic association with plants.Many member
scientist introduced B.thuringiensis toxin gene so of the genus Glomus forms Mycorrhiza. The
into plants. Such plants are resistant to attack fungal symbiont helps the plant to absorb
by insect pests. Eg:Bt-Cotton phosphrous from the soil. This association also
Eg: (4)-Trichoderma (Free living fungi present resist to root borne pathogens, tolerance to
in the root ecosystem) used in the treatment salininty and drought. This association also
of plant diseases. accelerate the growth and development of the
Eg(5) Baculoviruses (Genus : plant
Nucleopolyhedrovirus) are viruses that attack  Eg: (4)-Cyanobacteria (Eg; Anabaena, Nostoc,
the insects and other arthropods. These Oscilaatoria) are autotrophic microbes widely
viruses are excellent candidates for species- distributed in aquatic and terrestrial
specific, narrow spectrum insecticidal environments. Many of which can fix
applications. The virus has no harmful effect atmospheric nitrogen. In paddy fields,
on plants and animals such as Mammals, cyanobacteria serve as biofertiliser. Blue green
Birds, Fishes or even on non-target insects.

Navas cheemadan
algae also add organic matter to the soil and
increase its fertility.
Difference between Biofertiliser and Chemical

fertilizer
Biofertilisers Chemical fertilizers
They are microbes They are chemicals
They do not cause They cause pollution
pollution
They are cheap They are costlier
They improve soil They destroy soil
structure and Functions structure and function

(b) Streptokinase
8. The first antibiotic discovered was
MICROBES IN HUMAN WELFARE _______. (HSE-March 2022)(1)
9. Match the following :(HSE-March 2022)(2)
1. Match the following :

(HSE-MARCH-2024).(2)
10. (a) Expand the term AIDS. Mention the

name of virus that causes AIDS.
(b) Name the widely used diagnostic test
for AIDS.
(c) List out any four practices for the
prevention of AIDS.
(HSE-March 2022)(5)
2. Microbe known as both Baker’s yeast as
well as Brewer’s yeast is ________ 11. Name the free living fungus used as an
(HSE-JUNE-2023).(1) effective biocontrol agent of several plant
3. Complete the table using appropriate pathogen (HSE-August 2021)(1)
terms (HSE-JUNE-2023).(2) 12. Biogas is a mixture of gases produced by
the microbial activity and used as a fuel
.Mention the name of bacteria used for
production of biogas
(HSE-August 2021)(1)
13. Match the following(HSE-August 2021)(2)
A B
1)Trichoderma a)Streptokinase
polysporum
2)Monascus b)Ethanol
purpureus
4. Which microbe is called baker’s yeast ?
3)Streptococcus c)Cyclosporin
(A) Propionibacterium sharmanii 4)Sacharomyces d)Statin
(B) Lacto bacillus cervisiae
(C)Saccharomyces cerevisiae
(D) Aspergillus niger (HSE-March 2023)(1) 14. Organic pollutants in sewage water is
5. Two bioactive molecules are given : measured as _____(HSE March-
(i) Cyclosporin-A 2021)(1)(a) GMO (b) MTP (c) BOD (d)
(ii) Streptokinase HGP
(A) Name the microbe which produces 15. Enzyme used in detergents for removing
these bioactive molecules. oily stains from laundry is _____.
(B) Write its use. (HSE-March 2023)(2) (a) Lipase (b) Protease
6. Who discovered the first antibiotic (c) Amylase
Penicillin ? (HSE-July 2022)(1) (d) Pectinase (HSE March- 2021)(1)
7. Write the use of following microbial
product : (HSE-July 2022)(2) 16. Fill in the blanks to complete the table :
(a) Pectinase and Protease
Previous year Questions/+2/2024 [email protected]

(HSE March- 2021)(2)

22. Bio-fertilisers are organisms that enrich
17. A free living nitrogen fixing bacteria in the
soil. (HSE-July-2020)(1) the nutrient quality of the soil. How
(a) Rhizobium (b) Azospirillum these biofertilisers enrich the soil
(c) Nostoc(d) Anabaena nutrients ? Give two examples
18. Match the following : (HSE-July-2020)(2) (HSE-June-2019)(2)
(a) Acetic acid (i)Trichoderma 23. Microbes are useful to human beings in
polysporum
(b) Citric acid (ii) Acetobacter aceti diverse ways. If so, name the following
(c) Cyclosporine A (iii) Lactobacillus : (HSE-March-2019)(2)
(d) Lactic acid (iv) Aspergillus niger
(v)Monascus
(a) Microbe known as "Baker's Yeast".
purpureus (b) Lactic acid producing bacterium.
(c)Fungus which helps in theproduction
19. Microbe which help in the production of bio-active molecule –cyclosporine A.
of Biogas (HSE-March-2020)(1) (d) Symbiotic nitrogen fixing bacterium.
(a) Aspergillusniger
(b) TrichodermaPolysporum
24. In Sewage Treatment plant microbes
(c) Saccharomyces cerevisiae play a significant role. Distinguish
(d) Methanobacterium between primary and secondary
20. Some examples of microbes in human treatment in sewage plant?
welfare are given. Classify them under (HSE-June 2018)(2)
the headings given below. 25. Complete the table with appropriate
[Egs : Rhizobium, Propionibacterium terms (HSE-March 2018)(2)
sharmanii, Azaspirillum, Lactic acid
bacteria, Anabaena, Azotobacter,
Aspergillus niger, Saccharomyces
cerevisiae...] (HSE-March-2020)(2)
26. Find the odd one out

a)Trichoderma polysporum
21. Match the following(HSE-June-2019)(2) b)Clostidium butyliorm
c)Acetobacter aceti
d)Aspergillus niger
(HSE-model 2018)(1)

27. a)Name the yeast used for the the functioning of biogas plants with
commercial production of ethanol. the help of microbe.
b)Name the yeast used for the (HSE-June 2014)(2)
production of statins 34. BOD of some water sample is given
(HSE-model 2018)(2) below (HSE-June 2015)(2)
28.Complete the table by filling A,B,C and A- Sample-1 200mg/L
D using hints from the bracket B- Sample-2 80mg/L
(HSE-JUNE-2017)(2) C- Sample-3 300mg/L
(Gobar gas, biological control, anabaena, D- Sample-4 25mg/L
Sacharomyces cerviciae ,Prpionibacterium a)Which of above water sample is most
sharmanii ) polluted ?
b) what is meant by flocs/ what is its
Methanogen- ........A............. role in sewage treatment ?
Bread making-.........B............. 35. Microbes can also be used as a source
Biofertilizer:.............C............ of energy. Substantiate with example?
Trichoderma:...........D.......... (HSE-March 2015)(2)
29. What are the advantages of 36. Complete the illustration appropriately
biofertilizers over chemical fertilizers? ? (HSE-MAY 2013)(2)
Give an example for biofertilizer?
(HSE-March-2017)(2)
30. Chose the correct answer from the
bracket (HSE-June-2016) (1)
Cyclosporin A is produced by.......
(a)Aspergillus (b)Clostridium
(c)Trichoderma (d)Acetobacter
31. Select a bio-control agent from the
given microbe (HSE-June-2016)(1)
a)Baculo virus b)Rhino virus
c)Picorna virus d)Adeno virus
32. “BOD is commonly calculated as an
index of water pollution” 37. Some bioactive molecule, their sources
and their medical importance are given
a)Do you agree with this statement? Why?
in the table below. Fill up the missing
b)Expand BOD? (HSE-March 2016)(2)
33. In our state waste management is a part (HSE-March 2013)(2)
problem. Government promote and
give subsidy to biogas plants. Comment

38. Match the following (HSE-june-2012)(2)
39. Rearrange the coloumn B & C with

respect to A (HSE-March-2012)(2)
A B C
Monascus Streptoki Antibiotic
pupureus nase
Streptococcus Statin Immunosuppr
essant
Pencillium Cylospor Clot buster
notatum in-A
Trichoderma Pencillin Cholesterol
polysporum lowering agent

SOHSS-Areekode
Biodiversity and Conservation  More than 70 per cent of all the species
recorded are animals,, while plants (including
algae, fungi, bryophytes, gymnosperms and
Biodiversity angiosperms) comprise no more than 22 per
cent of the total.
 There are more than 20,000 species of ants,  Among animals, insects are the most species-
species
3,00,000 species of beetles,, 28,000 species rich taxonomic group, making up more than
of fishes and nearly 20,000 species of 70 per cent of the total (it
it means that, out of
orchids. every 10 animals on this planet, 7 are
 Biodiversity is the term popularized by the insects.)
sociobiologist ,Edward Wilson to describe  The number of fungi species in the world is
the combined diversity at all the levels of more than the combined total of the species
biological organization of fishes, amphibians, reptiles and
 Biodiversity can be described as the sum mammals.
totall of genes, species and ecosystem of a  The number of fishes among vertebrates are
region more than total number of o mammals, Birds,
(i) Genetic diversity reptiles and Amphibians !
 A single species might show high diversity at
the genetic level over its distributional range
Eg: The genetic variation shown by the
medicinal plant Rauwolfia vomitoria growing
in different Himalayan ranges might be in
terms of the potency and concentration of the
active chemical (reserpine)) that the plant
produces.
 India has more than 50,000 genetically
different strains of rice, and 1,000 varieties of
mango.
(ii) Species diversity:
 The diversity at the species level.
Eg: the Western Ghats have a greater
amphibian species diversity than the Eastern
Ghats.
(iii) Ecological diversity:
 The diversity at the ecosystem level.
Eg: India has variety of ecosystem like deserts,
rain forests,
sts, mangroves, coral reefs,
wetlands, estuaries, and alpine meadows has  Biologists are not sure about how many
a greater ecosystem diversity than a prokaryotic species there might be India has
Scandinavian country like Norway. only 2.4 per cent of the world’s land area, its
share of the global species diversity is an
How Many Species are there on impressive 8.1 per cent. (This makes our
Earth and How Many in India? country one of the 12 mega diversity
 According to the IUCN (2004), ), the total countries of the world.)
number of plant and animal species  Nearly 45,000 species of plants and twice as
described so far is slightly more than 1.5 many of animals have been recorded from
million. India.
 According to Robert May total the global  If we accept May’s global estimates, only 22
species diversity Is about 7 million. per cent of the total species
speci have been

SOHSS-Areekode
recorded so far. Applying this proportion to promote niche specialisation and lead to a
India’s diversity figures, we estimate that greater species diversity.
there are probably more than 1,00,000 plant (3) There is more solar energy available in the
species and more than 3,00,000 animal tropics, which contributes to higher productivity;
species yet to be discovered and described ! this
is in turn might contribute indirectly to greater
diversity.
Patterns of Biodiversit
Biodiversity (ii) Species-Area
Area relationships:
(i) Latitudinal gradients:  During his pioneering and extensive
 The diversity of plants and animals is not explorations in the wilderness of South
uniform throughout the world. American jungles,, the great German
 In general, species diversity decreases as we naturalist and geographer Alexander von
move away from the equator towards the Humboldt observed that within a region
poles. With very few exceptions, tropics species richness increased with increasing
(latitudinal range of 23.5° N to 23.5° S) explored area, but only up to a limit
harbour more species than temperate or  The relationship between species richness
polar areas. and area for a wide variety of taxa
 Colombia located near the equator has (angiosperm plants, birds, bats, freshwater
nearly 1,400 species of birds while New York fishes) turns out to be a rectangular
at 41° N has 105 species and Greenland at hyperbola. On a logarithmic scale, the
71° N only 56 species. India, with m much of its relationship is a straight line described by
land area in the tropical latitudes, has more the equation
than 1,200 species of birds.
 A forest in a tropical region like Equador has
up to 10 times as many species of vascular
plants as a forest of equal area in a
temperate region like the Midwest of the
USA.
 The largely tropical Amazonian rain forest in
South America has the greatest biodiversity
on earth- it is home to more than 40,000
species of plants, 3,000 of fishes, 1,300 of
birds, 427 of mammals, 427 of amphibians,
378 of reptiles and of more than 1,25,000
invertebrates. Scientists estimate that in
these rain forests there might be at least two
million insect species waiting to be
discovered and named !!!!  log S = log C + Z log A
 where
Reason for the great diversity in the  S= Species richness A= Area
tropical regions  Z = slope of the line (regression
Ecologists and evolutionary biologists have  coefficient)
proposed various hypotheses; some important  C = Y-intercept
intercept
ones are
(1) Tropical regions have remained relatively  Ecologists have discovered that the value
undisturbed for millions of years and thus had a of Z lies in the range of 0.1 to 0.2, regardless of
long time for species diversification. the taxonomic group or the region (whether it is
(2) Tropical environments, unlike temperate the plants in Britain, birds in California or
ones, are less seasonal, relatively more constant molluscs in New York state, the slopes of the
and predictable. Such constant environments regression line are amazingly similar)

 The species-area relationships among very Loss of Biodiversity
large areas like the entire continents, you will find
 The colonisation of tropical Pacific Islands by
that the slope of the line to be much steeper (Z
humans is said to have led to the extinction
values in the range of 0.6 to 1.2).
of more than 2,000 species of native birds.
For example, for frugivorous (fruit-eating)
birds and mammals in the tropical forests of  The IUCN Red List (2004) documents the
different continents, the slope is found to be 1.15 extinction of 784 species (including 338
vertebrates, 359 invertebrates and 87
plants) in the last 500 years.
The importance of Species
Diversity to the Ecosystem  Some examples of recent extinctions include
 Dodo (Mauritius),
A community with more species tend to be  Quagga (Africa),
more stable than those with less stable.  Thylacine (Australia),
A community which should not show too  Steller’s Sea Cow (Russia) and
much variation in productivity from year to  Three subspecies of tiger
year called Stable community. Such (Bali, Javan, Caspian)
community are resistant to occasional
disturbance (Natural or Man made) and The last twenty years alone have witnessed
resistant to alien species invasion. the disappearance of 27 species
David Tilman conducted some long term more than 15,500 species world-wide are
experiments using outdoor plots, explained facing the threat of extinction.
that increased diversity contributed to higher Presently, 12 % of all bird species, 23% of all
productivity. Rich diversity and higher mammal species, 32 % of all amphibian
productivity are not only essential for a species and 31%of all gymnosperm species
healthy ecosystem but also important for the in the world face the threat of extinction.
survival of human race
 Loss of biodiversity in a region may lead to
RIVET POPPER HYPOTHESIS (a) Decline in plant production,
Proposed by Stanford ecologist Paul Ehrlich. (b)Lowered resistance to
In an airplane (ecosystem) all parts are joined environmental perturbations such
together using thousands of rivets (species). as drought
If every passenger travelling in it starts (c)Increased variability in certain
popping a rivet to take home (causing a ecosystem processes such as plant
species to become extinct), it may not affect productivity, water use, and pest
flight safety (proper functioning of the and disease cycle.
ecosystem) initially, but as more and more
rivets are removed, the plane becomes Causes of biodiversity losses:
dangerously weak over a period of time. There are four major causes (‘ The Evil Quartet ’
Furthermore, which rivet is removed may also is the sobriquet)
be critical. Loss of rivets on the wings (key
species that drive major ecosystem functions) (i) Habitat loss and fragmentation:
is obviously a more serious threat to flight This is the most important cause driving
safety than loss of a few rivets on the seats or animals and plants to extinction. The most
windows inside the plane. dramatic examples of habitat loss come from
tropical rain forests. Once covering more than 14
% of the earth’s land surface, these rain forests
now cover not more than 6 %. They are being
destroyed fast. By the time you finish reading this
Printout of zoology, 1000 more hectares of rain
forest would have been lost.
Biodiversity and conservation/2024 [email protected]

The Amazon rain forest (it is so huge that Eg 1: When a host fish species becomes extinct,
it is called the ‘lungs of the planet’) harbouring its unique assemblage of parasites also meets the
probably millions of species is being cut and same fate.
cleared for cultivating soya beans or for Eg 2: Coevolved plant-pollinator mutualism
conversion to grasslands for raising beef cattle. where extinction of one invariably leads to the
Besides total loss, the degradation of extinction of the other.
many habitats by pollution also threatens the
survival of many species.
When large habitats are broken up into
BIODIVERSITY CONSERVATION
small fragments (Fragmentation) due to various
Why Should We Conserve Biodiversity?
human activities, mammals and birds requiring The great biodiversity on Earth is vital for the
large territories and certain animals with existence of mankind. The reason for conserving
migratory habits are badly affected, leading to biodiversity are the following
population declines. a)Narrow Utilitarian
The narrowly utilitarian arguments for
(ii) Over-exploitation: conserving biodiversity are obvious; humans
Humans have always depended on nature derive countless direct economic benefits from
for food and shelter, but when ‘need’ turns to nature food (cereals, pulses, fruits), firewood,
‘greed’ it leads to over-exploitation of natural fibre, construction material, industrial products
resources. (tannins, lubricants, dyes, resins, perfumes ) and
Eg: Many species extinctions in the last 500 years products of medicinal importance.
(Steller’s sea cow, passenger pigeon) were due  More than 25 % of the drugs currently sold in
to overexploitation by humans. the market worldwide are derived from plants
and 25,000 species of plants contribute to the
(iii)Alien species invasions: traditional medicines used by native peoples
When alien species are introduced around the world. Nobody knows how many
unintentionally or deliberately for whatever more medicinally useful plants there are in
purpose, some of them turn invasive, and cause tropical rain forests waiting to be explored.
decline or extinction of indigenous species.  With increasing resources put into
Eg 1: The Nile perch introduced into Lake ‘bioprospecting’ (exploring molecular, genetic
Victoria in east Africa led eventually to the and species-level diversity for products of
extinction of an ecologically unique assemblage economic importance), nations endowed with
of more than 200 species of cichlid fish in the rich biodiversity can expect to reap enormous
lake. benefits.
Eg 2: the environmental damage caused and b)Broadly utilitarian:
threat posed to our native species by invasive The broadly utilitarian argument says that
weed species like carrot grass biodiversity plays a major role in many ecosystem
(Parthenium), Lantana and water hyacinth services that nature provides. The fast- dwindling
(Eicchornia). Amazon forest (Lungs of Planet) is estimated to
Eg 3: The recent illegal introduction of the produce, through photosynthesis, 20 per cent of
African catfish Clarias gariepinus for aquaculture the total oxygen in the earth’s atmosphere.
purposes is posing a threat to the indigenous Pollination (without which plants cannot
catfishes in our rivers. giveus fruits or seeds) is another service,
ecosystems provide through pollinators layer –
(iv)Co-extinctions: bees, bumblebees, birds and bats.
When a species becomes extinct, the There are other intangible benefits – that
plant and animal species associated with it in an we derive from nature–the aesthetic pleasures of
way also become extinct. walking through thick woods, watching spring
flowers in full bloom or waking up to a bulbul’s
song in the morning etc give pleasure

c)Ethical argument  Initially 25 biodiversity hotspots were
Philosophically or spiritually, we need to identified but subsequently nine more have
realise that Every species has an intrinsic value, been added to the list, bringing the total
even if it may not be of current or any economic number of biodiversity hotspots in the
value to us. We have a moral duty to care for world to 34. These hotspots are also regions
their well-being and pass on our biological legacy of accelerated habitat loss.
in good order to future generations.  Three of these hotspots – Western Ghats
How do we conserve Biodiversity? and Sri Lanka, Indo-Burma and Himalaya –
Conservation of biodiversity can be done by two cover our country’s exceptionally high
ways biodiversity regions.
a)In-situ conservation  Although all the biodiversity hotspots put
b)Ex-situ conservation together cover less than 2% of the earth’s
land area, the number of species they
a)In-situ (On site) conservation collectively harbour is extremely high and
When we conserve and protect the whole strict protection of these hotspots could
ecosystem, its biodiversity at all levels is reduce the ongoing mass extinctions by
protected - we save the entire forest to save the almost 30 per cent.
tiger. This approach is called in situ (on site)
conservation. (b) Ex situ (off site) Conservation
Ie: In-situ conservation refers to the practice of  When there are situations where an animal
protecting plant and animal species within their or plant is endangered or threatened
natural habitats (organisms facing a very high risk of
Eg: extinction in the wild in the near future) and
 National park needs urgent measures to save it from
 Sanctuaries extinction, ex situ (off site) conservation is
 Biosphere reserves, the desirable approach.
 Natural monuments,  Conservation outside their habitat is called
 Hot spots ex-situ conservation.
 sacred grooves  In this approach, threatened animals and
 cultural landscapes plants are taken out from their natural
 India has habitat and placed in special setting where
they can be protected and given special care.
 14 biosphere reserves,
Eg :
 90 national parks and
 Cryoprservation,
 448 wildlife sanctuaries.
 Zoological parks,
 Sacred groves are found in Khasi and Jaintia
 Botanical gardens
Hills in Meghalaya, Aravalli Hills of
 Wildlife safari parks
Rajasthan, Western Ghat regions of Cryopreservation
Karnataka and Maharashtra and the  Storage of materials (Like seeds, gametes) at
Sarguja, Chanda and Bastar areas of very low temperature is called
Madhya Pradesh. In Meghalaya, the sacred cryopreservation.
groves are the last refuges for a large
 Now gametes of threatened species can be
number of rare and threatened plants
preserved in viable and fertile condition for
Hotspots:
long periods using cryopreservation
Scientists identified certain regions with
techniques, eggs can be fertilised in vitro,
very high level of species richness and high
and plants can be propagated using tissue
degree of Endemism (species that is confined to
culture methods.
that region and not found anywhere else) to
 In recent years ex situ conservation has
protect biodiversity.Hot spots are the richest and
advanced beyond keeping threatened
most threatened reservoirs of plants and animal
species in enclosures. Seeds of different
life on earth.

genetic strains of commercially important
plants can be kept for long periods in seed
banks.
 Biodiversity knows no political boundaries and

its conservation is therefore a collective
responsibility of all nations.
 The historic Convention on Biological
Diversity (‘The Earth Summit’) held in Rio de
Janeiro in 1992, called upon all nations to
take appropriate measures for conservation
of biodiversity and sustainable utilisation of
its benefits.
 In a follow-up, the World Summit on
Sustainable Development held in 2002 in
Johannesburg, South Africa, 190 countries
pledged their commitment to achieve by
2010, a significant reduction in the current
rate of biodiversity loss at global, regional
and local levels.

5. A figure showing the global
biodiversity of invertebrates and
BIODIVERSITY AND CONSERVATION
vertebrates are given :
1. Biodiversity is the term popularized
(HSE March 2023)(2)
by the sociobiologist _____ to
describe the combined diversity at
all the levels of biological
organization .(HSE-March-2024)(1)
2. Biodiversity and its conservation are
now vital environmental issues of
international concern as more and
more people around the world
begin to realise the critical (A) Identify the most diverse groups
importance of biodiversity for our of vertebrates and invertebrates.
survival and well being on this (B) What are the three important
planet. (HSE-March-2024)(3) levels of biodiversity ?
(a) Which are the four major causes 6. The given illustration shows ‘Evil
of biodiversity losses ? (1) Quartet’ of biodiversity loss :
(b) Name two different methods of
biodiversity conservation. (1)
(c) What is so special about tropics
that might account for their greater
biological diversity ? (1)
3. “Evil Quartet” is the sobriquet used (i) Fill up ‘A’ and ‘B’.
to describe biodiversity loss. If so, (ii) Explain Co-extinction and Alien
(a) List out the four major causes of species invasion with suitable
biodiversity loss. examples (HSE March 2023)(3)
(b) Mention the two major 7. Differentiate between in-situ and ex-
approaches of biodiversity situ approaches of biodiversity
conservation (HSE-June-2024)(3) conservation with two examples
4. Identify two ex-situ conservation each (HSE July 2022)(2)
approaches of organisms from the 8. The term ‘Biodiversity’ was
following list : (HSE March 2023)(1) popularised by the scientist
(Zoological Park, Biosphere Reserve, ________. (HSE-March 2022)(1)
National Park, Botanical Garden) 9. (a)Write four major causes of
Biodiversity loss.

(b) Give one example for in-situ 16. Tropical Amazonian rainforest in
conservation and ex-situ South America has the greatest
conservation of Biodiversity. biodiversity on earth. Do you agree
(HSE-March 2022)(3) with this? Explain.
10. Biodiversity can be descried at 3 (HSE-March 2020)(2)
levels of biological organizations 17. In your school the Science Club
a) Mention three levels of biological decided to conduct a seminar about
diversity ? "Biodiversity conservation -
b)Who popularized the term Approaches". You are invited
“Biodiversity” (HSE-August-2021) (2) to.present a paper on this seminar.
11. Mention the two conservative List out the main points you
approaches to protect our included in the presentation.
biodiversity. Give one example for (Hint : In Situ, Ex-Situ conservation)
each conservative approach ? (HSE-June-2019)(3)
(HSE-August-2021) (2) 18. Which among the following belongs
12. Now-a-days, the world is facing a to ex-situ conservation?
problem of increased rate of species Wildlife sanctuaries, Bio sphere
extinction due to human activities’. reserves, Zoological parks, National
Write major causes of biodiversity parks, Sacred groves
losses (HSE March 2021)(2) (HSE-March-2019)(1)
13. “Species diversity is greater in 19. The causes of biodiversity loss are
tropical regions than in temperate designated as "EVIL QUARTET".
regions.” Give reasons. Explain the Evil Quartet in
(HSE March 2021)(2) biodiversity loss.
14. (a) The term ‘biodiversity’ was (HSE-March-2019)(2)
popularised by _________. 20. Human beings can conserve and
(b) Name the two types of protect ecosystem and biodiversity.
biodiversity conservation. Prepare a handout to show
(c) Write any three causes of different methods of biodiversity
biodiversity loss. conservation? (HSE-June 2018)(2)
(HSE-July 2020)(3) 21. Observe the graph and answer the
15. Select the cause of extinction of following questions
Cichlid fish in lake Victoria of East (HSE-March 2018)(3)
Africa. (HSE-March 2020)(1)
(a) Habitat loss and fragmentation
(b) Over-exploitation
(c) Alien species invasions
(d) Co-extinctions

(HSE-June 2016)(3)
28. Observe the concept diagram of Evil
Quartet of biodiversity loss
(HSE-March 2016)(2)
a) Name S,A,C and Z in the graph

b) Name the scientist who explained
species-area relationship
22. "Theaccelerated rates of species
extinction thatthe world is facing
today is largely due to human
activities". (HSE-Model 2018)(3) a)Write A and B
Do you agree with this b)What is co-extinction ?
statement.Justify youranswer.
23. Explain the levels of biodiversity? 29. Read the statement and chose the
(HSE-JUNE-2017)(3) correct option (HSE-March 2014)(1)
24. Explain different types of
biodiversity conservation with
example (HSE-JUNE-2017)(3)
25. Distinguish between in
situconservation from ex
situconservation with one example
each ? (HSE-March-2017)(2) 30. Two approaches for the
26. “When we conserve and protect conservation of biodiversity is
the whole ecosystem, its shown as A and B(HSE-June 2015)(3)
biodiversity at all levels is
protected”. Based on this statement
explain the strategies of biodiversity
conservation (HSE-June 2016)(3)
27. “when need turns to greed, it leads
to biodiversity loss”. Substantiate
this statement by explaining two a)Identify the type of conservation
causes of biodiversity loss. shown in A and B?

b)Write the difference between two a)Which area show maximum
types of biodiversity conservation species richness ?
shown in A and B? b)what are the expected reasons for
c)Which of the above approach is the loss of biodiversity in area with
more desirable when there is an low species richness ?
urgent need to save species ? (HSE-May 2013)(3)
31. We have moral responsibility to 35. “Nature does lot of service for
take good care of earth’s which an economic value or price
biodiversity and pass it on in good tag cane put” substantiates giving
order to next generation. examples. (HSE-March 2013)(2)
a)Define biodiversity? 36. “Conservation of biodiversity is a
b)write causes for biodiversity loss? collective responsibility of all
c)Name two type of biodiversity nations”. Write a slogan stressing
conservation ? (HSE-March 2015)(3) the significance of biodiversity
32. a)Variety of species are present conservation? (HSE-March 2013)(1)
around us, what they constitute and 37. Last twenty years alone have
comment? witnessed the disappearance of 27
b)comment on in situ conservation animal species from earth.
and ex situ conservation? (June2012)(3)
c)In these aspect explain the a)Name the animal disappeared
concept of hot spot with example- recently
give importance to recent issues b) What may be the causes of this
with regard to western ghat loss ?
(HSE-June 2014)(3) c) How can we conserve
33. “Nature provides all for the need of biodiversity?
man but not for his greed” 38. The given graph shows the
a)Do you agree with this statement? distribution of insects in different
Justify your answer latitude of earth (March-2012)(3)
b)distinguish between two types of
biodiversity conservation ?
(HSE-March 2014)(3)
34. While preparing the species are
relationship graph of 4 areas, the
following Z values are obtained
Area A =0.1
Area B= 0.8
Area C =1.2
Area D= 0.3

a)What is your observation ?b)List the
three reasons for greater biodiversity in
tropical region ?
c)Write 2 causes of biodiversity loss ?
Click here to watch video lesson

Plus Two Zoology Notes Navas-2024-25 - Hssreporter - Com

Uploaded by

Copyright:

Available Formats

Plus Two Zoology Notes Navas-2024-25 - Hssreporter - Com

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Plus Two Zoology Notes Navas-2024-25 - Hssreporter - Com

Uploaded by

Copyright:

Available Formats

SOHSS-AREEKODE NAVAS CHEEMADAN

Chapter-01  All these reproductive events occur only

Downloaded from hssreporter.com

Seminiferous tubules Rete testis Vasa

NAVAS CHEEMADAN/2024 [email protected]

Downloaded from hssreporter.com

Seminal Plasma + Sperm = Semen

 The female reproductive system is located

NAVAS CHEEMADAN/2024 [email protected]

Downloaded from hssreporter.com

NAVAS CHEEMADAN/2024 [email protected]

Downloaded from hssreporter.com

NAVAS CHEEMADAN/2024 [email protected]

Downloaded from hssreporter.com

 Spermatogenesis starts at the age of

NAVAS CHEEMADAN/2024 [email protected]

Downloaded from hssreporter.com

NAVAS CHEEMADAN/2024 [email protected]

Downloaded from hssreporter.com

NAVAS CHEEMADAN/2024 [email protected]

Downloaded from hssreporter.com

Downloaded from hssreporter.com

 10-17 days of menstrual cycle is called C) Fertilisation

Downloaded from hssreporter.com

Inner cell mass contains certain cells

 The morula continues to divide and

NAVAS CHEEMADAN/2024 [email protected]

Downloaded from hssreporter.com

 After implantation, finger-like

 hCG, hPL and relaxin are produced

 In the later phase of pregnancy, a

Downloaded from hssreporter.com

 The mammary glands of the female

NAVAS CHEEMADAN/2024 [email protected]

Downloaded from hssreporter.com

Chapter 4 Strategies for Reproductive Health

Downloaded from hssreporter.com

NAVAS CHEEMADAN/2024 [email protected]

Downloaded from hssreporter.com

ii) Withdrawal or coitus interruptus :

Downloaded from hssreporter.com

ii) Diaphragms, cervical caps and vaults

C) IUDs (Intra Uterine Devices)

Downloaded from hssreporter.com

G) Surgical Methods (sterilisation)

These techniques are highly effective but

Qn. Note the relationship between the first

NAVAS CHEEMADAN/2024 [email protected]

Downloaded from hssreporter.com

NAVAS CHEEMADAN/2024 [email protected]

Downloaded from hssreporter.com

 The Medical Termination of Pregnancy

NAVAS CHEEMADAN/2024 [email protected]

Downloaded from hssreporter.com

Downloaded from hssreporter.com

1. Name an oral contraceptive for females developed

11. Select the odd one. Justify your selection. (1)

(i) Name hormones A and B.

Previous year Question/+2/2024 [email protected]