See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/6411253

A PCR-Based Sex Determination Method for Possible Application in Caprine

Gender Selection by Simultaneous Amplification of the Sry and Aml-X Genes

Article in Journal of Reproduction and Development · September 2003

DOI: 10.1262/jrd.49.307 · Source: PubMed

CITATIONS READS

36 1,059

3 authors:

Alice Phua Ramli Abdullah

UCSI University University of Malaya
1 PUBLICATION 36 CITATIONS 48 PUBLICATIONS 461 CITATIONS

SEE PROFILE SEE PROFILE

Zul Mohamed
University of Malaya
45 PUBLICATIONS 690 CITATIONS

SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Ethnobotany of Plant Resources among the Indigenous People of Cameron Highlands, Malaysia View project

In vitro production of goat embryos in Malaysia View project

All content following this page was uploaded by Alice Phua on 24 August 2018.

The user has requested enhancement of the downloaded file.

Journal of Reproduction and Development, Vol. 49, No. 4, 2003

—Original—

A PCR-Based Sex Determination Method for Possible Application

in Caprine Gender Selection by Simultaneous Amplification of
the Sry and Aml-X Genes
Alice Choon Yen PHUA1), Ramli Bin ABDULLAH2) and Zulqarnain MOHAMED1)
1)
Institute of Biological Sciences, Faculty of Science, University of Malaya, 50603 Kuala Lumpur,
2)
Institute of Postgraduate Studies, University of Malaya, 50603 Kuala Lumpur, Malaysia

Abstract. Sex determination of livestock is performed to achieve the objectives of livestock breeding
programmes. Techniques for sex determination have evolved from karyotyping to detecting Y-
specific antigens and recently to the polymerase chain reaction (PCR), which appears to be the most
sensitive, accurate, rapid and reliable method to date. In this study, a PCR-based sex determination
method for potential application in goat breeding programmes was developed. Primers were
designed to amplify a portion of the X amelogenin gene (Aml-X) on the X chromosome to give a 300 bp
product and Sry gene on the Y chromosome to give a 116 bp product. PCR optimization was
performed using DNA template extracted from a whole blood sample of Jermasia goats (German
Fawn × Katjang) of both sexes. It was possible to identify the sex chromosomes by amplifying both
male- and female-specific genes simultaneously in a duplex reaction with males yielding two bands
and females yielding one band. The Aml-X primer set, which served as an internal control primer, did
not interfere with amplification of the Y-specific sequence even when a low amount of DNA (1 ng)
was used. The duplex reaction subjected to a blind test showed 100% (14/14) concordance, proving its
accuracy and reliability. The primer sets used were found to be highly specific and were suitable for
gender selection of goats.
Key words: Goat, Polymerase chain reaction, Sex determination
(J. Reprod. Dev. 49: 307–311, 2003)

ex determination of livestock is performed to reaction (PCR) [2–9]. Among these procedures, the
achieve the objectives of livestock breeding PCR approach is generally favoured, as it appears
programmes. In th e livestock industry, it is to offer the most sensitive, accurate, rapid and
desirable to control the sex ratio of animals. For reliable technique [2–7]. In addition, due to its
example, modern dairy production benefits from simplicity and cost-effectiveness, PCR-based
the birth of female offspring. For meat production embryo sexing is becoming increasingly prevalent
systems, however, male offspring are generally compared to other methods [10] for commercial
advantageous because male animals tend to grow purposes [7–9]. For example, karyotyping is
faster and have better feed efficiencies [1]. successful for only about half of bovine embryos
Several approaches have been established for collected 7 days after estrus despite using up to half
genetic sex typing, such as karyotyping [11–13], H- the number of each embryo sample [11–13]. On the
Y antigen detection [17], X-linked enzymatic other hand, the X-linked enzymatic determination
determination [14, 15] and the polymerase chain of glucose-6-phosphate dehydrogenase (G6PD)
Accepted for publication: June 3, 2003
[14], or hypoxanthine phosphoribosyl transferase
Correspondence: Z. Mohamed (e-mail: [email protected]) (HPRT) [15], requires embryos to be sexed before
308 PHUA et al.

they undergo X chromosome inactivation, thus A f t e r i n c u b a ti o n , 2 0 0 µ l o f 6 M N a C l ( A P S

limiting this approach to cleavage and morula stage Chemicals, Seven Hills, NSW, Australia) was
embryos [16]. For the H-Y antigen detection added and vortexed vigorously. Then, two times
approach [17], despite a reported accuracy of over vo l u m e o f P h e n o l- C h l o ro f o r m K it ( P i e rc e ,
80% in sex determination assays of various species, Rockford, IL, USA) was added and the mixture was
the method has not been proven to be reproducible shaken vigorously until milky. After
[18]. ce n t r if u g a t io n , t h e t o p a qu e o u s la y e r w a s
To date, PCR-based embryo sexing had been transferred into a clean tube containing 900 µ l
established for bovine [2, 3, 5–9] and murine [19– absolute ethanol (Sigma, St. Louis, MO, USA). The
22] embryos. In the present study, an efficient and precipitated DNA was pelleted down and the
reliable PCR-based method for sexing goats (Capra supernatant discarded. The DNA pellet was
hircus) was described. This paper represents a pilot washed gently with 70% ethanol, and the DNA
study in which genomic DNA extracted from blood pellet was air-dried. The DNA was then dissolved
was utilized (instead of embryos) because design in 100 µl of TE buffer (10 mM Tris-Cl, 1 mM EDTA)
and optimiza ti on of variou s lab oratory containing 0.2 mg/ml RNase A (Amresco, Solon,
experimental conditions were required before OH, USA). The DNA concentration and its relative
applying to embryo sexing proper. Targeted sex purity were determined spectrophotometrically.
chromosome-specific genes for amplification Concentration of each DNA solution was adjusted
included the Sry gene located on the long arm of to 0.1, 0.2, 1, 2, 10, 20, 50 and 100 ng/ µ l for PCR
the goat Y chromosome and the X amelogenin gene purposes.
(Aml-X) on the X chromosome. In the present
study, the possibility of simultaneous amplification Primer design
of sequences corresponding to both X and Y Primers were designe d usin g the P RIMER
chromosomes in a duplex reaction to establish a Version 0.5 programme (C opyright 1991,
reliable, reproducible and efficient PCR-based Whitehead Institute for Biomedical Research). The
caprine sexing system was tested. primer sets were designed to amplify a portion of
the Aml-X gene (GenBank accession no. AF215887)
and Sry gene (GenBank accession no. Z30646),
Materials and Methods respectively. The primer sequences are as below.
Aml-X.5: 5’ CAGTAGCTCCAGCTCCAGCT 3’
Blood samples and DNA extraction Aml-X.3: 5’ GTGCATCCCTTCATTGGC 3’
Blood samples were obtained from 14 male and Sry.5: 5’ ATGAATAGAACGGTGCAATCG 3’
female Jermasia goats (German Fawn × Katjang) Sry.3: 5’ GAAGAGGTTTTCCCAAAGGC 3’
and collected in EDTA Vacutainer® tubes (Becton
Dickinson, Plymouth, UK). Genomic DNA was Duplex PCR
extracted using the salting-out method. In this Polymerase chain reaction (PCR) was performed
method, the whole blood sample was mixed with in 25 µl of reaction mixture, containing 1 µl of DNA
1X lysis buffer (0.32 M sucrose, 5 mM MgCl2.6H2O, solution, 200 µM of each dNTP, 1.5 mM MgCl2, 5
1% Triton X-100 and 12 mM Tris-Cl, pH 7.5) to a pmoles of each forward and reverse Sry and Aml-X
total volume of 50 ml, mixed gently by inversion (1 primers (Alpha DNA, Montreal, Quebec, Canada),
min) and centrifuged (3500 rpm, 10 min, 10 C). The 1U Taq DNA Polymerase (Promega, Madison, WI,
supernatant was discarded, the pellet resuspended USA), 1X Buffer (Promega, Madison, WI, USA) and
in 20 m l 1X lys is b uf fe r a nd cen trifu g ed as 13.8 µl sterile ultrapure MilliQ water.
previously describe d. The supe rn atan t was Amplification was performed on a PTC-200 DNA
thoroughly discarded without disturbing the pellet. Engine T M th e rmal c ycler (M J R es earch In c.,
The pellet was then resuspended in 540 µ l of Watertown, MA, USA) using 0.2-ml reaction tubes.
solution containing 1X Proteinase K buffer (75 mM The P CR programme consisted of 5 min
NaCl, 24 mM EDTA), 0.0015% SDS (Amresco, denaturation at 94 C, followed by 34 cycles of
Solon, OH, USA) and 0.74 mg/ml Proteinase K denaturation (94 C, 45 sec), annealing (58 C, 45 sec)
(Promega, Madison, WI, USA). The mixture was and primer extension (72 C, 60 sec). The final cycle
incubated overnight at 37 C with gentle agitation. was followed by extension at 72 C for 7 min and
 PCR-BASED GENDER SELECTION OF GOATS 309

indefinite hold time at 25 C. The PCR products

were electrophoresed in 2% agarose gel stained
with ethidium bromide (0.5 µg/ml). The products
were viewed using UV illumination and
documented.

Results

The duplex PCR amplification using the Sry and

Aml-X primer sets with 100 ng genomic DNA per
reaction yielded the expected 116 bp and 300 bp
products (Fig. 1). Males are expected to show two
bands (116 bp and 300 bp) whereas females, one
band only (300 bp). No non-specific amplification
was observed.
As for duplex PCR in decreasing D NA
concentrations, both sexes yielded the expected
result in concentrations down to 1 ng genomic
DNA per reaction. However, no bands were Fig. 1. Duplex PCR assay using the Sry and Aml-X primers
for sex diagnosis. Aml-X product (300 bp) is amplified
observed at DNA concentrations under 0.2 ng per from the X-specific target sequence whereas Sry
reaction (Figs. 2A, B). product (116 bp) is amplified from the Y-specific
The result of the blind test for confirming the target sequence. Lane 1 contains female goat DNA
accuracy of the duplex PCR is presented in Table 1. and lane 2, male goat DNA. Lane 3 is a negative
control to check for contamination. L= 100 bp DNA
All sex determinations by the duplex PCR were in ladder.
agreement with the actual sexes of the goats from
which blood samples were obtained. This result
indicates that the duplex PCR-based sexing method
is 100% (14/14) reproducible and reliable.

Fig. 2. Duplex PCR in decreasing DNA concentrations. The Aml-X internal control primer (300 bp product) did not interfere
with amplification of the Y-specific target sequence (116 bp) even when a low amount of DNA template (1 ng) was used.
A. Lanes 1 to 8 contain male goat DNA at 100, 50, 20, 10, 2, 1, 0.2 and 0.1 ng per reaction of DNA template, respectively.
B. Lanes 1 to 7 contain female goat DNA at 50, 20, 10, 2, 1, 0.2 and 0.1 ng per reaction of DNA template, respectively. L=
100 bp DNA ladder.
310 PHUA et al.

Table 1. Comparison of sex determination results from primer also did not interfere with amplification of
duplex PCR and sex of goats from which blood the Y-specific target sequence, even when a low
was obtained amount of DNA template (1 ng) was used. This
Sexing by Sex of goats from was especially significant since Bredbacka et al. [3]
Blood sample duplex PCR which blood was had reported that in their study, all autosomal
obtained oligonucleotides tested seemed to interfere with
1 F F amplification of the Y-chromosome repetitive
2 M M sequence BRY.1, especially when a low amount of
3 F F
DNA template was used.
4 F F
5 F F
The duplex reaction was also subjected to a range
6 M M of annealing temperatures (48 C to 58 C) and the
7 M M reaction was found to work well at 56.5 C to 58.0 C.
8 M M However, in a separate trial, the duplex reaction
9 M M was subjected to an annealing temperature of 60 C
10 F F
in three different thermal cyclers: PTC-200 DNA
11 F F
12 M M Engine TM (MJ Research Inc., Watertown, MA,
13 F F USA), GeneAmp ® PCR System 9700 (PE Applied
14 M M Biosystems, Foster City, CA, USA) and GeneAmp ®
F=female, M=male. PCR System 9600 (Perkin-Elmer, Norwalk, CT,
USA). It was noticed that amplification was
efficient only in the GeneAmp ® PCR System 9700
Discussion and GeneAmp ® PCR System 9600. This difference
in performance could be due to differences in
In t his paper , w e d es cr ibe an accur at e, thermal cycling mechanisms between different
reproducible and reliable protocol for PCR-based makes and models, and calibration status [26, 27].
caprine sexing based on detection of the presence of Further duplex reaction tests were then conducted
target sequences, i.e., Aml-X and Sry. Although o n t h e G e n e A m p ® P C R S y st e m 9 6 0 0 u s in g
amplification of only the Y-specific target sequence annealing temperatures slightly lower than 60 C. It
(Sry, in this case) was sufficient to determine the was again observed that 56 C and 58 C annealing
gender as has been done successfully in bovine temperatures produced desirable results without
embryo sexing studies [3, 7, 23–25], the X-specific any compromise on the quality of the PCR product
target sequence (Aml-X) was included for a two- bands.
fold purpose. Firstly, it served as an internal I n c on clu sion , th e pr es en te d P CR du p lex
control in the discrimination of male and female protocol is reliable, accurate, reproducible and
with higher accuracy. This is especially important efficient for caprine sexing. Work is currently
for the future application of the protocol to caprine underway to refine this protocol for sexing of
embryo sexing. Secondly, it served as a PCR caprine embryos and sperm.
positive control ensuring that the absence of a Y-
specific product was not due to PCR failure, which
could generate a false negative result. Acknowledgements
A lthou gh th ere were no X- and Y-specific
products observed at DNA concentrations 0.2 and The authors would like to thank Mr. Jamaluddin
0.1 ng/µl, it may be possible to obtain the expected Alias for his technical assistance in obtaining the
products by increasing the number of cycles to 50 goat blood samples and to the Ministry of Science,
as has been done successfully in the sexing of Technology and the Environment, Malaysia, for
bovine embryos [3, 7]. The Aml-X internal control IRPA funding (01/02/03/696).

References

1. Silversides DW, Pilon N, Behdjani R, Boyer A, Daneau I, Lussier J. Genetic manipulation of sex
 PCR-BASED GENDER SELECTION OF GOATS 311

differentiation and phenotype in domestic animals. Theriogenology 2001; 55: 23–34.

Theriogenology 2001; 55: 51–63. 17. Anderson GB. Identification of embryonic sex by
2. Agrawala PL, Wagner VA, Geldermann H. Sex detection of H-Y antigen. Theriogenology 1987; 27:
determination and milk protein genotyping of 81–97.
preimplantation stage bovine embryos using 18. Veerhuis R, Hendriksen PJ, Hengst AM, Kruijt L,
multiplex PCR. Theriogenology 1992; 38: 969–978. Tieman M, Booman P. The production of anti-H-Y
3. Bredbacka P, Velmala R, Peippo J, Bredbacka K. monoclonal antibodies: Their potential use in a sex
Survival of biopsied and sexed bovine demi- test for bovine embryos. Vet Immunol Immunopath
embryos. Theriogenology 1994; 41: 1023–1031. 1994; 42: 317–330.
4. Herr CM, Matthaei KI, Bradley MP, Reed KC. 19. Cui KH, Putland RA, Seamark RF, Mattheros CD.
Rapid accurate sexing of livestock embryos. In: Hill Precise sex-selected births of mice following single
WG, Thompson R, Woolliams JA (eds.), Proceedings cell embryo biopsy and Y-linked testis-specific gene
of the 4th World Congress on Genetics Applied to analysis. Human Reprod 1993; 8: 621–626.
Livestock Production, Edinburgh, 1990; 16: 334–343. 20. Dreesen JCFM, Dumoulin JCM, Evers JLH,
5. Kirkpatrick BW, Monson RL. Sensitive sex Geraedts JPM, Pieters MHEC. Multiplex
determination assay applicable to bovine embryos polymerase chain reaction for sex determination of
derived from IVM and IVF. J Reprod Fert 1993; 98: single mouse blastomeres. Mol Human Reprod 1995;
335–340. 10: 743–748.
6. Peura T, Hyttinen J-M, Turunen M, Jänne J. A 21. Tangchaisin P, Trirawatanapong TW,
reliable sex determination assay for bovine Pruksananonda K, Virutamasen P. Reliable sex
preimplantation embryos using the polymerase determination of mouse preimplantation embryos
chain reaction. Theriogenology 1991; 35: 547–555. by PCR amplification of male-specific genes in
7. Bredbacka P, Kankaanpaa A, Peippo J. PCR-sexing single blastomeres. J Med Assoc Thai 1996; 79 (suppl
of bovine embryos: A simplified protocol. 1): S78–S87.
Theriogenology 1995; 44: 167–176. 22. Greenlee AR, Krisher RL, Plotka ED. Rapid sexing
8. Thibier M, Nibart M. The sexing of bovine embryos of murine preimpantation embryos using a nested,
in the field. Theriogenology 1995; 43: 71–80. multiplex polymerase chain reaction (PCR). Mol
9. Shea BF. Determining the sex of bovine embryos Reprod Dev 1998; 49: 261–267.
using polymerase chain reaction results: A six-year 23. Utsumi K, Takeda H, Yamada M, Iritani A. Sexing
retrospective study. Theriogenology 1999; 51: 841– of bovine embryos by PCR using Sry primer.
854. Theriogenology 1994; 41: 323 (abstract).
10. Garcia JF. Practical considerations of embryo 24. Hasler JF. Sex determination of bovine embryos
manipulation: Preimplantation genetic typing. using a simplified PCR protocol. In: Proceedings of
Theriogenology 2001; 56: 1393–1399. the 15th Annual Convention of AETE, Portland,
11. King WA. Sexing embryos by cytological methods. Oregon, 1996: 71–76.
Theriogenology 1984; 21: 7–17. 25. Hasler JF, Cardey E, Stokes JE, Bredbacka P.
12. Picard L, King WA, Betteridge KJ. Cytological Nonelectrophoretic PCR-sexing of bovine embryos
studies of bovine half-embryos. Theriogenology 1984; in a commercial environment. Theriogenology 2002;
21: 252 (abstract). 58: 1457–1469.
13. Seike N, Utaka K, Kanagawa H. Production and 26. Saunders GC, Dukes J, Parkes HC, Cornett JH.
development of calves from sexed-bisected bovine Interlaboratory study on thermal cycler
embryos. Jpn J Vet Res 1990; 38: 1–9. performance in controlled PCR and random
14. Williams TJ. A technique for sexing mouse embryos amplified polymorphic DNA analyses. Clin Chem
by a visual colorimetric assay of the X-linked 2001; 47: 47–55.
enzyme glucose-6-phosphate dehydrogenase. 27. Weber T, Klapper PE, Cleator GM, Bodemer M,
Theriogenology 1986; 25: 733–739. Lûke W, Knowles W, Cinque P, Van Loon AM,
15. Monk M, Handyside AH. Sexing of Grandien M, Hammarin AL, Ciardi M, Bogdanovic
preimplantation mouse embryos by measurement G, the European Union Concerted Action on Viral
of X-linked gene dosage in a single blastomere. J Meningitis and Encephalitis. Polymerase chain
Reprod Fert 1988; 82: 365–368. reaction for detection of JC virus DNA in
16. Bredbacka P. Progress on methods of gene cerebrospinal fluid: a quality control study. J Virol
detection in preimplantation embryos. Methods 1997; 69: 231–237.

View publication stats