Final revision module 102 practical

Lab equipments

Centrifuge:

Spectrophotometer

Full automated chemical analyzer

1
Semi-automated chemical analyzer

Thermal cycler : for PCR

Electrophoresis system:

2
 Real- time PCR system: used to measure gene expression.

Determination of Ph
 pH: is the negative value of log of [H+] or pH = -log [H+]
In case of water [H+] = 10-7 pH = -log 10-7 = 7

ACIDS AND BASES

 Acids are substances, when dissolved in H2O produce increase in [H+] (or termed proton
donors) e.g. HCl.
HCl H+ + Cl-
 Basic or alkaline solutions are solutions that contain OH- in excess of H+. In some cases by
providing OHˉ as in NaOH, and in other cases by combining with H+ as in amines (act as proton
acceptor).

Solutions in water are classified into 3 types according to their pH.

1- Neutral solutions (pH = 7): contain [H+] = [OH-] e.g. pure water and NaCl in H2O.
2- Acidic solutions (pH <7): contain [H+] > [OH-] or their [H+] >10-7.
3- Basic solutions (pH >7): contain [H+] < [OH-] or their [H+] <10-7.
pH is determined by p meter, pH strips, pH indicators

3
 BUFFERS

Definition:
They are solutions that resist changes in their pH when moderate amounts of acids or bases are
added.
Composition and Types:
There are mainly two types:
1- (Acidic buffer) A weak acid and its salt with strong base, for example:
Acetic acid / Na acetate mixture (CH3COOH / CH3COONa).
Carbonic acid / Na-bicarbonate mixture (H2CO3 / NaHCO3).
2- (Basic buffer) A weak base and its salt with strong acid ,for example:
Ammonium hydroxide / ammonium chloride (NH4OH / NH4Cl) mixture.

Mechanism of Action:
For example in case of H2CO3 / NaHCO3
1- Addition of a strong acid as HCl to carbonic / bicarbonate system. It reacts with the
bicarbonate as follows: NaHCO3 + HCl NaCl + H2CO3
So HCl which is a strong acid is neutralized forming NaCl and H2CO3. The latter is a weak acid
which produces minimal change in the pH of the solution.
2- Addition of strong base as NaOH to carbonic / bicarbonate system. It reacts with carbonic acid
as follows: H2CO3 + NaOH NaHCO3 + H2O
NaHCO3 is a weak basic salt, which produces minimal change in the pH of the solution and the OH-
of NaOH is neutralized to form water.

Physiological Buffers

They keep the pH of the blood and tissue around 7.4, for optimum function of body enzymes.
Physiological buffers include the following:
1- Carbonic / bicarbonate system (H2CO3 / BHCO3).
2- Acid phosphate / alkaline phosphate system (BH2PO4 / B2HPO4).
3- Acid protein / proteinate salt system (H-proteinic acid / B-proteinate)
4- Hemoglobin / oxy hemoglobin system which is present only in red blood cells
(RBC’s) and specific for buffering of CO2 or H2CO3 produced by oxidation in tissues).
N.B. B means Na+ in extracellular or K+ in intracellular buffers.

The most important buffer system is the carbonic / bicarbonate system, because:
 It is present in higher concentration:
Carbonic acid is easily formed at the tissues from CO2 by the carbonic anhydrase enzyme.

H2CO3 Carbonic anhydrase CO2 + H2O

(Tissues) (Lungs)

 At the lungs, due to low CO2 tension, the carbonic anhydrase reaction is reversed with release of
CO2, which is excreted with expired air.

N.B:
 The ratio between BHCO3 to H2CO3 in blood is 20 to 1 (20/1) at the normal pH (7.4).

4
 The phosphate buffer would be more efficient than the bicarbonate system at
physiological pH 7.4.
 The bicarbonate buffer system is more important because of its presence in much
higher concentration than the phosphate buffer in blood plasma.

Acid base imbalance

Acidosis Alkalosis
Decrease in HCO3- / H2CO3 ratio (less Increase in HCO3- / H2CO3 ratio (more
than 20 / 1) so pH is less than 7.35. than 20 / 1) so pH is more than 7.45.
Causes of Respiratory Acidosis: Causes of respiratory alkalosis:
(failure of lung to excrete H2CO3) (decrease H2CO3 in blood by
asphyxia, bronchial asthma, emphysema hyperventilation), Aspirin overdose,
and massive pneumonia, morphia (cause CNS diseases (meningitis and
depression of respiratory center) encephalitis), Fevers, Hysterical attacks
and high altitudes
Compensation of Respiratory Acidosis: Compensation of Respiratory
increased excretion of acids (H+) and Alkalosis: The kidneys respond by
increased reabsorption of bicarbonate increasing excretion of HCO3 and
(HCO3- ) by the kidneys decreases excretion of H+.
Causes of metabolic acidosis: (decrease Causes of metabolic alkalosis (increase
of HCO3-) High protein diet, severe of HCO3): vomiting (high intestinal
muscular exercise, renal failure, ketosis obstruction) or repeated gastric wash
(severe uncontrolled diabetes mellitus, (loss of gastric HCL), high fruits and
starvation and carbohydrate deficiency) vegetables diet, Administration of alkalis
diarrhea, vomiting (due to low intestinal for treatment of peptic ulcer &
obstruction) hyperacidity
Compensation of metabolic acidosis: Compensation of Metabolic Alkalosis:
primary: increased rate of respiration there is depression of the respiratory
with removal of CO2 from blood by the center which decreases the rate of
lungs (Kausmal breath) secondary: by respiration and decreases the excretion of
the kidneys (except in renal acidosis). CO2 by the lungs and renal
compensation

Arterial Blood Gases (ABG) in Normal Subjects and in Different Types of Acidosis and
Alkalosis at 37oC
[HCO3-] PCO2 pH
mmol/L mm Hg
Normal Subject 22-26 35-45 7.35-7.45

I- Respiratory Acidosis

a- Uncompensated Normal Increased Decreased

b- Partial compensation Increased Increased near 7.35

5
 II- Metabolic Acidosis

a- Uncompensated Decreased Normal Decreased

b- Partial compensation Decreased Decreased near 7.35

III- Respiratory Alkalosis

a- Uncompensated Normal Decreased Increased

b- Partial compensation Decreased Decreased near 7.45

IV- Metabolic Alkalosis

a- Uncompensated Increased Normal Increased

b- Partial compensation Increased Increased near 7.45

N.B: full compensation occur if pH become normal.

MCQ Questions
1. In a man presented with pneumonia, measurement of arterial blood gas shows pH 7.3,
PaCO2 68 mm Hg, and HCO3- 28 mmol/L. How would you interpret this?
A) Partially compensated respiratory acidosis
B) Partially compensated metabolic acidosis
C) Uncompensated respiratory acidosis
D) Uncompensated metabolic Alkalosis

6
The answer is A: Partially compensated respiratory acidosis

2. A diabetic student was admitted to the hospital due to excess vomiting . Measurement of
arterial blood gas shows pH 7.2, PaCO2 23 mm Hg, and HCO3 12 mmol/L. What is your
assessment?
A) Partially compensated respiratory acidosis
B) Partially compensated metabolic acidosis
C) Uncompensated respiratory acidosis
D) Uncompensated metabolic Alkalosis
The answer is B: Partially compensated metabolic acidosis

3. A 21 year old man is brought in by his father with a one week history of vomiting.
He has been diagnosed with Hashimoto’s thyroiditis by his local doctor 4 months
previously. These are his venous blood gas results:

pH 7.31 pCO2 39 HCO3- 19 pO2 25

Comment on the acid – base balance state

Metabolic acidosis- uncompensated

4. Case 4:

Respiratory acidosis full compensated

5. A patient has been receiving Morphine intravenously for complaining of severe back pain.
His respiratory rate is 7 per minute and measurement of arterial blood gas shows pH 7.10,
PaCO2 70 mm Hg and HCO3 24 mEq/L. What does this mean?
A) Partially compensated metabolic alkalosis
B) Partially compensated respiratory acidosis
C) Uncompensated metabolic acidosis
7
 D) Uncompensated respiratory acidosis
The answer is D: Uncompensated respiratory acidosis
6. An athelete climbed mountain. He became drowsy. Measurement of arterial blood gas
reveals pH 7.6, PaO2 120 mm Hg, PaCO2 31 mm Hg, and HCO3 25 mmol/L. What
does this mean?
A) Partially compensated respiratory acidosis
B) Partially compensated metabolic alkalosis
C) Uncompensated metabolic alkalosis
D) Uncompensated respiratory alkalosis
The answer is D) Uncompensated respiratory alkalosis
7. patient was diagnosed as having gastroenteritis and dehydration. Measurement of
arterial blood gas shows pH 7.5, PaCO2 40 mm Hg, and HCO3 34 mmol/L. What acid-
base disorder is shown?
A) Uncompensated metabolic alkalosis
B) Uncompensated respiratory alkalosis
C) Partially compensated respiratory acidosis
D) Partially compensated metabolic alkalosis
The answer is A) Uncompensated metabolic alkalosis
8. Metabolic acidosis is caused by:
a. Uncontrolled diabetes with ketosis
b. Pneumonia
c. Fever
d. Morphine poisoning
9. Respiratory alkalosis occurs in:
a. Depression of respiratory center
b. Fever
c. Renal failure
d. Loss of intestinal fluids
10. A 3-year old child was brought to the hospital with a cough and difficulty in
respiration. Physical examination suggested pneumonia. Choose the most likely acid-
base imbalance state.
a. Metabolic Acidosis
b. Metabolic Alkalosis
c. Respiratory Alkalosis
8
 d. Respiratory Acidosis
11- Buffer solutions are characterized by which of the following?
a. Always have a pH of 7
b. Tend to maintain a relatively constant pH
c. Cause a decrease in pH when acids are added to them
d. Are rarely found in living systems
12- A 10 year old child suffers from fever and hyperventilation uncontrollably. His
initial arterial blood gas (ABG) results are as follows:
Patient value Normal range
pH 7.5 7.35-7.45
PCO2 29 mmHg 35-45 mmHg
-
HCO3 23 mmol/L 22-26 mmol/L

a. Respiratory acidosis
b. Metabolic acidosis
c. Respiratory alkalosis
d. Metabolic alkalosis

13- How could you interpret the following ABG results?

Patient value Normal range
pH 7.3 7.35-7.45
PCO2 60 mmHg 35-45 mmHg
-
HCO3 29 mmol/L 22-26 mmol/L

a. Normal ABG values

b. Respiratory acidosis without compensation
c. Respiratory acidosis with partial compensation
d. Respiratory acidosis with full compensation
14- A patient was suffering from persistent vomiting for two days. She was diagnosed
as having gastroenteritis and dehydration. How could you interpret her ABG?

Patient value Normal range

pH 7.5 7.35-7.45
PCO2 40 mmHg 35-45 mmHg
HCO3- 34 mmol/L 22-26 mmol/L

a. Respiratory acidosis
b. Metabolic acidosis
c. Respiratory alkalosis
d. Metabolic alkalosis

15- Buffers are:

a) Used to maintain the pH constant.
b) Mixture of weak base and its salt with strong base.
c) Mixture of weak acid and its salt with weak base.
d) a and c.
9
 e) a and b.
16- The most important physiologic buffer is:
a) Hb system.
b) Phosphate system.
c) Protein system.
d) Citrate system.
e) Carbonic bicarbonate system
17- The pH of blood is 7.4 when the ratio between H2CO3 and HCO3- is :

a) 1: 10
b) 1: 20
c) 1: 25
d) 20: 1
e) None of the above.
18- Acidosis is due to:
a) Addition of acids.
b) Failure of excretion of H2CO3.
c) Loss of bases.
d) All of the above.
19- All the following are causes of respiratory acidosis except:

a) Pneumonia.
b) Bronchial asthma.
c) Emphysema.
d) Morphia.
e) Hyperventilation.
20- Respiratory acidosis is compensated by:
a) Increase excretion of acids.
b) Increase reabsorption of bicarbonate by kidney.
c) Decrease reabsorption of bicarbonate by kidney.
d) a and b.
e) a and c.
21- Ketosis leads to:
a) Respiratory alkalosis.
b) Respiratory acidosis.
c) Metabolic alkalosis.
d) Metabolic acidosis.
e) Alkalemia.
22- Severe Diarrhea leads to:
a) Metabolic alkalosis.
b) Respiratory acidosis.
c) Metabolic acidosis.
d) Respiratory alkalosis.
23- Metabolic alkalosis is characterized by the following except:
a) There is increase in bicarbonate concentration.
b) There is decrease H2CO3 / HCO3- ratio.
c) Compensated by decrease bicarbonate excretion.
d) Compensated by increase bicarbonate excretion.

10
 ELECTROPHORESIS
Definition: It is the migration of a charged molecule in an electric field. It is used for separating
amino acids, proteins, peptides and nucleic acids.
Theory of Electrophoresis:
- Separation of molecules according to their charges and molecular weight.
- Cations migrate to the cathode (-) and anions move towards the anode (+) at various rates
depending on various factors. e.g. amino acid.
Factors affecting the velocity of migration of molecules:
1- Size, shape, and net charge of the particles
2- pH of the medium
3- Strengths of electric field
4- Properties of supporting medium
5- Temperature
Electrophoresis equipment:
(1) Power Supply: To provide the necessary direct current.
(2) Electrophoresis Unit: For separation of the required molecule.

This unit consists of:

1- Electrodes: Cathode (-ve) and anode (+ve). Best types of electrodes are made of platinum
(stainless steel type may be eroded by the buffer).
2- Buffer reservoirs (tanks or chambers).
3- A support for the electrophoretic medium.
4- A transparent insulating cover to minimize evaporation of buffer.

Buffers:
a. Importance of buffers:
1- They transmit electric current.
2- They adjust the pH: so they can determine the electric charge on the solute to be separated..
3- They facilitate migration of the substance to be separated.
b. The rate of migration of solute molecule and the sharpness of the zone are affected
by the followings:
a. pH of the buffer.
b.Ionic strength of the buffer.

11
 Examples of stains used:
1- Bromophenol blue for proteins.
2- Ninhydrin for amino acids.
3- Sudan black for lipoproteins.
4- Iodine for polysaccharides.
5- Ethidium bromide for DNA
 Quantitation of the separated zones: This can be done by either:
1. Direct densitometry, or
2. Eluting the dye followed by spectrophotometric measurement.

Hemoglobin electrophoresis
Normal hemoglobin:
Form Chain composition Fraction of total hemoglobin
HbA 22 95 – 98%
HbF 22 < 2%
HbA2 22 2 – 5%

12
Abnormal hemoglobin:
Form
β-thalassemia minor HbA decrease HbA2 increase, no increase in HbF
β-thalassemia major HbA absent HbA2 increase and HbF increase
HbA2 22
Sickle cell trait (AS) HbA decrease and HbS increase
Heterozygous
Sickle cell disease (SS) HbA absent and HbS increase
Homozygous

A- Sickle cell disease (HbS disease)

• It is a genetic disorder of the red blood cells caused by a single nucleotide
alteration (a point mutation) in the β-globin gene.
• A molecule of HbS contains two normal α-globin chains and two mutant β-globin
( βs) chains
• Which the polar glutamate at position 6 has been replaced with a nonpolar valine.
Types:
• Sickle cell trait; heterozygous; 1 allele is affected
• Sickle cell anemia (disease); homozygous; 2 alleles are affected

13
 B. Thalassemias
β-Thalassemia :
• In these disorders, synthesis of β-globin chains is decreased or absent, whereas α-
globin chain synthesis is normal.
• β-Thalassemia is associated with increased HbF as well as HbA2.

14
15
16
 MCQ Questions

1- Which instrument is represented in the following figure?

a. A centrifuge
b. A colorimeter
c. An electrophoresis apparatus
d. A sensitive balance

2- Which stain can be used in electrophoresis of proteins?

a. Bromophenol blue
b. Sudan black
c. Iodine
d. Ethidium bromide
3- Which stain can be used in electrophoresis of DNA?
a. Bromophenol blue (protein)
b. Sudan black (lipoprotein)
c. Iodine (polysaccharide)
d. Ethidium bromide (DNA)
e. Ninhydrin (amino acids)
4- The electrode used in electrophoresis is better made of?
a. Stainless steel
b. Platinum
c. Iron
d. Copper

5- The electrophoresis is used to separate all of the following except?

a. Amino acids
b. Polysaccharides
c. DNA
d. Peptides
e. protein

17
6- How could you interpret lane 2 of this electrophoresis (provided that lane 1 is the
control?

a. Homozygous sickle cell (lane 3)

b. Heterozygous sickle cell (lane 2)
c. Thalassemia major
d. Thalassemia minor
e. Normal hemoglobin (lane 1)

7- How could you interpret lane 2 of this electrophoresis (provided that lane 1 is the
control?

a. Homozygous sickle cell

b. Heterozygous sickle cell
c. Thalassemia major
d. Thalassemia minor

8- What is the cause of genetic disorder in the electrophoretic pattern of lane 2?

a. A frame shift mutation

b. Replacing glutamate at position 6 of β chain with valine.
c. Defective synthesis of β-globin chains
d. Defective synthesis of α-globin chain
18
9- How could you interpret this electrophoretic pattern?

a. Sickle cell anemia

b. Sickle cell trait
c. Thalassemia major
d. Thalassemia minor

10- How could you interpret this electrophoretic pattern?

a. Homozygous sickle cell

b. Heterozygous sickle cell
c. Thalassemia major
d. Thalassemia minor
11- How could you interpret the electrophoretic pattern of the lower lane?

a. Sickle cell anemia

b. Sickle cell trait
c. Thalassemia major
d. Thalassemia minor

19
 DNA and MOLECULAR BIOLOGY
Gene analysis and Recombinant DNA technology
 The science that deals with the structure of genes, pathological defects, and possible
therapy.
 The ability to isolate, analyze and prepare genes are possible through DNA technology.

DNA Extraction
1- Lysis
 The cellular and the nuclear membranes are broken, releasing DNA.
 This process involves mechanical disruption and uses enzymes and detergents like
Proteinase K to dissolve the cellular proteins and free DNA.

2- Precipitation
 Separation of the freed DNA from the cellular debris.
 It involves use of sodium (Na+) ions to neutralize any negative charge in DNA
molecules, making them less water soluble and more stable.
 Alcohol (e.g isopropanol or ethanol) is added, causes precipitation of DNA from
the aqueous solution since it does not dissolve in alcohol.

20
 3- Purification
 Removing all the remaining cellular debris and unwanted material
 It involves rinsing with alcohol. Once the DNA is completely purified, it is usually
dissolved in water again for convenient storage and handling (elution).

DNA Quantification

Spectroscopic Quantification:
 Measuring the intensity of absorbance of the DNA solution at wavelengths 260 nm and
280nm is used as a measure of DNA purity.
- DNA absorbs UV light at 260 and 280 nm
- aromatic proteins absorbs UV light at 280 nm;
- a pure sample of DNA has the 260/280 ratio at 1.8 and is relatively free from protein
contamination.
A DNA preparation that is contaminated with protein will have a 260/280 ratio lower than 1.8

21
 Restriction Endonucleases
 They are bacterial enzymes.
 Their function is to restrict the viral growth inside the bacteria.
 The host (bacterial) DNA is protected by being methylated.
 Many restriction endonucleases are known, and they are named according to the species
from which they were isolated.
- The 1st letter indicates the genus.
- The other 2 letters indicate the species.
- Roman number identify the enzyme (indicate the sequence of discovery).
- Like EcoRI isolated from Escherichia coli (E. coli, Rough strain).
 Over 3000 restriction enzymes have been studied and more than 600 are available
commercially and are routinely used for DNA modification and manipulation.
Mechanism of action of restriction endonuclease

 There are two main ways in which the DNA can be cut:
 Each restriction enzyme produce cleavage of the 2 strands at a certain site called
restriction site which is a part of restriction sequence (4 to 8 nucleotides).

22
Importance of restriction Endonuclease
Binds 2 DNA molecules from 2 different sources together (Recombinant DNA or chimeric
molecule)

DNA markers
 A genetic marker is a gene or DNA sequence with a known location on a chromosome
that can be used to identify cells, individuals or species.
 Most of our DNA is identical to DNA of others. However, there are inherited regions of
our DNA that can vary from person to person.
 Variations in DNA sequence between individuals are termed "polymorphisms"
Types of DNA markers
1. Single nucleotide polymorphism (SNP)
2. Restriction fragment length polymorphism (RFLP)
3. Short tandem repeats (Str)
1. Single nucleotide polymorphism (SNP):
 It is pronounced snip.
 It is a DNA sequence variation occurring when a single nucleotide A, T, C, or G
in the genome differs between members of a biological species or paired
chromosomes in an individual.
 It occurs once in 500 to 1000 bp in non-coding sequences and once in 1000 to
3000 in coding sequences.
 In humans about 300,000 SNPs were identified and located.

23
 SNPs in the coding region are of two types, synonymous and nonsynonymous SNPs.
 Synonymous SNPs: do not affect the protein sequence
 Non-synonymous SNPs: change the amino acid sequence of protein.

2. Restriction fragment length polymorphism (RFLP):

 Digestion of DNA by certain restriction endonucleases results in fragments of different

length
 Used in diagnosis of genetic diseases i.e. sickle cell anemia

3. Short tandem repeats (Str):

 STRs are short sequences of DNA, normally of length 2-6 base pairs.
 The number of repeat units is highly variable among individuals, which offer a high
power of discrimination when analyzed for identification purposes.

24
 Uses of DNA markers
1. Diagnosis of genetic diseases
2. Individual identification test (DNA fingerprinting)
3. Gene mapping

25
 DNA Amplification Techniques
DNA amplification techniques include:
I- DNA cloning (in vivo method).
II- Polymerase chain reaction or PCR (in vitro method).

I-DNA Cloning
A clone is a large number of identical molecules, or cells.
Vectors:
Definition: it is a DNA molecule used as a vehicle to transfer foreign genetic material into another
cell.
Properties of vectors:
1. Capable of replication inside the host cell.
2. Contains at least 1 restriction site for 1 restriction endonuclease
26
Vectors include:
Plasmid They are double- It is used to clone small
stranded circular DNA DNA fragments (10 kb).
Smaller than bacterial
chromosome.
Multiply independent of
the bacterial
chromosome.
Phage It is a virus that infects It is used to clone large
bacteria. DNA fragments (20 kb).

cosmid It is synthetic vector It is used to clone large

Plasmid containing cos DNA fragments (50 kb).
site of phage
(responsible for
packaging of DNA).

The process of cloning consists of:

1- The plasmid is isolated then cut with a restriction enzyme forming cohesive ends.
2- The foreign DNA is cut by the same restriction enzyme.
3- The cohesive ends of the foreign DNA anneal with the ends of the plasmid DNA and joined
by DNA ligase to form a recombinant plasmid DNA.
4- The recombinant plasmid DNA is introduced into bacteria by transformation.
5- The bacterial cells are allowed to divide and the recombinant plasmid DNA undergoes
replication and amplification.

27
 II- PCR = Polymerase Chain Reaction

Definition: in-vitro method for amplification of a sequence of DNA.

The reaction requires the following:

a- Two oligonucleotide primers.

b- Thermostable DNA polymerase (Taq polymerase).

c- All the four deoxyribonucleoside triphosphates.

d- DNA to be amplified.

PCR is done in cycles. Each cycle comprises the following three steps:

1- Denaturation: The mixture is heated to 95oC for 30 sec. to denature the DNA and separate the
two strands.

2- Primer annealing: The mixture is cooled to 50 oC to allow the two primers to bind to the two
strands of the target DNA.

3- Elongation: The mixture is heated to 72 oC to allow the polymerase to elongate each primer.

4- Cycles are repeated: In each cycle the target DNA is doubled. After 10 cycles the DNA is
multiplied 103 times. After 30 cycles the DNA is doubled 109 times.

28
29
Advantages of PCR over cloning:

1- PCR is more sensitive, faster, and less technically difficult after the use of automated
thermocyclers.

Applications of PCR:

1- It allows synthesis of DNA for sequencing or cloning.

2- Diagnosis study and of genetic disease e.g. sickle cell anemia.
3- Diagnosis of viral disease as HIV.
4- Synthesis of human proteins (e.g. insulin), synthesis of vaccines (e.g. hepatitis B virus) and
synthesis of antibodies (e.g. monoclonal antibodies).
5- Gene therapy.
6- Forensic analysis.

PCR results analysis

30
31
32
 Gene Therapy
 Diseases caused by deficiency of gene product are liable to treatment by replacement
therapy.
 The strategy is to clone the gene into a vector and incorporate into the genome of host
cells.
 The introduced gene begins to direct expression of its protein products and correct the
deficiency in the host cells.
33
 The technique is still under trial and not well established.
 Two approaches have been used, ex-vivo and in-vivo gene delivery.
1- Ex-vivo gene delivery: Cells are taken from a patient, the new gene is
inserted, and the cells are then replaced.
2- In-vivo gene delivery: It is by targeting the gene directly to the patient’s
tissues

MCQ Questions
1. Regarding restriction enzymes which is incorrect:
a) It is isolated from bacteria
b) It restricts viral infection
c) It digests the host DNA
d) It is used in preparation of recombinant DNA
2. DNA cloning is used for:
a) Amplification of RNA in vitro
b) Amplification of DNA in vitro
c) Amplification of DNA in vivo
d) Amplification of RNA in vivo

3. Cloning does NOT require one of the following:

a) Thermus aquaticus DNA polymerase (Taq polymerase)
b) Restriction enzyme
c) Cloning vector
d) Recombinant DNA molecule
4. Polymerase chain reaction (PCR) is NOT characterized by:
a) It is an in-vitro method for amplification of DNA.
b) It needs a restriction enzyme.
c) It needs Thermus aquaticus DNA polymerase (Taq polymerase).
d) It needs the four deoxyribonucleoside triphosphates.

5. Which of the following matches stage 1 of PCR?

Stage 1 stage 2 stage 3

a. Denaturation
b. Elongation
c. Annealing
d. Termination

34
 6. Which of the following is required for PCR?
a. Ribonucleoside triphosphate
b. Thermostable polymerase.
c. A plasmid
d. Restriction Enzymes
7. Which of the following is required for cloning?
a. Ribonucleoside triphosphate
b. Thermostable polymerase.
c. RNA polymerase
d. Restriction Enzymes

8. Which of the following is an application of PCR?

a. Separation of proteins
b. Centrifugation of blood samples
c. Amplification of DNA from hair samples
d. Measuring glucose levels in serum samples

9. The elongation temperature of PCR is:

a. 35º C
b. 50º C (primer annealing)
c. 72º C (elongation)
d. 95º C (denaturation)

10. Which of the following applies to PCR?

a. It is in vivo amplification of DNA.
b. A plasmid and foreign DNA are cut by the same restriction endonuclease.
c. ATP, GTP, CTP, and UTP nucleotides are needed
d. It allows detection of viral infection as HIV

11. What is the role of ethyl alcohol during extraction of DNA?

a. Breaks the cellular and the nuclear membranes (detergents as proteinase K)

b. Dissolve the cellular proteins and free DNA.
c. Neutralize any negative charge in DNA molecules (Na)
d. Precipitates of DNA from the aqueous solution (ethanol)

12. Which of the following is characteristic to a plasmid?

a. It is a virus that can infect bacteria.

b. It clones small DNA fragments (up to 10 kb).
c. It is larger than the bacterial chromosome.
d. It multiplies only with the bacterial chromosome.

13. Which of the following is characteristic to a phage?

a. It is a virus that can infect bacteria and clone 20 kb

b. It clones small DNA fragments (up to 10 kb).
c. It is larger than the bacterial chromosome.
35
 d. It multiplies only with the bacterial chromosome.

14. Which of the following is characteristic to a cosmid?

a. It is synthetic and clone 50 kb

b. It clones small DNA fragments (up to 10 kb).
c. It is larger than the bacterial chromosome.
d. It multiplies only with the bacterial chromosome.

15- paternity test:

36
 16. Which is the melting temperature for the following DNA molecule?
3` TTACGTAGGCTACGTGACGC 5`
5` AATGCATCCGATGCACTGCG 3`

a. 64⁰ C
b. 62⁰ C
c. 60⁰ C
d. 58⁰ C

17. The following Covid-19 PCR curve shows:

a. Positive result
b. Negative result
c. Invalid test result
d. Inconclusive result

37