Text Book for

I N T E R M E D I AT E
Second Year

Zoology
Permission & Support by:

National Council of Educational Research and Training

New Delhi

Board of Intermediate Education, Andhra Pradesh

Telugu and Sanskrit Akademi, Andhra Pradesh
Intermediate
Second Year Text Book

Zoology

Pages : xx + 308 + iv

National Council of Educational

Research and Training, 2007

Reprint
2023

Copies : 12000

ALL RIGHTS RESERVED

 No part of this publication may be reproduced, stored in a retrieval system or transmitted,
in any form or by any means, electronic, mechanical, photocopying, recording or
otherwise without this prior permission of the publisher.

 This book is sold subject to the condition that it shall not, by way of trade, be lent, resold,
hired out or otherwise disposed of without the publisher’s consent, in any form of binding
or cover other than that in which it is published.

 The correct price of these publication is the price printed on this page, any revised price
indicated by rubber stamp or by a sticker or by any other means is incorrect and is
unacceptable.

 Published by Telugu and Sanskrit Akademi, Andhra Pradesh under the Centrally
Sponsored Scheme of Production of Books and Literature in Regional Languages at the
University level of the Government of India in the Ministry of Human Resource
Development, New Delhi.

Permission and Prescribed by

Board of Intermediate Education, A.P.
Vijayawada.
Published, Printed & Distributed by
Telugu and Sanskrit Akademi, A.P.

Price: Rs. 161.00

Printed in India
Laser Typeset by Pavan Graphics, Hyderabad

Published and Printed by

M/s GBR Offset Printers & Publishers
Surampalli, NTR Dist.

on behalf of Telugu and Sanskrit Akademi

Y.S. JAGAN MOHAN REDDY CHIEF MINISTER
AMARAVATI
ANDHRA PRADESH

MESSAGE
I congratulate Akademi for starting its activities with printing of textbooks from
the academic year 2021 – 22.
Education is a real asset which cannot be stolen by anyone and it is the foundation
on which children build their future. As the world has become a global village, children
will have to compete with the world as they grow up. For this there is every need for
good books and good education.
Our government has brought in many changes in the education system and more
are to come. The government has been taking care to provide education to the poor
and needy through various measures, like developing infrastructure, upgrading the skills
of teachers, providing incentives to the children and parents to pursue education. Nutritious
mid-day meal and converting Anganwadis into pre-primary schools with English as medium
of instruction are the steps taken to initiate children into education from a young age.
Besides introducing CBSE syllabus and Telugu as a compulsory subject, the government
has taken up numerous innovative programmes.
The revival of the Akademi also took place during the tenure of our government
as it was neglected after the State was bifurcated. The Akademi, which was started on
August 6, 1968 in the undivided state of Andhra Pradesh, was printing text books,
works of popular writers and books for competitive exams and personality development.
Our government has decided to make available all kinds of books required for
students and employees through Akademi, with headquarters at Tirupati.

I extend my best wishes to the Akademi and hope it will regain its past glory.
Dr. Nandamuri Lakshmiparvathi
M.A., M.Phil., Ph.D.
Chairperson, (Cabinet Minister Rank)
Telugu and Sanskrit Akademi, A.P.

Message of Chairperson, Telugu and Sanskrit Akademi, A.P.

In accordance with the syllabus developed by the Board of Intermediate, State

Council for Higher Education, SCERT etc., we design high quality Text books by recruiting
efficient Professors, department heads and faculty members from various Universities and
Colleges as writers and editors. We are taking steps to print the required number of these
books in a timely manner and distribute through the Akademi’s Regional Centers present
across the Andhra Pradesh.
In addition to text books, we strive to keep monographs, dictionaries, dialect texts,
question banks, contact texts, popular texts, essays, linguistics texts, school level dictionaries,
glossaries, etc., updated and printed and made available to students from time to time.
For competitive examinations conducted by the Andhra Pradesh Public Service
Commission and for Entrance examinations conducted by various Universities, the contents
of the Akademi publications are taken as standard. So, I want all the students and
Employees to make use of Akademi books of high standards for their golden future.
Congratulations and best wishes to all of you.

Nandamuri Lakshmiparvathi
Chairperson, Telugu and Sanskrit Akademi, A.P.
J. SYAMALA RAO, I.A.S., Higher Education Department
Principal Secretary to Government Government of Andhra Pradesh

MESSAGE
I Congratulate Telugu and Sanskrit Akademi for taking up the initiative of
printing and distributing textbooks in both Telugu and English media within a short
span of establishing Telugu and Sanskrit Akademi.

Number of students of Andhra Pradesh are competing of National Level for

admissions into Medicine and Engineering courses. In order to help these students
Telugu and Sanskrit Akademi consultation with NCERT redesigned their Textbooks
to suit the requirement of National Level Examinations in a lucid language.

As the content in Telugu and Sanskrit Akademi books is highly informative

and authentic, printed in multi-color on high quality paper and will be made available
to the students in a time bound manner. I hope all the students in Andhra Pradesh
will utilize the Akademi textbooks for better understanding of the subjects to compete
of state and national levels.

(J. SYAMALA RAO)

 THE CONSTITUTION OF INDIA
PREAMBLE

WE, THE PEOPLE OF INDIA, having

solemnly resolved to constitute India into a
[SOVEREIGN SOCIALIST SECULAR
DEMOCRATIC REPUBLIC] and to secure to all
its citizens:

JUSTICE, social, economic and political;

LIBERTY of thought, expression, belief, faith

and worship;

EQUALITY of status and of opportunity; and

to promote among them all

FRATERNITY assuring the dignity of the

individual and the [unity and integrity of the
Nation];
IN OUR CONSTITUENT ASSEMBLY this
twenty-sixth day of November, 1949 do HEREBY
ADOPT, ENACT AND GIVE TO OURSELVES
THIS CONSTITUTION.
 Textbook Development Committee (NCERT)

Chairperson, Advisory Group for Textbooks in Science and Mathematics

J.V. Narlikar, Emeritus Professor, Inter University Centre for Astronomy and Astrophysics (IUCAA),
Pune University, Pune

Chief Advisor
K. Muralidhar, Professor, Department of Zoology, University of Delhi, Delhi

Members
Ajit Kumar Kavathekar, Reader (Botany), Sri Venkateswara College, University of Delhi, Delhi
B.B.P. Gupta, Professor, Department of Zoology, North-Eastern Hill University, Shillong
B.N. Pandey, Principal, Ordinance Factory Higher Secondary School, Dehradun
C.V. Shimray, Lecturer, Department of Education in Science and Mathematics, NCERT, New Delhi
Dinesh Kumar, Reader, Department of Education in Science and Mathematics, NCERT, New Delhi
J.P. Gaur, Professor, Department of Botany, Banaras Hindu University, Varanasi
J.S. Virdi, Reader, Department of Microbiology, University of Delhi, South Campus, New Delhi
K. Sarath Chandran, Reader (Zoology), Sri Venkateswara College, University of Delhi, Delhi
L.C. Rai, Professor, Department of Botany, Banaras Hindu University, Varanasi
M.M. Chaturvedi, Professor, Department of Zoology, University of Delhi, Delhi
N.V.S.R.K. Prasad, Reader (Botany), Sri Venkateswara College, University of Delhi, Delhi
Sangeeta Sharma, PGT (Biology), Kendriya Vidyalaya, JNU, New Delhi
Savithri Singh, Principal, Acharya Narendra Dev College, University of Delhi, Delhi
Shanti Chandrashekaran, Principal Scientist, Division of Genetics, I.A.R.I., New Delhi
Shardendu, Reader, Department of Botany, Science College, Patna University, Patna
Simminder K. Thukral, Assistant Professor, NIIT Institute of Information Technology, New Delhi
Sunaina Sharma, Lecturer (Biology), Rajkiya Pratibha Vikas Vidyalaya, Dwarka, New Delhi
T.R. Rao, Professor (Retd.) School of Enviornmental Studies, University of Delhi, Delhi
V.K. Kakaria, Reader, Regional Institute of Education, Bhopal

V.V. Anand, Reader, Regional Institute of Education, Mysore

Member-coordinator
B.K. Tripathi, Reader, Department of Education in Science and Mathematics, NCERT, New Delhi
 TEXT BOOK DEVELOPMENT COMMITTEE - A.P.
Co-ordinator
Prof. V. Vanita Das, Dept., of Zoology,
Nizam Colleg, Osmania University, Hyderabad.

Chief Editor
E.S.R.K. Prasad, Sr. Lecturer, Srigayathri
Jr. College, Vijayawada

Editor
K. Jaganmohan Rao
Sr. Lecturer in Zoology,
Narayana Jr. College, Madapur, Hyderabad

Members
K. Jaganmohan Rao, Sr. Lecturer in Zoology,
Narayana Jr. College, Madapur, Hyderabad,

Dr. M. Guru Prasad Rao, Deputy Secretary,

BIE, Hyderabad,

Ahmedullah Qureshi, Jr. Lecturer in Zoology,

GJC (B), Mahaboobnagar

M.B. Tilak, Lecturer in Zoology,

Sri Chaitanya Kalashala, Hyderabad

L. Yohan Babu, Lecturer in Zoology,

Narayana Jr. College, Madhapur, Hyderabad
Dr. Prasad A.V., Lecturer in Zoology,
Narayana Jr. College, Hyderabad
S. Chandra Sekhar, Lecturer in Zoology,
Srigayathri Jr. College, Saidabad, Hyderabad
N. Nageswara Rao, Lecturer in Zoology,
Narayana Jr. College, Visakhapatnam
Sk. M. Bhasha, Lecturer in Zoology,
Srigayathri Jr. College, Madapur, Hyderabad
K. Siva Chandra, Lecturer in Zoology,
Narayana Jr. College, Nagole, Hyderabad
Text Book Review Committee

Editor
Prof. K.R.S. Sambasiva Rao
Former Vice Chancellor
Mizoram University,
AIZAWL
&
Former Professor of Biotechnology
Acharya Nagarjuna University
NAGARJUNA NAGAR, GUNTUR.

Reviewed by
Sri K. Sreeramulu
Senior Lecturer in Zoology (Rtd.)
V.S.R. & N.V.R College (Autonomus)
Tenali.
 Coordinating Committee of
Board of Intermediate Education, A.P.

Sri M.V. Seshagiri Babu, I.A.S.

Commissioner & Secretary
Board of Intermediate Education,
Andhra Pradesh

Educational Research & Training Wing (Text Books)

Dr. A. Srinivasulu
Professor

Sri. M. Ravi Sankar Naik

Assistant Professor

Dr. M. Ramana Reddy

Assistant Professor

Sri J.V. Ramana Gupta

Assistant Professor
Telugu and Sanskrit Akademi, Andhra Pradesh
Coordinating Committee

Sri V. Ramakrishna, I.R.S.

Director

Dr. M. Koteswaramma, M.Com., Ph.D.

Research Officer

Dr. S.A.T. Rajyalakshmi M.Sc., B.Ed., M.A., Ph.D.

Research Assistant

Dr. K. Glory Sathyavani, M.Sc., Ph.D., M.Ed.

Research Assistant
 Foreword

The Government of India vowed to remove the educational disparities and

adopt a common core curriculum across the country especially at the Intermediate
level. Ever since the Government of Andhra Pradesh and the Board of Intermediate
Education (BIE) swung into action with the task of evolving a revised syllabus in all the
Science subjects on par with that of COBSE, approved by NCERT, its chief intention
being enabling the students from Andhra Pradesh to prepare for the National Level
Common Entrance tests like NEET, ISEET etc for admission into Institutions of
professional courses in our Country.

For the first time BIE AP has decided to prepare the Science textbooks.
Accordingly an Academic Review Committee was constituted with the Commissioner
of Intermediate Education, AP as Chairman and the Secretary, BIE AP; the Director
SCERT and the Director Telugu Akademi as members. The National and State Level
Educational luminaries were involved in the textbook preparation, who did it with
meticulous care. The textbooks are printed on the lines of NCERT maintaining National
Level Standards.

The Education Department of Government of Andhra Pradesh has taken a

decision to publish and to supply all the text books with free of cost for the students of
all Government and Aided Junior Colleges of newly formed state of Andhra Pradesh.

We express our sincere gratitude to the Director, NCERT for according

permission to adopt its syllabi and curriculum of Science textbooks. We have been
permitted to make use of their textbooks which will be of great advantage to our student
community. I also express my gratitude to the Chairman, BIE and the honorable Minister
for HRD and Vice Chairman, BIE and Secretary (SE) for their dedicated sincere
guidance and help.
 I sincerely hope that the assorted methods of innovation that are adopted in the
preparation of these textbooks will be of great help and guidance to the students.

I wholeheartedly appreciate the sincere endeavors of the Textbook

Development Committee which has accomplished this noble task.

Constructive suggestions are solicited for the improvement of this textbook

from the students, teachers and general public in the subjects concerned so that next
edition will be revised duly incorporating these suggestions.

It is very much commendable that Intermediate text books are being printed
for the first time by the Akademi from the 2021-22 academic year.

Sri. V. Ramakrishna I.R.S.

Director
Telugu and Sanskrit Akademi,
Andhra Pradesh
 Preface
This Edition, as you are aware, is the ‘Brain Child’ of BIE, AP. Preparing a Text Book is
no small job. It requires months of preparation, innumerable discussions ,editing, and
uncompromising efforts to maintain quality. The ‘central dogma’ of this exercise is to bring out
the best in us. Barring some minor possible errors, which are generally common in the first
Edition of any book written by ordinary mortals like us, we know we did a pretty good job of this
book. And, we know – “The proof of pudding lies in eating”. It is ultimately the students and
well intentioned Teachers that decide the quality of our work. I request my young friends, the
Lecturers in Zoology, AP, who are giving their life to the ‘GREATER GLORY’ of ‘ZOOLOGY’
to read in depth, and help us weed out errors, if any. The doors of wisdom must never shut,
hence our efforts to give valid comments their due. We tried very sincerely to present updated
information, while not forgetting the so called ‘common’ student. We tried to present Zoology in
a readable way. We also tried ways to draw the attention of the students to points that matter, in
view of the Public Examinations they face, and also tried in our own little way to cater to the
needs of students who aspire to MAKE IT BIG. This book gave me immense pleasure, thanks to
my esteemed Authors and the Editor. They always reposed immense confidence in my capabilities
as the Chief Editor. And, should there be any errors, I would like to categorically state that I own
the total responsibility. The fact that I am currently the senior most Lecturer in Zoology in AP,
does not necessarily mean that I am ‘error proof’, but I must say, I tried my best to avoid errors.
We consulted some recent Reference Editions liberally. However, we must admit that we had to
follow the NCERT books in letter and spirit, keep to the perimeters and parameters of the
syllabus prepared by the COBSE, with some freedom to update information. We presented
some new illustrations, which are self explanatory. The First Page of each Chapter is a ‘Preview’
of the contents in that chapter and the CAPTIONS and TAGS given are aimed at ‘raising curiosity’
in the reader of that Chapter and are just ‘cosmetic’ in nature. The IGNITED MINDS, at the
end of each Chapter, is aimed at giving a ‘taste’ of ‘application’ of the subject learnt.
It has been a pleasure working with the BIE, its esteemed Secretary, the ever inspring
Commissioner and the wonderful Officials of the BIE.

Chief Editor
 Preface to the Reviewed Edition

In view of advancements in Science, periodical review of Text Books at

different levels of study has become necessary. Taking into consideration the
syllabus for the students of Zoology of Senior Intermediate, Board of Intermediate
Education, Andhra Pradesh, the present book is thoroughly reviewed. The
additional information presented in the previous edition is retained as
boxed items in colour. Those topics are not meant for evaluation. They
may be useful for the advanced learners. Lapses in some units are fulfilled and
now the present book is as per the prescribed syllabus.

In spite of the best efforts in preparation of this book, some errors may
crept in. We welcome the constructive criticism from the academic fraternity. It
will be reviewed and incorporated in the coming edition.

We gratefully acknowledge the help received from the Director, Telugu

Akademi and the team of dedicated Officials.

Editor
(Reviewed Edition)
 Contents
UNIT I: Human Anatomy and Physiology - I 1-38
Unit 1A: Digestion and Absorption 2 - 20
Unit 1B: Breathing and Exchange of Gases 21 - 38

UNIT II: Human Anatomy and Physiology - II 39-74

Unit IIA: Body Fluids and Circulation 40 - 57
Unit IIB: Excretory Products and their Elimination 58 - 74

UNIT III: Human Anatomy and Physiology - III 75-120

Unit IIIA: Musculo-Skeletal System 76 - 93
Unit IIIB: Neuronal Control and Coordination 94 - 120

UNIT IV: Human Anatomy and Physiology - IV 121-158

Unit IVA: Endocrine System and Chemical coordination 122 - 140
Unit IVB: Immune System 141 - 158

UNIT V: Human Reproduction 159-196

Unit VA: Human Reproductive System 160 - 183
Unit VB: Reproductive Health 184 - 196

UNIT VI: Genetics 197-238

UNIT VII: Organic Evolution 239-266

UNIT VIII: Applied Biology 267-304

Syllabus 305-307

Model Question Paper 308

 Human Anatomy and
Physiology - I

Unit-I
HUMAN ANA TOMY AND
NAT
PHY SIOL
HYSIOL OG
SIOLOG Y-I
OGY
Digestive System-
The ‘Fuel Provider’ and ‘Life Sustainer’
Digestive system consists of the alimentary canal and associated glands such
as salivary glands, liver, pancreas etc. Vertebrates (heterotrophs) are either
herbivores or carnivores. Human beings are mostly ‘omnivores’ in food habits.
The dental formula of man shows all the four types of teeth indicating his
fundamentally omnivorous nature. Complex items of food have to be broken
down (digested/hydro-lysed) into simple, absorbable substances. Human food
has essential substances such as carbohydrates (chief energy providers), proteins
(body builders and enzymes), fats (energy reserves) mostly stored in adipose
tissue. Insufficient intake of food materials causes nutritional deficiency disorders.
If protein intake is deficient, in spite of normal caloric intake, a person suffers
from Kwashiorkor. Protein-calorie under nutrition (severe malnutrition and energy
deficiency), leads to ‘Marasmus’. Alimentary canal is generally long in the
herbivores as much of what they eat (cellulose) is not digested and they require
a larger absorptive surface area to absorb fully of what little they digested.
Carnivores have comparatively shorter alimentary canal, as digestion is more
efficient in them. The major site of digestion in the human gut is the small
intestine. Water and some minerals are reabsorbed and faeces is formed in the
large intestine. The movements of the gut are controlled by nerve plexuses
present in the muscle layers. Enzymes are produced in their inactive forms such
as pepsinogen, trypsinogen, chymotrypsinogen.Thus the cells which secrete these
inactive enzymes escape from ‘autodigestion’. Only activated enzymes can act
on the cells of the wall of the gut. The ‘Brush Border Enzymes’ embedded in
the plasma membrane hydrolyse disaccharides into monosaccharides. The
‘intestinal flora’ is important in producing some vitamins. Hyper acidity causes
peptic ulcers in the wall of the stomach. However scientists found that peptic
ulcers are caused by the bacterium Helicobacter pylori. Thus, nowadays,
antibiotic treatment is given for treating ulcers.

1
 Zoology

UNIT I A
Digestion and
Absorption
1.1 Digestive System

Food is one of the basic requirements of all living organisms as it provides energy
and organic material for growth and repair of tissues. The water we drink plays
an important role in metabolic processes and also prevents ‘dehydration’ of the
body. Vitamins, minerals and water can be absorbed into the cells directly whereas
bio-macromolecules of food such as carbohydrates, proteins and fats cannot be
absorbed and utilised by our body in their original form. The breakdown of bio-
macromolecules into simple substances is required for their absorption into cells.
The process of conversion of the complex food substances into their simple
absorbable forms is called digestion, and it is carried out by our digestive system.
Digestion involves both mechanical and biochemical processes.

2
 Human Anatomy and
Physiology - I

1.1 Digestive System

Human digestive system consists of the alimentary canal and the associated
glands.

1.1.1 Alimentary canal/digestive tract

The alimentary canal of man begins with the anterior opening, the mouth,
and ends with the posterior opening, the anus. Parts of the alimentary
canal between the mouth and the anus include buccal cavity, pharynx,
oesophagus, stomach, small intestine and the large intestine in the
given order.

Oral cavity
Parotid gland
Mouth
Pharynx
Submaxillary and
sublingual glands

Oesophagus

Liver

Gall bladder Stomach

Pancreas
Duodenum

Transverse colon Jejunum

Ascending colon
Descending colon
Ileum

Caecum
Rectum
Vermiform appendix
Anus

Figure 1.1 The human digestive system

3
 Zoology

I. Mouth and Buccal (oral) cavity

The mouth, bordered by the movable upper and lower lips (labia), leads into
the buccal or oral cavity. The palate separates the ventral buccal cavity
from the dorsal nasal chamber and facilitates chewing and breathing
simultaneously. The anterior bony hard palate is lined by palatine rugae.
The posterior soft palate that hangs down into the pharynx is called uvula.
The jawbones bear four kinds of teeth and a tongue occurs at the base of the
buccal cavity.

i. Teeth
These are ecto-mesodermal in origin.
Teeth of human beings are embedded in
the sockets of the jaw bones, hence called
thecodont. Majority of mammals
including human beings form two sets
of teeth during their life time, a set of
temporary/ milk teeth or deciduous
teeth replaced by a set of permanent
teeth or adult teeth. This type of
dentition is called diphyodont dentition.
An adult human has 32 permanent teeth,
which are of four different types namely,
Figure 1.2 Arrangement of different
types of teeth in the jaw on incisors (I), canines (C), premolars (PM),
one side and the sockets on and molars (M), and such a type of
the other side
dentition is called heterodont dentition.
The arrangement of different types of
teeth in each half of both the jaws in the order I, C, PM, M is represented by
2 1 2 3
the dental formula in adult humans is I C PM M 32 . The dental
2 1 2 3

formula of the ‘milk dentition’ of a baby is teeth. The

third molar teeth appear very late (usually at about 21 years of age ) and are
called wisdom teeth. Incisors, the ‘chisel shaped’ teeth are useful in cutting,
canines, the dagger like teeth help in tearing, premolars and molars, the
cheek teeth, help in grinding the food.
The Structure of a Tooth
Tooth has three parts namely crown (the exposed part), neck (the middle
part) and root (the inner most part embedded in the socket of jaw bone). The
bulk of a tooth is formed by a hard material called dentine, which is secreted
by odontoblasts, of mesodermal origin. Dentine of the crown is covered by

4
 Human Anatomy and
Physiology - I

enamel (the hardest substance in C

R
the body), which is secreted by Enamel O
W
Dentine N
ameloblasts of ectodermal origin.
A small cavity present inside the Pulp cavity N
E
Gum C
tooth is called pulp cavity, which K
is filled with pulp (odontoblasts,
R
nerves,blood vessels etc) and lined O
O
Blood Vessels
by a layer of odontoblasts. Dentine T
Nerve
of the root is covered by cementum.
The root is fixed in the socket
Jaw bone
(alveolus) of the jaw bone by
cementum and periodontal Periodontal
membrane
membrane. The basal parts of teeth
(neck and root) are covered by the
gums (gingiva).
Figure 1.3 L.S. of tooth
ii. Tongue
It is a freely movable, muscular sense organ,
attached to the floor of the oral cavity by a fold
of tissue called frenulum. The upper surface of
the tongue has small projections called papillae,
some of which bear taste buds. In humans the
tongue bears 4 types of papillae namely 1. fungi
form (at the anterior margin and tip of tongue),
Circum vallate
2. filiform (on the surface of the tongue) and 3. Foliate
papillae
circumvallate (on the posterior surface/base papillae
of the tongue) and 4. foliate papillae (on the Fungiform
Filiform papillae
lateral sides of posterior 1/3rd of the tongue, papillae
rudimentary in adults). The tongue acts as
‘universal tooth brush’, and helps in mixing
saliva with food, taste detection, deglutition and Figure 1.4 Tongue
speaking.
II. Pharynx
The oral cavity leads into a short pharynx which serves as a common passage
for food and air. It is divided into nasopharynx (lies above the soft palate),
oropharynx (the middle part) and laryngopharynx (the lower part). The
trachea opens into the larynx and from there into the laryngopharynx through
the glottis. A cartilaginous flap called epiglottis prevents the entry of food
into glottis during swallowing. Pharynx possesses voluntary muscles to assist
in swallowing. Tonsils (lymphoid tissues) present in the pharynx , include
i) pharyngeal tonsils or adenoids, ii) a pair of palatine tonsils and iii) a
pair of lingual tonsils. Eustachian tubes from the middle ear cavities open
into the nasopharynx.

5
 Zoology

III. Oesophagus
The oesophagus is a thin long tube which extends posteriorly, passing through
the neck, thorax and diaphragm and it finally leads into the stomach. A
muscular sphincter (gastro-oesophageal/cardiac sphincter) regulates the
opening between the oesophagus and the stomach. There is an upper
oesophageal sphincter at the beginning of the oesophagus.
IV. Stomach
The stomach is a wide, J-shaped,
distensible muscular bag like structure,
located in the upper left portion of the
abdominal cavity just below the diaphragm.
It has three major parts, an anterior
cardiac portion into which the oesophagus
opens, a middle large fundic region (main
body) and a posterior pyloric portion which
opens into the first part of the small
intestine through the pyloric aperture
Figure 1.5 Anatomical regions of which is guarded by the pyloric sphincter.
human stomach
V. Small intestine
The small intestine is the longest part of the alimentary canal. It is
distinguished serially into three regions namely proximal duodenum, middle
long coiled jejunum and distal highly coiled ileum. Duodenum receives the
hepato-pancreatic duct. Ileum opens into the large intestine,and the opening
bears the ilio-caecal valve and a sphincter to prevent backward flow of
faecal matter into the ileum.
VI. Large Intestine
It consists of caecum, colon and rectum. Caecum is a small blind sac which
hosts some symbiotic microorganisms. A narrow finger-like tubular
projection, the vermiform appendix ( abdominal tonsil ) which is a vestigial
organ, arises from the caecum. The caecum opens into the colon which is
divided into - an ascending, a transverse, a descending parts and a sigmoid
colon that continues behind into the rectum. Colon shows the external
bulged out pouches called haustra and three longitudinal smooth muscle
folds called taenia coli. Rectum is a small dilated sac which leads into anal
canal that opens out through the anus. It is guarded by an internal anal
sphincter formed by ‘smooth muscle’ and external anal sphincter formed
by a ring of voluntary, striped muscle. There is no significant digestive
activity in the large intestine. It is concerned with the absorption of some
water, minerals and certain drugs. It secretes mucus which helps in keeping the
undigested particles together and lubricating their passage to the exterior.

6
 Human Anatomy and
Physiology - I

Histology of alimentary canal

The wall of the alimentary canal
from the oesophagus to the
rectum possesses four layers
namely serosa, muscularis Muscle layers:
externa, sub mucosa and
mucosa.
i) Serosa: it is the outermost
layer and is made up of a thin
mesothelium with some
connective tissue. ii) Muscularis
externa: It is formed by smooth
muscles usually arranged into
outer longitudinal and inner Figure 1.6 Diagrammatic representation of
circular muscles. An oblique transverse section of gut
muscle layer may be present in
some regions such as stomach, iii) Sub mucosa: It is formed of loose
connective tissue containing nerves, blood vessels and lymph vessels. Sub
mucosa of duodenum has Brunner’s glands which secrete mucus, iv) Mucosa:
It is the innermost layer lining the lumen of the alimentary canal. Mucosa
of the stomach forms irregular folds called gastric rugae in between which
there are many microscopic gastric glands. The mucosa of the small intestine
forms small folds called villi. The columnar epithelial cells that line the villi
produce numerous microscopic projections called microvilli giving a ‘brush
border’ appearance. These modifications increase the surface area of
absorption. Plasma membrane of
microvilli bears enzymes such as
disaccharidases,which are called ‘brush
border enzymes’. Each villus has a
network of capillaries and a large lymph
capillary called lacteal. Mucosal
epithelium has goblet cells which
secrete mucus, that helps in the
protection of the wall from the action of
the enzymes. It also helps in the
lubrication of the passage of food.
Mucosa of the small intestine forms Figure 1.7 A section of small intestinal
crypts of Lieberkuhn between the bases mucosa showing villi
of villi.

7
 Zoology

1.1.2 Digestive glands

The digestive glands present in the wall of the alimentary canal are gastric
glands, Brunner’s glands, and crypts of Lieberkuhn. The salivary glands,
liver and pancreas are the digestive glands associated with the gut (extra
alimentary canal glands).

I. Salivary glands
There are three pairs of salivary glands in man, the parotid glands (present
below the pinna/inner surface of the cheeks), the sub maxillary/sub
mandibular glands (angles of lower jaw) and the sublingual glands(below
the tongue). These are formed of serous cells and mucous cells which secrete
saliva. Saliva contains water, salts, mucin, the enzyme ptyalin or salivary
amylase ( -amylase) and lysozyme (which kills bacteria). The pH of saliva
is 6.8.

Note: Mumps, a painful inflammation of the parotid salivary glands is

caused by a virus of the group ‘Paramyxovirus’.

II. Gastric glands

These are located in the wall of the stomach beneath the surface epithelium.
Gastric glands are of three types namely: i) Cardiac glands (secrete mucus
for protection), ii) Pyloric glands (secrete mucus and the hormone ‘gastrin’)
and iii) Fundic/Oxyntic glands (They are composed of three different types
of cells, the mucous neck cells which secrete mainly mucus; the peptic/
chief cells which secrete large quantities of the ‘proenzymes’ pepsinogen,
prorennin and the oxyntic/parietal cells which secrete hydrochloric acid
and Castle’s Intrinsic Factor (essential for the absorption of vitamin B12).
Secretions of all these glands form the ‘gastric juice’ with the pH ranging
from 0.9 to 1.8. Chief cells of gastric glands also secrete some amount of
gastric lipase.

III. Intestinal glands

They are of two types, i) Brunner’s glands (secrete mucus), ii) Crypts of
Lieberkuhn. The secretion of Brunner’s glands along with that of crypts of
Lieberkuhn constitutes the intestinal juice or succus entericus, with the
pH ranging from 7.5 to 8.0. Succus entericus contains peptidases such as
tripeptidases, dipeptidases, aminopeptidases and disaccharidases such
as sucrase (invertase), maltase, and lactase. It also has small amounts of
intestinal lipase and the enzyme activator enterokinase. Paneth cells
lining the bases of the intestinal glands secrete lysozyme which kills the
bacteria that escape destruction in the stomach.

8
 Human Anatomy and
Physiology - I

NOTE: The intestinal wall has some ‘stem cells’ which play an important
role in renewing the epithelial cells lost in the intestinal epithelium.
The Paneth cells are believed to play an important role in the protection
of those cells .

IV. Liver
Liver is the largest gland
of the body weighing about
1.2 to 1.5 kg. in an adult Hepatic ducts
human. It is situated in
the abdominal cavity, just
below the diaphragm
towards the right side and
has two lobes. Each liver
lobe is formed of hexagonal
hepatic lobules,
surrounded by a thin
connective tissue sheath
called the Glisson’s
capsule. The hepatic Figure 1.8 The duct system of liver, gall bladder and pancreas
lobules are the structural
and the functional units
of the liver, containing hepatic Branch of hepatic
portal vein Branch of hepatic
cells arranged in the form artery
hepatic cords present around a Hepatocytes
central vein. The bile secreted by
hepatic cells passes through the Sinusoids
hepatic ducts and is stored and
concentrated in a thin muscular Central vein
sac called the gall bladder. The
duct of the gall bladder (cystic
Bile canaliculi
duct) along with the common
hepatic duct from the liver forms Hepatic cords

the common bile duct (CBD). The

CBD is joined by the pancreatic
duct to form the ampulla of
Figure 1.9 Components of a hepatic lobule
Vater. Its opening into the
duodenum is guarded by the
sphincter of Oddi.

9
 Zoology

Do You Know: The pancreatic duct and the common bile duct unite to
form the ampulla of Vater/Hepatopancreatic ampulla.

Functions of the liver

Liver performs a variety of functions such as synthesis, storage and secretion of various
substances. There are as follows:
1. Liver secretes bile juice (yellowish-green in colour). It does not contain
enzymes, but it contains bile salts such as glycocholates and
taurocholates of sodium and potassium and bile pigments the
bilirubin and biliverdin (formed by the breakdown of hemoglobin of the
old RBC destroyed in the body).
2. Liver plays the ‘key role’ in carbohydrate metabolism (glycogenesis,
glycogenolysis, gluconeogenesis and lipogenesis).
3. Liver also plays a role in lipid metabolism (synthesis of cholesterol and
production of triglycerides).
4. Deamination of proteins (removal of NH2 group from the amino acids)
and conversion of ammonia into to urea (via the ornithine cycle).
5. The lactic acid formed during anaerobic muscle contraction is converted
into glucose via pyruvates (gluconeogenesis) in the liver by Cori cycle.
6. Liver is the chief organ of detoxification of toxic substances that enter
the gut along with food.

NOTE: Liver is the ‘first check post’ that bars entry of toxins into general
circulation. Recall the role of the smooth ER in detoxification of toxins.
The toxins that enter the body through food and water reach the liver
via the hepatic portal vein, where they are detoxified. In the case of
alcoholics, liver detoxifies alcohol to some extent before it is sent into
general circulation. That is why liver is the first and most affected
organ in chronic alcoholism (cirrhosis). This is the reason behind
development of liver cancers by certain fungal toxins, produced by
organisms such as Aspergillus flavus. After entering the body, the
‘aflatoxins’ are generally metabolized by the liver into some other non-
toxic/ less toxic substances.

7. Liver acts as thermoregulatory organ (like skeletal muscle, liver too

takes part in thermogenesis as it has high glucose (in the form of glycogen)
at its disposal).
8. Liver acts as a haemopoietic organ in the foetus and erythroclastic
organ in the adult (along with the spleen).

10
 Human Anatomy and
Physiology - I

9. The liver synthesizes the plasma proteins such as albumins, globulins,

blood clotting factors such as fibrinogen, prothrombin, etc. and the
anticoagulant, called heparin.
10. Kupffer cells are the large phagocytic cells which remove unwanted
substances and microbes that attack the liver by phagocytosis. They
are present in the sinusoids that lie in between hepatic cords and they
are also called hepatic macrophages.

V. Pancreas (Sweet gland / Mixed gland / Heterocrine gland)

The pancreas is the second largest gland in human body. It is a mixed
(compound) gland situated between the limbs of ‘U’ shaped duodenum.
Exocrine part of pancreas, the pancreatic acini secrete an alkaline pancreatic
juice ( pH 8.4) containing enzymes and the endocrine part, the islets of
Langerhans which secrete insulin, glucagon and other hormones. Pancreatic
Juice contains sodium bicarbonate, trypsinogen, chymotrypsinogen,
carboxypeptidase, pancreatic lipase (steapsin), pancreatic amylase and
nucleases such as DNAase and RNAase.

1.1.3 Physiology of digestion

Digestion is the process of conversion of complex non--diffusible food
substances into simple diffusible forms. The process of digestion is
accomplished by mechanical (cutting and chewing of food by teeth and
churning of food by peristalsis) and chemical (enzymatic reactions by
hydrolysing enzymes)processes.

I. Digestion in the buccal cavity

Buccal cavity performs two major functions, mastication of food and
facilitation of swallowing (deglutition). Teeth and tongue with the help of
saliva masticate and mix up the food thoroughly. Mucus in saliva helps in
lubricating and adhering the masticated food particles into a bolus. The
saliva secreted into oral cavity contains electrolytes such as Na+, K+, Cl–,
HCO3– and enzymes, such as salivary amylase (ptyalin) and lysozyme.
The chemical process of digestion is initiated in the oral cavity (buccal
cavity) by the hydrolytic action of carbohydrate (starch) splitting enzyme,
the salivary amylase. About 30% of starch is hydrolyzed here into a
disaccharide called maltose by the enzyme ptyalin. Lysozyme present in
the saliva acts as an antibacterial agent that prevents infections.
Salivary amylase
Starch pH 6.8
Maltose

11
 Zoology

II. Digestion in the stomach

The stomach stores food for 4-5 hours. The food is mixed thoroughly with the
acidic gastric juice of the stomach by the churning movements of its muscular
wall and the product is called chyme. The mucus and bicarbonates present
in the gastric juice play an important role in the lubrication and protection of
the mucosal epithelium from ‘excoriation’ by the highly concentrated
hydrochloric acid. HCl provides the acidic pH (1.8) which is optimal for the
action of pepsin. It also kills the microorganisms ingested along with food.
The proenzymes of gastric juice, the pepsinogen and prorennin, on exposure
to hydrochloric acid are converted into the active enzymes, pepsin and rennin,
respectively. Pepsin can convert pepsinogen into pepsin (autocatalysis). Pepsin
converts proteins into proteoses and peptones. Rennin is a proteolytic
enzyme found in the gastric juice of infants. It acts on the milk protein, the
casein in the presence of calcium ions and converts it into calcium
paracaseinate (curdling of milk) and proteoses. Pepsin acts on calcium
paracaseinate and converts it into peptones. Proteoses are a group of
compounds formed during protein digestion and they are more complex
than peptones. Certain other cells in the wall of the stomach
produce bicarbonate, a base, to buffer the acidic contents of the stomach.
They also prevent too much acidity in the stomach. The mucus produced by
the wall of the stomach forms a physical barrier to prevent HCl from damaging
the wall of the stomach.

Hcl
Prorennin (inactive) Rennin (active)
Hcl
Pepsinogen (inactive) Pepsin (active)
Rennin
Casein Calciumparacaseinate
Ca+2
Pepsin
Calciumparacaseinate Peptones
Pepsin
Proteins Proteoses + Peptones

III. Digestion in the small intestine

Various types of movements are generated by the muscularis externa layer

of the small intestine. These movements help in thorough mixing up of the
food with bile, pancreatic juice and intestinal juice in the intestine and
thereby facilitate digestion. The mucus along with the bicarbonates from
pancreas protects the intestinal mucosa from the acidic medium and provides
an alkaline medium (pH7.8) for enzymatic activities. The duodenal cells of
the proximal part also produce large amounts of bicarbonate to completely

12
 Human Anatomy and
Physiology - I

neutralize any gastric acid that passes further down into the digestive tract.
All the enzymes of the pancreatic juice and succus entericus (mentioned
above) act only in alkaline medium.

i. Digestion of proteins
Trypsinogen, chymotrypsinogen and procarboxy peptidases are inactive
enzymes. Trypsinogen is activated by the enzyme, enterokinase, secreted
by the intestinal mucosa into active trypsin, which in turn activates the
other enzymes in the pancreatic juice. Trypsin itself can similarly activate
trypsinogen into trypsin (autocatalysis).
Enterokinase
Trypsinogen Trypsin
Trypsin
Trypsinogen Trypsin (Autocatalysis)
Trypsin
Chymotrypsinogen Chymotrypsin

Proteins, proteoses and peptones (partly hydrolysed proteins) in the chyme, reaching
the intestine are acted upon by the proteolytic enzymes of the pancreatic juice and
intestinal juice as shown below:

Proteins Trypsin/Cymotrypsin
Proteoses Tripeptides + Dipeptides
Carboxypeptidase, aminopeptidase
Peptones
Tripeptidase
Trypeptidase
Tripeptides Dipeptides + Amino acids
Dipeptidase
Dipeptides Amino acids

Thus the end products of digestion of proteins namely amino acids are formed
in the small intestine.

ii. Digestion of fats

Bile salts of the bile help in the emulsification of fats i.e. break down of fats
into very small micelles. Bile also activates lipases of pancreatic juice
(steapsin) and intestinal lipases. These lipases act on emulsified fats and
convert them into fatty acids and glycerols.

Bile salts
Fats Emulsified fats
Lipases Lipases
Emulsified fats Diglycerides Monoglycerides
Lipases
Monoglycerides Fatty acids + Glycerol

13
 Zoology

iii. Digestion of Carbohydrates

Starch (Carbohydrates) in the chyme are hydrolysed by the pancreatic amylase
into disaccharides. Intestinal disaccharidases act on the ‘disaccharides’
and convert them into monosaccharides.

Starch

Galactose

iv. Digestion of nucleic acids

Nucleases (DNAase, RNAase) of the pancreatic juice act on the nucleic acids
to form nucleotides and nucleosides. Nucleotidases and nucleosidases of
the intestinal juice covert the nucleotides and nucleosides into pentose sugars
and nitrogen bases.

Nucleases
Nucleic acids (DNA, RNA)
Nucleicacides Nucleotides
DNAase,RNAase
Nucleotidease
Nucleotides Nucleosides + Phosphates
Nucleosidases
Nucleosides Sugars + Bases

1.1.4 Peristalsis
It involves contraction and relaxation of smooth muscles of the wall of the
gut, resulting in successive wave like movements throughout the gut. It
causes propulsion of food through different parts of the gut and its exposure
to efficient enzymatic action. The bolus of food formed in the buccal cavity
is conveyed into pharynx and then into the oesophagus by swallowing or
deglutition. The bolus further passes down through the oesophagus by
successive waves of muscular contractions called peristalsis. Usually
peristaltic movements are initiated from the oesophagus and are continued
up to the rectum. However the sphincters associated with the gut regulate
the passage of food through different parts of the gut. Peristaltic movements
of the stomach (churning movements) are so powerful that they can cause
mechanical digestion. Peristaltic movements of the intestine are slow.
Stimulation from the parasympathetic nervous system increases the
peristaltic movements of the gut and relaxes the sphincters (made of smooth
muscles).

14
 Human Anatomy and
Physiology - I

1.1.5 Absorption of digested food

Absorption is the process by which the end products of digestion pass through
the intestinal mucosa into blood or lymph. It is carried out by passive,
active or facilitated transport mechanisms. Monosaccharides such as
glucose and galactose are transported into the cells of the villi via secondary
active transport (SAT), coupled with Na + and from there into blood by
Facilitated Diffusion. Substances such as fructose is absorbed by Facilitated
Diffusion. From the intestinal epithelial cells, it is transported into blood by
FD. Transport of water depends upon the osmotic gradient. Amino acids
are actively transported or by Secondary Active Transport with Na+ and from
there they enter blood capillaries by FD. Short chain fatty acids ‘diffuse’ into
the intestinal epithelial cells and blood capillaries.
Long chain fatty acids and glycerol, being insoluble in water cannot be
absorbed into the blood directly. They are first modified into small droplets
called micelles, which enter the intestinal mucosal cells by diffusion. In the
intestinal epithelial cells they are formed into very small protein coated fat
globules called chylomicrons. These chylomicrons are transported into the
lacteals (lymph capillaries) in the villi by exocytosis (they cannot enter the
blood capillaries due to their large size). The lymph vessels ultimately release
the absorbed substances into the blood stream through the left subclavian
vein via the thoracic duct. These chylomicrons (triglycerides) are broken
down to fatty acids and glycerol by the action of the enzyme ‘lipoprotein
lipase’ present in the endothelial walls and they diffuse into the adipocytes
of the adipose tissue, and liver for storage (as neutral fat / tissue fat).
Vitamins are generally absorbed by simple diffusion.
Vitamin B12 is actively reabsorbed in combination with Castle’s Intrinsic
Factor.
Absorption of substances takes place in different parts of the gut, like mouth,
stomach, small intestine and large intestine. However maximum absorption
of the end products of digestion occurs in the small intestine.
Summary of absorption of different parts of digestive system

Mouth Stomach Small intestine Large Intestine

Certain drugs coming Absorption of Principal organ for the absorption of Absorption of water, some
in contact with the water, simple nutrients. The digestion is completed
minerals and drugs takes
mucosa of mouth and sugars, and here and the final (end) products of
lower side of the alcohol, drugs digestion such as glucose, fructose, place.
tongue are etc., takes galactose, amino acids are absorbed
absorbed in to place. into blood through mucosa whereas fatty
the blood acids and glycerol are absorbed through
capillaries lining the mucosa into lymph of the lacteals.
them.

15
 Zoology

Assimilation
The absorbed substances finally reach the tissues where food materials
become integral components of the living protoplasm and are used for the
production of energy, growth and repair. This process is called assimilation.
Defaecation
The undigested, unabsorbed substances are passed on to the large intestine.
No significant digestive activity occurs in the large intestine. The functions
of large intestine are 1. Absorption of some water, minerals and certain drugs. 2.
Secretion of mucus which helps in holding the undigested particles together and
lubricating it for easy passage. The undigested, unabsorbed substances which mostly
include fibre of plant material generally called roughage enter the large intestine. Water
and some useful substances are reabsorbed in it. It is temporarily stored in the rectum
till it is expelled out through the anus (defaecation).
The undigested wastes, solidified into faeces in the rectum, initiate a neural reflex
causing an urge for its removal. The egestion of faeces to the outside through the anal
opening is a voluntary process and it is carried out by a ‘mass peristaltic
movement’ (forcible peristaltic movements that expel the contents of the
large intestine).

1.1.6 Gastro Intestinal hormones

Activities of the gastrointestinal tract are under neural and hormonal control
for proper coordination of different parts. The sight, smell and the presence
of food in the oral cavity can stimulate the secretions of saliva. Gastric and
intestinal secretions are also similarly stimulated by neural signals. The
muscular activities of different parts of the alimentary canal are also
moderated by neural mechanisms. Hormonal control of the secretions of
digestive juices is carried out by the ‘local hormones’ by gastric and intestinal
mucosa as given below.
Gastrin is secreted from the epithelium of the stomach; it stimulates the
secretions of hydrochloric acid and pepsinogen.
Enterogastrone or gastric inhibitory peptide (GIP) is secreted by the
epithelium of duodenum due to the effect of dietary lipids. It inhibits gastric
acidity and gastro-intestinal motility.
Secretin is secreted by the epithelium of duodenum and acts on the pancreatic
acini; stimulates the secretions of water and bicarbonates of the pancreatic
juice.

16
 Human Anatomy and
Physiology - I

Cholecystokinin (CCK)/Pancreozymin: It is secreted from the epithelium

of the duodenum; acts on pancreas and gall bladder and stimulate the
secretion of pancreatic enzymes and release of bile, respectively.
Enterocrinin secreted from the duodenal mucosa stimulates the secretions of
succus entericus, villikinin secreted from intestinal villi, stimulates the movement
of villi to increase absorption.

Calorific values of carbohydrates, proteins and fats

The oxidation of one gram of proteins and carbohydrates yield almost
the same amount of energy i.e.4.0 K cal, whereas it is 9.0 K cal in the
case of fats.

1.1.7 Nutritional disorders

1. Protein energy Malnutrition (PEM) [Kwashiorkor] : Kwashiorkor is a
disease caused due to deficiency of proteins in diet. The main symptom
of this disease is the accumulation of fluid in intercullular spaces of
tissues of body. As a result body shows oedema, hands, legs, face show
swelling, skin becomes dry. The patient suffers from diarrhoea.
2. Indigestion: In this condition, the food is not properly digested leading
to a feeling of ‘fullness’. The causes of indigestion are mostly ‘spicy
foods’, ‘over eating’ and ‘anxiety’.

3. Vomiting: It is the ‘throwing out’ of the contents of the stomach through

the mouth. This reflex action is controlled by the ‘vomiting centre’ in
the medulla oblongata. A feeling of nausea precedes vomiting.
4. Jaundice: The liver is affected (hepatitis); anorexia (lack of appetite) is
a common symptom. Skin and the white part of the eye balls turn
yellow due to deposition of bile pigments.
5. Diarrhoea: The abnormal frequency of bowl movement and increased
liquidity of the faecal discharge is known as diarrhoea. It reduces the
absorption of food and results in loss of water (dehydration).
Constipation: In constipation, the faeces are retained within the rectum
as it is hard due to low content of water and the movement of the bowel
occurs irregularly.

6. Marasmus: This disease is caused due to deficiency of proteins and

calories. It is observed in children born without sufficient interval.
The child appears weak and surrers from swelling of joints, deficiency
in development of muscles, dry skin, diarrhoea etc.

17
 Zoology

G LOSSARY
Adenoids: A mass of lymphoid tissue Odontoblasts: Dentine producing cells
present in the nasopharynx, also of teeth.
called pharyngeal tonsil. Ornithine cycle: The synthesis of
Ameloblasts: The epidermal cell that urea from ammonia and CO2, which
secrete the enamel of teeth. involves ornithine,citruline,
Brunner’s glands: Intestinal glands arginine and the enzyme arginase.
of the sub mucosa of the Oxyntic cells: Cells of fundic glands
duodenum; secrete mucus. of the stomach; secrete
Castle’s intrinsic factor: It is hydrochloric acid and Castle’s
secreted from the oxyntic cells of intrinsic factor.
the stomach, and promotes the
Parotid glands: The largest of the
absorption of the vitamin B12 in the
intestine. salivary glands of man, present
Chyme: Partly digested acidic food below the pinnae on the inner
formed in the stomach. surface of the cheeks.
Crypts of Lieberkuhn: They are the Peptic ells: These are the chief cells;
‘tubular invaginations of the secrete pepsinogen and prorennin.
intestinal epithelium around the Periodontal membrane: It is a layer
villi/ Intestinal glands of the of dense irregular connective tissue
mucosa of the ileum; secrete that lines the sockets of the jaw
intestinal juice. bones ; fixes the root of a tooth
Cystic duct: Duct that arises from in the alveolus of the jaw bone.
the gall bladder and joins the
Sphincter of Oddi: A sphincter which
hepatic duct to form the common
bile duct in liver. guards the opening of the hepato-
Deamination: Removal of ammono pancreatic duct into the
group from amino acids during duodenum.
their metabolism (the amino group Succus entericus: Intestinal juice
is used in the formation of secreted by both Brunner’s glands
ammonia) in liver. and crypts of Lieberkuhn of the
Deciduous/milk teeth: A set of intestine.
temporary teeth that are formed as Thecodont teeth: Teeth embedded in
the first set, they don’t include the sockets of jaw bone. e.g.
premolar and last molars in man. mammals and crocodiles.
Glycogenesis: Conversion of excess
glucose into glycogen in liver. Vermiform appendix: A narrow finger
Glycogenolysis: Conversion of like tubular projection, that arises
glycogen (animal starch) into from the caecum of man; it is a
glucose vestigial organ in man.
Gluconeogensis: Synthesis of
glucose from non-carbohydrates
such as proteins and lipids.
Lacteals: L ymph capillaries of
intestinal villi, help in the
absorption of fats and fat soluble
vitamins into lymph.
Lipogenesis: Conversion of excess
carbohydrates and proteins into
lipids and it occurs in liver.

18
 Human Anatomy and
Physiology - I

Q UESTIONS
Very Short Answer Type 14. Name two hormones secreted by
Questions the duodenal mucosa.
15. Distinguish between absorption
1. Give the dental formula of adult and assimilation
human beings.
2. Bile juice contains no digestive
enzymes, yet it is important for Short Answer Type Questions
digestion. How?
3. Describe the role of chymotrypsin. 1. Draw a neat labelled diagram of
Name two other digestive enzymes L.S. of a tooth.
of the same category and secreted 2. Describe the process of digestion
by the same gland. of proteins in the stomach.
4. What would happen if, HCl were 3. Explain the role of pancreatic
not secreted in the stomach? Juice in the digestion of
5. Explain the terms thecodont and proteins.
diphyodont dentitions. 4. How are polysaccharides and
6. What is auto catalysis? Give two disaccharides digested?
examples. 5. If, you take butter in your food,
7. What is chyme? how does it get digested and
absorbed in the body? Explain.
8. Name the different types of salivary
glands of man, and their locations 6. What are the functions of liver?
in the human body.
9. Name different types of papillae Long Answer Type Questions
present on the tongue of man. 1. Describe the physiology of
10. What is the hardest substance in digestion of various types
the human body? What is its of food in the human digestive
origin? system.
11. Name the structure of gut which 2. Explain the digestive system
is vestigial in human beings, but of man with neat labelled
well developed in the herbivores diagrams.
.And mention the type of tissue
with which it is mostly formed.
12. Distinguish between deglutition
and mastication
13. Distinguish between diarrhoea
and constipation.

19
 Zoology

FOR IGNITED
MINDS
The ‘Fuel Provider’
and ‘Life Sustainer’

Digestion and Absorption

1. Regarding the length of the alimentary canal in animals, in general-which type of
animals possess a long alimentary canal and which possess a comparatively short
alimentary canal? Can you give one example of a vertebrate which possesses a long
alimentary canal in some stage of the life history and a relatively short alimentary
canal in another stage. HINT: you probably heard of such animal in your school biology
lessons.
2. Alcohol is harmful to the body. It gets directly absorbed into blood through the wall of
the gut, as it does not require any digestion. In such a case will there be any difference
between drinking alcohol (without diluting it with water) and injecting alcohol into
blood directly through a vein? If you think there is a difference, what is it?.
3. Saliva is an important constituent of the human digestive process. Simultaneously,
can your saliva be a part of any other important system in your body ? If so what is the
system. HINT: Recall all the enzymes present in saliva.
4. If, 100 molecules each of glucose and fructose are required, hypothetically, from lactose
and sucrose , how many molecules of ‘invertase’ and ‘lactase’ are required, respectively
? (CONDITION: You must use both the enzymes and hypothetically consider one molecule
of enzyme working on one molecule of the substrate only).
5. We say that fats cannot be absorbed into blood directly, because of their larger molecular
size and that they enter circulation through the lymph system. If so, when blood reaches
tissues how do these fats pass into the tissues through the walls of the blood capillaries?
6. If you eat a piece of meat, it gets digested in the lumen of the gut, due to the activity of
various enzymes. Can you guess why the same enzymes, do not digest the wall of your
gut or the cells they are produced by , which are equivalent to the piece of meat eaten.
HINT : You have a clue somewhere in this exercise / questionnaire .
7. Why are certain amino acids and fatty acids called ‘essential amino acids’ and ‘essential
fatty acids’?
8. Hypothetically, if more ammonia and CO2 are injected into the blood in the HPV, what
substance can be expected to be present in more quantity in the blood sample collected
from the hepatic vein of the same person.
9. Presuming the microbial content of the blood sample from the HPV as 10,000 per cubic
millimeter, what in your opinion will be the microbial content of blood sample taken
from the hepatic vein? Will it be more/ less/ same ? Give reason(s).

n
10. The food we ingest contains potentially harmful toxins, which can cause serious
consequences. One organ acts as a ‘Guardian Angel’ acting as a barrier and protecting
other body parts from the ill effects to a lesser or greater extent. What is the name
of the organ?

20
 Human Anatomy and
Physiology - I

U NIT I B
Breathing and
Exchange of Gases
1.2 Breathing and
Exchange of Gases
Respiratory system -
Your ‘Calorie Burner’ and ‘Energy Provider’
Respiration is a catabolic process of release of energy mostly by the
oxidation of foods. Oxygen obtained from the surrouding medium is utilised
in the production of ‘metabolic water’, an end product of the ‘burning
of calories’. The direction of flow of blood in the gills and the
direction of flow of water are in ‘counter current flow’ mechanism,
for efficient ‘oxygenation’ of blood. Birds have developed a technique
of continuous exchange of gases even during expiration, with the help of
a unique feature - the presence of ‘air sacs’ and ‘parabronchi’.
Insects and some other arthropods supply oxygen directly to each cell via
the tracheae and tracheoles. Thus every cell can virtually receive
oxygen directly, making the ‘tracheate animals’ very active.
At a height of about 6000 m the pO2 becomes almost half of what it is at
the mean sea level, hence the ‘mountain sickness’ in people ascending
mountains. The ‘ribcage’ and the ‘diaphragm’ help mammals breathe in air
more effectively. Homeostasis of oxygen and carbon dioxide are under the
control of the respiratory centre. Inhalation and exhalation are under
the control of the medulla oblongata. There is a pneumotaxic centre
in the pons and it controls the rate and depth of breathing. Man
cannot hold his breath for long. He is forced to breathe in. Elephant
seal, a mammal can remain under water for up to two hours. The muscles
of the elephant seal and some other aquatic mammals, contains myoglobin
(muscle haemoglobin) which has more affinity for oxygen.

21
 Zoology

All living cells need constant supply of energy in order to carryout various
metabolic activities. Energy is produced by the oxidation of micromolecules
of digested food such as glucose, amino acids, and fatty acids. These are
transported to the body cells through the circulatory system. Oxygen is
utilized by organisms to breakdown stored food materials such as glucose,
fatty acids etc. Carbon dioxide which is harmful (dissolves in water to form
carbonic acid, which lowers the pH of blood threatening homeostasis) is also
released during the above catabolic reactions. It is therefore, evident that O2
has to be continuously provided to the body cells and CO2 produced by the
cells has to be sent out. Respiration is a vital feature of life. The process of
exchange of O2 from the medium (air or water) with CO2 produced by the cells at
the same time is called ‘breathing’ (Ref: NCERT Vol I, Page 268). However, the
process of respiration, during which air is inhaled into the lungs and exhaled
out of the lungs is called ‘breathing’. Many authors described the process of
gaseous exchange as ‘external respiration’ or ‘ventilation’ because it
emphasizes that the entry of oxygen and the exit of CO2 happen at places
other than the energy releasing sites. More accurately the “processes leading
to, and including the chemical breakdown of food materials to provide
energy for life is called respiration.” As the chemical breakdown of the
nutrients occurs inside the living cells of every organism, it is called internal
respiration or cellular respiration.
Anaerobic respiration is the incomplete break down of organic molecules
with less yield of energy; it takes place in the absence of oxygen in organisms
such as yeast and bacteria, muscles(under certain conditions) etc.
C6H12O6 2CO2+ 2C2H5OH(ethanol)+2ATP
C6H12O6 2C3H6O3(lactic acid)+2ATP
Aerobic (requiring oxygen) respiration yields more energy (gradually) due
to complete breakdown of organic molecules, utilising oxygen.
C6H12O6+6H2O+6O2  6CO2+12H2O+36ATP

1.2.1 Respiratory organs in animals

Mechanisms of breathing vary among different groups of animals depending
mainly on their habitats and levels of organisation. Protozoans and lower
invertebrates such as the sponges, cnidarians, flatworms, etc., exchange
with by simple diffusion over their entire body surface. Earthworms use
their moist body wall; insects have a network of tubes (tracheal system) to
transport atmospheric air with in the body. Spiders and scorpions have
book lungs for aerial respiration. Special vascular structures called gills

22
 Human Anatomy and
Physiology - I

are used by most of the aquatic arthropods and molluscs, whereas vascular
bags called lungs are used by terrestrial forms for the exchange of gases.
Among vertebrates’ fishes, larvae of amphibians and some adult urodeles
use gills, where as the reptiles, birds and mammals respire through lungs.
Amphibians like frogs respire through their moist skin and lungs also.
Mammals have a well developed respiratory system.

1.2.2 Human Respiratory System

Respiratory system of man includes the following:
I. External nostrils (External Nares)
A pair of external nostrils opens out above the upper lip. They lead into
nasal chambers.
II. Nasal Chambers
They lie above the palate and are separated from each other by a nasal
septum. Each nasal chamber can be differentiated into three parts namely;
i. vestibular part (which has hair and sebaceous glands to prevent the
entry of dust particles),ii. respiratory part (which is involved in the
conditioning the temperature of inhaled air; it is supported by three thin,
twisted bony plates called turbinals /conchae) and iii.olfactory part (which
is lined by an olfactory epithelium to detect sense of smell).
III. Naso-pharynx
Nasal chambers lead into nasopharynx through a pair of internal nostrils,
located above the soft palate. Nasopharynx is the upper portion of the pharynx.
IV. Larynx
Larynx is a cartilaginous box which helps in sound production, hence called
the voice box. Wall of the larynx is supported by nine cartilages. Thyroid,
cricoid and epiglottis are the unpaired cartilages, whereas corniculate
cartilages (cartilages of Santorini - two small conical nodules of
elastic cartilage articulating with the arytenoid cartilages), arytenoids, and
cuneiform cartilages are the paired cartilages. Epiglottis is a thin leaf like
elastic cartilaginous flap attached to the thyroid cartilage to prevent the entry
of food into the larynx through the glottis. The yellow elastic fibres which
connect the thyroid and arytenoid cartilages are called vocal cords/vocal
folds. The opening between the true vocal cords and the arytenoid
cartilages is called (some sources give a simple difinition- ‘the narrow
opening between the two vocal cords’) rima glottidis.

23
 Zoology

 The mid ventral part of the thyroid cartilage forms the laryngeal
prominence called Adam’s apple.
 In males, the vocal cords are thicker, longer, and produce low pitch
voice, where as in women and children the vocal cords are usually
short and produce high pitch voice.

NOTE: Larynx contains two types of vocal cords: the ‘false vocal cords’
are the folds of mucous membrane, which do not have a role in sound
production, and ‘true vocal cords’ which produce sound.

V. Trachea
Trachea, the wind pipe is a straight tube extending up to the mid-thoracic
cavity. The wall of the trachea is supported by ‘C’ shaped rings of hyaline
cartilage. These rings are incomplete dorsally and keep the trachea always
open preventing its collapse. Internally the trachea is lined by pseudostratified
ciliated epithelium.
VI. Bronchi and Bronchioles
On entering the mid thoracic cavity, trachea divides at the level of the fifth
thoracic vertebra into right and left primary bronchi. Each primary bronchus
enters the corresponding lung and divides into secondary bronchi that
further divide into tertiary
Terminal bronchiole
bronchi. Each tertiary
Pulmonary
Pulmonary arteriole
bronchus divides and re-
venule
L ymphatic vessel divides to form primary,
Elastic
secondary, tertiary, terminal
connective
tissue and respiratory bronchioles
Respiratory bronchiole
sequentially. Each
respiratory bronchiole
terminates in a cluster of
Alveolar ducts
alveolar ducts which end in
Alveoli
alveolar sacs. Bronchi and
Alveolar sacs
initial bronchioles are
Pulmonary
Capillaries
supported by incomplete
cartilaginous rings. The
branching network of
trachea, bronchi and
bronchioles constitute the
Figure 1.10 Structure of a part of a
‘pulmonary tree’ (an upside
‘Pulmonary lobule’
down tree).

24
 Human Anatomy and
Physiology - I

VII. Lungs
Lungs occupy the greater part of the thoracic cavity. Lungs are covered by a
double layered pleura, with pleural fluid between them. It reduces friction
on the lung surface. The outer pleural membrane is in close contact with the
thoracic lining whereas the inner pleural membrane is in contact with lung’s
surface. The part starting with external nostrils up to the terminal bronchioles
constitute the conducting part, whereas the alveoli and their ducts form the
respiratory or exchange part of the respiratory system. The conducting part
transports the atmospheric air to the alveoli, clears it from foreign particles,
humidifies and also brings the inhaled air to the body temperature. Exchange
part is the site of actual diffusion of oxygen and carbon dioxide between
blood and atmospheric air.
The lungs are situated in the thoracic chamber which is anatomically an
air-tight chamber. It is formed dorsally by the vertebral column, ventrally
the sternum, laterally by ribs and on the lower side by the dome-shaped
diaphragm. The anatomical setup of lungs in the thorax is such that any
change in the volume of thoracic cavity will be reflected in the lung cavity
(pulmonary volume). Such an arrangement is essential for breathing, as the
pulmonary volume cannot be directly altered.

Epiglottis

Larynx

Trachea

Bronchus

Cut end of rib Pleural membranes

heart
Alveoli
Pleural fluid
Lung
Bronchiole
Diaphragm

Figure 1.11 Diagrammatic view of human respiratory system (Sectional view of the
left lung is also shown)

25
 Zoology

Respiration in humans involves the following steps:

i. Breathing or pulmonary ventilation by which atmospheric air with
21% of O2 is drawn in and alveolar air rich in CO2 is sent out.
ii. Diffusion of gases across the alveolar membrane
iii. Transport of gases by blood, between the lungs and tissues.
iv. Diffusion of O2 and CO2 between the blood in the systemic capillaries
and the tissues.
v. Utilization of O 2 by the cells for catabolic reactions and resultant
production of CO2, H2o, and ATP(Cellular respiration).

1.2.3 Mechanism of Breathing

Breathing is a means of maximising the process of gaseous exchange. The
movement of air into and out of the lungs is carried out by creating a pressure
gradient between the lungs and the atmosphere.
Breathing involves two stages such as inspiration
and expiration. Inspiration can occur if the
pressure within the lungs (Intra-pulmonary
pressure) is less than the atmospheric pressure,
i.e., there is a negative pressure in the lungs with
respect to atmospheric pressure. Similarly,
expiration takes place when the intra-pulmonary
pressure is higher than the atmospheric pressure.
The muscular diaphragm and a specialized set of
muscles, the external and internal inter -costal
muscles help in generating such gradients.
i. Inspiration: Intake of atmospheric air into the
lungs is called inspiration. It is an active
process , as it takes place by the contraction
of the muscles of the diaphragm and the
external inter-costal muscles, which extend
in between the ribs. The contraction of the
diaphragm (phrenic muscles) increases the
volume of the thoracic chamber in the antero-
posterior axis. The contraction of external
inter -costal muscles lifts up the ribs and
sternum causing an increase in the volume
of the thoracic chamber in the dorso-ventral
axis. The overall increase in the thoracic
volume causes a similar increase in the
‘pulmonary volume’. An increase in the pulmonary
Figure 1.12 Mechanism of breathing volume decreases the intra-pulmonary pressure
showing: (a) inspiration to less than that of the atmosphere, which forces
(b) expiration
the air from the outside to move into the lungs,
i.e. inspiration.

26
 Human Anatomy and
Physiology - I

ii. Expiration: Release of alveolar air to the exterior is called expiration. It

is a passive process. Relaxation of the diaphragm and the external
inter-costal muscles returns the diaphragm and sternum to their normal
positions, and reduces the thoracic volume and thereby the pulmonary
volume. This leads to an increase in the intra-pulmonary pressure to
slightly above that of the atmospheric pressure, causing the expulsion
of air from the lungs, i.e. expiration.

NOTE : The contraction of the internal intercostal muscles and the

lateral abdominal muscles help in ‘forced expiration’.

We have the ability to increase the strength of inspiration and expiration

with the help of additional muscles in the abdomen. On an average, a healthy
human breaths 12-16 times/minute. The volume of the air involved in
breathing movements, can be estimated by using a spirometer, which helps
in clinical assessment of the pulmonary functions.

1.2.4 Exchange of gases

Alveoli are the primary sites of exchange of gases in the lungs. Exchange of
gases also occurs between blood and tissues. O2 and CO2 are exchanged in
these sites by simple diffusion. The exchange of gases is based on some
important factors that can affect the rate of diffusion; these factors include
(i) partial pressure / concentration gradient of gases, (ii) solubility of the
gases, (iii) thickness of the respiratory membrane, (iv) surface area, (v)
distance of diffusion.
The pressure contributed by an individual gas in a mixture of gases is called
its partial pressure and is represented as pO 2 for oxygen and pCO 2 for
carbon dioxide. The data given below in the table clearly indicates a
concentration gradient for oxygen from the alveoli to the blood and from the
blood to the tissues. Similarly, a gradient present for in the opposite direction
i.e., from the tissues to the blood and from the blood to the alveoli.

Partial pressures (in mm Hg) of oxygen and carbon dioxide at different

parts involved in diffusion in comparison to those in the atmospheric air
Respiratory Atmospheric Alveoli Blood Blood Tissues
Gas Air (Deoxyge-nated) (Oxygenated)

O2 159 104 40 95 40
CO2 0.3 40 45 40 45

27
 Zoology

As the solubility of CO2 is 20-25 times

Air
higher than that of O2 the amount of
CO 2 that can diffuse through the Basement
Alveolar wall
diffusion membrane per unit (one-celled thick) substance
difference in partial pressure is much
Alveolar cavity
higher compared to that of O 2. The
diffusion membrane is made up of
three major layers namely, the thin
Blood
squamous epithelium of the alveolar capillary Red blood
wall, the endothelium of the alveolar cell

capillaries and the basement material

in between them. As it is a very thin Figure 1.13 A section of an alveolus with a
pulmonary capillary
border, it is favourable for diffusion
of gases.

Figure 1.14 Diagrammatic represetnation of exchange of gases at the alveolus and

the body tissues with blood and transport of O2 and CO2

28
 Human Anatomy and
Physiology - I

I. Pulmonary gas exchange (External respiration)

Differences in pO2 and pCO2 of alveolar air and pulmonary capillaries favour
the diffusion of O2 from the alveolar air into the blood in the pulmonary
capillaries and the diffusion of CO2 in the opposite direction.

II. Systemic gas exchange (Internal respiration)

Difference in pO2and pCO2 of oxygenated blood in systemic capillaries and
tissues favour the diffusion of O2 from systemic capillaries into tissues and
the diffusion of CO2 in the opposite direction.

1.2.5 Transport of gases

Blood is the medium of transport for O2 and CO2.

I. Transport of Oxygen
Oxygen is transported from the lungs to the tissues through the plasma and
RBC of the blood.100ml of oxygenated blood can deliver 5 ml of O2 to the
tissues under normal conditions.
(i) Transport of oxygen through plasma: About 3% of O2 is carried through
the blood plasma in a dissolved state.
(ii) Transport of oxygen by RBC: About 97% of O2 is transported by the
RBCs in the blood. Haemoglobin is a red coloured iron containing pigment
present in the RBCs. Each haemoglobin molecule can carry a maximum
of four molecules of oxygen. Binding of oxygen with haemoglobin is
primarily related to the partial pressure of O2. At lungs, where the
partial pressure of O 2 (oxygen tension) is high, oxygen binds to
haemoglobin (purplish-bluish-red in colour) in a reversible manner to
form oxyhaemoglobin (bright red in
colour). This is called oxygenation of
haemoglobin.

Hb + 4O2 Hb(O2)4

At the tissues, where the partial pressure

of O2 is low, oxyhaemoglobin dissociates
into haemoglobin and oxygen. The other
factors that influence binding of oxygen
with haemoglobin are the partial
pressure of CO 2 , the hydrogen ion
concentration (pH) and the temperature.

29
 Zoology

(iii) Oxygen – haemoglobin dissociation curve: It explains the relation

between percentage saturation of haemoglobin and partial pressure of
oxygen. A sigmoid curve is obtained when percentage saturation of
haemoglobin with O2 is plotted against the pO2. This curve is called
‘oxyhaemoglobin dissociation curve’ and is highly useful in studying
the effect of factors such as pCO2, H+ concentration, temperature, etc.,
on the binding of O2 with haemoglobin. In the alveoli, where there is a
high pO 2, low pCO 2, lesser H + concentration (high pH) and lower
temperature, the factors are all favourable for the formation of
oxyhaemoglobin. In the tissues where low pO2, high pCO2, high H +
concentration (low pH) and higher temperature exist, the conditions
are favourable for dissociation of oxygen from oxyhaemoglobin. Under
these conditions, oxygen dissociation curve shifts away from the Y-axis
(to the right). The effect of pCO2 and H+ concentration on the oxygen
affinity of haemoglobin is called Bohr Effect (increase of carbon dioxide
in the blood and decrease in pH results in the reduction of the affinity
of hemoglobin for oxygen).
NOTE: A rise in pCO2 and fall in pH decreases the affinity of haemoglobin
for oxygen. On the other hand a fall in pCO2 and rise in pH, increases
affinity of haemoglobin for oxygen. This clearly indicates that O2 gets
bound to haemoglobin at the lung surface and gets dissociated at the
tissues.

NOTE: At pO2 of 100mmHg. typical in the lungs haemoglobin is saturated

to about 97%. At a pO2 of 40mm Hg which is common in tissues
during rest time, haemoglobin is about 75% saturated. It means
oxyhaemoglobin gives away about 22% oxygen only to ‘resting tissues’.
It also means, only about 1/5th of the oxygen from blood is unloaded in
the resting tissues. The remaining 4/5th is in the form of ‘Reserve’ in
the blood itself. If the tissues such as skeletal muscles are involved in
vigorous exercise, there is more‘unloading tension’ in the
oxyhaemoglobin and so more oxygen is given away rapidly (up to 62% at
20mmHg.of pO2 and the percent of saturation of haemoglobin is only
35%). As mentioned above in a ‘resting person’, haemoglobin always
carries about 70% oxygen (which is still available to tissues, for the
asking). Hence oxyhaemoglobin ensures supply of oxygen for survival
for 4-5 minutes after the stopping of heart or when breathing is
interrupted.

30
 Human Anatomy and
Physiology - I

II. Transport of Carbon Dioxide: CO2is transported in three ways.

(i) In dissolved state: 7 per cent of CO2 is carried in a dissolved state
(physical solution) through plasma.

CO2 + H2O H2CO3

Do you know: Why is the PH of deoxygenated (venous) blood less than

that of oxygenated (arterial) blood.
(ii) As carbamino compounds: About 20-25 per cent of CO 2 combines
directly with free amino group of the haemoglobin and forms carbamino-
haemoglobin in a reversible manner.

Hb – NH2 + CO2 Hb – NHCOO- + H+

This binding of CO2 is related to the partial pressure of CO2. pO2 is a
major factor which could affect this binding. When pCO2 is high and
pO2 is low as in the tissues, binding of more carbon dioxide occurs.
When pCO2 is low and pO2 is high as in the alveoli, dissociation of CO2
from carbamino – haemoglobin takes place, i.e., CO2 which is bound to
haemoglobin from the tissues is delivered at the alveoli. Carbamino
compounds are also formed by the union of CO2 with plasma proteins.

HC O 3
NOTE: Haemoglobin is an amphoteric compound (reacting chemically
as either an acid or a base). It has the peculiar character of taking
more oxygen in oxygen rich areas and release CO2 and accepting more
CO2 in areas where the CO2 is more and release oxygen.
(iii) As Bicarbonates: About 70 per cent of CO 2 is transported as
bicarbonate. RBCs contain a very high concentration of the enzyme,
carbonic anhydrase and a minute quantity of the same is present in
the plasma too. This enzyme facilitates the following reaction in both
the directions.

Carbonic anhydrase Carbonic anhydrase

CO2 + H2O H 2CO 3 +H+
At the tissue level, where partial pressure of CO2 is high due to catabolism,
CO2 diffuses into the blood (RBC and Plasma) and forms carbonic acid which
dissociates into HCO3– and H+. At the alveolar site where pCO2 is low, the
reaction proceeds in the opposite direction leading to the formation of CO2
and water. Thus CO2 is mostly trapped as bicarbonate at the tissues and
transported to the alveoli where it is released out as CO2. Every 100 mL of
deoxygenated blood delivers approximately 4mL of CO2 to the alveolar air.

31
 Zoology

Chloride shift: Due to the permeability

of plasma membrane of RBC to anions,
HCO3– ions (formed due to dissociation of
H2CO3) diffuse into the blood plasma from
the RBC at the tissues. The H+ ions are
‘buffered’ (to curtail acidity) by
haemoglobin which turns into HHb (acid
haemoglobin). Haemoglobin can act as
a buffer at physiological pH (7.4), because
of its high content of ‘ histidine’.
H+ + HCO3 + Hb.4O2 HHb +HCO3+ 4O2

As a result, the molecule loses its affinity

for oxygen and so O 2 is released. It
diffuses into the plasma and from there
into the tissues (in the pulmonary
capillaries of the lung, where the partial
pressures and pH are reversed, all of
these reactions run in the reverse way).
To maintain electrolyte balance, Cl– ions
diffuse from plasma into RBC when the
bicorbonate ions pass out of the RBC into
plasma. This exchange of chloride and
bicarbonate ions between RBC and
plasma at the tissues is called chloride
shift or Hamburger’s phenomenon/
Hamburger’s shift. Reverse chloride shift
occurs when blood reaches the lungs.
1.2.6 Regulation of
respiratory movements
Human beings have a significant ability
to maintain and moderate the respiratory
rhythm to suit the demands of the body
tissues. This is done by the neural Figure 1.15 Carbon dioxide
system. transport in the blood
1. A special centre present in the
medulla region of brain, called
‘Respiratory rhythm centre’ is
primarily responsible for this
regulation/respiratory rhythm.
32
 Human Anatomy and
Physiology - I

Homeostasis
2. Another centre present
Blood pH of about 7.4 in the pons of the brain
stem called ‘Pneumotaxic
CO2 level decreases, Centre’ can moderate the
restoring pH to normal Stimulus:
Rising level of CO2 in
functions of the ‘respiratory
tissues lowers blood rhythm centre’. Neural
pH (such as when
Response:
Signals from
excercising) signal from this centre can
medulla and reduce the duration of
pons to rib
muscles and inspiration and there by
diaphragm alter the respiratory rate.
increase rate
and depth of 3. A chemo-sensitive area
ventilation Carotid
arteries Sensors is situated adjacent to the
in major respiratory rhythm centre
medulla detects
blood
decrease in pH which is highly sensitive to
vessels
of cerebrospinal
detect
fluid (CSF)
decrease
CO 2 and hydrogen ions.
Sensor/ control in pH of Increase in these
centre: CSF blood
substances can activate
this centre, which inturn
can send signals to the
Medulla
receives respiratory rhythm centre
Medulla signals from to make necessary
oblongata major blood
vessels adjustments in the
Figure 1.16 Homeostatic control of breathing respiratory process by
which these substances
can be eliminated.
4. Receptors associated with aortic arch and carotid artery also recognize
changes in CO2 and H+ concentration and send necessary signals to the
respiratory rhythm centre and pneumo tactic centre for necessary
actions (increase in the rate and depth of breathing when their
concentration is high). The role of oxygen in the regulation of the
respiratory rhythm is quite insignificant.

1.2.7 Respiratory volumes and Capacities

Tidal Volume (T.V.): Volume of air inspired or expired during normal
inspiration or expiration. It is approximately 500 ml. i.e., a healthy man can
inhale or exhale approximately 6000 to 8000 ml of air, per minute.
Inspiratory Reserve volume (IRV): The additional volume of air that can be
inhaled during forced breathing, in addition to the ‘tidal volume’. This is
about 2500 ml to 3000 ml.

33
 Zoology

Expiratory reserve Volume (ERV): The additional volume of air that can be
exhaled during forced expiration, in addition to the ‘tidal volume’. This is
about 1000ml to 1100ml.

Residual volume (R.V): The volume of air remaining in the lungs even after
forcible expiration. This is about 1100 ml to 1200 ml.

By adding up a few ‘respiratory volumes’ described above, one can derive

various pulmonary capacities, which are useful in clinical diagnosis of
pulmonary disorders.

Inspiratory Capacity (IC): The total volume of air, a person can inhale after
‘normal expiration’. This includes the ‘tidal volume’ and ‘inspiratory reserve
volume’: IC = TV + IRV. It is about 3000 ml to 3500 ml.

Functional Residual Capacity (FRC): The volume of air that remains in the
lungs after normal expiration: FRC=ERV + RV.

Vital Capacity (VC): The maximum volume of air a person can breathe in
after ‘forced expiration’. This includes ERV, TV and IRV or the maximum
volume of air a person can breathe out after ‘forced inspiration’:
VC=TV+IRV+ERV

Total Lung Capacity (TLC): The total volume of air accommodated in the
lungs at the end of ‘forced inspiration’. This includes RV, ERV, TV and IRV
or vital capacity + residual volume: TLC=VC+RV or TLC= ERV+IRV+TV+RV

1.2.8 Disorders of the Respiratory System

1. Asthma is a disorder of difficulty in breathing caused due to
inflammation of bronchi and bronchioles. It is characterized by the
spasm of smooth muscles present in the walls of the bronchi and
bronchioles. Symptoms include coughing, difficulty in breathing and
wheezing .In the case of asthma, the allergen causes release of histamine
and other inflammatory substances which cause constriction of the
bronchi.
2. Emphysema is a chronic disorder in which alveolar walls are damaged
and their walls coalesce due to which respiratory surface area of
exchange of gases is decreased. The lung shows larger but fewer alveoli
and more fibrous and less elastic. One of the major causes of this is
‘smoking’ of tobacco.

34
 Human Anatomy and
Physiology - I

l Bronchitis is the inflammation of the bronchi, resulting in the swelling

of mucous lining of bronchi, increased mucus production and
decrease in the diameter of bronchi. Symptoms include chronic cough
with thick mucus/ sputum (phlegm).
l Pneumonia is infection of lungs caused by bacteria such as
Streptococcus pneumoniae and also by certain viruses, fungi,
protozoans and mycoplasmas. Symptoms include inflammation of
lungs, accumulation of mucus in alveoli, and impaired exchange of
gases , leading to death if untreated .
l Emphysema, chronic bronchitis and asthma come under Chronic
Obstructive Pulmonary diseases (COPDs).

3. Occupational Respiratory disorders: These are caused by exposure of

the body to the harmful substances from certain industries, especially those
involving grinding or stone breaking. Long term exposure of the body to such
substances can give rise to inflammation of respiratory passage and lungs
leading to several disorders.
i. Asbestosis: It occurs due to chronic exposure to asbestos dust in the
people working in asbestos industry.
ii. Silicosis: It occurs because of long term exposure to ‘silica dust’ in the
people working in mining industries, quarries etc.
iii. Siderosis: It occurs due to deposition of inhaled iron particles in tissues.
It can cause different types of siderosis such as pneumoconiosis,
hyperferremia and hemosiderosis (which causes recurrent alveolar
hemorrhage).
iv. Black-lung disease: It is a lung disease that develops from inhalation
of coal dust. It is common in long time coal mine workers.

35
 Zoology

G LOSSARY
Alveoli: Thin walled, irregular, Inter costal muscles: Muscles that
highly vascularized bag like extend in between ribs and help in
structures that form the sites of bringing breathing movements.
exchange of gases in the lungs. Pneumotaxic centre: It is present in
Bohr Effect: Effect of CO2 and H+ the pons region of brain and can
on the oxygen-affinity of moderate the functions of
haemoglobin. respiratory rhythm centre.
Carbonic anhydrase: (fastest Pulmonary exchange: Exchange of
known enzyme) An enzyme O2 and CO2 between pulmonary
present in RBC, that catalyses capillaries and alveoli of lungs.
the formation of carbonic acid Respiratory rhythm centre: A
from CO 2 and H 2 O its specialized centre present in the
dissociation into H+ and HCO3-. medulla region, primarily
Chemo-sensitive area: It is an area responsible for regulation of
situated adjacent to the respiration.
respiratory rhythm centre; it is Systemic exchange: Exchange of O2
highly sensitive to CO2 and H+. and CO 2 between systemic
Chloride shift: Exchange of capillaries and tissues.
chloride and bicarbonate ions Thyroid cartilage: The largest
between erythrocytes and cartilage that supports the ventral
plasma. It is also called and lateral walls of the larynx.
Hamburger’s phenomenon. Vocal cords: A pair of thin strands
Cricoid cartilage: Circular of yellow elastic fibres that extend
cartilage that forms the lower between thyroid and arytenoids
and posterior part of wall of cartilages. They help in the
larynx. production of sound.
Glottis: It is an opening of the
larynx into the pharynx.

36
 Human Anatomy and
Physiology - I

Q UESTIONS
Very Short Answer Type Short Answer Type Questions
Questions
Questions
1. Explain the process of
1. Define vital capacity. What is its inspiration and expiration
significance. under normal conditions.
2. What is the volume of air 2. What are the major transport
remaining in lungs after a mechanisms for CO 2 ?
normal expiration? Explain.
3. Diffusion of oxygen occurs in 3. How is respiratory movements
the alveolar region only and not regulated in man?
in the other parts of respiratory 4. Distinguish between
system. How do you justify the (a) IRV and ERV
statement? (b) Inspiratory capacity
4. What is the effect of pCO2 on and expiratory capacity
oxygen transport? (c) Vital capacity and Total
5. What happens to the lung capacity.
respiratory process in a man 5. Describe disorders of
going up a hill? respiratory system.
6. What is Tidal volume? Find out
the Tidal volume (approximate
value) in a healthy human, in Long Answer Type Questions
an hour.
1. Describe the respiratory
7. Define oxyhaemoglobin
system in man.
dissociation curve. Can you
suggest any reason for its 2. Write an essay on the
transport of oxygen and
sigmoidal pattern?
carbon dioxide by blood.
8. What are conchae?
9. What is meant by chloride shift?
10. Mention any two occupational
respiratory disorders and their
causes in human beings.
11. Name the muscles that help in
normal breathing movements.
12. Draw a diagram of oxy-
haemoglobin dissociation
curve.

37
 Zoology

FOR IGNITED
MINDS
Your ‘Calorie Burner’
and ‘Energy Provider’

Breathing and Exchange of Gases

1. To maximise oxygen uptake fishes adopt a special technique with reference to
flow of blood in their gills and direction of flow of water. What do we call it?
2. Why does a pregnant woman in advanced pregnancy gasp for breath, if she
walks fast.
3. In some people, lungs have ‘larger’, but ‘fewer alveoli’ due to damage to alveolar
partition tissue. What do you call such a disorder?
4. Do alpha and beta chains of haemoglobin carry the same amount of oxygen per
chain?
5. What is the percentage of oxygen that is released from saturated RBC in a
resting person and what is the percentage of saturation of haemoglobin of the
blood that returns to the heart.
6. In two different studies it was found that the dissociation of oxyhaemoglobin is
60% and 40% at the same partial pressure of oxygen . Do you think it is possible?
If so what could be the reason(s) for such a shift in the oxyhaemoglobin
dissociation curve ?
7. Why do people who suffer from carbon monoxide poisoning tend to die?
8. What is the enzyme that plays an important role in the transport of CO2 by
blood?
9. Will the two oxyhaemoglobin dissociation curves of foetus and mother be similar
or different? Can you give reasons for your opinion?
10. Evaluate the correctness of the following statement: If a person breathes in and
out rapidly for some time (hyperventilation), his body allows him to hold his
breath for a longer period than in the case of normal ventilation(for example
when he is submerged in water). Is that due to (i) increase in O2 levels in his

n
body (ii) decreased level of CO2 in his body at that time?

38
 Unit-II
HUMAN ANA TOMY AND
NAT
William Harvey
PHYSIOL
HYSIOLOG
SIOLOG
OGYY - II

The third ‘Integrating System’ cum

‘The Postman’ cum ‘The Policeman’
Eucoelomate animals require a ‘circulatory system’ to carry nutrients and oxygen
to the body parts, collect wastes including carbon dioxide from the tissues and
carry them to the appropriate excretory organs. Blood and lymph are the only fluid
tissues that collect various substances including respiratory gases, hormones etc.,
and deliver them to the appropriate organs/tissues, the ‘Postman’s job’.
Simultaneously the blood vascular system is involved in the defence system of the
body as it contains various types of phagocytic cells including certain progenitors of
‘macrophages’ (tissue fixed or otherwise), the ‘Policeman’s job’. Blood contains
several types of proteins such as albumins, globulins etc. The albumins provide
‘capillary osmotic pressure’ to prevent excessive loss of fluids from blood and
help maintain its normal consistency. Fibrinogen and prothrombin play a vital
role in clotting of blood to prevent excessive bleeding. Blood carries various
hormones to body parts from the organs of their secretion and help coordination of
the body, hence deserves to be reckoned as the ‘Third Integrating System’.
Circulatory system has a ‘pumping station’, the heart. Blood pressure is
monitored by ‘pressure sensors’ in the aorta and the volume of the blood is controlled
by hormones such as ADH and aldosterone.
 Zoology

UNIT II A
Body Fluids and
Circulation
2.1 Lymphatic System
2.2 Clotting of Blood
2.3 Circulating Pathways
2.4 Cardiac Cycle
2.5 Blood Vessels

Different groups of animals have evolved various methods for transport of

substances between body parts. Simple organisms such as sponges and
cnidarians circulate water drawn from their surroundings through their
body cavities facilitating exchange of these substances. More complex
organisms use special ‘circulatory’ fluids within their bodies to transport
such materials. Blood is the most commonly used circulatory fluid by most
of the higher organisms, including the humans. In the higher animals, in
addition to blood, another body fluid, the lymph, also helps in the transport
of certain substances. Blood and lymph together constitute the fluid tissues
in the human body. In this chapter, you will learn about lymph, clotting of
blood, the structure and functioning of the heart, circulatory blood vessels
along with certain disorders of the circulatory system.

NOTE: The composition of blood is not discussed here as it is already

covered in the Junior Inter Text Book.

40
 Human Anatomy
and Physiology - II

2.1 Lymphatic system

It is an extensive network of thin-walled vessels that arise as blind-ended
lymph capillaries in most of the tissues of the body. The lymph capillaries
unite to form a tree like structure of increasingly larger lymph vessels,
which finally drain lymph into veins in the lower neck region. Lymphatic
system is an open circulatory system.
• Lymph capillaries are microscopic, closed-ended tubes that form vast
network in the intercellular spaces. The walls are composed of endothelial
cells, with pores, through which interstitial fluid/extracellular fluid
(ECF), proteins, microorganisms and absorbed fats can easily enter.
Once the extra cellular fluid enters the lymphatic capillaries, it is referred
to as lymph.
• The lymph capillaries merge and form large, lymphatic vessels which
lead into larger lymph ducts. The walls of the lymph vessels and ducts
are similar to those of veins and are provided with valves. The smooth
muscles of their walls cause peristaltic waves of contraction pushing
lymph towards the neck region.
All the lymph vessels from the lower part of the body eventually empty lymph
into the thoracic duct. The thoracic duct of the lymphatic system is the
largest lymphatic vessel (lymph duct) in the body. It is also known as
the left lymphatic duct, chyliferous duct etc., and it empties the lymph
into the venous system at the junction of the left internal jugular vein and
left subclavian vein. Lymph collected from the left side of the head, the left
arm, and the parts of the chest region also enters the thoracic duct before it
empties into the venous system.
L ymph
Lymph from the right side of the Lymph capillary

neck, head, right arm, and the right Tissue cells ECF

part of the thorax is collected into

the right lymphatic duct which
empties it into venous system at the
junction of the right sub clavian
vein and right internal jugular vein.
Thus, lymph ,which was once a part Venule L ymphatic
of the blood that came out of the blood vessel
Arteriole
vessels to supply oxygen and
nutrients to tissues, as the ECF, is
Figure 2.1 The relationship between
finally drained back into the left and
blood capillaries and
right subclavian veins (venous lymphatic capillaries and ECF
system).

41
 Zoology

Before lymph is returned to the heart via the venous system, bacteria,
viruses etc., are phagocytised by the WBC in the lymph nodes. The lymphatic
system also consists of other organs such as spleen, thymus, tonsils etc.
Mucosa associated lymphoid tissue (MALT) and appendix also constituting
a part of the lymphatic system.
Do you know? Spleen is the largest lymphatic organ and is also the
reservoir of red blood cells and lymphocytes .It acts as ‘haemopoietic
organ’ until the fifth month of gestation.
Formation of lymph
When blood passes through the capillaries, due to high filtration pressure
at the arteriolar ends of capillaries, along with plasma, many substances
such as glucose, small sized organic molecules, inorganic salts etc. (except
the large plasma proteins) are filtered into the extracellular spaces where
it is called ‘tissue fluid’/‘ECF’. This causes an increase in colloidal osmotic
pressure of the plasma of the blood in the venular ends of the capillaries
(due to plasma proteins). This pressure favours the movement of about 85
percent of the ECF into the capillaries at the venular ends after exchanging
oxygen, CO 2 , nutrients, other metabolites etc., with the tissues. The
remaining 15% of ECF is collected into the lymphatic system through lymph
capillaries. Henceforth it is called lymph.
DO YOU KNOW? In a pregnant woman when the enlarged uterus exerts pressure
on the abdominal veins, it increases the capillary hydrostatic pressure, it leads
to accumulation of fluids (ECF) in the legs, hence the swollen legs - ‘edema’, in
them.

Composition of lymph
Lymph is similar in its composition to the blood’s plasma, except that it
contains a much lower concentration of proteins and nutrients such as
fatty acids and glycerol than those in the plasma. Erythrocytes are absent.
Lymph contains water, some plasma proteins, electrolytes, leucocytes mostly
lymphocytes, some coagulation factors, antibodies, enzymes, hormones,
vitamins, nutrients etc. An emulsion of lymph and triglyceride fat (chylomicrons),
characteristically present in lacteals is called chyle.
Functions of lymphatic system
1. Lymph returns some ECF and wastes collected from the body parts to
the blood.
2. It transports lymphocytes from the lymphatic glands to the blood.
3. It transports digested fats which are absorbed through lacteals, present
in the intestinal villi, to the blood vascular system.
4. It destroys the invading microorganisms and foreign particles in the
lymph nodes.

42
 Human Anatomy
and Physiology - II

2.2 Clotting of blood

When a blood vessel is injured a number of physiological mechanisms are
activated that promote hemostasis (hemo = blood; stasis = standing). Breakage
of a blood vessel exposes collagen proteins to the blood. This initiates three
separate, but overlapping hemostatic mechanisms - (1) vasoconstriction
(2) the formation of a platelet plug, and (3) the production of a web of fibrin
proteins (blood clot)
(1) Vasoconstriction: When a blood vessel is damaged, the smooth muscles
in it’s wall contract, which makes the lumen of the vessels narrow,
sometimes so strongly that blood flow is completely stopped.
(2) Platelet-plug formation: When the endothelium is ruptured, platelets
adhere to the collagen and release some secretions. These secretions
aggregate other platelets and make them sticky, so that they adhere to
those already stuck on the collagen and form a ‘platelet- plug’.
(3) Production of web of fibrin protein: The third mechanism for
hemostasis is the formation of clot. The activator substances from the
injured vascular wall, platelets and blood proteins adhering to the injured
vascular wall, initiate the clotting process. Clot is a web of fibrin with
blood cells trapped in it.
Mechanism of blood clotting
Clotting takes place in three essential steps.
i) Step -1: It involves the formation of a complex of activated substances
collectively called, prothrombin activator. It is formed by a complex
cascade of chemical reactions that occur in the blood by the involvement
of clotting factors in two pathways.
(a) Intrinsic pathway: It occurs when the blood is exposed to collagen
of injured endothelium of blood vessel. This activates Factor XII,
and in turn it activates another clotting factor, which activates yet
another reaction (cascade fashion), which results in the formation
of the prothrombin activator.
(b) Extrinsic pathway: It occurs when the vascular wall is severely
damaged and extra vascular tissue comes into contact with blood.
This activates the release of tissue thromboplastin, from the
damaged tissue. It activates the Factor VII. As a result of these
cascade reactions, the final product formed is the prothrombin
activator.
ii) Step -2: The prothrombin activator, in the presence of sufficient amounts
of Ca++, causes the conversion of inactive prothrombin to active thrombin
(activation of prothrombin).

43
 Zoology

iii) Step -3: Thrombin converts the soluble protein fibrinogen into soluble
fibrin monomers, which are held together by weak hydrogen bonds. The
fibrin stabilizing factor (Factor XIII, released from platelets) replaces
hydrogen bonds with covalent bonds and cross links the fibres to form
a ‘mesh work’. The insoluble mesh work of fibrin fibers spreading in all
directions adhere to the damaged surfaces and trap the blood cells and
platelets.
Within a few minutes after the clot is formed. It begins to contract so that
the fluid is expelled out. This is called clot retraction and the fluid thus
formed is the serum (plasma without fibrinogen) and some other proteins.

Clotting factors
Factor Name
I Fibrinogen
II Prothrombin
III Thromboplastin
IV Calcium ions (Ca++)
V Proaccelerin (Labile factor)
VII Proconvertin (Stable factor)
VIII Antihemophilic Factor - A
IX Plasmathromboplastin component (PTC) or Christmas
Factor
X Stuart-Prower Factor
XI Plasmathromboplastin antecedent (PTA)
XII Hageman’s Factor
XIII Fibrin Stabilizing Factor

*Factor VI is no longer referred as clotting factor.

44
 Human Anatomy
and Physiology - II

Do You Know? Platelets are necessary for clot retraction. Failure of

clot retraction is an indication that the number of platelets in the blood
might be low. In the case of diseases such as ‘dengue’ the platelet
count falls low and the patient may require transfusion of blood platelets.
Anticoagulants
They are as follows:
• Heparin is an anticoagulant synthesized by mast cells and basophils.
It activates antithrombin, a plasma protein, which combines with
thrombin and inactivates it.
• Coumarins of plant origin are the precursors of anticoagulants
such as warfarin (see glossary), which are antagonistic to Vit-K
and thus prevent the synthesis of the blood clotting factors - II, VII,
IX and X, formed in the liver.
• Clotting of blood in test tubes in clinical laboratories and ‘Blood
Banks’ can be prevented by the addition of citrates or oxalates of
sodium or Ethylene diamine tetra acetic acid (EDTA). They bind to
calcium ions and thus make Ca ++ unavailable for the action in
clotting.

Circulating pathways
The circulatory patterns are of two types – open and closed.
a) Open type: In this type, blood (more appropriately - haemolymph)
flows from the heart into the vessels. The vessels open into large
spaces called sinuses. From the sinuses, the haemolymph is collected
into the heart and distributed to body parts.
As the circulatory fluid comes out of the vessels and freely flows in
the body spaces, this type of circulatory system is called open type.
It is found in leeches, arthropods, molluscs, echinoderms and
ascidians.
b) Closed type: In this type blood flows through blood vessels. The
blood flows from the arteries to the veins through small blood vessels
called capillaries. Closed type of blood vascular system is found in
the annelids, cephalopods among the non-chordates,
cephalochordates and all the vertebrates among chordates.
Plan of circulatory system in the vertebrates
In the vertebrates the principal differences in the blood-vascular system
involve the gradual differentiation of the heart into two separate ‘pumps’
as they evolved from the gill breathing aquatic life to the lung breathing,
complete terrestrial life.

45
 Zoology

• Fishes have a 2-chambered heart with an atrium and a ventricle.

It pumps out deoxygenated blood to gills for oxygenation, hence
the name ‘branchial heart’. Blood passes through the heart only
once in a complete circuit, hence called single circulation.
• Amphibians have a 3-chambered heart with two atria and one
ventricle. Reptiles have two atria and an incompletely divided
ventricle (except in the crocodiles in which the ventricle is divided
into two chambers). The left atrium receives oxygenated blood from
the gills/lungs/skin and the right atrium receives deoxygenated
blood from the other parts of the body through the venae cavae.
However, the two types of blood get mixed up in the single ventricle,
which pumps out mixed type of blood. Thus these animals
(amphibians and reptiles) show an incomplete double
circulation.
• Birds and mammals possess a 4-chambered heart with two atria
and two ventricles. In these animals the oxygenated and the
deoxygenated types of blood received by the left and right atria,
passes on to the left and right ventricles, respectively. The
ventricles pump the blood out without any mixing of the oxygenated
and deoxygenated types of blood i.e., there are two completely
separate circulatory pathways namely systemic and pulmonary
circulations. Hence, these animals are said to be showing ‘double
circulation’.

2.3 Human cardio-vascular system

It consists of a four chambered muscular heart, a network of closed branching
blood vessels and blood.
2.3.1 Structure of the heart
The heart is mesodermal in origin. It is a thick walled, muscular and
pulsating organ, situated in the mediastinum (the region in the thorax
between the two lungs), and with its apex slightly turned to the left. It is of
the size of a clenched fist.
The heart is covered by a double walled pericardium which consists of the
outer fibrous pericardium and the inner serous pericardium. The serous
pericardium is double-layered, formed of an outer parietal layer and an inner
visceral layer. The parietal layer is fused with the fibrous pericardium, whereas
the visceral layer adheres to the surface of the heart and forms its outer
layer, the epicardium. The two layers are separated by a narrow pericardial
space, which is filled with the pericardial fluid. This fluid reduces friction
between the two membranes and allows free movement of the heart.

46
 Human Anatomy
and Physiology - II

The wall of the heart consists of three layers. They are the outer epicardium,
the middle myocardium (a thick layer of cardiac muscles), and the inner
most endocardium (a thin layer of endothelium). The endothelium covers
the heart valves also and is continuous with the endothelial lining of the
large blood vessels connected to the heart.
External structure
Human heart has four
chambers, with two
relatively smaller upper Precaval vein Systemic arch
chambers, called atria Ligamentum arteriosum
Right pulmonary Left pulmonary artery
and two larger lower artery
Left pulmonary veins
Pulmonary arch
chambers called
Left atrium
ventricles. Atria and Right pulmonary
veins
ventricles are separated by
Right atrium
a deep transverse groove Right coronary Left coronary atery
atery
called coronary sulcus Left ventricle
(atrio-ventricular groove). Right ventricle
The muscular pouch like
Post caval vein
projection from each
atrium is called auricular
appendix (auricular Figure 2.2 External structure of the heart.
appendage). The ventricles
are separated by two inter ventricular grooves (anterior and posterior), in
which the coronary arteries and their branches are lodged.
Internal structure
i) Atria: Atria are thin walled ‘receiving chambers’ (upper chambers). The
two atria are separated by thin inter-atrial septum. In the fetal heart,
the atrial septum has a small pore called foramen ovale. Normally the
foramen ovale closes at birth, when lungs become functional. It is
represented by a depression in the septum between the right and left
atria, called fossa ovalis (that marks the position of the foramen ovale
in the fetus). If, the foramen ovale does not close properly, it is called a
patent foramen ovale.
The right atrium receives deoxygenated blood from different parts of the body
(except the lungs) through two caval veins viz. a precaval vein or superior
vena cava (collecting blood from the the head, forelimbs and thoracic region)
and a post caval vein (collecting blood from the hind limbs and abdominal
organs). The heart also receives blood from the myocardium (wall of the

47
 Zoology

Systemic arch
Precaval vein

Pulmonary arch
Left pulmonary veins

Right pulmonary veins

Left atrium

Right atrium

Bicuspid valve
Chordae
tendineae
Papillary muscle
Tricuspid valve
Left ventricle
Right ventricle
Columnae
carneae

Post caval vein

Figure 2.3 Internal structure of the Heart.

heart) through the coronary sinus, whose opening into the right atrium is
guarded by the valve of Thebesius. Opening of the postcaval vein is guarded
by the valve of the inferior vena cava or Eustachian valve. It directs the
blood to the left atrium through the foramen ovale, in the foetal stage, but in
the adult it becomes rudimentary and non-functional. The opening of the
precaval vein into the right atrium has no valve. The left atrium receives
blood from each lung through two pulmonary veins, which open into the left
atrium.
Atria and ventricles are separated by a membranous atrio-ventricular
septum, which possesses left and right atrioventricular apertures. The left
and right apertures are guarded by bicuspid (mitral valve) and tricuspid
valves respectively.
ii) Ventricles: These are the thick walled blood pumping chambers (lower
chambers), separated by an interventricular septum. The wall of the
left ventricle is thicker than that of the right ventricle. The inner surface
48
 Human Anatomy
and Physiology - II

of the ventricles is raised into muscular ridges or columns called

columnae carneae/ trabeculae carneae projecting from the inner walls
of the ventricles. Some of these ridges are large and conical, and are
called papillary muscles, whose apices are connected to the chordae
tendineae, or ‘heart strings’. They are cord-like collagenous processes
that connect the papillary muscles to the tricuspid valve and
the mitral valve in the heart. They prevent the cusps of the
atrioventricular valves from bulging too far into atria during ventricular
systole.
Nodal tissue
A specialized cardiac musculature called the nodal tissue is also distributed
in the heart. A patch of this tissue called the sinoatrial node (SAN) is present
in the right upper corner of the right atrium near the opening of the superior
vena cava. Another mass of this tissue, called the atrioventricular node
(AVN), is seen in the lower left corner of the right atrium postero-inferior
region of the inter atrial septum close to the opening of the coronary sinus.
It electrially connects atrial and ventricular chambers. A bundle of nodal
firbres, called atrioventricular bundle (AV bundle/‘His’ bundle) continues
from the AVN into the inter-ventricular septum. It divides into right and left
bundle branches. These branches give rise to minute fibres called Purkinje
firbres that extend throughout the ventricular musculature /walls of the
respective sides.

SAN consists of specialized cardiomyocytes. It has the ability to

generate action potentials without any external stimuli (myogenic), hence
called ‘pace maker’. AV NODE is a ‘relay point’ that relays the action
potentials received from the SA node to the ventricular musculature.
SAN can generate action potentials every 0.6 sec. (which means it can
initiate 100 beats per minute). Our heart normally beats 70-80 times
per minute (on average 72 beats min -1). Autonomous and hormonal
coordination systems take charge of increasing or decreasing the rates,
depending on the situation.
iii) Aortic arches: The pulmonary arch arises from the left anterior angle
of the right ventricle. Its opening is guarded by the pulmonary valve
and it carries deoxygenated blood to the lungs. The systemic arch
(left) arises from the left ventricle and transports oxygenated blood to
different parts of the body through its branches. Its opening is guarded
by the ‘aortic valve’. The pulmonary and aortic velves are madeup of
three semilunar flaps, each. A fibrous strand, known as ligamentum
arteriosum is present at the point of contact of the systemic and

49
 Zoology

pulmonary arches. It is the remnant of the ductus arteriosus, which

connects the systemic and pulmonary arches in the embryonic stage.
Do You Know? Human embryonic heart begins beating at around a
month of embryonic development.

2.3.2 Cardiac cycle

The cardiac events that occur from the beginning of one heart beat to the
beginning of the next constitute a cardiac cycle. This cardiac cycle consists
of three phases, namely atrial systole, ventricular systole and joint diastole.
To begin with, all the four chambers of the heart are in a relaxed state/
joint diastole stage. Blood from the pulmonary veins and venae cavae flows
into the respective atria. As the A-V valves are in open condition, blood
flows into the left and right ventricles, through the left and right
atrioventricular apertures. The semilunar valves of the pulmonary and aortic
arches are closed at this stage.
Atrial systole (0.1 sec)
The SAN now generates an action potential which stimulates both the atria
to contract simultaneously causing the ‘atrial systole’. This increases the
flow of blood into the ventricles by about 30%. It means atrial systole accounts
for about 30 % of the filling of the ventricles, the remaining blood flows into
the ventricles before the atrial systole.
Ventricular systole (0.3 sec)
The action potentials from the SAN reach the AVN from where they are
conducted through the bundle of His, its branches and the Purkinje fibres to
the entire ventricular musculature. This causes the simultaneous ventricular
systole. The atria undergo relaxation coinciding with the ventricular systole.
Ventricular systole increases the pressure causing the closure of the AV
valves preventing the ‘backflow’ of blood. It results in the production of the
first heart sound known as ‘Lub’. As the ventricular pressure increases
further, the semilunar valves guarding the pulmonary artery and the aorta
are forced open. This allows the blood in the ventricles to flow into the
aortic arches and enter the circulatory pathway.
Joint diastole (0.4 sec)
The ventricles now relax and the ventricular pressure falls causing the closure
of the semilunar valves which prevents the back flow of blood. This results
in the production of the second heart sound known as ‘Dup’. As the ventricular
pressure declines further, the AV valves are pushed open by the pressure in
the atria exerted by the blood, which flowed into them through the larger

50
 Human Anatomy
and Physiology - II

veins. The blood now once again flows freely into the ventricles. All the heart
chambers are now again in a relaxed state (joint diastolic phase). Soon,
another cardiac cycle sets in.

NOTE: The human heart beats 72 times per minute normally. Hence
the duration of a cardiac cycle is about 0.8 sec.
2.3.3 Cardiac output
The volume of blood pumped out by each ventricle, for each heart beat, is
known as the stroke volume. The volume of blood pumped out by the heart
from each ventricle per minute is termed cardiac output.
Cardiac output = stroke volume x No. of beats per minute = 70ml/
beat x 72 beats/minute = 5040 ml/min. or approximately 5 liters

Do You Know? The body has the ability to alter the stroke volume
(especially in athletes) as well as the heart rate and thereby the cardiac
output. The cardiac output generally increases in the active state and
decreases in resting condition.
2.3.4 Double circulation
The blood pumped by the right ventricle enters the pulmonary artery,
whereas the left ventricle pumps blood
Lung capillaries
into the aorta. The deoxygenated blood
pumped into the pulmonary arch is
passed on to the lungs from where the
oxygenated blood is carried by the Pulmonary Pulmonary
artery vein
pulmonary veins into the left atrium. Pulmonary
This pathway constitutes the circuit
pulmonary circulation (lesser Left systemic
circulation). The oxygenated blood Venae cavae
entering the aorta is carried by a RA LA
network of arteries, arterioles and RV LV
capillaries to the tissues from where
the deoxygenated blood is collected by Systemic circuit
a system of venules, veins and venae
cavae and emptied into the right
atrium. This is the systemic
circulation (greater circulation). The
systemic circulation provides Systemic
nutrients, O 2 and other essential capillaries
substances to the tissues and collects
Figure 2.4 Double circulation.
CO 2 and other harmful substances
away, for their elimination.
51
 Zoology

Portal circulation and Coronary circulation

A blood vessel that starts in capillaries and ends in capillaries is
called a ‘portal vessel’. A system of portal vessel is named after the
name of the organ in which it ends in capillaries. In man there is a
portal system between the digestive tract and the liver. It is called
hepatic portal system. The hepatic portal vein carries blood from the
gut to the liver before it is delivered to the systemic circulation via the
heart. The absorbed foods such as sugars, when present in excess, are
converted into glycogen and stored in the liver cells (glycogenesis). A
special coronary system of blood vessels is present in the human body
exclusively for the circulation of blood to and from the heart/cardiac
musculature. The coronary circulation in humans includes the right
and left coronary arteries and four cardiac veins/coronary veins. The
coronary veins open into the coronary sinus.

2.3.5 Regulation of cardiac activity

Normal activities of the heart are regulated intrinsically, i.e., auto
regulated by specialized muscles (nodal tissue). A special neural centre in
the medulla oblongata can moderate the cardiac function through the
‘autonomic nervous system’ (ANS). Neural signals through the sympathetic
nerves (part of ANS) can increase the rate of heart beat, the strength of
ventricular contraction and thereby the cardiac output. On the other hand,
parasympathetic neural signals (another component of ANS) decrease the
rate of heart beat and thereby the cardiac output. Adrenal medullary hormones,
the epinephrine and norepinephrine can also increase the cardiac output.
Thyroxine also increases the heart rate and cardiac output.

2.4 Blood vessels

Blood vessels form a tubular network through the body that permits blood to
Artery Vein
flow from the heart to all the living cells of the
body and then back to the heart. Blood leaving
Valve the heart passes through vessels of progressively
Endothelium
smaller diameter, referred to as arteries,
Basement membrane
Elastic laminae
arterioles, and capillaries. Capillaries are
Muscle layer
microscopic vessels that join the arterial flow to
the venous flow. Blood returning to the heart
from the capillaries passes through vessels of
Connective progressively larger diameters, called venules
tissue layer
and veins.
Arteries and veins have essentially three layers
Figure 2.5 Blood vessels
in their walls. (1) Tunica externa / tunica

52
 Human Anatomy
and Physiology - II

adventitia consists of fibrous connective tissue, (2) tunica media madeup

of smooth muscles and (3) tunica interna made up of endothelium (and
basement membrane).
In addition to the above layers arteries and arterioles have two elastic laminae
one on either side of the muscle layer. Veins have one elastic lamina inner to
the muscle layer. The muscle layer is much thicker in the arteries than in
the veins. Endothelium of veins is double folded to form valves, which are
directed towards the heart and they allow flow of blood towards the heart
only.
Differences between arteries and veins
Arteries Veins
Arteries carry oxygenated blood, Veins carry deoxygenated blood,
away from the heart (except the towards the heart (except the
pulmonary artery) pulmonary veins)
These are bright red in colour These are dark red in colour
These are mostly deep seated in the Veins are generally superficial
body
Arteries are thick-walled as the Veins are thin walled (tunica media
tunica media is relatively thick, with is relatively thin with one elastic
smooth muscles and two elastic lamina) and the walls are slightly
laminae muscular.
Lumen is wide
Lumen is narrow
Valvular
Non-valvular
Blood in the veins flows steadily
Blood in the arteries flows with with relatively low pressure
more pressure and by jerks Veins start with capillaries
Arteries end in capillaries
NOTE: The smallest vessels present in the walls of large blood vessels like aortic arches
are called ‘Vasa vasorum’ (the ‘vessels of the vessels’).
Capillaries
These are the smallest blood vessels of the body, which connect arterioles
and venules. Unlike the vessels of the arterial and venous systems, the
walls of capillaries are composed of just one cell thick layer a simple
squamous epithelium, or endothelium. The absence of smooth muscles
and connective tissue layers permits rapid exchange of materials between
the blood and the tissues.
2.5. Disorders of circulatory system
i) Hypertension (High blood pressure)
Hypertension is a chronic medical condition in which blood pressure in
the arteries is elevated. The normal blood pressure at rest is 120
53
 Zoology

mm.Hg. (Systolic)/80 mm. Hg. (diastolic) mmHg. on an average. High

blood pressure leads to heart diseases and also affects other vital organs
such as the brain and kidneys.
Blood pressure (BP): It is the force exerted by the blood against the walls of
the vessels. It is affected by age, sex and state of health. Blood pressure is
measured in the brachial artery of the arm by using a sphygmomanometer.
Pressure 120/80 mm.Hg is considered normal blood pressure in human
beings. The upper reading pertains to systolic pressure and the lower one,
the diastolic pressure. Blood pressure above 140/90 is considered
hypertension. It is worth knowing that it is universally believed that excessive
intake of salt causes hypertension (in addition to genetic reasons).
ii) Coronary Artery Disease (CAD)
CAD often referred to as atherosclerotic heart disease. It is the result of
the accumulation of calcium, fat, cholesterol and fibrous tissue along
the wall of coronary arteries which makes their lumen narrow. This
narrow blood vessel reduces the blood flow to the heart, causes ischemia
(restriction of blood supply to muscle tissue, causing shortage of oxygen).
Myocardial cells may die due to lack of oxygen and this is called a
myocardial infarction. It leads to heart muscle damage. CAD is associated
with smoking, diabetes and hypertension.
iii) Angina Pectoris
It is marked by ‘chest pain’ caused by narrowing of blood vessels to the
heart (ischemia). Angina pectoris is a ‘warning signal’ of deprivation
of blood supply to the heart muscles. However there is no necrosis
(death) of the cardiac muscle tissue. It occurs in men and women of
any age , but it is more common among the middle aged and the elderly
people .
The major risk factors for angina include smoking , diabetes, high
cholesterol, high blood pressure etc.
iv) Heart Failure
It is a condition in which the heart is unable to provide sufficient
pumping action to distribute blood flow to meet the needs of the body.
Common causes of heart failure include myocardial infarction/heart
attack (localized death of heart tissue–necrosis) and other forms of
ischemic heart diseases, hypertension etc. It is also called congestive
heart failure because congestion of the lungs is one of the main
symptoms of this disease. Heart failure is not the same as cardiac arrest
or heart attack (see glossary).

54
 Human Anatomy
and Physiology - II

G LOSSARY
Auricular appendix: A small conical ear- from the lack of blood supplyto a part of
shaped pouch projecting from the upper the heart, causing heart cells to die. This
anterior portion of each atrium of the is most commonly due to blockage of
heart, increasing slightly the atrial a coronary artery following the rupture
volume. of a vulnerable atherosclerotic plaque.
Bundle of His: It is a collection of heart The heart tissue deprived of oxygen
muscle cells specialized for electrical becomes a necrotic spot (an area of
conduction that transmits the electrical localized death of an organ)
impulses from the AV node to the walls Myocardial ischemia: It is a disease/or
of the ventricles. condition characterised by reduced blood
Cardiac arrest: It is also known supply to the heart muscle, (coronary
as cardiopulmonary arrest or circulatory artery disease- atherosclerosis of
arrest. It is the cessation of the coronary arteries), which results in
normal circulation of the blood due to narrowing of the parts of arteries that
sudden stoppage of contraction of the supply blood to the muscles of the heart.
heart (sudden cardiac arrest, which ‘Ischemia’ is common in aged people and
sometimes run in families). people who consume ‘fat rich food’.
Cascade reaction: A series of chemical or Portal venous system: It is a system of a
physiological processes that occur in blood vessel starting in capillaries in one
successive stages, each of which is organ and ending in capillaries in
dependent of the preceding one, to another organ.
produce a culminating effect. The steps Purkinje fibers: These are located in the
involved in the clotting of blood occur as inner ventricular walls of the heart, just
a cascade of reactions. beneath the endocardium. These fibers
Colloid osmotic pressure: It is also referred consist of specialized cardio
to as oncotic pressure and is a myocytes that are able to
measurement of pressure exerted within conduct cardiac action potentials more
the blood vessels by the proteins found in quickly and efficiently than any other
blood plasma. The special nature of these cells in the heart.
proteins helps ensure passage of fluids Tricuspid valve: It is a valve between
in and out of the capillaries at the proper the right atrium and the right ventricle
rate. of the mammalian heart, usually has
Lacteal: It is a lymphatic capillary in three leaflets connected to three papillary
the villus of the small intestine that muscles by chordae tendineae.
absorbs digested fats. Warfarin: It is also known under the brand
Mitral valve: Is a dual-flap (mitral-from the names Coumadin, Jantoven etc. It is
Latin, meaning shaped like an anticoagulant, normally used in the
a mitre) valve in the heart that lies prevention of thrombosis
between the left atrium and the left and thromboembolism (the formation of
ventricle. Mitre is the cap/head gear with blood clots in the blood vessels and their
two flaps worn by bishops. migration elsewhere in the body)
Myocardial infarction (MI): It is commonly
known as a heart attack, and it results

55
 Zoology

Q UESTIONS
Very Short Answer Type Short Answer Type Questions
Questions
1) Describe the evolutionary
change in the structural
1) Write the dif ferences pattern of the heart
between ‘open’ and ‘closed’ among the vertebrates.
systems of circulation. 2) Describe atria of the heart
2) Sino-atrial node is called of man.
the pacemaker of our heart. 3) Describe the ventricles of
Why? the heart of man.
3) What is the significance of 4) Draw a labeled diagram of
artrio-ventricular node and the L.S of the heart of
antrio-ventricualr bundle man.
in the functioning of the
5) Describe the events in a
heart?
cardiac cycle, briefly.
4) Name the valves that
6) Explain the mechanism of
guard the left and right
clotting of blood.
atrioventricualr apertures
in man. 7) Distinguish between SAN
and AVN.
5) Where is the valve of
Thebesius in the heart of 8) Distinguish between
man? arteries and veins.
6) Name the aortic arches
arising from the ventricles Long Answer Type Questions
of the heart of man.
1) Describe the structure of the heart
7) Name the heart sounds.
of man with the help of neat labelled
When are they produced.
diagram.
8) Define cardiac cycle and
2) Write notes on the working of the
cardiac output.
heart of man.
9) What is meant by double
circulation? What is its
significance?
10) Why the arteries are more
elastic than the veins?

56
 Human Anatomy
and Physiology - II

FOR IGNITED
MINDS
‘Third Intergrating System’ cum
‘The postman’ cum ‘The Policeman

Body Fluids and Circulation

1. In what type of animals blood from the respiratory organs does not return to the
heart directly and goes to the tissues instead.
2. Veins generally carry blood towards the heart (except the portal veins), whether
it is oxygenated or deoxygenated blood. Can you give an example of a vein that
does not carry blood to the heart directly, but carries away from it.
3. What is the purpose of the presence of the sheet of connective tissue separating
the atria from the ventricles.
HINT: It has something to do with the conduction of impulses in the chambers
of the heart.
4. Why do doctors suggest people with angina pectoris to carry/to keep with them
nitroglycerine tablets and asprin tablets with them always.
5. What is the difference between a ‘heart attack’ and ‘angina pectoris’.
6. When a person is running a long race (such as marathon) and is closing on the
finish line, he makes the maximum effort to win the race. Do you think there
will be ‘more cardiac output’ or ‘more stroke volume’ or ‘both’ in him at that
time?
7. Which period of interval is shorter comparatively, with reference to the heart
sounds popularly called ‘lub’ and ‘dup’. Is it ‘1ub’ to ‘dup’ or ‘dup’ to ‘lub’?
8. It is scientifically true that S.A. node can generate an action potential every 0.6
sec. which by logical inference means the heart beats 100 times/min. In a
normal healthy person, it is however 70-80 times (on average 72 times). What
system in the human body slows it down to the normal/average level?
9. If somebody says-“The left atrial systole is completely responsible for the left
ventricular filling, in a cardiac cycle” -do you agree with the statement? If you
do not agree, why?
10. If your neighbor has angina pectoris and if you have immediate access to a

n
medical shop, what type of tablets would you bring and administer to him
(provided you are permitted to take a chance).
Hint: You can go for two types of drugs - a vasodilator and a blood thinner.

57
 Zoology

UNIT II B
Excretory Products and
their Elimination
2.6 Modes of excretion
2.7 Human excretory system
2.8 Urine formation, Osmoregulation, Regulation of kidney functions
2.9 Role of other organs in excretion
2.10 Disorders of the excretory system

Excretion- Good Riddance, And Homeostasis

Excretion is the elimination of nitrogenous and other waste materials from the
body. Kidneys are the chief excretory organs. Nitrogenous wastes are sent out
along with some water. Water is the most important constituent of protoplasm,
the living substance. Dehydration kills a person much faster than lack of food.
Metabolism of proteins and nucleic acids produces ammonia, a toxic waste (no
energy is spent for the production of ammonia). Aquatic animals excrete ammonia
(ammonotelic) through body surface, gill surface etc. by diffusion. They can
send ammonia through dilute urine as they can afford to lose much water. In
others, ammonia is converted into urea (along with carbon dioxide), which is
less toxic, via the ‘ornithine cycle’ in the liver (ureotelic). In insects, reptiles
birds and land snails the end product of nitrogen metabolism is uric acid
(uricotelic), to conserve water (uric acid is almost insoluble in water and
production of uric acid involves expenditure of more energy). Uric acid is produced
by mammals too by purine metabolism. Many mammals except apes, man
etc., produce the enzyme ‘uricase’ by which they can convert uric acid into a
more soluble “allantoin”. Some animals excrete the excess amino acids also
(aminotelic).
Kidneys also maintain acid-base balance by excreting H+ ions. The regulation of
internal fluids (water balance) is an example of ‘homeostasis’. Kidneys are
involved in the homeostasis of the body fluids and their concentration (the salt
balance). The tissues of cartilaginous fishes are well adapted to tolerate/survive
high urea concentrations. These fishes (and many other salt water fishes and
molluscs also) have large quantities of trimethyl amine oxide (TMAO), an
organic molecule that protects body proteins from the damaging effect of urea.

58
 Human Anatomy
and Physiology - II

2.6 Modes of excretion

Animals cannot eliminate free nitrogen, but can eliminate it in the form of
nitrogenous end products. The metabolism of excess amino acids, and the
nitrogen bases of nucleic acids produce ammonia from which urea or uric
acid is formed depending upon the need.
I. Ammonotelism: The elimination of ammonia as the chief nitrogenous
waste material is termed ammonotelism. Ammonia is formed by the
oxidative deamination of amino acids. Deamination chiefly occurs in
the liver of the vertebrate body. The amino group, separated from the
amino acid, combines with hydrogen and becomes ammonia (NH 3).
Ammonia is highly toxic and readily soluble in water, hence it should
be eliminated from the body quickly and in the form of a very dilute
solution. Therefore excretion of ammonia is most common in aquatic
species. Many lower invertebrates expel ammonia through the whole
body surface by simple diffusion. In bony fishes, most of the ammonia
is lost as ammonium ions (NH4) across the epithelium of the gills, with
kidneys excreting only minor amounts of nitrogenous wastes. The
animals which excrete ammonia are called ammonotelic animals.
II. Ureotelism: Terrestrial adaptation necessitated the production of lesser
toxic nitrogenous wastes such as urea and uric acid for the conservation
of water. The elimination of urea as the principal nitrogenous waste
material is termed ureotelism. It is produced in the vertebrate liver by
a metabolic cycle (ornithine cycle) that combines ammonia with carbon
dioxide. The circulatory system transports urea to the kidneys for
filtration and elimination. Urea is 100,000 times less toxic than
ammonia. This permits some animals to transport and store urea safely
at higher concentrations (Physiological uremia as seen in cartilaginous
fishies). Thus ‘urea-excreting’ animals require much less water than
the ammonotelic animals. Some amount of urea may be retained in the
medullary fluid of kidneys to maintain the desired osmolarity.
Earthworms, cartilaginous fishes, most of the amphibians (which spend
most of the time on land) and mammals excrete urea as their chief
nitrogenous waste and are called ureotelic animals.
III. Uricotelism: The elimination of uric acid as the chief nitrogenous waste
material is called uricotelism. Uric acid is mainly formed from ammonia
mostly in the liver of sauropsids and in the Malpighian tubules of
tracheate arthropods. Uric acid is less toxic than urea and being
insoluble in water can be excreted as semisolid paste or pellets with
very little water loss. This is a great advantage for animals with little

59
 Zoology

access to water. Tracheate arthropods, land snails, many reptiles and

birds excrete uric acid as their major nitrogenous waste, hence they
are called uricotelic animals.

Excretory organs
The organs responsible for the elimination of metabolic waste products
are called excretory organs. They help in the elimination of nitrogenous
wastes, water balance and maintains constant ionic composition of the
extracellular fluids in the body. A variety of excretory organs are present
in the animal kingdom. In most invertebrates, these structures are simple
tubular forms. However, in man and other vertebrates they are complex
tubular structures called kidneys. Some of the excretory structures in
invertebrates are mentioned here.
 Protonephridium is a network of dead-end tubules with cellular
units called flame bulbs. Each flame bulb has a tuft of cilia
projecting into the tubule. Protonephridia are found in
platyhelminths, rotifers, larvae of annelids and molluscs and
lancelets (with solenocytes). Protonephridia are primarily
concerned with ionic and fluid volume regulation i.e
osmoregulation.
 Metanephridia are tubular excretory structures which are
immersed in the coelomic fluid and enveloped by a capillary
network. They are found in most annelids such as the
earthworms. They help to remove nitrogenous wastes and
maintain fluid and ionic balance.
 Malpighian tubules are ‘blind’ tubular structures floating in the
haemolymph and opening into the digestive tract. They are found
in insects and other terrestrial arthropods. Besides excretion,
they have a role in conserving water and salts effectively, as
they send wastes into the gut where water is reabsorbed.
 Antennary glands or green glands are paired structures which
lie at the bases of the antennae and open to the exterior. These
structures draw waste materials from the haemolymph. They
are found in crustaceans.
 Coxal glands are the excretory structures in the arachnids.
 Kidneys (metanephridia/renal organs) and pericardial glands
are the excretory structures found in the adult molluscs.

60
 Human Anatomy
and Physiology - II

2.7 Human Excretory System

In humans, the excretory system consists of a pair of kidneys, a pair of
ureters, a urinary bladder and urethra.
Kidneys
Kidneys are reddish brown, bean shaped
structures, situated on either side of the
vertebral column between the levels of the
last thoracic and third lumbar vertebrae,
in a ‘retroperitoneal position’. The right
kidney is slightly lower than the left one
due to the presence of large liver.
Do you Know? The average weight of
kidney is 120 – 170 gms in man.
The outer surface of the kidney is convex
and the inner surface has a deep notch
called hilum, the point at which the renal
artery and nerves enter and the renal vein
and ureter leave. Each kidney is Figure 2.6 Human urinary system
surrounded by a tough, fibrous capsule
that protects its delicate inner surface.
Internal structure
A longitudinal section of the human kidney
shows two distinct regions, the outer cortex
and the inner medulla. The medulla is
divided into multiple cone shaped masses
of tissue called renal pyramids. The renal
pyramids are separated by the projections
of the cortex called columns of Bertin (renal
columns). The base of each pyramid
originates at the border between the cortex
and the medulla and terminates in the
renal papilla. Renal papillae project into
cup like calyces, formed by the extensions
Figure 2.7 L.S of Kidney
of funnel shaped pelvis, which continues
out as the ureter.
Ureters
These are slender whitish tubes which emerge from the pelvis of the kidneys.
Their walls are lined by ‘transitional epithelium’. The ureters run downwards
and open into the urinary bladder.
61
 Zoology

Urinary bladder
It is a median storage sac, situated in the lower abdominal cavity. It has
thick, muscular, distensible wall lined by ‘transitional epithelium’. The neck
of the bladder leads into the urethra, which has an internal urethral
sphincter (made of smooth muscles) and external urethral sphincter (made
of striped muscles). Urethra opens near the vaginal orifice in the females
and through penis in the males.

Do you know? Infection of the urinary tract is more common in women

than in men, due to her short urethra (more close to the anal aperture
on par with its surface)and the greater possibility of ‘germs’ passing in
the anal-urinary tract route.
Structure of a Nephron
Each kidney has nearly one million nephrons or uriniferous tubulus which
are the ‘structural’ and ‘functional’ units. Each nephron has two parts – the
‘renal corpuscle’ or malpighian corpuscle and the ‘renal tubule’. Renal
corpuscle is composed of a network of blood capillaries called glomerulus
Afferent arteriole
and a double walled cup called Bowman’s capsule.
The glomerulus is formed by the afferent renal
Efferent arteriole – a fine branch of the renal artery. Blood
arteriole
from the glomerulus is carried away by an efferent
Bowman’s renal arteriole of a lesser diameter. The inner wall
capsule
Glomerulus
of the Bowman’s capsule has certain unique cells
called podocytes which wrap around each capillary
of the glomerulus. The podocytes are arranged in
an intricate manner so as to leave some minute
spaces called ‘filtration slits’ or ‘slit pores’. The
Proximal
endothelial cells of the capillaries have numerous
convoluted tubule pores or ‘fenestrations’. The glomerulus along with
the Bowman’s capsule constitutes the Malpighian
Figure 2.8 Malpighian body
(renal corpuscle) body or renal corpuscle.
The renal tubule continues further and forms a
highly coiled proximal convoluted tubule (PCT). A hairpin shaped Henle’s
loop, which has descending and ascending limbs, is the next part of the
tubule. The proximal part of the ascending limb is thin and the distal part is
thick. The thick ascending limb continues into the distal convoluted tubule
(DCT). The DCT continues as the ‘initial collecting duct’ in the cortex.
Some initial collecting ducts unite to form a straight collecting duct, which
passes through the medullary pyramid. In the medulla, the collecting ducts

62
 Human Anatomy
and Physiology - II

Straight collecting duct

Figure 2.9 A diagrammatic representation of a nephron showing blood vessels,

collecting duct and tubule

of each pyramid join and form the central large duct of Bellini, which finally
opens on the tip of the renal papilla. The contents of the duct of Bellini are
discharged into the renal pelvis through the renal calyx.
The Malpighian corpuscle, PCT and DCT of a nephron are situated in the
cortical region of the kidney, whereas the loop of Henle is in the medulla. In
a majority of nephrons, the loop of Henle is too short and extends only very
little into the medulla. Such nephrons are called cortical nephrons. In some
of the nephrons, the loops of Henle are very long and run deep into the
medulla. These nephrons are called juxtamedullary nephrons (as their renal
corpuscles are located close to the medulla in the inner cortex).
The efferent arteriole emerging from the glomerulus forms a fine capillary
network called the peritubular capillaries, around the renal tubule. The
portion of the peritubular capillaries that surrounds the loop of Henle is
called the vasa recta. The vasa recta is absent or highly reduced in the
cortical nephrons. The juxtamedullary nephrons possess well developed vasa
recta.
Do you know? After the age of 40 years, the number of functioning
nephrons usually decreases, by about 10 percent, every 10 years.

63
 Zoology

2.8 Urine Formation

The formation of urine involves three main processes namely, glomerular
filtration, selective reabsorption and tubular secretion.
a) Glomerular filtration: The first step in the formation of urine is the
‘filtration’ of the blood from the glomerulus into the lumen of the
Bowman’s capsule and this ‘passive’ (non-energy consuming process)
process is called glomerular filtration. The hydrostatic pressure of the
blood while flowing in the glomerulus is 60 mmHg. It is opposed by
‘glomerular colloidal osmotic pressure’ of 32 mmHg (which is exerted
by the non-filtered plasma proteins of the blood in the glomerular
capillaries ) and Bowman’s capsular hydrostatic pressure of 18mmHg.
The net filtration pressure (NFP) is 10mm Hg {60–(32+18) =10}. This
causes the filtration of blood through the 3 layered filtrate membrane
formed by the endothelial cells of glomerular capillary together with
the basement membrane and podocytes of the Bowman’s cup. Blood is
filtered through the fine slit pores and fenestrations due to the NFP.
Therefore, this process is called ‘ultrafiltration’. The filtrate contains
almost all the constituents of the plasma, except the proteins. The
filtrate thus formed is called ultra-filtrate or ‘glomerular filtrate’ or
‘primary urine’, which is hypotonic to the cortical fluid. It passes into
the next part of the renal tubule.
Do you know? On an average 1100 – 1200 ml of blood is subjected to
filtration by the kidneys per minute which constitute roughly 1/5th of
the blood pumped out by each ventricle of the heart in a minute.

NOTE: The amount of filtrate formed by both the kidneys, per minute,
is called Glomerular Filtration Rate. The GFR in a healthy individual
is approximately 125ml/minute, i.e., 180L per day. Although about
180L of glomerular ultra-filtrate is produced each day, the kidneys
normally excrete only 1 to 1.5 L of urine in a 24 hour period. A comparison
of these two volumes suggests that nearly 99% of the filtrate is
reabsorbed by the renal tubules. This process is called reabsorption/
selective reabsorption.

b) Selective reabsorption and secretion: The tubular epithelial cells in

different segments of a nephron reabsorb certain substances of the
glomerular filtrate either by active or passive mechanisms. About 85%
of the filtrate formed is reabsorbed in a constant, unregulated fashion
by the PCT and descending limb of Henle’s loop (obligatory or mandatory
reabsorption) and the reabsorption of the rest of the fluid is ‘regulated’.

64
 Human Anatomy
and Physiology - II

Based on the necessity of re-absorption, the substances of glomerular

filtrate can be categorized into ‘high threshold substances’ (essential
and are efficiently reabsorbed e.g. glucose, amino acids, vitamins, some
salts etc.), ‘low threshold substances’ (absorbed in very little amounts
e.g. urea, uric acid etc.) or ‘athreshold substances’ (actual excretory
products and are not reabsorbed at all e.g. creatinine).
During the formation of urine, the tubular cells secrete substances such as
H+, K+ and NH3 into the filtrate. Tubular secretion is also an important step
in the formation of urine as it helps in the maintenance of ionic and acid-
base balance of the body fluids. Mechanism of selective reabsorption and
secretion in different parts of a nephron takes place as follows:
i) In the proximal convoluted tubule: PCT is lined by simple cuboidal
epithelium with ‘brush border’, which increases the surface area of
absorption. Nearly all the essential nutrients and 70-80% of electrolytes
and water are reabsorbed by this segment. Na+ is actively transported
into the cortical interstitial fluid. This transfer of positive charge drives
the passive transport of Cl-. Glucose, amino acids, and other essential
substances are also ‘actively’ transported. Movement of water occurs
by ‘osmosis’.
PCT also helps to maintain the pH and ionic balance of the body fluids
by selective secretion of hydrogen ions, and ammonia into the filtrate
and by the reabsorption of K+ and HCO3- from it.
ii) In the Henle’s loop: Reabsorption in this segment is minimum.
However, this region plays a significant role in the maintenance of high
osmolarity of the medullary interstitial fluid.
The descending limb of loop of Henle is permeable to water and almost
impermeable to electrolytes, hence reabsorption of water continues as
the filtrate moves along the descending limb (passive transport). As a
result, the filtrate concentration gradually increases as it moves towards
the inner medulla. The ascending limb has two specialized regions, a
proximal thin segment, in which NaCl diffuses out into the interstitial
fluid passively, and a distal thick segment, in which NaCl is actively
pumped out. The ascending limb is impermeable to water. Thus the
filtrate becomes progressively more dilute as it moves up to the cortex
(towards the DCT).
iii) In the distal convoluted tubule (DCT)
The cells here are shorter than those in the proximal tubule and lack
‘microvilli’, indicating that they are not involved much in reabsorption.

65
 Zoology

NH 3

(Active)


H+

(Passive) K+

Figure 2.10 Reabsorption and secretion of major substances at different parts of the
nephron (arrows indicate direction of movement of materials.)

‘Conditional reabsorption’/‘facultative reabsorption’ of Na+ and water

takes place in this segment. The reabsorption of water is variable
depending on several conditions and is regulated by ADH. DCT is also
capable of reabsorption of HCO3- and selective secretion of H+ and K+
ions and NH3 into the DCT from the peritubular network via the cortical
interstitium to maintain the pH and sodium–potassium balance in the
blood.
iv) In the collecting duct (CD)
This long duct carries the filtrate through the medulla to the renal
pelvis. Considerable amount of water could be reabsorbed from this
region to produce concentrated urine. This segment allows passage of
small amount of urea to the medullary interstitum to keep up its
osmolarity. It also plays a role in the maintenance of pH and ionic
balance of blood by the selective secretion of H+ and K+ ions. The renal
fluid after the process of facultative reabsorption in the CD, influenced

66
 Human Anatomy
and Physiology - II

by ADH, constitutes the ‘urine’, that is sent out .Urine in the CD is

hypertonic to the plasma of blood.

Urinary excretion = glomerular filtration – tubular reabsorption +

tubular secretion
2.8.1 Mechanism of concentration of the filtrate
Mammals have the ability to produce concentrated urine. The Henle’s loop
and vasa recta play a significant role in this. The flow of the renal filtrate in
the two limbs of Henle’s loop is in opposite directions and thus forms a
counter current. The flow of blood through the two limbs of vasa recta is
also in a counter current pattern. The proximity between the Henle’s loop
and vasa recta, as well as the counter currents of renal fluid and blood in
them help in maintaining an increasing osmolarity towards the inner
medullary interstitium. i.e., from 300 mOsml/L in the cortex to about 1200
mOsml/L in the inner medulla. This gradient is mainly caused by NaCl and

(Active)

Nacl


(Passive)


H+

K+


Figure 2.11 Diagrammatic representation of a nephron and vasa recta showing counter
current mechanisms

67
 Zoology

urea. NaCl passes out of the ascending limb of Henle’s loop, and it enters the
blood of the descending limb of vasa recta. NaCl is returned to the interstitium
from the ascending portion of the vasa recta. Similarly, small amounts of
urea enter the thin segment of the ascending limb of Henle’s loop which is
transported back to the interstitium, from the collecting duct.
The above described transport of substances facilitated by the special
arrangement of Henle’s loop and vasa recta is called the counter current
mechanism (the two limbs of the loop of Henle constitute a counter current
multiplier system). This mechanism helps to maintain a concentration gradient
in the medullary interstitium. Presence of such interstitial gradient helps
easy passage of water from the collecting duct, thereby concentrating the
filtrate (urine). Human kidneys can produce urine nearly four times
concentrated than the initial filtrate formed.
2.8.2 Osmoregulation
The process of maintaining the quantity of water and dissolved solutes in
balance is referred to as osmoregulation (the main concern in this lesson is
to deal with the maintainance of the homeostatis of the organism’s water
content). This can be achieved by excretion through organs, such as the skin
and the kidneys. Regulation of the amount of water and salts in urine
generally takes place with the help of hormones such as ADH, aldosterone
and angiotensin II.

2.8.3 Regulation of kidney function

The functioning of the kidneys is efficiently monitored and regulated by
hormonal feedback control mechanism involving the hypothalamus, Juxta
Glomerular apparatus (JGA) and to a certain extent, the heart.
Osmoreceptors in the hypothalamus monitor the solute concentrations in
the blood. Excessive loss of fluid from the body can activate these receptors
which stimulate the hypothalamus to release antidiuretic hormone (ADH)/
vasopressin via the neurohypophysis. ADH facilitates reabsorption of water
from the DCT and the collecting duct, thereby preventing diuresis. An increase
in the volume of the body fluid can switch off the osmoreceptors and suppress
the release of ADH (negative feedback control). Defects in ADH receptors or
inability to secrete ADH leads to diabetes insipidus (characterized by
excessive thirst and excretion of large quantities of dilute urine) resulting in
dehydration and fall in BP.
The Juxta Glomerular Apparatus plays a complex regulating role. The JGA
is the region in each nephron where the afferent arteriole comes into contact
with the DCT. A group of modified epithelial cells of the DCT are crowded in

68
 Human Anatomy
and Physiology - II

this region, constituting the macula densa. The wall of the afferent renal
arteriole has JG cells (they are modified smooth muscle cells of the afferent
arteriole). Macula densa together with JG cells form the JGA.
A fall in glomerular blood flow/glomerular blood pressure/GFR can activate
the JG cells to release an enzyme called renin (angiotensinogenase) into the
blood. This enzyme catalyses the conversion of angiotensinogen (a protein
produced by the liver) into angiotensin I, which is converted into angiotensin
II, by angiotensin converting enzyme (ACE). This conversion occurs primarily
as blood passes through the capillaries of the lungs, where most of the
converting enzyme is present. Angiotensin II stimulates the adrenal cortex
to secrete aldosterone. Aldosterone causes reabsorption of Na+ (and water
indirectly) from the DCT and CD to reduce loss through urine, and also
promotes secretion of K+ ions into the DCT and CD. It leads to an increase in
the blood pressure and GFR. This complex mechanism is generally known as
renin - angiotensin – aldosterone system (RAAS).
An increase in the flow of blood to the right atrium of the heart stretches its
wall. It causes the release of atrial natriuretic factor (ANF)/atrial natriuretic
peptide (ANP). ANP can cause vasodilation (dilation of blood vessels) and
there by decrease the blood pressure by relaxing vascular smooth muscles
and inhibiting RAAS. ‘ANP’ mechanism therefore, acts as a counter check on
the ‘RAAS’.

Micturition
Urine formed by the nephrons is ultimately carried to the urinary bladder
where it is stored till a voluntary signal is given by the central nervous
system (CNS). This signal is initiated by the stretching of the urinary
bladder as it gets filled with urine. In response, the stretch receptors on
the walls of the bladder send signals to the CNS. The CNS passes on
motor messages to initiate the contraction of smooth muscles of the bladder
and simultaneous relaxation of the urethral sphincters, causing the release
of urine. The process of passing out urine is called micturition and the
neural mechanism involved is called ‘micturition reflex’.
Urine
An adult human excretes, on an average 1 to 1.5 litres of urine per day.
The urine formed is a light yellow coloured watery fluid which is slightly
acidic (pH–6.0) and has a characteristic odour. Urine of a healthy individual
contains 96% of water, 2% of urea, 2% of other dissolved substances. On
an average 25-30 gms. of urea is excreted per day. Various conditions can
affect the quantity and composition of urine. Analysis of urine helps in
the clinical diagnosis of many metabolic disorders as well as malfunctioning

69
 Zoology

of the kidney. For example, presence of glucose (glycosuria) and ketone

bodies (ketonuria) in urine are indicative of diabetes mellitus.

2.9 Role of other organs in excretion

In addition to the kidneys, lungs, liver and skin also help in the elimination
of excretory wastes.
(a) Lungs: Lungs regularly eliminate about 18L of CO2and also significant
amount of water in the form of water vapor in normal resting condition
per day. The quantity of water loss increases in dry climates. Various
volatile materials are also eliminated through the lungs.
(b) Liver: Liver is the largest gland in our body. It changes the decomposed
haemoglobin of the worn-out RBCs into bile pigments, namely, bilirubin
and biliverdin. These pigments pass into the alimentary canal along
with the bile for elimination. The liver also excretes cholesterol, degraded
products of steroid hormones, certain vitamins and drugs via bile.
(c) Skin: Human skin possesses two types of glands for the elimination of
certain substances through their secretion.
i) Sweat glands secrete a watery fluid called sweat. Primary function
of sweat is to facilitate a cooling effect on the body surface. It also
helps in the removal of some of the wastes like NaCl, small amounts
of urea, lactic acid etc.
ii) Sebaceous glands eliminate certain substances like sterols,
hydrocarbons, waxes through sebum. This secretion provides a
protective ‘oily covering’ to the skin.
Do you know? Small amounts of nitrogenous wastes are also eliminated
through saliva.

2.10 Disorders of the excretory system

(a) Uremia: The presence of excessive amounts of urea in the blood is
known as uremia. The chief cause of uremia is damage to the kidneys,
It occurs due to glomerulonephritis or hypertension or diabetes mellitus
or some other disorders that impair the functioning of the kidney. It is
usually treated by hemodialysis (a procedure used to remove wastes
from blood using a dialyser, a mechanical device to clean the patient’s
blood).
(b) Renal calculi: Renal calculi or kidney stones are hard crystalline
structures formed in the urinary tract when the concentration of certain
constituents, such as uric acid, oxalates etc., in the urine becomes too
high. Dehydration is the major risk factor/cause for kidney stone
formation.

70
 Human Anatomy
and Physiology - II

(c) Glomerulonephritis (GN): It is a renal disease characterized by

inflammation of glomeruli or small blood vessels of the kidneys. It occurs
due to certain infections (bacterial, viral or parasitic pathogens), drugs
or diabetes.
(d) Renal failure (RF): Renal failure or kidney failure (formerly called renal
insufficiency) is a situation in which kidneys fail to function adequately.
A number of other diseases or health problems may cause renal failure.
Renal failure is typically detected by an elevated serum creatinine level.

2.10 Artificial kidney/Dialysis

Artificial kidney/dialyser, is a machine that is used
to filter the blood of a person whose kidneys are
damaged. The process is called hemodialysis. In this
process blood is taken out from the main artery, mixed Blood out
Bubble
with an anticoagulant, such as heparin, and then trap
Dialyzer
pumped into the apparatus called dialyser. In this
apparatus blood flows through channels, or tubes Blood in
Dialysate Dialysate
made of cellophane. The membrane is impermeable in out
to macromolecules, such as plasma proteins, but
permeable to small solutes such as urea, uric acid,
creatinine and mineral ions. The membrane separates
the blood flowing inside the tube and the dialyzing
Fresh Constant Used
fluid (dialysate), which has the same composition as dialyzing temperature dialyzing
solution bath solution
that of plasma, except the nitrogenous wastes. The
cellophane membrane allows the passage of molecules Figure 2.12H a e m o d i a l y s i s
based on concentration gradient. As nitrogenous
wastes are absent in the dialyzing fluid, these substances from the blood
freely move out, there by clearing the blood of its wastes. This process is
called dialysis. The cleared blood is pumped back to the body through a vein
after adding anti-heparin to it. Each dialysis session lasts 2 to 6 hours. This
method is a boon for thousands of uremic/kidney failure patients all over
the world.
Kidney transplantation
Kidney transplantation is the ultimate solution for acute renal failure
(kidney failure). A functioning kidney is used in transplantation from a
donor, preferably a close relative, to minimize its chances of rejection by
the immune system of the host. Modern clinical procedures have increased
the success rate of such a complicated technique.

71
 Zoology

G LOSSARY
Atrial natriuretic peptide (ANP): It is Glomerular filtration rate (GFR): It is
a peptide hormone secreted by the the volume of fluid filtered from the
wall of the right atrium, when the renal glomerular capillaries into the
blood pressure increases (wall of the Bowman’s capsule, per unit time.
right atrium is stretched). It is a GFR is an important clinical
vasodilator and thus lowers the blood indicator of the functioning of the
pressure. It is involved in the kidney.
homeostatic control of fluids in the Osmolarity: Is the measure of solute
body countering the effect of concentration, defined as the
aldosterone. number of osmoles (Osm) of solute
Cellophane: It is a thin, transparent per litre (L) of solution (osmol/L or
sheet made of cellulose and is used OsmL).
in a dialyser , which removes wastes Renal column (column of Bertin): It
from blood in patients suffering from is a medullary extension of the renal
renal failure. cortex in between the renal
Counter current exchange: This is pyramids. It allows the cortex to be
accomplished by the vasa recta which better anchored in the medullary
run parallel to the loop of Henle of tissue.
Juxta meduallary nephrons. It Renal pelvis: It is the funnel-like
maintains hypertonicity of the renal dilated proximal part of the ureter in
medulla by exchanging the ions and the kidney.
collecting water from the limbs of the Renal threshold of a substance: A
loop of Henle. substance is excreted in the urine
Countercurrent multiplier system: It only when its concentration in the
is a system involving the two limbs of plasma exceeds a certain ‘threshold
the loop of Henle, which play an value’. For example glucose has high
important role in maintaining the threshold, urea has low threshold
concentration gradient in the and creatinine has no threshold
medulla, which is vital for the (athreshold substance). High
formation of concentrated urine. threshold substances are
Deamination: It is the removal of reabsorbed even though they are
an amine group from a molecule. filtered in the Bowman’s capsule.
Enzymes which catalyse this reaction Renin: It is an enzyme secreted
are called deaminases. It is the first by JG cells (also called
step in the production of major ‘angiotensinogenase’). This enzyme
nitrogenous wastes. catalyzes the conversion of
Duct of Bellini: Any of the large angiotensinogen into angiotensin I,
excretory ducts of the uriniferous which is converted into angiotensin
tubules of the kidney that open at the II by angiotensin converting enzyme
tip of the renal papilla into a calyx and (ACE).
thus into the renal pelvis; also called
‘papillary duct’.

72
 Human Anatomy
and Physiology - II

Q UESTIONS
Very Short Answer Type products they excrete, giving
Questions examples.
3) Draw a labeled diagram of the V.S.
1) Name the blood vessels that enter
of kidney.
and exit the kidney.
4) Describe the internal structure of
2) What are renal pyramids and renal
kidney of man.
papillae?
5) Explain micturition
3) What are the columns of Bertin?
6) What is the significance of juxta
4) Name the structural and
glomerular apparatus (JGA) in
functional units of kidney. What
kidney function?
are the two main types of
structural units in it. 7) Give a brief account of the counter
current mechanism.
5) Distinguish between cortical and
juxta medullary nephrons. 8) Explain the autoregulatory
mechanism of GFR.
6) Define glomerular filtration.
9) Describe the role of liver, lungs and
7) Define Glomerular Filtration Rate
skin in excretion.
(GFR).
10) Name the following
8) What is meant by mandatory
reabsorption? In which parts of a) A chordate animal having
nephron does it occur? protonephridial type excretory
structures.
9) Distinguish between
juxtaglomerular cells and macula b) Cortical portions projecting
densa. between the medullary
pyramids in the human
10) What is juxtaglomerular
kidney.
apparatus?
c) Capillary network paralleling
11) Distinguish between the enzymes
the loop of Henle
renin and rennin.
d) A non chordate animal having
12) What is meant by the term
green lands as excretory
osmoregulation?
structures
13) What is the role of atrial
natriuretic peptide in the Long Answer Type Questions
regulation of urine formation?
1) Describe the excretory system of
Short Answer Type Questions
man, giving the structure of a
1) Terrestrial animals are generally nephron.
either ureotelic or uricotelic and 2) Explain the physiology of urine
not ammonotelic. Why? formation.
2) Differentiate vertebrates on the
basis of the nitrogenous waste

73
 Zoology

FOR IGNITED
MINDS
Excretion-Good Riddance
and Homeostasis

Excretory Products and their Elimination

1. Do you think, human being can excrete allantoin. Give your reasons
for how or why not?
2. What type of nitrogenous waste do organisms who have access to
plenty of water supply, tend to excrete.
3. If an organism is able to live in isotonic, hypotonic and hypertonic
surrounding water, what technical name do you offer it?
4. If a patient is prescribed to take diuretic tablets (tablets which help
in passing more urine), what type of cardio vascular condition he
might be suffering from?
5. Why do people who drink alcohol feel ‘dehydrated’ the next morning?
Can you give specific reason for this ‘effect’?
Hint: The answer lies in your brain.
6. If there is excessive production of aldosterone in a person, he is
likely to be affected by a cardiovascular problem.
Hint: The answer can be one among the following: Hypothermia,
Hypochondria, Hypertension, Hypotension.
7. “Biological economics” refers to how a cell conserves or spends
energy. Biological economics wise, among the aminotelic,
ammonotelic, ureotelic and uricotelic animals, which are more liberal
in spending energy to produce the nitrogenous waste, they excrete.
8. If the following animals which has the probability of sending out
‘isotonic urine’ - snake, bird, spider, ant, shark ?
9. If you are asked to conduct an experiment on a uricotelic organism,
which animal among the following would you select as your
experimental animal - King crab, Jelly fish, silver fish, cuttle fish.

n
10. Of all the veins you have studied, which veins are likely to possess
blood highest urea content and least urea content, respectively.

74
 Unit-III
HUMAN ANA TOMY AND
NAT
PHYSIOL
HYSIOLOG
SIOLOGY - III
OGY

The Body Movement and Posture

The human body has two important systems to give it the right posture and
movement of body parts. Movement is the property of the muscular system.
Providing support to the body parts is the function of the skeletal system. These
two systems are closely integrated to provide posture and movement to the
various body parts. The human body has hundreds of muscles, about 640 in
total.

We deal with the mechanism of contraction of the skeletal muscles as they

constitute the bulk of our body. There are myosin ‘motors’ effecting change in
the length of a muscle by pulling actin molecules amidst them. You will be
exposed to all the biochemical events involved in effecting the contraction and
relaxation of these muscles. The skeletal muscles are controlled by the ‘somatic
nervous system’ and the cardiac and visceral muscles are controlled by the
‘autonomous system’ (Sympathetic and parasympathetic systems).

The skeletal system provides support to body parts, protects inner delicate
organs, gives posture to the body and it offers space for the attachment of
various muscles, without which the muscles cannot work. It is the skeletal system
that transforms muscle contraction into locomotion. The skeletal system has two
major components–the ‘axial skeleton’ (skull, vertebral column, ribs and sternum)
and ‘appendicular skeleton’ (the limb skeletons, girdles etc.). The muscular and
skeletal systems are so interdependent that they are treated under one unit –
the musculo-skeletal system.
 Zoology

UNIT III A
Musculo-
Skeletal System
3.1 The Muscle
3.2 The Skeleton
3.3 The Joints
3.4 Disorders of Muscular and
Skeletal systems

Movement is one of the significant features of living beings. Animals and

plants exhibit a wide range of movements. Change in the position of body
parts is called movement. For example human beings can move limbs, jaws,
eyelids, tongue, etc. Streaming of protoplasm in the acellular organisms like
Amoeba is a simple form of movement. Movement of cilia, flagella and tentacles
are shown by many organisms.
Some of the movements result in a change of place or location. Such voluntary
movements are called locomotor movements. Walking, running, climbing,
flying, swimming etc., are some forms of locomotor movements. Locomotor
structures may perform other functions also in some organisms. For example,
in Paramecium, cilia help in the movement of food through cytopharynx and
in locomotion, as well. Hydra can use its tentacles for capturing its prey and
also use them for locomotion. We use limbs for changing body postures and
locomotion too.

76
 Human Anatomy
and Physiology - III

The above observations suggest that movements and locomotion cannot be

studied separately. In animals locomotion is performed generally to search
for food, shelter, mate, suitable breeding grounds, and favourable climatic
conditions or to escape from enemies/predators.

TYPES OF MOVEMENT
The cells of the human body exhibit three main types of movements, namely,
amoeboid, ciliary and muscular.
i. Some specialized cells in our body such as the macrophages and
leucocytes in blood exhibit amoeboid movement. It is effected by
pseudopodia formed by the streaming of protoplasm in certain cells
(as in Amoeba). Cyto-skeletal elements such as microfilaments are
also involved in amoeboid movement. Dynein arms act as motors
utilising ATP.
ii. Ciliary movement occurs in most of our internal tubular organs such
as the respiratory passages, genital ducts and ventricles of the brain
which are lined by ciliated epithelium.
iii. Movement of our limbs, jaws, tongue, etc., requires muscular movement.
The contractile property of muscles is effectively used for locomotion
and other movements by human beings and majority of multicellular
organisms. Locomotion requires a perfect coordinated activity of
muscular, skeletal and neural systems. In this chapter, you will learn
about the ultrastructure of muscle cell , and mechanism of its
contraction and important aspects of the human skeletal system.

3.1 The Muscle

Muscle is a specialized tissue of mesodermal origin. About 40-50 percent of
the body weight of a human adult is contributed by the muscles. They have
special properties such as excitability, contractility, and relaxation. The skeletal
muscles are primarily involved in locomotor actions and bringing in changes
in body postures.

3.1.1 Structure of a Skeletal Muscle

Let us examine a skeletal muscle in detail to understand the structure and
mechanism of contraction. Each organised skeletal muscle in our body is
made of a number of muscle bundles or fascicles. Each fascicle contains a
number of cylindrical muscle fibers. The fascicles are held together by a
common collagenous connective tissue layer called fascia.

77
 Zoology

NOTE: Collagen is a fibrous protein constituent of bone, cartilage, tendon,

and other connective tissue. It is the chief protein in the human body.

A) Ultra structure of a Skeletal Muscle Fibre

Each muscle fibre is lined by the
plasma membrane called
Myofibril sarcolemma enclosing the
Sarcosome sarcoplasm. Skeletal muscle
Triad system fibre is a ‘syncytium’, as each
fiber is formed by fusion of
Sarcolemma
embryonic, mononucleate
‘myoblasts’. Hence, the skeletal
Sarcoplasmic
Reticulum muscle cells are multinucleate,
T tubule with characteristically
peripheral nuclei (just below
the sarcolemma). The
Figure 3.1 Skeletal Muscle Fibre endoplasmic reticulum, also
called sarcoplasmic reticulum
of the muscle fibers is the store house of calcium ions. A characteristic
feature of the muscle fiber is the presence of a large number of parallel
filaments called myofilaments or myofibrils, in the sarcoplasm.
i) Structure of Myofibril
Each myofibril has alternate dark and
Z-line
light bands in it. A detailed study of
the myofibril has established that the
striated appearance is due to the
distribution pattern of two important
proteins – actin and myosin. The
Sarcomere light band contains actin and two
Thin filament regulatory proteins called troponin
and tropomyosin. The light band is
called I-band or Isotropic band. The
dark band called A –band or
Thick filament Anisotropic band contains myosin.
Both the proteins, actin and myosin,
Figure 3.2 Sarcomere
are arranged as rod-like structures,
parallel to each other and also to the
longitudinal axis of the myofibrils. Actin filaments are thinner compared to
the myosin filaments, hence actin and myosin filaments are commonly called
thin and thick filaments, respectively.In the centre of each ‘I’ band is an
78
 Human Anatomy
and Physiology - III

elastic fiber called ‘Z’ line (called Z line because of its ‘Z’ like appearance in
electron micrographs ) which bisects it. The thin filaments are firmly attached
to the ‘Z’ line (also called Krause’s membrane or Dobie’s line). The thick
filaments are also held together in the middle of the ‘A’ band by a thin
fibrous membrane called ‘M’ line. All the thick filaments are arranged at the
same level in a muscle fibre, thus giving the characteristic striated/striped
appearance. The ‘A’ and ‘I’ bands are arranged alternately throughout the
length of the myofibrils.
ii) Sarcomere
The portion of the myofibril between two successive ‘Z’ lines is called
‘sarcomere’. It is the functional unit of contraction. In the resting /relaxed
state, the edges of the thin filaments encroach into the A –band on either
side and partially overlap the free ends of the thick filaments. The central
part of the A –band/dark band without the thin filaments is called the ‘H’
zone / ‘H’ band / Hensen’s disc. It is relatively less dark than the edges of
the A-band as there are no ‘thin filaments’ in it.
iii) Structure of Contractile Proteins
Each actin (thin) filament is made of two ‘F’ (filamentous) actin molecules
helically wound around each other. Each ‘F’ actin is a polymer of monomeric
‘G’ (globular) actin molecules. Two filaments of another protein, called
tropomyosin also run close to the ‘F’ actin molecules, throughout their length.
A complex protein called ‘troponin’ is distributed at regular intervals on the
tropomyosin.
Troponin is made of three polypeptide units named Tn-T, Tn-I, and Tn-C.
Tn-T binds to tropomyosin. Troponin-I (Tn-I), inhibits the myosin binding
site on the actin. Tn-C can bind to Ca2+. When calcium ions are not bound to
troponin (Tn-C), it stabilizes tropomyosin in its blocking position over the
active sites of actin. When
Calcium ions attach to the Tn-C
TnC TnT Tropomyosin
of the troponin, the tropomyosin TnI
moves away/is pulled away from
the ‘active sites’ allowing the
myosin heads to bind to the active
sites of actin (conformational
change). T roponin and
F actin
tropomyosin are often called
‘regulatory proteins’, because of Figure 3.3 Thin filament
their role in masking and
unmasking the active sites.

79
 Zoology

Actin binding site Myosin is a ‘motor protein’ that

is able to convert ‘chemical
Head
energy’ in the ATP molecules into
ATP binding site ‘mechanical energy’. Each
Tail Cross arm myosin (thick) filament is a
M
LM M
M
H polymerized protein. Each myosin
Short Arm molecule consists of two
polypeptide chains wrapped
Figure 3.4 Myosin
around each other. Many
monomeric proteins called meromyosins constitute one thick filament. Each
meromyosin has two important parts, a globular head with a short arm
(neck) and a tail. The globular head with short arm is composed of heavy
meromyosin (HMM) and the tail is made of light meromyosin (LMM). The short
arm /neck serves as a ‘flexible link’ between the head and tail regions. Half
of the myosin molecules have their ‘heads’ oriented towards one ‘Z’ membrane
and the other half towards the other ‘Z’ membrane of the same sarcomere, so
as to pull actin molecules/ thin filaments from either side. It means the
‘tails’ of all myosin molecules in an ‘A’ band are directed towards the ‘M’ line.
The head and short arm project outwards at regular distances and angles
from each other from the surface of a polymerized myosin filament and is
known as cross arm. Each head has two binding sites, one for ATP and the
other for an active site on the actin molecule. The heads on the two ends of
the thick filaments are oriented in opposite directions to pull in actin
filaments of both the sides towards the M-line.
iv) Triad System
Sarcolemma, in many types of muscles, invaginates into the sarcoplasm and
forms transverse tubules (T-tubules) at the level of Z line in the non-
mammalian vertebrates. In the mammals, they penetrate into the junction between
the A and I bands. Each T tubule is flanked on either side by several terminal
cisternae of the sarcoplasmic reticulum. T tubule and the two terminal
cisternae at its sides form the triad system. Most of the stored calcium of
the sarcocyte is located in the terminal cisternae.
B) Motor Unit
A motor neuron and the set of muscle fibres innervated by all the
telodendrites constitute a motor unit. The junction between a motor neuron
and the sarcolemma of a muscle fibre is called the neuromuscular junction
or motor-end plate. Sarcomere of a striated muscle can be considered a
‘functional unit’ of contraction.

80
 Human Anatomy
and Physiology - III

3.1.2 Mechanism of Muscle Contraction

Mechanism of muscle contraction is best explained by the ‘Sliding Filament
Theory’. It states that contraction of a muscle fibre takes place by the
sliding of the thin filaments over / in between the thick filaments. It was
proposed by Jean Hanson and Hugh Huxley. The process of muscle
contraction can be studied under the following heads:
i) Excitation of muscle: Muscle contraction is initiated by a signal sent
by the central nervous system (CNS) via a motor neuron. A neural
signal reaching the neuromuscular junction releases a neurotransmitter
(acetylcholine) which generates an ‘action potential’ in the
sarcolemma. When the action potential spreads to the triad system
through the T tubules, the cisternae of the sarcoplasmic reticulum
release calcium ions into the sarcoplasm.

is released

Figure 3.5 Mechanism of Muscle Contraction

81
 Zoology

ii) Formation of Cross bridges: Increase in the Ca2+ level leads to the
binding of calcium ions to the subunit Tn-C of the troponin of the thin
filaments. This makes troponin and tropomyosin complex to move away
from the active sites of actin molecules. Now, the active sites are exposed
to the heads of the myosin. Utilizing the energy released from hydrolysis
of ATP, the myosin head now binds to the exposed ‘active sites’ on the
actin molecules to form a cross bridge and Pi is released
iii) Power Stroke: The cross bridge pulls the attached actin filaments
towards the centre of the ‘A’
band. The ‘Z’ lines attached to
these actin filaments are also
pulled inwards from both the
sides, thereby causing shortening
of the sarcomere, i.e.,
contraction. During the
shortening of the muscle, the ‘I’
bands get reduced in size/length
(Z membranes of the sarcomere
are brought closer), whereas the
‘A’ bands retain their size /
length. It is important to note that
myofilaments do not actually
shorten. As the thin filaments are
Figure 3.6 Sliding Filaments
pulled deep in to the A bands
making the H bands narrow, the
muscle shows the effect-
contraction.
Cross bridge cycle: When myosin heads hydrolyse ATP into ADP and Pi ,
the conformation of the myosin is changed to an active state so that it can
perform the ‘power stroke’. When myosin head binds to actin (formation of
‘crosss bridge’), it releases P i and undergoes another conformational
change, pulling the thin filaments towards the centre of the ‘A’ band /
sarcomere. Thus the ‘power stroke’ is completed and the myosin head
releases the ADP. At the end of the power stroke, the myosin head binds
to a new molecule of ATP, which displaces/releases it from actin. This
entire process is called ‘cross bridge cycle’. The combined power of several
cross bridge cycles causes the muscle to contract. These cycles continue
as long as the muscle receives stimuli.

82
 Human Anatomy
and Physiology - III

iv) Recovery Stroke: The myosin head goes back to its relaxed state and
releases ADP. A new ATP molecule binds to the head of myosin and the
cross-bridge is broken. Now the new ATP is hydrolysed by the ATPase of
the myosin head and the cycle of conformational change in myosin
leads to cross bridge formation, and pulling of thin filaments is repeated
causing further sliding.
v) Relaxation of Muscle: When motor impulses stop the Ca2+ ions are
pumped back into the sarcoplasmic cisternae. It results in the masking
of the active sites of the actin filaments. The myosin heads fail to bind
with the active sites of actin. These changes cause the return of ‘Z’
lines back to their original position, i.e., relaxation.
3.1.3 Muscle Fatigue
Repeated activation of the skeletal muscles can lead to the accumulation of
lactic acid due to anaerobic breakdown of glucose in them, causing fatigue.
At this state the skeletal muscle fails to contract temporarily.
Cori Cycle
The lactic acid produced during rapid
contractions of skeletal muscles under low
availability of oxygen is partly oxidized and a
major part of it is carried to the liver by the
blood, where it is converted into pyruvic acid
(pyruvate) and then to glucose through
gluconeogenesis. The glucose can enter the
blood and be carried to muscles and immediately
used. In case glucose is not immediately
required, it can be used to rebuild reserve of
glycogen through glycogenesis. This two way
traffic between skeletal muscle and liver is
called the Cori cycle. Figure 3.7 Cori cycle
Types of Muscle Fibers
Muscle contains a red coloured oxygen storing pigment called ‘myoglobin’
(muscle haemoglobin). Myoglobin content is high in some of the muscles
which give a reddish appearance. Such muscle fibers are called the red
fibers. These muscles with red fibers also contain plenty of mitochondria
which can utilise the large amount of oxygen stored in them for the
production of ATP. These muscles, therefore, can also be called aerobic
muscles.
On the other hand, some of the muscles possess very less quantity of
myoglobin in their muscle fibers and therefore, appear pale or whitish.
These muscle fibers are white fibers. Mitochondria are also few in them,
but the amount of sarcoplasmic reticulum is more. They depend on
anaerobic process for the release of energy. White fibres show short term,
high intensity contractions.

83
 Zoology

3.2 The Skeleton

Skeletal system consists of
Coronal suture
a framework of bones and a
few cartilages. This system
Parietal bone has a significant role in
Frontal bone
maintaining the posture and
the movement of body parts.
Sphenoid bone
Lambdoid suture
Nasal bone
In adult human beings,
Occipital bone Zygomatic bone skeletal system is made up
Temporal bone of 206 bones and a few
Maxilla
External cartilages. It is grouped into
auditory canal
two principal divisions – the
Mandible
axial skeleton and the
Figure 3.8 The Skull appendicular skeleton.

3.2.1 Axial skeleton

It comprises 80 bones distributed along the main axis of the body. The skull,
vertebral column, sternum and ribs constitute the axial skeleton.

I. The skull
It is composed of two sets of bones –cranial and facial bones (22 bones in
all).
Cranium, the brain box, is formed by eight flattened bones. They are a)
frontal bone (1), b) Parietals (2), c) Temporal bones (2), d) Occipital bone (1),e)
Sphenoid bone (1) and f) Ethmoid bone(1).
i) Frontal bone: It forms the forehead, anterior part of the cranial floor,
and the roof of the orbits.
ii) Parietal bones: They form the major portion of the sides and roof of the
cranial cavity. They are joined to the frontal bone by a coronal suture
and posteriorly to the occiput by lambdoid suture.
iv) Temporal bones: They form the lateral parts and the floor of the cranium.
iii) Occipital bone: It forms the posterior part and most of the base of the
cranium. It has a large opening, the foramen magnum. Medulla oblongata
passes out through this foramen and joins the spinal cord. Two occipital
condyles are present one on each side of the foramen magnum
(dicondylic skull).

84
 Human Anatomy
and Physiology - III

iv) Sphenoid bone: It is present at the middle part of the base of the skull.
It is the keystone bone of the cranium because it articulates with most
of the other cranial bones.
v) Ethmoid bone: It is present on the midline of the anterior part of the
cranial floor.
A) The facial region is made up of 14 skeletal elements which form the
front part of the skull. The bones of the facial skeleton are the nasals
(2), the maxillae (2), the zygomatic bones (2), the mandible (1), the lacrimal
bones (2), the palatine bones (2), inferior nasal conchae (2), and the vomer
(1)
i) Nasal bones: These are paired bones that form the bridge of the
nose.
ii) Maxillae: Two maxillae join together and form the upper jaw. The
maxilla bears sockets (alveoli) for lodging the maxillary teeth. The
palatine processes are involved in the formation of the anterior
part of the hard palate.
iii) Zygomatic bones: These are known as cheek bones.
iv) Lacrimal bones: These are the smallest bones of the face
v) Palatine bones: They form the posterior portion of the hard palate.
vi) Inferior nasal conchae: These are scroll like bones that form a
part of lateral wall of the nasal cavity.
vii) Vomer: It is a triangular bone present on the floor of the nasal
cavity.
viii)Mandible (Lower jaw): It is ‘U’ shaped and is the longest and
strongest of all the facial bones. It is the only movable skull bone
(except the ear ossicles).
B) Skeletal structures associated with sense organs
i) The nasal cavity is divided into left and right cavities by a vertical
partition called the nasal septum.
ii) Orbits: Orbits are bony depressions which accommodate the
eyeballs and associated structures.
iii) Ear Ossicles: Each middle ear contains three tiny bones – Malleus
(modification of articular), Incus (modified quadrate) and Stapes
(modified hyomandibula), collectively called ear ossicles.
C) Hyoid Bone
It is a single U shaped bone present at the base of the buccal cavity between
the larynx and the mandible. The hyoid bone keeps the larynx open.

85
 Zoology

II. Vertebral Column

Our vertebral column is formed by 26 serially
Cervical arranged units called vertebrae.
vertebrae
Structure of Vertebra
Each vertebra has a central hollow portion (neural
Thoracic canal) through which the spinal cord passes. A
vertebrae
typical vertebra consists of the body (centrum),
vertebral (neural) arch, and many processes for
articulation or attachment of muscles.
Lumbar Articulatory skeletal structures between the
Intervertebral vertebrae
disc bodies of successive vertebrae are called
Sacrum intervertebral discs.

Coccyx The vertebral column is differentiated into cervical

(7), thoracic (12), lumbar (5), sacral (1-fused) and
Figure 3.9 Vertebral column coccygeal (1-fused) regions starting from the skull.

a) Cervical vertebrae: The first vertebra is called the atlas and the
second the axis. Atlas is articulated with the occipital condyles,
and has an odontoid canal. Axis has a strong odontoid process
that fits in to odontoid canal of the atlas to facilitate rotation of
head.
b) Thoracic vertebrae: Thoracic region consists of twelve vertebrae.
The heads of ribs namely capitulum and tuberculum articulate
with the ‘articular facets’ of the thoracic vertebrae.
c) Lumbar vertebrae: These are the largest and strongest free
vertebrae. They provide surface for the attachment of the large
back muscles.
d) Sacrum: It is a triangular bone formed by the fusion of five sacral
vertebrae.
e) Coccyx: It is a triangular bone formed by the fusion of four coccygeal
vertebrae.
Functions
i) Vertebral column protects the spinal cord in its neural canal
ii) It supports the skull
iii) It serves as the point of attachment for the ribs and musculature
of the back.

86
 Human Anatomy
and Physiology - III

III. Sternum (breast bone)

It is a flat bone on the mid ventral line of the thorax. It consists of three
parts. The superior (anterior) part is the manubrium, the middle part is the
body, and the inferior (posterior) smallest xiphoid process. The sternum
provides space for the attachment of the thoracic ribs and abdominal muscles
too.
IV. Ribs
Twelve pairs of ribs are present
in the human chest. Each rib
is a thin flat bone connected
dorsally to the vertebral column
and ventrally to the sternum.
It has two articulation surfaces
on its dorsal end, hence called
bicephalic. The first seven pairs
of ribs are called true ribs
(vertebro-sternal ribs).
Dorsally, they are attached to
the thoracic vertebrae and
ventrally connected to the
sternum with the help of
hyaline cartilages. The
remaining ribs are called ‘false
ribs’. The 8th, 9thand 10thpairs
of ribs do not articulate directly
with the sternum but join the
cartilaginous (hyaline cartilage) Figure 3.10 Rib cage
parts of the seventh rib. These
are called vertebro-chondral ribs. Last 2 pairs (11thand 12th) of ribs are not
connected ventrally either to the sternum or the anterior ribs, hence called
floating ribs. The last five pairs of ribs which are not attached to the sternum
directly are called ‘false ribs’. The thoracic vertebrae, ribs and sternum
together form the rib cage.
3.2.2 Appendicular Skeleton
The bones of the limbs along with their girdles constitute the appendicular
skeleton. The appendicular skeleton is composed of 126 bones.
i) Bones of the Forelimb
Each limb is made of 30 bones. The bones of the hand (forelimb) are humerus,
radius and ulna, carpals (wrist bones – 8), metacarpals (palm bones – 5) and
phalanges (digital bones – 14).
87
 Zoology

ii) Bones of the Hind limb

The bones of the leg are Femur (1) (thigh bone – the longest bone), tibia (1) and
fibula (1), tarsals (ankle bones – 7), metatarsals (5) and phalanges (digital
bones– 14) are the bones of the legs (hind limbs). A cup shaped bone called
patella (knee cap) (1) covers the knee joint ventrally.

RECALL: Bones such as the knee cap are formed in tendons and are
called ’sesamoid bones’.

iii) Pectoral Girdle

Pectoral girdle consists of two halves and helps
in the articulation of the upper limbs with the
axial skeleton. Each half of pectoral girdle
consists of a clavicle (collar bone) and a
scapula. The scapula is a large triangular, flat
bone situated in the dorsal part of the thorax
between the second and the seventh ribs. The
dorsal, flat, triangular body of the scapula has
a slightly elevated ridge called the spine which
projects as a flat, expanded process called the
acromion process. The clavicle articulates
Figure 3.11 Scapula with it. The acromion process articulates with
the clavicle and provides space for attachment
of the muscles of the upper limb and chest. Below the acromion process is a
depression called the glenoid cavity, which articulates with the head of the
humerus to form the shoulder joint.

Iliac crest iv) Pelvic Girdle

Pelvic girdle consists of two identical halves
Sacrum
called coxal bones/hip bones. Each coxal
Pubis bone is formed by the fusion of three bones
– ilium, ischium and pubis. At the point of
Coccyx
Acetabulum fusion of the above bones is a cavity called
Pubic acetabulum which the thighbone
symphysis
Ischium articulates. The two halves of the pelvic
Figure 3.12 Pelvic Girdle with a part of the girdle meet ventrally to form the pubic
vertebral column symphysis containing fibrous cartilage.

3.3 JOINTS
Joints are essential for all types of movements involving the bony parts of
the body. Locomotor movements are no exception to this. Joints are points of
88
 Human Anatomy
and Physiology - III

contact between bones, or between bones and cartilages. Force generated by

the muscles is used to carry out movement through joints, where the joint
acts as a fulcrum. The movability at these joints varies depending on different
factors.

3.3.1 Types of Joints

Joints are classified into three major structural forms, namely fibrous joints,
cartilaginous joints and synovial joints.
A. Fibrous joints: The fibrous joints do not allow any movement
(synarthroses). These are composed of dense irregular connective tissue.
These are three types- sutures, syndesmoses and gomphoses. a) Sutures
are present between cranial
Carpals
bones, e.g., coronal suture
Pelvic
present between frontal and girdle
Humerus First
pariental bones. b) Meta
Aceta- Radius carpal
Syndesmoses e.g., bulum
Femur
Interosseous membrane
between tibia and fibula. c)
Ulna
Gomphoses e.g., Dento-
alveolar joint. Sutures and Atlas
Radius
gomphoses are immovable Ulna
joints (synarthroses).
Syndesmosis is slightly Carpals
movable (amphiarthrosis). Axis
B. Cartilaginous joints: The
Carpals
bones involved are joined
Figure 3.13 Joints
together with the help of
cartilages. These are two types- a) Synchondrosis e.g., epiphyseal plate
present between epiphysis and diaphysis. (b) Symphysis e.g., pubic
symphysis of pelvic girdle and the joint between two adjacent vertebrae
of a mammal. It is an amphiarthrosis. Synchondrosis is a synarthrosis
and symphysis is an amphiarthrosis.
C. Synovial joints: These are characterized by the presence of a fluid
filled synovial cavity between the articulating surfaces of the two bones.
The articular surfaces of the bones are covered by hyaline cartilage. All
synovial joints are diarthroses (freely movable joints).
3.3.2 Structure of synovial joint
Synovial joint is covered by a double layered synovial capsule. The outer
layer consists of dense fibrous irregular connective tissue with more collagen
fibres. This layer is continuous with the periosteum and resists stretching
and prevents the dislocation of joints. Some fibres of these membranes are
arranged in bundles called ligaments. The inner layer of synovial capsule is

89
 Zoology

formed of areolar tissue and elastic fibers. It

secretes a viscous synovial fluid which contains
Bone hyaluronic acid , phagocytes etc. and acts as a
‘lubricant’ for the free movement of the joints .

Articular
3.3.3 Types of synovial joints
capsule Synovial joints include Ball and socket joint, Hinge
Ligament joint, Pivot joint, Gliding joint, Condyloid joint, Saddle
Synovial joint
cavity a) Ball and socket joint: e.g. hip joint (between
Hyaline femur and pelvic girdle), shoulder joint
carilage (between humerus and pectoral girdle).
Inner b) Hinge joint: e.g. elbow joint, knee joint etc
membrane
Outer c) Pivot joint: e.g. atlanto-axial joint and the
membrane joint between ulna and radius. The pivot joint
allows rotation of our fore arm at the elbow
and to move our hand side to side.
Figure 3.14 Synovial joint d) Gliding joint: e.g. inter-carpal joints, inter-
tarsal joints.
e) Condyloid joint: e.g. the joints between the
carpals and metacarpals, joint between occipital condyles and atlas.
f) Saddle joint: e.g. joint between the carpal and metacarpal of the thumb.

3.4 Disorders of Muscular and Skeletal Systems

a) Myasthenia gravis: An autoimmune disorder affecting the
neuromuscular junctions leading to fatigue, weakening and paralysis
of skeletal muscles. Acetylecholine receptors on the sarcolemma are
blocked by antibodies/auto-immune bodies, leading to weakness of
muscles.
b) Muscular dystrophy: Progressive degeneration/wasting of skeletal
muscle due to certain genetic disorders such as Duchenne Muscular
Dystrophy (DMD) or nutritional disorders.
c) Tetany: Muscle spasms in muscles a state of prolonged contraction of
muscles, caused by low blood calcium level, arising from vitamin D
deficiency or underactive parathyroid glands (hypoparathyroidism),
resulting in tetany.
d) Arthritis: Inflammation of joints.
e) Osteoporosis: Age-related disorder characterized by decreased bone
mass (loss of calcium due to reabsorption) whereby chances of fractures
increase. A decreased level of estrogen is a common cause, especially
in post menopause women.
f) Gout: Inflammation of joints due to accumulation of uric acid crystals.
g) Rigor mortis: Stiffening of the body after death. In a dead person cells
do not produce ATP and so cross bridges cannot be broken and the
muscles become ‘stiff’.

90
 Human Anatomy
and Physiology - III

GLOSSARY
Acetabulum Cup: like hollow on each Glenoid cavity: Cup-like hollow space
side of pelvic girdle into which head on each side of the pectoral girdle into
of femur fits. which head of the humerus fits.
Acromion process: Point of attachment Hyoid bone: Ventral element of the
of clavicle to scapula in the pectoral second visceral arch of the early
girdle of mammals. vertebrates. It supports the tongue.
Amphiarthroses: Slightly movable joints Hyomandibula: Dorsal element of the
of vertebrates second visceral arch ( hyoid arch). It
Clavicle: Membrane bone of the ventral becomes the ear ossicle called stapes,
side of the pectoral girdle of many in mammals; it is the smallest bone
vertebrates; also called collar bone of of the human skeletal system.
man Ligaments: Connective tissue joining
Coccyx: Fused tail vertebrae. In man it one bone to another bone. Elastic
comprises four coccygeal vertebrae ligaments consist primarily of elastic
Cori cycle: The lactic acid produced in fibers and collagenous ligaments
a fast working muscle, in low oxygen consist of parallel bundles of collagen.
conditions, to release energy for the Lumbar vertebrae: Bones of the lower
contraction of muscles is mostly back region, lacking rib attachments
converted into glucose in the liver and situated between the thoracic
cells (gluconeogenesis) by Cori cycle. and sacral vertebrae
Coxal bones: Each half of the pelvic Manubrium: The first upper(anterior
girdle. It is made of ilium, ischium and most) bone of the sternum.
pubis. Motor end plate: Depression of
Diarthroses: Freely movable joints of sarcolemma on which the tips of the
vertebrates. E.g. Most of these are motor axon terminals end.
synovial joints. Myoglobin: Myoglobin is an iron
Fascia: Sheet of connective tissue containing and oxygen-binding
enclosing muscles protein found in the muscle tissue of
Fascicles: Bundle of muscle fibers. almost all mammals.
These are covered by a connective Rigor mortis: Stiffening of the body after
tissue sheath, the perimysium. death. In a dead person cells do not
Fatigue: The inability of a muscle to produce ATP and so cross bridges
contract after repeated muscle cannot be broken and the muscles
contractions due to lack of ATP and become ‘stiff’.
accumulation of lactic acid. Sarcomere: Structural and functional
Foramen magnum: Opening at the contraction unit of a myofibril
back of the vertebrate skull; the Synarthroses. Immovable joints of
medulla oblongata passes out through vertebrates
this foramen and joins the spinal cord Tonus: A state of partial contraction of a
muscle

91
 Zoology

QUESTIONS
The Muscle The Skeleton
Very Short Answer Type Questions Very Short Answer Type Questions

1. What is a ‘motor unit’ with 1. Name two cranial sutures and their
reference to muscle and nerve ? locations
2. What is triad system? 2. Name the keystone bone of the
3. Write the difference between actin cranium. Where is it located?
and myosin 3. Human skull is described as
dicondylic skull. Give the reason
Short Answer Type Questions 4. Name the ear ossicles and their
evolutionary origin in human
1. Describe the important steps in beings.
muscle contraction. 5. Name the type of joint between a)
2. Describe the structure of a atlas/axis b) carpal/metacarpal of
skeletal muscle. the human thumb
3. Write short notes on contractile 6. Name the type of joint between
proteins Femur and hip bone.
4. Draw a neat labeled diagram of 7. Name the type of joint between a)
the ultrastructure of muscle fiber cranial bones b) Inter-tarsal joint
5. Draw the diagram of a sarcomere
of skeletal muscle showing Short Answer Type Questions
different regions.
1. List out the bones of the human
6. What is Cori’s cycle – explain the
cranium.
process.
2. Write short notes on the ribs of
human being .
Long Answer Type Questions
3. List the bones of human fore limb
1. Explain the mechanism of 4. List the bones of the human leg
muscle contraction. 5. Draw a neat labeled diagram of
pelvic girdle.
6. Describe the structure of synovial
joint with the help of a neat labeled
diagram

Long Answer Type Questions

7. Describe the structure of human

skull

92
 Human Anatomy
and Physiology - III

FOR IGNITED
MINDS
The Body Movement
and Posture

The Musculo Skeletal System

1. In which type of muscles do we find ‘multiple nuclear’, ‘structural units’?
2. What is the tiniest bone that plays an important role in a certain sensory
perception?
3. Which muscles do you think are the most powerful muscles in the body of a
tiger or a shark ?
4. Do muscles have any role in the homeostasis of temperature in our body? How
do they help?
5. If you are asked to identify a single inorganic element that actually facilitates
initiation of the contraction process in a muscle, what would you choose / what
strikes your mind first? And do you think it has another important role in the
proper functioning of one our circulatory fluids? what is it?
6. Does nodding the head ‘yes’ involve movement at the same joint as shaking the
head ‘no’?
Clue: Condylid joint and Pivot joint
7. Which joint allows you to twist your forearm almost 1800 (rotate the fore arm
elbow)?
Clue: Pivot joint.
8. Unlike arms (shoulder joints) we cannot move or rotate our legs (hip joints)
freely. Why?
9 In the human limb skeleton can you identify a bone which is rather feeble and
does not have much role in supporting body weight or maintaining posture,
and doctors use pieces of it to transplant to other broken bones, where
necessary?
10. The sternum’s main purpose is to protect the inner delicate organs such as the
heart. Why should majority of the ribs be attached to the sternum. What is the

n
significance of such attachment?
11. Long duration low intensity exercises mostly use red fibers of muscles and high
intensity actions lasting a few seconds use predominantly white fibers. Of the
above two types, what type of muscles help a high jumper most?

93
 Zoology

UNIT III B
Neural Control and
Co-ordination
3.5 Human Neural System
3.6 Generation and Conduction of
Nerve Impulse
3.7 Reflex action and Reflex arc
3.8 Sensory reception and processing

The integrating net work of the ‘Ultimate

Biocomputer’
Nervous system evolved from the basic non-polarised nerve cells forming a
diffuse ‘nerve net’ as seen in the diploblastic organisms to a highly organized
‘integrating system’ with the ‘Think Tank”, the ‘Brain’ (containing 100 billion
neurons), controlling it. Man has come to know more about this ‘Head Quarters’
of the nervous system, with the help of ‘Functional Magnetic Resonance Imaging’
(FMRI) technique. A three dimensional map of brain’s functioning can be obtained
with FMRI and a computer. These studies could pinpoint the various physiological
regions of the brain and correlate them with specific tasks we perform in our
daily life. Nervous tissue has connecting cells called ‘neurons’ and ‘supporting
cells’ called ‘glial cells’. The system mainly controls the body activities by
receiving stimuli (sensory stimuli), processing them and reacting to them by
sending ‘motor’ signals. Among the vertebrates, the nervous system reached
the peak of evolution in man ,especially with the development of the ‘neopallium’
(cerebral cortex,the ‘grey matter’ with 10% of the total neurons of the brain in it
), and the ‘corpus callosum’ (nervous connection between the right and left
halves of the cerebrum). Although both are structurally similar, the two cerebral
hemispheres are responsible for different activities. For example, most neuronal
processing related to language is performed in the left hemisphere of the ‘right
handed people’ and about 65% in the ‘left handed people’. Hippocampus
of the brain is responsible for the formation and recall of memory. Our brain
has developed two types of memory – the long term memory and short term
memory. The ‘limbic system’ of the brain formed by hippocampus and
amygdale along with the hypothalamus is responsible for the emotional
response. Research work is going on why people develop dementia, involving
memory loss as seen in Alzheimer’s. The human brain remains an ultra-
computer, the working mechanism of whose processor has not yet been deciphered
or may be it can never be deciphered at all.
94
 Human Anatomy
and Physiology - III

Introduction
As you know, the functions of the organs/organ systems in our body must be
coordinated to maintain homeostasis. Coordination is the process through
which two or more organs interact and complement the functions of one
another. For example, when we do physical exercise, the energy demand is
increased for maintaining increased muscular activity. The increased demand
of oxygen necessitates an increase in the rate of respiration, heart beat and
increased blood flow via the blood vessels. When physical exercise is stopped,
the activities of nerves, lungs, heart and kidneys gradually return to their
normal conditions. Thus, the functions of muscles, lungs, heart, blood vessels,
kidney and other organs are coordinated while performing physical exercise.
In our body the neural system and the endocrine system jointly coordinate
and integrate all the activities of the organs so that they function in a
synchronized fashion.
The neural system provides an organized network of point-to-point connections
for a quick coordination. You will learn about the neural system of human
beings, mechanisms of neural coordination like transmission of nerve impulse,
its conduction across a synapse, the physiology of reflex action and also
sensory perception, along with the structure of the most important sense
organs in the human body, the eye and ear, in this chapter.

3.5 Human Neural System

It is divided into two parts: (I) The Central Neural System (CNS) and (II) The
Peripheral Neural System (PNS)

3.5.1 The Central Neural System (CNS)

The CNS includes the brain and the spinal cord. It develops from
neurectoderm.

BRAIN (‘the living super computer’)

It is the site of information processing and control. It is protected in the
cranial cavity and covered by three connective tissue membranes called
‘cranial meninges’ namely, dura mater, arachnoid mater and pia mater.
Dura mater is the outer most, thick, double layered membrane which lines
the inner surface of the cranial cavity. Arachnoid mater is a thin, webby
middle membrane covering the brain. Pia mater is the thin, innermost meninx
which closely adheres to the brain. Pia mater is separated from the arachnoid
membrane by the subarachnoid space. The brain can be divided into three
major parts called i. Forebrain, ii. Midbrain and iii. Hindbrain.

95
 Zoology

I. Forebrain (Prosencephalon)
The forebrain consists of i. Olfactory bulb, ii. Cerebrum and iii.
Diencephalon.
i. Olfactory Bulb: Olfactory bulbs receive impulses pertaining to smell
from the olfactory epithelium.
ii. Cerebrum : Cerebrum forms the major part of the brain and is
longitudinally divided into the left and the right cerebral hemispheres by
a deep cleft called ‘longitudinal fissure’. The two hemispheres are
internally connected by a transverse, wide and flat bundle of myelinated
fibres beneath the cortex, called ‘corpus callosum’ (colossal
commissure). It brings ‘coordination’ between the right and left sides
of the cerebral hemispheres. The surface of the cerebrum is composed
of grey matter and is called the ‘cerebral cortex’. The neuronal cell
bodies are concentrated in the cerebral cortex.
The surface of the cerebral cortex shows many convolutions or folds
and grooves. The folds are called gyri (singular: gyrus), the deepest and
shallower grooves between the folds are called fissures and sulci,
respectively. Gyri and sulci increase the surface area of the cerebral
cortex (which is an indication of the higher level of evolution of the
human being).
Cerebral cortex has three functional areas called a)sensory areas, that
receive and interpret the sensory impulses b) motor areas, which control
voluntary muscular movements c) association areas, which are neither
clearly sensory nor motor in function and they deal with more complex
‘integrative functions’ such as memory and communications. The cerebral
medulla consists of mostly myelinated axons (white matter). Each
cerebral hemisphere of the cerebrum is divided into four lobes namely
frontal, parietal, temporal and occipital lobes.
iii. Diencephalon (Thalamencephalon): The main parts of the diencephalon
are the epithalamus, thalamus and hypothalamus.
i) Epithalamus: It is the roof of the diencephalon. It is a non-nervous
part which is fused with the pia mater to form the anterior choroid
plexus. Just behind the anterior choroid plexus, the epithelium of
the epithalamus forms a pineal stalk, which ends in a rounded
structure called pineal body.
ii) Thalamus: It lies superior to the mid brain. It is the major
coordinating centre for sensory and motor signalling.
iii)Hypothalamus (the thermostat of the body): It lies at the base of
the thalamus. The hypothalamus forms a funnel-shaped downward
extension called ‘infundibulum’, connecting the hypothalamus with
96
 Human Anatomy
and Physiology - III

the pituitary gland. It also contains several groups of neurosecretory

cells, which secrete hormones called hypothalamic hormones.
Hypothalamus controls and integrates the activities of the
autonomous nervous system (ANS) and it has osmoregulatory,
thermoregulatory, thirst, feeding (hunger) and satiety centres.
Limbic system
The inner parts of the cerebral hemispheres and a group of associated deep
structures like amygdala or amygdale, hippocampus etc. form the limbic
system. The limbic system is involved in the regulation of sexual behaviour
and expression of emotional reactions/ responses.
II. Midbrain
(Mesencephalon)
The midbrain is
located between the
thalamus/
hypothalamus of the
forebrain and the pons
Varolii of the
hindbrain. The ventral
portion of the midbrain
consists of a pair of
longitudinal bands of
nervous tissue called
cerebral peduncles or
crura cerebri (sing:
Figure 3.15 Sagittal section of human brain
crus cerebrum) which
connect the cerebral hemispheres with the pons. The dorsal portion of the
midbrain consists of four rounded lobes called corpora quadrigemina (Four
optic lobes). The two larger anterior optic lobes are called superior colliculi
and the smaller posterior lobes are called inferior colliculi. The superior
colliculi and the inferior colliculi are concerned with visual and auditory
functions, respectively.
III. Hindbrain (Rhombencephalon)
The hind brain comprises cerebellum, pons Varolii and medulla
oblongata.
Cerebellum (‘the little brain’): It is the second largest part of the brain. It
consists of two cerebellar hemispheres and a central vermis. Each cerebellar
hemisphere consists of three lobes namely anterior, posterior and floccular
lobes. It has a branching tree - like core of white mater called arbor vitae
(the tree of life) surrounded by a sheath of grey matter (cerebellar cortex).

97
 Zoology

NOTE: Cerebellum is responsible for the control and coordination of

locomotor movements. The cerebellum is called the ’gyroscope of the
body’ because it maintains equilibrium. Damage to cerebellum often
results in ataxia (uncoordinated voluntary muscle movements).

Pons Varolii
It lies in front of the cerebellum below the mid brain and above the medulla
oblongata. It consists of nerve fibres which form a bridge between the two
cerebellar hemispheres. It is a relay station between the cerebellum, spinal
cord and the rest of the brain. Pons has the pneumotaxic centre (involved
in the control of the respiratory muscles as it regulates the amount of air
a person can take in (rate of breathing and depth of respiration).
Medulla oblongata
It is the posterior most part of the brain. It extends from the pons Varolii
above and continuous with the spinal cord below. It has a very thin, vascular
folded structure called posterior choroid plexus. Medulla includes
cardiovascular and respiratory centers, the centers for swallowing, vomiting,
coughing, sneezing and hiccupping. The midbrain, pons and the medulla
oblongata are together referred to as the ‘brain stem’.The medulla oblongata
passes out of the cranium through the foramen magnum and joins the spinal
cord.

Ventricles of the human brain

Human brain consists of four ventricles. The first and second ventricles
(lateral ventricles or paracoels) are present in the right and left cerebral
hemispheres respectively. The third ventricle (diocoel) occurs in the
diencephalon. The two paracoels are connected to the median diocoel
individually by the two ‘foramina of Monro’ (interventricular foramina). The
fourth ventricle (myelocoel) is present in the medulla. The myelocoel and
the diocoel are connected by a narrow canal called iter or aqueduct of
Sylvius/cerebral aqueduct. The myelocoel is continuous with the central
canal of the spinal cord.
The ventricles of the brain, and the subarachnoid space are filled with
Cerebro-spinal fluid (CSF). CSF is an alkaline, colourless fluid which is
filtered from the choroid plexuses into the ventricles of the brain.
NOTE: CSF serves as shock absorbing medium. CSF is recycled (flushed)
4 times per day in order to clear out metabolites and toxins.

98
 Human Anatomy
and Physiology - III

3.5.2 Spinal Cord

The spinal cord is located in the vertebral canal (neural canal) of the vertebral
column. It is protected by the bony arch of each vertebra and the three
spinal meninges called dura mater, arachnoid mater and pia mater.
In the adult, it extends from the Dorsal horn

medulla oblongata to the superior

border of the second lumbar vertebra. Posterior median
sulcus

It has two conspicuous enlargements,

Central canal
the superior enlargement called White
matter
‘cervical enlargement’ and the Dorsal root of
inferior enlargement called ‘lumbar Grey
spinal nerve

matter
enlargement’. The spinal cord is
divided into right and left halves by Anterior Dorsal root
ganglion

two grooves namely, the anterior median fissure

Ventral
(ventral) median fissure and the horn Spinal
nerve
posterior (dorsal) median sulcus. Ventral root
of spinal nerve

Inferior to the lumbar enlargement, the

spinal cord tapers to a conical portion Figure 3.16 T.S of spinal cord
known as the conus medullaris,
which ends at the level of the intervertebral disc between the first and second
lumbar vertebrae in the adult. The extension of the conus medullaris as the
non-nervous fibrous tissue to the coccyx is called ‘filum terminale’.
The internal anatomy of the spinal cord shows H- shaped or butterfly shaped
central area of grey matter surrounded by the outer white matter. The grey
matter is composed of cell bodies, neuroglia, dendrites and unmyelinated
axons and it surrounds a narrow longitudinal cavity called ‘central canal’ or
‘spinal neurocoel’ which is the continuation of the fourth ventricle of the
brain and is lined by the ependymal epithelium. The grey matter is
subdivided into regions called ‘anterior and posterior horns’ on each side.
The white matter consists of bundles of myelinated axons and it is organized
into the regions called anterior (ventral) funiculus, posterior (dorsal)
funiculus and lateral funiculi, one on each side. The spinal cord acts as a
coordinating centre for simple spinal reflexes. It also acts as the ‘middle man’
between the receptors and the effectors, as it conducts sensory and motor
impulses to and from the brain.
3.5.3 The Peripheral Neural System (PNS)
The PNS is formed by the nerves that are associated with brain (cranial
nerves) and spinal cord (spinal nerves).

99
 Zoology

3.5.3.1 The Cranial Nerves

The nerves that are associated with the brain are called cranial nerves.
They enter or emerge out of the cranium through different foramina. They
are 12 pairs in man. Functionally they are of three types, namely, sensory,
motor and mixed nerves.
I) Olfactory nerve (sensory): It arises from the olfactory epithelium of
the nasal chamber, and extends to the ‘temporal lobe’ of cerebral
hemisphere via the olfactory bulb.
II) Optic nerve (sensory): It arises from the retina of the eye. The two
optic nerves cross each other on the floor of the diencephalon in front of
the infundibulum. This crossing is called optic chiasma. Finally the
impulses reach the visual cortex in the occipital lobe of the brain.
III) Oculomotor nerve (motor): It arises from the floor of the mid brain
and innervates the inferior oblique, superior, inferior and medial rectus
muscles, ciliary and iris muscles of the eye ball.
IV) Pathetic or Trochlear nerve (motor): It arises from the floor of the mid
brain and innervates superior oblique muscles of the eye ball.
V) Trigeminal nerve (mixed): It is associated with the pons Varolii and
joins the Gasserian ganglion. It has three branches. They are ophthalmic
(sensory), maxillary (sensory) and mandibular (mixed) branches. The
trigeminal nerve receives the sensory impulses from the conjunctiva,
lacrimal glands, eye lids, palate, teeth, lips, nose, tongue, cheek and it
sends motor impulses to the lacrimal glands, muscles of the lower jaw,
sublingual and sub maxillary salivary glands.
VI) Abducens nerve (motor): It arises from the pons and ends in the lateral
rectus muscle of the eye ball.
VII) Facial nerve (mixed): Its motor fibres arise from the pons and end in
facial parts, palate, hyoid, sublingual and submaxillary salivary glands.
Its sensory fibres extend from the taste buds of the anterior two-thirds
of the tongue to the pons through the gasserian ganglion.
VIII) Vestibulo-cochlear nerve / Acoustic or Auditory nerve (sensory): It
has two branches called ‘cochlear’ and ‘vestibular’ branches. Cochlear
branch arises from the organ of Corti of the cochlea and terminates in
a sensory nucleus called the cochlear nucleus which is located at the
junction of the pons and medulla. The vestibular branch arises from
the semicircular canals, sacculus and utriculus of the internal ear and
ends in the vestibular nuclear complex located in the floor of the fourth
ventricle.
IX) Glossopharyngeal nerve (mixed): Its motor fibres arise from the medulla
and end in the muscles of the pharynx and the parotid, sublingual and

100
 Human Anatomy
and Physiology - III

sub maxillary salivary glands. Its sensory fibres conduct impulses to

the medulla from the taste buds of the ‘posterior third’ of the tongue
and pharynx.
X) Vagus nerve (mixed): The motor fibres of the vagus nerve arise from
the medulla and terminate in the muscles of organs such as the lungs,
heart, oesophagus, stomach, and intestine, from which sensory fibres
arise and terminate in the medulla.
XI) Spinal accessory or accessory nerve (motor): It arises from the medulla
and terminates in the muscles of the pharynx, larynx, neck and shoulder.
XII) Hypoglossal (motor): It arises from the medulla and terminates in the
muscles of the tongue, which control the tongue movements pertaining
to speech, food manipulation, and swallowing.
3.5.3.2 The Spinal Nerves
The spinal nerves are formed by the union of dorsal and ventral roots soon
after they leave the spinal cord. The first pair of cervical spinal nerves emerges
between the atlas and occipital bone of the cranium. All other spinal nerves
emerge from the vertebral column through the intervertebral foramina
between the adjoining vertebrae. There are 31 pairs of spinal nerves in man
which are classified into five groups based on their location, they are:
i. Cervical (8 pairs) ii. Thoracic (12 pairs) iii. Lumbar (5 pairs) iv. Sacral (5
pairs) v. Coccygeal/ caudal (1 pair). Before emerging out from the
intervertebral foramina, the lumbar, the sacral and the caudal nerves extend
back along with the filum terminale forming a thick bundle of nerves called
cauda equina.
Certain spinal nerves are joined to form networks called plexuses on either
side. They are: 1)cervical plexus(1st to 4th cervical nerves), 2) brachial plexus
(5th to 8th cervical and 1st thoracic nerves), 3) lumbar plexus L1, L2, L3 and
L4 lumbar nerves, 4) sacral plexus (Branches of L4, L5 and S1, S2 and S3
nerves) and 5) coccygeal plexus (parts of 4th and 5th sacral and coccygeal
nerve). Functionally, the PNS is divided into two divisions called Somatic
and Autonomic neural systems.
3.5.4 Somatic neural system (SNS)
The somatic neural system includes both sensory and motor neurons. The
sensory neurons conduct sensory impulses from the different somatic
receptors to the CNS. All these sensations normally are consciously perceived.
Somatic motor neurons innervate the skeletal muscles and produce voluntary
movements. The axon of a single myelinated somatic motor neuron extends
from the CNS all the way to the skeletal muscle fibres. In the SNS, the effect
of a somatic motor neuron always is excitation.

101
 Zoology

3.5.5 Autonomic Neural System (ANS)

The ANS usually operates without conscious control. The autonomic neurons
are associated with interoceptors (located in the viscera and sense internal
stimuli), such as chemoreceptors. These sensory signals are generally not
consciously perceived. Autonomic motor neurons regulate the involuntary
activities of the cardiac muscles, smooth muscle and glands. The ANS has
two divisions: 1. Sympathetic and 2. Parasympathetic divisions.
1. Sympathetic division: In the sympathetic division, the preganglionic
neurons arise from the thoracic and lumbar regions of the spinal cord,
hence called ‘Thoracolumbar division’. The sympathetic nervous system
is said to exhibit ‘Thoracolumbar outflow’ (outflow of information, which
refers to its ‘motor’ signals). The sympathetic system consists of two
sympathetic chains, pre-ganglionic sympathetic fibres, post-ganglionic
sympathetic fibres and collateral ganglia.
A pair of sympathetic chains / trunks of ganglia extend from the base
of the skull to the pelvis of the body along the sides of the dorsal aorta.
The ‘chain ganglia’ contain cell bodies of many neurons and are connected
serially by nerve fibres extending between them in the trunk. The
preganglionic sympathetic fibres may synapse directly with the post
ganglionic neurons in the chain ganglia or may synapse directly with
the collateral ganglia. There are three collateral ganglia located in the
abdominal cavity close to the origins of arteries with the same names
on each side. They are coeliac, superior mesenteric and inferior
mesenteric ganglia. It means the postganglionic sympathetic neurons
may have their cell bodies, either in one of the chain ganglia or in the
collateral ganglia. As the sympathetic trunk ganglia are closer to the
spinal cord, most sympathetic preganglionic axons are shorter and the
postganglionic axons are longer. In general, postganglionic axons from
the sympathetic trunk mostly innervate organs anterior to the
diaphragm, whereas, post ganglionic axons from the collateral ganglia
innervate organs posterior to the diaphragm.
2. Parasympathetic division: The cell bodies of the preganglionic neurons
of the parasympathetic division are located in the brain and in the
sacral region of the spinal cord. Hence, the parasympathetic division is
also known as the cranio sacral division. The axons of the
parasympathetic neurons that emerge from the brain occur in the III,
VII, IX and X cranial nerves. The axons of the parasympathetic
preganglionic neurons that emerge from the spinal cord occur in the II,
III and IV sacral spinal nerves. The parasympathetic neural system is
said to exhibit ‘cranio-sacral outflow’ (out flow of information / ‘motor’
signals) as the ‘efferent impulses of these nerves’ originate in the cranial
and sacral regions of the CNS.

102
 Human Anatomy
and Physiology - III

SYMPATHETIC PARA
SYMPATHETIC

otic ganglion

Coeliac

Figure 3.17 Autonomic Neural System (ANS)

The ‘cranial out flow’ of the parasymapathetic unit includes the ciliary,
pterygopalatine, submandibular and Otic ganglia which receive
preganglionic fibres from the cranial nerves III,VII and IX and send post-
ganglionic fibres to smooth muscles of the eye ball, nasal mucosa, palate,
pharynx, lacrimal glands and salivary glands in the head.
The preganglionic fibres that leave the brain as part of the vagus nerve are
the last components of the cranial out flow which extend to many terminal
ganglia in the thorax and abdomen. It sends fibres to the heart, lungs and to
the components of the digestive system. Sacral out flow includes the pelvic
plexus which receives preganglionic fibres from the 2nd to 4th sacral spinal
nerves and supplies nerves mainly to the urinary and genital systems. As
the parasympathetic ganglia are nearer to the organs they innervate, most
parasympathetic preganglionic axons are longer and the postganglionic axons
are shorter.

103
 Zoology

Differences between sympathetic and parasympathetic neural systems

Sympathetic neural system Parasympathetic neural system

1. SNS originates in the thoracic and PNS originates in the cranial region
lumbar regions of the spinal cord of the brain and the sacral region
of the spinal cord
2. Its ganglia are linked up to form a Its ganglia remain isolated
chain (one chain on each side of
the vertebral column)
3. Preganglionic fibres are short and Preganglionic fibres are long and
the postganglionic fibres are long the postganglionic fibres are short

4. Norepinephrine is produced at the Acetylcholine is produced at the

terminal ends of the post- terminal ends of the postganglionic
ganglionic fibres at the synapses fibres at the effector organ. Hence
on the effectors organ. Hence the the system is called ‘cholinergic’
system is called ‘adrenergic’ usually.
usually.

5. Active during stressful conditions, Active during relaxing times,

preparing the body to face them. restoring normal activity after
stress.

6. The overall effect is excitatory and The overall effect is inhibitory.

stimulating.

Comparison of effects of sympathetic and parasympathetic systems on some organs

ORGAN SYMPATHETIC (Fight or PARASYMPATHETIC

Flight response) (Rest and digest response)
Eye Dilates pupil of the eye Constricts pupil of the eye
Heart Increases rate and force of Slows down the rate and force
contraction of contraction
Blood Vessels Constricts Dilates
Digestive tract Inhibits peristalsis Increases peristalsis
Salivary glands Inhibits salivary secretion Stimulates salivary secretion
Pancreas Inhibits activity of pancreas Stimulates activity of pancreas
Lungs Relaxes bronchi Constricts bronchi
Kidney Increases secretion of renin Decreases the secretion of renin
Urinary bladder Inhibits emptying bladder Promotes emptying the bladder

104
 Human Anatomy
and Physiology - III

3.6 Generation and Conduction of Nerve Impulse

Nerve cells exhibit a special property called electrical excitability. The signal
that travels along the length of a nerve fiber and ends in the release of
neurotransmitters is called a nerve impulse. Neurons can respond to external
and internal stimuli and conduct nerve impulses (action potentials) because
in a neuron a membrane potential is established across the neuronal
membrane. It means there is an ‘unequal distribution of ions’ (charged atoms)
on the two sides of a nerve cell membrane with the cell’s interior more
negative with respect to that of the exterior. Ions keep moving in and out of
an axon through several ‘ion channels’. The neuronal membrane of a neuron
has the following three different types of ion channels.
1) Leakage channels: They are k+ and Na+ leakage channels. K+ leakage
channels are more than those of Na+ leakage channels. Hence axolemma
has greater permeability to K+ ions than Na+ ions.
2) Ligand-gated channels: They are located in the post synaptic membrane
(dendrites and cell bodies) and open or close in response to chemical
stimuli.
3) Voltage gated channels: These channels open in response to a change
in membrane potential. There are sodium voltage gated and potassium
voltage gated channels across the axolemma. Sodium voltage gated
channels have two types of gates. They are sodium activation and
inactivation voltage gates. Each potassium voltage gated channel
has only one activation gate.
Resting membrane potential
The resting membrane potential exists because of a small buildup of negative
ions in the axoplasm along the inside of the membrane, and an equal buildup
of positive ions in the extra cellular fluid along the outer surface of the
membrane. Such a separation of positive and negative electrical charges is a
form of potential energy. In neurons, the resting membrane potential ranges
from -40 to -90 mV. A typical value of resting membrane potential is -70 mV.
The minus sign indicates that the inside of the cell is negative relative to the
outside.
At resting phase, the axolemma is polarized. The membrane potential can
change from its resting value when the membrane’s permeability to particular
ions changes. If the inner side becomes less negative, it is said to be
depolarized. If the inner side becomes more negative, it is said to be
hyperpolarized. During the resting phase the activation gates of sodium are
closed, the inactivation gates of sodium are open and the activation gates of
potassium are closed.

105
 Zoology

Sodium - potassium pump

Sodium and potassium ions diffuse inwards and outwards , respectively,
down their concentration gradients through leakage channels. Such a
movement of ions, if unchecked, would eventually disturb the resting
membrane potential. These flows of ions are offset by sodium - potassium
pumps (Na + / K + ATPases) present in the axonal walls. These pumps
expel three Na+ ions for each two K+ ions imported. As these pumps remove
more positive charges from the axoplasm than they bring into it, they
contribute to the negativity of the resting membrane potential i.e., -70mV.

Depolarization (Rising phase)

When a nerve fibre is stimulated, the plasma membrane first becomes more
permeable to Na + ions than to K + ions as the activation and inactivation
state voltage gates of sodium open and activation voltage gates of potassium
are in closed. As a result the rate of flow of Na+ into the axoplasm exceeds
the rate of flow of K+ in to the ECF. Hence, the axolemma is positively charged
inside and negatively charged outside. This reversal of electrical charge is
called “depolarization”
Outer face of the point which is adjacent to the site of depolarization remains
positively charged. The electrical potential difference between these two areas
is called “action potential”. An action potential occurs in the membrane of
the axon of a neuron when depolarization reaches a certain level called
‘threshold potential’ (-55 mV). The particular stimulus which is able to
bring the membrane potential to threshold is called ‘threshold stimulus’.
The action potential occurs in response to a threshold stimulus or supra
threshold stimulus but does not occur at subthreshold stimuli. It means the
nerve impulse is either conducted totally or not conducted at all and this is
called ‘all- or - none principle’. Due to the rapid influx of Na+ ions, the
membrane potential shoots rapidly up to +45 mV (spike potential).
NOTE: The initial entry of sodium ions causes charge reversal from
negative to positive inside. It results in the opening of more and more
sodium channels leading to a larger influx of sodium ions (called
POSITIVE FEED BACK REGULATION).

Repolarization (Falling phase)

As the wave of depolarization passes away from its site of origin to the adjacent
point, the activation gates of sodium remain open, inactivation gates of sodium
close and activation gates of potassium open at the site of origin of
depolarization. As a result the influx of Na+ ions into the axoplasm from the

106
 Human Anatomy
and Physiology - III

ECF is checked and ‘efflux’ of K+ions occurs, which leads to the returning of
axolemma to the resting state (exit of potassium ions causes a reversal of
membrane potential to negative inside). This is called ‘repolarization’.

Hyperpolarization (Undershoot)
The repolarization typically goes more negative than the resting potential to
about -90 mV. This is called ‘hyperpolarization’. This occurs because of the
increased K+ permeability that exists while voltage-gated K+ channels are
open (K voltage gates close rather slowly and are said to be ‘lazy’ gates),
activation and inactivation gates of Na + channels remain closed. The
membrane potential returns to its original resting state as the K+ channels
close completely. As the voltage falls below the -70mV level of the resting
state, it is called ‘undershoot’

5. Hyperpolarization

Figure 3.18 Nerve Impulse

107
 Zoology

The various types of responses of voltage gated sodium and potassium

channels to depolarization.
Channel type of resting depolarisation repolarisation hyperpol- speed of
gate state arisation response
SODIUM ACTIVATION CLOSED OPENS OPENS CLOSES FAST
SODIUM INACTIVATION OPENS OPENS CLOSES CLOSES SLOW
POTASSIUM ACTIVATION CLOSED CLOSED OPENS OPENS SLOW

The Refractory Periods

The period of time after an action potential begins during which the neuron
cannot generate another action potential in response to a normal threshold
stimulus is called the ‘refractory period’. There are two kinds of refractory
periods, namely absolute refractory period and relative refractory period.
During the absolute refractory period, even a very strong stimulus cannot
initiate a second action potential. This period coincides with the periods of
depolarization and repolarization. The relative refractory period is the time
during which a second action potential can be initiated by a larger- than -
normal stimulus. It coincides with the period of hyperpolarization.

Conduction speed
The conduction speed of a nerve impulse depends on the diameter of the
axon: the greater the axon’s diameter, the faster is the conduction. In a
myelinated axon, the voltage-gated Na+ and K+ channels are concentrated at
the nodes of Ranvier. As a result the impulse ‘jumps’ from one Ranvier’s
node to the next, rather than traveling the entire length of the nerve fibre.
This mechanism of conduction is called Saltatory conduction. Saltatory
conduction is faster (in myelinated fibres) than the continuous conduction
(in nonmyelinated fibres).

3.6.1 Synaptic Transmission

A nerve impulse is transmitted from one neuron to another through junctions
called synapses. A synapse is formed by the membranes of a pre-synaptic
neuron and a post-synaptic neuron, which may or may not be separated by a
gap called synaptic cleft. There are two types of synapses, namely, electrical
synapses and chemical synapses. At electrical synapses, the membranes of
pre- and post -synaptic neurons are in very close proximity compared to
chemical synapses. These electrical synapses are electrically conductive links
between two neurons and are also called ‘gap junctions’. Impulse transmission
across an electrical synapse is always faster than that across a chemical
synapse and they are in some cases bidirectional conductions.

108
 Human Anatomy
and Physiology - III

At a chemical synapse, the

membranes of the pre- and
post-synaptic neurons are
separated by a fluid-filled
space called synaptic cleft
(a structural gap and a
functional bridge).
Chemicals called
neurotransmitters are
involved in the transmission
of impulses at these
synapses. The axon
terminals (boutons) contain
vesicles filled with these
neurotransmitters. When an
impulse (action potential)
Figure 3.19 Synaptic Transmission
arrives at the axon terminal,
it depolarizes the membrane
opening voltage gated calcium channels. Calcium ions stimulate the
movement of the synaptic vesicles towards the membrane where they fuse
with the plasma membrane and release their neurotransmitters in the
synaptic cleft by exocytosis. The released neurotransmitters bind to their
specific receptors, present on the post-synaptic membrane. Acetyl choline
is the most common neurotransmitter. Epinephrine, norepinephrine,
dopamine, serotonin etc. are either excitatory or inhibitory
neurotransmitters. Glycine, GABA (Gamma Amino Butyric Acid) are inhibitory
neurotransmitters. The post synaptic membrane has ligand gated channels.
They are ion channels which respond to chemical signals (ligands), rather
than to changes in the membrane potential). The entry of ions can generate
a new potential in the post-synaptic neuron. The new potential developed
may be either excitatory or inhibitory. Excitatory post synaptic potentials
(EPSPs) cause depolarization, whereas inhibitory post synaptic potentials
(IPSPs) cause hyperpolarisation of post synaptic membrane. Post synaptic
potentials are graded potentials and ‘summation’ of these potentials occurs
at the ‘axon hillocks’. Summation of inputs from many presynaptic
membranes is called ‘spatial summation’, whereas summation of successive
inputs from a single presynaptic membrane is called ‘temporal summation’.
Development of an action potential depends on which ever is more? - The
sum of excitatory post synaptic potentials or the sum of inhibitory
postsynaptic potentials.

109
 Zoology

3.7 Reflex Action and Reflex Arc

An automatic, involuntary, instantaneous and unconscious action brought
about by the involvement of the central nervous system is called a reflex
action. The reflex action is mediated by the ‘neuronal components’, which
constitute the ‘reflex arc’. A reflex arc is the ‘route’ followed by a nerve
impulse in the production of a reflex action (the neural pathway involved in
a reflex action). The neural (reflex) pathway comprises at least one afferent
neuron (receptor), one internuncial neuron and one efferent (effector or excitor)
neuron arranged in series. The afferent neuron receives signal from a sense
organ and transmits the impulse via the dorsal root of a spinal nerve to the
CNS (at the level of the spinal cord). The efferent neuron then carries signals
from the CNS to the effector through the ventral root of the spinal nerve. The
stimulus and response thus forms a reflex action as shown in the diagram
showing knee jerk reflex.

Figure 3.20 Reflex arc

3.8 Sensory Reception and Processing

In the human body the different types of receptors detect all types of changes
in the environment and send appropriate signals to the CNS, where all the
inputs are processed and analysed. Then the different controlling centres of
the brain send ‘motor impulses’ to the ‘effectors’ through motor nerves. This
is how you can sense changes in the environment. In the following sections,
you will be introduced to some of the important receptors of human body.

110
 Human Anatomy
and Physiology - III

1) Exteroceptors: They are located at or near the surface of the body,

and sensitive to external stimuli like hearing, vision, touch, taste and
pain etc.
2) Interoceptors (visceroceptors): They are located in the visceral organs
and blood vessels and sensitive to internal stimuli.
3) Proprioceptors: They are also a kind of interoceptors and they provide
information about body position and movement and are located in
muscles, tendons, joints and the internal ear.
4) Thermoreceptors: They respond to heat (caloreceptors) and cold
(frigidoreceptors).

3.8.1 The Eye

The eye is the organ
of vision which is
located in the orbit of
the skull. Eye
consists of accessory
structures and the
eye ball.

Accessory
structures of eye
Eye lids, eye lashes,
eye brows, lacrimal
appartus and
extrinsic eye muscles
are the accessory Figure 3.21 Diagram showing parts of eye
structures of eye. The
eye lids, the eye lashes and the eye brows are useful for the protection of the
eye. The lacrimal apparatus is a group of structures that produce and drain
lacrimal fluid or tears which contains salts, mucus and bactericidal enzyme
called lysozyme. There are six extrinsic (extra ocular) eye muscles present
attached to the human eye, namely superior, inferior, lateral, medial rectus
muscles, and superior oblique and inferior oblique muscles. These muscles
aid in the movement of the eye and they receive their innervations from the
III, IV and VI cranial nerves.
The eye ball
Anatomically, the wall of the eye ball can be divided into three layers: fibrous
tunic, vascular tunic , nervous tunic (retina). It also has a lens which is
held in position by suspensory ligaments.

111
 Zoology

Fibrous tunic
It is the outer coat of the eye ball consisting of the anterior cornea (acts as a
sort of ‘fixed lens’) and the posterior sclera. The cornea is a non-vascular,
transparent coat that covers the coloured iris. Cornea is covered by a thin
layer called conjunctiva. The sclera, ‘white’ of the eye, is a coat that covers
the entire eye ball. The sclera gives shape to the eye ball, makes it more
rigid, and protects its inner parts. At the junction of the sclera and cornea is
a channel known as the scleral venous sinus or canal of Schlemm.
Vascular tunic
The vascular tunic or uvea is the middle layer of the eye ball. It has three
portions: choroid, ciliary body and iris. The choroid is highly vascularised
and looks bluish in colour. It is thick in the anterior part to form the ciliary
body. The ciliary body is a pigmented and vascularized part that consists of
the ciliary processes. The muscle associated with the ciliary body is a
circular band of smooth muscle that holds and alters the shape of the lens
for near or far vision (eye accommodation power- the process by which
the eye changes optical power to focus on an object as its distance varies).
The iris is the coloured portion of the eyeball. It is suspended between the
cornea and the lens and is attached at its outer margin to the ciliary processes.
The aperture in the centre of the iris is called pupil. The principal function
of the iris is to regulate the amount of light entering the vitreous chamber
of the eye ball through the pupil. The diameter of the pupil is regulated by
the muscles of the iris.

Retina (Nervous tunic)

This is the third and inner coat of the eye. It consists of a pigmented
epithelium (non-visual portion) and a neural portion (visual portion). The
pigmented epithelium is a sheet of melanin - containing epithelial cells that
lie between the choroid and the neural portion of the retina. The neural
portion of the retina has three layers of retinal neurons namely:
photoreceptor layer (the layer closest to the choroid coat), bipolar cell
layer and ganglion cell layer.
NOTE: Light must pass through ganglion layer, bipolar cells to reach the
photo receptor cones and rods. Ganglion cells are the only cells of the
retina capable of sending ‘action potentials ‘ to the brain .
Photoreceptor layer consists of two types of photoreceptor cells called rods
and cones. Rods contain a purplish-red protein called the rhodopsin or
visual purple, which is formed by the reversible combination of the protein
opsin and a light absorbing molecule called ‘retinal’ derivation from

112
 Human Anatomy
and Physiology - III

Pigment Epithelium
(Back of the eye)
Rod
Cone

Photoreceptor layer

Bipolar cell
Bipolar cell layer

Ganglion cell Ganglion cell layer

Light (falling on
retina)

Figure 3.22 Microscopic structure of the retina

Vitamin A. Rods are important in twilight (scotopic vision- the vision of the
eye under low light conditions). Cones contain a visual pigment called iodopsin
and they are important in daylight (photopic) vision and colour vision.
There are three types of cones, each having different sensitivity (difference
in light absorption pattern) and they provide ‘optimal response’ to red, green
and blue colours. Equal stimulation of all the cones produces a sensation of
white colour (trichromacy theory).
The centre of the posterior portion of the retina is called the macula lutea or
yellow spot. A small depression present in the centre of the yellow spot is
called fovea centralis, and it contains only cones. Fovea is responsible for
sharp, central vision, which is useful while walking, reading, driving etc.
The axons of the ganglion cells extend posteriorly and exit the eye ball as the
optic nerve. The site of the retina where the optic nerve exits the eye ball is
called optic disc or blind spot which is devoid of photoreceptor cells (no
image is formed at that spot).
Why does the sales person in a cloth store switch on all the lights, when we
go in, to purchase clothes?

113
 Zoology

Lens
A non-vascular and transparent lens is present within the cavity of the eye
ball just posterior to the pupil and iris. The lens is held in position by encircling
suspensory ligaments. Ciliary muscles control the shape of the lens helping
focusing light on the retina.

Chambers of the eye’s interior

The interior space of the eye ball is divided by the lens into anterior and
posterior chambers. The anterior chamber is filled with aqueous humor
(secreted by ciliary processes), which helps in nourishing the lens and the
cornea. The posterior cavity lies between the lens and the retina and contains
a jelly like substance called vitreous body / vitreous humor. The vitreous
body contributes to the intraocular pressure along with aqueous humor
and helps to protect the shape of the eye ball.

Mechanism of Vision
The light rays of visible wave length focused on the retina through the cornea
and lens generate potentials (impulses) in rods and cones. As mentioned
earlier, the photosensitive compounds (photo pigments) in the human eyes
are composed of opsin (a protein) and retinal. Light induces dissociation of
the retinal from opsin resulting in changes in the structure of the opsin.
This causes changes in membrane permeability. As a result action potentials
develop. These action potentials (impulses) are transmitted by the optic nerve
to the visual cortex area of the brain (occipital lobes of the cerebrum), where
the neural impulses are analyzed.

3.8.2 The Ear (The stato - acoustic receptor)

The ear is the site of reception of two senses, namely hearing and equilibrium.
Anatomically, the ear is divided into three principal regions: the external
ear, the middle ear and the internal ear.
External ear (outer ear)
The outer ear consists of the pinna(auricle), external auditory
meatus(external auditory canal) and ear drum. The auricle is a flap of elastic
cartilage covered by skin. It collects vibrations in the air that produce sound.
The external auditory meatus is a curved tube that leads inwards and extends
upto the tympanic membrane (the ear drum), which is a thin, semi
transparent partition between the external auditory canal and middle ear.
The tympanic membrane is composed of connective tissues covered with
skin outside and with mucus membrane inside. There are very fine hairs
and ear’s wax secreting ‘sebaceous glands’ called ceruminous glands in the

114
 Human Anatomy
and Physiology - III

skin of the pinna and the meatus. Semi circular canals

The combination of hair and
cerumen (ear’s wax) helps to
Ampulla
prevent dust and foreign particles
from entering the ear.
The middle ear Utricle
The middle ear (tympanic cavity) Saccule
is a small, air - filled cavity in the
temporal bone. It is separated from
the external ear by the eardrum
and from the internal ear by a thin
bony partition that contains two
small membrane - covered openings
Round window
called the oval window (fenestra
Figure 3.23 Diagram showing parts of ear
ovalis) and the round window
(fenestra rotunda). The middle ear
contains three ossicles called malleus (hammer bone), incus (anvil bone)
and stapes (stirrup bone) which are attached to one another in a chain-like
fashion. The malleus is attached to the tympanic membrane and its head
articulates with the incus. The incus is the intermediate bone in the series
of ‘ear ossicles’ and articulates with the head of the stapes. The stapes is
attached to the oval window in the thin bony partition between the middle
and inner ear. The ear ossicles transmit sound waves to the inner ear. A
Eustachian tube connects the middle ear cavity with the pharynx. The
Eustachian tube helps in equalising the pressures of air on either sides of
the ear drum.
Inner ear
The fluid-filled inner ear called labyrinth consists of two parts, the bony
and the membranous labyrinths. The bony labyrinth is a series of channels
which can be divided into three areas: 1) cochlea, 2) vestibule, and 3)
semicircular canals. The cochlea is a coiled (watch spring like) portion of
the labyrinth. Infact the cochlea is ‘three tubes in one’. The three tubes are
namely scala vestibuli, scala media (cochlear duct) and scala tympani.
The scala vestibuli and scala media are separated by a membrane called
Reissner’s membrane, the scala media and scala tympani are separated by
another membrane called basilar membrane. Scala vestibuli and scala
tympani are filled with perilymph. However the scala media is filled with
endolymph. At the base of the cochlea, the scala vestibuli ends at the ‘oval
window’, while the scala tympani terminates at the ‘round window’ which
leads to the middle ear. The cochlear epithelium forms a sensory ridge called

115
 Zoology

“organ of Corti” on basilar

membrane. The organ of
Corti contains ‘hair cells’
that act as ‘auditory
receptors’. The hair cells are
present in rows on the
internal side of the organ of
Corti. These cells are
innervated by the nerve
fibres of the cochlear
branch of the VIII cranial
nerve. The basal end of the
hair cell is in close contact
with the auditory nerve
fibres. A large number of
processes called stereocilia
Figure 3.24 Section of Cochlea
are projected from the
apical part of each hair cell.
Above the rows of the hair cells is a thin elastic membrane called tectorial
membrane.
There are three semicircular canals, each one lies approximately at right
angles to the other two. The base of each canal is swollen and is
called ampulla, which contains a projecting ridge called crista (which has
‘hair cells’). The semicircular canals provide a sense of ‘angular acceleration
’ perceiving ‘rotation’ of the body (direction of body movement or turning of
head to sides). The vestibule is the oval central part of the bony labyrinth
located between the cochlea and the semicircular canals. The membranous
labyrinth in the vestibule consists of two sacs called the saccule and
the utricle (collectively called the otolith organ). The saccule and the utricle
contain a projecting ridge called macula. It has receptors for gravity .Saccule
and utricle provide a sense of ‘linear acceleration’. The saccule perceives
vertical movement (as when you are going in a lift –moving upwards or
downwards). The utricle perceives horizontal movement (as when you are
going in a car – moving forwards or backwards).
The semi-circular canals and the otolith organ together constitute the
“vestibular apparatus”. The semi-circular canals, the saccule and the utricle
are innervated by the vestibular branch of VIII cranial nerve. This vestibular
apparatus is concerned with equilibrium (maintenance of balance of the body
and posture).Vestibular branch of the auditory nerve carries these impulses
to the brain.

116
 Human Anatomy
and Physiology - III

Mechanism of Hearing
The external ear receives sound waves and directs them to the ear drum.
The ear drum vibrates in response to the sound waves and these vibrations
are transmitted through the ear ossicles to the oval window. The vibrations
are passed through the oval window on to the fluid of the cochlea, where
they generate waves in the peri and endolymphs. These waves induce a
ripple in the basilar membrane. These movements of the basilar membrane
press the hair like process of the hair cells against the tectorial membrane.
As a result, nerve impulses are generated in the associated afferent neurons.
These impulses are transmitted by the afferent fibres via the auditory nerves
to the auditory cortex of the brain, where the impulses are analyzed and the
sound is recognized.

Disorders of Human Neural system

1. Alzheimer’s disease (AD): It is the most common form of dementia
(Senile Dementia of the Alzheimer Type) in people above 65 years of age.
It is a progressive neurologic disease of the brain, leading to the loss of
neurons and the loss of intellectual abilities, including memory. It worsens
with age and eventually it leads to death.
2.Meningitis: It is the inflammation of the protective membranes
(meninges) covering the brain and the spinal cord. The inflammation may
be caused by infection with viruses, bacteria and rarely by certain drugs.
3.Parkinson’s disease: It is a progressive disorder of a certain region in
the brain. It affects movements producing motor symptoms, which include
autonomic dysfunction, neuropsychiatric problems, and sleep difficulties,
and uncontrolled movements of other body parts.
4.Stroke or Cerebro-Vascular Accident (CVA): It is the rapid loss of
brain functions due to disturbance in the blood supply to the brain. This
can be due to ischemia (reduced blood flow) caused by partial blockage,
or hemorrhage. As a result, the affected area of the brain cannot function,
and it might cause inability to move one or more limbs on one side of the
body, and the inability to understand or speak.

117
 Zoology

GLOSSARY
Adrenergic nerve fibres : Nerve Gyrus: The elevated portion of
fibres that release adrenaline the cerebral surface.
at their terminal ends. Hippocampus: It is a part of the
Amygdala: The part of the cerebral hemisphere in the
telencephalon, located in the basal medial part of the
temporal lobe. It is involved in temporal lobe. This part of the
memory, emotion, and fear, brain is important for learning
essentially acting as the and for converting short term
‘brain’s warning center’. This memory to permanent (long-
is a component of the limbic term) memory.
system. Iris: It is a shelf-like diaphragm
Brain stem: The region of the of choroid of the eye. It works-
brain that consists of the like a diaphragm of a
midbrain, pons and medulla; photographic camera.
responsible for the functions Limbic system: A group of
such as breathing, heart beat structures including the
and blood pressure. amygdala and hippocampus
Blind spot: The place of retina (and others); important for
which has no photoreceptors. controlling emotions and
Cochlea: A spirally coiled part of memory.
the internal ear in which the Neurotransmitter: A chemical
organ of Corti is present. substance which is released by
Corpus callosum: The large the presynaptic neurons at
bundle of axons which connects synapses that transmits
the two cerebral hemispheres. information to the next
It disseminates the information neurons.
from the cerebral cortex on one Organ of Corti: The hearing
side of the brain to the same apparatus that is present in
region on the other side; it is the ‘middle canal’ of the
the system that helps cochlea.
communication between the Sulcus: The depression between
right and left cerebral cortices. gyri of the cerebrum.

118
 Human Anatomy
and Physiology - III

QUESTIONS
3. Give an account of the retina
Very Short Answer Type Questions
of the human eye.
1. Name the cranial meninges 4. Give an account of synaptic
covering the brain of man transmission.
2. What is corpus callosum? 5. List out the differences
3. What do you know about between sympathetic and
arbor vitae? parasympathetic neural
systems in man.
4. Why the sympathetic division
is called thoraco-lumbar
Long Answer Type Questions
division?
5. Why the parasympathetic 1. Give a brief account of the
division is called cranio- structure and functions of
sacral division? the brain of man.
6. Distinguish between the 2. Explain the transmission of
absolute and relative nerve impulse through a
refractory periods. nerve fibre with the help of
7. How do rods and cones of suitable diagrams.
human eye differ from each
other chemically and
functionally?
8. Distinguish between the
blind spot and the yellow
spot.
9. What is organ of Corti?

Short Answer Type Questions

1. Draw a labelled diagram of

the T.S of the spinal cord of
man.
2. Describe sympathetic
nervous system.

119
 Zoology

FOR IGNITED
MINDS
The integrating network of
the ‘Ultimate Biocomputer’

Neural control and Coordination

1. Why does a person who gets a hard hit on the back of the upper neck region
die almost instantaneously ?
2. What happens if the corpus callosum of the cerebrum is severed/cut ?
3. Which component of the nervous system brings a ‘Fight or Flight Response’
in human body ?
4. If you are reading your news paper,sipping your coffee, quietly, what part of
your nervous system is perhaps actively working /dominating?
5. If you think of a lemon, most probably you will notice salivation in your oral
cavity. What do you call this type of response in your body with reference to
your nervous system’s functioning, if you are asked to give your answer in
just ‘two words’?
6. When a clinical investigator pricks your finger for a sample of a drop of blood,
if the prick continues to give you pain for some time, it is due to successive
‘action potentials’ from the same region, causing you the pain. What do you
call this in terms of development and conduction of action potentials?
7. If a person suffers from ‘hyperacidity‘, do you think cutting the branch of the
pneumogastric nerve to the stomach will help him reduce hyperacidity? If so
what is the reason you can offer?
8. If you, hypothetically, introduce some gamma amino butyric acid in a synapse,
what will happen in the succeeding neuron’s membrane potential, if it is
already in a normal, polarized state by that time.
9. If the room in which you are sitting is relatively hot and humid, which part of
your CNS will show a neural response to take care of your problem to the
extent possible to it?

n
10. If the ‘inactivation gates of sodium’ are closed and ‘potassium voltage gated
channels’ are open, in what phase is the ‘action potential’ in your body?
– Rising, Falling or Undershoot?

120
 Unit-IV
HUMAN ANA TOMY AND
NAT
Arnold Adolph
Berthold
PHYSIOL
HYSIOLOG
SIOLOGY - IV
OGY

Hormones - The Biochemical ‘Integrators’

Hormones are mostly the body’s long distance signaling substances. They
are released by the endocrine glands (ductless glands with the exception of
pancreas which is a ‘dual gland’). Endocrine secretions are released into
circulating fluids and they have a role in the body’s ‘homeostasis’. In higher
animals we come across various types of cytokines which are also ‘local regulators’
(dealt with in the lesson on immunity). Hormones such as vasopressin, oxytocin
are secreted by parts of the central nervous system and reach target cells via
the circulatory fluids. Many animals (e.g. insects) are known to produce regulatory
molecules called pheromones which are released to the exterior. They help in
chemo-communication. Some hormones in our body are produced from cholesterol
(by some enzymatic modifications). Water soluble hormones cannot pass through
plasma membrane. They show their action by stimulating certain cell surface
receptors. The lipid soluble hormones can pass through the plasma membrane
and bind to some receptors in the cytoplasm. These complexes can pass into
the nucleus of the cell and cause their effect on the DNA.
Certain hormones which stimulate the production of other hormones in other
parts of the body are called “Tropic hormones”, e.g. Adrenocorticotropic hormone
(ACTH) stimulates some of the cells of the adrenal cortex.
 Zoology

UNIT IV A
Endocrine System and
Chemical Co-ordination
4.1 Human endocrine system
4.2 Mechanism of Hormonal action
4.3 Human hormonal disorders

INTRODUCTION
All functions in the human body are coordinated and regulated in order to
maintain homeostatic state in the body. You have already learnt that the
neural system provides a point-to-point rapid coordination among organs,
which is rather short lived compared to the ‘chemical coordinating’ system.
As the nerve fibers do not innervate all the cells of the body and the cellular
functions need to be continuously regulated, a special kind of coordination
and integration has to be provided. This function is performed by the endocrine
glands through their secretions called ‘hormones’. The endocrine system
regulates the functions that do not require instantaneous response and the
effects persist for a relatively longer period. It is believed that the neural and
endocrine systems originated and developed side by side, as the needs of
communication became more complex due to the increased complexity in
body organization, particularly in mammals. The principal role of both the
systems is the coordination and control of many of the major physiological
activities.
Endocrine (Greek: endo = inner; crine = away) system consists of discrete
tissues or organs called endocrine glands and their secretions. These glands
do not possess ducts to carry their secretions out, hence called ductless
glands. The secretions of these glands namely hormones, released directly

122
 Human Anatomy
and Physiology - IV

into the blood stream or lymph, are circulated in the body to reach their
target cells / tissues / organs.
As per one of the current scientific definitions, ‘hormones are non-nutrient
chemicals which act as intercellular messengers and are produced in
trace amounts’. The new definition covers a number of new molecules in
addition to the hormones secreted by the organised endocrine glands.

Hormones
The term hormone (hormone = to excite) was coined by Starling. Secretin
was the first hormone to be detected. Usually, hormones function on targets
away from their production sites except some local hormones such as gastrin,
somatostatin etc. Hormones coordinate, accelerate or inhibit one or more
physiological activities. They are biomolecules of small size and are effective
in very low concentrations. Most of the hormones are highly specific regarding
their ‘targets’ (e.g. TSH, ACTH), but some hormones such as thyroxine and
STH act on nearly all somatic cells. Hyper or hypo secretion of any hormone
produces certain disorders. Hormones are short lived and they are degraded
by tissues and excreted through bile (by the liver) and urine (by the kidneys).

Chemically hormones fall into three classes

They are as follows:
1. Amine hormones which are derivatives of a single amino acid. The
examples for this class are : a) catecholamines (epinephrine and nor-
epinephrine) and thyroxine, as derivatives of ‘tyrosine’ and b) melatonin,
a derivative of ‘tryptophan’.
2. Peptide and protein hormones are polymers of amino acids. Small
peptide hormones (3 to 49 amino acids) include ADH, oxytocin etc. The
peptides that are formed by numerous amino acids (50 to 200) are
referred to as protein hormones and the examples include the hormones
of the anterior pituitary, pancreas, parathyroids etc. The more complex
protein hormones, with carbohydrate side chains, namely glyco-proteins
include FSH, TSH, LH etc.
3. Steroid hormones, the derivatives of cholesterol, include hormones
such as aldosterone, testosterone, estrogens and progesterone. The widely
studied prostaglandins are derivatives of eicosanoids (a large group of
molecules derived from the ‘essential fatty acids’ such as the omega-3
and omega-6 fatty acids).

123
 Zoology

Some higher invertebrates possess very simple endocrine system that

produces a few hormones, whereas a well developed endocrine system that
produces a large number of hormones occurs in the vertebrates. The human
endocrine system is described here.

4.1 Human Endocrine System

The endocrine glands of
human beings are well
studied than those of any
Hypothalamus Pineal body
Pineal other animal because of their
Pituitary role in the maintenance of
human health. The endocrine
Thyroid and glands and the hormone
Parathyroid producing diffused tissues /
cells located in different parts
Thymus
of the human body constitute
the endocrine system. The
organized endocrine tissues /
organs in the human body
Pancreas include pituitary, pineal,
Adrenal
Adrenal gland thyroid, parathyroid,
adrenal, pancreas, thymus
and gonads (testes and
ovaries). Besides these, some
other non-endocrine organs
Ovary
Ovaries Testis
Testes such as gastrointestinal tract,
(in female)
(in male)
(in male) liver, kidney, and heart also
produce hormones. A brief
account of the structure and
Figure 4.1 Location of endocrine glands functions of all the major
endocrine glands and
hypothalamus is given below.

124
 Human Anatomy
and Physiology - IV

4.1.1 Hypothalamus
(Greek: Hypo = under; Thalamus
= chamber) Hypothalamus
The hypothalamus is located below the Hypothalamic
thalamus, constituting the floor of the neurons

diencephalon, a part of the fore brain. It

connects the neural and endocrine
systems as it is closely tied to the pituitary
gland. It responds to the sensory impulses
received from different receptors by
sending out appropriate neural or
endocrine signals. Infundibulum
Portal circulation
It regulates a wide range of body functions.
Hypothalamo-
It contains several groups of hypophyseal tract
neurosecretory cells called ‘nuclei’ which Posterior
produce hormones called neuro-hormones. pituitary
They are transported to the
neurohypophysis through the axons of the
Anterior
hypothalamo-hypophysial tract. The two pituitary
other types of hormones produced by the
Figure 4.2 Pituitary gland and
hypothalamus are 1) the releasing hypothalamus
hormones (which stimulate secretion of
pituitary hormones), and 2) the inhibiting
hormones (which inhibit secretions of pituitary hormones).

NOTE: The hypothalamus is the ‘Master Control Centre’ of the endocrine

system, as its secretions directly control the pituitary gland which in
turn secretes hormones that regulate the growth and functioning of
other endocrine glands.
For example, a hypothalamic hormone called growth hormone releasing
hormone (GHRH/Somatocrinin) stimulates the synthesis and release of
Somatotropin (growth hormone) by the pituitary. On the contrary the growth
hormone-inhibiting hormone (GHIH) or somatostatin from the hypothalamus
inhibits the release of growth hormone from the pituitary. These hormones
originating in the hypothalamic neurons pass through axons and are released
from their nerve endings. They reach the anterior pituitary through a portal
circulatory system called hypophysial portal system and regulate the
functions of the anterior pituitary. The posterior pituitary is under the direct
neural regulation of the hypothalamus.

125
 Zoology

4.1.2 Pituitary Gland

The pituitary gland, also called ‘hypophysis’, is a small unpaired round body.
It is located immediately beneath the hypothalamus, attached to it by a
stalk, called the infundibulum. It lies in a bony depression called sella turcica
of the sphenoid bone. It is divided anatomically into anterior pituitary
(parsdistalis) or adenohypophysis and posterior pituitary or
neurohypophysis. Between these two is a small zone called the pars
intermedia, which is considered a part of the anterior pituitary in man, as
it is almost fused with the anterior lobe.

Origin of the pituitary

Embryologically the two portions of the pituitary have their origins from two
different sources (dual origin). The anterior pituitary (adenohypophysis)
develops from the Rathke’s pouch which is an embryonic outgrowth from
the roof of the oral region. It is the major secretory part of the pituitary. An
outgrowth from the floor of the hypothalamus gives rise to the infundibular
process which becomes the neurohypophysis.
Anterior pituitary / Adenohypophysis
The anterior pituitary produces six important protein hormones. The hormones
of the anterior pituitary play major roles in the control of metabolic functions
throughout the body.
1. Growth Hormone (GH): It is also called somatotropin. It stimulates
mostly the cells of the liver to produce insulin-like growth factors
(IGFs).They stimulate cell division in the epiphyseal plates leading to
‘elongation of bones’. They also promote growth of the entire body by
accelerating protein synthesis, cell division and cell differentiation. They
also decrease the catabolism of proteins.
2. Prolactin: It is also called lactogenic hormone / luteotropic hormone
(LTH): It causes enlargement of the mammary glands of the breasts
and prepare them for the production of milk. In women the major action
of prolactin is to initiate and sustain lactation. Prolactin also helps in
maintaining the corpus luteum of the ovary, which is the source of a
natural female sex hormone progesterone, and thus it helps to sustain
pregnancy.
3. Thyroid Stimulating Hormone (TSH) / (Thyrotropin): It stimulates
the synthesis and secretions of thyroid hormones from the thyroid gland.
4. Adrenocorticotropic Hormone / Corticotropin (ACTH): Controls the
synthesis and secretion of steroid hormones called glucocorticoids,
mineralocorticoids and sex corticoids by the adrenal cortex.

126
 Human Anatomy
and Physiology - IV

5. Follicle Stimulating Hormone (FSH): It stimulates growth and

development of the ovarian follicles in females. In males FSH, along
with the androgens, regulates spermatogenesis.
6. Luteinizing hormone (LH): In males it stimulates the interstitial cells
of Leydig of the testes for the synthesis and secretion of hormones
called androgens (‘testosterone’ is the chief androgen). In females, this
hormone stimulates ‘ovulation’ from the fully mature Graafian follicles.
Besides this, it stimulates the ovaries to produce ‘estrogens’ and
progesterone. It maintains the corpus luteum formed from the remnants
of the Graafian follicles, after ovulation.
NOTE: The two hormones of the anterior pituitary, namely FSH and LH are
called ‘gonadotropins’ because they stimulate the gonads to produce other
hormones.
Pars intermedia secretes only one hormone called melanocyte stimulating
hormone (MSH). In human beings, pars intermedia is almost merged with
pars distalis and the role of MSH is not significant, excepting that it can
darken the hair by increasing deposition of melanin in the developing hair
shaft. MSH regulates pigmentation in the melanocytes of the lower vertebrates
and its role in man is not significant.

Anterior
pituitary

Posterior
pituitary
FSH
Vasopress
in
GH

Ovary Kidney
Ox
yt
oc
SH

tin

in
Ox
/IC

lac

TS

yt
ACTH
L.H

Pro

oc
H

in

Bones & Uterus

muscles
Ovaries
testes
Mammary Thyroid Mammary
Adrenal
gland gland
gland

Figure 4.3 Hormones secreted by pituitary gland and their target organs

127
 Zoology

Posterior pituitary / Neurohypophysis: It stores and releases two hormones

called oxytocin and vasopressin /ADH, which are actually synthesized by
the hypothalamus and are called neuro-secretions. They are small chain
peptides. Oxytocin works on the smooth muscles of the body and induces
their contraction. In a female it stimulates powerful contractions of the uterus
during child birth and ejection of milk from the mammary glands.
Vasopressin affects the kidney and stimulates reabsorption of water and
electrolytes by the DCT and the collecting duct from the nephric filtrate.
Thus urine becomes more concentrated and diuresis (increased excretion of
the urine) is prevented. Hence, it is also called ‘anti-diuretic hormone’ (ADH).
4.1.3 Pineal Gland
The pineal gland or epiphysis cerebri is located on the dorsal surface of the
diencephalon. The pineal gland secretes a hormone called melatonin. It
plays a very important role in the regulation of 24 hour (diurnal / circadian)
rhythms of our body. For instance, it helps in maintaining the normal rhythms
of the sleep-wake cycle, body temperature etc. Besides this, melatonin
influences metabolism, pigmentation, menstrual cycle and defence capability
of our body. In some animals it stimulates gonads while in others it inhibits
the gonads.
NOTE: Secretion of melatonin is more in darkness (night time). Recent studies
indicate that the main target of melatonin is the suprachiasmatic nucleus (SCN)
of the hypothalamus which acts as the “Biological clock” in humans.

4.1.4 Thyroid Gland

It is the largest endocrine gland and is endodermal in origin. It lies close to
the body surface, in the neck near the junction of larynx and the trachea.
The thyroid consists of two lobes connected by a thin flap of connective
tissue called isthmus. The lobes lie on either side of the trachea and extend
upwards along the sides of the larynx. The complete thyroid gland somewhat
resembles a butterfly with its wings spread (H shaped).

4.1.4.1 Thyroxine
The thyroid gland is composed of follicles and stromal tissues. Each thyroid
follicle is composed of follicular cells, enclosing a cavity. These follicular
cells produce two major hormones, namely tetra-iodothyronine or thyroxine
(T 4) and tri-iodothyronine (T3). Iodine is necessary for the normal rate of
hormone synthesis in the thyroid. Thyroxine (T4) and Triiodothyronine have
the same endocrine functions.

128
 Human Anatomy
and Physiology - IV

Thyroid hormones (calorigenic hormones) play an

important role in the regulation of the basal
metabolic rate (BMR), the rate of consumption of
oxygen per unit weight of the body, at rest. Thyroid
hormones increase the basal metabolic rate by
stimulating the use of cellular oxygen to produce
ATP. As cells produce and use more ATP, more heat
is given off and the temperature of the body rises.
In this way, they maintain normal body temperature
of a homeotherm. These hormones stimulate the
process of erythropoiesis. Thyroid hormones control
Figure 4.4 Thyroid gland
the metabolism of carbohydrates, proteins and fats.
Maintenance of water and electrolyte balance is also influenced by thyroid
hormones.

4.1.4.2 Calcitonin
The parafollicular cells also called ‘C’ cells of the thyroid produce a polypeptide
hormone called Thyrocalcitonin (TCT). It plays an important role in maintaining
proper levels of calcium (Ca2+) and phosphates in the blood. It decreases blood
calcium by promoting deposition of calcium in bones and thus it counters the
effect of parathormone. Higher calcium content in the plasma stimulates the
secretion of calcitonin (negative feedback control mechanism).

4.1.5 Parathyroid Glands

In humans there are four parathyroid glands,
located on the back side of the thyroid gland. Each
lobe of thyroid has one pair of parathyroids, of
endodermal origin. The parathyroid glands secrete
a hormone called parathyroid hormone (PTH) /
parathormone. The secretion of PTH is controlled
by the levels of Ca2+ in the circulatory fluids. This
hormone augments the Ca2+ levels in the blood.
Thus it is a hypercalcemic hormone. It
stimulates the process of bone resorption
(dissolution/demineralization of the bone) by
stimulating the osteoclasts to dissolve calcium
phosphate of the matrix of bones releasing calcium Figure 4.5 Parathyroid glands
into blood. PTH also stimulates reabsorption of
calcium ions by renal tubules and increases the absorption of Ca2+ from the
gut. Together with thyrocalcitonin (TCT), it plays a significant role in calcium

129
 Zoology

balance in the body. It promotes the activation of vitamin D into its active
form, the ‘hormone’ called ‘calcitriol’.
NOTE: Vitamin D (calciferol) is actually an inactive form of a hormone, the
calcitriol. Parathyroid hormone is indirectly involved in the absorption of
calcium from the intestine by promoting formation of Calcitriol / 1,25-
dihydroxy vitamin D. Calcitriol increases blood calcium levels (Ca2+) by
promoting absorption of calcium from the gastrointestinal tract.

Thymus Gland
The thymus gland is a lobular structure located just above the heart and
the aorta, underneath the ‘breast bone’. This gland plays a significant
role in strengthening the immune system. It secretes peptide hormones
called thymosins. Thymosins play a major role in the differentiation of T-
lymphocytes, which provide cell-mediated immunity. In addition,
thymosins also promote the production of antibodies to provide humoral
immunity.

NOTE: Thymus is small at birth. It increases in size during childhood and

reaches its maximum size at the age of ‘puberty’. During adulthood, it
shrinks to its size at birth. In old persons, thymus gland is degenerated,
resulting in a decreased production of thymosin. Thus immune response of
old people becomes weak, which is often said to be the cause of the process
of ageing.

4.1.6 Adrenal Glands

One pair of adrenal glands is present in the body of a human being, located
one at the anterior part of each kidney. It is
also called suprarenal gland. Adrenal gland
is composed of two types of tissues. The
peripheral tissue is the adrenal cortex
(mesodermal in origin) and the centrally
located tissue is called adrenal medulla
(ectodermal in origin).
a. Adrenal Cortex: Adrenal cortex is the
peripheral tissue of the adrenal gland. It is
differentiated into three zones. The outer
zone is called zona glomerulosa, the middle
Figure 4.6 (a) Adrenal gland at the one is known as zona fasciculata and the
superior border of the kidney inner one, the zona reticularis. The adrenal
(b) Section showing two parts
of the adrenal gland cortex secretes many hormones commonly
called corticoids (steroid hormones).

130
 Human Anatomy
and Physiology - IV

Zona glomerulosa secretes mineralo-corticoids (aldosterone is the chief

mineralo-corticoid). Aldosterone regulates the balance of water and
electrolytes in the body. Aldosterone, whose secretion is stimulated by
‘angiotensin II’ when the blood pressure falls , acts mainly on the renal
tubules and stimulates the reabsorption of Na+ and water from renal
tubules and excretion of K+ and phosphate ions. Thus aldosterone helps
in the maintenance of electrolytes, body fluid volume, osmotic pressure
and blood pressure.

NOTE: Aldosterone not only retains Na but also promotes excretion of

K, which, if accumulated, is harmful. Removal of the adrenal cortex or
diseases that prevent secretion of aldosterone can kill a person.

Zona fasciculata secretes glucocorticoids. They are concerned with the

carbohydrate metabolism. In the body of humans cortisol is the chief
glucocorticoid. The glucocorticoids are ‘life saving’ hormones.
Glucocorticoids stimulate gluconeogenesis, lipolysis and proteolysis. These
corticoids inhibit cellular uptake and utilization of amino acids. Cortisol
(also called hydrocortisone) regulates the cardio-vascular system and the
kidney functions.Glucocorticoids, specially cortisol, generates anti-
inflammatory reactions and suppresses immune responses in the case of
tissue and organ transplants. Cortisol stimulates RBC production. Cortisol
is a “stress combat” hormone.
Zona reticularis synthesize sex hormones. Androgens are the male sex
hormones and testosterone is the chief androgen. It is concerned with the
development of growth of axial, pubic and facial hair during puberty.
b. Adrenal medulla: It secretes two hormones called adrenaline or
epinephrine and noradrenaline or norepinephrine. These are
commonly called catecholamines. These hormones are secreted in
response to stress of any kind and during emergency situations, hence
are called emergency hormones or hormones of fight or flight. These
hormones enhance alertness, dilation of pupils, piloerection (involuntary
erection of hair on skin), sweating, dilation of the bronchioles etc. These
hormones increase the rate of heartbeat, the strength of the contraction
of heart and also increases the rate of respiration. Catecholamines also
stimulate the breakdown of glycogen, lipids and proteins (Glycogenolysis,
gluconeogenesis). Thus the concentration of glucose in the blood
increases.

131
 Zoology

4.1.7 Pancreas
Pancreas is both exocrine and endocrine in function. It is an elongated organ
located posterior to the stomach. The exocrine portions of pancreas are known
as acini. The endocrine portion
of the pancreas is just 1 to 2%
and consists of 1 to 2 million
Acinous
Acini Islets of Langerhans. The two
main types of cells in the Islets
of Langerhans are the  -cells
Alpha cell and  -cells. The  -cells
Delta cell produce the hormone,
Beta cell
glucagon, whereas the -cells
produce insulin. Glucagon is
secreted in response to
hypoglycemia. Its action is
Islet of mainly on the liver cells
Langerhans (hepatocytes) and it stimulates
Figure 4.7 A section of pancreas showing islets of glycogenolysis. This increases
Langerhans and acini the sugar level in the blood
(hyperglycemia). It also
converts amino acids and fatty acids into glucose (gluconeogenesis) which
also increases the level of glucose in the blood. This hormone decreases the
uptake of glucose and its utilization by the cells. Therefore glucagon is a
hyperglycemic hormone.Insulin regulates the normal glucose level in the
blood. It mainly acts on the liver cells and adipocytes and increases the
uptake and utilization of glucose by the body cells. Glucose is taken up by
the hepatocytes, skeletal muscles and adipocytes, thus reducing the level of
glucose in the blood (hypoglycemia). Insulin promotes conversion of glucose
into glycogen (glycogenesis) in the target cells (hypoglycemic hormone).
Both glucagon and insulin maintain the homeostasis of glucose in the blood.
Persistent hyperglycemia leads to a complex disorder called diabetes
mellitus.

4.1.8 Testes
(Male Gonadal Glands)
Testes are the male gonads. Each testis is enclosed in a scrotal sac outside
the abdomen. Testis is a cytogenic organ (an organ which produces cells),
and it produces both sperms and sex hormones. The Leydig cells or
interstitial cells of Leydig , lie in the ‘inter-seminiferous tubule spaces’,
they produce androgens, chiefly the testosterone. Male sex hormones are

132
 Human Anatomy
and Physiology - IV

required for the development, maturation and functioning of the male

accessory sex organs such as epididymis, vas deferens, seminal vesicles,
prostate gland, urethra etc. These hormones control muscular growth, growth
of facial and axillary hair, aggressiveness, low pitch voice (masculine voice)
etc. Androgens stimulate the process of spermatogenesis. Androgens affect
the central neural system, controlling the male sexual behaviour (libido /
sex drive /sexual urge) and also have an effect on protein and carbohydrate
anabolism. Androgens are also called anabolic steroids.

4.1.9 Ovaries
(Female Gonadal Gland)
Ovaries are the female gonadal organs present in the abdominal cavity.
These are cytogenic organs and produce one ovum during each menstrual
cycle. Besides this, ovaries act as endocrine glands too producing the female
hormones chiefly: estrogen and progesterone. Ovarian follicles and stromal
tissues are present in the ovary. The hormone estrogen is produced by the
growing follicles of the ovary. After ovulation, the ruptured follicle becomes a
‘yellow body’ called corpus luteum (which acts as a temporary endocrine
gland) and secretes progesterone. After a few days, in the absence of
pregnancy, the corpus luteum stops functioning and becomes the ‘corpus
albicans’.
Estrogen is responsible for the development and the activity of the female
secondary sex organs, development of the ovarian follicles, high pitch of
voice etc. and the development of the mammary glands. Estrogen also controls
the female sexual behaviour.
Progesterone has an important role in preparing the uterus for the
implantation of the blastocyst in the wall of the uterus. It inhibits contraction
of the uterus. Thus it supports pregnancy. In case of deficiency of this hormone,
pregnancy fails to maintain. It stimulates the formation of alveoli (sac like
structures which store milk) in the mammary glands and secretion of milk.
Hormones of Kidney, Heart, Gastro-intestinal Tract and
Liver
In addition to the endocrine glands, some tissues which are not
fundamentally endocrinous in nature also secrete certain hormones that
perform important functions. Among such non-endocrine tissues /organs,
the kidney, heart and gastrointestinal tract are important
The muscle cells in the atria (atrial myocytes) of the human heart secrete
a peptide hormone of vital importance when the pressure of blood increases.
It is called atrial natriuretic factor / atrial natriuretic peptide (ANF/

133
 Zoology

ANP). This hormone dilates the blood vessels, and lowers the blood pressure
when the blood pressure increases. It decreases renal reabsorption of sodium
which also helps in lowering the blood pressure.
Kidney also produces a hormone called erythropoietin. The juxtaglomerular
cells of the kidneys secrete this hormone, which stimulates erythropoiesis
(formation of RBC). The role of erythropoietin is to control the formation
of red blood cells by regulating the proliferation and differentiation of
erythroid progenitor cells (Proerythorblasts) in the bone marrow.
The mucosa of the gastrointestinal tract has some kinds of cells which
produce five major peptide hormones, helping in the digestion of food.
These hormones include gastrin, secretin, cholecystokinin (CCK),
enterocrinin, gastric inhibitory peptide (GIP) etc.
Gastrin acts on gastric glands and stimulates the secretion of hydrochloric
acid and pepsinogen. Secretin is produced by the duodenal mucosa. It
acts on the exocrine part of the pancreas and stimulate secretion of water
and bicarbonate ions. Cholecystokinin is a ‘polypeptide hormone’ produced
in the duodenum, in response to the presence of fats in the chyme. It
causes contraction of the gallbladder, release of bile, and secretion of
pancreatic digestive enzymes. It relaxes the sphincter of Oddi. It is also
called pancreozymin. Gastric inhibitory peptide inhibits gastric secretion
and motility (inhibits emptying of the stomach).
Many other non-endocrine tissues secrete hormones called ‘growth factors’.
These factors are necessary for the normal growth of tissues and their
repair/ regeneration.

4.2 Mechanism of Hormonal Action

Hormones stimulate or inhibit the target cells’ activities. Hence they are
called regulators. Hormones play a vital role in regulating the functions of
the body.
Hormones produce their effects on target tissue by binding to specific proteins
called hormone receptors located in the target tissues only. Hormone
receptors present on the cell membranes of the target cells are called
membrane bound- receptors and the hormone receptors present inside the
target cells are called intracellular receptors. Hormone receptors are specific,
as each receptor is specific to a certain hormone only. A hormone and its
receptor protein together form a hormone-receptor complex. This hormone-
receptor complex generates biochemical changes in the target cells.

134
 Human Anatomy
and Physiology - IV

Hormones interacting with membrane bound receptors (fixed receptors) do

not enter the target cell, but they generate ‘second messengers’ (e.g. Cyclic
AMP produced from ATP by the action of the enzyme adenylate cyclase/
Adenylyl cyclase). These second messengers regulate cellular metabolism in
the target cells in a cascading action amplifying the final effect. In this way
even a very small quantity of the hormone can cause a series of enzymatic
actions, each step having a multiplicating effect, bringing a powerful cascading
effect.
We can take an example to understand the action of hydrophilic hormone,
such as Epinephrine, which cannot enter a cell. In the liver cells
1) Epinephrine attaches to cell membrane receptor 2) G protein of cell
membrane binds to GTP and activates adenylate cyclase, a membrane
enzyme 3) Activated Adenylate cyclase forms cAMP from ATP 4) cAMP activates
Protein Kinase–A, which activates the enzyme ‘phosphorylase’
5) Phosphorylase ‘phosphorylates’ Glycogen to Glucose-6 -phosphate and
it, in turn produces glucose. Thus the liver cell is able to produce several
molecules of glucose needed to the cell under the action of epinephrine (one
of the fight and flight responses of the body).

(b)
(a)

Figure 4.8 Mechanism of hormonal action (a) Membrane bound - receptor

mechanism (b) Intracellular receptor mechanism

NOTE: The cyclic-AMP (cAMP) is a ‘signalling molecule’. A single hormone

molecule activates hundreds of phosphorylations by causing a series of
‘cascading actions’ initiating with cAMP.
Hormones which interact with intracellular receptors (e.g. steroid hormones,
iodothyronines, etc.) are lipid soluble and they diffuse through the plasma
membrane into the cytoplasm. They bind to certain internal receptors and
the complex enters the nucleus and regulates gene expression. The hormonal

135
 Zoology

mechanism of steroid hormones is called mobile-receptor mechanism (as

the receptors are not fixed in the cell membrane).
Mechanism of action of lipid soluble hormone: Aldosterone is a lipid soluble
hormone which can easily diffuse through the cell membrane. It binds to a
specific receptor in the cytoplasm forming an aldosterone –receptor complex
molecule .This complex molecule enters the nucleus and binds to the DNA and
stimulates the production of a specific mRNA molecule. The mRNA passes into
the cytoplasm and attaches to ribosomes making them produce the specific
protein. These proteins are produced by the cell as a response to aldosterone.
Thus, hormones play a major role in maintaining homeostasis by their
integrated actions and feedback control mechanisms.

4.3. Human hormonal disorders due to hypo and

hyper secretions
When hormones are secreted in normal quantities, a dynamic effect is exerted
in the maintenance of ‘homeostasis and regulation of biological processes’. If
the production of the hormones is imbalanced by over production or under
production, the biological processes are disturbed, and abnormalities occur.
Some important disorders caused by hypo or hyper secretion of hormones
include dwar fism, gigantism, acromegaly, cretinism, simple goiter,
exophthalamic goiter, diabetes (mellitus and insipidus), Addison’s disease,
Cushing syndrome etc.
Hypersecretion of growth stimulating hormone (somatotropin), before puberty
and completion of ossification, leads to an abnormality called gigantism.
This is ‘over growth’ of the skeleton resulting in abnormal height of the
person affected. Hypersecretion of this hormone in adults results in an
abnormality called acromegaly. This disease is characterized by enlargement
of the bones of the jaw, hands and feet, thickened nose, lips, eyelids and
wide finger tips and ‘gorilla like appearance’ of the person affected.
Hyposecretion of GH during childhood retards growth, resulting in a ‘pituitary
dwarf’ / ‘midget’. The pituitary dwarf is sexually and intellectually a normal
individual.
Over activity of the thyroid, cancer of the gland or development of nodules of
thyroid lead to hyperthyroidism. In adults abnormal growth causes a disease
called exophthalmic goiter, with characteristically protruded eyeballs.
Hyperthyroidism also affects the physiology of the body (increased metabolic
rate). Inadequate supply of iodine in the diet results in hypothyroidism and
enlargement of the thyroid gland. This condition is called simple goiter.

136
 Human Anatomy
and Physiology - IV

During pregnancy, due to hypothyroidism, defective development of the

growing baby leads to a disorder called cretinism. Physical and mental
growth gets severely stunted (thyroid dwarf) due to untreated ‘congenital
hypothyroidism’ (deficiency of thyroid hormones by birth). Stunted growth,
mental retardation, low intelligence quotient, deafness and mutism are some
of the characteristic features of this disease. In adult women, hypothyroidism
may cause irregular menstrual cycles. In adults the hypothyroidism results
in a condition called myxedema. Lethargy, mental impairment, intolerance
to cold, puffiness of face and dry skin are some of the symptoms of myxedema.
Over activity of parathyroid gland (hyper parathyroidism) causes excess
decalcification by promoting the action of osteoclasts leading to bone
deformities and fractures. Besides this, calcification (stone formation) in
the kidneys takes place. Underactivity of parathyroid gland (hypo-
parathyroidism) leads to tetany (prolonged contraction of muscles) and the
calcium ion levels in the blood decrease (hypocalcemia).
Under secretion of insulin by the pancreatic gland (hypo-secretion) increases
the level of glucose in blood (hyperglycemia). Prolonged hyperglycemia leads
to a disease called diabetes mellitus, associated with loss of glucose through
urine (glycosuria) and formation of harmful compounds called ‘ketone bodies’.
Insulin therapy is used to treat diabetic patients.
Hyper secretion of insulin leads to decreased level of glucose in the blood
(hypoglycemia) resulting in insulin shock.
Deficiency of vasopressin causes a disease called diabetes insipidus. It
does not involve loss of sugar in urine (a difference from diabetes mellitus) .
Addison’s disease is caused due to hyposecretion of glucocorticoids by the
adrenal cortex. This disease is characterised by loss of weight, muscle
weakness, fatigue and reduced blood pressure. Sometimes darkening of the
skin in both exposed and nonexposed parts of the body occurs in this disorder.
This disorder does not allow an individual to respond to stress.
Cushing’s syndrome: It results due to over production of glucocorticoids.
This condition is characterized by breakdown of muscle proteins and
redistribution of body fat resulting in spindly arms and legs accompanied by
a round moon face, buffalo hump on the back and pendulous abdomen.
Wound healing is poor. The elevated level of cortisols causes hyperglycemia,
over deposition of glycogen in liver and rapid gain of weight.

137
 Zoology

GLOSSARY
Acromegaly: An abnormal growth, induces production of RBC
especially of the bones of the face (erythrocytes).
and extremities associated with the Growth Factors: Hormones secreted
over secretion of the pituitary by non-endocrine tissue, which are
growth hormone after reaching essential for normal growth of
adulthood. It is also called tissues and their repair.
disproportionate gigantism. It gives
a gorilla like appearance to the Hepatocytes: Liver cells.
affected person. Infundibulum: A stalk like structure
CAMP : Cyclic Adenosine Mono that connects pituitary gland with
Phosphate. Acts as a second the hypothalamus.
messenger (intracellular messenger) Melanocytes: Melanin containing
in the case of water soluble cells.
hormones.
Midget: Pituitary dwarf, a condition
Catecholamines: A common name caused by hyposecretion of growth
given to the hormones namely hormone in children.
adrenaline, noradrenaline and
Piloerection: Raising of hair, caused
dopamine.
by the secretion of emergency
Cytogenic organ: An organ which hormones during emergency
produces cells (gametes). situations.
Diabetes Insipidus: Excessive Puberty: The age at which the
urination and extreme thirst as a secondary sexual characters
result of inadequate output of the appear.
pituitary hormone ADH (anti-
Sella turcica: A cavity of the sphenoid
diuretic hormone).
bone in the skull in which the
Diabetes Mellitus: A condition pituitary gland is lodged.
resulting from lack of insulin as a
Simple Goiter: A condition in which
result of which, the body cannot
enlargement of the thyroid gland
store or oxidise sugar efficiently
due to iodine deficiency occurs.
(and sugar is lost through urine).
Somatotropic Hormone: The growth
Diuresis: Diuresis is an increase in the
hormone secreted by the anterior
production of urine by the kidneys
lobe of the pituitary gland that
Erythropoietin: A hormone regulates the growth of the skeleton.
produced in the kidneys which

138
 Human Anatomy
and Physiology - IV

QUESTIONS
Very Short Answer Type Questions 3. Give an account of the secretions
of pituitary gland.
1. What is acromegaly? Name the 4. Compare a ‘pituitary dwarf’ and
hormone responsible for this a ‘thyroid dwarf’ in respect of
disorder. similarities and dissimilarities
2. Which hormone is called anti- they possess.
diuretic hormone? Write the 5. Explain how hypothyroidism
name of the gland that secretes and hyperthyroidism can affect
it. the body.
3. Name the gland that increases 6. Write a note on Addison’s disease
in size during childhood and and Cushing’s syndrome.
decreases in size during 7. Why does sugar appear in the
adulthood. What important role urine of a diabetic?
does it play in case of infection? 8. Describe the male and female sex
4. Distinguish between diabetes hormones and their actions.
insipidus and diabetes mellitus. 9. Write a note on the mechanism
5. What are Islets of Langerhans? of action of hormones.
6. What is ‘insulin shock’?
7. Which hormone is commonly
known as fight and flight
hormone?
8. What are androgens? Which
cells secrete them?
9. What is erythropoietin? What is
its function?

Short Answer Type Questions

1. List out the names of endocrine

glands present in human
beings and mention the
hormones they secrete.
2. Describe the role of
hypothalamus as a neuro-
endocrine organ.

139
 Zoology

FOR IGNITED
MINDS
Hormones -
The Biochemical ‘Integrators

Endocrine System and Chemical Coordination

1. What is the indirect effect of alcohol on the functioning of the kidneys in
man.
2. Why do women after menopause tend to develop osteoporosis.
3. Nerve cells secrete neurotransmitters that act locally stimulating the next
neuron’s dendrites. However there are certain hormones secreted by neural
tissue and act on receptors in certain distant parts in the body. Can you
name one such hormone?
4. What is the difference between ‘tropic’ and ‘non-tropic’ hormones.
5. Can you name a hormone whose main job is controlling biorhythms.
6. Excepting some parts of the pituitary, is there any other endocrine gland
derived from the ‘neural tissue’ during development?
7. Did you ever observe ‘milking’ a cow. Why does not milk start flowing out
immediately even though the udder is full of milk. What happens most initially
when the teats are squeezed?
8. In the good old days physicians (doctors) used to prescribe calcium tablets
to people affected by osteoporosis. Nowadays they are prescribing
combinations of calcuim and Vit. D or Calcium and calcitriol. Can you
explain the reason behind this change.
9. Does increased production of ACTH help a person whose Na, K balance in
the body is out of order?

n140
 Human Anatomy
and Physiology - IV

UNIT IV B
Immune System
4.4 Basic concepts of Immunity
4.5 Types of Immunity
Edward Jenner
4.6 Vaccination or immunization
4.7 Immunological Disorders

IMMUNE SYSTEM - The “Body Guard” with

Powerful “Arsenal”
Immune system is the 24 hr/7day ‘bodyguard’ system. The human body
defends itself offering a “Three Line” defence. The pattern of defence is either,
‘innate’ (present by birth / congenital) or ‘acquired’ (after birth). The most
external ‘First Line of Defence’ of the body is provided by the skin, the largest
organ in the body. It chiefly acts as the ‘Physical Barrier’ for the invading
germs. In addition, it can mount an attack on the germs with the lysozyme
present in the sweat. The sebum with its low pH also helps in the process of
defence. The mucus secreted by the wall of the gut, saliva and tears containing
‘lysozyme’ too offer the first line of defence. Epithelial layers in different parts
of the body are known to produce antimicrobial proteins. Microbes entering
the body through inhaled air are caught in the ‘mucus’ of the bronchioles and
bronchi and the mucus along with the killed microbes is ‘swept’ out by the
ciliature of the lining epithelium. The phagocytes (both tissue fixed and the
wandering types), NK cells, high temperature, inflammatory response etc.,
provide the Second Line of Defence. High temperature (fever) is body’s natural
defence to inhibit rapid multiplication of the microbes. Phagocytes such as
the macrophages ‘phagocytise’ microbes and digest them. The most, powerful
defence is the one provided by the ‘T’ cells, ‘B’ cells and the antibodies.
They constitute the Third Line of Defence. Thus the immune system is the
‘GUARDIAN ANGEL’ acting as the ‘BODY GUARD SYSTEM’.

141
 Zoology

Introduction
Every day we are exposed to a large number of infectious agents. However,
only a few of them result in diseases- why? It is due to the fact that the body
is able to defend itself from most of them. This overall ability of an individual
to fight against the disease causing organisms is called immunity. The network
of organs, cells and proteins that protect the body from harmful, infectious
agents such as bacteria, viruses, animal parasites, fungi etc., is called the
Immune System. The basic requirement of the immune system is to
differentiate between self and non-self and to protect the body from harmful
foreign substances, micro-organisms, toxins and malignant cells etc. The
branch of biology that deals with immunity or the study of immune system is
called Immunology. Edward Jenner is acknowledged as the Father of
Immunology.

4.4 Basic concepts of Immunology

To understand immunology better, we have to know certain basic concepts
such as lines of defence, cells, organs and soluble mediators of the immune
system, antigens, types of immunity, mechanism of immunity and immunological
disorders.

4.4.1 Lines of Immunity or Lines of defence in the body

Whenever bacteria, viruses, fungi and parasites try to enter the body of an
organism, skin, mucous membranes and the enzyme lysozyme of saliva,
tears, etc., prevent their entry. This is called the First line of defence. If the
microorganisms cross this line and enter the body, the phagocytes, natural
killer cells, antimicrobial substances, inflammation, fever, etc., destroy them.
This is called the Second line of defence. These two lines of defence are
very fast reacting responses but they are not specific. If the microbes cross
even this line, then the lymphocytes and antibodies fight against them. It is
called the Third line of defence. It is highly specific but takes several days
to become fully functional. If all the three lines of defence fail, it results in
diseases.

4.4.2 Cells of the immune system

These are mainly of three types, namely (i) Lymphocytes, (ii) Phagocytes
and (iii) Auxiliary cells
4.4.2.1 Lymphocytes
These are the chief cells of the immune system which are again of three types
namely (a) B-cells, (b) T-cells and (c) Large granular lymphocytes (LGLs).

142
 Human Anatomy
and Physiology - IV

Note: Based on the size, lymphocytes can be divided into small

lymphocytes and large lymphocytes. Small lymphocytes include B-cells
and T -cells, wheres the large lymphocytes include large granular
lymphocytes that consist of Natural killer cells (NK-cells)
(a) B-cells (B-Lymphocytes): The lymphocytes capable of producing
antibodies and can capture circulating antigens are called B-cells. They
are produced from the ‘stem cells’ in the bone marrow of adult mammals,
liver of foetus and bursa of Fabricius in birds. Mature B-cells synthesize
various types of antibodies which are displayed on their membrane
surfaces. The mature B-cells are also called immuno-competent B-
cells. These mature immuno-competent B-cells reach the secondary
lymphoid organs and develop into functional immune cells which later
differentiate into ‘long lived’ memory cells and ‘effector’ plasma cells.
The plasma cells produce antibodies specific to the antigen to which
they are exposed. Memory cells store information about the specific
antigens and show quick response, when the same type of antigen
invades the body later.
(b) T-cells (T-Lymphocytes): The lymphocytes that are not capable of
producing antibodies and cannot recognize the free or circulating
antigens are known as T-cells. They are produced in the bone marrow,
reach the thymus gland and differentiate into mature T-cells or
immuno-competent T-cells. In the secondary lymphoid organs, they
transform into functional T-cells. On exposure to antigens both TH and
Tc cells produce memory cells and effector cells.
Do you know? Though T-cells cannot recognize the free or circulating antigens,
they can recognize antigens, if presented by antigen presenting cells (APCs) or
altered self cells by MHC molecules. APCs include dendritic cells, macrophages
and B lymphocytes.
Types of T cells
On the surface of T -cells, certain glycoprotein molecules called ‘cluster of
differentiation molecules’ (CD markers) are present. Based on these
glycoprotein molecules, the T-cells are of two types, namely CD4+ cells or T4
cells and CD8+ cells or T8 cells. Based on their function, the T cells are of
two types, namely T helper cells and T cytotoxic cells. Monocytes, macrophages
and dendritic cells also bear CD4 markers.
i. T helper cells or TH cells
These are CD4+ cells. They can recognise the exogenous antigens presented
by the APCs through MHC class-II proteins. They help the B-cells in producing
antibodies, help mononuclear phagocytes (MNPs) in stimulating phagocytosis
143
 Zoology

T cell
receptor T cell
CD8
B cell (TCR) CD4 receptor
receptor (TCR)
(antibody)

B cell TH Cell TC Cell

Figure 4.9 Types of Lymphocytes

and also activate TC cells to initiate ‘cell mediated immunity’. Hence they are
involved in both humoral immunity and cell mediated immunity. T cells are
also involved in the rejection of ‘transplanted tissues /organs. TH cells secrete
gamma interferons which stimulate cells such as macrophages. The
macrophages, inturn secrete cytokines such as interleukins that stimulate
TH cells. TH cells are activated only when they are needed. This is ensured by
a protein called CD28, which can bind to a protein called B7 present on the
APCs.
ii. TC cells or Killer T cells
These are CD8+ cells. They can recognise the antigens presented by ASCs
(altered self cells) through MHC class-I protein. As soon as they receive the
antigens and stimulation from interleukins, they are differentiated into
Cytotoxic T Lymphocytes (CTLs) or effector T cells which kill the virus-
infected host cells as well as the tumour cells and APCs. Thus, these cells
are involved only in cell mediated immunity.
(c) Large Granular Lymphocytes (LGLs) : Natural killer cells form the body’s
most important cells of defence and they destroy the infected cells or altered
self cells (such as cancer cells) in an antibody independent manner (non-
specific). The reaction time of NK cells is fast as they are always in an
active form to identify and destroy even small cancer cells well before they
form a tumour. (you will learn more in the ‘mechanism of cell mediated
immunity’).
Note: NK cells are a part of the innate immune system and play a major
role in defending the host from VIRUS infected cells and tumours (cancer
cells).

4.4.2.2 Phagocytes
Based on the types of nuclei present, they are of two types, namely
(a) Mononuclear phagocytes (MNPs) and (b) Polymorphonuclear phagocytes
(PMNs).

144
 Human Anatomy
and Physiology - IV

(a) Mononuclear phagocytes (MNPs): The monocytes of the blood enter

the extra-capillary spaces and transform into histiocytes in the
connective tissue, Kupffer cells in the liver, microglia in the brain,
osteoclasts in the bone and synovial cells in the synovial fluid,
etc.
(b) Polymorphonuclear phagocytes: They are the ‘granulocytes’ of the
blood including neutrophils, basophils and eosinophils. However,
in common usage this term is mostly used for neutrophils as they
constitute the majority.
4.4.2.3 Auxiliary cells
The cells that help lymphocytes in immune responses are called
auxiliary cells. These cells include basophils, mast cells, platelets
and antigen presenting cells (APCs). Basophils, mast cells and platelets
secrete inflammatory mediators which cause inflammation in the
surrounding tissues. Antigen presenting cells include macrophages,
B-cells and dendritic cells which present the antigens to TH cells.
Mediators

Do you know? The cells of the host with the processed antigenic
polypeptides on the class-I MHCs are called altered self-cells.

4.4.3 Organs of immune system

The organs involved in the origin, maturation and proliferation of lymphocytes
are called lymphoid organs. Based on their function, they are of two types,
namely (i) Primary lymphoid organs and (ii) Secondary lymphoid organs
(i) Primary lymphoid organs: The organs where the lymphoid stem cells
become mature lymphocytes (which are antigen-sensitive) are called
primary lymphoid organs, e.g. Bursa of Fabricius of birds, bone marrow
and thymus gland of mammals
(ii) Secondary lymphoid organs: The organs where the mature lymphocytes
transform into functional lymphocytes are called the secondary lymphoid
organs. They provide the sites for interaction of lymphocytes with the
antigens, which then proliferate to become effector cells, e.g. spleen,
lymph nodes, tonsils, Peyer’s patches of small intestine, appendix,
etc.
Spleen: It is a large bean-shaped organ located at the upper-left part of
the abdomen under the diaphragm. It mainly contains lymphocytes and
phagocytes. It acts as a filter of the blood by trapping blood-borne micro-
organisms. It acts as a large reservoir of erythrocytes as well as the burial
ground or grave yard of the old and worn out RBC.
Lymph nodes: These are small solid structures located at different points
along the lymphatic system. They trap micro-organisms or other antigens

145
 Zoology

which are responsible for the activation of lymphocytes present there and
cause the immune response.

Do you know? There is a lymphoid tissue located within the lining of

the major tracts like respiratory, gastrointestinal and urinogenital tracts,
called mucosa-associated lymphoid tissue (MALT). It constitutes about
50 per cent of the lymphoid tissue in the human body.

4.4.4 Soluble mediators of immunity

They are of three types namely (i) Complement proteins, (ii) Cytokines and
(iii) Antibodies
1. Complement proteins: These are a group of inactive plasma proteins
and cell surface proteins. When activated, they form a membrane
attack complex (MAC) that forms pores in the plasma membrane of
the affected cells allowing ECF to enter the cells and make them swell
and burst. Some of them form a coat on the surface of the pathogens
and attract neutrophils and macrophages to phagocytose and destroy
them (opsonisation). Complement proteins and their activities are
together called complement system.
2. Cytokines: They are small, soluble molecules secreted mostly by the TH
cells or infected cells. They bind to cell surface receptors and initiate
activation or differentiation of the cells of the immune system to
stimulate phagocytosis and cytolysis of the infected cells. They are mainly
of two types namely Interleukins and Interferons.
(i) Interleukins (ILs): They are produced by leucocytes and are primarily
involved in the differentiation of the cells of the immune system. IL-I reaches
the brain (hypothalamus) and causes fever response.
(ii) Interferons (IFNs): They are antiviral
Antigen
binding sites
proteins produced by virus infected cells and are
e (Fab ends) P ar involved in protecting the neighbouring cells
p
a to at
r V o pe from the viruses of infected cells. There are of
Pa V
V
V three types, namely alpha, beta and gamma
C C interferons.
Light
3. Antibodies (Immunoglobulins): Whenever
chain
pathogens enter our body, the B-lymphocytes
produce an army of proteins called antibodies
Heavy
C C chain to ‘fight’ with them. They are highly specialized
for binding with specific antigens. The part of
Fc end
an antibody that recognizes an antigen is called
Figure 4.10 Structure of Antibody the paratope (antigen binding site). Based on

146
 Human Anatomy
and Physiology - IV

their mobility, antibodies are of two types, namely circulating or free

antibodies and surface antibodies. The circulating or free antibodies are
present in the body fluids whereas the surface antibodies are present
on the surface of the mature B-cells as well as the memory cells.
Structure: The basic structure of an antibody was proposedby Rodney Porter.
It is a Y shaped molecule with four polypeptide chains of which two are long,
identical heavy chains (H) and two are small, identical light chains (L).
Hence, an antibody is represented as H2 L2. The two chains are linked by
disulphide bonds. One end of the antibody molecule is called Fab end (Fragment-
antigen binding) and the other end is called Fc end (Fragment-crystallizable or
Fragment-cell binding). Based on the structure, the antibodies are of five
types, namely IgD, IgE, IgG, IgA and IgM.
Do you know? IgD, IgE and IgG are monomeric units, whereas IgA is
dimeric and IgM is a pentameric form of antibody.

4.4.5 Antigens
The molecular substances such as polysaccharides, proteins,
lipoproteins, nucleoproteins, nucleic acids, etc., that can induce
a detectable immune response are called antigens. They can
be recognized by B-cells or T -cells (if presented by APCs or
Epitopes of Antigens
ASCs). The antigenic site that binds to a paratope of antibody
is called the epitope. Based on their existence, they are of various types like
free or circulatory antigens that freely circulate in the body fluids, intra
cellular antigens which are present inside the infected cells and cell surface
antigens such as the blood group deciding antigens.
Processing and presentation of antigens
Whenever a pathogen is taken in by cells such
as macrophages, it gets broken-down by the
action of enzymes released from lysosomes.
These broken pieces are called antigenic
determinants (epitopes). This is called the
processing of antigens. These antigenic
determinants are presented by specialized group
of molecules called Major Histocompatibility
Complex (MHC) molecules (called human
leukocyte antigen system /HLA system in human-
beings) which are of two types namely Class-I Figure 4.11 Processing of Antigen
and Class-II MHCs.
Class–I MHC molecules: They are found on the surface of almost all nucleated
cells of the body. They present the antigens to Tc cells for cell mediated
immunity.
147
 Zoology

Class–II MHC molecules: They are found only on the surface of APCs (in
addition to Class-I MHC molecules). They present the antigens to TH cells
for cell mediated or humoral immunity.
Do you know? To recognize antigenic polypeptides, T-cells have some
receptors called antigen specific receptors (ASR) on their surface and
can recognize the antigenic polypeptides, only if bound to the MHC
molecules.

4.5 Types of immunity

4.5.1 Based on the nature of response, immunity is mainly of two types,
namely (i) Innate immunity and (ii) Acquired immunity.
1. Innate Immunity (Innate – inborn or present at the time of birth):
The inborn resistance to diseases, possessed by all the living organisms
is called innate immunity. It is a non-specific type of defence and
does not depend on prior contact with the micro-organisms. This is
executed by providing different types of barriers like:
(a) Physical barriers: Skin and mucous membranes are the main
physical barriers. Skin prevents the entry of micro-organisms
whereas the mucus membranes help in trapping and killing the
microbes entering our body.
(b) Physiological barriers: Secretions of the body such as HCl in the
stomach, saliva in the mouth, tears from the eyes are the main
physiological barriers against microbes.
NOTE: Saliva, tears, sweat contain ‘lysozyme’ which can ‘digest’ the
bacterial cell walls. Oil (sebum) and sweat of skin have a pH range of
3-5, making the skin (the largest organ in the body) an effective inhibitor
of microbial growth.
(c) Cellular barriers: Certain types of cells like polymorpho-nuclear
leukocytes (PMN - neutrophils), monocytes and natural killer cells
in the blood as well as macrophages in the tissues are the main
cellular barriers. They phagocytose and/ or destroy the microbes.
(d) Cytokine barriers: The cytokines such as interferons protect the
non-infected cells from infection.
2. Acquired Immunity or Adaptive immunity
The immunological resistance developed by an individual throughout
the life after the birth is known as acquired immunity or adaptive
immunity. It is pathogen specific and depends on prior contact with
the infectious micro-organisms. Hence it is characterised by
immunological memory. It varies from person to person. It is again of
two types namely (A) Active acquired immunity and (B) Passive acquired
immunity.

148
 Human Anatomy
and Physiology - IV

(A) Active acquired immunity

The immunological resistance developed by the organisms through the
production of antibodies in their body, is called active immunity. It is a
lifetime-immunity or long lasting immunity. But it is slow and takes time to
show its fully effective response. It is again of two types, namely (a) Natural
active acquired immunity and (b) Artificial active acquired immunity
(a) Natural active immunity: The resistance developed by an individual in
response to natural infection, from which a person recovers is called
natural active acquired immunity, e.g. the lifetime immunity acquired
by an individual after recovering from infections such as smallpox,
chickenpox, etc.
(b) Artificial active immunity: The immunity developed by an individual
due to the inoculation of weakened (attenuated) antigens into the body
is called artificial active acquired immunity, e.g. immunity that
develops due to vaccination e.g., injection of ‘tetanus toxoid’ to generate
immunity aganist tetanus.
(B) Passive acquired immunity
The immunological resistance developed by an organism due to the transfer
of ready-made (preformed) antibodies is called passive acquired immunity.
It is again of two types, namely (a) Natural passive immunity and (b) Artificial
passive immunity.
(i) Natural passive immunity: If the preformed antibodies are transferred
from mother to child, it is called natural passive acquired immunity,
e.g. Transfer of antibodies from mother to foetus across the placenta or
from mother to child through colostrum.
Do you know? Why is mother’s milk considered very essential for the
new-born infant? The colostrum secreted by the mother during the
initial days of lactation has abundant IgA antibodies, to protect the
infant.
(ii)Artificial passive immunity: If the pre-formed antibodies are transferred
from an immunised donor to a non-immunised individual, it is called
artificial passive acquired immunity, e.g. Injection of anti-tetanus
serum (ATS), anti-rabies serum and serum containing antivenin against
the venom of a snake, etc. These antibodies are generally produced in
the body of an immunised horse or sheep.
4.5.2 Based on the types of responses evoked, immunity is of two types,
namely (i) Humoral immunity and (ii) Cell mediated immunity
(i) Humoral Immunity (HI): The immunity mediated by the antibodies
that are released into the fluids of the body (humors) such as
plasma, lymph, etc. is called humoral immunity. It is generated
due to the interaction of B-cells with free antigens.
149
 Zoology

Mechanism of Humoral immunity (HI)

In the secondary lymphoid organs, the free antigens
bind to the Fab end of the antibodies that are present
on the surface of mature B-cells. They engulf and
process the antigens. Then they display the
antigenic fragments on their membrane with the
help of Class-II MHC molecules. TH cells recognise
them and interact with the antigen-MHC-II
complex and release a type of interleukin, which
stimulates the B-cells to proliferate and
differentiate into memory cells and plasma cells.
The plasma cells release specific antibodies into
the plasma or extra cellular fluids. These antibodies
help in opsonising and immobolising the bacteria,
neutralising and cross linking of antigens leading
to agglutination of insoluble antigens and
precipitation of soluble antigens. They also activate
the phagocytes and complement system.

Do you know? The products of antigen, antibody

reactions are called ‘antigen- antibody complexes’
Figure 4.12 Mechanism of
humoral immunity or immunocomplexes, which are removed by
eosinophils and monocytes.

Figure 4.13 Function of Antibodies

150
 Human Anatomy
and Physiology - IV

(ii) Cell Mediated Immunity (CMI): The immunity mediated by the

activated T -cells, natural killer cells, etc., is known as cell
mediated immunity. It is effective against both exogenous and
endogenous antigens. It does not involve production of antibodies.

Mechanism of Cell mediated immunity (CMI)

Antigen presenting cells process the exogenous antigens whereas the altered
self-cells process endogenous antigens. Then, the processed antigenic
fragments are displayed on their (APCs or ASCs) membranes. They are
recognised by T-cells. Binding of T-cells to the APCs or ASCs causes the
production of activated T cells and memory T cells. The activated TH cells
secrete various types of interleukins which transform activated Tc cells
into effector Cytotoxic T-Lymphocytes (CTLs / Killer cells). CTLs attach
to the infected cells and release certain enzymes called perforins and
granzymes. Perforins form pores in the cell membrane of the infected
cells. Then granzymes enter the infected cells through these perforations
and activate certain proteins (e.g. caspases) which help in the destruction
of the infected cell (apoptosis). The NK cells are similar in their action to
CTLs. However NK cells distroy the infected cells in an antibody independent
manner where as the CTLs destroy the infected cells in an antibody
dependent manner.

Figure 4.14 Mechanism of cell mediated immunity

151
 Zoology

Vaccination or Immunization
The principle of vaccination or immunization is based on the property of
the immunological memory of the immune system. During the process of
vaccination, inactivated (killed) or weakened (attenuated) pathogens
(vaccines) or antigenic proteins of the pathogen are introduced into the
body of the host. They initiate the production of appropriate antibodies in
the host and also generate memory–B cells and memory T cells. On
subsequent exposures, the memory cells recognise that pathogen quickly
and overcome the invader with a rapid and massive production of
antibodies.

Do you know? Recombinant DNA Technology has allowed the

production of antigenic polypeptides of pathogens in bacteria or yeast.
Vaccines can be produced on a large scale using this method, e.g.
Hepatitis-B vaccine is produced by using genetically modified
(recombinant) yeast.

Immunological Disorders
Any situation that results in the impairment of immune system is referred
to as immunological disorder. These are of various types like (a)
immunodeficiency disorders, (b) hypersensitivity disorders, (c) auto-immune
disorders, (d) graft rejections, etc.

Immunodeficiency disorders
They occur when the immune response of the body is reduced or absent.
These are again of two types, namely primary and secondary
immunodeficiency disorders. Primary immunodeficiency disorders are
caused by the defective genes, e.g. Severe combined immunodeficiency
(SCID). The secondary immunodeficiency disorders are caused by various
factors like infections, ageing, etc., e.g. HIV/AIDS

Do you know? A person positive to HIV is not called AIDS patient until
the virus completely destroys the immune system and makes the person
susceptible to certain ‘opportunistic diseases’.

4.6 Acquired Immuno Deficiency Syndrome (AIDS)

It is a transmissible (mostly sexually transmitted) lethal disease, caused by
Human Immunodeficiency Virus (HIV). It was first reported in 1981 by CDC
(Centre for Disease Control), USA and in the last thirty years, it has spread
all over the world, killing more than 25 million people.

152
 Human Anatomy
and Physiology - IV

1. Mode of infection
It generally occurs by sexual contact with an infected person, by transfusion
of the virus contaminated blood, by sharing the infected needles and from an
infected mother to her child through placenta. It is important to note that
HIV/AIDS is not spread by mere touch (physical contact).
2. Structure of HIV
It is a retrovirus which has an envelope enclosing two ssRNA (single stranded
RNA) molecules as the genetic material and two molecules of the enzyme
reverse transcriptase. The ssRNA is surrounded by a protein coat, followed
by a layer of proteins which is again surrounded by an outer lipid layer that
contains a number of glycoproteins such as gp41 and gp120. These proteins
bind to host cell’s surface receptors during infection.
3. Mechanism
After getting into the body of a person,
the HIV enters the TH cells, macrophages
or dendritic cells. In these cells the
ssRNA of HIV synthesizes a DNA strand
‘complementary’ to the viral RNA, using
the enzyme reverse transcriptase. The
reverse transcriptase also catalyses
the formation of the second DNA strand
‘complementary’ to the first strand
forming the double stranded viral
DNA. This viral DNA gets incorporated
into the host cell’s DNA by a viral Figure 4.15 Structure of HIV
enzyme (integrase) and it is now in the
form of a ‘provirus’. Transcription of the DNA results in the production of
RNA, which can act as the ‘genome’ for the new viruses or it can be translated
into viral proteins. The various components of the viral particles are ‘assembled’
and the HIV are produced. The infected human cells continue to produce
virus particles and in this way they act like HIV generating factories. New
viruses ‘bud off’ from the host cell. This leads to a progressive decrease in
the number of T H cells in the body of an infected person leading to the
immunodeficiency in him. Even though HIV attacks any cells with CD4
marker, for reasons not known, only T H cells are destroyed and not the
‘macrophages’. The gp120 molecules on the surface of HIV attach to CD4
receptors of human cells, mostly the TH cells (gp120 fits the CD4 marker).
Attack on certain types of cells/ tissues only by viruses such as HIV is
referred to as ‘tissue tropism’.

153
 Zoology

4. Symptoms
There is always a time-lag between the first infection and appearance of
symptoms. This period may vary from a few months to many years (usually
5-10 years) to develop into full blown AIDS. During this period, the person
suffers from bouts of fever, diarrhoea and loss of weight. Due to decrease in
the number of TH cells, the person starts suffering from infections due to
bacteria (especially Mycobacterium), viruses, fungi and other parasites such
as Toxoplasma. The patients become so immuno-deficient that they are unable
to protect themselves against these minor infections, which normal healthy
people can easily overcome.

NOTE: The time between the first exposure to HIV and the production
of antibodies by the immune system in response to HIV infection is
called “window period” during which time the presence of virus cannot
be detected.

5. Diagnosis
A widely used diagnostic test for detecing HIV infection is the Enzyme Linked
Immuno-Sorbent Assay (ELISA) test. This can be detected within 15 days to
4 months after the exposure to virus. ELISA is only a ‘screening test’. Western
blot is used as a more reliable confirmation test for HIV infection.

6. Treatment of HIV infection and prophylaxis

Treatment of AIDS with ‘anti-retroviral drugs’ can only prolong the life of the
patient but cannot prevent death. Hence, it is better to follow prophylactic
methods to avoid HIV infection.
7. Prophylaxis
Safe sex, proper sterilization of hospital syringes and needles and screening
the blood for HIV before transfusion, are some of the important prophylactic
methods. In our country the National AIDS Control Organization (NACO) and
other non-governmental organization (NGOs) are doing a lot to educate people
about AIDS.

Hypersensitivity disorders (Allergies)

Did this happen to you? You went to a new place and soon you started
sneezing, wheezing for no explained reason. When you returned from
that place, your symptoms disappeared. What could be the reason?
Reason: Some people are highly sensitive to dust particles, pollen etc.,
present in the environment. If they avoid allergens, the symptoms
subside. The above mentioned reactions could be due to allergic response
by the body.

154
 Human Anatomy
and Physiology - IV

The exaggerated response of the immune system to certain antigens present

in the environment is called hypersensitivity. There are different types of
hypersensitivity reactions of which Type-I hypersensitivity is referred to
as allergy. It is due to the release of chemicals such as histamine and
serotonin from the mast cells. The antibodies responsible for allergies are
of the group IgE. The substances to which allergy is produced are called
allergens. Common examples of allergens are dust mites, pollen, animal
dander, etc. Symptoms include sneezing, watery eyes, running nose and
difficulty in breathing.
For determining the cause of allergy, the patient is exposed to or injected
with very small doses of possible allergens, and the reactions are studied.
The use of drugs like anti-histamine, adrenalin and steroids quickly control
the symptoms of allergy.

Did You Notice? More and more children in metro cities of India suffer
from allergies leading to asthmatic attacks due to environmental
pollutants. This could be mostly due exposure to various types of
pollutants in the urban atmosphere.

HAVE YOU EVER HEARD OF ANAPHYLAXIS /ANAPHYLACTIC

SHOCK: Sometimes hypersensitivity reaction occurs within seconds
and blood pressure falls to critical low levels, which may even cause
death.

Auto-immune disorders
Generally our immune system can recognise our own proteins and does
not attack our own tissues. Unfortunately, in some cases our immune
system fails to recognise some of our own body proteins and treats them
as foreign antigens that results in attacks on our own tissues. This leads
to some very serious diseases collectively known as auto-immune diseases,
e.g. Graves’ disease, Rheumatoid arthritis, myasthenia gravis, Addison’s
disease etc., which are treated with immuno suppressants.
Graft rejections
When some human organs like cornea, heart, liver, kidney, etc., fail to
function satisfactorily, transplantation is the only remedy to enable the
patient to lead a normal life. Whenever such organs are transplanted, the
host body identifies them as foreign and initiates the graft rejection sooner
or later. Hence tissue matching and blood group matching are essential
before undertaking any graft or transplant. Even after this, the patient
has to take immuno–suppressant drugs throughout their life.

155
 Zoology

GLOSSARY
Barrier: Anything that obstructs free Inflammation: A protective response
movement brought about by the mast cells and
other immunological cells, in an
Bursa of Fabricius: A lymphoid organ organism to initiate the healing
in birds that is connected to the process. It is characterised by pain,
cloaca and is the site of B cell burning sensation, redness and
maturation swelling
Colostrum: It is the first milk containing Inoculation: Introduction of attenuated
IgA antibodies, produced by mother pathogens (vaccine) to develop
after child birth immunity, as a precaution against
Congenital disease: A disease or contacting a disease
disorder that is inherited genetically Lymphoid stem cells: The
(by birth) undifferentiated cells which give rise
Cytolysis: Destruction of cell to lymphocytes
Dander: Small scales from animal skins, Malignant cells: Tumour-cells capable
hair or feathers of a bird, that can of invading and growing in other
cause allergic reactions in some tissues and organs of the body and
people cause secondaries of cancer
(metastasis)
Dendritic cells: Immune cells forming
a part of the mammalian immune Opsonisation: The process by which
system. Their main function is to bacteria and other cells are altered
process an antigen /pathogen and so as to be more efficiently engulfed
present it to the TH cells. They show by phagocytes; a process whereby
branched-extensions which look like opsonins make an invading
the dendrites of neurons. They are microorganism more susceptible to
present in tissues in contact with the phagocytosis.
external environment, such as the Peyer’s patches: Oval elevated patches
skin, inner lining of the nose, lungs, of closely packed lymphoid follicles
stomach and intestines. in mucous and sub-mucous layers
Immunological memory: When our of the small intestine.
body encounters a pathogen for the Phagocytose: The action of engulfing
first time it produces a response by phagocytes
called primary response which is of
low intensity. Subsequent encounter Provirus: A virus genome that is
with the same pathogen causes a integrated into the DNA of a host cell
highly intensified secondary or Syndrome: A group of symptoms
anamnestic (renewed) response. This
is due to the fact that our body Tonsils: The masses of lymphatic tissue
appears to have memory of the first present one on either side of the
encounter. oropharynx

Immunosuppressants: Medication Wheezing: A whistling sound during

which decreases the immune breathing due to a respiratory
response especially in the case of disorder
tissue transplants.

156
 Human Anatomy
and Physiology - IV

QUESTIONS
Very Short Answer Type Questions Short Answer Type Questions

1) Define the terms immunity and 1) Write short notes on B-cells.

immune system. 2) Write short notes on
2) Define the non-specific lines of immunoglobulins.
defence in the body. 3) Describe various types of
3) Differentiate between mature barriers of innate immunity.
B-cells and functional B-cells. 4) Explain the mechanism by
4) Write the names of any four which HIV multiplies and leads
mononuclear phagocytes. to AIDS.
5) What are complement proteins? 5) What are various types of
6) “Colostrum is very much essential immunity?
for the new born infants”. Justify.
7) Differentiate between perforins
and granzymes.
8) What are interferons?
9) What is meant by paratope?
10) Which substances form
membrane attack complex?

157
 Zoology

FOR IGNITED
MINDS
The ‘Body Guard’ with
Powerful ‘Arsenal’

Immune System
1. HIV infection cannot be controlled by vaccinations as they are yet to be
developed. In the case of poliomyelitis, another viral disease, vaccinations or
oral drops of polio vaccine are successful. What is the reason for such a
difference?
2. With reference to infection to attack by germs - is skin a physical barrier or
physiological barrier or both. How do you justify your opinion?
3. In the history of evolution of the medical science, who first observed that pre
exposure to a disease/ disease causing organism, prevented subsequent
infections (atleast in the near future)?
4. Certain T cells directly attack ‘non-self cells’ or ‘altered self cells’. What type
of immunity is it called? What is the name of such cells?
5. All nucleated cells possess MHC Class-I proteins. In what type of cells do
you find MHC class- II proteins?
6. Which two types of ‘cells’ in our body exhibit almost the same immune
mechanism, with reference to destruction of altered/foreign cells.
7. In case of rejection of a transplant (cell/tissue), what are the cells that are
primarily involved in the mediation of ‘transplant rejection’?
8. Of the activated B cells, TH cells and TC Cells, which cells produce, memory
cells.
9. With reference to showing immune response to a certain pathogen, it is 15
days in a certain case (hypothetically). However a person showed immune
response on exposure to the said pathogen in one week or even less time.
What could be the reason?
10. Why do almost all infections result in ‘fever’? What is the reason/significance
people ‘sneeze’, ‘cough’ and have a ‘running nose’ when infected by certain

n
pathogens or allergens?

158
 Unit-V
HUMAN REPRODUCTION
Ernst Haeckel

Asexual reproduction is the process adopted by many lower organisms, which

have a high degree of regenerative capacity, sometimes helping in that process.
Sexual reproduction creates another organism(s) showing variation from the parent.
Variations are raw materials for evolution, and Natural Selection operates
on them. Formation of gametes taking part in sexual reproduction involves
meiosis, the reduction division, making them haploid. During meiosis there is
some degree of exchange of chromatids between the chromosomes of the paternal
set and maternal set. This phenomenon is called cross over and it leads to
novelty in the DNA which is important for evolution to occur. Among the sexually
reproducing organisms viviparity is of a higher degree of evolution, where the
mother supplies nourishment and oxygen through placenta. Sexual cycles in
animals are controlled by hormones whose production is sometimes linked to
favourable season, for the young ones to survive, grow and reproduce (genetic
continuity). The wealth of a Nation is the health of its people. As many people
are under educated, at least regarding reproductive health, it is necessary to
educate adolescents on reproductive health, sexually transmitted diseases,
necessity of a planned family, misconceptions regarding sex etc. You will discover
more on human reproductive system, puberty, secondary sexual features,
gametogenisis, fertilisation, implantation of embryo, gestation and post natal
care along with reproductive health etc. in this chapter.
 Zoology

UNIT V A
Human Reproductive
System
5.1 The Male Reproductive System
5.2 The Female Reproductive System
5.3 Gametogenesis
5.4 Menstrual Cycle
5.5 Fertilisation
5.6 Gastrulation
5.7 Organogenesis
5.8 Placenta Formation
5.9 Parturition
5.10 Lactation

Human reproduction is a form of sexual reproduction resulting in the

conception of a child, typically involving sexual intercourse between a man
and a woman. The reproductive events in humans include formation of
gametes (gametogenesis), i.e. sperms in males and ova in females, transfer
of sperms into the female genital tract (insemination) and fusion of male
and female gametes (fertilisation) leading to the formation of zygote. This is
followed by the formation and development of blastocyst and its attachment
to the uterine wall (implantation), embryonic development (gestation) and
delivery of the baby (parturition). All these reproductive events occur after
puberty (sexual maturity; the first occurrence of maturation in girls). There
are remarkable differences between the reproductive events in a male and a
female. Let us examine the male and female reproductive systems in humans.

160
 Human ReproductIon

5.1 The Male Reproductive System

The male reproductive system (male genital system) consists of a number
of sex organs that are a part of the human reproductive process. The sex
organs which are located in the pelvic region include a pair of testes (sing:
testis) along with accessory ducts, glands and the external genitalia.
1. Testes
The testes (testicles) are a
pair of oval pinkish male
primary sex organs suspended
outside the abdominal cavity
within a pouch called scrotum.
The scrotum helps in
maintaining the low tempe-
rature of the testes (2-2.50 C
lower than the normal internal
body temperature) necessary
for spermatogenesis. The
cavity of the scrotal sac is Figure 5.1(a) Diagrammatic sectional view of male pelvis
connected to the abdominal showing reproductive system
cavity through the inguinal
canal. Testis is held in position
in the scrotum by the guberna-
culum, a fibrous cord that
connects the testis with the
bottom of the scrotum. A
spermatic cord, formed by
the vas deferens, nerves, blood
vessels and other tissues runs
from the abdominal wall, down
to each testicle, through the
inguinal canal. Each testis is
enclosed in a fibrous envelope,
the tunica albuginea, which
extends inward to form septa Figure 5.1(b) Diagrammatic view of male reproductive
system
that partition the testis into
lobules. There are about 250
testicular lobules in each testis. Each lobule contains 1 to 3 highly coiled

161
 Zoology

seminiferous tubules. A
pouch of serous membrane
(peritoneal layer) called
tunica vaginalis covers the
testis.
of Leydig
Each seminiferous tubule is
lined by the germinal epithe-
lium which consists of un-
differentiated male germ cells
called spermatogonial
mother cells and it also bears
‘nourishing cells’ called
Sertoli cells. The spermato-
gonia produce the primary
Figure 5.2 Diagrammatic sectional view of seminiferous tubule spermatocytes which
undergo meiotic division,
leading to the formation of spermatids which form spermatozoa or sperms
(spermatogenesis). Sertoli cells provide nutrition to the spermatozoa and
also produce a hormone called inhibin, which inhibits the secretion of FSH.
The regions outside the seminiferous tubules, called interstitial spaces,
contain interstitial cells of Leydig or Leydig cells. Leydig cells produce
androgens, the most important of which is testosterone. Testosterone
controls the development of secondary sexual characters and
spermatogenesis. Other immunologically competent cells are also present.
The seminiferous tubules open into the vasa efferentia through the rete
testis (a network of tubules in the testis, carrying spermatozoa from the
seminiferous tubules to the vasa efferentia).
NOTE: The testes descend into the scrotum just before birth. The condition
in which the testes do not descend into the scrotum is called cryptorchidism

2. Epididymis
The vasa efferentia leave the testis and open into a narrow, tightly coiled
tube called epididymis located along the posterior surface of each testis. The
epididymis provides a storage space for the sperms and gives the sperms
time to mature. It is differentiated into three regions – caput epididymis,
corpus epididymis and cauda epididymis. The caput epididymis receives
spermatozoa via the vasa efferentia of the mediastinum testis (a mass of
connective tissue at the back of the testis that encloses the rete testis).

162
 Human ReproductIon

3. Vasa deferentia
The vas deferens or ductus deferens is a long, narrow, muscular tube. The
mucosa of the ductus deferens consists of pseudostratified columnar
epithelium and lamina propria (areolar connective tissue). It starts from the
tail of the epididymis, passes through the inguinal canal into the abdomen
and loops over the urinary bladder. It receives a duct from the seminal vesicle.
The vas deferens and the duct of the seminal vesicle unite to form a short
ejaculatory duct/ductus ejaculatorius. The two ejaculatory ducts, carrying
spermatozoa and the fluid secreted by the seminal vesicles, converge in the
centre of the prostate and open into the urethra, which transports the sperms
to outside.

Passage Of Spermatozoa:
Seminiferous tubules  Rete testis  Vasa efferentia  Epididymis 
Vas deferens  Ejaculatory duct  Urethra  Vagina of the female

4. Urethra
In males, the urethra is the shared (common) terminal duct of the reproductive
and urinary systems. The urethra originates from the neck of the urinary
bladder and extends through the penis to its external opening called urethral
meatus. The urethra provides an exit for urine and semen during ejaculation,
in males

5. Penis
The penis and the scrotum constitute the male external genitalia. The penis
serves as a urinal duct and also intromittent organ that transfers spermatozoa
to the vagina of a female. The human penis is made up of three columns of
tissue; two upper corpora cavernosa on the dorsal aspect and one corpus
spongiosum on the ventral side. Skin and a subcutaneous layer enclose all
three columns. The corpora cavernosa consist of special tissue with spaces
that are filled with blood. They help in erection of the penis to facilitate
insemination. The enlarged and bulbous end of penis called glans penis is
covered by a loose fold of skin (foreskin) called prepuce. The urethra traverses
the corpus spongiosum, and its opening called urethral meatus lies at the
tip of the glans penis.

163
 Zoology

6. Male accessory genital glands

The male accessory glands include paired seminal vesicles, a prostate gland
and bulbourethral glands.

i. Seminal vesicles
The seminal vesicles are a pair of simple tubular glands present postero-
inferior to the urinary bladder in the pelvis. Each seminal vesicle opens into
the corresponding vas deferens, where the vas deferens enters the prostate
gland. The secretion of the seminal vesicles constitute about 60 percent of
the volume of seminal fluid. It is an alkaline, viscous fluid that contains
fructose, proteins, citric acid, inorganic phosphorus, potassium, and
prostaglandins. Once this fluid joins the sperm in the ejaculatory duct,
fructose acts as the main energy source for the sperm outside the body.
Prostaglandins are believed to aid fertilization by causing the mucous lining
of the cervix to be more receptive to sperm as well as by aiding the movement
of the sperm towards the ovum with peristaltic contractions of the uterus
and fallopian tubes, after coitus.

ii. Prostate gland

Prostate gland is located directly beneath the urinary bladder. The gland
surrounds the prostatic urethra, and sends its secretions through several
prostatic ducts. In man, the prostate contributes 15–30 percent of the semen.
The fluid from the prostate is clear and slightly acidic. The prostatic secretion
‘activates’ the spermatozoa and provides nutrition.

iii. Bulbourethral Glands

Bulbourethral glands, also called Cowper’s glands, are located beneath
the prostate gland at the beginning of the internal portion of the penis. They
add an alkaline fluid to semen during the process of ejaculation. The fluid
secreted by these glands lubricates the urethra. It is also thought to function
as a ‘flushing agent’ that washes out the acidic urinary residues that may
remain in the urethra, before the semen is ejaculated.

5.2 The Female Reproductive System

The female reproductive system consists of a pair of ovaries along with a
pair of oviducts, uterus, vagina and the external genitalia located in the
pelvic region. These parts of the system along with a pair of the mammary
glands are integrated structurally and functionally to support the processes
of ovulation, fertilization, pregnancy, birth and child care.

164
 Human ReproductIon

1. Ovaries
Ovaries are the primary female sex organs that produce the female gametes
(ova) and several steroid hormones (ovarian hormones). A pair of ovaries is
located one on each side of the lower abdomen. The double layered fold of
peritoneum connecting the ovary with the wall of the abdominal cavity is
known as the mesovarium.
The ovaries are covered on the outside by a layer of simple cuboidal epithelium
called germinal (ovarian) epithelium. This is actually the visceral peritoneum
that envelops the ovaries. Underneath this layer there is a dense connective
tissue capsule, the tunica albuginea. The ovarian stroma is distinctly divided
into an outer cortex and an inner medulla. The cortex appears more dense
and granular due to the presence of numerous ovarian follicles in various
stages of development. The medulla is a loose connective tissue with abundant
blood vessels, lymphatic vessels, and nerve fibers. Each follicle is formed by
the infolding of the germinal epithelium.

2. Fallopian tubes (Oviducts)

Each fallopian tube extends from the periphery of each ovary to the uterus,
and it bears a funnel shaped infundibulum. The edges of the infundibulum
possess finger like projections called fimbriae, which help in collection of
the ovum after ‘ovulation’. The infundibulum leads to a wider part of the
oviduct called ampulla. The last part of the oviduct, isthmus has a narrow
lumen and it joins the uterus. Fallopian tube (Ampulla-isthmus junction) is
the site of fertilization. It conducts the ovum or zygote towards the uterus by
peristalsis. The fallopian tube is attached to the abdominal wall by a peritoneal
fold called mesosalpinx.

3. Uterus
Cervix
The uterus is single and
it is also called womb. Uterus Rectum
It is a large, muscular, Urinary bladder
highly vascular and Pubic symphysis
Vagina
inverted pear shaped
Urethra
structure present in the
pelvis between the Clitoris
Anus
Labium minora
bladder and the rectum. Labium majora
The uterus is connected Vaginal orifice

to the abdominal wall by

the peritoneal fold called Figure 5.3(a) Diagrammatic sectional view of female pelvis
showing reproductive system
m e s o m e t r i u m .

165
 Zoology

The lower, narrow part

through which the uterus
opens into the vagina is called
the cervix. The cavity of the
cervix is called cervical canal
which along with vagina
forms the birth canal.
The wall of the uterus has
three layers of tissue. The
external thin membranous
Figure 5.3(b) Diagrammatic sectional view of the female perimetrium, the middle
reproductive system
thick layer of smooth muscle
called myometrium and inner
glandular lining layer called endometrium. The endometrium undergoes
cyclic changes during menstrual cycle while the myometrium exhibits strong
contractions during parturition.

4. Vagina
The vagina is a large, median, fibro-muscular tube that extends from the
cervix to the vestibule (the space between the labia minora). It is lined by
non-keratinised stratified squamous epithelium. It is highly vascular, and
opens into the vestibule by the vaginal orifice.

5. Vulva
The term vulva (vulva=to wrap around) or pudendum refers to the external
genitals of the female. The vestibule has two apertures- the upper external
urethral orifice of the urethra and the lower vaginal orifice of vagina. Vaginal
orifice is often covered partially by a membrane called hymen which is a
mucous membrane. Vestibule is bound by two pairs of fleshy folds of tissue
called labia minora (inner) and larger pair called labia majora (outer). Clitoris
is a sensitive, erectile structure, which lies at the upper junction of the two
labia minora above the urethral opening. The clitoris is homologous to the
penis of a male as both are supported by corpora cavernosa internally.
There is a cushion of fatty tissue covered by skin and pubic hair present
above the labia majora. It is known as mons pubis.

NOTE: The hymen is often torn during the first coitus (intercourse). However,
it can also be broken by a sudden fall or jolt, insertion of a vaginal tampon,
active participation in some sports like horseback riding, cycling, etc.

166
 Human ReproductIon

6. Accessory reproductive glands of female

These glands include Bartholin’s glands, Skene’s glands and mammary
glands.

i. Bartholin’s glands
The Bartholin’s glands (Greater vestibular glands) are two glands located
slightly posterior and to the left and right of the opening of the vagina. They
secrete mucus to lubricate the vagina and are homologous to the
bulbourethral glands of the male reproductive system.

ii. Skene’s glands

The Skene’s glands (Lesser vestibular glands) are located on the anterior
wall of the vagina, around the lower end of the urethra. They secrete a
lubricating fluid when stimulated. The Skene’s glands are homologous to the
prostate gland, of the male reproductive system.

iii. Mammary glands

A functional mammary gland is characteristic of all female mammals. The
mammary glands are paired structures (breasts) that contain glandular tissue
and variable amount of fat. The glandular tissue of each breast is divided
into 15-20 mammary lobes containing clusters of cells called alveoli. The
cells of the alveoli secrete milk, which is
stored in the cavities (lumens) of the
alveoli. The alveoli open into mammary
tubules. The tubules of each lobe join to
form a mammary duct. Several
mammary ducts join to form a wider
mammary ampulla which is connected
to lactiferous duct in the ‘nipple’ through
which milk is sucked out by the baby.

5.3 Gametogenesis
Gametogenesis is the process of
formation of gametes i.e. sperms and ova
from the primary sex organs – the testes Figure 5.4 A diagrammatic sectional view of
and ovaries respectively. Gametogenesis Mammary gland

in a male is called spermatogenesis and

that in a female is called oogenesis.

167
 Zoology

5.3.1 Spermatogenesis
In the testis, the immature male germ cells, spermatogonia produce sperms
by spermatogenesis that begins at puberty. The spermatogonial stem cells
(present in the seminiferous tubules) multiply by mitotic divisions and
increase in numbers. Each spermatogonial stem cell is diploid and contains
46 chromosomes. Some of the spermatogonial stem cells develop into primary
spermatocytes which undergo meiosis periodically. A primary spermatocyte
completes the first meiotic division (Meiosis-I) leading to formation of two
equal sized, haploid cells called secondary spermatocytes, which have only
23 chromosomes each. The secondary spermatocytes undergo the second
meiotic division (Meiosis-II) to produce four equal sized haploid spermatids.
The spermatids are transformed into spermatozoa (sperms) by the process
called spermiogenesis. After spermiogenesis, sperm heads become embedded
in the Sertoli cells, and are finally released from the seminiferous tubules by
the process called spermiation.
Spermatogenesis starts at the age of puberty
due to significant increase in the secretion of
gonadotropin releasing hormone (GnRH)
which is a hypothalamic hormone. The
increased levels of GnRH then acts on the
adenohypophysis of pituitary gland and
stimulates secretion of two types of
gonadotropins – luteinising hormone (LH) and
follicle stimulating hormone (FSH). LH acts
on the Leydig cells and stimulates secretion
of androgens. Androgens, in turn, stimulate
the process of spermatogenesis. FSH acts on
Figure 5.5 Diagrammatic sectional view of the Sertoli cells and stimulates secretion of
a seminiferous tubule (enlarged) some factors which help in the process of
spermiogenesis.

5.3.1.1 Structure of a mature spermatozoon

The spermatozoon is a microscopic structure composed of head, neck, middle
piece and a tail. A plasma membrane envelops the whole body of
spermatozoon. The head of a spermatozoon contains an elongated haploid
nucleus. The head is covered by a cap-like structure, the acrosome. The
acrosome contains numerous enzymes (proteases, acid phosphatase,
hyaluronidase etc.) that help fertilisation of the ovum (penetration into the

168
 Human ReproductIon

ovum). The middle piece possesses numerous

mitochondria which produce energy for the
movement of the tail. Sperm motility is essential for
fertilization. A human male ejaculates about 200 to
300 million sperms during coitus. At least 60 percent
sperms must have normal shape and size and at least
40 percent of them must show vigorous motility, for
normal fertility.
Sperms released from the seminiferous tubules, are
transported by the accessory ducts. Secretions of
epididymis, vas deferens, seminal vesicle and prostate
are essential for maturation and motility of sperms.
The seminal plasma along with the sperms Figure 5.6 Structure of a
constitutes the semen. The functions of male sex sperm
accessory ducts and glands are maintained by the
testicular hormones (androgens).

Figure 5.8 Schematic representation of (a) Spermatogenesis; (b) Oogenesis

5.3.2 Oogenesis
The process of formation of a mature female gamete is called oogenesis.
Oogenesis is initiated during the embryonic development stage when a couple
of million gamete mother cells (oogonia) are formed within each foetal
ovary and do not multiply thereafter. These cells start division and stop the
process at prophase-I of the meiosis-I. At this stage these are called primary
oocytes.
169
 Zoology

5.3.2.1 Formation of ovarian follicles

Each primary oocyte then gets surrounded by flattened layer of follicular
(squamous) cells. It is called the primordial follicle. A large number of these
follicles degenerate during the period from birth to puberty. Therefore, at
puberty only 60,000-80,000 follicles are left in each ovary. Later the flattened
follicular cells become cuboidal and proliferate to produce a stratified
epithelium which constitutes the membrana granulosa. The cells are called
granulosa cells. Follicles at this stage of development are called primary
follicles. A homogenous membrane, the zona pellucida, appears between
the primary oocyte and granulosa cells. Zona pellucida is a membrane derived
from the ovum. The innermost layer of granulosa cells are firmly attached to
zona pellucida forming the corona radiata.
A cavity (antrum) appears within the membrana granulosa. The follicular
cavity increases in size. As a result, the wall of the follicle becomes relatively
thin. The oocyte now lies eccentrically in the follicle surrounded by some
granulosa cells. It is called cumulus oophorus. As the follicle expands the
stromal cells surrounding the membrana granulosa become condensed to
form a covering called the theca interna. Outside the theca interna some
fibrous tissue becomes condensed to form another covering called theca
externa. Now these follicles are called secondary follicles. The cells of theca
interna later secrete a hormone called oestrogen. At this stage, the primary
oocyte within the secondary follicle grows in size and completes Meiosis I. It
is an unequal division resulting in the formation of a large haploid secondary
oocyte and a tiny first polar body (haploid).The secondary oocyte retains
bulk of the cytoplasm (nutrient rich) of the primary oocyte. Then the second
meiotic division begins, but stops at the metaphase-II. The secondary follicle
further changes into the mature follicle called Tertiary follicle or Graafian
follicle.
5.3.2.2 Ovulation
The release of ovum (secondary oocyte) from the ovary is called ovulation.
The Graafian follicle is at first very small compared to the thickness of the
cortex of the ovary. As it enlarges, it becomes so big that it reaches the
surface of the ovary, and forms a bulging. Ultimately, the follicle ruptures
releasing the ovum.
5.3.2.3 Structure of ovum
The ovum that is shed from the ovary is not fully mature (it is arrested in the
metaphase-II of the maturation division-Meiosis-II). It is surrounded by the
zona pellucida. Between the cell membrane (vitelline membrane) and the

170
 Human ReproductIon

zona pellucida, a distinct space called

perivitelline space is seen. In it lies
the first polar body, which separates
from the ovum during the first meiotic
division.
5.3.2.4 Corpus luteum
After ovulation the granulosa cells in
the follicle proliferate and are
transformed into a yellowish glandular
mass called corpus luteum (yellow
body). If the ovum is not fertilised, the
corpus luteum persists for about 14
days. During this period it secretes Figure 5.7 Diagrammatic Sectional view of ovary
progesterone and at the end of its
functional life, it degenerates and forms a mass of fibrous tissue called the
corpus albicans (white body).
If the ovum is fertilized leading to pregnancy, the corpus luteum persists
for three to four months. Now it is called corpus luteum of pregnancy. The
progesterone secreted by it is essential for the maintenance of pregnancy in
the first few months. After the fourth month, the corpus luteum is no longer
needed, as the placenta begins to secrete progesterone. The series of changes
that begin with the formation of an ovarian follicle and end with the
degeneration of the corpus luteum constitute what is called an ovarian cycle.

5.3.2.5 Reproductive period

In an individual the formation of gametes takes place only during the
reproductive period which begins at the age of puberty (10 to 14 years). In
women it ends between 45 and 50 years with the onset of menopause and in
men it extends much longer.

5.4 Menstrual Cycle

The reproductive cycle in the female primates (e.g. monkeys, apes and human
beings) is called menstrual cycle. The term menstrual cycle is applied to
cyclical changes that occur in the endometrium every month (mensem: month).
The first menstruation begins at puberty and is called menarche. In human
females, menstruation is repeated at an average interval of about 28/29
days. One ovum is released (ovulation) during the middle of each menstrual

171
 Zoology

cycle. The major events of the menstrual cycle are Menstrual phase, Follicular
phase, Ovulatory phase and Luteal phase.

Menstrual phase
The cycle starts with the menstrual phase (menstruation or menses), when
menstrual flow occurs and it lasts for 3-5 days. The menstrual flow results
due to breakdown of endometrial lining of the uterus and its blood vessels
which forms a fluid that comes out through the vagina. Menstruation occurs
only if the released ovum is not fertilised. Absence of menstruation may be
indicative of pregnancy. However, it may also be caused due to some other
underlying causes like stress, poor health etc.

Follicular phase
During this phase, the primary follicles in the ovary grow to become a fully
mature Graafian follicles and simultaneously the endometrium of the uterus
regenerates through proliferation. These changes in the ovary and the uterus
are induced by changes in the levels of pituitary and ovarian hormones. The
secretion of gonadotropins (LH and FSH) increases towards the end of the
follicular phase, and stimulates follicular development as well as secretion
of estrogens by the growing follicles.

Ovulatory phase
Both LH and FSH attain a peak level in the middle of cycle (about 14th day).
Rapid secretion of LH leading to its maximum level during the mid-cycle is
called LH surge. It induces rupture of Graafian follicle and thereby the release
of ovum, the secondary oocyte (ovulation).

Luteal phase
During luteal phase the remaining parts of the Graafian follicle transform
into the corpus luteum. The corpus luteum secretes large amounts of
progesterone which is essential for maintenance of the uterine endometrium.
Such an endometrium is necessary for implantation of the ‘blastocyst’ stage
and other events of pregnancy. During pregnancy all events of the menstrual
cycle stop and there is no menstruation. In the absence of fertilization, the
corpus luteum degenerates into a whitish body called corpus albicans. This
causes disintegration of the endometrium leading to menstruation.
In human beings, menstrual cycles cease around 50 years of age and it is
referred to as menopause (natural cessation of menstrual cycles). Cyclic

172
 Human ReproductIon

Ovulation phase

Ovulation cycle
Uterine cycle

Ovulation
phase

Figure 5.9 Diagrammatic presentation of various events during a menstrual cycle

menstruation is an indicator of normal reproductive phase and extends

between the menarche and the menopause.

Copulation
During copulation (coitus) semen is ejaculated through the penis into
the vagina (insemination). Spermatozoa acquire the ability to fertilize the
ovum only after they undergo some changes in the female genital tract.
These changes are called capacitation. The changes in the properties of
the zona pellucida after the entry of a sperm constitute the zona reaction.

173
 Zoology

NOTE: Sperm capacitation refers to the physiological changes that the

spermatozoa must undergo in order to be able to penetrate and fertilize an
egg. Changes take place in the membranes over the acrosome and enable
release of lysosomal enzymes. This is called acrosome reaction. The
acrosomal vesicle at the tip of the head fuses with the plasma membrane
of the egg, releasing enzymes from the tip of the sperm.

5.5 Fertilisation and Development

The motile sperms swim rapidly, pass through the cervix, enter the uterus
and finally reach ampullary-isthmic junction of the fallopian tube. The
ovum released by the ovary is also transported to the fallopian tube where
fertilisation (also called conception in humans) takes place.
The oocyte-cumulus complex of the female is surrounded by a zona pellucida,
corona radiata, and cumulus layer. When a motile sperm reaches the ovum,
it makes its way through the corona radiata and zona pellucida. In this
process, the enzyme hyaluronidase released by the acrosome of a sperm (it
is a corona penetrating enzyme) plays an important role in dissolving the
hyaluronic acid in the ground substance of the follicle cells. The enzyme
acrosin released from the acrosome as
an effect of acrosome reaction,
dissolves/digests the zona pellucida
(lysis of the zona pellucida to facilitate
penetration of the sperm). Though
several sperms penetrate through the
zona pellucida into the perivitelline
space, only one sperm enters the ovum
(monospermy). This induces the
completion of the meiosis-II of the
secondary oocyte (ovum). The second
meiotic division is also unequal and
results in the formation of a second
polar body and an ovum (ootid). The
fusion of gametes is called syngamy or
amphimixis. The nuclear union results
Figure 5.10 Ovum surrounded by some sperms in the formation of synkaryon (zygotic
nucleus). Corona radiata disappears
after fertilisation. The entry of sperm causes release of calcium which blocks
the entry of other sperms. A parallel reaction is the ‘zonal reaction’.

174
 Human ReproductIon

NOTE: One has to remember that the sex of the baby has been decided at
the time of fertilization itself. Let us see how? As you know the chromosome
pattern in the human female is XX and that in the male is XY. Therefore,
all the haploid gametes produced by the female (ova) have the sex
chromosome X, whereas the male gametes (sperms) have either X
chromosome or Y chromosome (50 percent of sperms carry the X
chromosome while the other 50 percent carry the Y chromosome).
After fusion of the male and female gametes the zygote would carry either
XX or XY depending on what type of sperm fertilised the ovum. The zygote
carrying ‘XX’ would develop into a female child and that with ‘XY’ would
form a male child. So, the sex of a child depends on the male parent
(heterogametic parent).

5.6 Develpment
5.6.1 Cleavage
Human embryology is the study of human development during the first eight
weeks after fertilization. From the beginning of the 9th week, the developing
young one is called foetus. The type of cleavage is holoblastic, because of
the microlecithal condition of egg, and indeterminate. The first
division(cleavage) occurs at about 36 hours after fertilization. The blastomeres
are equal in size.

5.6.2 Morula
When the number of daughter cells is 16-32, the solid ball of cells is called
morula as it looks like a ‘mulberry’. At this stage the cells start to bind
firmly together and this process is called compaction (the cells of the morula
become bound tightly together and the outer surface of blastomeres ‘flatten’
against each other). This tightly packed arrangement is stabilized by ‘tight
junctions’ that form between the outer cells of the morula. The cells within
the sphere form ‘gap junctions’, which help in better passage of substances
between them. The tiny embryo is still surrounded by the glyco-proteinous
layer of the egg, the zona pellucida. At the completion of cleavage/
blastulation, the embryo has a central cavity called ‘blastocoel’. Now the
embryo has a superficial flat cell layer and an ‘inner cell mass’. The cells on
the exterior of this early embryo develop into the trophoblast or trophectoderm
(the outer epithelium of the blastocyst). The blastocyst is formed while the
early embryo passes through the fallopian tube.
5.6.3 Blastocyst
Some fluid is secreted into this cavity. As the quantity of the fluid increases,
the embryo acquires the shape of a ‘cyst’, hence the name ‘blastocyst’. The
process of formation of a space around the formative cells is called ‘cavitation’.

175
 Zoology

The ‘inner cell mass / ‘formative cells’, which give rise to the ‘embryo
proper‘ and some fetal membranes and so these cells constitute the
‘embryoblast’. They are the source of all the pluripotent ‘embryonic stem
cell lines’ . In addition to the embryo proper the inner cell mass gives rise to
the extra-embryonic membranes also.

5.6.4 Implantation
The blastocyst ‘hatches’ out/comes out of the envelope, the zona
pellucida, by lysing its wall with the help of the enzyme called strypsin.
Later the cells of the zona pellucida gradually disappear. The cells of the
trophoblast stick to the uterine endometrium and form a part of the ‘foetal
part’ of the ‘placenta’ later. The trophoblast invades the endometrium of the
uterus. In humans, the process of
implantation begins on the 6th day after
fertilisation. The process of implantation
is aided by proteolytic enzymes
produced by the cells of the
trophoblast.The trophoblast thickens
through cell division and the wall of
the trophoblast develops villi
(‘trophoblastic villi’) that branch and
project into the highly vascular uterine
endometrium, to draw ‘nourishment’ for
the embryo. The trophoblast
differentiates into an inner cellular layer
called ‘cyto-trophoblast’ (cellular
trophoblast) or ‘layer of Langhans’
Figure 5.11 Transport of ovum, fertilization and consisting of cuboidal epithelial cells , and
passage of growing embryo through
fallopian tube outer ‘syncytio-trophoblast’ (a layer of
fused cells). The embryo along with its
membranes is called conceptus.
Formation of Bilaminar Embryonic Disc
Implantation of the blastocyst is completed by the end of the second
week. The inner cell mass forms into a ‘disc’ called embryonic disc or
germinal disc. The embryonic disc has an outer group of cells called the
‘EPIBLAST’ (primitive ectoderm) and inner layer of cells ,the ‘HYPOBLAST’
(primitive endoderm made up of cuboidal cells).The hypoblast lines surface

176
 Human ReproductIon

facing the blastocyst cavity. It is the future extra embryonic endoderm.The

hypoblast is pushed down(delamination) and it forms the lining of the ‘yolk
sac’(exocoelomic cavity). The remaining part of the embryonic disc is called
the epiblast (primitive ectoderm made up of columnar cells). Now the
embryonic disc is called bilaminar embryonic disc. Further development
involves ‘gastrulation’.

Gastrulation
Gastrulation is an important ‘dynamic process’ in the development of the
early embryo, which involves movement of cell masses to their definitive
positions in the embryo and form their three primary germinal layers.
These movements are called morphogenetic movements.
Along the longitudinal axis of the embryonic disc, a primitive streak is
formed. Formation of the primitive streak marks the beginning of
gastrulation. A longitudinal furrow known as primitive groove forms along
the middle of the primitive streak. On either side of it are the primitive
folds. Anteriorly the primitive streak has a shallow primitive pit. The
region in front of the primitive streak becomes thickened. This thickened
part of the streak is called the primitive knot or primitive node or Hensen’s
node. The primitive streak and Hensen’s node provide places / avenues
for the migration / ingression of the future mesodermal and chorda-
mesodermal cells to their respective places for further differentiation. This
process of migration of cells is called ‘gastrulation’. The process of
gastrulation transforms the two-layered embryo into a three-layered
embryo.
Trilaminar Embryo - Formation of Primary Germ Layers
Ingression of the future endodermal cells from the epiblast, replaces
the hypoblast and forms the endoderm of the embryo. The future
mesodermal cells converge towards the primitive folds, move through the
primitive groove and reach between epiblast and endoderm. The remaining
epiblast now constitutes the ectoderm. Thus the three germinal layers
namely ectoderm, mesoderm and endoderm are all derived from the
undifferentiated cells of the epiblast.Thus the bilaminar embryonic disc
is transformed into a trilaminar embryonic disc.
5.6.2 Formation of the Notochord and Neural Tube
The chorda mesodermal cells present in the epiblast of the embryo converge
and involute through the Hensen’s node and extend ‘forwards’ as
notochordal process / notochordal rudiment. This is later transformed

177
 Zoology

into a solid rod – the notochord, the embryonic axial skeleton which is
replaced by the ‘vertebral column’. The notochordal mesoderm induces the
‘overlying ectodermal cells’ to form the neural plate. This is a good example
of induction where one tissue induces the formation of another. The neural
plate invaginates towards the notochord to form a neural groove, which
deepens progressively to form a tube by the fusion of the lateral neural
folds. The process of formation of neural tube is referred to as ‘neurulation’
.
Differentiation of Mesoderm and Formation of Coelom
The intra embryonic mesoderm spreads in all directions between the
outer ectoderm and inner endoderm. The longitudinal column of mesoderm
adjacent to the notochord and neural tube on either side is called epimere
(paraxial mesoderm). The mesoderm around the gut is the hypomere
(lateral plate mesoderm). The mesoderm in between these two is the
mesomere (intermediate mesoderm). The epimere become s segmented
into cubical blocks called somites or metameres. Each somite differentiates
into sclerotome, myotome, and dermatome. The sclerotome forms the
vertebral column. The myotome forms the voluntary muscles of the body.
The dermatome forms the dermis of the skin and other connective tissues.
The mesomere forms the urinogenital organs and their ducts. The hypomere
splits into outer somatic and inner splanchnic mesodermal layers. Intra
embryonic coelom is formed between these two layers. It gives rise to
pericardial, pleural, peritoneal cavities etc.
Extraembryonic Membranes
Development of the foetal /extra-embryonic membranes helps protect the
embryo from desiccation, mechanical shock, absorption of nutrients,
exchange of gases etc. The epiblast adjacent to the trophoblast ‘migrates’
away from the ‘trophoblast’ forming the amniotic cavity. (NOTE: The
formation of amnion and chorion in human embryos is different from that
in the other amniotes). The lining of the amniotic cavity is made up of cells
called ‘amnioblasts’, derived from the ‘epiblast’. The amnion is filled with
‘water’ (amniotic fluid). The hypoblast is pushed ‘down’ forming the lining
of a cavity called yolk sac. The chorion consists of an outer layer formed
by the primitive ectoderm or trophoblast, and an inner by the somatic
mesoderm / extraembryonic mesoderm from which the chorionic cavity is
formed. The chorion undergoes rapid proliferation of cells and forms chorionic
villi. The chorionic villi invade the endometrium and help in the transfer
of nutrients and oxygen from maternal blood to fetal blood. The chorion
surrounds the embryo and other membranes. Soon, a fourth membrane
called allantois develops as an outgrowth from the ‘embryonic hindgut’

178
 Human ReproductIon

(splanchnopleure consisting of outer mesodermal layer and inner

endoderm). The membrane of the allantois meets the inner surface of the
chorion and forms a highly vascularised region called allanto-chorion.The
allanto–chorion contributes the ‘foetal part’ of the placenta.The placenta
facilitates a more effective and efficient part for exchange / passage of
nutrients , respiratory gases ,hormones ,antibodies etc. between the foetus
and mother by the 12th week of pregnancy.
Organogenesis: During organogenesis, regions of the three embryonic germ
layers develop into the rudiments of organs.

5.7 Formation of Placenta

The placenta consists of two
essential portions: a maternal Chorionic mesoderm
part of the placenta derived
Amnion
from the endometrium of the
Mesoderm
uterus, and foetal membranes Endoderm
of the foetal part of the placenta. Yolk (made of Splanchnopleure)
The maternal components of the Extraembryonic mesoderm
placenta are : Uterine Allantois (from hind gut)
epithelium, Uterine connective
Trophoblastic part of chorion
tissue and Uterine capillary
endothelium. The foetal Figure 5.12 Formation of Placenta
components of the placenta are
foetal capillary endothelium, foetal connective tissue and foetal chorionic
epithelium. The inner region of the chorionic villi develops a network of
capillaries of the umbilical artery and umbilical vein. These vessels run in
the tough umbilical cord .The placenta of humans is called chorioallantoic
placenta as allantois also fuses with the chorion in the process of
vascularisation. Placenta is described as haemochorial as the maternal
blood comes into direct contact with the membrane of the foetal chorionic
villi.
Functions of Placenta
The placenta facilitates the supply of oxygen and nutrients to the embryo
and also removal of carbon dioxide and excretory/waste materials produced
by the embryo. The placenta is connected to the embryo through an umbilical
cord which helps in the transport of substances to and from the embryo.
Progesterone secreted by the placenta is essential for the maintenance of
pregnancy after the 4 th month (when the corpus luteum degenerates).

179
 Zoology

Oestrogens (mainly estradiol) produced by the placenta reach maternal blood

and promote uterine growth and development of the mammary glands. Human
chorionic gonadotropin (hCG) produced by the placenta is similar in its
actions to luteinizing hormone.Human chorionic gonadotropin sends the
message of pregnancy to the Master Endocrine System so that LH is secreted
to maintain corpus luteum and prevent menstruation and further ovulation.
Gonadotropins are excreted through maternal urine where their presence in
urine is used as a test to detect pregnancy in its early stages.
Somatomammotropin, also called ‘placental lactogen’ has an ‘anti-insulin
effect’ on the mother leading to increased plasma levels of glucose and amino
acids in the maternal circulation. In this way it increases the availability of
these materials to the foetus. The placenta protects the foetus from the
relatively high blood pressure of the maternal circulation .The foetal tissue
having paternal chromosomal effect, acts as foreign structure(antigenic
allograft) to the mother who produces antibodies. The foetus sustains such
a rejection for about 38-40 weeks by producing certain immunosuppressant
substances .
5.8 Pregnancy
Pregnancy is the intra uterine development of the embryo or foetus (also
called gestation period), in a woman’s uterus. Human pregnancy averages
266 days (38 weeks) from fertilization of the egg, or 40 weeks from the start
of the last menstrual cycle.
Timetable of some events during pregnancy
Human gestation can be divided for convenience into three trimesters of
about three months each. The first trimester is the main period of
organogenesis, the development of the body
organs. In human beings, after one month of
pregnancy, the embryo’s heart is formed. The first
sign of growing foetus may be noticed by listening
to the heart sounds carefully using a stethoscope.
By the end of the second month of pregnancy, the
foetus develops limbs and digits. By the end of 12
weeks (first trimester), most of the major organ
systems are formed, for example, the limbs and
external genital organs are well-developed. The first
Figure 5.13 The human foetus
movements of the foetus and appearance of hair
within the uterus on the head are usually observed during the fifth

180
 Human ReproductIon

month. By the end of 24 weeks (second trimester), the body is covered with
fine hair, eye-lids separate, and eyelashes are formed. By the end of nine
months of pregnancy (third trimester), the foetus is fully developed and is
ready for delivery.

5.9 Parturition
Childbirth begins with labor, a series of strong, rhythmic uterine contractions
that push the fetus and placenta out of the body. This process of delivery of
the foetus (childbirth) is called parturition. Parturition is induced by a
complex neuroendocrine mechanism. The signals for parturition originate
from the ‘fully developed foetus’ and the ‘placenta’, which induce mild uterine
contractions called foetal ejection reflex. This triggers release of oxytocin
from the maternal pituitary. Oxytocin acts on the uterine muscle and causes
stronger uterine contractions, which in turn stimulate further secretion of
oxytocin. The stimulatory reflex between the uterine contractions and oxytocin
secretion continues resulting in increasingly stronger contractions. This leads
to expulsion of the baby out of the uterus through the birth canal. Soon after
the infant is delivered, the placenta along with decidua is also expelled out
of the uterus.

5.10 Lactation
One aspect of post-natal care unique to mammals is lactation, the production
of mother’s milk. In response to suckling by the newborn, as well as changes
in estradiol levels after birth, the hypothalamus signals the anterior pituitary
to secrete prolactin, which stimulates the mammary glands to produce milk.
The mammary glands of the female undergo differentiation during pregnancy
and starts producing milk towards the end of pregnancy (lactation). This
helps the mother in feeding the newborn. The milk produced during the
initial few days of lactation is called colostrum, which contains several
antibodies (especially Ig-A) absolutely essential to protect the new-born babies
from initial sources of infections. Breast-feeding during the initial period of
infant growth is recommended by doctors for bringing up a healthy baby.

181
 Zoology

GLOSSARY
Androgens: Androgens are the Involution: The inward growth and
generic term for any natural or curling inward of a group of cells
synthetic compound, usually (prospective mesodermal cells), as in
a steroid hormone, that stimulates the formation of a gastrula from a
or controls the development and blastula.
maintenance of male characteristics Oogonium: A primordial oocyte
in vertebrates. during fetal development; it is
Decidua: After the implantation of the derived from a primordial germ cell
embryo, the uterine endometrium is and before birth becomes a primary
differentiated into a spongy, vascular oocyte; The primitive egg mother cell
layer called decidua. The portion of from which the oocytes develop.
the decidua where the placenta is to Polar body: One of the small cells
be formed (i.e. inner to the produced during the two meiotic
developing blastocyst lying between divisions in the maturation of a
the blastocycst and uterine female gamete, or ovum. Polar
myometrium) is called the decidua bodies are nonfunctional and
basalis. The part of the decidua that incapable of being fertilized.
separates the embryo from the Somatopleure: A complex sheet of
uterine lumen is called the decidua embryonic cells formed by
capsularis. The part lining the rest association of part of the mesoderm
of the uterine cavity is called the with the ectoderm. It continues as
decidua parietalis /deciduas vera. the amnion and chorion external to
At the end of pregnancy the decidua the embryo.
is shed off, along with the placenta
Splanchnopleure: Greek splanchno =
and membranes.
the viscera; pleur = the side, a layer
Foetus: It is a developing mammal or of tissue in the early developing
other viviparous vertebrate after embryo, formed by the union of
the embryonic stage and before extra embryonic endoderm and
birth. splanchnic mesoderm. It gives rise
Formative cells : the embryonic cells to the embryonic gut and the visceral
which are capable of producing new organs and continues externally to
cells or tissue. the embryo as the yolk sac and
Intromittent organ: An intromittent allantois.
organ is a general term for an Umbilical cord: In placental
external organ of a male organism mammals, the umbilical cord (birth
that is specialized to deliver sperm cord or funiculus umbilicalis) is the
during copulation (the male connecting cord from the developing
copulatory organ of an animal). embryo or foetus to the placenta.

182
 Human ReproductIon

QUESTIONS
Very Short Answer Type Questions Short Answer Type Questions

1. Where are the testes located in man? 1. Describe microscopic structure of

Name the protective coverings of each testis of man.
testis. 2. Describe the microscopic structure
2. Name the canals that connect the of ovary of woman.
cavities of scrotal sac and abdominal 3. Describe the Graaian follicle in
cavity. Name the structures that woman.
keep the testes in their position. 4. Draw a labelled diagram of the male
3. What are the functions of Sertoli cells reproductive system.
of the seminiferous tubules and the 5. Draw a labelled diagram of the
Leydig cells in man? female reproductive system.
4. Name the copulatory structure of 6. Describe the structure of
man. What are the three columns of seminiferous tubule.
tissues in it? 7. What is spermatogenesis? Briefly
5. Define spermiogenesis and describe the process of
spermiation. spermatogenesis in man.
6. Name the yellow mass of cells 8. What is oogenesis? Give a brief
accumulated in the empty follicle after account of oogenesis in a woman.
ovulation. Name the hormone 9. Draw a labelled diagram of a
secreted by it and what is its function? Graafian follicle.
7. Define gestation period. What is the 10. In our society women are often
duration of gestation period in the blamed for giving birth to daughters.
human beings? Can you explain why this is not
8. What is implantation, with reference correct?
to embryo? 11.Describe the accessory glands
9. Distinguish between epiblast and associated with male reproductive
hypoblast. system of man.
10. Write two major functions, each of 12. Describe the placenta in a woman.
testis and ovary.
11. Draw a labelled diagram of a sperm. Long Answer Type Questions
12. What are the major components of the
seminal fluid? 1. Describe female reproductive system
of a woman with the help of a
13. What is menstrual cycle? Which
labelled diagram.
hormones regulate menstrual cycle?
2. Describe male reproductive system
14. What is parturition? Which homones of a man. Draw a labelled diagram
are involved in inducing parturition? of it.
15. What is capacitation of sperms? 3. Write an essay on different events
16. Distinguish between involution and that occur during development of a
ingression in the human human.
development.

183
 Zoology

UNIT V B
Reproductive Health
5.11 Need for Reproductive Health and
Prevention of Sexually Transmitted
Diseases
5.12 Birth control – Need and Methods
5.13 Amniocentesis, Infertility and Assisted
Reproductive Technologies (ART)

In simple terms, the term ‘reproductive health’ refers to having healthy

reproductive organs with normal functioning. However in a broader point of
view, it includes the emotional and social aspects of reproduction also.
According to the World Health Organization (WHO), ‘reproductive health’ is a
state of complete well being of individuals in physical, functional, emotional,
behavioral and social aspects of reproductive system. A society will be considered
‘reproductively healthy’ when the people have physically and functionally normal
reproductive processes and normal emotional and behavioral interactions among
themselves, in all sex related aspects.

184
 Human ReproductIon

5.11 Need for Reproductive Health and Prevention

of Sexually Transmitted Diseases
Reproductive health problems remain the leading cause of death and disease
in the people of reproductive age, worldwide. In India maternal mortality
rate and infant mortality rate are high. Spread of Sexually transmitted
diseases (STDs) is still a major problem. Approximately 2 million people in
India live with HIV/AIDS.
Everyone has the right to enjoy reproductive health and healthy children.
India is among the first countries in the world to initiate action plans and
programmes at the national level to attain total reproductive health as a
social goal. These programmes called Family Planning Programmes were
initiated as far back as in 1951. Improved programmes covering wider
reproduction-related areas are currently in operation under the popular name
Reproductive and Child Healthcare (RCH) Programmes. Programmes such
as massive child immunization, supply of nutritional food to the pregnant
women, Janani Suraksha Yojana (for promoting institutionalized deliveries)
etc. are some important healthcare programmes taken up at national level
by the Government. Creating awareness among the people on various
reproduction-related aspects and providing facilities and support for building
up a reproductively healthy society are the major tasks under these
programmes.
Governmental and non-governmental agencies have taken various steps to
educate people on reproduction-related issues using audio-visual and print
media. Introduction of sex education in schools will provide right information
to the young on sex and other related issues. Proper information about the
reproductive organs, adolescence and related changes, safe and hygienic
sexual practices, sexually transmitted diseases such as HIV/AIDS, etc. would
help people, especially those in the adolescent age group to lead a
reproductively healthy life. People, especially fertile couples and those in
marriageable age group, should be well informed about available birth control
options, care of pregnant mothers, post natal (after birth) care of the mother
and new born child, importance of breast feeding, giving equal preference
for male and female child etc. This will help in bringing up healthy families
of desired size. Awareness should be created in the society on problems
caused by uncontrolled population growth and social evils like sex abuse
and sex related crimes etc.

185
 Zoology

Female Foeticide – A Burning Problem In India: Female foeticide (the

act of aborting a female foetus) is a major social problem in India. Sex
determination of the foetus first became possible in India with the advent
of amniocentesis in 1970s. This technology intended to detect genetic
abnormalities in foetuses, was often used to determine the sex of the
foetus. As early as in 1976 the Government banned the use of these
tests for the purpose of sex determination of the foetus. Later in 1987
3D ultra sound scanning technique was invented for detecting
developmental abnormalities in foetuses. Misuse of ultrasound scanning
for the sex determination of foetus became very common which
significantly increased the number of female foeticides in the country.
As a measure to legally check increasing female foeticides, the
Government of India enacted the Pre-natal Diagnostic Techniques
(Regulation and prevention of misuse) Act, 1994 with stringent
punishment rules.
ACTION PLANS: Successful implementation of various action plans to
attain reproductive health requires strong infrastructural facilities,
professional expertise and material support. These are essential to provide
medical assistance and care to people in reproduction-related problems
namely pregnancy, delivery, STDs, abortions, contraception, menstrual
problems, infertility, etc.
Sexually Transmitted Diseases (STDs)
Diseases or infections which are transmitted through sexual contact
(intercourse) are collectively called sexually transmitted diseases (STDs) or
venereal diseases (VDs) or reproductive tract infections (RTI). Most common
STDs and their causative organisms are shown in the table below.

S.No Name of the Disease Causative organism

1 Gonorrhea Neisseria gonorrhoeae (bacteria)
2 Syphilis T reponema pallidum (spirochete
bacterium)
3 Genital herpes Herpes simplex virus (HSV)
4 Genital warts, cervical cancer Human papilloma virus (HPV)
5 Trichomoniasis Trichomonas vaginalis (a protozoan
parasite )
6 Chlamydiasis Chlamydia trachomatis (bacteria)
7 Hepatitis – B HBV
8 HIV infection/AIDS HIV (Human immunodeficiency virus)

186
 Human ReproductIon

General Information About STDs

Except for hepatitis-B, genital herpes and HIV infection, all the above diseases
are completely curable if they are detected early and treated properly. Sharing
injection needles, surgical instruments etc. with infected persons, transfusion
of contaminated blood, or from infected mother to the foetus are the other
possible ways of transmission of Hepatitis-B, HIV infections etc. Early
symptoms of most of the above mentioned diseases are minor and include
itching, fluid discharge, slight pain, swellings etc. in the genital region.
Infected females may often be asymptomatic and hence may remain undetected
for long. Untreated STDs in women may lead to complications such as pelvic
inflammatory diseases (PID), abortions, still births, ectopic pregnancies
(ectopic pregnancy is an abnormal pregnancy that occurs outside the uterus
and the foetus generally cannot survive), infertility or even cancer of the
reproductive tract. STDs are a major threat to a healthy society. Therefore
prevention or early detection and cure of these diseases are given prime
consideration under the reproductive healthcare programmes. Persons in
the age group of 15-24 years are more vulnerable to contract STDs. But
there is no need to panic as the prevention is right in the hands of youngsters
themselves if they follow the simple principles mentioned below.
i) Avoiding sex with unknown partners/multiple partners,
ii) Using condoms compulsorily during coitus
iii) Consulting qualified doctor for early detection of STDs and getting
complete treatment in case of infections.

5.12 Birth Control – Need And Methods

In the last century an all-round development in various fields significantly
improved the quality of life of the people. However, the increased healthcare
facilities along with better living conditions had an explosive impact on the
population growth. Probable reasons for this growth rate are decline in death
rate, maternal mortality rate (MMR) and infant mortality rate (IMR).
According to the 2011 census the population growth rate (annual %) is still
around 1.64 percent. Such a high growth rate could lead to an absolute
scarcity of even the basic requirements i.e. food, shelter and clothing, in
spite of significant progress made in those areas.
To overcome the problem of population explosion, birth control is the only
available solution. People should be motivated to have smaller families by
using various contraceptive methods. Statutory raise of marriageable age of
the females to 18 and that of males to 21 years, and providing incentives to
couples with smaller families are two of the other measures taken by the
Government to tackle this problem.
187
 Zoology

5.12.1 Contraception
The intentional prevention of conception (fertilization of an egg by a sperm
at the beginning of pregnancy) by natural or artificial means is called
contraception. Contraceptives prevent pregnancy by interfering with the
normal process of ovulation, fertilization, and implantation. There are different
kinds of contraceptives that act at different points of the process of conception.
An ideal contraceptive should have the following qualities. i) user- friendly,
ii) easily available, iii) effective and reversible with no or less side effects
and iv) does not affect the sexual life of the user.
A wide range of contraceptive methods are presently available which could
be broadly classified as follows. 1. Natural/Traditional methods, 2. Barriers,
3. Intrauterine devices (IUDs), 4. Oral contraceptive pills, 5. Injectables,
Implants, Vaginal rings and Skin patches, and 6. Surgical methods

1. Natural methods
These methods depend on the principle of avoiding chances of sperms
meeting the ovum. These are of three types.
i) Periodic abstinence: In this method couples avoid or abstain from coitus
from the 10th to the 17th day of the menstrual cycle (the fertile period),
when ovulation generally occurs.
ii) Withdrawal or Coitus interruptus: In this method, the male partner
withdraws his penis from the vagina, just before ‘ejaculation’, so as to
avoid insemination.
iii) Lactational amenorrhea method: Amenorrhoea means absence of
menstruation (missing of menstrual period). Ovulation generally will
not occur during the period of intense lactation by the mother following
parturition (delivery). This is known as Lactational amenorrhea. Some
couples utilize the contraceptive benefit of this method.

NOTE: As long as the mother fully breast feeds her child, chances of
conception are almost zero. In addition breast feeding offers many benefits
to the infant such as enhanced immunity, protection against allergies
etc. However, this method has been reported to be effective only up to a
maximum of six months following parturition

2. Barrier methods
In barrier methods, sperms are prevented from
physically meeting with the ovum by barriers.
Condoms (male and female condoms) are popular
Figure 5.13 Condom for male
barriers in use. They are made of thin rubber/

188
 Human ReproductIon

latex sheath. Condoms are used to cover the penis

in the male and cervix (neck of the uterus) or vagina
in the female to prevent ejaculated semen from
entering into the uterus of the female. Nirodh is
an easily wearable popular brand of condoms for
males, widely used in India. Using condom will
give an additional benefit of protection from
contracting (getting infected by) STDs. Other types Fig 5.14 Female condom
of ‘reusable’ ‘female barriers’ called diaphragms,
cervical caps and vaults (made of rubber) are available. Spermicidal creams,
jellies and foams are also useful.
3. Intra Uterine Devices (IUDs)
These devices are inserted into the uterus by doctors or trained
nurses through vagina. Different types of IUDs such as Non-
medicated IUDs (e.g. Lippes loop), Copper releasing IUDs
(Cu T, Cu 7, Multiload 375) and hormone releasing IUDs
(Progestasert, LNG-20) are available for contraception. IUDs
promote ‘phagocytosis’ of sperms by white blood corpuscles
within the uterus and the copper ions released suppress the
motility, viability and fertilizing capacity of the spermatozoa.
The hormone releasing IUDs, in addition, make the uterus
unsuitable for implantation and the cervix hostile/antagonistic
to the sperms. IUDs are ideal contraceptives to females who
Fig 5.15 Copper T
want to delay and/or have space between children. This is a
widely accepted method of contraception in India.

4. Oral contraceptive pills (OCPs)

Oral administration of small doses of progestogens or progestogen-estrogen
combinations in the form of tablets or pills is another popular contraceptive
method used by females. Pills have to be taken daily for a period of 21 days
starting preferably within the first five days of the menstrual cycle. After a
gap of 7 days (during which menstruation occurs) the same course in the
same pattern has to be repeated as long as the female desires to prevent
conception. The pill inhibits ovulation, implantation and also alters the
quality of cervical mucous and retards entry of sperms. A once a week pill
by name Saheli developed by CDRI, Lucknow is a non-steroidal oral
contraceptive preparation with very few side effects and high contraceptive
value.

189
 Zoology

5. Contraceptive Injections, Drug releasing Implants, Vaginal rings

and Skin patches
Progestogens alone or in combination with estrogen
can also be used by females in the form of injections,
implants, vaginal rings and skin patches. An injection
of depot medroxyprogesterone acetate (DMPA)
provides protection against pregnancy for three
months. A contraceptive implant is a single rod about
the size of a match stick. A health care provider inserts
the implant under the skin with a special applicator.
It prevents pregnancy for a period of three years.
Fig 5.16 Implants Vaginal ring is a flexible, plastic ring to be inserted
into vagina. It releases small doses of estrogen and
progestogen which prevent conception. Small skin patches loaded with
contraceptive hormones are worn on the skin. These patches slowly release
estrogen and progestogen into blood stream to prevent pregnancy.

NOTE: Administration of progestogens or progestogen-estrogen

combinations or copper-bearing IUDs within 72 hours of coitus have
been found to be very effective emergency contraceptives as they could
be used to avoid possible pregnancy due to rape or casual unprotected
intercourse.

6. Surgical methods :
Surgical procedure to prevent pregnancy is also known as sterilization.
Sterilization procedure in the male is called vasectomy and that in the
female, tubectomy.
Fallopian tubes
cut and tied

Vas deference
cut and tied

Fig 5.17 Vasectomy Fig 5.18 Tubectomy

190
 Human ReproductIon

i. Vasectomy : A small part of the vas deferens on either side is

removed or tied up through a small incision on the scrotum. Thus
the sperms are prevented from reaching seminal vesicle and so the
‘semen’ in ‘vasectomised’ males do not contain sperms.
ii. Tubectomy: A small part of the fallopian tube on both sides is
removed or tied up through a small incision made in the abdomen or
through vagina. This will block the entry of ova into the fallopian
tubes and thus pregnancy is prevented.

5.12.2 Medical Termination of Pregnancy (MTP)

Intentional or voluntary termination of pregnancy before the full term of
gestation is called Medical termination of pregnancy (MTP) or induced
abortion. In this procedure pregnancy is terminated with the help of
medications. Government of India made an act in 1971 legalizing MTP with
certain restrictions and conditions to avoid its misuse. These restrictions
are more important that the administrative machinery can keep a check on
indiscriminate and illegal female foeticides. Legalizing MTP is still an issue
of serious debate in many countries because of ethical, religious and social
issues involved.

Medical Terminaiton of Pregnancy (MTP)

It is considered to be the only available choice to get rid of unwanted
pregnancies resulted due to casual unprotected intercourse, failure of the
contraceptive used during coitus or in case of rapes or in the case of confirmed
incurable genetic disorders in the foetus. In cases where continuation of
pregnancy could be harmful or even fatal either to the mother, or to the
foetus or for both, MTP is the inevitable solution.

5.13 Amniocentesis, Infertility and Assisted

Reproductive Technology (ART)
5.13.1 Amniocentesis
Amniocentesis is a diagnostic procedure to detect genetic defects in the
unborn baby. In this procedure, usually a needle is inserted through the
mother’s abdominal wall into the amniotic sac. The physician carefully
punctures the sac and extracts some amniotic fluid. For prenatal diagnosis
of suspected genetic disorders, the foetal cells are separated from the extracted
sample. The chromosomes of the stained foetal cells are examined under a
microscope for abnormalities. The most common abnormalities that can be
detected by amniocentesis are Down syndrome, Edwards syndrome and
Turner’s syndrome.

191
 Zoology

The purpose of amniocentesis, ultrasound scanning etc. is often defeated

because such tests mostly end up in illegal female foeticide, at least in
certain parts of India.
5.13.2 Infertility
Another important sub-topic to be discussed under the heading Reproductive
Health is Infertility. Infertility is biological inability of a person to contribute
to conception. A large number of couples in the conceivable age all over the
world are childless. The reasons could be many - physical, genetic, certain
diseases, drugs, immunological or even psychological. In India female partners
are often blamed for not conceiving, in childless couple. But in many cases,
the problem lies with male partner. Infertility clinics and specialized health
care units could help in diagnosis and corrective treatment of some of these
disorders and enable the couples to have children in natural way.
5.13.3 Assisted Reproductive Technology (ART)
In the cases where such corrections are not possible, the couple could be
assisted to have children through certain special techniques known as
Assisted Reproductive Technology (ART). The following are some important
techniques employed in ART.
1. In Vitro Fertilization and Embryo Transfer (IVF-ET)
Fertilization of ovum by sperm done outside the body of a woman is
called in vitro fertilization. The resultant early embryonic stage (with
generally 8 blastomeres) is transferred into the mother’s uterus for
further development (Embryo Transfer or Intra Uterine Transfer -
IUT). In this method, which is popularly known as Test Tube Baby
Procedure, ova from the wife/female donor and sperms from the
husband/male donor are collected, mixed and induced to form zygote
under simulated conditions (almost similar conditions as that in the
female body) in the laboratory. If the mother’s uterus is not medically
fit to receive the embryo produced in vitro, it can be implanted in the
uterus of another woman (surrogate mother) willing to carry this
embryo.
2. Zygote Intrafallopian Transfer (ZIFT)
This is another technique used to overcome infertility. The ovum is
extracted and fertilized in vitro (outside the body) and the zygote is
transferred to the woman’s fallopian tube to complete its further course
of development (“intrafallopian” means “inside the fallopian tubes”).

192
 Human ReproductIon

3. Gamete Intrafallopian Transfer (GIFT)

Some women cannot produce ova either due to defects or diseases in
the ovaries, but still can provide suitable environment for fertilization
and further development of the embryo in their uteri. In such cases an
ovum collected from a donor is transferred to the fallopian tube of the
recipient woman for fertilization. This method is known as GIFT.
4. Intracytoplasmic Sperm Injection (ICSI)
This is another specialized procedure in which a sperm is directly injected
into the ovum with the help of a microscopic needle to form an embryo
in the laboratory. Later the embryo is transferred to the uterus or
fallopian tube for further development. This method is employed to assist
the couple where there are problems with the sperms such as decrease
in sperm count.
5. Artificial Insemination (AI)
In cases of infertility either due to inability of the male partner to
inseminate the female or due to very low sperm count in the ejaculate,
artificial insemination technique is suggested. In this technique, semen
is collected from the husband/healthy donor and is introduced into the
uterus (Intrauterine insemination- IUI) for achieving fertilization.

Surrogacy
In the instances where the women have problems with conceiving or
providing suitable environment for the development of the embryo in her
uterus, surrogacy is suggested. The ovum of the wife/donor and the sperm
of the husband/male donor are fertilized and the zygote is transferred into
the womb of a surrogate mother (a woman who provides her uterus for
the development of some other person’s embryo and carries the baby until
delivery).

NOTE: Though there are many options to tackle infertility problems, all
those techniques require professionals and use of expensive instrumentation.
Religious and social factors may discourage the adoption of some of the
procedures. There is one good way out – the adoption of a child .Indian
law permits legal adoption and it is the best choice for the childless couples
looking for parenthood.

193
 Zoology

GLOSSARY
Amenorrhea: Absence of menstrual wall of the uterus / lining of the
period / menstruation in women womb to receive nourishment
of reproducible age. from the mother, for development,
Amniotic sac: The amniotic sac is the in the ‘placental mammals’.
extra-embryonic sac filled with Insemination: ‘Insemination’ is the
amniotic fluid (liquor amnii). introduction of sperm into the
Amnion surrounds and protects uterus for impregnating a female.
the embryo from shock /injury, Insemination normally takes
and also provides a watery bag in place during coitus. When semen
which free movements of the fetus is introduced by a medical
during the later stages of procedure to facilitate conception,
pregnancy are facilitated. it is called ‘artificial insemination’.
Blastomere: Any of the cells resulting In vitro: In an artificial environment
from the cleavage of a fertilized (for example in a test tube in a
ovum/zygote during the early laboratory) outside the living
embryonic development. organism’s body.
Coitus: Sexual union between a male In vivo: Within the living organism
and a female involving insertion of or within the body of an animal or
the penis into the vagina. human being.
Coitus interruptus: Deliberate Intra Uterine Device (IUD): A small
interruption of Sexual intercourse T – shaped device inserted into the
by withdrawal of the penis from the uterus to prevent pregnancy.
vagina prior to ejaculation of Maternal mortality: Death of a
semen (fluid containing sperms woman while pregnant or within
and other secretions). 42 days of termination of
Contraception: Also known as Birth pregnancy, irrespective of the
control and Fertility control. , It duration and site of the
refers to methods or devices used pregnancy, from any cause related
to prevent pregnancy. to pregnancy or its management
Foeticide: The destruction of a foetus (WHO definition).
in the uterus. Phagocytosis: Cellular process of
Implantation: It is the process of the engulfing solid particles by the cell
early embryo (blastocyst) membrane to form an internal
becoming fixed or embedded in the phagosome by phagocytes and
protists.

194
 Human ReproductIon

QUESTIONS
Very Short Answer Type Questions Very Short Answer Type Questions

1. What are the measures one has 1. Briefly describe the common
to take to prevent contracting sexually transmitted diseases in
STDs? human beings.
2. What in your view are the 2. Describe the surgical methods of
reasons for population contraception.
explosion, especially in India?
3. Write short notes on any two of the
3. It is true that ‘MTP is not meant following.
for population control’. Then a) IVF b) ICSI c) IUDs
why did the Government of India
4. Suggest some methods to assist
legalize MTP?
infertile couples to have children.
4. What is ‘amniocentesis’? Name
5. Is sex education necessary in
any two disorders that can be
schools? Why?
detected by amniocentesis.
5. Mention the advantages of
‘lactational amenorrhea
method’.

195
 Zoology

FOR IGNITED
MINDS
Human Reproduction and Reproductive Health
1. Why do fish, frogs etc., show external fertilisation and reptiles,
aves and mammals show internal fertilisation?
2. Why do children of the same family/parentage show difference in
morphological, physiological and psychological differences?
3. A frog has no tail. Why does its tadpole larva possess a tail?
4. Why don’t young children show secondary sexual features such as
beard, and breast development until they reach a certain age?
5. How does fertilisation occur in animals which lay shelled eggs?
6. The developing embryo of fish or frog does not run the risk of drying
up generally. How do embryos of terrestrial vertebrates protect
themselves from drying up?
7. We say that nervous system is ectodermal in origin. How can nervous
system, which is enclosed in the mesodermal bony skeletal
structures, arise from the outermost germinal layer, the ectoderm?
8. How many times does a normal woman get a chance to become
pregnant in her life time, assuming that she lives into her sixties?
9. Placing an IUD, can lead to phagocytosis of spermatozoa. How?
10. How do you differentiate between GIFT and ZIFT with reference to
assisting childless couples?

n
196
 Unit-VI
G ENETICS
T.H. Morgan

Genetics - Mendel’s ‘Breakfast’, Morgan’s ‘Dinner’ and a

Versatile Teacher’s ‘Cup of Tea’
Life is diverse, encased in the shell of ‘conservatism of Nature’ - Well that is
Genetics, though not literally. Genetics, the enigma of heredity,has its roots
lying in the Mendelian experiments on heredity and variations.
LIKE FATHER LIKE SON - yet different in phenotype/ appearance and attitudes.
How does it occur in its manifold patterns? Is only the genetic material passed
on from the parent to the child responsible for this? It is true, with certain
limitations, that GENES LOAD THE GUN BUT THE ENVIRONMENT TRIGGERS
IT. Genes (cistrons) control ‘traits’. However a single gene may have two or
more allelic forms each allele controlling a contrasting feature of a specific trait.
T.H. Morgan, a Nobel laureate, contributed to the glory of the science of ‘Genetics’
with his experiments on Drosophila melanogaster, the ‘fruit fly’. Morgan’s
work laid a firm foundation to the genetical theory of inheritance in animals and
today man has come to know of the genetical roots of various diseases which
are evading cure. The working out of the HUMAN GENOME and identification of
the individual chromosomal and ‘genic errors’ and their patterns of inheritance
and of course the fruitful research going in the field of Gene Therapy are steps
to making human life better. This unit mainly deals with topics such as- Multiple
alleles and Human blood groups, Sex determination, Sex – linked
Inheritance, Genetic disorders, Human genome project, DNA
Fingerprinting etc., to help you get a grasp on the different dimensions of
Mendelian and Non-Mendelian Gentics.
 Zoology

Genetics
6.1 Heredity and variations
6.2 Mendel’s laws of inheritance in Drosophila
6.3 Pleiotropy
6.4 Multiple alleles and human blood groups
6.5 Codominance
6.6 Polygenic Inheritance
6.7 Sex Determination
6.8 Sex – Linked Inheritance
6.9 Genetic Disorders
6.10 Human Genome Project
6.11 DNA Finger Printing

Genetics, a discipline of biology, is the science of heredity and hereditary

variations in living organisms. The word ‘genetics’ is derived from the Greek
word genesis, which means “origin of anything” or “a beginning”. The term
genetics was coined by W. Bateson. Genetics deals with the patterns of
inheritance from the parent to the offspring, gene distribution, variation and
change in populations.

6.1 Heredity and variations

Heredity is the study of transmission of characters from one generation to
the next. The characters that are passed from one generation to the other
are called hereditary characters. Variations on the other hand may be defined
as the differences in characteristics shown by the individuals of a species
and also by the progeny of the same parents. Humans knew from as early as
8000-1000 B.C. that one of the causes of variations was hidden in sexual
reproduction. They exploited the variations that were naturally present in
the wild populations of plants and animals to selectively breed and select
organisms that possessed desirable characters. For example, through artificial
selection and domestication from ancestral wild cows, we developed well
known Indian breeds, such as Sahiwal cows of Punjab.

198
 Genetics

However, the modern science of genetics, which seeks to understand the

process of inheritance, only began with the work of Gregor Mendel in the
mid-19th century. Although he did not know the physical basis for heredity,
Mendel observed that organisms inherit traits via distinct units of inheritance,
which are now called ‘genes’/‘cistrons’. After the rediscovery of Mendel’s
work by de Vries, Correns and Tschermak, scientists tried to determine
which molecules in the cell were responsible for inheritance. Chromosome
Theory of Inheritance or the Sutton – Boveri Theory is a fundamental
unifying theory of genetics which identifies chromosomes as the carriers of
genetic material. It states simply those chromosomes, which are seen in all
dividing cells and pass from one generation to the next, are the basis for all
genetic inheritance.
Experimental verification of the “Chromosomal theory of inheritance” by
Thomas Hunt Morgan and his colleagues, led to discovering the basis for
the variation that sexual reproduction produced. For his work, Morgan selected
a species of fruit fly, Drosophila melanogaster, which can be grown on
simple synthetic medium in the laboratory. It completes its life cycle in
about two weeks, and a single mating could produce a large number of progeny.
Further, it has many types of morphological, hereditary variations that can
be seen under a low power microscope. Another advantage of the fruit fly is
that it has only four pairs of chromosomes, which are easily distinguishable
under a light microscope. There are three pairs of autosomes and one pair of
sex chromosomes. Female fruit flies have a pair of homologous X-
chromosomes, and males have one X- chromosome and one Y-chromosome.

6.2 Mendel’s laws of inheritance in Drosophila

Gregor Mendel performed hydridisation experiments on Pisum sativum
(garden pea plant) in the middle of 19th century (1856-1863) and proposed
laws of inheritance, which become very popular as Law of segregation and
Law of independent assortment, Which you have studied in detail in Botany.
We may discuss these laws in animals also. T.H.Morgan explained them in
Drosophila melanogaster (fruit fly).
1. Law of segregation: It states that -
i. The alleles in parents did not mix with each other.
ii. During gametogenesis, paternal and maternal alleles separate. Hence,
each gamete receives one allele only of that particular trait.
iii. Homozygous parents produce similar types of gametes (e.g., T or t).
Heterozygous parents produce two types of gametes (e.g., T and t).

199
 Zoology

iv. During fertilisation, as per their union, homozygous progeny (TT or tt)
or heterozygous progeny (Tt) are produced. Hence, the traits which are
not expressed in first filial generation (F1 generation) are expressed in
second filial generation (F2 generation).
Let us explain law of segregation based on the size of wings of Drosophila.
In this insect long wing trait is dominant and vestigial wing trait is recessive.
If a homozygous long winged (LL) Drosophila is crossed with a homozygous
vestigial winged (ll) Drosophila (Monohybrid cross), in F1 generation, all
insects have long wings. When they are interbred, in F2 generation, long
winged and vestigial winged flies are formed in 3 :1 ratio. Observe the
illustration given below.

Homozygous long Homozygous vestigial : Parents

winged Drosophila winged Drosophila

LL ll

L l
: Gametes

Long winged progeny : F1 gen

Ll

L l

LL Ll
L Homozygous Heterozygous
long wings long wings
: F2 gen
Ll ll
l Heterozygous vestigial
long wings wings

200
 Genetics

(P) Parents

long wings vestigial

(LL) wings
(ll)

F1 gen

long wings
(Ll)

long long
(LL) (Ll)
F2 gen

long vestigial
(Ll)
(ll)

LL = Long winged Drosophila - Homozygous (1)

Ll = Long winged Drosophila - Heterozygous (2)
ll = Vestigial winged Drosophila - Homozygous (1)
Phenotypic ratio of Monohybrid cross - 3 : 1
Genotypic ratio of Monohybrid cross- 1 : 2 : 1
As shown in the illustration, the progeny formed in F 1 generation is
heterozygous (Ll). The dominant (L) and recessive (l) alleles segregate in it.
Hence, in F2 generation, long winged and vestigial winged Drosophila are
produced. Their phenotypic ratio is 3:1 and genotypic ratio is 1:2:1.
2. Law of independent assortment: As per this law proposed by Mendel, if
in a hybrid two pairs of different alleles are considered, one pair independently
segregate from the other and inherited to next generation. Through dihybrid
cross in Drosophila, law of independent assortment can be prooved.
In Drosophila, the genes that influence body colour (grey or ebony), wing
size (long or vestigial) follow the independent assortment. In these, the

201
 Zoology

genes for the traits grey colour and long wings are dominant (GGLL) and
that of ebony (black) and vestigial wings are recessive (ggll).
When a grey coloured long winged male Drosophila and a ebony coloured,
vestigial winged female Drosophilia are crossed, in F 1 generation,
heterozygous grey colured long winged (GgLl) progeny are formed. When
they are interbred, in F2 generation, grey, long; gery, vestigial; ebony, long
and ebony, vestigial flies are formed in 9:3:3:1 ratio. Here, in addition to
parental types, two new varieties are formed.

P- gen

Grey coloured long winged Ebony coloured vestigial

Drosophila (GGLL) winged Drosophila (ggll)

GL gl
: F1 gen

(GgLl) Grey,Long

GL Gl gL gl
GL GGLL GGLl GgLL GgLl

grey grey grey grey

long long long long

Gl GGLl GGll GgLl Ggll

grey grey grey grey : F2 gen

long veste long veste
gL GgLL GgLl ggLL ggLl

grey grey Ebony Ebony

long long long long

gl GgLl Ggll ggLl ggll

grey grey Ebony Ebony

long veste long veste

Drosophilia

202
 Genetics

Grey colured, long winged Drosophila = 9(9/16)

Grey colured, vestigial winged Drosophila = 3(3/16)
Ebony colured, long winged Drosophila = 3(3/16)
Ebony colured, vestigial winged Drosophila = 1(1/16)
Phenotypic ratio of dihybrid cross = 9 : 3 : 3 : 1
Mendel’s dihybrid phenotypic ratio = 9 : 3 : 3 : 1
Genotypic ratio = 1 : 2 : 2 : 4 : 1 : 2 : 1 : 2 : 1
Generally genes for grey colour and long wings occur in pairs. Similarly
genes for ebony colour and vestigial wings occur in pairs. But in F1 dihybrid,
during gamete formation, due to segregation of genes, four types of gametes
are formed. But at the time of fertilisation, they unite randomly and bring
about all possible combinatons of different traits. This is called independent
assortment of genes. Hence, four types of Drosophila are formed in 9:3:3:1
ratio.
Along with the above experiment, T.H. Morgan performed test cross by
crossing the dihybrid (GgLl) Drosophila with recessive one (ggll). As a result,
majority of the progeny resemble the parents, Morgan concluded that the
genes for body colour and size of wings in Drosophila are to linked in same
chromosome.

6.3 Pleiotropy
It is an established fact that a specific gene controls a specific phenotypic
trait. This finding is not always true. Studies on ‘gene expression’ have revealed
that a single gene often influences more than one phenotypic trait. This
phenomenon of multiple effects of a single gene is called pleiotropy. The
usual underlying mechanism is that, the same gene is activated in several
different tissues producing different phenotypic effects. One of the most widely
cited examples of pleiotropy in humans is the genetic disorder
Phenylketonuria (PKU). This disorder is caused by the deficiency of the
enzyme phenylalanine hydroxylase. If this enzyme is not produced because
of a mutated gene, the amino acid phenylalanine cannot be converted to
tyrosine and is converted into phenylpyruvic acid, which accumulates in
body fluids. The buildup of phenylpyruvic acid causes multiple phenotypes
associated with PKU, including mental retardation, reduced hair and skin
pigmentation. Pleiotropic alleles are responsible for the multiple symptoms
associated with certain other diseases, such as Cystic fibrosis and Sickle-
cell disease.

203
 Zoology

6.4 Multiple alleles and human blood groups

Generally a gene has two alternative forms/versions called alleles. They are
present at the same locus in a pair of homologous chromosomes. Two alleles
of a gene can form three genotypes in a diploid organism. Sometimes a gene
may have more than two alleles. When more than two allelic forms occur at
the same locus on the homologous chromosomes of an organism, they are
called multiple alleles. When more than two alleles exist in a population of
a specific organism, the phenomenon is called multiple allelism. As
mentioned above ‘multiple alleles’ cannot be observed in the genotype of a
diploid individual, but can be observed in a population. The number of kinds
of genotypes that can occur for multiple alleles is given by the expression
n(n+1)/2, where, n = number of alleles. A well known example of multiple
allelism in man is the expression of ABO blood types by three alleles of a
single gene which can produce six genotypes.

6.4.1 ABO Blood Types

The ABO blood group system was proposed by Karl Landsteiner. He was
awarded the Nobel Prize in Physiology or Medicine in 1930 for his work. The
phenotypes (blood types) A, B, AB and O types are characterized by the
presence or absence of ‘antigens’ on the plasma membrane of the RBCs. The
A and B antigens are actually carbohydrate groups (sugar polymers) that
are bound to lipid molecules (fatty acids) and they protrude from the membrane
of the red blood cell. They are also called isoagglutinogens because they
cause blood cell agglutination in the case of incompatible blood transfusions.
‘Blood type A’ persons have antigen A on their RBCs and anti-B antibodies
in the plasma. ‘Blood type B’ persons have antigen B on their RBCs and
anti-A antibodies in the plasma. ‘Blood type AB’ persons have antigens ‘A’
and ‘B’ on the RBCs and no antibodies in the plasma. ‘Blood type O’ persons
have no antigens on their RBCs and both ‘anti-A’ and ‘anti-B’ antibodies are
present in the plasma.
Bernstein discovered that these phenotypes were inherited by the interaction
of three ‘autosomal alleles’ of the gene named I, located on chromosome 9.
IA, IB and i (or IO) are the three alleles of the gene I. The antibodies ‘anti-A’
and ‘anti-B’ are called isoagglutinins (also called isohaemagglutinins) which
are usually IgM type. The isoagglutinins of an individual cause agglutination
reactions with the antigens of another individual. The alleles IA and IB are
responsible for the production of the respective antigens ‘A’ and ‘B’. The
allele i does not produce any antigen. The alleles IA and IB are dominant to
the allele i, but co-dominant to each other (IA = IB > i). A child receives one of

204
 Genetics

Table 1 : Genetic control of the human ABO blood groups

Genotype Antigens present ABO blood group Antibodies Blood types Blood types that
on red blood cells phenotype present in that can be can accept
blood plasma tolerated blood for
transfusion

IAI A A Type A Anti-B A&O A & AB

A
Ii A Type A Anti-B A&O A & AB
I BI B B Type B Anti-A B&O B & AB
IBi B Type B Anti-A B&O B & AB
I AI B A&B Type AB Neither anti-A nor A,B, AB & O AB only
anti-B
i i/IOIO Neither A nor B Type O Anti-A & anti-B O only A,B, AB & O

the three alleles from each parent, giving rise to six possible genotypes and
four possible blood types (phenotypes). The genotypes are IAIA, IAi, IBIB, IBi,
IAIB and ii. The phenotypic expressions of IAIA and IAi are ‘A’ – type blood, the
phenotypic expressions of IBIB and IBi are ‘B’–type blood, and that of IAIB is
‘AB’–type blood. The phenotype of ii (I0I0)is ‘O’–type blood.

Blood Typing
The ABO phenotype of any individual is ascertained by mixing a blood sample
with an antiserum containing ‘anti-A’ or ‘anti-B’ antibodies. If a clump is
formed with ‘anti-A’ serum, the type of blood can be ‘A’ or ‘AB’. If a clump is
formed with ‘anti-B’ serum, the type of blood can be ‘B’ or ‘AB’. If a clump is
formed with both ‘anti-A’ and ‘anti-B’ antibodies, the type of blood is ‘AB’ and
if no clump is produced with either of the antibodies, the type of blood is ‘O’.

Importance of ABO groups in blood transfusion

While transfusing blood, the type/types of antigens of the donor and the
type/types of antibodies of the recipient are to be taken into consideration.
The antibodies of the donor and the antigens of the recipient are relatively of
less importance. The RBCs of an ‘O group’ have no antigens and so
agglutination does not occur with any other group of blood. So, persons with
‘O group blood’ are called universal donors. The plasma of persons with ‘AB
group’ blood has no antagonistic antibodies. This does not cause agglutination
of RBC received from persons of other groups of blood. So people with ‘AB
group’ blood are called Universal recipients. Can you think of how an AB
group person can be considered a ‘universal donor’ with reference to
transfusion of plasma?

205
 Zoology

NOTE : Type AB+ is the universal recipient. Although those with AB

blood type may be referred to as universal recipients, in actuality, type
-
AB+ blood is that of the universal recipient, whereas type AB is not.
- - -
This is an important distinction to make. Because A , A+, B , B+, AB ,
- -
AB+, O and O+ individuals can all receive blood from donors of type O
-
blood. An individual with type O blood is deemed a universal donor.

6.4.2 Rh Blood Types

Karl Landsteiner and Alexander S. Wiener
discovered another antigen called Rh-
C or c C or c
antigen or Rh factor on the surface of RBCs
of Rhesus monkeys (Macaca mulatta) and D or d D or d
later in human beings. But the term ‘Rh
factor’ strictly refers only to the most E or e E or e
immunogenic D antigen of the Rh-blood
group system. The persons having D Homologous Chromosome Pair # 1
antigen are called ‘Rh D positive (Rh+)’ and (Showing 3 loci with 2 alleles per locus)
those without D antigen are called Rh D
Figure 6.1 Fisher And Race
negative (Rh-). Rhesus factor in the blood
Hypothesis - Rh Blood
is an inherited dominant trait. Anti-D Type
antibodies are absent in the plasma of any
person normally (naturally). However, if an ‘Rh negative’ person is exposed
to Rh positive blood cells (erythrocytes) for the first time, ‘anti-D antibodies’
are formed in that person’s blood. On the other hand, an Rh positive person
can receive Rh negative blood without any consequent effects/complications.
6.4.3 Genetic control of Rh system
Fisher and Race hypothesis
Unlike the A-B-O blood types where all the alleles occur on one pair of loci
on chromosome pair 9, the Rh factor involves three different pairs of alleles
located on three different closley linked loci on the chromosome pair 1. The
Fisher-Race system, which is more commonly in use today, uses the CDE
nomenclature.
In the above figure, 3 pairs of Rh alleles (Cc, Dd and Ee) occur at 3 different
loci on homologous chromosome pair-1. The possible genotypes will have
one C or c, one D or d, and one E or e from each chromosome. For example:
CDE/cde; CdE/cDe; cde/cde; CDe/CdE, etc. All genotypes carrying a
dominant ‘D allele’ will produce ‘Rh-positive’ phenotype and double recessive
genotype ‘dd’ will give rise to ‘Rh-negative’ phenotype.
Wiener hypothesis
Wiener proposed the existence of eight alleles (R1, R2, Ro, Rz, r, r’, r’’, ry) at a
single Rh locus. All genotypes carrying a dominant ‘R allele’ (R1, R2, RO, RZ)

206
 Genetics

will produce ‘Rh-positive’ phenotype and double recessive genotypes rr (or

rr’, rr’’, rry) will give rise to ‘Rh-negative’ phenotype.

6.4.4 Erythroblastosis foetalis

Erythroblastosis foetalis/Haemolytic Disease of the Newborn/Haemolytic
disease of the foetus and newborn (HDN/HDFN) is an alloimmune condition
that develops in an Rh positive foetus whose father is Rh positive and mother
is Rh negative. The genetic consequence in this marriage is the Rh
-
incompatibility between the mother (Rh ) and the growing foetus (Rh+). The
foetal blood cells may pass through the ruptured placenta at birth into the
Rh nagative meternal blood. The mother’s immune system recognizes the Rh
antigens and gets sensitized. The sensitized immune system in the mother
produces Rh antibodies. The Rh antibodies are of the IgG type which are
small in size. So, they can pass through the placental barrier and enter the
foetal blood circulation. Generally the first child of this ‘genetically
incompatible marriage’ is unaffected because foetus is delivered by the time
the mother gets sensitized and produces anti ‘D’ antibodies.
During the second pregnancy,if the second child is Rh positive, these
antibodies cross the placental border and enter the foetal blood circulation.
The blood cells of the Rh positive foetus are destroyed, causing HDN.
Haemolytic anaemia and jaundice are the symptoms of this disorder in the
affected neonatal babies. To compensate the haemolysis of more and more
number of RBCs, there is a rapid production of RBCs, not only from the bone
marrow, but also from spleen and liver. Now, many large and immature cells
in erythroblast stage are released into circulation. Because of this, the
disease is called erythroblastosis foetalis.

Prevention of Erythroblastosis Foetalis

If the mother is found to be ‘Rh negative’ and the foetus is ‘Rh positive’, IgG
anti-D antibodies (Rho (D) Immuno Globulin) should be administered to
the mother at 28th and 34th weeks of gestation as a prophylactic measure. If
the ‘Rh negative’ mother delivers ‘Rh-positive’ baby, then anti-D antibodies
should be administered to the mother soon after delivery. This develops passive
immunity and prevents the formation of ‘anti-D antibodies’ in the mother’s
blood, by destroying the Rh positive foetal erythrocytes, before the mother’s
immune system is ‘sensitized’. This has to be done every time the lady is
pregnant.

6.5 Codominance
The expression of paternal and maternal traits equally in the heterozygotes
of F1 generation is known as codominance. In this phenomenon there is no
recessive trait. Hence the alleles of the two phenotypes are visible in the

207
 Zoology

indeviduals of F 1 generation. It means, the substances (e.g. proteins,

glycoproteins, glycolipids) formed expression of both alleles are present in
equal amounts in F1 individuals. Hence codominance is also called eqal
dominance.

Man Woman
A - group B group Parental gen

I A IA I B IB

IA IB Gametes

IAIB F1 generation
(AB)

IA IA F1 gametes
I AI A
IB (A) IB F2 generation
I AI B I AI B
(AB) (AB)
I BI B
(B)

Explanation

genotype phenotype Ratio

I AI A A blood group 1
I AI B AB blood group 2
IBI B B blood group 1

Codominance in AB blood group in human beings

For example, the alleles responsible for human blood groups - IA and IB
are codominant. Due to their expression, A and B antigens are formed on

208
 Genetics

RBC in equal numbers. Due to IAIA homozygous condition A group and due to
IBIB homozygous condition B-group are formed. But in IAIB heterozygote the
antigens A and B are formed in equal numbers and hence AB-group is
produced. When a man with A-blood group marries a woman with B-blood
group, in their children AB-blood group is expressed. If two F1 heterozygotes
marry, in F2 generation in their children the three blood groups, namely, A,
AB and B are expressed in 1:2:1 ratio. See the illustration above.

6.6 Polygenic Inheritance

Mendel studied characters that could be classified on an either-or basis,
such as purple versus white flower color. But for many characters, such as
human skin color and height, an either-or classification is impossible because
the characters vary in the population in gradations along a continuum. These
are called quantitative characters. Quantitative variation usually indicates
polygenic inheritance, an additive/cumulative effect of two or more genes
on a single phenotypic character (the converse of pleiotropy, where a single
gene affects several phenotypic characters).

Skin colour in man

For example human skin colour varies in the population in gradations. It is
called a quantitative character. There is evidence, for instance, that skin
pigmentation in humans is controlled by at least three separately inherited
genes (probably more, but we will simplify). Let us assume that three genes
namely A,B,C control skin colour in human with the dominant alleles A, B
and C responsible for dark skin colour and the recessive alleles a, b and c for
light skin colour. An AABBCC person would be very dark, while an aabbcc
individual would be very light/fair in complexion. An AaBbCc person would
have skin of an intermediate shade. The genotypes AaBbCc and AABbcc
would make the same genetic contribution (three major units) to skin’s
darkness. There are different skin-color phenotypes that could result from
a mating between AaBbCc heterozygous organisms. In this manner the number
of each type of alleles in the genotype would determine the degree of darkness
or lightness of the skin in an individual. Environmental factors, such as
exposure to the sun, also affect the skin-color.

6.7 Sex Determination

The mechanism of sex determination has always been a puzzle to geneticists.
In fact, the cytological observations made in a number of insects led to the
development of the concept of genetic/chromosomal basis of sex determination.

209
 Zoology

6.7.1 Sex Chromosomes

In most of the animals a pair of chromosomes is responsible for the
determination of sex. These two chromosomes are called sex chromosomes
or allosomes. The chromosomes other than the sex chromosomes are called
autosomes. The first indication that sex chromosomes were distinct from
the other chromosomes came from the experiments conducted by Henking.
He could trace a specific nuclear structure all through spermatogenesis in
wasps, and it was also observed by him that 50 percent of the spermatozoa
received this structure after spermatogenesis, whereas the other 50 percent
did not receive it. Henking gave the name X–body to this structure, but he
could not explain its significance. Further investigations by other scientists
led to the conclusion that the X–body of Henking was in fact a chromosome
and that is why it was given the name X–chromosome. Stevens and Wilson
first identified Y–chromosome as a sex-determining chromosome in the
mealworm, Tenebrio molitor. They revealed that the chromosomal basis of
sex depended on the presence or absence of the Y–chromosome.
NOTE : If the two sex chromosomes are similar (XX), the individual is
described as homogametic. Gametes produced from it are similar. If
the two sex chromosomes are different (XY) or it contains only one sex
chromosome (XO), the individual is described as heterogametic.
Gametes formed in a heterogametic individual are dissimilar. The
reproductive organs that produce gametes form the ‘primary sexual
characters’. The various explanations given for sex determination are
chiefly - i. Chromosomal theory of sex determination, ii. Genic balance
theory of sex determination and iii. Haplodipoidy method

6.7.2 Heterogametic Sex Determination

Heterogametic sex refers to the sex of a species in which the sex chromosomes
are not similar. The process of sex determination by allosomes is called
genetic or chromosomal sex determination. In the heterogametic sex
determination, one of the sexes produces ‘similar’ gametes and the other sex
(heterogametic sex) produces dissimilar/unlike gametes. The sex of the young
one is determined at the time of syngamy (fertilization). It depends on which
gamete of the two dissimilar gametes unites with the other gamete produced
by the ‘homogametic parent’.

1. Male Heterogamety
In this method of sex determination, the males (heterogametic) produce
dissimilar gametes while females (homogametic) produce similar gametes.

210
 Genetics

Male heterogamety is of two kinds, XX – XO type and XX – XY type (XX

refer to female).

A. XX – XO type Grasshopper
In some insects such as bugs, grasshoppers and
cockroaches, females are with two X-chromosomes and
males are with one X-chromosome in each somatic cell.
McClung discovered this type in grasshoppers. The
unpaired X-chromosome determines the male sex. The
karyotype of the female (homogametic) is AAXX and that
of the male (heterogametic) is AAXO. All the ova contain
‘AX’ complement of chromosomes and the sperms are of
two types. One half of the sperms have ‘AX’ complement
and the other half have ‘A’ complement of chromosomes. Figure 6.2 Sex determination
The sex of the offspring depends on the type of sperm in grasshopper
that fertilizes the ovum.

B. XX – XY type
In human beings and some insects such as Drosophila,
both females and males have the same number of
chromosomes. The karyotype of the female is AAXX and
that of the male is AAXY. Females are ‘homogametic’
with ‘XX’ chromosomes. They produce similar ova having
one X-chromosome each. Males are ‘heterogametic’ with
X and Y-chromosomes. They produce two kinds of
sperms; one half of them with X-chromosome and the
other half with Y-chromosome. The sex of the offspring Figure 6.3 Sex determination
in human being
depends on the fertilizing sperm. The XX - XY type is
also found in most other mammals.
2. Female Heterogamety
In this method of sex determination, the males produce
‘similar gametes’ while females produce ‘dissimilar
gametes’. Female heterogamety is of two kinds, ZO – ZZ
type and ZW – ZZ type.

A. ZO - ZZ type
In moths (e.g., Fumea) and some butterflies, female is
heterogametic with one Z-chromosome (ZO) and male is
homogametic with two Z-chromosomes (ZZ). The Figure 6.4 Sex determination
karyotype of female is AAZO and male is AAZZ. Females in Fumea

211
 Zoology

produce two kinds of ova, half of them with a Z-chromosome and the other
half with no sex chromosome. Males produce similar type of sperms. The sex
of the offspring depends on the type of ovum that is
fertilized.

B. ZW – ZZ type
In birds, reptiles, some fishes, etc., the females are
heterogametic with ZW- allosomes and males are
homogametic with ZZ – allosomes. The karyotype of
the female is AAZW and that of the male is AAZZ. All
sperms are similar with the allosome- Z. Ova are of
two different kinds; one half of the ova are with the
allosome- Z and the other half with the allosome-W.
Figure 6.5 Sex determination The sex of the offspring depends on the type of ovum
in fowl that is fertilized.

6.7.3 Sex Determination in Humans

It has already been mentioned that the sex determining mechanism in case
of humans is XX - XY type. Out of 23 pairs of chromosomes present, 22
pairs are exactly same in both males and females; these are the autosomes.
A pair of X-chromosomes is present in the female, whereas the presence of
an X and Y-chromosome are determinant of the male characteristic. During
spermatogenesis among males, two types of gametes are produced. 50 percent
of the total sperm produced carry the X-chromosome and the rest 50 percent
has Y-chromosome besides the autosomes. Females, however, produce only
one type of ovum with an X-chromosome. There is an equal probability of
fertilisation of the ovum by the sperm carrying either X or Y-chromosome. In
case the ovum is fertilised by a sperm carrying X-chromosome, the zygote
develops into a female and the fertilisation of ovum with Y-chromosome
carrying sperm results into a male offspring. Thus, it is evident that it is the
genetic makeup of the sperm that determines the sex of the child. It is also
evident that in each pregnancy there is always 50 per cent probability of
either a male or a female child.

NOTE: It is unfortunate that in our society women are blamed for producing
female children and have been ostracised (to exclude from the society) and
ill-treated because of this false notion.

6.7.4 Genic Balance Theory

By studying the Chromosomal theory of sex determination, it may appear at
first glance that some genes carried on the sex chromosomes, for example, X
212
 Genetics

and Y are entirely responsible for determining the sex of the offspring. But
this is not always true.
The Genic Balance Theory of determination of sex was proposed by Bridges
while working on Drosophila. This theory explains the mechanics of sex
determination in Drosophila melanogaster. According to his concept, the sex
of an individual is determined by the ‘balance’ between the genes for
femaleness located on the X-chromosome and those for maleness located on
the ‘autosomes’. Hence, the sex of an individual is determined by the ratio of
number of its X chromosomes and that of its autosomal sets, the ‘Y’
chromosome taking no part in the determination of the sex. The ratio is
termed sex index and is expressed as follows.

Sex index = Number of X chromosomes / Number of sets of

autosomes (X/A)
Bridges studied the offspring resulting from the non-disjunction of
X-chromosomes during meiosis in females. Non-disjunction (not coming
apart) is the failure of paired chromosomes to segregate or separate during
the anaphase stage of the first or second meiotic divisions. The result is the
production of gametes with abnormal numbers of chromosomes. There were
various types of gametes such as the ones which contained one extra X-
chromosome (AXX) and some others contained one chromosome less (AO).
Syngamy of such gametes and normal gametes produces zygotes with
aneuploid karyotypes such as 2n+1, 2n-1 etc. AAXO male is produced when
an unusual ovum (AO) in the female is fertilised by a sperm with AX
chromosome complement. An ‘AAXXY female’ is produced when an unusual
ovum with AXX and a sperm with AY fuse. Bridges found that the ‘AAXXY
flies’ were ‘fertile females’ and ‘AAXO flies’ were ‘sterile males’. It is important
to note that the presence Table 2 Chromosome complements and Sexual phenotypes in
of Y-chromosome in the Drosophila
‘AAXXY flies’ did not cause Sex Haploid
Chromosome Sets of X:A Sexual
maleness, and its absence Complement Autosomes Ratio Phenotype
in the ‘AAXO flies’ did not XX AA 1.0 Female
produce femaleness. XY AA 0.5 Male
XO AA 0.5 Male
When Bridges crossed
XXY AA 1.0 Female
triploid females (AAAXXX) XXX AA 1.5 Metafemale
with normal diploid males XXXY AA 1.5 Metafemale
(AAXY), he obtained XX AAA 0.67 Intersex
normal diploid females, XO AAA 0.33 Metamale
males, triploid females, XXXX AAA 1.33 Metafemale

213
 Zoology

intersexes, super males and super females. The occurrence of triploid

intersexes from such a cross clearly established that autosomes have a role
with determination of sex.
Bridges realized that the critical factor in determining sex is the ratio of X
chromosomes to the number of haploid sets of autosomes (A) present. He
concluded that Y-chromosome in Drosophila lacks male determining factor,
TDF (encoded by the SRY gene - Sex-determining Region Y). However, the
Y-chromosome of Drosophila is required for male fertility. In ‘XO males’,
sperms develop but are non-motile.

NOTE : Females have a ratio equal to 1.0. If the ratio is >1.0, such
females are called super females/metafemales, and they are ‘infertile’.
Normal males have a ratio of X-chromosomes to sets of autosomes of
0.5. When the ratio is < 0.5 the males are called super males/
metamales, and they are infertile. If the ratio is between 0.5 and 1.0,
the flies are called intersexes, which are larger, with morphological
abnormalities and rudimentary bisexual gonads. The investigations on
Drosophila by Bridges showed that female determiners are located on
the X-chromosomes and the male determiners are on the autosomes.

6.7.5 Haplodiploidy in honeybees

Haplodiploidy is a mechanism of sex determination that is common in the
hymenopteran insects such as honey bees, ants, and wasps. In this system,
the sex of the offspring is determined by the number of sets of chromosomes,
it receives. Fertilized eggs develop into females, and unfertilized eggs develop
(parthenogenesis) into males (drones). This means that the males have half
the number of chromosomes (haploid) and the females have ‘double’ the
number (diploid), hence the name ‘haplodiploidy’ for this system of sex
determination.
In Apis mellifera, drones are haploid with 16 chromosomes, queen and
worker bees are diploid with 32 chromosomes in each somatic cell. Males
produce sperms by mitosis. As per this type, males have no father and they
cannot have sons, but they do have grandfathers and grandsons. Female
that feeds on royal jelly becomes the fertile queen. Other females that feed
on honey and pollen become sterile females called worker bees. If a queen
bee mates with one drone, her daughters share ¾ of their genes with each
other and not ½ as in the XY and ZW systems.

214
 Genetics

Barr Bodies
In mammals, males are heterogametic (XY) and females, homogametic
(XX). As the female has two copies of the X chromosome, Dosage
Compensation is achieved by the random inactivation of one of the two ‘X’
chromosomes. The extra X-chromosome undergoes heterochromatinisation
and becomes inactive during early embryonic development. The descendant
cells inherit the same inactivated X chromosome. The heterochromatinized
X-chromosome appears as a darkly-staining body attached to the nuclear
membrane. This phenomenon was first described by Murray L. Barr and
the heterochromatinised X chromosomes are now called Barr Bodies.
Barr and Bertram observed chromatin bodies in the nerve cells of female
cats that were not present in the cells of the male. In humans, this body
can be easily demonstrated in the female cells derived from the buccal
mucosa (cheek cells) or in fibroblasts (undifferentiated connective tissue
cells), but not in similar male cells. A Barr body appears as a small
drumstick-like projection (drumstick appendage) on one of the lobes of
some neutrophils in females . With this technique, the sex of human embryos
can be distinguished at early stages of development. This cellular
characteristic generally seems to apply to all mammals.
X-inactivation (also called Lyonisation, proposed by Mary Lyon and Liane
Russell) is a process by which one of the two copies of the X-chromosome
present in the body cells of female mammals is inactivated. The inactive
X-chromosome is ‘silenced’ by making it a transcriptionally inactive
structure called heterochromatic body. As female mammals have two X-
chromosomes in each cell, X-inactivation in their cells causes them not to
have twice as many products of the X-chromosomal genes as those of the
males which possess a single copy of the X-chromosome in each cell
(Dosage Compensation).

NOTE : Regardless of how many X-chromosomes a somatic cell possesses,

all but one of them appears to be inactivated and can be seen as Barr
bodies. For example, no Barr body is seen in the somatic cells of Turner
females 45, XO; one is seen in Klinefelter males 47,XXY; two in 47,XXX
females; three in 48,XXXX females; and so on. Therefore, the number
of Barr bodies follows an N-1 rule (N minus one rule), where N is the
total number of X-chromosomes present.

215
 Zoology

NOTE : The female progeny share between them 50% of the mother’s
genes (16 out of 32) and 100% of the male parent’s genes (entire male
genome of 16 chromosomes). It accounts for 50+100=150 out of a possible
200 (considering the male genome of 16 chromosomes as 100% of male
genes). It amounts to saying that the female progeny share between them
150 out of a possible 200 parental units (genes), which is equal to ¾ or
75% and not 50% as seen in human beings.

6.8 Sex – Linked Inheritance

The inheritance of a trait that is determined by a gene located on one of the
sex chromosomes is called sex-linked inheritance. This mode of inheritance
is in contrast to the inheritance of traits controlled by the autosomes, where
both the sexes have the same probability of inheritance. Sex linked inheritance
depends on how the chromosomes (allosomes) determine the sex.

Sex Linkage in Drosophila

Thomas H. Morgan (Father of Modern Genetics) discovered sex linkage
in Drosophila
melanogaster. Morgan
wanted to analyze the
behavior of the two
Y
alleles of a fruit fly’s
eye-colour gene. When
he crossed a white eyed
(mutant) male to a
normal (wild) red eyed
female, in the F 1
generation all the males
and females were red
eyed. When the F 1
generation ’red eyed
female’ was crossed to
a ‘red eyed male’, in the
F 2 generation all the
females were red eyed
and 50 percent of the
males were ‘white
eyed’. The white eyed
Figure 6.6 Sex linkage in Drosophila melanogaster trait from the male is

216
 Genetics

inherited to the male of the F2 generation through the ‘carrier daughter’ of

the F1 generation. This pattern of inheritance is called crisscross pattern
of inheritance (skip gene-ration inheritance) in which a gene responsible
for the white eyes is transmitted from a male parent to a male grandchild
through carrier female of the first generation.
In a reciprocal cross (to test the role of parental sex on inheritance pattern),
in which a white eyed female was crossed to a red eyed male, the results
were different. The first generation male offspring had white eyes while
the female offspring had red eyes. The reason was that the allele responsible
for the white eye is sex-linked (more specifically X-linked, as it occurs on
the X-chromosome) and recessive. Males always inherit the X-linked
recessive traits from the female parents.
Morgan’s discovery that transmission of the X-chromosome in Drosophila
correlates with the inheritance of an eye-color trait was the first solid
evidence indicating that a specific gene is associated with a specific
chromosome.

6.8.1 Sex-linked Genes

Genes that are present on the X or Y-chromosome are called sex-linked
genes. The genes located on the X-chromosome, whose alleles are absent on
the Y-chromosome are called X-linked genes. Male human beings are
hemizygous and females are homozygous or heterozygous for these alleles.
The genes located on the Y-chromosome, whose alleles are absent on the
X-chromosome are called Y-linked genes or holandric genes. Males are
hemizygous for these alleles also. X-linked and Y-linked genes (on their non-
homologous parts) do not undergo pairing or crossing over during meiosis.
The genes which are located on the homologous segments (pseudoautosomal
regions) of the X and Y-chromosomes are called XY-linked genes. These are
also called incompletely sex-linked genes as these regions undergo pairing
and crossing over.
6.8.2 Sex-linked inheritance in Human beings
Characters in individuals may be classified into two categories – those which
do not show any difference in the pattern of inheritance in reciprocal crosses
and those which are inherited differently in reciprocal crosses. The characters
of the first category occur on the autosomes, while those of the second
category are on the sex chromosomes. The sex chromosomes carry sex-
linked genes for some traits that are unrelated to sex characteristics and
the inheritance is called sex linked inheritance. While most Y-linked genes
help determine sex, the X chromosomes have genes for many characters
unrelated to sex.

217
 Zoology

1. X-Linked inheritance
Genetic diseases caused by mutations of genes on the X-chromosome have
specific characteristics. X-linked diseases are mostly recessive and restricted
to the males who carry the mutant allele. This is because males have only
one X-chromosome, whereas females have two. Thus, females who carry a
single mutant allele are generally unaffected.
2. X-Linked Recessive Inheritance
X-linked recessive inheritance is the of inheritance in which a mutation in
a gene on the X-chromosome causes the phenotype to be expressed in males
(who are necessarily hemizygous for the ‘recessive allele’ and they have only
one X chromosome) and in the females who are homozygous for the allele
(i.e., they have a copy of the allele on each of their two X chromosomes).
Affected males get the allele from their
Normal Color-blind mothers. If a female is homozygous affected,
mother father
all her sons are affected. All affected
+ + g
females have an affected father and a
P
carrier or af fected mother. X-linked
+ g recessive traits are typically passed on
from an affected father to 50 percent of his
Carrier female Normal male grandsons through carrier daughter. The
+ g + most common X-linked recessive disorders
F1
X are Haemophilia, Colour blindness
(protanopia and deuteranopia), Duchenne
Carrier female Normal male
muscular dystrophy etc.
+ g +
X A. Colour blindness
+ Two types of colour blindness are sex-
linked recessive disorders. Retina of the
eye in man contains the cells sensitive to
+ + +
+ red and green colours. This phenotypic trait
Normal female Normal male is genetically controlled. Its alleles are
+ g
located on the X-chromosome. When a
g
g woman with normal vision (homozygous)
Carrier female Color-blind male marries a colour-blind man, all the sons
and daughters are normal, but daughters
Figure 6.7 : X-linked recessive inheritance
are ‘carriers’ (heterozygous). If a carrier
- Colour blindness
woman marries a man with normal vision,
* Dystrophin is a protein that connects cytoskeleton of a muscle fiber to the surrounding extra
cellular matrix through the cell membrane. These links help to dissipate the contractile
force of the muscular cytoskeleton to the extracellular matrix.

218
 Genetics

all the daughters and half of the sons have normal vision and the other half
of the sons are colour-blind. Colour-blind trait is inherited from a male
parent to his grand sons through carrier daughter, which is an example of
crisscross pattern of inheritance.

B. Haemophilia
Haemophilia A is a recessive X-linked genetic disorder involving lack of the
functional clotting Factor- VIII and accounts for about 80% of haemophilia
cases. Haemophilia B is also a recessive X-linked genetic disorder involving
lack of the functional clotting Factor IX. When a person with hemophilia is
injured, bleeding is prolonged because a firm clot is slow to form. Haemophilia
follows the characteristic crisscross pattern of inheritance like that of colour-
blindness.

Duchenne muscular dystrophy

Duchenne muscular dystrophy (DMD) is a recessive X-linked form of
muscular dystrophy, affecting around 1 in 3,600 boys. The disease is
characterized by a progressive weakening of the muscles and loss of
coordination. Affected individuals rarely live past their early 20s as they
do not posses the protein dystrophin. The disorder is caused by a mutation
in the dystrophin gene (the largest known gene in humans) located on the
X-chromosome, which codes for the protein dystrophin*, an important
structural component within muscle tissue (connects sarcolemma and the
outer muscle filaments and supports muscle fiber strength). If the mother
is known to be a carrier of this gene, one half of her male children are
expected to be affected. All female children born to a carrier mother do not
suffer from DMD, are expected to be normal, since the possibility of their
being homozygous for this sex-linked recessive gene is virtually non-existent.

X-Linked Dominant Inheritance

X-linked dominant inheritance is a mode of genetic inheritance
transmitted by a dominant allele carried on the X chromosome with
reference to inheritance pattern, it is less common than the X-linked
recessive type. X-linked dominant inheritance indicates that the allele
responsible for a genetic disorder is located on the X chromosome, and
only one copy of the allele is sufficient to cause the disorder when inherited
from a parent who has the disorder. The exact pattern of inheritance varies,
depending on whether the father or the mother has the trait of interest. All
daughters of an affected father will be affected but none of his sons will be
affected if mother doesnot suffer from the disorder. If mother is homozygous
affected, all her children are affected. Males are more severely affected
than the heterozygous females, because males do not have a normal copy
of the gene to balance the effects of the mutation on their single X-
chromosome.
Presently, there are only a few known human X-linked dominant traits.
They include: Follicular Hyperkeratosis, Incontinentia Pigmenti etc.
219
 Zoology

Follicular hyperkeratosis
Follicular hyperkeratosis (also called
incontinentia Phrynoderma) is a skin condition characterized
normal pigmenti
by excessive development of keratin in hair
follicles, resulting in rough, cone-shaped,
X| X| X| Y
elevated papules. The openings are often closed
X| X| Y
with a white plug of encrusted sebum.

Incontinentia Pigmenti
affected Incontinentia pigmenti is an uncommon
normal
disorder. IP is inherited in an X-linked dominant
X| X| X| Y manner. IP is lethal in most, but not all, males.
A random loss of melanin from skin leads to
Figure 6.8 X-linked dominant mosaic appearance of skin. A female with IP
inheritance
may have inherited the mutant allele from either
of parents or she might have had a new gene mutation in the very early
development. Homozygous IP in female is lethal.

Y-Linked Inheritance
Y-linked inheritance is also called holandric inheritance. The genes
controlling Y-linked characters, also called holandric genes, are located
on the non-homologous part of Y-chromosome. Y-linked disorders are caused
by mutations on the Y-chromosome. Because males inherit a Y-chromosome
from their fathers, every son of an affected father will be affected. Because
females only inherit the X chromosome from their fathers and they do not
show the ‘Y’ linked disorder. Males are hemizygous for these genes. The
SRY gene is on the Y chromosome and causes the development of male
characteristics in humans. Y-linked characters in human being are
hypertrichosis (excessive growth of hair on the
pinna of the ear), webbing of toes, porcupine
bobbed wild man (straight and stiff hair on the body).

XY - Linked Inheritance
Xb Xb Xb+ Yb+
The probability of inheritance of traits by XY-
Xb X+ Y+
linked genes (incompletely sex linked genes
present on the pseudoautosomal regions of X
and Y chromosomes) is similar in both sexes
wild because they are homozygous or heterozygous
wild
for these traits. Unlike the autosomal genes of
male, the genes on X-chromosome can be
Xb+ Xb XbYb+ inherited only to females, whereas genes on
Y-chromosome can be inherited only to males.
Figure 6.9 XY-linked inheritance
in Drosophila

220
 Genetics

In Drosophila, XY-linked alleles for bobbed bristles occur on same loci of

X-chromosomes in females. In males, these alleles are present on the X-
chromosome and Y-chromosome (in the homologous regions). e.g. Bobbed
condition in Drosophila is due to a recessive (mutant) allele (b). The normal
allele is wild type (b+).
Sex-Limited Inheritance
In contrast to X-linked inheritance, patterns of gene expression may be
affected by the sex of an individual even when the genes are not on the X
chromosome. Sex-limited genes are autosomal genes present in both males
and females. Their phenotypic expression is limited to only one sex due to
internal hormonal environment, e.g. beard in man, development of breast
and secretion of milk in woman etc. are sex limited traits.
Sex-Influenced Inheritance
Sex-influenced genes are the autosomal genes present in both males
and females. In sex-influenced inheritance, the genes behave differently
in the two sexes, probably because the sex hormones provide different
cellular environments in males and females. Thus, the heterozygous
genotype may exhibit one phenotype in males and the contrasting one in
females. Cases of sex-influenced inheritance include pattern baldness in
humans, horn formation in certain breeds of sheep (e.g. Dorset Horn sheep).

Figure 6.10 Inheritance of pattern baldness in human being

Pattern-baldness
The allele for baldness behaves dominant (B) in males but recessive (b) in
females. The amount of thinning of the hair or balding that is observed
depends both on genotype and the amount of testosterone exposure.
A male who is ‘BB’ will show severe balding. A female who is ‘BB’ will also
be affected, and usually less severely, with thinning of the hair, rather
than total loss. A male who is heterozygous (Bb) will also become bald,
whereas a female who is heterozygous (Bb) will not be affected. Individuals
of either sex who are fully recessive (bb) will not be affected. If a
heterozygous non-bald woman (Bb) marries a heterozygous bald man (Bb),
in the offspring the ratio of bald to non-bald in the male progeny is 3 : 1,
while in females it is 1: 3.

221
 Zoology

Pedigree Analysis
Scientists have devised an approach called
pedigree analysis, to study the inheritance of
a specific trait, abnormality or disease. Pedigree
is a chart showing the record of inheritance of
certain traits over two or more ancestral
generations of a person in the form of a diagram
of family tree (pedigree chart). Pedigree
analysis is useful in many ways like it helps to
work out the possible genotypes from the
knowledge of the respective phenotypes. It helps
to study the pattern of inheritance of a dominant
or a recessive trait. The possible genetic makeup
of a person for a trait can also be known with
the help of the pedigree chart. Some of the
important standard symbols used in the
pedigree analysis are shown in the figure.
Figure 6.11 Symbols used in the
human pedigree chart

Figure 6.12 Representative pedigree chart for the analytsis of (a) Autosomal dominant
trait (for example: Myotonic dystrophy) (b) Autosomal recessive trait (for
example: Sickle-cell anaemia)

6.9 Genetic Disorders

A genetic disorder is a disease or syndrome that is caused by an abnormality
in an individual’s DNA. Abnormalities can range from a small mutation in a
single gene to the addition or subtraction of an entire chromosome or even a
set of chromosomes. The occurrence of genetic disorders is based on the
heritability of certain characteristic features in families. After the rediscovery
of Mendel’s work, the practice of analyzing the pattern of inheritance of
traits in human beings began. As controlled crosses can be performed in pea

222
 Genetics

plants and some other organisms and not possible in human beings,
alternative studies were made to study the family history about the
inheritance of a particular trait.
A number of disorders in human beings have been found to be associated
with the inheritance of changed or altered genes or chromosomes. Genetic
disorders may broadly be grouped into two categories – Mendelian disorders
and Chromosomal disorders.
6.9.1 Mendelian disorders
Mendelian disorders are genetic diseases showing Mendelian pattern of
inheritance, caused by a single mutation in the structure of DNA, which
causes a single basic defect with pathologic consequences, in some cases.
Mendelian disorders are also called monogenic diseases. Monogenic diseases
run in families and can be dominant or recessive and autosomal or sex-
linked (allosomic). The pattern of inheritance of Mendelian disorders can be
traced in a family with the help of pedigree charts and their analyses.
The most common and prevalent Mendelian disorders are Haemophilia, Cystic
fibrosis, Sickle-cell anaemia, Colour blindness, Phenylketonuria,
Thalassemia, DMD, Albinism, etc.
1. Haemophilia
Haemophilia A (caused by deficiency of clotting factor VIII) and Haemophilia
B (caused by deficiency of clotting factor IX) are X-linked recessive disorders
that impair the body’s ability to control clotting or coagulation of blood.
Haemophilia C is an autosomal recessive disorder involving lack of the
functional clotting ‘factor XI’. Haemophilia is also called bleeder’s disease.
Haemophilia A and B follow the characteristic crisscross pattern of
inheritance like that of colour-blindness. In this disease, a single protein
that is a part of the cascade of reactions involved in the clotting of blood is
affected.
Haemophilia is more likely to occur in males than in females. This is because
females have two X-chromosomes while males have only one, and so the
defective gene on the X will certainly express in the male who carries it. As
it is caused by a recessive allele on the X chromosome, a female human
being has to be ‘double recessive’ to express haemophilia. Because the chance
of a female having two defective copies of the gene (alleles) is very remote,
the females are mostly asymptomatic carriers of the disorder. The ‘allele’ is
typically passed on from an affected father to 50% of his grandsons through
his ‘carrier daughters’. The family pedigree of Queen Victoria shows a number
of haemophilic descendents, as she was a carrier for the disease.

223
 Zoology

2. Sickle-cell anaemia
Sickle-cell anaemia is an autosomal recessive genetic blood disorder
characterized by red blood cells that assume an abnormal, rigid, sickle shape
in hypoxia conditions (at high altitudes or under physical stress, for instance).
Sickled cells may clump and clog small blood vessels, often leading to other
symptoms throughout the body, including physical weakness, pain, organ
damage, and even paralysis.
This disease is controlled by a single pair of alleles, HbA and HbS found on
the chromosome 11. The homozygous individuals for sickle-cell anaemia (HbS
HbS) express the diseased phenotype. Heterozygous individuals (HbA HbS)
appear ‘unaffected’ but they are still, carriers of the disease. Even though
two sickle cell alleles are necessary to cause sickle cell anaemia, one dose
can affect the phenotype. Persons ‘heterozygous’ to sickle cell trait can usually
lead a healthy life but in prolonged periods of reduced oxygen content in the
blood may suffer from symptoms of SCD as both normal and sickle cell
haemoglobin are formed in them.
Sickle cell anaemia is caused by a point mutation in the DNA that codes for
the beta globin polypeptide chains of the haemoglobin molecule, causing the
replacement of the glutamic acid in the sixth position by valine. The

Figure 6.13 Micrograph of the red blood cells and the amino acid composition of the relevant
portion of -chain of haemoglobin : (a) From a normal individual; (b) From an
individual with sickle-cell anaemia

224
 Genetics

heterozygous individuals are relatively resistant to the most severe effects of

malaria such as those of ‘falciparum malaria’ also (although they are not
resistant to malaria infection) – an effect called heterozygote advantage.
The heterozygous individuals carry the deleterious alleles in their genomes
(genetic load).

3. Phenylketonuria [PKU]
Phenylketonuria was discovered by A. Folling. This is an autosomal recessive,
metabolic genetic disorder caused by a mutation in the gene (PAH-
Phenylalanine hydroxylase gene) located on the chromosome 12 for the
hepatic enzyme ‘phenylalanine hydroxylase’. The affected individual lacks
the above mentioned enzyme that converts the amino acid phenylalanine
into tyrosine. When phenylalanine hydroxylase’s is absent, phenylalanine
accumulates and is converted into phenylpyruvate (also known as
phenylketone) and other derivatives. Accumulation of these substances in
the brain causes mental retardation. Adherence to a low phenylalanine diet
prevents major mental retardation.
Colour blindness
Colour blindness (colour vision deficiency) is a sex-linked recessive
disorder. It is the inability or decreased ability to see certain colours or
perceive differences between some colours. This phenotypic trait is due to
mutation in certain genes located on X-chromosome. The most common
inherited forms of colour blindness are Protanopia (red colour blindness),
Deuteranopia (green colour blindness) and Tritanopia (blue colour
blindness which is autosomal).
The son of a woman who carries one allele has a 50 percent chance of
being colour-blind. The mother herself is not colour-blind because the
allele is recessive. That means its effect is suppressed by her matching
dominant normal allele. A daughter will not normally be colour blind,
unless her mother is ‘colour-blind’ or a ‘carrier’ and her father is colour-
blind. The Ishihara colour test, which consists of a series of pictures of
coloured spots, is most often used to diagnose red-green colour blindness.
4. Thalassemia
Thalassemia is an autosome linked recessive blood disorder. This disease is
caused by the excessive destruction or degradation of red blood cells due to
formation of abnormal haemoglobin molecules, because of defects caused by
genetic mutations. Normally, haemoglobin is composed of four polypeptide
chains, two alpha and two beta globin chains arranged into a heterotetramer.
In the case of thalassemia, patients have defects in either the alpha or beta

225
 Zoology

globin chain (unlike sickle-cell anaemia, which is caused due to a specific

change in the beta chain), causing production of abnormal haemoglobin
molecules resulting in anaemia which is characteristic of the disease.
Thalassemias are classified based on which chain of haemoglobin molecule
is affected. In Alpha thalassemia, the production of alpha globin chain is
affected. Alpha thalassemia is controlled by two closely linked genes HBA1
and HBA2 on chromosome 16 of each parent and it is caused due to mutation
or deletion of one or more of the four alpha gene “alleles”. The more genes
affected, the less alpha globin molecules are produced and more severe in
the disease. In Beta thalassemia (Cooley’s Anaemia) production of beta
globin chain is affected. The Beta thalassemia is controlled by a single gene
HBB on the chromosome 11. It is the most common type of thalassemia. In
this disorder the alpha chains wihch are relatively more in number bind to
the RBCs and damage the membranes of RBC.
5. Cystic fibrosis
Cystic fibrosis is an autosomal recessive genetic disorder. CF is the result
of mutations affecting a gene on the long arm of chromosome 7 that influences
salt and water movement across epithelial cell membranes. The genetic defect
causes increased sodium and chloride content in sweat and increased
resorption of sodium and water from respiratory epithelium. The extracellular
chloride causes the mucus that coats the cells to become more viscous and
sticky. The mucus clog builds up in organs such as lungs, pancreas, GI tract
etc. and leads to further complications and may lead to death by the age five,
if untreated.
6. Alkaptonuria
Alkaptonuria is a rare genetic disorder due to recessive gene in autosomes.
In this disorder the urine of affected persons becomes black when it is exposed
to air. (Gk. Alkapton - black). When our body is unable to utilise the
aminoacids phenyl aniline and tyrosine properly, homogentisic acid or
alkapton is accumulated in the tissues of skin and catilages. When it is
eliminated through urine, on exposure to air, it becomes black. Alkaptonuria
is resulted when homogentisate 1, 2 dioxugemase (enzyme) is not produced
in sufficient amounts. This condition is due to a mutation in the HGD gene
(homogentisate dioxygenase gene). The affected persons suffer from joint
pains (especialy in vertebral column), blackening of cartilages, formation of
black spots in retina and sclera of eye. The pinnae, tip of nose become black
due to accumulation of alkaptone.
6.9.2 Chromosomal disorders
Chromosomal disorders are caused by errors in the ‘number’ or ‘structure’ of
chromosomes. Chromosomal anomalies usually occur when there is an error

226
 Genetics

in cell division. Aneuploidy is a chromosomal aberration where there is a

gain or loss of one or more chromosomes in a ‘set’. It is caused by non-
disjunction of chromosomes. The result of this error is origin of cells with a
deviation from the normal number of chromosomes – aneuploidy.
NOTE : Monosomy (2n-1) is a chromosomal aberration where one
chromosome is lost from a pair. Monosomy 23 (loss of an X chromosome)
causes a syndrome called Turner’s syndrome in human females.
Trisomy (2n+1) is a chromosomal aberration where one chromosome is
added to the already existing homologous pair. When a chromosome is
added to the 21st pair of autosomes, it is called trisomy 21. Trisomy 21
in man causes a syndrome called Down syndrome. Trisomy of sex
chromosomes is due to the addition of one sex chromosome. It causes a
syndrome called Klinefelter’s syndrome.

A. Allosomal disorders
i. Klinefelter’s syndrome
This genetic disorder is caused by trisomy 23rd pair in males. The karyotype
is 47, XXY. A Klinefelter male possesses an additional X-Chromosome along
with the normal XY. The principal effects include hypogonadism and reduced
fertility. At the same time, feminine sexual development is not entirely
suppressed. Slight enlargement of the breasts (gynecomastia) is common.
The somatic cells of a Klinefelter male exhibit Barr bodies in their nuclei.
NOTE : Karyotype 47, XXY. Note the convention used in designating
these chromosome compositions: the number states the total number of
chromosomes present, and the symbols after the comma indicate the
deviation from the normal diploid number.

ii. Turner’s syndrome

The Karyotype is 45, X. It is due to monosomy 23rd pair, where one X-
chromosome is lost. A Turner female does not show Barr bodies in her
somatic cells. The symptoms are short stature, gonadal dysgenesis, webbed
neck and broad shield like chest with widely spaced nipples.
B. Autosomal disorders
Most of the following disorders are common in children born to women who
conceive babies rather late in their reproductive phase.
Down syndrome (Trisomy 21)
Down syndrome is a genetic condition that causes delays in physical and
intellectual development. The cause of this genetic disorder is the presence
of an additional copy of the chromosome numbered 21 (trisomy of 21st set).

227
 Zoology

The karyotype is designated as Trisomy 21 (47,+21). The affected individual

is short statured with small round head, furrowed tongue and partially open
mouth. Physical, psychomotor and mental development is retarded.
Edwards syndrome (Trisomy 18)
Edwards syndrome (47,+18) is a chromosomal abnormality characterized
by the presence of an extra copy of the genetic material of the 18th
chromosome, either in whole (trisomy 18) or in part (such as due to
translocations). Edwards syndrome occurs in both males and female but
is more common in the female offspring. The majority of people with the
syndrome die during the foetal stage; infants who survive experience serious
defects (cardiac abnormalities and kidney malfunction) and commonly live
for short periods of time.
Patau syndrome (Trisomy 13)
Patau syndrome, is a chromosomal condition associated with severe
intellectual disability and physical abnormalities in many parts of the
body. Most cases of trisomy 13 (47,+13) result from having three copies of
chromosome 13 in each cell in the body instead of the usual two copies.
Individuals with trisomy 13 often have heart and kidney defects, brain or
spinal cord abnormalities, very small or poorly developed eyes
(microphthalmia), cleft palate etc. Due to the presence of several life-
threatening medical problems, many infants with trisomy 13 die within
their first days or weeks of life.
Cri-du-Chat syndrome (5p minus syndrome)
Cri-du-chat syndrome (cat-cry) is due to a partial deletion of the short
arm of chromosome 5, (also called 5p monosomy). It might be considered
a case of partial monosomy, but since the region that is missing is so
small, it is better referred to as 5p segmental deletion. The karyotype is
46,5p-. It is a French term referring to the characteristic cat-like cry of
the affected children due to problems with the larynx and nervous system.
Such infants are mentally retarded, have a small head with unusual facial
features. They die in infancy or early childhood.
Chronic Myelogenous (Myeloid) Leukemia (CML)
In certain cancers such as Chronic myelogenous leukemia (also called
Chronic granulocytic leukemia), a piece of the chromosome 9 and a piece
of the chromosome 22 break off and ‘switch places’ (exchange places) with
each other (reciprocal translocation). This results in the formation of an
abnormally short chromosome 22 and abnormally long chromosome 9.
The short 22nd chromosome is called Philadelphia chromosome produced
by translocation which is also called Philadelphia translocation. The
karyotype is 46, t(9 ; 22). The Philadelphia chromosome results in the
production of an abnormal enzyme called a tyrosine kinase. Along with
other abnormalities, this enzyme causes uncontrolled cell cycle progression
leading to the cancer called chronic myelogenous leukemia.

228
 Genetics

6.10 Human Genome Project

6.10.1 What is a chromosome/DNA?
Chromosome is a chain of DNA wrapped in a proteinous pellicle (eukaryotic
chromosome). DNA consists of a linear series of nucleosomes. A nucleosome
consists of a group of protein molecules (8 molecules of histone protein)
wrapped around twice by DNA. The dense mass of loops and coils inside the
nucleus constitute the chromatin. Chromatin occurs in two forms - the
deeply staining heterochromatin and the light staining euchromatin. Some
DNA codes for specific proteins which control the
structure and functioning of the body of the organism –
in this case, man. Some DNA is involved in regulating
the expression of the genes that code for specific proteins
(e.g. repressor protein). The remaining nonfunctional
DNA is called Junk DNA.
A genome (whole hereditary information encoded in
DNA/a set of DNA instructions in a cell) is an organism’s
complete set of deoxyribonucleic acid (DNA) molecules.
DNA is a chemical compound that contains the genetic instructions needed
to develop and direct the activities of every organism (in the form of a set of
chromosomes). The genetic make-up of an organism or an individual lies in
the DNA sequences. If two individuals differ, then their DNA sequences should
also be different, at least at some places. These assumptions led to the quest
of finding out the complete DNA sequence of human genome.

6.10.2 What is Human Genome Project?

Human Genome Project (HGP) was a mega project. It was an International
efforts formally begun in October 1990. The HGP was a 13-year project
coordinated by the U.S. Department of Energy and the National Institute
of Health. During the early years of the HGP, the Wellcome Trust (U.K.)
became a major partner, and additional contributions came from Japan,
France, Germany, China and others. The project was almost completed by
2003. Knowledge about the effects of DNA variations among individuals can
lead to revolutionary new ways to diagnose, treat and someday hopefully
prevent thousands of disorders that affect human beings. HGP was closely
associated with the rapid development of a new area in biology called
Bioinformatics.
Besides providing clues to understanding human biology, learning about
non-human organisms’ DNA sequences can lead to an understanding of their
natural capabilities that can be applied towards solving challenges in health

229
 Zoology

care, agriculture, energy production, environmental remediation. Genomes

of many non-human model organisms, such as bacteria, yeast, Caenorhabditis
elegans (a free living non-pathogenic nematode), Drosophila, plants (rice and
Arabidopsis), etc. have also been sequenced. In a way they helped the progress
of HGP.
6.10.3 Goals of HGP
Some of the important goals of HGP were as follows:
i) Identify all the approximately 30,000 genes in human DNA.
ii) Determine the sequences of the 3 billion chemical base pairs that
make up human DNA.
iii) Improve tools for data analysis.
iv) Address the ethical, legal, and social issues (ELSI) that may arise
from the project.

6.10.4 Methodologies
The methods involved two major approaches. One approach focused on
identifying all the genes that expressed as RNA (referred to as Expressed
Sequence Tags (ESTs). The other took the blind approach of simply
sequencing the whole set of genome that contained all the coding and non-
coding sequence, and later assigning different regions in the sequence with
functions (a term referred to as Sequence Annotation).
What is DNA sequencing?
DNA sequencing, the process of determining the exact order of the 3 billion
paired chemical building blocks (called ‘bases’ - A, T, C, and G) that make
up the DNA of the 24 different human chromosomes (23 + Y in a male), was
the greatest technical challenge in the Human Genome Project.
For sequencing, the total DNA from a cell is isolated and converted into
random fragments of relatively smaller size and cloned in a suitable host
using specialized vectors. The cloning results in the amplification of DNA
fragments which are used for sequencing the bases. The commonly used
hosts are bacteria and yeast, and the vectors are called BAC (bacterial
artificial chromosomes), and YAC (yeast artificial chromosomes). The
fragments were sequenced using automated DNA sequencers that work on
the principle of a method developed by Frederick Sanger. Alignment of these
sequences was humanly not possible. Therefore, specialized computer based
programs were developed. These sequences were subsequently annotated
and were assigned to each chromosome. The latest method of sequencing
even longer fragments, by a method called Shotgun sequencing using super
computers, replaced the traditional sequencing methods.

230
 Genetics

6.10.5 Salient Features of Human Genome

Some of the salient observations drawn from human genome project are as
follows:
i) The human genome consists of chromosoms made up of nucleotide
base pairs.
ii) The average gene consists of 3000 bases, but sizes vary greatly, with
the largest known human gene being the one that codes for the
protein called dystrophin.
iii) The total number of genes is estimated at 30,000. Almost all (99.9
%) nucleotide bases are exactly the same in all people.
iv) The functions are unknown for over 50 % of the genes discovered.
v) Less than 2 per cent of the genome codes for proteins.
vi) Repeated sequences make up very large portion of the human genome.
vii) Repetitive sequences are stretches of DNA sequences that are
repeated many times. They are thought to have no direct coding
functions, but they shed light on chromosome structure, dynamics
and evolution.
viii) Chromosome 1 has the highest number of genes (2,968), and the Y-
chromosome has the fewest genes (231).
ix) Scientists have identified about 1.4 million locations where single
base DNA differences (SNPs – single nucleotide polymorphism,
pronounced as snips) occur in humans. This information promises
to revolutionise the processes of finding chromosomal locations for
disease-associated sequences and tracing human history.

6.10.6 Advantages of HGP

1. In the area of health care, identification and mapping of the genes
responsible for genetic diseases helps in diagnosis, treatment and
prevention of these diseases.
2. Detailed knowledge of the genomes of humans and other species will
give a clearer picture of Gene expression, Cellular growth and
differentiation and evolutionary biology.
3. Earlier detection of genetic predispositions to disease, rational drug
design, Gene therapy is going to be easy with more knowledge on human
genome.
4. A new era of Molecular Medicine, characterized by looking into the
most fundamental causes of disease than treating the symptoms will
be an important advantage.

231
 Zoology

6.11 DNA Finger Printing

Introduction
Over 99.9% of the 3 billion nucleotide pairs in human DNA are identical
among all individuals. No two people (other than identical twins) have exactly
the same sequence of bases in their DNA. Restriction Fragment Length
Polymorphisms (RFLPs -pronounced ‘riflips’) are characteristic to every
person’s DNA. They are called Variable Number Tandem Repeats (VNTRs)
and are useful as Genetic markers. The VNTRs of two persons generally
show variations. DNA fingerprinting involves identifying differences in some
specific regions in DNA sequence called repetitive DNA, because in these
sequences, a small stretch of DNA is repeated many times. These sequences
show high degree of polymorphism and form the basis of DNA fingerprinting.
They are bits of chromosomes that can be cut by restriction endonucleases.
The ‘fundamental technique’ involved in DNA Finger Printing was pioneered
and perfected by Jeffrys of Great Britain. He observed that the gene pertaining
to myoglobin of muscles contains many segments that vary in size and
composition, from one person to another. For example in the following
hypothetical example nucleotide base sequence, there are 6 Tandem Repeats
of 16 bases each (count the first 16 and note how they are repeated)
5’ GACTGCCTGCTAAGATGACTGCCTGCTAAGATGACTGCCTGCTAAGAT
GACTGCCTGCTAAGATGACTGCCTGCTAAGATGACTGCCTGCTAAGAT 3’
Such clusters of 10 -100 nucleotides are called mini satellites. Such tandem
repeats are characteristic of every person’s DNA. The VNTRs of two persons
differ in the number of tandem repeats or the sequence of bases. Such changes
are caused due to mutations and gene recombinations. For example a child
might inherit a chromosome with 6 tandem repeats from the mother and the
same tandem repeated 4 times from the father in homologous chromosomes.
It means some of the VNTR segments of the child resemble those of the
mother and the others, those of the father. This is a ‘heterozygous condition
with reference to VNTR segments’. These tandem repeats serve as basis of a
technique called DNA fingerprinting.

NOTE : DNA fingerprinting, also known as DNA Typing or Genetic

Fingerprinting, is a method for identifying individuals by the particular
structure of their DNA. DNA fingerprinting is used for many purposes,
particularly paternity/maternity testing and for forensic work. DNA
can be obtained from blood, semen, vaginal fluid, hair roots, almost
any tissue, and even from bones that have been buried for a long time,
for fingerprinting. DNA fingerprinting is a technique by which the DNA
of an individual can be compared with that found in a sample or another
individual (a suspect in a crime).

232
 Genetics

6.11.1 DNA Fingerprinting-Protocol

1. Obtaining DNA (Isolation/Extraction) : The first step is to obtain a
sample of DNA from blood, saliva, hair roots, semen etc. If needed many
copies of the DNA can be produced by PCR (cloning/DNA amplification)
2. Fragmenting DNA (Restriction Digestion) : Treating DNA with Restriction
Enzymes (Restriction endonucleases) which cut the DNA into smaller
fragments by cutting it at specific sites.
3. Separation of DNA fragments by electrophoresis : DNA fragments
are applied at one end of agarose gel plate. When an electric current is
applied to the gel, the DNA fragments (which are slightly negatively
charged) travel across the gel (smaller and more mobile pieces travel
farther). This technique of separation of DNA fragments into individual
bands is called Gel Electrophoresis.
4. Denaturing DNA : The DNA on the gel is ‘denatured’ using alkaline
chemicals or by heating. (denaturing means separation/splitting of the
double helix into ‘single strands’ by breaking hydrogen bonds between
the two strands).
5. Blotting : A thin nylon membrane is placed over the ‘size fractionated
DNA strands’ and covered by paper towels. As the towels draw moisture
the DNA strands are transferred on to the nylon membrane by capillary
action. This process is called ‘Blotting’ – more precisely Southern
blotting, after the name of its inventor E.M. Southern.
6. Using probes to identify specific DNA: A radioactive probe (DNA
labeled with a radioactive substance) is added to the DNA bands. The
Probe is a single stranded DNA molecule that is ‘complementary’ to the
gene of interest in the sample under study. The probe attaches by base
pairing to those restriction fragments that are complementary to its
sequence. The probes can be also prepared by using either ‘fluorescent
substances’ or ‘radioactive isotopes’.
7. Hybridisation with probe: After the probe hybridises and the excess
probe washed off, a photographic film is placed on the membrane
containing ‘DNA hybrids’.
8. Exposure on film to make a Genetic/DNA Finger Print: The radioactive
label exposes the film to form an image (image of bands) corresponding
to specific DNA bands. The thick and thin dark bands form a pattern of
bars which constitute a Genetic fingerprint.
A given person can never have a VNTR which his parents do not have.
Obtaining hybrid with radioactive probe and matching DNAs of different

233
 Zoology

members of a family with

biological children and
adopted children, gives us an
idea of how DNA Finger Prints
help identification of
paternity/maternity, by
studying the ‘DNA Finger
Prints’ of members of a Family
– Biological and non-
biological relationships.
Figure 6.13 Forensic application of DNA fingerprinting
The illustrations given below
are the VNTR patterns for,
Mrs. Rose [blue], Mr. Rao
[yellow], and their four children : D1 (Mr. Rao’s biological daughter), D2
(Mr. Rao’s step-daughter, child of Mrs. Rose and her former husband [red],
S1 (Mr. Rao’s biological son), and S2 (Mr. Rao’s adopted son - not biologically
related, his parents’ DNA marked in light and dark green bands).

6.11.2 Applications of DNA Finger Printing

1. Conservation of wild life – protection of endangered species. By
maintaining their DNA records for identification of tissues of the dead
endangered organisms
2. Taxonomical applications – study of phylogeny.
3. Pedigree analysis – inheritance pattern of gene through generations.
4. Anthropological studies –charting of origin and migration of human
population.
5. Medico-legal cases – establishing paternity and/or maternity more
accurately.
6. Forensic analysis – positive identification of a suspect in a crime.

234
 Genetics

G LOSSARY
Agglutinogens: An antigen that Ig G antibody: IgG is the main
stimulates the production of a antibody found in the blood and
particular agglutinin, such as an extracellular fluid, allowing it to
antibody. control infection of body tissues by
Aneuploid: Having a chromosome binding many kinds of pathogens,
number that is not an exact such as viruses, bacteria, and
multiple of the haploid number of fungi—IgG protects the body from
the species. infection. They are simple antibodies
Antiserum: Antiserum is the blood that cross the placental border and
serum containing antibodies cause HDNB in the case of Rh
against a specific antigen, used to incompatibility.
treat or provide immunity to a Ig M antibody: It is a basic antibody
disease. It is extracted from an that is produced by B cells. IgM is
animal that was artificially made to physically the largest antibody in the
develop antibodies and thus a human circulatory system. It is the
specific immunity to a particular first antibody to appear in response
disease. to initial exposure to antigen. The
Erythroblast: An immature spleen is the major site of specific
form(developmental immature IgM production.
stage) of a red blood cell. It is Isoagglutinin: An isoantibody
normally found only in bone normally present in the serum of an
marrow and contains haemoglobin. individual that causes the
Genetic markers: A genetic marker agglutination of the red blood cells
is a gene or DNA sequence with a of another individual of the same
known location on a chromosome species.
that can be used to identify PCR: The polymerase chain reaction
individuals or species. (PCR) is a biochemical technology to
Haemolytic anaemia: It is a form of amplify a single or a few copies of a
anemia due to haemolysis, the piece of DNA into thousands to
abnormal breakdown of red blood millions of copies ; it is a process of
cells, either in the blood vessels ‘cloning’ DNA.
(intravascular haemolysis) or Point mutation: A point mutation, or
elsewhere in the human body single base substitution, is a type of
(extravascular). mutation that causes the
Heterochromatin: The part of a replacement of a single base
chromosome that is inactive in gene nucleotide with another nucleotide
expression but may function in of the genetic material, DNA or RNA.
controlling metabolic activities, The term point mutation also
transcription, and cell division. It includes insertions or deletions of a
stains most intensely during single base pair.
interphase and usually remains in Pseudoautosomal regions: These are
a condensed state throughout the sequences of nucleotides on the
cell cycle. homologous regions of the X and Y

235
 Zoology

chromosomes. The restriction endonucleases. A

pseudoautosomal regions get their restriction enzyme recognizes and
name because any genes located cuts DNA only at a particular unique
within them are inherited just like sequence of nucleotides, allowing for
any autosomal genes and they show restriction sites to be mapped.
genetic recombination by cross over Satellite DNA : Short, highly repeated
as in autosomal pairs. eukaryotic DNA sequences, usually
Restriction endonucleases : clustered in heterochromatin and
Restriction enzymes are ‘DNA- generally not transcribed.
cutting enzymes’ They cut within the
molecule, and so they are called

Q UESTIONS
11. What is haplo-diploidy?
Very Short Answer Type Questions 12. What is Klinefelter’s syndrome?
1. What is pleiotropy? 13. What is Turner’s syndrome?
2. What are the antigens causing 14. What is Down syndrome?
‘ABO’ blood grouping? Where are 15. What is sex-linked inheritance?
they present?
16. Define hemizygous condition?
3. What are the antibodies of ‘ABO’
17. What is crisscross inheritance?
blood grouping? Where are they
present? 18. Why are sex-linked recessive
characters more common in the
4. What are multiple alleles?
male human beings?
5. What is erythroblastosis foetalis?
19. How many base pairs are observed
6. A child has blood group ‘O’. If the in human genome? What is the
father has blood group ‘A’ and average number of base pairs in a
mother blood group ’B’, work out human gene?
the genotypes of the parents and
20. What is ‘junk DNA’?
the possible genotypes of the other
off spring. 21. What are VNTRs?
7. What is the genetic basis of blood 22. List out any two applications of DNA
types in ABO system in man? fingerprinting technology.
8. What is polygenic inheritance?
9. Compare the importance of Y-
chromosome in human being and
Drosophila.
10. Distinguish between heterogametic
and homogametic sex deter -
mination systems.

236
 Genetics

Short Answer Type Questions Long Answer Type Questions

1. How is sex determined in human 1. What are multiple alleles? Describe

beings? multiple alleles with the help of ABO
2. Describe erythroblastosis foetalis. blood groups in man.
2. Describe chromosomal theory of sex
3. Mention any two allosomal genetic
determination.
disorders with their symptoms.
3. What is crisscross inheritance?
4. Describe the genetic basis of ABO Explain the inheritance of one sex
blood grouping. linked recessive character in
5. Describe male heterogamety. human beings.
6. Describe female heterogamety. 4. Write an essay on common genetic
disorders.
7. Describe the Genic Balance
5. Why is the Human Genome project
Theory of sex determination.
called a mega project?
8. Explain the inheritance of sex 6. What is DNA fingerprinting?
linked recessive character in Mention its applications.
human being.
9. A man and woman of normal
vision have one son and one
daughter. Son is colour-blind and
his son is with normal vision.
Daughter is with normal vision,
but one of her sons is colour-blind
and the other is normal. What are
the genotypes of the father,
mother, son and daughter?
10. A colour -blind man married a
woman who is the daughter of a
colour-blind father and mother
homozygous normal vision. What
is the probability of their
daughters being colour-blind?
11. Write the salient features of ‘HGP’.
12. Describe the steps involved in
DNA fingerprinting technology.

237
 Zoology

FOR IGNITED
MINDS GENETICS
1. Can a human being with relatively more dark pigment in the skin, give birth to
a fair complexioned child? If so, how? (Do not consider gametic donors, in vitro
fertilisation etc.).
2. Is it scientifically possible for the first Rh positive child of a Rh negative mother,
with no transplacental ‘sensitisation’ during the gestation period, die of HDNB,
for whatever possibility? Hint : The mother need not necessarily be sensitised
by the Rh positive foetus only.
3. What is the statistical possibility of the birth of four consecutive homogametic
human offspring in a family with normal healthy husband and wife?
4. The Guinness Book of Records says that there is a family with five Rh positive
children born to an Rh negative mother. The children do not have large ‘age
gaps’ between them. How was that possible?
5. If the mother is Rh negative, all her Rh positive children will suffer from HDNB
(assuming the normal sensitisation of mother during parturition)? Do you endorse
this statement or challenge the validity of the statement?
6. The word ‘UNIVERSAL DONOR’ can never be used for, with reference to transfusion
of fluid tissues or components of it? Comment.
7. All ‘gene based disorders’/‘genetic disorders’ are congenital (expression by birth),
for the simple reason they are ‘gene based’. Do you agree with the statement?
8. How many genes control the ABO system of blood groups in man? HINT: It is the
question of application of a little ‘genetical sense’.
9. When the blood of an ‘A’ group person is transfused to a ‘B’ blood group person,
the B group person (recipient) dies predominantly due to ‘clumping’ of his RBCs
due to the anti B anti bodies of the donor’s blood. Can you defend the statement
or can you prove it wrong?
10. If your class mate says “the first child in a family, who receives Rh antigen from
the paternal source and Rh antibodies from his Rh negative mother, suffers from
HDNB” - do you agree with him? If not why don’t you agree?
11. If an animal cell has ‘XO’ allosomic condition, what are the possible influences
you can draw regarding that person and condition.

n
12. Failure of a process during cell divisions causes most of the common syndromes
in human beings. What do you call that process?
13. Mostly allosomes and sometimes autosomes too take part in the determination
of the sex of the embryo. Can you give an example where neither allosomes, nor
autosomes or their ratios do not decide the sex of the young one?

238
 Unit-VII
ORGANIC EVOLUTION
OLUTION
A.R. Wallace

Organic Evolution – ‘Darwin’s Play Field’ and the

‘Mystery of Mysteries’
Gone are the days when people believed that some supernatural force created
this world and that the Earth had all the current fauna and flora right from the
beginning. The term ‘Organic Evolution’ was coined by Herbert Spencer.
The core of the evolution spins around ‘alleles’ and changes in their frequencies,
with several natural phenomena governing them. Lamarck is recognized to be
the first person to have proposed an organized theory to explain evolutionary
process,which was based on ‘inheritance of acquired characters’.
Darwin,with his historical book ‘On The Origin of Species” revolutionized the
human approach to this ‘mystery of mysteries’ –the evolution, better called
‘organic evolution’. Natural Selection according to Darwin is the ‘force’ that
‘selects the fittest’ and the one which is selected has obviously better features to
adapt to the environment. It passes its special features of survival and over a
long time the ‘slow and gradual accumulation of beneficial variations caused
‘speciation’ (Descent with Modification) according to Darwin (microevolution).
Hugo de Vries laid more stress on the role of ‘mutations’ in evolution -
macroevolution. It is clear that individual organisms do not evolve. The present
day concept of evolution is – it is the gradual change in the allelic frequencies in
a population. It lays more stress on occurrence of variations through mutations,
gene recombinations, genetic drift, gene flow etc., and the selection of the
‘heritable’ beneficial variations through positive selection pressure, reproductive
isolation. Mutation is the ultimate source of genetic variation and thus it makes
evolution possible, as considered by NeoDarwinists. Beneficial mutations tend
to accumulate and are considered the ‘driving force’ of evolution. A non-evolving
population is in a state of equilibrium called ‘HARDY-WEINBERG EQUILIBRIUM’.
You are going to learn in depth, the efforts humans are making to make us
understand this ‘mystery’.
 Zoology

Organic Evolution
7.1 Origin of life
7.2 Biological Evolution
7.3 Evidences for Biological Evolution
7.4 Theories of Evolution
7.5 Modern Synthetic theory of Evolution
7.6 Mechanism of Evolution
7.7 A brief account of evolution
7.8 Origin and evolution of Man

Introduction
Evolution is the branch of biology that deals with the origin of life and the
diversity of organisms on the earth through ages. The literal meaning of
evolution is unfolding or rolling out. The word ‘organic evolution’ was coined
by Herbert Spencer. Evolution is a continuous process of development of
more complex organization from simple level. “Nothing in Biology makes sense
except in the light of Evolution” according to Dobzhansky.

7.1 Origin of life

Life had a beginning. When did life begin on the earth? What is the mechanism
involved in the origin of the life? Since the origin of living organisms, did
they change through time? - are some of the important questions that confront
our minds. Many theories have been proposed to explain the origin of life.
But most of them are of only historical importance. Some of them are discussed
here.
I. Theory of Special creation: It is purely a mythological belief. This
theory states that living organisms on the earth were created by a
Divine Power.

240
 Organic Evolution

II. Cosmozoic theory or Panspermia: According to this theory, life might

have existed else where in the universe (cosmos) and it might have
reached the Earth in the form of resistant spores called cosmozoa or
panspermia.
III. Theory of Spontaneous generation or Abiogenesis: According to this
theory, life originated from non-living or decaying and rotting substances
like manure, dew, etc. Aristotle, Thales, Plato and Von Helmont
believed in this idea of abiogenesis.
IV. Theory of Catastrophism: This theory was proposed by Georges Cuvier.
According to this theory, earth was subjected to periodic catastrophes.
It essentially states that all the existing organisms would die and new
organisms would be created after every catastrophe that occurred in
the history of the Earth.
V. Theory of Biogenesis: According to this theory, living organisms
originate from pre-existing organisms. Louis Pasteur expirementally
proved that ‘life’ cannot arise from non-living substances by his swan-
neck flask experiment.
VI. Theory of Chemical and Biological Origin of life or Coacervate theory:
This theory was proposed by A.I. Oparin of Russia and supported by
J.B.S. Haldane of England. According to this theory, primitive organisms
evolved spontaneously from the inorganic substances as a result of
physical forces such as lightning, ultraviolet radiation, volcanic
activities, etc. in the Primordial environment of the Earth. Thus origin
of life was primarily a phenomenon of ‘chemical evolution’ that later led
to ‘biological evolution’.
1. Chemical evolution: This includes the origin of the earth and the primitive
atmosphere, formation of early simple organic molecules which later formed
the complex organic molecules. The earth originated approximately 4.5 to
5 billion years ago. At that time, the temperature of the earth was estimated
to be around 5000OC to 6000OC and it slowly cooled down over millions of
years. During this process, lighter elements such as helium, hydrogen,
nitrogen, carbon, etc., flowed to the surface and formed the primitive
atmosphere. This was hot with abundant hydrogen and absence of free
oxygen. Thus, it was a reducing atmosphere. The elements combined and
formed compounds such as ammonia, methane, etc. The water vapour in the
atmosphere condensed into droplets of rain, which ran over the land as
streams, rivers and finally collected to form oceans. Ammonia, methane,
etc., were washed down along with the rain water. Mineral-rocks were also
dissolved leading to the accumulation of minerals in the water. Highly reactive
 
radicals such as CH and CH 2 are condensed to form a variety of
hydrocarbons. They reacted with ammonia and water to produce various
241
 Zoology

simple organic molecules like sugars, amino acids, fatty acids, purines and
pyrimidines which later formed nucleosides and nucleotides. All these
reactions occurred in the pools of boiling water on the Earth, which was
described as the hot dilute soup or prebiotic soup by J.B.S. Haldane. In
the prebiotic soup, these simple organic molecules produced complex polymers
like polysaccharides, proteins, fats and nucleic acids. Nucleic acids and
proteins combined to form nucleoproteins.

2. Biological evolution :This includes (i) the formation of protobionts, (ii) the
origin of living organisms from them and their diversification.
(i) The formation of Protobionts: From the complex organic molecules,
large colloidal aggregates called coacervates (bubble like droplets) were
synthesized due to intermolecular attractions. Some type of chemical
organisers (considered free genes) developed to give these droplets ‘the
ability to take-in molecules from the surroundings’. Later they acquired
lipid membranes. Some of the proteins inside them acquired the property
of enzymes resulting in the fast multiplication of molecules.
(ii) The origin of living organisms: The ‘Free Genes’ started absorbing
organic molecules from the prebiotic soup and evolved into anaerobic
heterotrophs approximately three to four billion years ago. They obtained
their energy by the fermentation of some organic molecules. The earliest
living organisms had clumps of nucleoproteins containing one or two
DNA molecules and were similar to the present day prokaryotes. During
the course of evolution these early prokaryotes acquired the
carbohydrate-synthesis catalysing enzymes. Thus early chemo-
autotrophic organisms (e.g. iron and sulphur bacteria) which can
thrive at high temperatures evolved. These organisms could take carbon
dioxide into their bodies and used the chemical energy to create
carbohydrates and sugars. Meanwhile some bacteria synthesised
bacterial chlorophyll (e.g. purple and green sulphur bacteria) from
the magnesium porphyrin of ocean waters. This pigment trapped the
solar energy and fixed the CO2. These were the anoxygenic photo-
autotrophic organisms. Later the bacterial chlorophyll evolved into
true chlorophyll as in cyanobacteria and plants. As a result, oxygenic
photo-autotrophic organisms (like blue green algae) evolved. It
resulted in the increase of large quantity of oxygen in the atmosphere
about two billion years ago. These events transformed the reducing
atmosphere into the modern oxidising atmosphere. With the availability

242
 Organic Evolution

of free oxygen, finally aerobic mode of respiration evolved. Later, the

eukaryotes evolved probably by two processes. a) Some prokaryotes
entered the bodies of the ancestral eukaryotes and lived symbiotically.
They evolved into organelles such as mitochondria and plastids. b)
The endomembrane system of eukaryotes might have evolved by the
infoldings of plasma membrane of the ancestral prokaryotes.

Figure 7.1 Formation of Eukaryotes

Experimental verification of chemical
origin of life
Harold Urey and Stanley Miller
successfully proved the chemical origin of
life that was explained by Oparin, with
their simulation experiment. They tried
to create the primordial conditions in the
laboratory. They sealed a mixture of water
vapour, methane, ammonia and hydrogen
(simulation of primordial atmosphere)
in a spark chamber which was provided
with electrodes for electric discharge
(simulation of lightning energy). It was
connected to another flask with the
provision for boiling. The spark chamber
was connected on the other end to a
condenser tube (simulation of rain and
Cooling). After some days, they noticed
Figure 7.2 Urey & Miller Experiment

243
 Zoology

simple amino acids such as glycine, alanine and aspartic acid in the aqueous
solution. Later in similar experiments, formation of all types of amino acids,
and also formation of adenine and other nitrogen bases were noticed.

7.2 Evidences for Biological Evolution

The theories that explain the evolution are hypothetical. There is no practical
proof for them. In fact, it is not possible for anybody to observe even a single
change in favour of evolution that occurs in the body of organisms as our life
span is too short to notice such slow changes. Hence scientists collected
evidences from different branches of biology. Some of them are
a. Evidences from palaeontology,
b. Evidences from embryology,
c. Evidences from comparative anatomy
d. Evidences from cell and molecular biology
1. Evidences from Palaeontology: Palaeontology (Gr. Palaios - old, on-
existing, logos - to study) is the study of prehistoric life through fossils.
Fossils are the remnants of plants or animals that were preserved in
the layers of the earth and have been excavated from the soil. They are
of various types like moulds, casts, petrifications, coprolites (fossilized
faecal matter), actual remains of animals preserved in ice, etc. They
support the idea that life has gradually evolved on the earth. The
biologists and palaeontologists have found the fossils of many transitional
forms (connecting links) which link all the major groups of vertebrates
e.g. Eusthenopteron between fishes and amphibians, Seymouria
between amphibians and reptiles, Archaeopteryx between reptiles and
birds, Cynognathus between reptiles and mammals, etc.

Do you know? The age of a fossil is calculated by using Carbon14,

Uranium238 and Potassium40. Of these, as C14 is commonly used to
determine the age of comparatively recent and this method is called
Radio Carbon Dating method.
A complete fossil record of the various stages in the evolution of horse is
available. It indicates that evolution is a gradual process and not a sudden
creation of a species.
Geological Time Scale: The earth contains different layers of sediments of
which, the bottom layer is the oldest layer and the upper layer is the most
recent layer. Based on the age of rocks, a time scale was prepared and it is
called the geological time scale, it depicts the different stages of the evolution

244
 Organic Evolution

of life on the earth over the past millions of years. It consists of Eras which
are divided into Periods that may be further subdivided into Epochs (in the
coenozoic Era). These Eras, Periods and Epochs depict the time of origin and
dominance of certain groups of animals during certain Eras or Periods. It
provides the most direct evidences for the concept of evolution.

Table 1 Geological Time Scale

Era Period Epoch Significance

Holocene Civilization of human beings
Quaternary
Pleistocene Origin of human beings
Coenozoic Era Pliocene
(Age of mammals) Miocene
Tertiary Oligocene Origin of many mammals
Eocene
Palaeocene

Cretaceous Extinction of dinosaurs by the end

Mesozoic Era
Jurassic No Epochs Origin of birds
Golden age of reptiles)
Triassic Origin of dinosaurs and mammals

Extinction of trilobites and many

Permian
other marine animals
Golden age of amphibians,
Carboniferous
Origin of cotylosaurs (first reptiles)
Palaeozoic Era Devonian No Epochs Golden age of fishes,
Origin of amphibians
Silurian Origin of fishes
Ordovician Origin of ostracoderms
Cambrian Origin of trilobites

Precambrian Era
Comprises 88% of the geologic time

Do you know? If the entire earth is considered a book, then the layers
are the pages and the fossils are letters with which the history of the
earth was written. Hence the fossils are considered the documentary
evidences in support of evolution ( meaning that fossils are some kind
of written proofs for evolution)

245
 Zoology

2. Evidences from embryology: The study of the formation and early

development of an organism is called embryology. Ernst Haeckel is
considered the ‘Father of Embryology’ and Von Baer is considered the
Father of Modern Embryology. When the embryos of different animals
are observed, we find a fundamental similarity which tells us that there
is a relationship among the animals. Embryology provides evidences
from i) the observations of Von Baer, ii) sequence of the developmental
stages of some animals, and iii) recapitulation of certain ancestral
features during embryonic
development.
i) The observations of Von
Baer: Von Baer studied the
embryology of fish,
salamander, tortoise, chick
and man. He observed that
the early embryos of the
above animals resemble each
other closely in some basic/
fundamental features.
However these embryos
differ in the final stages due
to the formation of specialized
characters. It indicates that
the above animals have a
common ancestor.
ii) Sequence of the develop-
mental stages: The life of all
Fish Salamander Tortoise Chick Man the multicellular organisms
begins with a single celled
Figure 7.3 Embryological Evidences stage, the zygote. It
undergoes cleavages to
produce the first stage embryo, the morula, which develops into a single
layered second stage embryo, the blastula. It develops into the third
stage embryo, the gastrula, which finally develops into adult. During
this process, the zygote represents the unicellular stage, morula and
blastula stages represent the colonial protozoan stages, whereas the
gastrula stage represents the cnidarian stage. The development of the
embryos of different organisms differs after the gastrula stage. This
sequence of embryos shows that every multicellular organism passes
through the above stages representing their common ancestry.
246
 Organic Evolution

iii) Biogenetic Law or Theory of recapitulation: It was proposed by

Ernst Haeckel. It states that ontogeny repeats phylogeny which
means the developmental history of an organism repeats the
evolutionary history of its ancestor, e.g. 1) Tadpole larva of frog
resembles fish both externally and internally. It possesses a tail,
gills and two chambered heart like that of a fish. Later it
metamorphoses into adult frog 2) Caterpillar larva of butter fly
recapitulates its closest ancestor, the annelid in body form 3) In
the embryos of birds and mammals, the heart is initially two
chambered as in fish, then three chambered as in amphibians, and
after that an incompletely divided four chambered heart as in reptiles
and finally four chambered (as seen in birds and mammals).
3. Evidences from comparative anatomy: When we compare the anatomy
of different animals, we find some similarities among them. For example,
the fore limbs of different vertebrates are similar in origin and internal
structure. All these indicate that there is a relationship among the
organisms. These relationships can be studied under i) Homologous
organs, ii) Analogous organs, iii) Vestigial organs, iv) Atavistic organs
and v) Connecting links
i) Homologous organs: The organs which have similar structure and
origin but not necessarily the same function are called homologous
organs. The evolutionary pattern that describes the occurrence of
similarity in origin and internal structure is called homology. Such
organs show adaptive radiation, hence ‘divergent evolution’, e.g.
the appendages of vertebrates such as the flippers of whale, wings

Whale Bat Horse Cat Human

Figure 7.4 Homologous Organs

247
 Zoology

of bat, forelimbs of horse, paw of cat and hand of man, have a

common pattern in the arrangement of bones even though their
external form and functions may vary to suit their mode of life. It
explains that all the vertebrates might have had a common ancestor.
Do you know? When the animals (of a species) of a certain habitat enter
into different habitats, they evolve into different forms. This phenomenon
is called adaptive radiation and it indicates divergent evolution, e.g. In
Darwin’s finches of Galapagos islands, many forms with variations in
beak pattern were formed from the original seed-eating birds believed to
have come from the main land, the South America.
ii) Analogous organs: The organs which have dissimilar structure and
origin but perform the same function are called the analogous organs.
Analogous organs suggest ‘convergent evolution’, e.g. wings of a
butterfly and wings of a bird.
Do you know? When different animals live in the same habitat, they
tend to show similarity in body form, e.g. shark and whale have the same
body form as both live in aquatic environment. Earthworm and snake
have the same body form as both live in burrows. This type of evolution is
called convergent evolution.
iii) Vestigial organs: The organs which were functional
in the ancestors but non-functional and reduced in
the descendants are called vestigial organs. Presence
of vestigial organs is the most convincing evidence in
Wing of an insect favour of organic evolution and also supports the
concept of disuse proposed by Lamarck, e.g. Hind limbs
in python, hind limbs and pelvic girdle in whale, wings
of flightless birds, vermiform appendix, coccyx, plica
semilunaris (vestigial nictitating membrane), auricular
muscles that move the pinna, hair on the body,
Wing of a bird
mammary glands in males, etc., in human beings.
Figure 7.5 Analogous organs

Do you know? In man there are nearly 180 different types of vestigial
organs. Hence Weidersheim described human being a ‘Moving Museum
of Antiquities’.

iv) Atavistic organs: Sudden appearance of some vestigial organs in

a better developed condition as in the case of the tailed human
baby is called atavism. Such organs are called atavistic organs
they strongly support the concept of organic evolution.

248
 Organic Evolution

v) Connecting links: The organisms which possess the

characters of two different groups between which they are
transitional are called connecting links. They clearly
explain the path of evolution, e.g. Peripatus between
annelida and arthropoda, prototherians between reptilia
and mammalia, etc.
4. Evidences from cell and molecular biology: The field of cell
and molecular biology provides the most detailed and convincing
evidence in favour of biological evolution. They are studied under
three headings, namely i) Fundamental unity of life, ii) Blood
precipitation (serological) tests and iii) Biochemical Figure 7.6 Atavism
recapitulations
Do you know? The nature of DNA, the functioning of enzymes and
other protein molecules in all the living organisms from bacteria to
humans suggest that all organisms evolved from a common ancestor.
i) Fundamental unity of life: In all the living organisms, the structural
and functional units are the cells. Every eukaryotic cell contains
all the kinds of cell organelles such as Golgi complex, mitochondria,
E.R., ribosomes, lysosomes, nucleus, chromosomes, D.N.A. and
R.N.A. In all the living organisms, mitochondria help in energy
production and storage, ribosomes help in protein synthesis; DNA
has the same four types of nucleotides; all the proteins are
synthesized from different combinations of the same 20 types of
amino acids, the genetic code is virtually the same everywhere;
different types of biochemical substances such as enzymes,
hormones, respiratory pigments, etc., and different types of
biochemical reactions that occur in all the living organisms are the
same, indicating some relationship among all the organisms on the
earth.
Do you know?In frog, the hormone thyroxine is essential for
metamorphosis. If human thyroxine is injected to a tadpole, whose
thyroid is removed, it undergoes metamorphosis. This indicates that
the function of thyroxine is the same in all animals.
ii) Blood precipitation tests: They are also called serological tests
and were first conducted by H.F. Nuttal. He first injected a small
amount of human serum into a rabbit. As our serum proteins are
foreign to rabbit, antihuman antibodies are produced in that rabbit.
The serum of the rabbit was collected, and it is called anti human
serum. When it is mixed with the serums of an anthropoid ape, a
monkey and a dog in separate test tubes, within a short time, a

249
 Zoology

thick precipitate is formed with the serum of the anthropoid ape,

moderate precipitate with that of the monkey and no precipitate
with that of the dog. It indicates that the anthropoid ape is more
closely related to man than to monkey and dog. These tests also
proved that whale is closely related to pig and the south American
Llamas are closely related to the camels of Eurasia. Is it not
interesting to see that evolutionary relationships can be proved by
such simple tests?
iii) Biochemical recapitulations: Animals recapitulate the biochemical
aspects of their ancestors, e.g. a) An adult frog excretes urea but
its tadpole excretes ammonia as the fishes do. b) The embryo of a
bird excretes ammonia during the first four days of development
as the fishes do, then urea in the next nine days as the amphibians
do and finally uric acid as the reptiles and birds do. c) Even the
mammalian embryo first excretes ammonia then uric acid and
finally urea.

7.3 Theories of evolution

Various theories have been proposed to explain the process of evolution, but
the theories that explain the scientific basis of organic evolution are
Lamarckism, Mutation theory of de Vries, Darwinism and Modern synthetic
theory (Neo-Darwinism).

7.3.1 Lamarckism
It was explained by Jean Baptiste de Lamarck (1774-
1829), a French Biologist in his book Philosophie
Zoologique. It deals with the influence of environment
on organisms, use or disuse of organs and the inheritance
of acquired characters. According to him, whenever the
environment of certain organisms undergoes some
changes, it forces the organisms to use certain organs
more and put certain other organs to disuse. The organs
that are used more will increase in size and those not
used continuously will degenerate. Such characters that
are developed during the life time of an organism are
Figure 7.7 Lamarck called acquired characters. They are passed on to the
next generation (Inheritance of acquired characters).
Examples: Elongation of neck and forelimbs in giraffe (use), absence
of limbs in snakes (disuse).

250
 Organic Evolution

Objections: The main objection for Lamarckism came from Augustus

Weismann. He conducted decaudalisation experiments on mice and proposed
that the bodies of all the living organisms possess somatoplasm and germplasm.
If any change occurs in the somatoplasm, it will not be transferred to the
next generation but if any change occurs in the germplasm, it will be inherited
to the next generation, e.g. 1) Well-developed muscles of athletes are not
inherited to their children. 2) Making perforations to pinna for wearing
ornaments has been in practice in India for the past several centuries. However
no girl child is born with ready-made perforations in their pinna.
Neo-Lamarckism: The contributions of Lamarck paved the way for the gradual
acceptance of the concept of biological evolution (not creation) and stimulated
many further studies in this field later, it was modified to make it more
acceptable. The followers of Lamarck (Neo-Lamarckists) like Cope, Osborn,
Packard, Spencer, etc., tried to explain the Lamarck’s theory on a more
scientific basis. They considered that adaptations are universal. Organisms
acquire new structures due to their adaptations to the changed environmental
conditions. They argue that external conditions stimulate the somatic cells
to produce certain ‘secretions’ which reach the sex cells through the blood.
Such variations can be inherited by the offspring. Paul Kammarer observed
the development of normal eyes and skin colour in the cave dwelling
salamander, Proteus anguinus, when exposed to daylight. This somatic
character was passed on to the next generation.

7.3.2 Darwinism
It is an evolutionary theory proposed by Charles Robert
Darwin (1809-1882), an English Naturalist. He went on
a voyage for five years on a world survey-ship of the
British Government, H.M.S. Beagle and explored the
fauna and flora of a number of continents and islands.
He was much influenced by three publications namely
‘An Essay on the Principles of Populations’ of Thomas
Malthus, which states that animals increase in geometric
progression, whereas their food sources increase in
arithmetic progression, the book written by Sir Charles
Lyell entitled ‘Principles of Geology’ that explains the
phenomenon of gradualism (earth has changed slowly
and gradually through ages) and uniformitarianism (the Figure 7.8 Darwin
fundamental laws that operate today on the earth are in the
same way as they did in the past) and the paper titled ‘On the tendency of

251
 Zoology

varieties to depart from original types’ of Alfred Russell Wallace. He

published his theory in his book titled ‘The Origin of Species by means of
Natural Selection’.
Theory of Natural Selection: Darwin’s theory of Natural Selection does not
explain what exactly evolution is, but explains how evolution might have
occurred in nature. He believed that evolution is a gradual, rather than a
sudden biological event. His theory was based on several facts, observations
and inferences. They are
i. Prodigality of production or over production: Every organism tends
to increase its population in large proportions. For example, Paramecium
divides by binary fission at the rate of three to four times a day. At this
rate, the volume of all the Paramecia equals to 10,000 times that of the
earth at the end of the 9000th generation. Salmon fish produces 28
million eggs and starfish one million eggs in a season. If all of them
hatch and the larvae grow to reproductive age, all the seas will be filled
with them in a few generations. Even the slowest breeder, the elephant
can produce 19 million descendants at the end of the 800th generation
in the absence of any check.
ii. Constancy in population: However, such an abnormal increase is not
noticed in the population of any species in nature as the offspring die
in large numbers before reaching the reproductive age. It is true that
the food and the other sources do not increase in the same proportion
as that of the population.
iii. Struggle for existence: As the food sources are limited, severe
competition exists among the members of a population. Darwin called
it struggle for existence which is of three types as:
1. Intraspecific struggle: The competition found among the individuals
of the same species is called intraspecific struggle. It is for food,
shelter and mate. It is the most severe check on the rate of
reproduction.
2. Interspecific struggle: The competition found among the animals
of different species is called interspecific struggle. Most of the species
have the same type of food habits. Hence, competition exists among
them chiefly for food and shelter.
3. Struggle with the environment: All living organisms struggle with
the adverse environmental conditions such as cyclones, floods,
earthquakes, tsunamis, volcanic eruptions, etc.

252
 Organic Evolution

iv. Universal occurrence of variations: No two organisms are exactly

similar. They show variations. Even the offspring of the same parents
are different. These variations may be harmful or useful or neutral.
The useful variations help an organism to overcome struggle. Such
variations are passed on to the next generation.
v. Natural selection: According to Darwin, the individuals possessing
harmful variations are reproductively less successful. The organisms
with beneficial variations would increase the ability to reproduce and
leave more fertile offspring. They are said to be the ‘fittest organisms’
and they only can survive. The organisms with less reproductive success
are not represented in future generations, however fit they may be in
the struggle for existence. This is called the Natural Selection. Herbert
Spencer called this phenomenon ‘survival of the fittest’.
vi. Origin of species: Darwin concluded that ‘the struggle for existence
resulting in the survival of the fittest’ allows successive generations to
become better adapted to the environment. All the variations selected
by Nature accumulate from generation to generation. Such an
accumulation over a long period of time brings so many changes in an
organism that it does not interbreed any more with the original parental
species. Such a reproductively isolated organism is considered a ‘new
species’.

Do you know? Darwin considered that formation of a new species is

due to the cumulative effect of ‘fluctuating variations’.
II. Objections to Darwinism: Though Darwinism is considered the best
explanation for the organic evolution; some objections were raised against
it. Some of them are
i) It failed to explain the mechanism by which variations occur. Thus
Darwin faced the criticism ‘DARWINISM EXPLAINS THE SURVIVAL
OF THE FITTEST BUT NOT THE ARRIVAL OF THE FITTEST’.
ii) It could not explain the occurrence of vestigial organs, over
specialisation of some organs like large tusks in extinct mammoths,
oversized antlers in the extinct Irish deer, etc.
iii) It focused on small, fluctuating variations which are mostly non-
heritable.
iv) It did not distinguish between somatic and germinal variations.
v) Darwin did not consider the importance of macro-variations and
considered them ‘sports of nature’.

253
 Zoology

Do you know? Alfred Russell Wallace, a British naturalist who worked

in Malayan Archipelago had also come to conclusions similar to those
of Darwin, around the same time.

Experimental verification of Natural Selection – Industrial melanism

An important practical proof for the operation of
Natural Selection is the classical case of industrial
melanism, exhibited by peppered moth – Biston
betularia. These moths were available in two
colours, grey and black. Prior to industrial
revolution, the grey moths were abundant. During
the industrial revolution, the black forms were
more and the grey forms were less in the
industrial cities like Birmingham. Biologists
proposed that with the industrial revolution, more
soot was released due to the burning of coal,
which resulted in the darkening of the barks of
trees. Grey moths on the dark bark were easily
identified and predated more by birds. Hence the
number of grey moths decreased and that of the
black moths increased in the population. It means
Figure 7.9 Industrial melanism Nature offered ‘positive selection’ pressure to the
black (melanic) forms. Bernard Kettlewell, a
British ecologist, tested this hypothesis experimentally. He collected both
the grey and the black forms of Biston betularia for his experiment. He released
them in two sets of equal numbers; one set in Birmingham, a polluted urban
area, and the other set in Dorset, an unpolluted rural area. After a few days
he recaptured them. Of those moths recaptured from Birmingham, there
were more black forms. Among those recaptured from Dorset there were
more grey forms. The reason for such a difference is: the melanic forms
could not be easily spotted by predator birds as their body colour merged
with the dark colour of the bark of trees in Birmingham area. In the rural
areas (Dorset) the grey forms had better survival chance as their body colour
merged with the light coloured surroundings. This explains the differential
survival of the moths due to Natural Selection. It will be interesting to know
that there was a reversal in the selection process after the introduction of
pollution check laws in the urban areas.

254
 Organic Evolution

7.3.3 Mutation Theory

It was proposed by Hugo de Vries, a Dutch botanist who coined the term
‘mutation’. Mutations are sudden, random inheritable changes that occur
in organisms. He found four different forms in Oenothera lamarckiana
(commonly called ‘evening primrose’) such as O. brevistylis-small style, O.
levifolia-smooth leaves, O. gigas-the giant form, O. nanella-the dwarf form
(mutant varieties). T. H. Morgan studied the inheritance pattern of mutations
in Drosophila melanogaster. Darwin called mutations (large variations) sports
of nature or saltations, whereas Bateson called them discontinuous
variations.

Salient Features of Mutation theory

1) Mutations occur from time to time in naturally breeding
populations.
2) They are discontinuous and are not accumulated over generations.
3) They are full-fledged, and so there are no ‘intermediate forms’.
4) They are subjected to Natural Selection.

7.4 Modern synthetic theory of Evolution or Neo-

Darwinism
Weismann’s germplasm theory, de Vries’ mutation theory and Mendel’s laws
of inheritance helped a lot in understanding the origin and inheritance of
variations. The scientists such as Huxley, Haeckel, Simpson, etc., supported
Darwinism. Later Fisher, Sewall Wright, Mayr explained Natural Selection
in the light of post-Darwinian discoveries (Synthetic theory/Genetical
theory/Neo-Darwinism). According to this theory, five basic factors are
involved in the process of organic evolution. They are (i) Gene mutations, (ii)
Chromosomal mutations, (iii) Genetic recombinations, (iv) Natural Selection
and (v) Reproductive isolation.
i) Gene mutations: Changes in the structure of a gene (DNA molecule)
are called gene mutations or point mutations. They alter the
phenotypic characters of the individuals. Thus, gene mutations tend
to produce ‘variations’ in the offspring.
ii) Chromosomal mutations: Changes in the structure of chromosomes
(due to deletion, addition, duplication, inversion or translocation) are
called chromosomal mutations. They also bring about variations in
the phenotype of organisms which lead to the occurrence of
variations in the offspring.

255
 Zoology

iii) Genetic recombinations: Recombinations of genes due to crossing

over during meiosis are also responsible for bringing about genetic
variability among the individuals of the same species, thus,
contributing to the occurrence of heritable variations.
iv) Natural Selection: Natural selection does not produce any genetic
changes but once genetic changes occurred, it favours some genetic
changes while rejecting others. Hence it is considered the driving
force of evolution.
v) Reproductive isolation: The absence of gene exchange between
populations is called the reproductive isolation. It plays a great role
in giving rise to new species and preserving the species integrity.

7.5 Mechanism of evolution

The process by which variations appear and new species are formed is called
the mechanism of evolution. Some of these mechanisms include deviations
from Hardy-Weinberg equilibrium, different types of evolutionary forces leading
to speciation.

I. Hardy-Weinberg equilibrium
The Hardy-Weinberg equilibrium was explained independently by Hardy of
U.K. and Weinberg of Germany. It is a principle stating that the allelic
frequencies in a population will remain constant from generation to
generation under certain conditions. They are;
1) Size of the population should be large.
2) Mating should be random (panmictic).
3) There should be no evolutionary forces like Natural Selection or
mutations or large scale migrations.
4) There should be no differential reproductive success, among the
organisms of a population.
5) All the members of a population should be homogenous in age.
Significance of Hardy-Weinberg equilibrium
Any deviation from one or more of these conditions will disturb the equilibrium
by changing allelic frequency or genotypic frequency or both. These changes
in frequencies are significant in producing variations, which are the raw
materials for evolution.

256
 Organic Evolution

Hardy-Weinberg Equation
It is a mathematical model which explains the genetic equilibrium in a
population. In a stable population, for a gene with two alleles ‘A’ (dominant)
and ‘a’ (recessive), three genotypes, namely ‘AA’ (homozygous dominant), ‘Aa’
(heterozygous) and ‘aa’ (recessive)’ are possible. If the frequency of ‘A’ is ‘p’
and that of ‘a’ is ‘q’, then the genotypic frequencies of ‘AA, Aa and aa’ can be
expressed by the equation p2 + 2pq + q2 = 1 or (p+q)2 = 1.
In mathematical terms, if (p+q)2 = 1, then (p+q) = 1. Where,
p = frequency of dominant allele, q = frequency of the recessive allele,
2
p = frequency of the homozygous dominant genotype,
2pq = frequency of the heterozygous dominant genotype and
q2 = frequency of the recessive genotype
Example I: Assume in a population of 1600 individuals, 256 individuals
are with a recessive trait. Find out the homozygous dominant and
heterozygous dominant individuals in that population.
Solution: To work out this problem, first we have to find out the recessive
genotypic frequency (q2), then recessive allelic frequency (q) and finally substitute
the values.
 Frequency of recessive genotype (q2)
number of recessive individuals 256
= = = 0.16
total number of individuals in a population 1600

then the allelic frequency q = 0.16 = 0.4

 As we have come to know the value of ‘q’, now we have to find out the
value of ‘p’ by using the equation (p + q) = 1, where q = 0.4, then p =
(l – q) = (l - 0.4) = 0.6.
 So the dominant allelic frequency ‘p’ = 0.6, then the homozygous
dominant genotypic frequency (p2) = 0.6X0.6 = 0.36.
 Now we can find out the number of homozygous dominant individuals
number
by using the formula: frequency =
total number of population
where frequency of p2 is 0.36, and the total number of population is
1600, then
 The number of homozygous dominant individuals = frequency x total
number of the population = 0.36 X 1600 = 576
 The heterozygous genotypic frequency = 2pq = 2 X 0.6 X 0.4 = 0.48,
then the number of heterozygous dominant individuals = 0.48 x 1600
= 768.
257
 Zoology

Example II : Assume, in a population of 200 individuals, the homozygous

dominant are 114, the heterozygous dominants are 76 and the recessive
are 10. Find out the dominant and recessive allelic frequencies.
Solution : Dominant allelic frequency = p
2 (no. of homozygous dominant individuals) + no. of heterozygous individuals
=
2(total no. of individuals in the population)

2(114) + 76 304
= = = 0.76,
2(200) 400
Recessive allelic frequency = q
2 (no. of recessive individuals) + no. of heterozygous individuals
=
2(total no. of individuals in the population)

2(10) + 76 96
= = = 0.24
2(200) 400

II. Evolutionary forces

The forces that bring changes in the gene pool of populations are called
evolutionary forces. They include Natural Selection, gene flow, genetic load,
genetic drift, etc.
i) Natural Selection: It is mainly of three types, namely a) stabilising
selection, b) directional selection and c) disruptive selection
a) Stabilising Selection (centripetal selection): This selection operates
in a stable environment. In this process, the organisms with average
phenotype are preserved whereas the extreme individuals from both
the ends are eliminated. Hence this does not promote any
evolutionary change that leads to speciation, but maintains the
phenotypic stability within the population over generations. For
example, in England, weights of new born babies were studied in a
large sample. Greater mortality was found in the babies whose
weight was greater or lesser than the average weight of 8 lbs.
b) Directional Selection: This selection operates in an environment
which gradually undergoes changes. It works by constantly removing
the individuals from one end and constantly shifting the average
value of fitness towards the other end of the phenotypic distribution.
For example, in the case of giraffes the average value of the length

258
 Organic Evolution

Figure 7.10 Types of Phenotypic Distribution

of the neck shifted towards the long-neck. Stabilising selection takes

over the directional selection once the average value of the phenotype
coincides with the new optimum environmental conditions. The
development of resistance to DDT by mosquitoes is another example
for directional selection.
c) Disruptive Selection (centrifugal selection): This type of selection
operates when homogenous environment changes into a
heterogenous type. In this process, the organisms of both the extreme
phenotypes are selected while the individuals with average phenotype
are eliminated. This can split the population into two or more
subpopulations/species populations. Though it is a rare form of
selection, it can lead to the formation of two or more different species.
It is also called adaptive radiation, e.g. Dark and light coloured
species in Biston betularia, Darwin’s finches with different shapes
of beaks, sunflower populations in California which split into two
subpopulations of which one was adapted to dry area and the other
was adapted to wet area. If the two sub populations do not inter
breed (sexually isolated) they
develop in to new species.
ii) Gene Flow: The movement of alleles
from one population to another is called
gene flow. The random introduction of
alleles into the recipient population
(immigration) and their removal from
donor population (emigration) affect
the allelic frequencies of both the
Figure 7.11 Gene Flow
populations.

259
 Zoology

iii) Genetic Load: The existence of deleterious genes within the populations
is called genetic load, e.g. Gene for sickle cell anaemia. The individuals
homozygous for sickle cell gene (Hb S Hb S) usually die early due to
anaemia. Those heterozygous (HbA HbS) can live reasonably healthy and
exhibit resistance to malaria. So this disadvantageous gene is carried
in heterozygous condition.
iv) Genetic Drift: The change in the frequency of a gene that occurs merely
by chance and not by selection, in small populations, is called genetic
drift or Sewall Wright effect. Suppose, for a gene with two alleles, the
frequency of a particular allele is 1% (q = 0.01), the probability of losing
that allele by chance from the small
population is more. The end result is
either Fixation (p or q = 1)or Loss (p
or q = 0) of that allele. The probability
of reaching the end point depends on
the size of the population. Genetic
drift tends to reduce the amount of
genetic variation within the
population mainly by removing the
Figure 7.12 Genetic drift by Chance
alleles with low frequencies. It can
be exemplified by the Founder Effect
and Bottleneck Effect.
Founder effect: If a small group of individuals from a population start a
new colony in an isolated region, those individuals are called the founders
of the new population. The allelic frequencies of their descendants are similar
to those of the founders rather than to their ancestral parent population,
e.g. presence of O+ve blood group in nearly 100% of the Red-Indians. It means

Original Population New Population

Founders

Figure 7.13 Founder Effect

260
 Organic Evolution

the forefathers of the Red Indian tribe were predominantly O+ve and they
isolated themselves reproductively from other populations.
Bottleneck effect: Natural
calamities such as earthquakes,
volcanic eruptions, floods etc.,
reduce the size of a population
drastically. After these calamities,
the lucky survivors may be
genetically different from the
original population in their genetic
makeup. This condition is known
as the Bottleneck Effect, e.g.
Figure 7.14 Bottleneck effect (Hypothetical)
Polydactylic dwarf individuals in
the Old Order Amish population of
Lancaster in USA

III. Speciation
The process by which one species evolves into
one or more different species is called
speciation. Evolution of new species in a
single lineage is called anagenesis or phyletic
evolution. On the other hand, if one species
diverges to become two or more species, it is
called cladogenesis or divergent evolution.
If speciation takes place due to geographical
isolation, it is called allopatric speciation.
If speciation takes place in the organisms
which live in the same habitat, capable of
Anagenesis Cladogenesis
interbreeding, but do not interbreed due to
some isolation mechanisms is called Figure 7.15 Speciation
sympatric speciation.

Do you know? The evolutionary changes that cause differences in

populations of a species are referred to as microevolution whereas the
evolution of taxa higher than the level of species is referred to as
macroevolution.

261
 Zoology

A brief account of evolution

The first non-cellular forms of life might have originated approximately
3000 million years ago. The first cellular forms of life appeared about 2000
mya. Invertebrates originated about 500 mya. Jawless fishes evolved during
the ordovician period. Fish with stout and lobe like fins could move on to
land and evolved into the amphibians. Later amphibians evolved into
reptiles which dominated the terrestrial habitat, e.g. Dinosaurs. The biggest
of them was Tyrannosaurus rex, which was about 20 feet in height and
had dagger like teeth. Some of the land reptiles went back into water and
evolved into fish like reptiles such as Ichthyosaurus. The dinosaurs became
extinct by the end of the cretaceous period. Some of the reptiles evolved
into mammals and later some others into birds. The most successful episode
in the history of evolution is the ‘origin of man’ with language skills,
intelligence and self-consciousness.

7.6 Origin and evolution of man

The origin and evolution of human beings did not occur in a linear manner
(straight line). However, we can get a general idea by looking back at the
evolution of the primates which includes the animals distantly related
(hominoids), less closely related (hominids) and more closely related (Homo)
to the humans. About 15 million years ago, there used to live certain
hominoids called Dryopithecus and Ramapithecus which were hairy and
walked like gorillas and chimpanzees. Dryopithecus was more ape-like while
Ramapithecus was more man-like. A few fossils of bones similar to those
of man were discovered in Ethiopia and Tanzania leading to the belief that
about 3 to 4 million years ago, man-like primates (hominids) walked in the
eastern Africa. They were probably 4 feet in height but walked up right.
About 2 million years ago, Australopithecus lived in East African grasslands.
The first human-like being was Homo habilis (also around 2 mya). Evidences
show that they hunted with sharp stone tools, but essentially ate fruit.
Their cranial capacities* were between 650-800cc. They probably did not
eat meat. Fossils discovered in Java in 1891 revealed the next stage i.e.
Homo erectus (about 1.5 mya). Homo erectus had a comparatively larger
cranial capacity of around 900 cc, and probably ate meat. Homo
erectus and Homo ergaster spread through Africa and were the first to leave
Africa.

262
 Organic Evolution

Figure 7.16 Evolution of man

The next important form was Homo neanderthalensis, with a cranial capacity
of around 1400cc, who lived in East and Central Asia between 1,00,000 to
40,000 ya. They used hides to protect their body and buried their dead.
Later during the ice age between 75,000-10,000 ya., modern Homo sapiens
arose in Africa and moved across the continents (first to Asia and later to
Europe) and developed into distinct races. Early modern humans of the
European region is informally called Cro-Magnon man. He is known for his
cave paintings about 18,000 ya and agriculture came around 10,000 ya
and then human settlements started.

263
 Zoology

GLOSSARY
Actual remains (unaltered fossils): image’ of the organism. When an
Fossils of the actual animal or organism is buried in sediment,
animal parts trapped in amber, ice, such as sand, silt or clay, the
etc., like woolly mammoth in ice in organic matter completely
the Siberian snow lands, insects in decomposes over a period of time,
amber (a plant resin) etc. leaving behind a hollow area with
Archipelago: A group of many the organism’s shape.
islands in a large body of water Ontogeny: Developmental history of
Cast: When empty space of a mould an individual.
is filled with mud with dissolved Petrification: The process of
minerals and sediment, slowly the replacement of hard parts of an
water in the mud evaporates organism with minerals, making it
forming a rock-like fossil. It gives a fossil.
the form of the organism that was
Phylogeny: Ancestral history of an
fossilized.
individual.
Catastrophe: A sudden violent
Protobionts: Molecules with limited
natural calamity like an
metabolic activity, believed to be
earthquake, tsunami, volcanic
formed during the early part of
eruption etc.
evolution of life.
Coprolites: Fossilized faecal matter
Reproductive success: The
of organisms
proportion of fertile offspring
Deleterious genes: The genes which produced by a genotype relative to
are harmful to the organisms the other genotypes is called
possessing them. reproductive success.
Gene pool: The sum total of all the Simulation: The act of creating
genes present in a sexually conditions similar to those believed
reproducing population during a to be present actually.
given period of time.
Traces: Fossilized nests, burrows,
Hides: The skin of an animal, to be footprints (tracks), etc.
used as leather.
Lineage: The descendants of an
individual
Mould: Fossilized impression made
in the sediment or a ‘negative

264
 Organic Evolution

QUESTIONS
Very Short Answer Type Questions Short Answer Type Questions

1. What are panspermia? 1. Distinguish between

2. Define prebiotic soup. Who coined homologous and analogous
this term? organs.
3. How did eukaryotes evolve? 2. Write a short note on the theory
4. What are the components of the of mutations.
mixture used by Urey & Miller in 3. Explain Darwin’s theory of
their experiments to simulate the Natural Selection with industrial
primitive atmosphere? melanism as an experimental
5. Mention the names of any four proof.
connecting links that you have 4. Discuss the role of different
studied. patterns of selections in
6. Define Biogenetic Law, giving an evolution.
example. 5. Write a short note on Neo-
7. Define atavism with an example. Darwinism.
8. Cite two examples to disprove 6. In a population of 100 rabbits
Lamarck’s inheritance of acquired which is in Hardy-Weinberg
characters. equilibrium, 24 are homozygous
long-eared. Short ears are
9. Who influenced Darwin most, in
recessive to long ears. There are
formulating the idea of Natural
only two alleles for this gene.
Selection?
Find out the frequency of
10. What is common between recessive allele in the population.
Darwinism and Lamarckism?
7. What is meant by genetic drift?
11. What is meant by genetic load? Explain genetic drift citing the
Give an example. example of Founder Effect.
12. Distinguish between allopatric
and sympatric speciations.
13. Mention the scientific names of
ape like and man like earlier
primates. Which man like primate
first used hides to cover the
bodies?

265
 Zoology

FOR IGNITED
MINDS
‘Darwin’s Play Field’ and
the ‘Mystery of Mysteries

Organic Evolution
1. If in a H.W population of fruit flies, the frequency of the red eyed (dominant)
individuals in 96%, what is the frequency of the dominant allele in that
population?
2. In the experiments conducted on Biston betularia in England, the frequency of
melanic forms was 93% in 1959. If has dropped to 15% in 1995. Can you explain
the reason for this drop in the melanic forms?
3. We know that birth records showed that the babies born underweight or
overweight showed a higher mortality as Natural Selection operates in
normalising / stabilising manner. With the advent of medical facilities mortality
in the over weight babies has considerably decreased. What do you think, will
happen over the coming decades with perhaps still better medicare is available
to the overweight born children. Will the birth weight increase or decrease with
the Natural Selection process in operation.
4. Will Genetic Drift bring changes in genotypic frequencies or allelic frequencies
or both?
5. When organisms from the extremes of a population mean are removed what
type of selection is it called?
6. What type of selection does not occur singly but is followed by another type at
some point?
7. What are popularly the ‘Documentary evidences’ of evolution?
8. Would you support Biogenetic law? Can you think of one example so familiar to
you and most probably you read about it in your school curriculum?
9. DATA: The embryo of a chick excretes nitrogenous wastes in the form of ammonia
in the early part. Later it excretes urea for some days. Finally before hatching
out, it starts excreting uric acid.
Question: Do you think this data is scientifically correct? What is the ‘principle’

n
behind such a phenomenon, if you believe in it?
10. If in a population, the rate of change of allelic frequencies is zero, what type of
population is it, in the light of the phenomenon of evolution?

266
 Unit-VIII
Dr. Kurian
APPLIED BIOLOGY
Biology And Its ‘Multifaceted Glory’
Many years of research have gone into the study of biology as a pure science.
Nowadays more stress is laid on application of biology to human utility, health
and welfare. Biology has applications in Animal husbandry, Agriculture,
Aquaculture, Pollution Management, Synthetic preparation of Hormonal
analogues, Manufacture of Vaccines, Molecular Diagnosis of various
human ailments etc., are a few that come to our mind first. Production of
Transgenic Animals and obtaining products of commercial utility at the industrial
level is going on at a rapid pace, with the sole objective of making human life
better and comfortable.
This unit also deals with Medical Biotechnology Tools and Testing
Methodologies. The Green Revolution, Blue Revolution and White Revolution
(production of more milk from domestic cattle) etc., are applied branches of
biology. Naturally, Breeding Technologies in domesticated animals to produce
high milk, egg and meat yielding animals improved with the acquisition of in
depth knowledge in the fields of Genetics. Molecular Biology and related
sciences such as Biochemistry paved the way to developing Biomedical
technology ‘kits’ in the field of testing certain human body functions,in easy
and quick ways. Providing certain scientific inputs into rearing fish, poultry
birds, honeybees, silk worm moths proved very useful. This unit also gives you
an insight into Cancer biology, Gene Therapy and Bio-safety issues.
The present day Biology student should know at least the basics involved in X -
ray radiography, CT scan, MRI, ECG, EEG, ELISA etc. So, this chapter
gives an over view of all the above.
 Zoology

Applied Biology
8.1 Animal Husbandry 8.2 Poultry Farm Management
8.3 Bee Keeping 8.4 Fishery Management
8.5 Biomedical Applications 8.6 Vaccines
8.7 Molecular Diagnosis 8.8 Gene Therapy
8.9 Transgenic Animals 8.10 Cancer Biology
8.11 Stem Cells 8.12 Biomedical Technology

8.1 Animal Husbandry

The strategies adopted for enhancing food production are bound to play a
major role in meeting the requirement of food for the ever increasing world’s
population in the near future. The biological principles that are applied to
animal husbandry will become crucial in our efforts to increase the food
production.
Animal husbandry is the agricultural practice of breeding and raising
livestock (all domesticated animals reared for the benefit of man). It includes
buffaloes, cows, pigs, horses, cattle, sheep, camels, goats etc. However the
term livestock is often used for farm animals. If extended, it also includes
poultry farming and fisheries. Since time immemorial, animals like bees,
silk-worm, prawns, crabs, fishes, birds, pigs, cattle, sheep, goats and camels
have been used by humans for products such as honey, silk, meat, pork,
milk, hydes, wool, etc. Dairy farms, Dairy industry, Poultry and Aquaculture
have been providing employment and additional source of income, mainly in
rural areas.

268
 Applied Biology

The average annual milk yield is about 170 liters per cow in India. Contrary
to it, the average annual milk yield is about 4,100 liters per cow in Netherlands.
Because of its low productivity the Indian cow is known as ‘teacup cow’. So,
newer technologies have to be applied to achieve improvement in quality and
productivity. Modern methods of breeding, MOET (multiple ovulation and
embryo transfer) and production of transgenic animals must be taken up on
a large scale in addition to conventional practices and care.
Cattle population in India consists of three groups of breeds. They are:
1. Milch breeds which yield higher quantity of milk and the bullocks are
not useful in farms or transport. The superior milch buffalo breed is
the MURRAH breed.
2. Draught breeds: Bullocks are excellent draught animals (useful in
agricultural practices).
3. Dual purpose (general utility)

Do You Know? 1. The ONGOLE breed bull is the costliest of all the
types of bulls in India. 2. Anand dairy (in Gujarat), the most popular
dairy in India sells its milk products under the brand name ‘AMUL’ -
Anand Milk Union Limited.

A. Management of Farm and Farm Animals

A professional approach to farm management gives the much needed boost
to our food production and it certainly has an edge on traditional practices.
The farm management ensures optimum quality feed, breeding and caring.
It provides good infrastructure and takes care of sick animals.

B. Dairy Farm Management

Breeding, feeding and management of milch animals, production, processing
and marketing of their milk and milk products on economic basis constitute
dairying. Commercial dairy systems house five to hundreds of hybrid cows or
Murrah hybrid buffaloes. The different kinds of products that can be made
with milk from a dairy farm are butter, ghee, curds, butter milk, cheese,
paneer, etc.
Dairying provides an occupation and income in all seasons to the farmers.
Milk is considered an indispensable food for 1/4th of the population which
includes infants and children. In recent years dairying has assumed new
dimensions with emphasis on increased production of quality milk through
technical innovation and modern management methods. Indian dairy industry
had witnessed fantastic growth, since the inception of the programme/ project
‘Operation Flood’ by NATIONAL DAIRY DEVELOPMENT BOARD (NDDB).

269
 Zoology

Do You Know? The father of ‘white revolution’ in INDIA, the founder of

ANAND DAIRY and the founder chairman of NDDB was Dr. Kurian.
In dairy farm management, we deal with processes and systems that increase
yield and improve quality of milk. The following are essential components.
1. Selection of good breeds having high
yielding potential, combined with
disease resistance is important as milk
yield primarily depends on the quality
of breeds in the farm. Examples include
high yielding hybrid cows of the exotic
breeds like Holstein-Friesian, Jersey,
Ayrshire and Brown Swiss. Holstein-
Friesian cow yields up to 30 litres of
milk/day.
2. Proper housing with adequate water,
ventilation, suitable temperature, etc.,
is needed to enhance the yield potential.
Figure 8.1 Holstein-Friesian cow 3. Feeding of cattle with special
emphasis on quality and quantity of fodder
should be done in a scientific manner.
4. While milking, storage and transport, cleanliness and hygiene are of
paramount importance. As these processes are mechanised, direct
contact of the produce with the handler is reduced.
5. A regular visit by a veterinary doctor is necessary.
6. Proper record keeping and inspections would help to identify and rectify
the problems at the earliest.

Do You Know? In India, at present buffaloes’ milk accounts for about

54% and the rest for cow’s milk. Uttar Pradesh occupies the first place
followed by Punjab and Haryana, in milk production.

Animal Breeding
Animal breeding is an important aspect of animal husbandry which aims at
increasing the yield of animals and improving the desirable qualities of the
produce. A breed is a group of animals related by descent and similar in
most characters like appearance, features, size, configuration, etc. The
following are the desirable qualities for which we breed animals:
1. Disease resistance,
2. Increase in the quality and quantity of milk, meat, wool, etc.
3. Fast growth rate,

270
 Applied Biology

4. Enhanced productive life by improving the genetic merit of livestock,

5. Early maturity and
6. Economy of feed.

Methods of animal breeding are broadly two types. They are 1) INBREEDING
2) OUTBREEDING.

1. Inbreeding
When crossing is done between animals of the same breed it is called
inbreeding. It refers to mating of more closely related individuals within the
same breed of individuals in a lineage. The breeding strategy is the
identification and mating of superior males and superior females of the same
breed. A superior female, in the case of cattle, is the cow (Bos indicus) or
buffalo (Bubalus bubalis) that produces more milk per lactation. On the
other hand a superior male is the bull which gives rise to a superior progeny
as compared to those of other males. The progeny obtained from such matings
are evaluated and the superior ones among them are used for mating purpose.
Inbreeding is of two types 1.Close breeding, 2. Line breeding.

Close breeding is mating between male parent (sire) and female offspring
and/or female (dam) with male offspring. Line breeding (cousin mating) is
the selective breeding of animals for a desired feature by mating them within
a closely related line (but not as close as close breeding). It leads to upgrading
(to improve the quality of livestock by selective breeding for desired
characteristics) of a desired commercial character.

Advantages of Inbreeding
1. Inbreeding increases homozygosity. Thus, inbreeding is necessary if
we want to evolve a pure line animal.
2. It helps in the accumulation of superior genes and elimination of less
desirable genes.
3. This approach, where there is selection at each step, increases
productivity of inbred population.

Disadvantages of Inbreeding
1. Inbreeding may express harmful recessive alleles and the phenotypes
(that are generally eliminated by Natural Selection) concerned.
2. Continued inbreeding, especially close breeding, usually reduces fertility
and even productivity. This is called INBREEDING DEPRESSION.

271
 Zoology

Note: Whenever inbreeding depression becomes a problem, selected

animals of the breeding population should be mated with unrelated
superior animals of the same breed. This usually helps restore fertility
and yield.

2. Out Breeding
Out-breeding is the breeding of the unrelated animals. Out-breeding is of
three types 1.Out-crossing 2. Cross-breeding 3. Interspecific hybridisation.

A. Out-crossing
It is the practice of mating of animals within the same breed, but having no
common ancestors on either side of the pedigree for 4-6 generations. The
offspring of such a mating is known as an out-cross. It is the best breeding
method for animals that are below average in milk production, growth rate
(in beef cattle) etc. At times a single out-cross often helps to overcome
inbreeding depression.

B. Cross-breeding
In this method, superior males of one breed are mated with superior females
of another breed. The offspring of such a mating is said to be a cross-breed.
Cross-breeding allows the desirable qualities of two different breeds to be
combined. The progeny (cross breeds) are not only used for commercial
production but also inbreeding and selection to develop stable breeds which
may be superior to existing breeds. For example Hisardale is a new breed of
sheep developed in Punjab by crossing ‘Bikaneri ewes‘ and ‘Marino rams’.

C. Interspecific hybridisation
In this method, male and female animals of two different related species are
mated. The progeny may combine desirable features
of both the parents and is different from both the
parents. For example when a male donkey (jackass)
is crossed with a female horse (mare), it leads to the
production of a mule (sterile). Similarly when a male
horse (stallion) is crossed with a female donkey
(jennet), hinny (sterile) is produced. Mules have
considerable economic value.
Jackass X mare = mule; Stallion X jennet = hinny

Figure 8.2 Mule

272
 Applied Biology

Controlled Breeding Experiments

They are carried out using artificial insemination and multiple ovulation
and embryo transfer technology (MOET).
Artificial insemination (AI) is the technique in which semen is collected
from superior bulls and introduced into the female reproductive tract when
the female is in ‘heat’. This semen can be used immediately or can be
frozen and used at a later period. It can be transported in a frozen form to
the place where a female is housed. In this way desirable crosses can be
made. The major advantage of AI over natural mating is that it permits the
dairy farmer to use top proven sires (males) for genetic improvement of his
herd and control of venereal diseases. AI is also of tremendous value in
making optimal use of different sires and enables dairy farmer to breed
individual cows to selected sires according to their breeding goals.
The breeding centre at SALON in Rae Bareli is at present the breeder and
producer of top quality frozen semen of pure exotic breeds.

Multiple Ovulation and Embryo Transfer (MOET)

The following are the steps involved in MOET.
1. A cow is administered hormones, with FSH-like activity.
2. This induces follicular maturation and super ovulation (In super
ovulation- instead of one egg, which they normally produce per cycle, they
produce 6-8 eggs).
3. The animal (cow) is either mated with an elite bull or artificially
inseminated.
4. The embryos are at 8-32 celled stages are recovered non-surgically
and transferred to surrogate mother (an animal that develops the offspring
of another animal in its womb).
Now the genetic mother is ready for another round of super ovulation.
This technology is in use for cattle, sheep, rabbits, buffaloes, mares etc.
High milk-yielding breeds of females and high quality (lean meat with less
lipid) meat-yielding bulls have been bred successfully to increase the herd
size in a short period of time.

8.2 Poultry Farm Management

Poultry
It is a class of domesticated fowls (birds) reared for the production of eggs or
meat or both. It includes chicken, peafowls, ducks, turkeys, geese, pigeons,
pheasants and emus. The birds which are raised exclusively for the production
of eggs are called LAYERS. The birds which are raised only for their meat
are called BROILERS. They are of either sex under the age of 8—10 weeks,
weighing 1.5 kg and with a smooth textured breast.

273
 Zoology

Scientific poultry management aims at maximising returns with

minimum investment. Poultry farming is spread all over India both
as cottage and large scale industry in India. At present India ranks
third in egg production and fifth in chicken meat production in
the world. Andhra Pradesh is the largest egg producer in India.

Do You Know? Padmasri Dr. B.V. Rao is the FATHER OF

MODERN POULTRY IN INDIA. He was the founder chairman of
National Egg Coordination Committee (NECC) which monitors
marketing of eggs in India and their exports.
Figure 8.3 The central poultry breeding farms established at Mumbai,
White leg horn Bhubaneswar and Hesserghatta develop hybrid strains of layers.
Indian Veterinary Research Institute (IVRI) at Izatnagar produces
quality broiler strains and poultry vaccines.
Important Components of Poultry Management
1. Selection of disease free and suitable breeds: The selected breed
should get acclimatised to a wide range of climatic conditions. Hybrid
layers used in India are BV-300, Hyline, Poona pearls, etc. Commercial
broiler strains used in India include Hubbard, Vencobb, etc.,
2. Feed management (proper feed and water): Balanced diet is a must
to maximise the yield. Brooder/chick mash, grower mash, pre-layer
mash and layer mash are fed to layers at different ages. Likewise pre-
starter mash, starter mash and finish mash are the types of feeds
given to broilers. ‘Safe water’ should be supplied through waterers at
all times.
3. Health care: Vaccination against viral diseases (Ranikhet, Marek’s,
and Gumboro) and using antibiotics to treat bacterial diseases {Fowl
cholera, Infectious coryza, Chronic Respiratory Disease (CRD)} make
the poultry birds disease free. Fungal diseases affecting poultry are
Brooder’s pneumonia, Aflatoxicosis and Thrush.
4. In addition to the above, hygiene, proper and safe farm conditions ensure
better produce.
Nutritional value of chicken meat and egg (only proteins, lipids and
calorific value) are given below.

274
 Applied Biology

WEIGHT % PROTEIN % FATS% ENERGY IN K CAL

100g of egg 13.3 11.5 173

100g of Chicken meat 20 2.5 109

Egg is a highly nutritious food item for humans because of its high Biological
value (96%) and PER (4.5).
AVIAN FLU (BIRD FLU) is an important disease affecting poultry birds and
man has to be very watchful about this disease as it is very dangerous to
him too.
Causative organism: Bird flu is caused by an ‘avian flu virus’, the H5N1.
The virus that causes the bird infection infects humans too. It can start a
worldwide epidemic (Pandemic disease).
Mode of infection: Infection may be spread simply by touching contaminated
surfaces. Birds infected by this type of influenza, continue to release the
virus as in their faeces and saliva for as long as 10 days.
Symptoms: Infection by the avian influenza virus H5N1 in humans causes
typical flu-like symptoms, which might include: cough (dry or with phlegm),
diarrhoea, difficulty in breathing, fever, headache, malaise, muscle aches
and sore throat.
Prevention
1. Avoiding consumption of undercooked chicken meat reduces the risk of
exposure to avian flu.
2. People who work with birds should use protective clothing and special
breathing masks.
3. Complete culling of infected flock by burying or burning them.

8.3 Bee-Keeping/Apiculture
In the insect world, the economically important honeybees exemplify colonial
living, reciprocal communication, division of labour and polymorphism (caste
differentiation). Bee-keeping or apiculture is the maintenance of hives of
honey bees for the production of honey and wax. Bee-keeping is an age-old
cottage industry.
The two species of honey bees widely used in bee keeping in India are:
1. Apis mellifera (European bee): A favourite for apiculture; yields large
quantities of quality honey.

275
 Zoology

2. Apis cerana indica (Indian or Asian hive bee): It is wild and is also
domesticated.
A BEE COLONY: Queen (fertile female), drones (haploid males) and workers
(sterile females) are the three castes in a beehive.
i. QUEEN: It is the largest individual in the colony; It is a fertile, diploid
female, one per bee hive and the egg layer of the colony. She lives for about
five years and her only function is to lay eggs. The queen bee during its
nuptial flight receives sperms from a drone and stores in the spermathecae
and lays two types of eggs, the fertilised and unfertilised. All fertilised eggs
develop into females. All the larvae are fed with the royal jelly (vitamin and
nutrient rich secretion from the glands in the hypopharynx of the nurse
workers) for the first 3 days only. Afterwards royal jelly is fed only to the bee
that is bound to develop into next queen, whereas the other larvae fed on bee
bread (honey and pollen) become workers (sterile females) and drones.

ii. DRONES (haploid, fertile males)

These are robust, large winged, small numbered, short lived and are fed
with bee bread by nurse workers. They are developed from the unfertilized
ova by arrhenotoky (male parthenogenesis).

iii. Worker Bees

They are multifaceted sterile females which develop from the fertilised eggs
and perform diverse functions. They live for two or three months. They are
the smallest in size among the 3 castes. Worker bees secrete wax, build
hexagonal cells of the honey-comb, gather nectar from flowers, manufacture
and store honey, gather pollen, make propolis (bee glue-used to seal the
cracks in the combs). The scout bees (worker bees) perform a ‘waggle dance’
after returning to the hive, to inform other bees about source of nectar.
Waggle dance informs the other worker bees the direction with reference to
sun’s position and distance of availability of food (discovered by Nobel Laureate
Karl von Frisch). They also guard the hive for which purpose they possess a
poisonous sting. They have chewing and lapping type of mouth parts.
Do you know? Worker bees have pollen brushes on the tarsi of the legs
and pollen baskets on the tibia of the metathoracic legs.

Beehive
It is an enclosed structure in which honey bees live and raise their young.
Domesticated honeybees live in man-made beehives (boxes) in ‘apiaries’. Bee
wax is produced from their abdominal glands (present on 2nd to 5th abdominal

276
 Applied Biology

segments). Bees use the storage cells to store food (honey and pollen) and
brood cells to house the “brood” (eggs, larvae, and pupae).

Economic importance of Honey bees

The bee products like Honey, wax, propolis and bee venom are used in various
ways.
1. Honey is a rich source of fructose, water, glucose, minerals and vitamins.
2. Bee’s wax is used in the preparation of cosmetics, polishes of various
kinds and candles.
3. Propolis is used in the treatment of inflammation and superficial burns.
4. Bee’s venom, which is extracted from the sting of worker bees, is used
in the treatment of arthritis.
5. Pollination: Bees are the pollinators of our crop plants such as sunflower,
Brassica, apple and pear.
Factors /requirements for successful Bee-keeping:
1. Knowledge of nature and habits of honey bees.
2. Selection of suitable location (termed Apiary or Bee yard) for keeping
the beehives.
3. Raising a hive with the help of a queen and small group of worker bees.
4. Management of beehives during different seasons
5. Handling and collection of honey and bee wax.

8.4 Fishery Management/Pisciculture

Fishery is an industry or occupation devoted to the catching, processing for
storage in freezers and selling of fish, shellfish or any other aquatic animals
for human consumption.

Types of Fisheries
Based on how the fishery resource is obtained, fishery can be categorised
broadly into two types 1. Capture and 2. Culture fisheries.
1. Capture fishery: In capture fishery the resource is obtained from the
natural body of water. Capture fishery is either marine or inland. If the
capture is from the sea, it is called marine fishery. In the sea, if the
resource is captured from open waters, it is called offshore fishery. If
the resource is captured from coastal waters, it is called inshore fishery.
If the capture is from estuaries or fresh water it is called inland fishery.

277
 Zoology

2. Culture fishery (aquaculture): It involves rearing and management of

selected aquatic organisms under regulated conditions and their
subsequent harvesting after the stipulated time.
Aqua culture can be categorised into certain types based on the medium
used in culturing (fresh water, brackish water and mariculture), organisms
selected for culturing (prawn, crab, oyster and pisciculture) and the presence
or absence of fins in those organisms (fin fish fishery/shell fish fishery).
AQUACULTURE (culture fishery) not only includes the culturing of fish, but
also culturing of other aquatic organisms under regulated conditions to
achieve better production. The term PISCICULTURE is used when the
organisms cultured are exclusively fin fishes.
The organisms selected for culture practices must obviously possess certain
features to make their culture profitable. They show fast rate of growth,
economy of feed, early maturity, disease resistance, high nutritious value,
high consumer demand and export value.
Indian carps namely Catla catla (catla),
Cirrhinus mrigala (mrigal), Labeo rohita
(rohu) are extensively used in fresh water
pisciculture in INDIA. The common carp,
grass carp and silver carp (exotic-Chinese
Figure 8.4 Catla Catla carps) are also used in pisciculture in
recent years in India, as growth rate and
reproductive potential are high in them. The Indian carps are also harvested
from natural fresh water bodies (capture fishery).

Marine water fishes include Hilsa, Sardine, Bombayduck, Mackerel

and Silver pomfret. Oil sardine fishery along the Kerala coast is the
largest fishery in India.
Hypophysation or induced breeding is followed in artificial breeding. Pituitary
extracts containing gonadotropins (FSH and LH) or ovaprim (a synthetic analogue
of gonadotropin releasing agent and Dopamine inhibitor) are injected into brood
fish to induce release of spawn for seed production.

278
 Applied Biology

Economic Importance of Fishery

1. As Food
Fish meat, in general, is a good source of proteins, vitamins (A and D),
minerals and rich in iodine. Tunas, shrimps and crabs are not only edible
but have export value also.

2. By-products
A. Shark and cod liver oils are good sources of vitamins A and D. Oil from
Sardine and Salmon are good sources of omega 3 fatty acids, which
have multiple functions (reduce cholesterol, help prevent cancer cell
growth etc.,).
B. Fish guano: Fertilizer prepared from ‘scrap fish’.
C. Other fish by-products are shagreen (dried skin of fish such as sharks),
Isinglass (substance obtained from dried swim bladders of mostly cat
fish, used in clarification of wines) etc.
Fisheries have carved a niche in the Indian economy. We now talk about
‘Blue Revolution’ as being implemented on lines similar to ‘Green
Revolution’.
In addition to pisciculture, the culture of prawns, crabs and pearl oysters
enable us earn foreign exchange worth millions of dollars from their exports.

8.5 Biotechnological Applications in Medicine

Recombinant DNA technology involves manipulation of genes or
microorganisms to produce certain products useful to mankind. These
recombinant DNA technological processes have made an immense impact in
the area of human health care. They are used in the production of hormones,
synthetic vaccines, effective therapeutic products etc. These products like
the recombinant therapeutics do not induce unwanted immunological
responses. At present about 30 recombinant therapeutics have been approved
for human use, the world over.

Genetically Engineered Insulin

You have already learnt that INSULIN is a protein hormone produced from
the beta cells of islets of Langerhans of the pancreas and is required to
accelerate the uptake of glucose into the body cells and to promote
glycogenesis, lipogenesis, protein synthesis, etc. Insulin must be injected or
given via an insulin pump. It cannot be administered orally, because it is a
protein and is broken down in the stomach before it can be absorbed. Attempts
are underway to develop orally administerable insulin.

279
 Zoology

Prior to the development of humulin, diabetic patients used to be dependent

upon animal insulin extracted from the pancreatic islet tissue of slaughtered
cattle and pigs. The animal insulin is more expensive, less accessible and
causes allergies. They also cause several side effects, due to certain non-self
proteins in them, which act as antigens. Currently, genetically engineered
E.coli which can be grown in large quantities to produce human (humulin)
insulin is available and from which we can make as much insulin as we
need.
Structure of insulin: Human insulin is made up
of 51 amino acids arranged in two polypeptide
chains -chain A (21 amino acids) and chain B (30
amino acids), which are linked together by
disulphide linkages. In mammals, including
humans, insulin is synthesised as a pro-hormone
(like a pro-enzyme, which needs to be processed
before it becomes fully mature and functional
hormone) which contains an extra stretch called
the c peptide. This c peptide is not present in the
Figure 8.5 Maturation of pro-insulin
mature insulin and is removed during maturation
into insulin
into insulin.
The main challenge for the production of insulin in the laboratory using
rDNA technique was getting insulin assembled into its mature form. In 1983,
Eli Lilly, an American company, prepared two DNA sequences coding for A
and B chains of human insulin and introduced them into plasmids of E.coli
to produce insulin chains. The chains A and B were produced separately and
combined by creating disulphide bonds to form ‘humulin’ which is the brand
name for a group of biosynthetic human insulin products.

8.6 Vaccines
The term ‘vaccine’ was coined by Edward Jenner. He immunised
a boy against small pox by inoculating him with a relatively less
dangerous cow pox virus. The technique of attenuating or
weakening of a microbe was developed by Pasteur.
A vaccine is a biological preparation that improves immunity to
a particular disease. A vaccine typically contains the disease-
causing microorganism, and is often made from weakened or
killed forms of the microbe. The toxins or one of the surface
proteins of the microorganisms are also used in preparing vaccines.

280
 Applied Biology

Vaccines are generally used as prophylactic measures. Moreover, they may

not guarantee total protection from a disease. It may be due to inadequate
immune response of the host’s immune system. Even if the host develops
antibodies, the human immune system may not effectively defend the body
from the pathogen immediately. Therefore certain adjuvants are used to
enhance the immune response stimulated by the antigens . Most often
aluminium adjuvants are used.
Use of vaccines in the Afro-Asian countries has reduced the mortality rate.
For example smallpox could be eradicated completely in India/World by
intensive vaccination programme in an organised manner, by governmental
agencies,as it is being done in the case of polio, nowadays. Though there are
vaccines available against several pathogens, vaccines against dreaded
diseases such as AIDS and Malaria are yet to be developed.
The following are some important Biotechnologically produced vaccines.
1. Attenuated Whole Agent Vaccines
They contain disabled (made less virulent) live microorganisms. Mostly
they are antiviral. Examples: vaccines against yellow fever, measles,
rubella and mumps and the bacterial disease such as typhoid.
2. Inactivated Whole Agent Vaccines
They contain ‘killed microbes’ (virulent before killing). Examples:
vaccines against influenza, cholera, bubonic plague, polio, hepatitis A,
rabies and Salk’s polio vaccine.
3. Toxoids
They contain ‘toxoids’ which are inactivated ‘exotoxins’ of certain
microbes. Examples: the vaccines against Diphtheria and Tetanus.
Thus, vaccines are used in the prevention of diseases as they induce
artificially acquired active immunity.

Do you know? Jonas Salk produced polio vaccine (inactivated polio

visus) which became popular as Salk’s vaccine. Later SABIN’S oral polio
vaccine (attenuated poliomyelitin virus) produced by ALBERT SABIN
became much more popular as its effect lasts longer and is easy to
administer.

8.7 Molecular Diagnosis

We know that for effective treatment of a disease, early diagnosis and
understanding its pathophysiology is very important. Using conventional
methods of diagnosis (serum, urine analysis, etc.) early detection is not
possible. Recombinant DNA Technology, Polymerase Chain Reaction (PCR)
are some of the techniques that help early diagnosis.

281
 Zoology

Presence of a pathogen (bacteria, viruses, etc.) is normally suspected only

when the pathogen has produced a disease symptom. By this time the
concentration of pathogen is already very high in the body. However, very
low concentration of bacteria or viruses (at a time when the symptoms of the
disease are not yet visible) can be detected by amplification of their nucleic
acid by PCR. PCR helps to detect very low amounts of DNA by amplification
of the small DNA fragment. PCR is now routinely used to detect HIV in
suspected cases. It is being used to detect mutations in suspected cancer
patients too. It is a powerful technique to identify many other genetic disorders
such as haemophilia, phenylketonuria, etc.
A single stranded DNA or RNA, tagged with a radioactive molecule (probe) is
allowed to hybridize with its complementary DNA in a clone of cells followed
by its detection using autoradiography. The ‘clone’ having the mutated gene
will not appear on the photographic film, because the probe does not show
complementarity with the mutated gene.
Molecular Diagnostics is constantly translating new discoveries and novel
technologies into useful clinical tests that detect ‘molecular fingerprints’ of
diseases.

8.8 Gene Therapy

Gene therapy is the insertion of genes into an individual’s cells and tissues
to treat a disease, such as a hereditary disease in which a deleterious mutant
allele is replaced with a functional one. The biology of human gene therapy

Figure 8.6 Important steps in the process of Gene Therapy

282
 Applied Biology

is a collection of methods/techniques that allows correction of a gene defect

that has been diagnosed in a child/embryo.
Basic Technique: A normal gene is inserted into the genome to supplement
an abnormal gene (mutated gene), which is disease causing. To deliver the
normal gene (therapeutic gene) a vector must be used. The vector unloads
its genetic material containing the ‘therapeutic human gene’ into the target
cell. The generation of a functional protein product from the therapeutic
gene restores the cell to its normal state.
Types of Gene Therapy: Two basic types of gene therapy can be applied to
humans, germ line and somatic line.
a. Germ line gene therapy: In this type of therapy, functional genes
(normal genes) are introduced into sperms or ova and are thus integrated
in to their genomes. Therefore the change or modification becomes
heritable. Due to various technical and ethical reasons, the germ line
gene therapy remained at the ‘infant stage’ for the time being.
b. Somatic line therapy: In this type of therapy, functional genes are
introduced into somatic cells of a patient. The approach is to correct a
disease phenotype by treating some somatic cells in the affected person.
The changes effected in this type of GT are non-heritable.
Somatic line therapy can be either ex-vivo or in vivo. In ex-vivo, cells
are modified outside the body and then transplanted back. In in-vivo,
genes are changed in cells, while they are still inside the body.
First Clinical Gene Therapy
The first clinical gene therapy was given in 1990 to a four year old girl with
adenosine deaminase (ADA) deficiency. This enzyme is crucial for the
immune system to function. ADA deficiency causes severe combined
immunodeficiency (SCID). It is caused by the deletion or dysfunction of the
gene encoding for the enzyme ADA. In some children ADA deficiency can be
cured by bone marrow transplantation, in others it can be treated by an
enzyme replacement therapy, but both these approaches are not completely
curative.
As a first step towards gene therapy, lymphocytes from the blood of the
patient are kept in a nutrient medium outside the body. A functional ADA
cDNA (using a retroviral vector) is then introduced into these lymphocytes,
which are subsequently returned to the patient. However, as these cells are
not immortal the patients require periodic infusion of such genetically
engineered lymphocytes. Permanent cure is possible when the gene isolated

283
 Zoology

from marrow cells producing ADA is introduced into the cells at early
embryonic stages.
Diseases and Gene Therapy: Scientists are focusing on diseases caused by
single-gene defects, such as cystic fibrosis, haemophilia, muscular dystrophy
and sickle cell anaemia, wherein scientists are trying to introduce genes
directly into human cells. Currently, most gene therapy studies are aimed at
cancer and hereditary diseases linked to a genetic defect. In spite of so many
efforts, the biology of GT remains complex and many techniques need
improvement and perfection. The genetic link of many diseases is to be
understood more fully before GT can be used appropriately.
Transfer of Genetic Material: Genetically modified DNA can be introduced
into a eukaryotic cell by a process called ‘Transfection’. It can also be
introduced by Gene guns or through ‘electroporation’ of the cells. Viral
vectors are used to send the genetic material into cells, a process similar to
bacterial transduction. In methods in which DNA is directly sent, the DNA
to be delivered is protected from damage during transfer /entry into recipient
cell by enveloping it in lipid coats (Lipoplexes) or enveloping in complexes of
polymers (Polyplexes). Synthetic oligodeoxy nucleosides are used to inactivate
genes (Silencing the genes) involved in causing disease.

8.9 Transgenic Animals

Animals that have their own genome and had their DNA manipulated to possess
and express an extra (foreign) gene are known as transgenic animals. Transgenic
rats, rabbits, pigs, sheep, cows and fish have been produced, although over
95 percent of all existing transgenic animals are mice. Transgenic animals
are produced for many reasons aiming at benefitting human beings. Let us
try and explore some of the common reasons:
i) Normal physiology and development: Transgenic animals can be
specifically designed to allow the study of how genes are regulated, and
how they affect the normal functions of the body and its development,
e.g. study of complex factors involved in growth such as insulin-like
growth factor. By introducing genes from other species that alter the
formation of this factor and studying the biological effects that result,
information is obtained about the biological role of the factor in the
body.
ii) Study of disease: Many transgenic animals are designed to increase
our understanding of how genes contribute to the development of disease.
These are specially made to serve as models for human diseases so that
investigation of new treatments for diseases is made possible. Today

284
 Applied Biology

transgenic models exist for many human diseases such as cancer, cystic
fibrosis, rheumatoid arthritis and Alzheimer’s (Discussed in unit iii).
iii) Biological products: Medicines required to treat certain human diseases
can contain biological products, but such products are often expensive
to produce. Transgenic animals that produce useful biological products
can be created by the introduction of the portion of DNA (or genes)
which codes for a particular product such as human protein (  -1
antitrypsin) used to treat emphysema. Similar attempts were made for
treatment of phenylketonuria (PKU) and cystic fibrosis. In 1997, the
first transgenic cow, Rosie, produced human protein-enriched milk (2.4
grams per litre). The milk contained the human alpha–lactalbumin
and was nutritionally a more balanced product for human babies than
what is available in normal milk from untreated cows.

NOTE: Alpha-lactalbumin is rich in essential amino acids and is the

dominant protein in human milk.
iv) Vaccine safety: Transgenic mice are being developed for use in testing
the safety of vaccines before they are used on humans. Transgenic
mice are being used to test the safety of the polio vaccine. If successful
and found to be reliable, they could replace the use of monkeys to test
the safety of batches of the vaccine.
v) Chemical safety testing: This is known as toxicity/safety testing. The
procedure is the same as that used for testing toxicity of drugs.
Transgenic animals, that carry genes which make them more sensitive
to toxic substances than non-transgenic animals are produced. They
are then exposed to the toxic substances and the effects studied. Toxicity
testing in such animals will allow us to obtain results in less time.
Indian government has setup GEAC (Genetic Engineering Approval
Committee) to look into misuse of DNA manipulation and safety of
introducing GM-organisms for public services.

8.10 Cancer Biology

Cancer is a leading killer disease in the world. It is basically a condition of
failure of cell division control. Unchecked division of cells leads to the
formation of ‘neoplasm’ (tumor) and such an abnormal proliferation of cells
is called ‘neoplasia’ (formation of a tumor). Neoplasm may be (1) Benign
(harmless e.g. uterine fibroids in a female human being) (2) Pre-malignant
(also called ‘carcinoma in situ’– in which cells transform into cancerous
cells in due course of time) (3) Malignant (cancer, in which cells invade and
destroy surrounding cells forming ‘metastasis’). Some neoplasms, however

285
 Zoology

do not form tumor e.g. Leukemia. Oncology is the branch of medicine that
deals with tumors, including study of their development, diagnosis, treatment,
and prevention. Cancers are caused chiefly due to ‘failure of cell cycle regulation’
which is not yet clearly understood.
Normal cells show a phenomenon called ‘contact inhibition’ (which means
cessation of cell division and cell mobility, when they are in close (physical)
contact with each other. Cancer cells (neoplastic cells or tumor cells) lose
this property and keep on dividing.

GUESS: Cancer cells lack ‘anchorage dependence’. Normal cells attach/

anchor to the surface of the dish in which they grow when the medium
is sterile and supply of nutrients is enough. Now the question is –
I. What happens when ‘normal cells’ are grown in a dish containing all
the requirements necessary? II. What happens when ‘cancer cells’ are
grown in a dish containing all the requirements necessary?
As cancer cells actively divide and grow, they starve the normal cells by
competing for ‘vital nutrients’. Normal cells are joined by ‘intercellular adherens
junctions’ called ‘cadherins’ (calcium dependent trans membrane proteins)
and they are missing in cancer cells (hence their ability to detach and
cause metastasis). Cancer is a disease in which damaged cells do not
undergo ‘programmed cell death’ (apoptosis). Cancer cells have abnormal
changes on their cell surface /unusual profile of surface antigens,which can
be recognized and destroyed by NK cells and Tc cells of the immune system.
Another important aspect of tumors is – there is increased growth of blood
vessels towards the tumors. When tumors grow in size, diffusion of oxygen
and nutrients becomes restricted and so tumors resort to attracting more
blood vessels from their surrounding matrix (angiogenesis). If extension of
blood vessels can be inhibited, the cancer cells starve and die.

Proto-oncogenes, oncogenes, tumor suppressor genes

Human genome has some ‘proto-oncogenes’ which are normal cellular genes.
Due to the effect of certain mutagens,proto-oncogenes mutate into cellular
‘oncogenes’ which cause cancers. There are some tumor suppressor genes
also in the genome. For example the gene p53 is a gene that codes for a
‘protein’ (p53 protein) that inhibits the development and growth of tumors.
Mutations of proto-oncogenes are dominant (a single copy of the oncogene
can lead to cancer). Interestingly, in the case of tumor suppressor genes
such as the p53 gene, both copies of the gene in the homologous pair of
chromosomes must undergo mutation to allow cancer to develop. The protein

286
 Applied Biology

p53 plays an important role with reference to the ‘G1 check point’ in the
regulation of cell division cycle. It guards the ‘integrity of the DNA’ ( it is
often called the GUARDIAN ANGEL OF CELL’S GENOME ). It stops cell
division and helps repair the damaged DNA. If the damage is repaired, the
p53 protein allows the cell to enter the ‘S’ phase. If it is irreparable,it directs
the cell to undergo ‘apoptosis’. Hence the gene p 53 is called ‘tumor
suppressing gene’. The retinoblastoma protein (pRB) is also a ‘tumor
suppressor protein’ that is dysfunctional in several major cancers. Its
function is similar to that of p53 protein.
Carcinogens: A carcinogen is a substance that causes cancer. Carcinogens
damage the DNA. Several radioactive substances e.g. gamma rays, some U-
V rays, X rays etc. and ‘inhaled asbestos’, certain ‘Dioxins’, tobacco smoke
(which contains many types of carcinogens such as benzopyrene,
nitrosamines and inorganic compounds such as chromium, cadmium,
arsenic, polonium-210) etc. are carcinogenic. If the DNA damage is too
severe to repair, the cells undergo apoptosis, but if the programmed cell
death pathway is damaged, the cell becomes a cancer cell.
Do You Know? If,for example,cancer cells from the liver move to brain
and cause a tumor there,it is not called ‘brain cancer’. It is rather
called ‘Secondaries’ (metastasis) of liver cancer in the brain.

Types of cancers
There are different types of cancers such as carcinomas (cancers of epithelial
tissues/cells which are most common as epithelial cells divide more often),
sarcomas (cancers of connective tissues), leukemias (cancers of bone marrow
cells resulting in unrestrained production of WBC – a liquid tumor),
lymphomas (cancers of the lymphatic system). Certain types of cancers
are called ‘familial cancers’ (cancer that occurs in families; genetic based)
and others ’sporadic cancers’ (non-hereditary cancers occurring without
any family history). Some types of cancers are caused by ‘tumor forming
RNA viruses’ (oncoviruses), e.g. Rous sarcoma virus which causes ‘avian
sarcoma’.

Do You Know? When a retro virus enters a host cell, it reverse

transcribes into cDNA, which ‘integrates’ with the host cell’s DNA and
starts producing more viruses.

287
 Zoology

Did You Come to Know? A recent advance in science is the recognition

that cervical cancer (cancer of the neck of the uterus) in women is
caused by a VIRUS called Human Papillomavirus (HPV) and an effective
vaccine against cervical cancer is available as a prophylactic against
cervical cancer. Women are ‘screened’ to detect potentially pre-cancerous
condition by the test called Pap test / Pap smear test.

Detection of cancer
Cancer detection is based on‘biopsy’ (removal and microscopic examination
of a sample of body tissue from a living organism for diagnostic purposes). It
is essentially a ‘histopathological’ study to detect abnormalities such as
cancer. Blood test is performed to detect ‘leukemia’ (increased leucocyte
count, commonly referred to as ‘blood cancer’). The PSA (Prostate Specific
Antigen) test is used to screen for early prostate cancer. A mammogram is
a low-energy x-ray exam of the breasts to detect breast cancer. X ray, CT
scan (Computed Tomography), MRI (Magnetic Resonance Imaging) etc.,
are used for diagnostic imaging of body parts to detect cancer. PET
scan detects cancer, and help physicians diagnose breast cancer, lung cancer,
colo-rectal cancer, cervical cancer etc.
Treatment of cancer: Treatment of cancer generally involves
1. Surgical removal of the malignant tumor.
2. Radiation treatment to destroy cancer cells in the tissues adjoining
the tumor (to destroy any more cancer cells that may be remaining).
3. Chemotherapy and immunotherapy to destroy cancer cells that might
have moved to other parts of the body. Chemotherapy has side effects
such as loss of hair due to destruction of ‘hair follicle cells’
(alopecia),anaemia (due to inhibition of division/destruction of the
‘normal’ cells of the bone marrow). Anti-cancer drugs such as ‘taxol’
can stop active division of cells. Usually cancer cells avoid detection
and destruction by the immune system. Hence cancer patients are given
substances known as ‘BIOLOGICAL RESPONSE MODIFIERS’ such as
alpha interferons which activates the immune system of the patient
and help in destroying tumors. Monoclonal antibody–based biologic drugs
are also useful in treating certain cancers (Biotherapy)..

288
 Applied Biology

8.11 Stem Cells

Stem cells are undifferentiated cells found in most, if not all multicellular
animals. They are characterised by the ability to go through numerous mitotic
cycles while maintaining the undifferentiated state. The normal cells
produced by mitosis differentiate into diverse specialized cell types. Stem
cells are responsible for development, repair of adult tissues and cancer,
when the control over their division is lost. Stem cell research has the
potential to revolutionize the future of medicine with the ability to regenerate
damaged and diseased organs. In addition to self-renewal, stem cells also
exhibit ‘cellular potency’.
Potency specifies the differentiation potential of the stem cells. Totipotent
(Latin, ‘totus’means entire)/ omnipotent: These stem cells can construct a
complete, viable organism. Cells produced by the first few divisions of the
zygote and those from the morula are also totipotent. Pluripotent (Latin,plures
means several or many) stem cells are the descendants of totipotent cells
and can differentiate into nearly all types of cells, i.e. cells derived from any
of the three germ layers, ectoderm, endoderm and mesoderm, e.g.embryonic
stem cells. Multipotent stem cells can differentiate into a number of types
of cells, but only those of a closely related family of cells,e.g.haemopoietic
stem cells. Unipotent (Latin, ‘unus’ means one) cells can produce only one
cell type, their own.
In mammals, there are two broad types of stem cells: embryonic stem cells
and adult stem cells.

Embryonic Stem Cells (ES CELLS)

They are isolated from the epiblast tissue of the inner cell mass of a blastocyst.
ES cells are pluripotent and can give rise to the three primary germ layers-
ectoderm, endoderm and mesoderm. When given the necessary stimulation,
they can develop into more than 200 cell types of the adult body. ES cells are
immortal cells i.e. they can proliferate in a sterile culture medium perennially
and they are a source of a large number of cells in the undifferentiated
state.
Adult stem cells
They are found in various tissues of children as well as adults. Any cell
which is found in the body of a developed animal that has the ability to
divide and create another cell like it is called an adult stem cell or somatic
stem cell. These cells act as a repair system for the body, replenishing adult
tissues. Most of the adult stem cells are multipotent.

289
 Zoology

The red bone marrow is a rich source of adult stem cells. The other examples
include mesenchymal stem cells, adipocyte stem cells, endothelial stem cells,
etc.

Do you know? Pluripotent adult stem cells are rare and generally in
small number; occur in umbilical cord.
Haemopoietic stem cells (HSCs) of red bone marrow are multipotent stem
cells. HSCs are of two types namely myeloid stem cells and lymphoid stem
cells that give rise to all the blood cell types.
Myeloid stem cells and lymphoid stem cells are together called secondary
stem cells or common progenitors.
Myeloid stem cells: These are non-renewing cells and give rise to erythroid
committed progenitor, basophil committed progenitor, eosinophil committed
progenitor, granulocyte-monocyte progenitor and Megakaryoblast. Each of
these cells give rise to different but specific cell(s).
1. Erythroid committed progenitor (proerythroblast): Erythrocyte is
formed through stages like proerythroblast, erythroblast and reticulocyte.
2. Basophil committed progenitor: Gives rise to basophils which give
rise to ‘Mastcells’.
3. Eosinophil committed progenitor: Gives rise to eosinophil.
4. Granulocyte-monocyte progenitor: It gives rise to myeloblast and
monocyte committed progenitors. Neutrophil is formed from myeloblast
committed progenitor and monocyte is formed from monocyte committed
progenitor Monocytes give rise to macrophages in tissues.
5. Megakaryoblast: It forms megakaryocyte which by fragmentation gives
blood platelets.
Lymphoid stem cells: It gives rise to T-cell committed progenitor and B-cell
committed progenitor. T -cell committed progenitor differentiates into T -
lymphocyte in Thymus. T -cells may be T -helper or T -cytotoxic cell. B-cell
committed progenitor produces B-lymphocyte in the bone marrow.

Note: Natural killer cells originate directly from lymphoid stem cells
whereas dendritic cells originate from both myeloid stem cells and
lymphoid stem cells directly.

Applications Of Stem Cell Therapy

Stem cells, taken from umbilical cord, can be transform into specialized
cells to replace myocytes or neurons or perhaps the entire organism through
cell culture. A number of adult stem cell therapies already exist.

290
 Haemopoietic stem cell
Applied Biology

Figure 8.7 Haemopoietic stem cells

291
 Zoology

8.12 Biomedical Technology

Biomedical technology is the application of principles of biophysics and
biochemistry for studying certain biological aspects. It involves-
1. Diagnostic imaging: X- ray imaging , Computed Axial Tomography (CAT
scan) or Computed tomography (CT scan), Magnetic Resonance Imaging
(MRI), Positron Emission Tomography (PET scan), Sonography etc.
2. Biomedical procedures to study body’s vital functions and their disorders
(ECG, EEG)
3. Biochemical procedures to estimate various biochemical components
in body fluids (ELISA,Western Blot/Protein immunoblot etc.).

8.12.1 X ray Radiography

X-Rays, discovered by Rontgen, are useful in diagnostic radiography. It is a
simple radiological technique to observe the human body parts and diagnose
any physical (anatomical) variations. X-Ray images show areas of different
densities and composition in different identifiable/diagnosable forms.
A beam of X-rays is produced by an X-ray generator and is projected on the
body parts. X –rays that pass through the body parts are recorded on a
photographic film or observed on a fluorescent screen. Photographs developed
using X-rays are known as radiographs or skiagraphs. Dense bones absorb
much of the X- radiation and soft tissues allow more X-rays to pass through.
So, bones appear more white and soft tissues look greyish. Calcifications in
tissues too appear whitish. Air in the lungs appears blackish as it does not
blcok X-rays. The X- ray film provides a 2D representation of all the structures
of the body part superimposed on each other (X-ray radiograph) or it can be
stored as a digital image. It is used to diagnose or treat patients by assessing
the presence or absence of disease, foreign objects, and structural damage
or other anomalies. Angiography involves taking a series of X-rays as blood
flows through blood vessels such as the coronary or carotid arteries,to study
‘blocks’ in them. This procedure involves injecting dyes into blood to get
contrast images and nowadays Digital Subtraction Angiography is used
to get a better resolution images.
Portable X-ray machines are also available, nowadays. X-rays help to
detect skeletal fractures, pneumonia, tuberculosis, cancers etc. Every
precaution should be taken to avoid exposure of gonads and foetus of a
pregnant woman, as X-rays may prove to be more dangerous to them.

8.12.2 Computed Axial Tomography (CAT)

Computed Tomography (CT) or Computerized Axial Tomography (CAT) scan
is a medical imaging method that employs Tomography (a process of producing

292
 Applied Biology

a two dimensional slice through a 3 dimensional object). A large donut shaped

X-ray machine takes X-ray images at many different angles around the
body. The X-ray detector of the CT-scanner can detect hundreds of different
levels of density of tissues in body organs. The data is transmitted to a
computer which builds up 3-D cross sectional picture of the part of the
body and displays the picture on the screen. This recorded image is called
‘tomogram’. The body can be seen on CAT scan as slices from the skin to the
central part.
A CAT scanner emits a series of narrow beams of X-rays through the human
body as it moves through an arc, unlike an X-ray machine which sends just
one radiation beam. The final 3-D picture of a CAT scan is far more superior
and detailed than an ordinary X-ray picture. Sometimes, patients may be
given a contrast dye for better resolution.
CAT scans are useful to measure accurately the density of bones in evaluating
osteoporosis. CAT scans are performed to analyse the head injuries (blood
clots and skull fractures) to know the anatomy of various visceral organs.

8.12.3 MRI (Magnetic Resonance Imaging)

What is an MRI scan?
An MRI (Magnetic Resonance Imaging) scan is a ‘Diagnostic Radiology
Technique’ that uses magnetism, radio waves and a computer to produce
‘images of body components’. It is important to note that MRI does not use
ionizing radiation, as involved in X-rays, and is generally a very safe
procedure. MRI is a non-invasive medical ‘imaging technique’ that helps
physicians diagnose certain anatomical abnormalities or pathological
conditions. This technique uses nuclear magnetic resonance of protons to
generate ‘proton density images of body parts’. Magnetic Resonance Imaging
uses a powerful magnetic field, radio frequency pulses and a computer to
produce detailed pictures of organs, soft tissues, bones and virtually all
other internal body structures.

NOTE: MRI provides good contrast between the different soft tissues of
the body, which makes it especially useful in imaging the brain, muscles,
the heart, and cancerous tissues compared to other medical imaging
techniques such as Computed Tomography (CT) or X-rays.

293
 Zoology

MRI scanner and procedure

MRI scanner is a giant circular magnetic tube. The patient is placed on a
movable bed that is inserted into the magnet. Human body is mainly composed
of water molecules which contain two hydrogen nuclei / protons, each. The
magnet creates a strong ‘magnetic field’ that makes these protons align with
the direction of the magnetic field (protons are not aligned under normal
conditions). A second radiofrequency electromagnetic field is then turned on
for a ‘brief period’. The ‘protons’ absorb some energy from these ‘radio waves’.
When this ‘second radio frequency emitting field’ is turned off, the protons
release energy at a radiofrequency which can be detected by the MRI scanner
(the protons return to their ‘equilibrium state’ from the ‘energized state’ at
different ‘relaxation’ rates).
Different types of tissues emit different ‘quanta’ of energy (in the form of
different wave lengths and at different rates). Abnormal tissues, such as
tumors, can be detected because the protons in different types of tissues
return to their equilibrium state at different rates. Tissues such as bones with
less water content (hence, less number of protons) look different in an MRI
image. Accordingly there is a contrast between the ‘images’ of ‘different tissues’
based on their water content. Even in the case of the same tissue, ‘normal
healthy cells’ and ‘pathological cells’ emit different energy waves – hence the
difference in the images of the different types of cells.

Figure 8.8 MRI Scanner

294
 Applied Biology

The information received is processed by a computer, and an image is

generated. The image and resolution produced by MRI is quite detailed and
can detect tiny changes of structures within the body. For some procedures,
radiocontrast agents, such as gadolinium, are used to increase the
accuracy /resolution of the images. After scanning is completed, the
computer generated images (tomographs–images of thin slices of body
parts) can be transferred to a film (hard copy). A radiologist interprets the
images of the body parts and gives his diagnostic opinion.

NOTE: MRI is used to distinguish pathologic tissue (such as brain tumors)

from normal tissue. MRI can show even hairline fractures of the pelvis
and hip that may not be detected by the traditional X ray or CT Scan.
Balooning of blood vessels called aneurysms can be detected using MRI
(aneurysms may occur when a tear begins in the layers of the walls of
aorta, arteries, veins or parts of heart. More over MRI is preferred to CT
scans, as CT scan involves ‘effects’ of ‘ionising radiation’ whereas MRI
does not have ionising radiation .

8.12.4 ECG
What is ECG?
The word ECG may mean electrocardiogram/electrocardiograph, but it
is most commonly used for electrocardiogram. Electrocardiography is a
commonly used, non-invasive procedure for
recording electrical changes in the heart.
The graphic record, which is called an
electrocardiogram (ECG or EKG), shows the
series of waves that relate to the electrical
impulses which occur during each cardiac
cycle. An electrocardiograph is a device which
records the electrical activity of the heart
muscle (depolarisations and
repolarisations).

What is electrocardiography?
Electrocardiography is the technique by which
the electrical activities of the heart are
recorded for study. Sensors (electrodes) are
placed at specific parts of the body and linked
to the ECG machine. ECG is recorded using Figure 8.9 Electrocardiogram

12 ‘LEADS’ (sensors from limbs and chest).

295
 Zoology

Obtaining an electrocardiogram typically takes a few minutes, after which

the electrodes are removed.

The essential components of an ECG

A normal ECG consists of i. Waves ii. Intervals iii. Segments and
iv. Complexes.
WAVES: The waves in a normal record are named P, Q, R, S, and T, in that
order.
A typical ECG tracing of a normal heartbeat (or cardiac cycle) consists of I. a
‘P’ wave, II. a ‘QRS complex’ of ‘waves’, III. a ‘T‘ wave.
P wave: It represents the ‘atrial depolarization or atrial systole’. P wave
shows that the impulse is passing through the atria. The normal duration
of a P wave is – 0.1 sec.
QRS complex of ‘waves’: (Ventricular depolarization/ventricular systole)
i. Q wave is a small negative wave ii. R wave is a tall positive wave iii. S
wave is a negative wave. The normal duration of QRS complex of waves is
about 0.08- 0.1 sec.
T wave is a positive wave. It represents the ventricular repolarisation. Its
duration is 0.2 sec.

Intervals
i. P-R interval is the interval between the onset of P wave and the onset
of Q wave. P-R interval is normally 0.12 – 0.2 sec.
ii. Q-T interval is the interval between the onset of Q wave and the end of
the T wave. It represents the electrical activity in the muscle of the
ventricles (ventricular depolarisation).‘QT Interval ‘ is dependent on
the ‘heart rate’ (the ‘faster’ the ‘heart rate’ – the ‘shorter’ the interval).
It lasts for about 0.4 sec.
iii. R-R interval signifies the duration of one ‘cardiac cycle’ and it lasts for
about 0.8 sec. (60/75= 0.8 sec.).
Segments: S-T segment is the time period between the end of the S wave
and the onset of the T wave. It is an ‘isoelectric/zero voltage’ period.

Clinical Inferences from ECG

1. Enlarged P wave, indicates enlarged atria.
2. Variations in the duration, amplitude and morphology of the QRS
complex indicate disorders such as bundle branch block (block of
conduction of impulses through the branches of the bundle of His).

296
 Applied Biology

3. If the duration of the P-R interval is prolonged, it indicates delay in

conduction of impulses from S-A node (pace maker) to the A-V node. P-
R interval is prolonged in ‘bradycardia’ (slow beating of the heart) and
shortened in ‘tachycardia’ (fast beating of the heart).
4. Prolonged Q-T interval indicates myocardial infarction (MI) and
hypothyroidism. Shortened Q-T interval indicates ‘hypercalcemia’
5. Elevated S-T segment indicates myocardial* infarction.
6. Tall T wave indicates hyperkalemia; small, flat or inverted T wave
indicates hypokalemia.

8.12.5 EEG
Electroencephalography is the process of recording the electrical activity
of the brain (graphical recording called electroencephalogram) with the help
of an EEG machine and some ‘electrodes’ placed all over the scalp.
Electroencephalograph is a very useful tool in diagnosing neurological and
sleep disorders. The changed EEG patterns in the case of ‘epilepsy’ are
conveniently studied with the help of an EEG. Brain shows continuous
electrical activity of innumerable neurons. The intensity and pattern of
electrical activity depends on wakefulness, sleep, coma, certain pathological
and psychological conditions. The main diagnostic application of EEG in
neurological studies is the diagnosis of epilepsy (seizures). EEG shows
distinct abnormal pattern in the case of epilepsy. EEG is also useful in the
diagnosis of ‘coma’ and ‘brain death’. EEG studies are useful in analyzing
sleep disorders (such as insomnia).
Waves of EEG: The waves recorded by an EEG consist of
i. Synchronized waves which are common in normal healthy people and
ii. In certain neurological conditions the waves are desynchronized (irregular
wave pattern). The wave pattern can be broadly classified into ALPHA,
BETA, THETA and DELTA wave patterns. The nature of the waves
depends on the intensity of activity of the different parts of the cerebral
cortex.
Alpha waves: They are rhythmical 8-13 cycles per second. This type of wave
pattern is seen in persons who are drowsy/sleepy with closed eyes.
Beta waves: These waves occur at a high frequency of 13-40 cycles per
second. Their amplitude is low. These are ‘desynchronised waves’ recorded
in persons who are mentally very active and tense.

* Myocardial infarction involves necrosis (death of tissue) of heart muscle and is generally
refered to as ‘heart attack’.

297
 Zoology

Delta waves: Their frequency is quite low (less than 3 cycles per sec.).
However they have high amplitude. They are common in early childhood in
awaken condition. In adults they occur in deep sleep. In the case of brain
tumors, epilepsy, mental depression etc. these waves occur in awake adults
too.
Theta waves: Their frequency is between 4 and 7 cycles per second. These
waves are common in children of less than 5 years of age. They are also
recorded during emotional stress in adults.

8.12.6 ELISA (Enzyme Linked Immunosorbent Assay )

What is ELISA?
ELISA is the acronym (short form) of Enzyme-Linked Immunosorbent Assay.
It is a biochemical procedure to detect ‘antigens’ or ‘antibodies’ in a given
sample. All microbes have at least an antigen that is unique. This antigen
can be purified and used to generate specific ‘monoclonal antibodies’. Thus
MABs are made available for this procedure. Both the antibodies and the
purified antigens provide effective diagnostic tools. It is a method used mainly
to detect the presence of specific antibodies or antigens in a sample of
serum, urine etc. It is the first and most basic ‘tool’ to determine if an
individual is positive or negative for a particular pathogen such as HIV. It is a
useful tool both for determining serum antibody concentrations (such as the
antibodies produced in a person infected by pathogens such as HIV) and also
for detecting the presence of specific antigens and hormones such as human
chorionic gonadotropins (hCGs).
Requirements for ELISA
i. a microtitre plate
ii. a purified antibody (for detecting a specific antigen)
iii. a purified antigen ( for detecting a specific antibody)
iv. an enzyme that catalyses the production of colour from a chromagenic
substance (mostly peroxidase or alkaline phosphatase or beta
galactosidase).
v. a buffer (wash) fluid to remove unbound substances in the well.
vi. a substrate (chromogenic substance)
vii. a spectrophotometer to measure the intensity of the colour of the
substrate.
NOTE: Monoclonal antibodies are used as :1. Primary antibodies (which
react with the antigens of interest ) 2. Secondary antibodies (which
react with the primary antibodies).

298
 Applied Biology

ELISA is a fundamental tool of clinical immunology, and the purpose of an

ELISA is to determine if a particular protein is present in a sample, such as
serum of a person affected by a pathogen and if so, how much.
ELISA is of two types
I. Direct ELISA - ELISA used to detect antigens
II. Indirect ELISA - ELISA done to detect antibodies
Direct ELISA:
Direct ELISA is performed by using ‘primary antibodies’ (antibodies against
the ‘antigen’ of interest) attached/adsorbed on the solid surface of the ‘well’
on the titre plate. This antibody has affinity for the antigen of interest
(antigen for whose detection this test is being conducted). It is of two types.
I) Sandwich Assay: In this type, ‘Enzyme coupled antibodies’ are used. It
measures the amount of antigen ‘sandwiched’ between two layers of
antibodies (primary antibodies).
The antigen to be measured should contain at least 2 antigenic sites
(multivalent antigen-having several attachment sites for an antibody).
Sandwich assays are used to quantify multivalent antigens such as
proteins or polysaccharides.
In the illustration given you can notice how an antigen is sandwiched
between two antibodies (primary antibodies) The second antibody which
is tagged with the enzyme attaches to the primary antibody. When a
substrate is added the enzyme acts on it and changes the colour. It
happens only if the antigen is present in the sample given for testing.
Otherwise there will be no change in colour.

Figure 8.10 Sandwich Elisa

299
 Zoology

II) Competitive Assay: The common ‘pregnancy test’ using Human

Chorionic Gonadotropin (hCG), as an indicator of pregnancy is an example
for which ‘Competitive ELISA’ is conducted.
Protocol (plan of the experiment/assay)
1. Adsorption (the process by which molecules of a substance, collect on
the surface of another substance) of the primary antibodies.
2. Adding the ‘test sample’ (blood, urine) to the TEST SYSTEM
3. If there are hCG molecules in the sample they attach to the adsorbed
antibodies.
4. Now purified hCG molecules linked to an enzyme are added to the TEST
SYSTEM.
NOTE-I: If there is no hCG in the test sample, only hCG with linked
enzyme will bind to the adsorbed antibodies.NOTE-II-The more hCG in
the test sample, the less enzyme linked hCG will bind to the antibodies.
5. Then the substrate (chromogenic substance) is added.
6. The intensity of change in the colour of the solution is measured, if
there is any change.
NOTE-1: If the colour changes it means more molecules of the hCG
linked to an enzyme are attached to the primary antibodies .It thus means
that less or no molecules of the specific antigen in the ‘test sample’ are
attached to the primary antibodies.If the colour is intense, it indicates –
NO PREGNANCY.
NOTE -2: If there is no colour change, it means no enzyme linked hCGs
are attached to the antibodies (as they were already occupied by the hCG
molecules of the test sample)–it indicates PREGNANCY.
NOTE-3: As the two types of hCGs are competing for the space on the
antibodies,this is called ‘COMPETITIVE ELISA’.
Indirect ELISA
It is used to detect antibodies. The blood of the person undergoing the ‘assay’
(for example the HIV test) is allowed to clot and the clear serum with
antibodies (called primary antibodies) is obtained.
Protocol
1. It is used to detect ‘antibodies’.
2. A known ‘antigen’ (HIV antigen in this case) is added to the ‘well’
(adsorbed)
3. Patient’s antiserum (serum with specific antibodies) is added

300
 Applied Biology

4. The ‘antibodies’ in the patient’s ‘antiserum’ (primary/ complementary

antibodies) bind to the antigens coated on the surface of the ‘well’.
5. Enzyme linked antihuman immune serum globulins (anti HISGs) are
added. They bind to the specific antibodies which are already bound
to the antigens.
6. Enzyme’s substrate is added and the reaction produces a visible colour
change which can be measured by a spectrophotometer.

NOTE-A: Certain ‘Human serum proteins’ (Human immune serum

globulins- HISGs) are injected into experimental animals such as rabbit,
goat etc. B. In the blood of rabbit, ‘antibodies to HISGs’ are produced.
They are called “Antihuman immune serum globulins”. C. These secondary
antibodies are conjugated to a ‘substrate-specific enzyme’ before they are
added to the contents of the ‘well’.
If there are no “anti HIV antibodies” in the serum sample, there is no binding of
primary antibodies to the antigens and so ‘enzyme linked secondary antibodies’
do not bind to the primary antibodies. There cannot be any enzymatic action
and so no colour change is observed. The test is said to be ‘Negative’ and the
person is described ‘HIV negative’. However ELISA can be “False positive “under
certain circumstances and so it cannot be used as a confirmation test for the
presence of HIV antibodies. Similarly False negatives also can occur during the
“window period” between infection and development of antibodies against the
virus.

301
 Zoology

GLOSSARY
Adjuvant: An immunologic adjuvant is Malaise: It is a feeling of general
an substance that acts to accelerate, discomfort or uneasiness, often the first
prolong or enhance antigen specific indication of an infection or other
immune responses when used in disease.
combination with specific vaccine Milch animal: Domestic animal suitable
agents. for milk production.
Aneurysm: Balooning of an artery/vein p53protein: It is a tumour suppressor
or a part of heart due to weakening of protein which is crucial in multicellular
their walls. organisms, where it regulates the cell
Apoptosis: A form of cell death in which cycle and, thus, functions as a tumour
a programmed sequence of events suppressor and is involved in
leads to the elimination of cells without preventing cancer. As such, p53 has
releasing harmful substances into the been described as “the guardian of the
surrounding area. genome” because of its role in
Assay: It means to assess; chemical conserving stability by preventing
testing done to determine the genome mutation.
composition of a substance or the Pathophysiology: The study of the
concentration of its components. biological and physical manifestations
Attenuation: The process by which a of disease as they correlate with the
virus, bacterium, etc., changes under underlying abnormalities and
laboratory conditions to become physiological disturbances.
harmless or less virulent. Rheumatoid arthritis: Rheumatoid
Conventional practices: Practices arthritis (RA) is a chronic, systemic
which are in accordance with inflammatory disorder that may affect
established norms and conventions many tissues and organs, but
and requirements. principally attacks flexible (synovial
Epidemic: A disease affecting many joints). RA is considered a systemic
persons at the same time, and autoimmune disease.
spreading from person to person in a Serum: It is the clear liquid that
locality where the disease is not separates from blood when it is allowed
permanently prevalent. to clot completely, and is therefore
Hyperkalemia: It refers to the condition blood’s plasma from which fibrinogen
in which the concentration of the has been removed during clotting.
electrolyte potassium (K+) in the blood Small pox: A highly infectious and often
is elevated. fatal disease caused by the Variola
Hypokalemia: It refers to the condition virus of the genus Orthopoxvirus and
in which the concentration of characterized by fever, headache, and
potassium (K+) in the blood is low. severely inflamed skin sores that result
Insulin pump: It is a medical device used in extensive scarring.
for the administration of insulin in the Transfection: It is the direct uptake/
treatment of diabetes mellitus and is introduction of foreign material into
an alternative to multiple daily eukaryotic cells.
injections of insulin.

302
 Applied Biology

QUESTIONS
Very Short Answer Type Questions Short Answer Type Questions

1. What factors constitute dairying? 1. What are the various methods

2. Mention any two advantages of employed in animal breeding to
inbreeding. improve livestock?
3. Distinguish between out-cross and 2. Define the term ‘breed’. What are
cross-breed. the objectives of animal breeding?
4. Define the terms layer and broiler. 3. Explain the role of animal
5. What is apiculture? husbandry in human welfare.
6. Distinguish between a drone and 4. List out the various steps involved
worker in a honey bee colony. in MOET.
7. Define the term Fishery. 5. Write short notes on controlled
8. Differentiate aquaculture and breeding experiments.
pisciculture. 6. Explain the important components
9. Explain the term hypophysation. of poultry management.
10. List out any two Indian carps and 7. Discuss in brief about ‘Avian Flu’.
two exotic carps. 8. Explain in brief about queen bee.
11. Mention any four fish by-products 9. Honey bees are economically
12. How many amino acids and important-justify.
polypeptide chains are present in 10. What are the various factors
insulin? required for bee keeping.
13. Define the term ‘vaccine’. 11. Fisheries have carved a niche in
14. Mention any two features of PCR. Indian economy-explain
15. What does ADA stand 12. Explain in brief structure of Insulin.
for?Deficiency of ADA causes which 13. Define vaccine and discuss about
disease? types of vaccines.
16. Define the term transgenic animal. 14. Write in brief the types of gene
17. What is popularly called ‘Guardian therapy.
Angel of Cell’s Genome’? 15. List out any four salient features of
18. List out any four features of cancer cancer cells.
cells. 16. Explain the different types of
19. How do we obtain radiographs? cancers.
20. What is tomogram? 17. Write about the procedure involved
21. MRI scan is harmless –justify. in MRI.
22. What is electrocardiography and 18. Write briefly about different waves
what are the normal components and intervals in an ECG.
of ECG? 19. Discuss briefly the process of
23. What does prolonged P-R interval indirect ELISA.
indicate? 20. Write short note on EEG.
24. Differentiate between primary and Long Answer Type Questions
secondary antibodies.
25. Which substances in a sample are 1. Write in detail about outbreeding.
detected by direct and indirect 2. Explain in detail clinical inferences
ELISA respectively? from ECG.

303
 Zoology

FOR IGNITED
MINDS
Biology and it’s
multifaceted Glory

Applied Biology
1. What do you call ‘programmed cell death’?
2. If a person thinks he is affected by HIV due to unprotected sex, and
goes for a blood check, the next day –do you think some test such as
an ELISA or WESTERN BLOT will help? If so how? If not why?
3. If there is a flat or inverted T wave in a person’s ECG, what additives
do you suggest in that person’s diet?
4. If in a victim of ‘dengue’ the platelet count falls to a critical low,
one of the methods of treatment is transfusion of platelets. Under
such condition improvement in the production of what type of
heamopoeitic stem cells will help.
5. If a doctor suggests a person to get his PSA test report from a
Biochemist. Probably what ailment is the doctor suspecting?
6. Of the two – Attenuated whole agent vaccine and Inactivated whole
agent vaccine – which do you think is more risk free?
7. Why is invitro modification of T cells used in Gene Therapy not a
permanent, one time cure?
8. What is the chief difference between insulin obtained from animals
and the one obtained biotechnologically?
9. Why is cross breeding preferable over inbreeding?
10. India is a big country and Biodiversity is reasonably good .Why did
we have to introduce some exotic carps into the country from other
countries?

n
304
 BOARD OF INTERMEDIATE EDUCATION, A.P, HYDERABAD
Intermediate II Year Syllabus
Subject: ZOOLOGY-II (W.E.F 2013-14)

Unit I : Human Anatomy and Physiology-I 22 Periods

Unit I A: Digestion and absorption
Alimentary canal and digestive glands; Role of digestive enzymes and gastrointestinal
hormones; Peristalsis, digestion, absorption and assimilation of proteins, carbohydrates
and fats, egestion, Calorific value of proteins, carbohydrates and fats (for box item- not to
be evaluated); Nutritional disorders: Protein Energy Malnutrion (PEM), indigestion,
constipation, vomiting, jaundice, diarrhea, Kwashiorkor.
Unit I B: Breathing and Respiration
Respiratory organs in animals; Respiratory system in humans; Mechanism of breathing
and its regulation in humans - Exchange of gases, transport of gases and regulation of
respiration; Respiratory volumes; Respiratory disorders: Asthma, Emphysema,
Occupational respiratory disorders – Asbestosis, Silicosis, Siderosis, Black Lung Disease
in coal miners.

Unit II : Human Anatomy and Physiology-II 22 Periods

Unit IIA Body Fluids and Circulation
Covered in I year composition of lymph and functions; Clotting of blood; Human circulatory
system – structure of human heart and blood vessels; Cardiac cycle, cardiac output, double
circulation; regulation of cardiac activity; Disorders of circulatory system: Hypertension,
coronary artery disease, angina pectoris, heart failure.
Unit IIB Excretory products and their elimination
Modes of excretion – Ammonotelism, Ureotelism, Uricotelism; Human excretory system –
structure of kidney and nephron; Urine formation, osmoregulation; Regulation of kidney
function –Renin-Angiotensin – Aldosterone system, Atrial Natriuretic Factor, ADH and
diabetes insipidus; Role of other organs in excretion; Disorders: Uraemia, renal failure,
renal calculi, nephritis, dialysis using artificial kidney.

305
 Zoology

Unit III : Human Anatomy and Physiology-III 20 Periods

Unit IIIA: Muscular and Skeletal system
Skeletal muscle – ultra structure; Contractile proteins & muscle contraction; Skeletal
system and its functions; Joints. (to be dealt with relevance to practical syllabus);
Disorders of the muscular and skeletal system: myasthenia gravis, tetany, muscular
dystrophy, arthritis, osteoporosis, gout, regormortis.
Unit III B: Neural control and co-ordination
Nervous system in human beings – Central nervous system, Peripheral nervous system
and Visceral nervous system; Generation and conduction of nerve impulse; Reflex action;
Sensory perception; Sense organs; Brief description of other receptors; Elementary
structure and functioning of eye and ear.

Unit IV : Human Anatomy and Physiology-IV 15 Periods

Unit IVA: Endocrine system and chemical co-ordination
Endocrine glands and hormones; Human endocrine system – Hypothalamus, Pituitary,
Pineal, Thyroid, Parathyroid, Adrenal, Pancreas, Gonads; Mechanism of hormone action
(Elementary idea only); Role of hormones as messengers and regulators; Hypo and Hyper
activity and related disorders: Common disorders –Dwarfism, acromegaly, cretinism,
goiter, exophthalmic goiter, diabetes, Addison’s disease, Cushing’s syndrome.(Diseases &
disorders to be dealt in brief).
Unit IVB: Immune system
Basic concepts of Immunology - Types of Immunity - Innate Immunity, Acquired Immunity,
Active and Passive Immunity, Cell mediated Immunity and Humoral Immunity, Interferon,
HIV and AIDS.

Unit V: Human Reproduction 22 Periods

Unit VA: Human Reproductive System
Male and female reproductive systems; Microscopic anatomy of testis & ovary;
Gametogenesis “ Spermatogenesis & Oogenesis; Menstrual cycle; Fertilization, Embryo
development up to blastocyst formation, Implantation; Pregnancy, placenta formation,
Parturition, Lactation (elementary idea).
Unit VB: Reproductive Health
Need for reproductive health and prevention of sexually transmitted diseases (STD); Birth
control – Need and methods, contraception and medical termination of pregnancy (MTP);
Amniocentesis; infertility and assisted reproductive technologies – IVF-ET, ZIFT, GIFT
(elementary idea for general awareness).

306
Unit VI: Genetics 20 Periods
Heredity and variation: Mendel’s laws of inheritance with reference to Drosophila.
(Drosophila melanogaster Grey, Black body colour; Long, Vestigial wings), Pleiotropy;
Multiple alleles: Inheritance of blood groups and Rh-factor; Co-dominance (Blood
groups as example); Elementary idea of polygenic inheritance; Skin colour in humans
(refer Sinnott, Dunn and Dobzhansky); Sex determination – in humans, birds, Fumea
moth, genic balance theory of sex determination in Drosophila melanogaster and honey
bees; Sex linked inheritance – Haemophilia, Colour blindness; Mendelian disorders in
humans: Thalassemia, Haemophilia, Sickle celled anaemia, cystiefibrosis PKU,
Alkaptonuria; Chromosomal disorders –Down’s syndrome, Turner’s syndrome and
Klinefelter syndrome; Genome, Human Genome Project and DNA Finger Printing,

Unit VII: Organic Evolution 15 Periods

Origin of Life, Biological evolution and Evidences for biological evolution (palaeontological,
comparative anatomical, embryological and molecular evidences); Theories of evolution:
Lamarckism (in brief), Darwin’s theory of Evolution -Natural Selection with example
(Kettlewell’s experiments on Biston bitularia), Mutation Theory of Hugo De Vries; Modern
synthetic theory of Evolution - Hardy-Weinberg law ; Types of Natural Selection; Gene
flow and genetic drift; Variations (mutations and genetic recombination); Adaptive
radiation – viz., Darwin’s finches and adaptive radiation in marsupials; Human
evolution; Speciation – Allopatric, sympatric; Reproductive isolation.

Unit VIII: Applied Biology 15 Periods

Apiculture; Animal Husbandry: Pisciculture, Poultry management, Dairy management;
Animal breeding; Bio-medical Technology : Diagnostic Imaging (X-ray, CTscan, MRI), ECG,
EEG; Application of Biotechnology in health: Human insulin and vaccine production ;
Gene Therapy; Transgenic animals; ELISA; Vaccines, MABs, Cancer biology, stem cells.

307
 Zoology

BOARD OF INTERMEDIATE EDUCATION

A.P., HYDERABAD
MODEL QUESTION PAPER ZOOLOGY-II (W.E.F 2013-14)

SECTION-A 10 X 2 =20
Answer all the questions (Very short answer type)
1. Define chyme and chyle ?
2. Name the muscles that help in breathing movement of man ?
3. How many pace makers are present in the human heart ? What are they ?
4. What is a sarcomere ?
5. Name the meninges of the mammalian nervous system from the outer most to
the inner most ?
6. Write the functions of Leydig cells and Sertoli cells ?
7. Distinguish between ‘Humoral immunity’ and ‘Cell mediated immunity’.
8. How is acromegaly caused ?
9. Write any four important advantages of poultry farming ?
10. What is the principle involved in X ray radiography.

SECTION-B 6 X 4 =24
Answer any Six Questions (Short Answer Type)
11. Explain the process of digestion in the stomach.
12. What are the bio-chemical changes that occur in a muscle during contraction.
13. Write a brief note on Morphological Evidences in favour of organic evolution?
14. Draw a diagram of internal structure of testis.
15. Write a brief note on different types of immunities ?
16. Explain the following phenomena.
a) Turners Syndrome.
b) Down Syndrome.
17. How does Hardy Weinberg principle explain equilibrium of allelic frequency ?
18. What is the importance of MRI in diagnostic imaging ?

SECTION-C 2 X 8 =16
Answer any Two Questions (Long Answer Type)
19. How does human heart function to pump blood to the body parts ?
20. Describe the female reproductive system with the help of a labelled diagram ?
21. Describe the determination of sex by Genetic Balance theory of Bridges in
Drosophila.

308