Absolute Copy Number Differences of Y Chromosomal Genes Between Crossbred (Bos Taurus × Bos Indicus) and Indicine Bulls
Absolute Copy Number Differences of Y Chromosomal Genes Between Crossbred (Bos Taurus × Bos Indicus) and Indicine Bulls
Absolute Copy Number Differences of Y Chromosomal Genes Between Crossbred (Bos Taurus × Bos Indicus) and Indicine Bulls
Abstract
Background: The Y chromosome in mammal is paternally inherited and harbors genes related to male fertility and
spermatogenesis. The unique intra-chromosomal recombination pattern of Y chromosome and morphological difference
of this chromosome between Bos taurus and Bos indicus make it an ideal model for studying structural variation, especially
in crossbred (Bos taurus × Bos indicus) bulls. Copy Number Variation (CNV) is a type of genomic structural variation that
gives information complementary to SNP data. The purpose of this study was to find out copy number differences of four
Y chromosomal spermatogenesis-related candidate genes in genomic DNA of crossbred and purebred Indicine bulls.
Result: Four Y chromosomal candidate genes of spermatogenesis namely, sex determining gene on Y chromosome (SRY), DEAD
box polypeptide 3-Y chromosome (DDX3Y), Ubiquitin specific peptidase 9, Y-linked (USP9Y), testis-specific protein on Y chromosome
(TSPY) were evaluated. Absolute copy numbers of Y chromosomal genes were determined by standard curve-based
quantitative real time PCR. Copy numbers of SRY and TSPY genes per unit amount of genomic DNA are higher in crossbred
than Indicine bulls. However, no difference was observed in DDX3Y and USP9Y gene copy numbers between two groups.
Conclusion: The present study demonstrates that the structural organization of Y chromosomes differs between crossbred
and Indicine bulls which are reproductively healthy as observed from analysis of semen attributes. The absolute copy numbers
of SRY and TSPY genes in unit mass of genomic DNA of crossbred bulls are significantly higher than Indicine bulls. No alteration
in absolute copies of DDX3Y and USP9Y gene was found between the genome of crossbred and Indicine bulls. This study
suggests that the DDX3Y and USP9Y are likely to be single copy genes in the genome of crossbred and Indicine bulls and
variation in Y chromosome length between crossbred and Indicine bulls may be due to the copy number variation of SRY
gene and TSPY array.
Keywords: Absolute copy, SRY, DDX3Y, USP9Y, TSPY, Crossbred
© 2013 Mukherjee et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the
Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use,
distribution, and reproduction in any medium, provided the original work is properly cited.
Mukherjee et al. Journal of Animal Science and Biotechnology 2013, 4:15 Page 2 of 7
http://www.jasbsci.com/content/4/1/15
minor groove at a 6-base consensus target sequence and Assessment of seminal quality parameters
subsequently activates the cascade of testis determining We assessed progressive motility, plasmalemma and acro-
pathway [9]. DDX3Y and USP9Y genes are construed as somal integrity of the spermatozoa to evaluate the bulls as
‘fine-tuner’ of normal spermatogenesis process [10-12]. these are the most common semen evaluation tests in
The protein product of the TSPY gene probably interacts cattle. The percentage of sperm showing progressive for-
with type B cyclins and activates cyclin B-CDK com- ward motility was determined by mixing 100 μL of un-
plexes. The activated complex, in turn, impacts on bio- diluted semen into pre-warmed tubes containing 900 μL
logical machineries in spermatogonial cell renewal and of Tris buffer (pH 7.2). A thin drop of diluted semen was
in prophase I spermatocyte differentiation [13]. placed on a pre-warmed glass slide (37°C) and evaluated
Crossbreeding between taurine (Bos taurus) and indi- under microscope. The mean of the three estimations was
genous cattle (Bos indicus) is a popular practice in used as the final motility score [17]. 6-carboxyfluorescein
Indian dairy industry. Semen of three exotic breeds diacetate (CFDA) and propidium iodide (PI) staining was
namely, European Holstein Friesian, Brown Swiss and done to assess the sperm viability as described by
Jersey are extensively used for this purpose. The karyo- Selvaraju et al. [18]. Briefly, semen sample was incubated
types of two bovine subspecies Bos taurus and Bos with phosphate buffered saline (PBS) based CFDA/PI
indicus have a high similarity except for the morphology staining solution at 37°C for 15 min. After incubation,
of the Y chromosome [14]. Y chromosome in Bos taurus 0.2% glutaraldehyde was added and stained sample were
is submetacentric and acrocentric in Bos indicus. This examined under magnifications of 400× using an Olympus
morphological difference between Bos taurus and Bos BX51 microscope (Olympus America, Center Valley, PA,
indicus Y chromosome is the consequence of pericentric USA) equipped with CFDA filter set (excitation, 510–
inversion [15]. In crossbred animal this difference in Y 560 nm; emission, 505 nm). The sperm showing complete
chromosome morphology may lead to small deletions or green fluorescence were considered plasmalemma intact
altered position between the synapse region of the X and (live), and the cells showing partial or complete red nuclei
Y chromosomes, or change in genes present on sex were classified as dead. The hypo osmotic swelling
chromosomes. So far no study has been conducted on Y test was performed for assessment of sperm membrane
chromosomal gene copy number determination and integrity based on curled and swollen tails. The assay
their comparison between crossbred and Indicine bulls. was performed mixing neat semen with 150 mOsm/L
Therefore, present study was designed to investigate ab- hypoosmotic solution (13.51 g fructose + 7.35 g trisodium
solute copy number differences of major Y chromosomal citrate per liter of distilled water) and incubating at
genes SRY, DDX3Y, USP9Y and TSPY between Karan 38.5°C for 1 h [19]. After incubation, semen sample was
Fries (a crossbred) and Sahiwal (purebred Bos indicus). examined under the high power magnification (400×)
We included reproductively healthy bulls in this study to of a bright field microscope. Acrosomal integrity of the
avoid animals having poor semen quality which could be sperm was assessed by staining air-dried smears with
sequelae to the detrimental changes in Y chromosomal fluorescein isothiocyanate-conjugated pisum sativum
gene copies. agglutinin (FITC-PSA) staining [20]. Air-dried smear was
flooded with the FITC-PSA and kept in darkness for
Methods 30 min. Slides were washed in distilled water and
Animals and semen collection mounted with glycerol with a cover slip. The fluorescence
All the experimental procedures involving animals were pattern of 200 sperm in randomly selected fields was
approved by the Institutional Animal Ethics Committee determined under Olympus BX51 microscope (Olympus
(IAEC), National Dairy Research Institute, Karnal, India. America, Center Valley, PA, USA) with 1,000× magnifica-
The seminal attributes of the bulls under study were tion. The proportions of intact, reacting, and reacted
assessed and those consistently producing good quality acrosome were expressed as percentages of the respective
semen were included in the study. Semen samples were patterns in the total number of sperm counted [21].
collected from 10 Karan Fries (F1 generation crossbred
of Holstein-Friesian sire and Tharparkar or Sahiwal Collection of blood and isolation of genomic DNA
dam) and 10 Sahiwal (purebred Bos indicus) bulls by About 10 mL of blood sample was collected from each
artificial vagina (IMV, L’Aigele cedex, France) in the early animal in sterile VacutainerW (Beckton-Dickinson, Franklin
morning. The volume of the semen was measured in a Lakes, NJ, USA) containing sodium heparin as an anti-
graduated conical tube, mass motility was evaluated by coagulant. The collected samples were stored at 4°C
light microscopy and sperm concentration was estimated and transported to the laboratory at the earliest. The gen-
using Haemocytometer [16] immediately after collection. omic DNA was isolated from white blood cells using stand-
The semen samples were processed for assessing the ard phenol-chloroform procedure [22]. The DNA samples
sperm quality parameters without any further delay. were dissolved in TE buffer (pH 8.0), their concentrations
Mukherjee et al. Journal of Animal Science and Biotechnology 2013, 4:15 Page 3 of 7
http://www.jasbsci.com/content/4/1/15
were determined by optical density at 260 nm using the gene were assayed in triplicate. The Cp values were
NanoDrop 1000 Spectrophotometer (Thermo Fisher plotted against the logarithm of their initial template
Scientific, Wilmington, DE, USA) and stored at −20°C for copy concentrations. Each standard curve was generated
further use. by a linear regression of the plotted points. From the
slope of each curve, PCR amplification efficiency (E) was
Determination of absolute copy number calculated according to the following equation [24]:
Preparation of SRY, DDX3Y, USP9Y and TSPY plasmid
constructs E ¼ 101=slope 1
Fragments of SRY (736 bp), DDX3Y (2,010 bp), USP9Y
(1,646 bp) were amplified from cDNA of peripheral blood
lymphocyte. TSPY (1,141 bp) gene was amplified from tes- Quantitative PCR
ticular tissue of bull as the expression of the gene is testis- To determine the absolute copy number of SRY, USP9Y,
specific. PCR was carried out on an Eppendorf Mastercycler DDX3Y and TSPY genes in genomic DNA samples of
(Eppendorf, Hamburg, Germany) in a 25 μL reaction mix- bulls under study the gene-specific primers were
ture containing 2.5 μL of 10× Paq5000 reaction buffer (pro- designed. The sequences of the primer sets used for
vides a final Mg+2 concentration of 2 mmol/L), 200 μmol/L real-time PCR analysis are shown in Table 2. The
of dNTPs (Fermentas, Lithuania), 500 nmol/L of each pri- primers were amplified on a LightCyclerW 480 instru-
mer and 0.5 units of Stratagene Paq5000™ DNA polymerase ment with software version 1.5 (Roche Diagnostics,
(Agilent Technologies, West Cedar Creek, TX, USA). De- Mannheim, Germany). Concentrations of all the DNA
tails of the PCR primers used for amplifying these genes are samples of test bulls were adjusted to 10 ng/μL. The
listed in Table 1. ‘crossing point’ or Cp values were determined by
Amplified fragments were cloned separately into ‘second-derivative max method’ in the software. All real-
pcrW2.1 vector (3.9 kb) using the TOPO TA CloningW time PCR runs were performed in triplicate and each re-
system (Invitrogen Corporation, Carlsbad, CA, USA) action mixture was prepared using the KAPA SYBRW
and plasmids were isolated with the Qiagen Plasmid iso- FAST qPCR kit (Kapa Biosystems, Woburn, MA, USA)
lation kit (Qiagen GmBH, Hilden, Germany). in a total volume of 10 μL. Reaction for TSPY gene com-
prised of 2.4 μL PCR-grade water (Sigma-Aldrich, St.
Construction of standard curve Louis, MO, USA), 300 nmol/L each primer, 1× KAPA
Concentrations of plasmids containing SRY, DDX3Y, SYBRW FAST qPCR Master Mix and 2 μL of template
USP9Y and TSPY inserts were adjusted at 100 ng/μL DNA and that for SRY, DDX3Y and USP9Y comprised of
using NanoDrop 1000 Spectrophotometer (Thermo 2 μL PCR-grade water (Sigma-Aldrich, St. Louis, MO,
Fisher Scientific, Wilmington, DE, USA). The concentra- USA), 500 nmol/L each primer, 1X KAPA SYBRW FAST
tion of the plasmid was converted to corresponding copy qPCR Master Mix and 2 μL of template DNA.
concentration using the following equation [23] The following cycling conditions were employed for all
the genes: pre-incubation at 95°C for 3 min, followed by
6:023 1023 ðcopies=molÞ DNA amount ðg Þ 40 cycles of 10 s at 95°C, 20 s at 60°C, and 1 s at 72°C.
DNA copy ¼
ðPlasmid þ Insert ÞlengthðbpÞ 660ðgm=mol=bpÞ The fluorescence signal was measured at the end of each
extension step at 72°C. After the amplification, a melting
A tenfold dilution series of each of the plasmid con- peak analysis with a temperature gradient of 0.1°C/s
structs were used to construct the corresponding stand- from 65 to 95°C was performed. Finally, the samples
ard curves of two genes. Standard dilutions of each of were cooled down to 40°C for 10 s.
Table 1 Primers used to amplify the gene fragments
Primer Sequence, 50to 30 Melting temperature, Tm Product length, bp
SRY F: CGCAGTGCAGTCGTATGCTTCTGC 61°C 736
R: GAGCGCCTTTGTTAGCGAGAGTAAGG 61°C
DDX3Y F: TTCGCGCCTTTCTTCAGGCATGAGTCA 61°C 2010
R: CAGATTCAGTTGCCCCACCAGTCAAC 61°C
USP9Y F: TGTGGGACTCAAAAATGCTGGTGCTAC 60°C 1646
R: ACTCCAGAAGGTATTCAGAGAAACGATTTGA 59°C
TSPY F: ATGTCGCGTCCCTTCGCCTCTGC 62°C 1141
R: TCAGTTGTCTCTCATGGACGAACCTTCCT 62°C
F refers to forward primer and R refers to reverse primer.
Mukherjee et al. Journal of Animal Science and Biotechnology 2013, 4:15 Page 4 of 7
http://www.jasbsci.com/content/4/1/15
Figure 2 Construction of standard curves for SRY, DDX3Y, USP9Y and TSPY quantification. The standard curves for SRY, DDX3Y, USP9Y and
TSPY absolute copy number determination together with their respective line equations are shown here. Set of serial 10-fold dilutions was made
for each gene. Each of these dilutions (standard dilutions) had known copies of the plasmid construct harboring the respective gene fragment as
an insert. X-axis represents log transformed values of the standard copy number and Y-axis represents the crossing point (Cp) values i.e. the
fractional cycle number required for the fluorescence to cross the threshold.
Discussion
The male specific region on Y chromosome (MSY) har-
bors genes which have crucial role in spermatogenesis,
maintenance of male germ cells and fertility. Several
studies have pointed out the precise correlation between
compromised sperm quality and molecular abnormal-
ities of Y chromosome such as copy number variation of
gene-rich regions. The primary objective of the current
investigation was to find out the copy number differ-
ences of Y chromosomal genes between healthy cross-
bred and Indicine bulls. We performed semen quality
parameters to select reproductively healthy bulls and to
circumvent animals having poor semen quality which SRY USP9Y
could be sequelae to the detrimental changes in Y DDX3Y TSPY
chromosomal gene copies. Assessment of progressive Figure 3 Absolute copy numbers of SRY, DDX3Y, USP9Y and
motility, plasmalemma and acrosomal integrity are the TSPY genes in genomic DNA of crossbred (n = 10) and Indicine
most common semen evaluation tests in cattle [25]. (n = 10) bulls. Cp values obtained for each gene from each
genomic DNA sample were extrapolated in the linear equation of
Analysis of semen quality attributes shows that all the
the respective standard curve to obtain the absolute copy number
bulls under study were reproductively sound. Although of the gene. The absolute copy was transformed in the logarithmic
percentage of HOST-reacted spermatozoa was less in value. Y-axis represents the log transformed values of gene copy
Sahiwal bulls (68.62 ± 0.71) compared to KF bulls (73.59 number. Values are the mean ± S.E.M. of three experiments
± 0.74) signifying better sperm membrane integrity in performed in two groups of bulls Karan Fries (KF), a crossbred and
Sahiwal, an Indicine breed. Different superscripts indicate significant
KF bulls but it does not affect the overall fertility poten-
difference (P < 0.05) between two groups.
tial of Sahiwal bulls as these bulls are regularly used for
Mukherjee et al. Journal of Animal Science and Biotechnology 2013, 4:15 Page 6 of 7
http://www.jasbsci.com/content/4/1/15
breeding program. Present study was conducted to find in the cattle genome is not known [27]. No significant
out whether Y chromosomal genes SRY, DDX3Y, USP9Y difference in absolute copy number of this gene between
and TSPY copies vary in genomic DNA of crossbred and crossbreed and Indicine bulls was observed and quantity
Indicine bulls. We found significantly lower number of of this gene is almost equal to DDX3Y gene copy num-
SRY and TSPY gene copies in Indicine bulls compared ber. So, it can be assumed that like other mammalian
with crossbred bulls. Absolute copies of DDX3Y and species cattle Y chromosome also harbors single copy of
USP9Y gene did not vary between these two breeds. The this gene.
bulls included in the present study were not paternally Y chromosome is highly heterogeneous in both size
related. Hence, the copy numbers in different genes on and genetic makeup among species [28,35]. Vast
Y chromosomes may be identical by state but not by structural polymorphisms have been detected in both
descent. To our knowledge this is the first report of ab- heterochromatin and euchromatin of Y chromosome.
solute quantitative PCR to measure levels of Y chromo- Significant variations have been reported in the length of
somal gene copy numbers in genomic DNA samples of Y chromosome in different breeds of cattle [36] and Bos
bovine. Compared to relative PCR methods, the use of taurus × Bos indicus cattle [37]. The Y chromosome
absolute real-time PCR allows a direct comparison of length variation observed in the present study may be due
the exact copy number of the genes in each genomic to variation in copies of TSPY array. A previous study
DNA sample [26]. The absolute quantitative PCR of localization of TSPY on Bos taurus Y chromosome
reported here estimates the copy numbers of the gene of showed precise position of TSPY array on Yp arm [38].
interest without the requirement for a reference gene Acrocentric Bos indicus Y has distinctly smaller p-arms
through the construction of standard curve. than submetacentric Bos taurus Y [39]. The same study
Absolute copy number of SRY is significantly higher in [39] proposed the phenomena of pericentric inversion
crossbred bulls compared to Indicine bulls. SRY is a sin- with breakpoints on the proximal p-arms and on the distal
gle copy gene in the genome of most mammalian spe- band q12 of Bos indicus Y. It may be speculated that loss
cies. But multiple copies of this gene have also been of TSPY gene copies occurred during the point of diver-
reported in cat, rat and rabbit and it is not clear whether gence of Y chromosome in two subspecies.
multiple copies of this gene are present on cattle Y
chromosome [27]. Copy number of TSPY gene varies Conclusion
substantially even between closely related mammals like This study suggests that the structural organization of
human and chimpanzees [28]. In the present study log Y chromosome varies between crossbred and Indicine
TSPY copy number varied widely from 5.48 to 6.85 in bulls which are reproductively healthy as observed from
Indicine and from 6.31 to 7.13 in crossbred reflecting assessment of semen attributes. Absolute copy number of
wide variation of this multi-copied gene within the bo- DDX3Y and USP9Y do not vary between these two bovine
vine species. Studies conducted so far in human have subspecies probably because of their single-copy presence
pointed out the association of SRY, DDX3Y, USP9Y and in the genome. TSPY, a multicopy gene in bovine genome,
TSPY genes with spermatogenesis and seminal quality varies substantially between crossbred and Indicine bulls.
[29-33]. However, the impact of copy number variation Variation in Y chromosome length between crossbred and
of these genes on reproductive parameters is still elusive. Indicine bulls might be due to the copy number variation
This finding is congruent with the previous report in hu- of TSPY array and SRY gene. These findings establish a
man [31]. The phenotypic differences among different foundation for association study between chromosomal
phyla or classes of organisms result from accumulation genes copy number and reproductive fitness in crossbred
of mutations in the genome and their subsequent and Indicine bulls and existence of any correlation between
stabilization within the genome for the sake of adapta- them will be valuable in determining breeding programs.
tion to different environments [34]. So it may be as-
sumed that normal functionality requirement of the Competing interests
genes in two different subspecies are different. Accord- None of the authors have any competing interest to declare.
ingly the genes attained that optimum level in Bos
taurus and Bos indicus genome. As DDX3Y is a single Authors’ contributions
All listed authors have made substantial contributions to: the research
copy gene in the cattle genome [27] the absolute copy design, analysis or interpretation of data and in drafting the paper. All
number of DDX3Y gene should not vary between two authors read and approved the final manuscript.
bovine subspecies. Present study also did not reveal any
significant variation between crossbred and Indicine Acknowledgement
bulls in terms of absolute copy number of DDX3Y gene. This study was supported by World Bank funded National Agricultural
Innovation Project (C4/C30015). The authors also thank Dr. A.K. Chakravarty,
Although USP9Y is a single copy gene in most of the Principal Scientist, Animal Genetics and Breeding Division, for providing
mammalian species the exact copy number of the gene assistance in collecting blood and semen samples.
Mukherjee et al. Journal of Animal Science and Biotechnology 2013, 4:15 Page 7 of 7
http://www.jasbsci.com/content/4/1/15
Author details 23. Whelan JA, Russel NB, Whelan MA: A method for the absolute
1
Animal Genomics Lab, Animal Biotechnology Centre, National Dairy quantification of cDNA using real time PCR. J Immunol Methods 2003,
Research Institute, Karnal, India. 2Department of Veterinary Biochemistry, 278:261–269.
College of Veterinary Sciences & Animal Husbandry, Central Agricultural 24. Rasmussen R: Quantification on the LightCycler. In Rapid cycle real-time
University, Selesih, Aizawl, Mizoram, India. PCR: methods and applications. Edited by Meuer S, Wittwer C, Nakagawara K.
New York: Springer; 2001:21–34.
Received: 13 December 2012 Accepted: 25 March 2013 25. Rodriguez-Martinez H: Laboratory semen assessment and prediction of
Published: 4 April 2013 fertility: still utopia? Reproduction in Domestic Animal 2003, 38:312–318.
26. Scheurer ME, Dillon LM, Chen Z, Follen M, Adler-Storthz K: Absolute
quantitative real-time polymerase chain reaction for the measurement
References of human papillomavirus E7 mRNA in cervical cytobrush specimens.
1. Lahn BT, Page DC: Functional coherence of the human Y-chromosome. Infect Agent Cancer 2007, 2:8.
Science 1997, 278:675–680. 27. Paria N, Raudsepp T, Pearks Wilkerson AJ, O’Brien PCM, Ferguson-Smith MA,
2. Pecon Slattery J, Sanner-Wachter L, O’Brien SJ: Novel gene conversion Love CC, Arnold C, Rakestraw P, Murphy WJ, Chowdhary BP: A gene
between X-Y homologues located in the nonrecombining region of the catalogue of the euchromatic male-pecific region of the horse Y
Y chromosome in Felidae (Mammalia). Proc Natl Acad Sci USA 2000, chromosome: Comparison with human and other mammals. PLoS One
97:5307–5312. 2011, 6(7):e21374.
3. Skaletsky H, Kuroda-Kawaguchi T, Minx PJ, et al: The male-specific region 28. Hughes JF, Skaletsky H, Pyntikova T, Graves TA, van Daalen SK, Minx PJ,
of the human Y Chr is a mosaic of discrete sequence classes. Nature Fulton RS, McGrath SD, Locke DP, Friedman C, Trask BJ, Mardis ER, Warren
2003, 423(6942):825–837. WC, Repping S, Rozen S, Wilson RK, Page DC: Chimpanzee and human Y
4. Lin YW, Thi DA, Kuo PL, Hsu CC, Huang BD, Yu YH, Vogt PH, Krause W, Ferlin chromosomes are remarkably divergent in structure and gene content.
A, Foresta C, Bienvenu T, Schempp W, Yen PH: Polymorphisms associated Nature 2010, 463:536–539.
with the DAZ genes on the human Y chromosome. Genomics 2005, 29. Giachini C, Nuti F, Turner DJ, Laface I, Xue Y, Daguin F, et al: TSPY1 copy
86:431–438. number variation influences spermatogenesis and shows differences
5. Beckmann JS, Estivill X, Antonarakis SE: Copy number variants and genetic among Y lineages. J Clin Endocrinol Metab 2009, 94:4016–4022.
traits: Closer to the resolution of phenotypic to genotypic variability. Nat 30. Lardone MC, Parodi DA, Valdevenito R, Ebensperger M, Piottante A,
Rev Genet 2007, 8:639–646. Madariaga M, Smith R, Pommer R, Zambrano N, Castro A: Quantification of
6. Conrad B, Antonarakis SE: Gene duplication: A drive for phenotypic DDX3Y, RBMY1, DAZ and TSPY mRNAs in testes of patients with severe
diversity and cause of human disease. Annu Rev Genomics Hum Genet impairment of spermatogenesis. Mol Hum Reprod 2007, 13(10):705–712.
2007, 8:17–35. 31. Vodicka R, Vrtel R, Dusek L, Singh AR, Krizova K, Svacinova V, Horinova V,
7. Feuk L, Carson AR, Scherer SW: Structural variation in the human genome. Dostal J, Oborna I, Brezinova J, Sobek A, Santavy J: TSPY gene copy
Nat Rev Genet 2006, 7:85–97. number as a potential new risk factor for male infertility. Reprod Biomed
8. McCarroll SA, Altshuler DM: Copy-number variation and association Online 2007, 14:579–587.
studies of human disease. Nat Genet 2007, 39:S37–S42. 32. Vijayakumar S, Hall DC, Reveles XT, Troyer DA, Thompson IM, Garcia D,
9. Waters PD, Wallis MC, Marshall Graves JA: Mammalian sex—Origin and Xiang R, Leach RJ, Johnson-Pais TL, Naylor SL: Detection of recurrent copy
evolution of the Y chromosome and SRY. Semin Cell Dev Biol 2007, number loss at Yp11.2 involving TSPY gene cluster in prostate cancer
18:389–400. using array-based comparative genomic hybridization. Cancer Res 2006,
66:4055–4064.
10. Sun C, Skaletsky H, Birren B, Devon K, Tang Z, Silber S, Oates R, Page DC: An
33. Modi D, Shah C, Sachdeva G, Gadka S, Bhartiya D, Puri C: Ontogeny and
azoospermic man with a de novo point mutation in the Y-chromosomal
cellular location of SRY transcripts in the human testes and its detection
gene USP9Y. Nat Genet 1999, 23:429–432.
in spermatozoa. Reproduction 2005, 130(5):603–613.
11. Krausz C, Degl’Innocenti S, Nuti F, Morelli A, Felici F, Sansone M, Varriale G,
34. Nei M: The new mutation theory of phenotypic evolution. Proc Natl Acad
Forti G: Natural transmission of USP9Y gene mutations: a new
Sci USA 2007, 104:12235–12242.
perspective on the role of AZFa genes in male fertility. Hum Mol Genet
35. Liu W: Comparative genomics of the Y chromosome and male fertility. In
2006, 15:2673–2681.
Reproductive genomics in domestic animals. Edited by Jiang Z, Ott TL. Iowa:
12. Luddi A, Margollicci M, Gambera L, Serafini F, Cioni M, De Leo V, Balestri P,
Wiley-Blackwell; 2010:129–156.
Piomboni P: Spermatogenesis in a man with complete deletion of USP9Y.
36. De Giovanni A, Cribiu EP: Etude des variations du chromosome Y dans
N Engl J Med 2009, 60:881–885.
quatre races bovines italiennes. III - Colloque de Cytogénétique des
13. Lau YF-C, Li Y, Kido T: Role of the Y-located putative gonadoblastoma gene
animaux domestiques. Ann Genet Sel Anim 1977, 9:527–527.
in human spermatogenesis. Syst Biol Reprod Med 2011, 57(1–2):27–34.
37. Mandal A, Sharma A: Variations in the length of the Y chromosome and
14. Kieffer NM, Cartwright TC: Sex Chromosome polymorphism in domestic
the seminal attributes of Karan Fries bulls. Vet Res Commun 2003, 27(7):
cattle. J Hered 1968, 59:35–37.
567–575.
15. Pinheiro LEL, Moraes JCF, Mattevi MS, Erdtmann B, Salzano FM, Mies Filho A:
38. Hamilton CK, Favetta LA, Di Meo GP, Floriot S, Perucatti A, Peippo J,
Two types of Y chromosome in a Brazilian cattle breed. Caryologia 1980,
Kantanen J, Eggen A, Iannuzzi L, King WA: Copy Number Variation of
33:25–32.
Testis-Specific Protein, Y-Encoded (TSPY) in 14 Different Breeds of Cattle
16. Salisbury GW, Van den Mark NL, Lodge JR: Physiology of Reproduction and
(Bos taurus). Sex Dev 2009, 3:205–213.
Artificial Insemination of Cattle. Delhi: CBS Publishers and Distributors; 1985.
39. De Meo GP, Perucatti A, Floriot S, Incarnato D, Rullo R, Caputi Jambrenghi A,
17. Tomar NS: Artificial Insemination and Reproduction of Cattle and Buffaloes.
Ferretti L, Vonghia G, Cribiu E, Eggen A, Iannuzzi L: Chromosome evolution
Allahabad: Saroj Prakashan; 1997.
and improved cytogenetic maps of the Y chromosome in cattle, zebu,
18. Selvaraju S, Ravindra JP, Ghosh J, Gupta PSP, Suresh KP: Evaluation of river buffalo, sheep and goat. Chromosome Res 2005, 13:349–355.
sperm functional attributes in relation to in vitro sperm-zona pellucida
binding ability and cleavage rate in assessing frozen thawed buffalo
doi:10.1186/2049-1891-4-15
(Bubalus bubalis) semen quality. Anim Reprod Sci 2008, 106:311–321.
Cite this article as: Mukherjee et al.: Absolute copy number differences
19. Revell SG, Mrode RA: An osmotic resistance test for bovine semen. Anim
of Y chromosomal genes between crossbred (Bos taurus × Bos indicus)
Reprod Sci 1994, 36:77–86. and Indicine bulls. Journal of Animal Science and Biotechnology 2013 4:15.
20. Cross NL, Morales P, Overstreet JW, Hanson FW: Two simple methods for
detecting acrosome-reacted human sperm. Gamete Res 1986, 15:213–226.
21. Perry RL, Naeeni M, Barratt CL, Warren MA, Cooke ID: A time course study of
capacitation and the acrosome reaction in human spermatozoa using
revised chlortetracycline pattern classification. Fertil Steril 1995, 64:150–159.
22. Sambrook J, Russell D: Molecular cloning: A laboratory manual. New York:
Cold Spring Harbor Press; 2001.