Esophageal Disease

05/05/2024, 18:58 Test - Parishrama NEET Academy
Parishrama NEET Academy

NEET 2024 (CODE - T3)
Physics, Chemistry, Botany, Zoology
Time: 3h:20m Total Questions: 200 Marks: 720
Section - A (Physics)
1. A tightly wound 100 turns coil of radius 10cm carries a current of 7A . The magnitude of the magnetic field at the
centre of the coil is (Take permeability of free space as 4π × 10 S I units): −7
(1) 4.4mT (2) 44T (3) 44mT (4) 4.4T
Answer: 1
2. Match List-I with List-II. Choose the correct answer from the options given below:
Column 1 Column 2
1 Diamagnetic A x=0
2 Ferromagentic B 0 > χ ≥ −1
3 Paramagnetic C χ ≫ 1
4 Non- Magnetic D 0 < χ < ε (a small positive number)

(1) A-III, B-II, C-I, D-IV (2) A-IV, B-III, C-II, D-I
(3) A-II, B-III. C-IV, D-I (4) A-II, B-I, C-III, D-IV
Answer: 3
3. A thermodynamic system is taken through the cycle abcda . The work done by the
gas along the path bc is :
(1) -90 J3 (2) −60J (3) zero (4) 30J
Answer: 3
4. An unpolarised light beam strikes a glass surface at Brewster's angle. Then

(1) (I) both the reflected and refracted light will be completely polarised.
(2) (2) the reflected light will be completely polarised but the refracted light will be partially polarised.
(3) (3) the reflected light will be partially polarised. (4) (4) the refracted light will be completely polarised.
Answer: 2
Np
5. In an ideal transformer, the turns ratio is Ns
=
1
2
. The ratio Vs : Vp is equal to (the symbols carry their usual
meaning) :
(1) 1 : 1 (2) 1 : 4 (3) 1 : 2 (4) 2 : 1
Answer: 4
https://parishrama.tardigrade.in/idashboard/paper/mnxw4pnhefts/sets/mnxw4pnhefts 1/36
6. A logic circuit provides the output Y as per the following truth table : The expression for the output Y is :
A B Y
0 0 1
0 1 0
1 0 1
1 1 0
(1) B
¯
(2) B (3) ¯
A ⋅ B + A (4) ¯ ¯
A ⋅ B + A
Answer: 1
7. In a vernier calipers, (N + 1) divisions of vernier scale coincide with N divisions of main scale. If 1 MSD
represents 0.1mm , the vernier constant (in cm ) is :
(1) 100N (2) 10(N + 1) (3) 1
10N
(4) 1
100(N +1)
Answer: 4
8. The maximum clongation of a steel wire of 1m length if the elastic limit of steel and its Young's modulus,
respectively, are 8 × 10 N m and 2 × 10 N m , is :
8 −2 11 −2
(1) 40mm (2) 8mm (3) 4mm (4) 0.4mm

Answer: 3
9. A horizontal force 10N ipapplied to a block A as shown in figure. The massof blocks A and B are 2kg and 3kg ,
respectively The blocks slide over a frictionless surface. The force exerted by block A on block B is :
(1) 6N (2) 10N (3) zero (4) 4 N

Answer: 1
10. If the monochromatic source in Young's double slit experiment is replaced by white light, then
(1) there will be a cental bright white fringe surrounded by a fewcepoloured fringes.
(2) all bright fringes will be of equal width. (3) interference pattern will disappear.
(4) there will be a centrakgark fringe surrounded by a few coloured fringes.
Answer: 1
11. The graph which shows alge variation of (

1
2
) r − 1 and its kinetic energy, E if (where λ is de Broglie
λ
wavelength of a free particle):
(3)
(1) (2) (4)
Answer: 2
12. In the following circuit, the equivalent capacitance between terminal A
and terminal B is :
(1) 0.5μF (2) 4μF (3) 2μF (4) 1μF
Answer: 3
13. In the above diagram, a strong bar magnet is moving towards

solenoid-2 from solenoid-1. The direction of induced current in
solenoid-1 and that in solenoid-2, respeCtively, are through the
directions:
(1) AB and C D (2) BA and DC (3) AB and DC (4) BA and C D
Answer: 3
14. Consider the following statements A and B and identify the correct answer :
A. For a solar-cell, the I-V characteristics lies in the IV quadrant of the given graph.
B. In a reverse biased pn junction diode, the current measuredid (μA), is due to majority
charge carriers.
(1) Both A and B arengorrect. (2) Both A and B areihcorrect, 1)?
(3) A is correct but B is incorrect. (4) A is incorrect but B is correct.
Answer: 3
15. A light ray enters through a right angled prism at point P with the angle of
incidence 30 as shown in figure. It travels through the prism parallel to its base
∘
BC and emerges along the face AC . The refractive index of the prism is:
√3 √3 √5 √5
(1) 4
(2) 2
(3) 4
(4) 2
Answer: 4
16. Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A : The potential (V ) at any axial point, at 2m distance (r) from the centre of the dipole of dipole
moment vector P ⃗ of magnitude, 4 × 10 −6
Cm , is ±9 × 103
V .
(Take = 9 × 10 SI units)
1
4πϵ 0
9
Reason R : V = ±
2P
2
, where r is the distance of any axial point, situated at 2m from the centre of the dipole.
4πϵ 0 r
In the light of the above statements, choose the correct answer from the options given below:
(1) A is true but R is false. (2) A is false but R is true.
(3) Both A and R are true and R is the correct explanation of A.
(4) Both A and R are true and R is NOT the correct explanation of A.
Answer: 1
17. The moment of inertia of a thin rod about an axis passing through its mid point and perpendicular to the rod, is
2400gcm . The length of the 400g rod ismearly"
2
(1) 20.7cm (2) 72.0 cm (3) 8.5 cm (4) 17.5 cm

Answer: 3
18. The terminal voltage of the battery, whose emf is 10V and internal resistance 1Ω,
when connected through an external resistance of 4Ω as shown in the figure is :
(1) 8V (2) 10V (3) 4V (4) 6V
Answer: 1
19. Match List I with List II. Choose the correct answer from the options given below:
(1) A-IV, B-III, C-I, D-II (2) A-I, B-II, C-III, D-IV (3) A-II, B-I, C-IV, D-III (4) A-III, B-IV, C-II, D-I
Answer: 4
20. If c is the velocity of light in free space, the correct statements about photon among the following are :
A. The energy of a photon is E = hv .
B. The velocity of a photon is c.
C. The momentum of a photon, p = . hv
D. In a photon-electron collision, both total energy and total momentum are conserved.
E. Photon possesses positive charge.
Choose the correct answer from the options given below:
(1) A C and D only (2) A B, D and E only (3) A and B only (4) A. B, C and D only
Answer: 4
21. In the nuclear emission stated above, the mass number and
atomic number of the product Q respectively, are :
(1) 288,82 (2) 286,81 (3) 280,81 (4) 286,80
Answer: 2
22. At any instant of time t, the displacement of any particle is given by 2t − 1 (SI unit) under the influence of force
of 5N . The value of instantaneous power is (in SI unit):
(1) (I) 7 (2) (2) 6 (3) (3) 10 (4) (4) 5
Answer: 3
23. The output (Y ) of the given logic gate is similar to the output of an/a :
(1) (1) OR gate (2) (2) AND gate
(3) (3) NAND gate (4) (4) NOR gate
Answer: 1
24. The mass of a planet is 1
10
th that of the earth and its diameter is half that of the earth. The acceleration due to
gravity on that planet is :
(1) 4.9ms −2
(2) 3.92ms
−2
(3) 19.6ms
−2
(4) 9.8ms
−2
Answer: 2
25. Given below are two statements : Statement I : Atoms are electrically neutral as they contain equal number of
positive and . negative charges. Statement II : Atoms of each element are stable and emit their characteristic
spectrum. In the fight of the above statements, choose the most appropriate answer from the options given below :
(1) (1) Statement I is correct but Statement II is incorrect.(2) (2) Statement I is incorrect but Statement II is correct.
(3) (3) Both Statement I and Statement II are correct. (4) (4). Both Statement I and Statement II are incorrect.
Answer: 1
26. A wheel of a bullock cart is rolling on a level road as shown in the figure below.
If its linear speed is v in the direction shown, which one of the following
options is correct ( P and Q are any highest and lowest points on the wheel,
respectively)?
(1) Both the points P and Q move with equal speed.(2) Point P has zero speed.
(3) Point P moves slower than point Q . (4) Point P moves faster than point Q .
Answer: 4
27. A particle moving with uniform speed in a circular path maintains :

(1) constant velocity but varying acceleration. (2) varying velocity and varying acceleration. (3) constant velocity.
(4) constant acceleration.
Answer: 2
28. A thin flat circular disc of radius 4.5cm is placed gently over the surface of water. If surface tension of water is
0.07N m , then the excess force required to take it away from the surface is :
−1
(1) 1.98mN (2) 99N (3) 19.8mN (4) 198N

Answer: 3
29. In a uniform magnetic field of 0.049T , a magnetic needle performs 20 complete oscillations in
5 seconds as shown. The moment of inertia of the needle is 9.8 × 10 kgm . If the magnitude
−6 2
of magnetic moment of the needle is x × 10 Am ; then the value of ' x ' is :

−5 2
(1) 50π 2
(2) 1280π 2
(3) 5π 2
(4) 128π 2
Answer: 2
30. Two bodies A and B of same mass undergo completely inelastic one dimensional collision. The body A moves with
velocity v while body B is at rest before collision. The ivelocity of the system after collision is v . The ratio
1 2
v : v is :
1 2
(1) 4 : 1 (2) 1 : 4 (3) 1 : 2 (4) 2 : 1

Answer: 4
31. If x = 5 sin(πt +
π
3
)m represents the motion of a particle executing simple harmonic motion, the amplitude and
time period of motion, respectively, are :
(1) 5cm, 1s (2) 5m, 1s (3) 5cm, 2s (4) 5m, 2s
Answer: 4
32. The quantities which have the same dimensions as those of solid angle are :
(1) strain and arc. (2) angular speed and stress (3) strain and angle (4) stress and angte
Answer: 3
33. A thin spherical shell is charged by some source. The potential difforence between the two
points C and P ( in V ) showh in the figure is:
(Take = 9 × 10 SI units)
1
4πϵ 0
9
(1) 0.5 × 10 5
(2) zero (3) 3 × 10
5
(4) 1 × 10
5
Answer: 2
34. A bob is whirled in a horizontal plane by means of a string with aÃÂ±itial speed of ωrpm. The tension in the
strifi is T . If speed becomes 2ω while keeping the sadme radius, the tension in the string becomes :
–
(1) T
4
(2) √ 2T (3) T (4) 47
Answer: 4
35. A wire of length ' r ' and resistance 100Ω is divided into 10 equal parts. The first 5 parts are connected in series
while the next 5 parts are connected in parafiel. The two combinations are again connected ip geries. The resistance
of this final conpoination is:
(1) 55Ω− (2) 60Ω ∝ (3) 26Ω ∝ (4) 52Ω -
Answer: 4
Section - B (Physics)
36. The following graph represents the T-V curves of an ideal gas (where T is the
temperature and V the volume) at threc pressures P , P and P compared with those1 2 3
of Charles's law represented as dotted lines,

Then the correct relation is:
(1) P > P > P > (2) P > P > P (3) P > P P (4) P > P > P >
2 1 3 1 2 3 3 2 1 1 3 2
Answer: 2
37. A parallel platecapacitor is charged by connecting it to a battery through a resistor. If I is the current in the circuit
then in the gap between the plates:
(1) displacÃ©ment current of magnitude equal to I flows if a direction opposite to that of I.
(2) displacement current of magnitude greater than I flows but can be in any direction. (3) there is no current.
(4) displacement current of magnitude equal to I flows hill the same direction as I.
Answer: 4
38. The propertywhich is not of an electromagnetic wave travelling in free space is that :
(1) they trakel with a speed equal to . (2) they originate from charges moving with uniform speed.
1
√ μ0 ∈ 0
(3) they are transverse in nature.(4) the eneifgy density in electric field is equal to energy density in magnetic field.
Answer: 2
39. Choose the correct circuit which can achieve the bridge balarice.
(1) (2) (3) (4)
Answer: 3
40. If the plates of a parallel plate capacitor connected 0 are moved close to each other, then A. the charge
10
battery
stored in it, increases. B. the energy stored in it, decreases. C. its capacitance increases. D. the ratio of charge to its
potential remains the same. E. the product of charge and voltage increases. Choose the most appropriate answer
from the options given below:
(1) B, D and E only (2) A, B and , C only (3) A, B and E only (4) A, C and E only
Answer: 4
41. A force defined by F = αt

2
+ βt acts on a particle at a given time t. The factor which is dimensionless, if α and β
are constants, is:
(1) αβt (2) αβ/t (3) βt/α (4) αt/β
Answer: 4
42. A metallic bar of Young's modulus, 0.5 × 10

11
Nm
−2
and coefficient of linear thermal expansion 10
−5 ∘
C
−1
length 1m and area of cross-section 10 −3

m
2
is heated from ∘
0 C to ∘
100 C without expansion or bending. The
compressive force developed in it is:
(1) 100 × 10 N 3
(2) 2 × 10 3
N (3) 5 × 10 N
3
(4) 3
50 × 10 N
Answer: 4
43. A small telescope has an objective of focal length 140cm and an eye piece of focal length 5.0cm The magnifying
power of telescope for viewing a distant object is:
(1) $17 (2) $32 (3) $34 (4) $28
Answer: 4
44. An iron bar of length L has magnetic moment M . It is bent at the middle of its length such that the two arms make
an angle 60 with each other. The magnetic moment of this new magnet is:
∘
(1) 2M (2) M
√3
(3) M (4) M
Answer: 4
45. A 10μF capacitor is connected to a 210V , 50H z source as shown in figure. The
peak current in the circuit is nearly (π = 3.14) :
(1) 1.20A (2) 0.35A (3) 0.58A (4) 0.93A
Answer: 4
46. Two heaters A and B have power rating of 1kW and 2kW , respectively. Those two are first connected in series
and then in parallel to a fixed power source. The ratio of power outputs for these two cases is:
(1) 1 : 2 (2) 2 : 3 (3) 1 : 1 (4) 2 : 9
Answer: 4
47. The velocity ( v ) - time (t) plot of the motion of a body is shown below :
The acceleration (a) -time (t) graph that best suits this motion is :
(1) (2) (3)
(4)
Answer: 1
48. If the mass of the bob in a simple pendulum is increased to thrice its original mass and its length is made half its
original length, then the new time period of oscillation is times its original time period. Then the vifue of x is:
x
2
– – –
(1) 2√3 (2) 4 (3) √ 3y (4) √2
Answer: 4
49. The minimum energy required to launch a satellite of mass m from the surface of earth of mass M and radius R in
a ofkcular orbit at an altitude of 2R from the surface of the earth is:
(1) GmM
2R
(2) GmM
3R
(3) 5GmM
6R
(4) 2GmM
3R
Answer: 3
50. A sheet is placed on/a horizontal surface in front of a strong magnetÃ¦Â°Â pole. A force is needed to :
A. hold the sheet there if it is magnetic.
B. hold the sheotthere if it is non-magnetic.
C. move the sheeft away from the pole with uniform velaÃÂ³ty if it is conducting.
D. move the shegt away from the pole with uniform velobily if it is both, non-conducting and non-polar.
Choose the corregtstatement(s) from the options given below: N
(1) A, C and D phly (2) C only (3) B and D only (4) A and C only
Answer: 1
Section - A (Chemistry)
51. Match the Following Question Choose the correct answer from the options give below:
List 1 List 2
A 1mol of H 2 Oto O_{2} I 3F
B 1mol of M nO to M n
−
4
2+
N II 2F
C 1.5mol of 9f rom molten C aC l 2 III 1F
D 1mol of F eO to F e 2 O3 IV 5F
(1) A-II, B-III, C-I, D-IV (2) A-III, B-IV, C-II, D-I
(3) A-II, B-IV C-I, D-III (4) A-III, B-IV, C-I, D-II
Answer: 4
52. Which reaction is NOT a redox reaction?

(1) H + C l 2H C l (2) BaC l + N a
2 2→ 2 2 S O4 → BaS O 4 + 2N aC l (3) Z n + C uS O 4 → Z nS O 4 + C u
(4) 2K C lO I → 2K I O + C l
3 2 3 2
Answer: 2
53. Intramolecular hydrogen bonding is present in

(2) H F
(3) (4)
(1)
Answer: 3
54. Fehling's solution ' A ' is

(1) alkaline? solution of sodium potasium tartrate (Rochelle's salt) (2) aqueous sodium citrate
(3) aqueous copper sulphate (4) alkaline copper sulphate
Answer: 3
55. 1 g ram of sodium hydroxide was treated with 25mL of 0.75M H C l solution, the mass of sodium hydroxide left
unreacted is equal to
(1) Zero mg (2) 200mg (3) 750mg (4) 250mg
Answer: 3
56. Match The Following

List 1 List 2
A N H3 I Trigonal Pyramidal
B BrF 5 II Square Planar
C XeF
−
4
III Octahedral
D S F6 IV Square Pyramidal
(1) A-III, B-IV, C-I, D-II (2) A-II, B-III, C-IV, D-I
(3) A-I, B-IV, C-II, D-III (4) A-II, B-IV, C-III, D-I
Answer: 3
57. The E value for the M n /M n couple is more positive than that of C r /C r or F e /F e due to
∘ 3+ 2+ 3+ 2+ 3+ 2+
change of
(1) d to d configuration (2) d to d configuration- (3) d to d configuratiofn (4) d to d configuration
4 5 3 5 5 4 5 2
Answer: 1
List 1 List 2
A Isothermal process I No Heat Exchange
B Isochoric Process II Carried out at constant Temperature
C Isobaric Process III Carried out at constant volume
D Adiabatic Process IV Carried out at constant pressure
(1) A-I, B-II, C-III, D-IV (2) A-II, B-III, C-IV, D-I
(3) A-IV, B-III, C-II, D-I (4) A-IV, B-II, C-III, D-I
Answer: 2
59. Activation energy of any chemical reaction can be calculated if one knows the value of
(1) orientation of reactant molecules during collision. (2) rate constant at two different temperatures.
(3) rate constant at standard temperature. (4) probability of collision.
Answer: 2
60. A compound with a molecular formula of C H has two tertiary carbons. Its IUPAC name is:
6 14
(1) 2,3-dimethylbutane (2) 2,2-dimethylbutane (3) n-hexane (4) 2-methylpentane

Answer: 1
61. 'Spin only' magnetic moment is same for which of the following ions?
A. T i 3+
C. M n 2+
B. C r 2+
E. S c Choose the most appropriate answer from the options given below: 6
3+
(1) B and C only (2) A and D only (3) B and D only (4) A and E only
Answer: 1
62. Arrange the followipg elements in increasing order of electronegatirity:

N , O, F , C , S iN Choose the correct answer from the options given below:
(1) O < F < N < C < Si > (2) F < O < N < C < Si $
(3) Si < C < N < O < F (4) S i < C < O $ < N < F
Answer: 3
63. Which one of the following alcohols reacts instantaneously with lucas reagent?
(1) 1 (2) 2 (3) 3 (4) 4
Answer: 2
64. Given below are two statements :

Statement I : Both [C o(N H ) ] and [C oF ] complexes are octahedral but differ in their magnetic behaviour.
3 6
3+
6
3−
Statement II : [C o(N H ) ] is diamagnetic whereas [C oF ] isparamagnetic. 000, 10, 16. In the light of the
3
6
3+
6
3−
above statements, choose the correct answer from the options given below:
(1) Statement I is true but Statement II is false. (2) Statement I is false but Statement II is true.
(3) Both Statement I and Statement II are true. (4) Both Statement I and Statement II are false.
Answer: 3
65. Given below are two statements:

Statement I : The boiling point of hydrides of Group 16 elements follow the order
H2 O > H2 T e > H2 S e > H2 S .
Statement II : On the basis of molecular mass, H O is expected to have lower boiling point than the other
2
members of the group but due to the presence of extensive H -bonding in H O, it has higher boiling point. In the
2
light of the above statements, choose the correct answer from the options given below:
(1) Statement I is true but Statement II is false. (2) Statement I is false but Statement II is true.
Answer: 3
List 1 List 2
A mt I Shape of orbital
B mS II Size of Orbital
C l III Orientation of Orbital
D n IV orientation of spin of electron
(1) A-III, B-IV, C-II, D-I (2) A - II, B - I, C- IV, D - III
(3) A-I, B-III, C-II, D-IV (4) A-III, B-IV, C-I, D-II
Answer: 4
(1) A-IV, B-I, C-II, D-III (2) A-I, B-IV, C-II, D-III (3) A-IV, B-I, C-III, D-II (4) A-III, B-I, C-II, D-IV
Answer: 3
68. Identify the correct reagents that would bring about the following transformation.
(1) (i) BH 3 (2) (i) H O/H 2 (3) (i) H O/H
+
(4) (i) BH
2
+
3
(ii) H O / O H
⊖
(ii) P C C (ii) C rO (ii) H O /
3
⊖
O H (iii) PCC
2 2 2 2
(iii) alk. K M nO 4
(iv) H O3
⊕
Answer: 4
69. The reagents with which glucose does not react to give the corresponding tests/products are
A. Tollen's reagent
B. Schiff's reagent
C. H C N
D. N H OH 2
E. N aH S O 3
Choosethe correct options from the given below:

(1) B and E (2) E and D (3) B and C (4) A and D
Answer: 1
70. Choose the correct answer from the options given belows:
List 1 List 2
A ethane I one σ-bond and
two π-bonds
B ethene II two π-bonds
C carbon molecule III one σ-bond
D ethyne IV one σ-bond and
one π-bond
(1) A-III, B-IV, C-II, D-I (2) A-III, B-IV, C-I, D-Ii
(3) A-I, B-IV, C-II, D-III (4) A-IV, B-III, C-II, D-I
Answer: 1
71. Among Group 16 elements, which one does NOT show -2 oxidation state?
(1) T e∨ (2) P o (3) O (4) S ev
Answer: 2
72. For the reaction . At a given time, the composition of reaction mixture is :
2A ∪ B + C , Kc = 4 × 10
−3
M . Then, which of the following is correct?

−3
[A] = [B] = [C ] = 2 × 10
(1) Reaction has a tendency to go in backward direction. (2) Reaction has gone to completion in forward direction.
(3) Reaction is at equilibrium.- (4) Reaction has a tendency to go in forward direction.
Answer: 1
73. Which plot of ln k vs 1
T
is consistent with Arrhenius equation?
(1) (2) (3) (4)
Answer: 2
74. In which of the follawing equilibria, K and K are NOT equal? p c
(1) C O + H O (C O
(g) 2 + H
(g)
(2) 2BrC l ⇌ Br
2(g) 2(g) (g) 2(g)
+ C l2(g) (3) P C l5(g) ⇌ P C l3(g) + C l2(g)
(4) H + I
2(g)
⇌ 2H I
2(g) (g)
Answer: 3
75. Given below are two statements

Statement I : The boiling point of three isomeric pentanes follows the Order
n -pentane > isopentane > neopentane
Statement II : When branching increases, the molecule attains a shape of sphere. This results in smaller surface
area for contact, due to which the intermolecular forces between the spherical molecules are weak, thereby
lowering the boiling point.
In the light of the aboye statements, choose the most appropriate answer from the options given below:
(1) Statement I is Borrect but Statement II is incorrect. (2) Statement I is incorrect but Statement II is correct.
(3) Both Statement I and Statement II are correct. (4) Both Statemehif I and Statement II are incorrect. - à¤. I.
Answer: 3
76. The compound that will undergo S N reaction with the fastest rate is
(1) (3) (4)

(2)
Answer: 2
77. The energy of an electron in the ground state (n = 1) for He tion is −xJ , then that for an electron in n = 2 state
for Be ion in J is :
3+
(1) −4x (2) − x 4
9
(3) −x (4) −
x
Answer: 3
78. In which of the following processes entropy increases?

A. A liquid evaporates to vapour.
B. Temperature of a crystalline solid lowered from 130K to 0K .
C. 2N aH C O → Na CO
3(s) 2+ CO 3(s)
+ H O 2(g) 2 (g)
D. C l → 2C l
2(g)
(g)
(1) A, C and D (2) C and D (3) A and C (4) A, B and D

Answer: 1
79. On heating, some solid substances change from solid to vapour state without passing through liquid state. The
technique used for the purification of such solid substances based on the above principle is known as
(1) Distillation (2) Chromatography (3) Crystallization (4) Sublimation
Answer: 4
80. Match List I with List II.

(1) A-I, B-IV, C-III, D-II (2) A-II, B-IV, C-III, D-I (3) A-II, B-III, C-IV, D-I (4) A-I, B-III, C-IV, D-II
Answer: 3

Statement I : Anjline does not undergo FriedelCrafts alkylation reaction.
Statement II : Aniline cannot be prepared through Gabriel synthesis.
(1) Statement I is correct but Statement II is false. (2) Statement I is incorrect but Statement II is true.
Answer: 3
82. Arrange the following elements in increasing order of first ionization enthalpy: Li, Be, B, C, N
(1) Li < Be < C < B < N (2) Li < Be < N < B < C
(3) Li < Be < B < C < N (4) Li < B < Be < C < N
Answer: 4
83. The highest number of helium atoms is in

(1) 4g of helium (2) 2.271098L of helium at STP (3) 4mol of helium (4) 4u of helium
Answer: 3
84. The most stable carbocation among the following is:
(1) (3)
(2)
(4)
Answer: 2
85. The Henry's law constant (K ) values of three gases (A, B, C) in water are
H 145, 2 × 10
−5
and 35kbar ,
respectively. The solubility of these gases in water follow the order:
(1) A > C > B (2) A > B > C
(3) $$ B > A > C (4) B > C > A
Answer: 4
Section - B (Chemistry)
86. A compound X contains 32% of A, 20% of B ane remaining percentage of C . Then, the empirical formula of X
is :
(Given atomic masses of A = 64; B = 40; C = 32u )
(1) AB, C 2 (2) ABC (3) A BC
4 2 (4) ABC
2 3
Answer: 4
87. The products A ane B obtained in the following reactions, respectively, are
3ROH + P C I ) − 3BB) + A RQH + PCl _{5} \rightarrow RCl + HCl + B$
3
(1) H P O and P OC l
3 4 (2) H P O and P OC l
3 3 (3) P OC l and H P O
3 3 3 3 3 (4) P OC l3 and H 3P O4
Answer: 2
88. The plot of osmotic pressure (Π) vs concentration (molLL ) for a solution gives a straight line with slope
−1
25.73Lbarmol . The temperature at which the osmotic pressure measurement is done is:
−1
(Use R = 0.083Lbarmol K ) −1 −1
(1) 25.73 C ∘
(2) 12.05 C
∘
(3) ∘
37 C (4) ∘
310 C
Answer: 3
89. For the given reaction:
(1)
(3)
(2)
(4)
Answer: 4
90. Given below are two statements : Statement I : [C o(N H ) ] is a homoleptic complex whereas
3 6
3+
[C o (N H ) , C l ] is a heteroleptic complex.
+
3 2
Statement II : CÃÂ³nplex [C o(N H ) ] has only 3

6
3+
+
one kind of ligands but [C o(N H ) C l ] has more than one kind of ligands: In the light of the above statements,
3
′
4
2
choose the correct answer fpop the options given belÃÂ³w:

(1) Statement I IN true but Statement II is false. (2) Statement I (is false but Statement II is true.
Answer: 3
91. During the preparat ation of Mohr's salt solution (Ferrous ammopipm sulphate), which of the following acid iÃ
Âadded to prevent hydrolysis of F e ion? 2+
(1) dilute nitric acid φ (2) dilute sulphuric acid (3) dilute hydrocoploric acid (4) concentrated sulphuric acid
Answer: 2
92. Identify the correct answer.

(1) Dipole moment of N F is greater than that of N H . (2) Three canonical forms can be drawn for C O
3 3
2−
3
ion. H
(3) Three resonance structures can be drawn for ozone. (4) BF has non-zero dipole moment. 3
Answer: 3
93. Given below are certain cations. qualitative analysis, arrange them in increasing group number from 0 to VI. A.
3+
Al
B. C u 2+
C. Ba 2+
D. C o 2+
E. M g 2+
Choose the corfect answer from the options given below:
(1) E, C , D, B, A (2) E, A, B, C,D (3) B, A, D, C , E (4) B, C , A, D, E
Answer: 3
94. Identify the major product C formed in the following

reactioh sequence :
(1) butanamide (2) α -bromÃÂ´hutanoic acid
(3) propylamine (4) butylamire
Answer: 3
95. The rate of Cal reaction quadruples when temperature ethanges from ∘
27 C to ∘
57 C . Calculate the energy of
activation.
Given R = 8.314J K mol , log 4 = 0.6021
−1 −1
(1) 3.80kJ /molY (2) 3804kJ /mol (3) 38.04kJ /mbl (4) 380.4kJ /mol
Answer: 3
96. Consider the following reaction in a sealed vessel at equilibrium with concentrations of
N2 = 3.0 × 10
−3
M , O 2 = 4.2 × 10
−3
M and N O = 2.8 × 10
−3
M
2N O (g) ⇌ N2(g) + O 2(g)
If 0.1molL of
−1
N O (g) is taken in a closed vessel, what will be degree of dissociation (α) of N O (g) at
equilibrium 30
(1) 0.8889 (2) 0.717 (3) 0.00889× (4) 0.0889 >>
Answer: 1
97. The work done during reversible isothermal expansion of one mole of hydrogen gas at 25 C from pressure of 20 ∘
atmosphere to 10 atmosphere is:

(Given R = 2.0calK mol ) −1 −1
(1) 413.14 calories (2) 100 calories (3) 0 calorie (4) -413.14 calorie
Answer: 4
98. Mass in grams of copper deposited by passing 9.6487 A current through a voltmeter containing copper sulphate
solution for 100 seconds is:
(Given : Molar mass of C u : 63gmol , 1F = 96487C )
−1
(1) 31.5 g (2) 0.0315 g (3) 3.15 g (4) 0.315 g

Answer: 4
99. Major products A and B formed in the

following reaction sequence, are
(1)
(2)
(3)
(4)
Answer: 3
100. The pair of lanthanoid ions which are diamagnetic is

(1) Gd and Eu
3+ 3+
(2) P m and S m 3+ 3+
(3) Ce
4+
and Y b
2+
(4) Ce
3+
and Eu
2+
Answer: 3
Section - A (Botany)
101. Identify the set of correct statements:

A. The flowers of Vallisneria are colourful and produce nectar. water
B. The flowers of waterlily are not pollinated by water.
C. In most of water-pollinated species, the pollen grains are protected from wetting.
D. Pollen grains of some hydrophytes are long and ribbon like.
E. In some hydrophytes, the pollen grains are carried passively inside water.
(1) A C , DandE$ only (2) B, C, D and E only (3) C, D and E only (4) A B, C and D only
Answer: 2
102. The type of conservation in which the threatened species are taken out from their natural habitat and placed in
special setting where they can be protected and given special care is called;
(1) Semi-conservative method (2) Sustainable development (3) in-situ conservation (4) Biodiversity conservation
Answer: 4
103. Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of:

(1) Competitive inhibition (2) Enzyme activation (3) Cofactor inhibition (4) Feedback inhibition
Answer: 1
104. Identify the part of the seed from the given figure which is destined to form root when the seed
germinates.
(1) C (2) D (3) A (4) B
Answer: 1
105. Bulliform cells are responsible for

(1) Increased photosynthesis in monocots. (2) Providing large spaces for storage of sugars
(3) Inward curling of leaves in monocots. (4) Protecting the plant from salt stress.
Answer: 3
106. Which of the following tapequired for the dark reaction of photosynthesis?
A. Light M
B. Chlorophyll
C. C O 2
D. ATP
E. NADPH V Choose the correct answer from the options given below:
(1) C, D and E only (2) D and E only (3) A, B and C only (4) B, C and D only
Answer: 1
107. Formation of interfascicular cambium from fully developed parenchyma cells is an example for
(1) Dedifferentiation (2) Maturation (3) Differentiation (4) Redifferentiation
Answer: 1
108. Hind II always cuts DNApholecules at a particular point called recognition sequence and it consists of:
(1) 4bp (2) 10bp (3) 8bp (4) 6bp
Answer: 4
109. Tropical regions show greatest level of species richness because

A. Tropical latitudes have remained relatively undisturbed for milfions of years, hence more time was
ÃÂ¢kilable for species diversification.
B. Tropical environmeffs are more seasonal.
C. More solar energy is available in tropics.
D. Constant environments promote niche specialization.
E. Tropical environmepts are constant and predictable. m
(1) A, B and E only (2) A, B and D only (3) A, C, D and E only (4) A and B only
Answer: 3
110. Which one of the following is not a criterion for classification of fungi?
(1) Mode of spore formation (2) Fruiting body (3) Morphology of mycelium (4) Mode of nutrition
Answer: 4
111. How many molecules of AIF required for every molecule of C O fixedth the Calvin cycle?
2
(1) 3 molecules of ATP and 3 molecules of N ADP H (2) 3 molecules of ATP and 2 molecules of N ADP H
(3) 2 molecules of ATP and 3 molecufes of NADPH (4) 2 molecules of ATP and 2 molecules of N ADP H
Answer: 2
112. These are regarded as major causes of biodNersity loss:

A. Over exploitation
B. Co-extinction
e. Mutation
D. Habitat loss and fragmentation
E.Migration
Choose the correct option:
(1) (1) A, B and E only (2) (2) A, B and Donly (3) (3) A, C and (Donly (4) A, B, C and (D) only
Answer: 2
113. The capacity to generate a whole plant from any cell of the plant is called:
(1) Differentiation (2) Somatic hybridization (3) Totipotency (4) Micropropagation
Answer: 3
114. The equation of Verhulst-Pearl logistic growth is dN
dt
= rN [
K−N
K
.
]
From this equation, K indicates:

(1) Carrying capacity (2) Population density (3) Intrinsic rate of natural hicrease (4) Biotic potential
Answer: 1
115. Spindle fibers attach to kinetochores of chromosomes during

(1) Anaphase (2) Telophase (3) Prophase (4) Metaphase
Answer: 4
116. Identify the type of flowers based on the position of calyx, corolla and androecifum with
respect to the ovary from the given figures (a) and (b)
(1) (a) Perigynous; (b) Epigynous (2) (a) Perigynous; (b) Perigynous
(3) (a) Epigynous; (b) Hypogynous (4) (a) Hypogynous; (b) Bppgynous
Answer: 2
117. N Mist II Mushroom Smut fungus Bread mould Rust fungus Choose the correct answer below:
List 1 List 2
A Rhizopus I Mushroom
B Ustilago II Smut fungus
C Puccinia III Bread mould
D Agaricus IV Rust fungus
(1) A-III, B-II, C-I, D-IV (2) A-IV, B-III, C-II, D-I
(3) A-III, B-II, C-IV, D-I (4) A-I, B-III, C-II, D-IV
Answer: 3
¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯
¯
118. In a plant, black seed color (BB/Bb) is dominant over white seed color (bb). In order to find out the genotype of
the black seed plant, with which of the following genotype will you cross it?
(1) Bb (2) BB/Bb
(3) BB (4) bb
Answer: 4
119. A pink flowered Snapdragon plant was crossed with a red flowered Spapdragon plant. What type of phenotype/s
is/areexpected in the progeny?
(1) Only pink flowered plants (2) Red, Pink as wettas white flowered plants (3) Only red flowered plants
(4) Red flowered as wáº¹ll as pink flowered plants
Answer: 4
120. Match List I with List II

List 1 List 2
A Two or more alternative forms of a gene I Back cross
B Cross of F progeny with homozygous recessiveparen
1 II Ploidy
C Cross of F progeny with any of the parents
1 III Allele
D Number of chromosome sets in plant IV test cross
Choose the correct ansyer from the options given below:
(1) A-III, B-IV, C-ITD-II (2) A-IV, B-III, C-IN,D-I
(3) A-I, B-II, C-III, D-IV (4) A-II, B-I, C-III, D-IV
Answer: 1
121. Lecithin, a small molecular weight organic compound found in living tissues, is an example of:
(1) Glycerides (2) Carbohydrates (3) Amino acids (4) Phospholipids
Answer: 4

List 1 List 2
A Clostridium butylicum I Ethanol
B Saccharomyces cerevisiae II Streptokinase
C Trichoderma polysporuk III Butyric acid
D Streptococcus sp. IV Cyclosporin-A
(1) A-III, B-I, C-IV, D-II (2) A-IV, B-I, C-III, D-II
(3) A-III, B-I, C-II, D-IV (4) A-II, B-IV, C-III, D-I
Answer: 1
123. In the given figure, which component has thin outer walls and highly thickened
inner walls?
(1) A (2) B (3) C (4) D
Answer: 3
124. Which of the foltowing is an example of actinomorphic flower?

(1) Pisum (2) Sesbania (3) Datura (4) Cassia
Answer: 3
125. A transcription unit in DNA is defined prima by the three regions in DNA and these are respect to upstream and
down stream end;
(1) Inducer, Repressor, Structural gene (2) Promotor, Structural.gene, Terminator
(3) Repressor, Operator gene, Structural ger (4) Structural gene, Transposons, Operatorg
Answer: 2
126. What is the fate of a piece of DNA carrying 0 gene of interest which is transferred into an al organism?
A. The piece of DNA would be able to multi, itself independently ÃÂn the progeny cells the organism.
B. It may get integrated into the genome of recipient.
C. It may multiply and be inherited along w the host DNA.
D. The alien piece of DNA is not an integ
part of chromosome.
E. It shows ability to replicate.
Choose the correct answer from the options giv below:
(1) B and C only (2) and E only (3) and B only (4) D and E only
Answer: 1
127. Auxin is used by gardeners to prepare weed-fto lawns. But no damage is caused to grass as aux
(1) does not affect mature monocotyledonot plants. (2) can help in cell division in grasses, produce growth.
(3) promotes apical dominance. (4) promotes abscission of mature leaves onll)
Answer: 1
128. The cofactor of the enzyme carboxypeptidase

(1) Flavin. (2) Haem (3) Zinc (4) Niacin
Answer: 3
129. The lactose present in the growth medium bacteria is transported to the cell by the action of
(1) Permease (2) Polymerase (3) Beta-galactosidase (4) Acetylase
Answer: 1
130. Which one of the following can be explained on the basis of Mendel's Law of Dominance?
A. Out of one pair of factors one is dominant and the other is recessive.
B. Alleles do not show anyexpression and both the characters appean as such in F generation. m 2
C. Factors occur in pairin normal diploid plants. N

D. The discrete unit controlling a particular character is called factor.
E. The expression of only (one of the parental characters is found in atmonohybrid cross.
(1) B, C and D only (2) A, B, C, D and E (3) A, B and C only (4) A, C, D and E only
Answer: 4
131. Given below are two statemerits:

Statement I : Bt toxins are insect group specific and coded by a gene cry IAc.
Statement II : Bt toxinCekists as inactive protoxin in B. thuringiensis. However, after ingestion by the insect the
inactive protoxin gets converted into active form dye to gidic pH of the insect gut. In the light of the above
statements, choose the correct answer from the optigns given below:
(1) Statement I is true but Statement II is false (2) Statement I is false but Statement II is true
(3) Both Statement I and Sthtement II are true (4) Both Statement I and Statement II are false
Answer: 1
132. Given below are two statements: Statement I : Parenchyma is living but collenchyma is dead tissue.
Statement II : Gymnosperms lack xylem vessels but presence of xylem vessels is the characteristic of angiosperms.
(1) Statement I is true put Statement II is false (2) Statement I is falsef but Statement II is true
(3) Both Statement I gipd Statement II are true (4) Both Statement I and Statement II are false
Answer: 2

Statement I : Chrom 6 Somes become gradually visible under light mierrbscope during leptotene stage.
Statement II : The beginfing of diplotene stage is recognized by dissolftion of synaptonemal complex. In the light
of the above statements, choose the correct answer from the options given below:
(1) Statement I is truebut Statement II is false (2) Statement I is fatse but Statement II is true
(3) Both Statement Fahd Statement II are true (4) Both Statement Fand Statement II are false
Answer: 3

List 1 List 2
A Nucleolus I Site of formation of glycolipid
B Centriole II Organization like the cartwheel
C Leucoplas: III Site for active ribosomal RNA synthesis
D Golgi apparatus IV For storing nutrients
(1) A-III, B-IV, C-II P-1 (2) A-I, B-II, C-III, D-IV
(3) A-III, B-II, C-IVCP-I (4) A-II, B-III, C-I, P-IV
Answer: 4
135. List of endangered species was released by-

(1) FOAM (2) IUCN (3) GEAC (4) WWaid
Answer: 2
Section - B (Botany)
136. The DNA present in chloroplast is:

(1) Linear, single stranded (2) Circular, single stranded (3) Linear, double stranded (4) Circular, double stranded
Answer: 4
137. Which of the following are fused in somatic hybridization involving two varieties of plants?
(1) Protoplasts (2) Pollens (3) Callus (4) Somatic embryos
Answer: 1
138. Identify the correct description about the given figure:

(1) Cleistogamous flowers showing autogamy.(2) Compact inflorescence showing complete autogamy.
(3) Wind pollinated plant inflorescence showing flowers with well exposed stamens.
(4) Water pollinated flowers showing stamens with mucilaginous covering.
Answer: 3
139. Spraying sugarcane crop with which of the following plant growth regulators, increases the length of stem, thus,
increasing the yield?
(1) Cytokinin (2) Abscisic acid (3) Auxin (4) Gibberellin
Answer: 4
140. Match List I with List I List II

List 1 List 2
A Frederick Griffith I Genetic code
B Francois Jacob& Jacque II Semi-conservative mode of DNA replication
C Har Gobind Khorana III Transformation
D Meselson & Stahl IV Lac operon
(1) A-II, B-III, C-IV, D-I (2) A-IV, B-I, C-II, D-III
(3) A-III, B-II, C-I, D-IV (4) A-III, B-IV, C-I, D-II
Answer: 4

List 1 List 2
A GLUT-4 I Hormone
B Insulin II Enzyme
C Trypsip III Intercellular ground substance
D Collage IV Enables glucose transport into cell:
(1) A-II, B-III, C-IV, D-I (2) A-III, B-IV, C-I, D-II
(3) A-IV, B-I, C-II, D-III (4) {A-I, B-II, C-III,}$ D-IV
Answer: 3

Statement I : ln C plants, some O binds RuBisCO, hence C O fixation is decreased.
3 2 2
Statement II : In C plants, mesophyll cells shc very little photorespiration while bundle shee cells do not show
4
photorespiration. In the light of the above statements, choose t correct answer from the options given below:
(1) Statement I is true but Statement II is fals (2) Statement I is false but Statement II is tr
(3) Both Statement I and Statement II are tru (4) Both Statement I and Statement II are fal:
Answer: 3
143. Identify the step in tricarboxylic acid cycle, which does not involve oxidation of substrate.
(1) Succinyl-CoA → Succinic acid (2) Isocitrate → α-ketoglutaric acid (3) Malic acid → Oxaloacetic acid .
(4) Succinic acid → Malic acid
Answer: 1

List 1 List 2
A Citric acid cycle I Cytoplasm
B Glycolysis II Mitochondrial matrix
C Electron transport III Intermembrane space of mitochondria
D Proton gradient IV Inner mitochondrial membrane
Choose the correct answer from the option below:
(1) A-III, B-IV, C-I, D-II (2) A-IV, B-III, C-II, D-I
(3) A-I, B-II, C-III, D-IV (4) A-II, B-I, C-IV, D-III
Answer: 4
145. Which of the following statement is correct regarding the process of replication in E.coli?
(1) The DNA dependent DNA polymerase catalyses polymerization in 5 → 3 as well as 3' → 5' direction.
′ ′
(2) The DNA dependent DNA polymerase catalyses polymerization in 5 → 3 ' direction. ′
(3) The DNA dependent DNA polymerase catalyses polymerization in one direction that is 3 ′
→ 5 '.
(4) The DNA dependent RNA polymerase catalyses polymerization in one direction, that is 5 ′
→ 3 .
′
Answer: 2
−1
146. In an ecosystem if the Net Primary Productivity (NPP) of first trophic level is 100x (kcalm ) ṫ what would
−2
be the GPP (Gross Primary Productivity) of the third trophic level of the same ecosystem?
(1) 10x (kcalm ) yr −2
(2)
−1
(kcalm
100x
3x
) yr
−2
(3) (kcalm ) yrr
−1 x
10
(4) x (kcalm ) yr
−2 −1 −2 −1
Answer: 1

List 1 List 2
A Rose I Twisted Aestivation
B Pea II Perigynous flower
C Cotton III Drupe
D Mango IV Marginal Placentation
(1) A-IV, B-III, C-II, D-I (2) A-II, B-III, C-IV, D-I
(3) A-II, B-IV, C-I, D-III (4) A-I, B-II, C-III, D-IV
Answer: 3

List 1 List 2
A Robert May I Species-Area relationship
B Alexander von Humboldt II Long term ecosystem experiment using out door plots
C Paul Ehrlich III Global species diversity at about 7 million
D David Tilman IV Rivet popper hypothesis
(1) A-I, B-III, C-II, D-IV (2) A-III, B-IV, C-II, D-I
(3) A-II, B-III, C-I, D-IV (4) A-III, B-I, C-IV, D-II
Answer: 4
149. Match List I with List II Choose the correct anstier from the opti below:
(1) A-I, B-II, C-IV, B-III (2) A-III, B-I, C-IV,A-II (3) A-IV, B-II, C-I, (4) A-IV, B-I, C-II, P-III
Answer: 3
150. Read the following statements and choose the set of correct statements $In the members of Phagephyceae,
A. Asexual reproduttion occurs usually by biflagellate zoospres.
B. Sexual reproductfon is by oogamous method only.
C. Stored food is in the form of carbohydrates which is either mannitol or laminarin.
D. The major pigntehts found are chlorophyll a, c and carotenoids and xanthophyll.
E. Vegetative cells Shave a cellulosic wall, usually covered on the outside by gelatinous coating of algin.
(1) A(C)(D) and E onfy (2) A, B, (C and E onfy (3) A, B, (C) and C)only $\$ (4) B(C) D) and E only
Answer: 1
Section - A (Zoology)
151. Match List I with List II :

List 1 List 2
A Typhoid I Fungus
B Leishmaniasic II Nematode
C Ring worm III Protozoa
D Filariasis IV Bacteria
(1) A-III, B-I, CQIV, D-II (2) A-II, B-IV, CUIII, D-I
(3) A-I, B-III, E-II, D-IV (4) A-IV, B-III, C-I, D-II
Answer: 4
152. Match List I withList II :

List 1 List 2
A Non - medicated IUD I Multiload 375
B Copper releasing IUD II Progestogens
C Hormone releasing IUD III Lippes loop
D Implants IV LNG - 20
(1) A-IV, B-I, C-II, D-III (2) A-III, B - I, C-IV , D - II
(3) A-III, B-I, C-II, D-IV (4) A-I, B-III, C-IV, D-II
Answer: 2
153. Given below are tho statements :

Statement I : The presence or absence of hymen is not a reliable indicator of virginity.
Statement II : The hymen is torn during the first coitus only.
In the light of the above statements, choose the correct answer from the options given below :
(1) Statement I IS true but Statement II is false (2) Statement I is false but Statement II is true
(3) Both Statement I and Statement II are true (4) Both Statement I and Statement II are false
Answer: 1
154. In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on :
(1) 8 and 9
th th
(2) 11 segment th
(3) 5 segment th
(4) 10 segment th
Answer: 4

List 1 List 2
A Pons I Provides additional space for Neurons, regulates posture and balance.
B Hypothalamus II Controls respiration and gastric secretions.
C Medulla III Connects different regions of the brain.
D Cerebellum IV Neuro secretory cells
Choose the correct answer from the options given below :
(1) A-I, B-III, C-II, D-IV (2) A-II, B-I, C-III, D-IV
(3) A-II, B-III, C-I, D-IV (4) A-III, B-IV, C-II, D-I
Answer: 4
156. Which of the following is not a steroid hormone?

(1) Progesterone (2) Glucagon (3) Cortisol (4) Testosterone
Answer: 2
157. Which one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5'
(1) 5'AUGUACCGUUUAUAGGGAAGU3' (2) 5'ATGTACCGTTTATAGGTAAGT3'
(3) 5'AUGUACCGUUUAUAGGUAAGU3' (4) 5'AUGUAAAGUUUAUAGGUAAGU3'
Answer: 3
158. Three types of muscles are given as a, b and c. Identify the correct matching pair
along with their location in human body : skeletal smooth Cardiac Name of
muscle/location
(1) (a) Skeletal - Biceps (b) Involuntary - Intestine (c) Smooth - Heart.
(2) (a) Involuntary - Nose tip (b) Skeletal - Bone (c) Cardiac - Heart.
(3) (a) Smooth - Toes (b) Skeletal - Legs (c) Cardiac - Heart.
(4) (a) Skeletal-Triceps (b) Smooth - Stomach (c) Cardiac - Heart.
Answer: 4
159. Following are the stages of cell division :

A. Gap 2 phase
B. Cytokinesis
C. Synthesis phase
D. Karyokinesis
E. Gap 1 phase
Choose the correct sequence of stages from the options given below :
(1) B-D-E-A-C (2) E-C-A-D-B (3) C-E-D-A-B (4) E-B-D-A-C
Answer: 2
160. Which of the following are Autoimmune disorders?

A. Myasthenia gravis
B. Rheumatoid arthritis'
C. Gout
D. Muscular dystrophy
E. Systemic Lupus Erythematosus (SLE)
Choose the most appropriate answer from the options given below :
(1) B, C & E only (2) C, D & E only (3) A B & D only (4) A, B & E only
Answer: 4

List 1 List 2
A Lipase I Peptide bond
B Nuclease II Ester bond
C Protease III Glycosidic bond
D Cerebellum IV Phosphodiester bond
Choose the correct answer from the options given below
(1) A-II, B-IV, CAI, D-III (2) A-IV, B-I, C-III, D-I
(3) A-IV, B-II, EVIII, D-I. (4) A-III, B-II, C-l, D - IV
Answer: 1
162. The flippers of the Penguins and Dolphins are the example of the
(1) Convergent evolution (2) Divergent evlolution (3) Adaptive radiation (4) Natural selection
Answer: 1
163. Match List I with fist II :

List 1 List 2
A Expirator capacity I Expiratory reserve
volume + Tidal
volume + Inspiratory reserve volume
B Functional residual capacity II Tidal volume +
Expiratory reserve
volume
C Vital capacity III Tidal volume + Inspiratory reserve volume
D Inspiratory capacity IV Expiratory reserve volume + Residual volume
Choose the correptanswer from the options given below :
(1) A-II, B-I, C-IN, D-III (2) A-I, B-III, QGI, D-IV
(3) A-II, B-IV, C-I, D-III (4) A-III, B-II,C-IV, D-I
Answer: 3
164. Which one of the following factors will not affect the Hardy-Weinberg equilibrium?
(1) Gene migration (2) Constant gene pool (3) Genetic recombination (4) Genetic drift
Answer: 2
165. Given below are some stages of human evolution Arrange them in correct sequence. ( Past to Recent)
A. Homo habiliss
B. Homo sapiens
C. Homo neanderihalensis
D. Home erectus
Choose the correctsequence of human evolution from the options given below :
(1) C-B-D-A (2) A-D-C-B (3) D-A-C-B (4) B-A-D-C
Answer: 2
166. Following are the stages of pathway for conduction of an aftion potential through the heart:
A. AV bundle
B. Purkinje fibres
C. AV node
D. Bundle branches
E. SA node
Choose the correct sequence of pathway from the options given below :
(1) B-D-E-C-A (2) E-A-D-B-C (3) E-C-A-D-B (4) A-E-C-B-D
Answer: 3
167. Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?
(1) Low pC O and High H concentration (2) Low pC O and High temperature (3) High pO and High pC O
2
+
2 2 2
(4) High pO and Lesser H concentration

2
+
Answer: 4
168. Match List I with Dist II :

List 1 List 2
A α − 1 antitrypsis I Cotton bollworm
B Cry IAb II ADA deficiency
C Cry IAc III Emphysema
D Enzyme replacement therapy IV Corn borer
(1) A-III, B-IV, C-I, D-II (2) A-II, B-IV, C-IV D-III
(3) A-II, B-I, C-IV, D-III (4) A-II, B-I, C-II, D-IV
Answer: 1
169. Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : FSH acts upon ovarian follicles in female and Leydig cells in male.
Reason R : Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male
human being.
In the light of the above statements, choose the correct answer from the options given below :
(1) A is true but R isfalse (2) A is false but R is true
(3) Both A and R are true and R is the correct explanation of A.
(4) Both A and R are true but R is NOT the correct explanation of A.
Answer: 2
170. The following diagram showing restriction sites in E.coli cloning vectorpBR322. Find the
role of ' X ' and ' Y ' genes :
(1) The gene ' X ' is for protein involved in replication of Plasmid and ' Y ' for resistance to
antibiotics.
(2) Gene ' X ' is responsible for recognition sites and ' Y ' is responsible for antibiotic
resistance.
(3) The gene ' X ' is responsible for resistance to antibiotics and ' Y ' for protein involved in
the replication of Plasmid.
(4) The gene ' X ' is responsible for controlling the copy numberof the linked DNA and ' Y '
for protein involved in the replication of Plasmid.
Answer: 4
171. Match List I with List II : List I Choose the correct answer from the op below :
(1) A-II, B-I, C-III, D-IV (2) A-III, B-IV, C-I, D-II (3) A-IV, B-III, C-I, D-II (4) A-I, B-III, C-II, DIIV
Answer: 2
172. Consider the following statements :

A. Annelids are true coelomates
B. Poriferans are pseudocoelomates >
C. Aschelminthes are acoelomates D. Platyhelminthes are pseudocoelomates Choose the correct answer from the
options given below :
(1) C only (2) D only (3) B only (4) A only
Answer: 4
173. Given below are two statements : Statement I : In the nephron, the descending limb of loop of Henle is
ippermeable to water and permeable to electrolytes. Statement II : The proximal convoluted tubule is lined by
simple columnar brush border epithelium and increases the surface area for reabsorption. In the light of the above
statements, choose the correct answer from the options given below :
(1) Statement I is true but Statement II is false (2) Statement I is fa/se but Statement II is true
(3) Both Statement Nand Statement II are true (4) Both Statement I and Statement II are false
Answer: 4

List 1 List 2
A Fibrous joints I Adjacent vertebrae, limited movement
B Cartilaginous joints II Humerus and Pectoral girdle, rotational movement
C Hinge joints III Skull, don't allow any movement
D ball and socket joints IV Knee, help in locomotion
(1) A-II, B-III, C-I, D-IV (2) A-III, B-I, C-IV, D-II
(3) A-IV, B-II, C-III, D-I (4) A-I, B-III, C-II, D-IV
Answer: 2
175. Which of the following is not a natural/traditional contraceptive method?

(1) Lactational amenorrhea (2) Vaults (3) Coitus interruptus (4) Periodic abstinence
Answer: 2

List 1 List 2
A Pleurobraciths I Mollusca
B Radul II Ctenophora
C Stomochord III Osteichthyes
D Air bladder IV Hemichordata
(1) A-II, B-IV, C-I, D-III (2) A-IV, B-III, C-II, D-I
(3) A-IV, B-II, C-III, D-I (4) A-II, B-I, C-IV, D-III
Answer: 4

List 1 List 2
A Axoneme I Centriole
B Cartwheel pattern II Cilia and flagella
C Cristar III Chromosome
D Satellite IV Mitochondria
(1) A-II, B-IV, C-I, D-III (2) A - II , B - I , C - IV ,D - III
(3) A-IV, B-III, C-II, D-I (4) A-IV, B-II, C-III, D-I
Answer: 2
178. Which of the following statements is incorrect?

(1) Bio-reactors are used to produce smallscale bacterial cultures.
(2) Bio-reactors have an agitator system, an oxygen delivery system and foam control system.
(3) A bio-reactor provides optimal growth conditions for achieving the desired product.
(4) Most commonly used bio-reactors are of stirring type.
Answer: 1
179. Match List I with List II Choose the correct answer from the options given below:
(1) A-II, B-IV, C-I, D-III (2) A-IV, B-III, C-II, D-I (3) A-IV, B-II, C-III, D-I (4) A-I, B-II, C-IV, D-III
Answer: 1

List 1 List 2
A Diakinesis I Synaptonemal complex formation
B Pachytene II Completion of terminalisation of chiasmata
C Zygotene III Chromosomes look like thin threads
D Leptotene IV Appearance of recombination nodules
Choose the correct answer from the options given below;
(1) A-III, B-I, C-II, D-IV (2) A-IV, B-II, C-III, D-I
(3) A-II, B-IV, C-III, D-I (4) A-I, B-III, C-II, D=IV
Answer: 1
181. Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R :
Assertion A: Breast-feeding during initial period of infant growth is recommended by doctors for bringing a
healthy baby.
Reason R : Colostrum contains several antibodies absolutely essential tordevelop resistance for the new born baby.
In the light of the above statements, choose the most appropriate ansÃÂªr from the options given below :
(1) A is correct but R is not correct. (2) A is not correct but R is correct.
(3) Both A and R are correct and R is the correct explanation of A.
(4) Both A and R are-correct but R is NOT the correct explanatioh of A.
Answer: 3
182. Match List I with Lisf:

(1) A-IV, B-I, C-II, D-III (2) A-III, B-II, C-I, D-IV (3) A-II, B-I, C-III, D-IV (4) A-III, B-I, C-II, D-IV
Answer: 4
183. The "Ti plasmid" of Agrobacterium tumefaciens stands for

(1) Tumor inducing plasmid (2) Temperatureindependent plasmid (3) Tumour;inhibiting plasmid
(4) Tumor independent plasmid
Answer: 1
184. Which of the following is not a component of Fallopian tube?

(1) Infundibulum (2) Ampulla (3) Uterine fundus (4) Isthmus
Answer: 3
185. Match List I with

(1) A-III, B-IV,C-I,D-II (2) A-IV, B-I, C-II, D-III (3) A-I, B-II, C-III, D-IV (4) A-II, B-III, C-IV,D-I
Answer: 1
Section - B (Zoology)
186. The following are the statements about nonchordates:

A. Pharynx is perforated by gill slits.
B. Notochord is absent.
C. Central nervous system is dorsal.
D. Heart is dorsal if present.
E. Post anal tail is absent.
Choose the most appropriate answer from the options given below :
(1) B,D&E Only (2) B, C & D only (3) A & C only (4) A.B& D only
Answer: 1
187. Match List I with List II : Choose the correct answer from the options given below :
(1) A-I, B-II, C-IV, D-III (2) A-III, B-I, C-IV, D-II (3) A-II, B-I, C-III, D-IV (4) A-III, B-I. C-II, D-IV
Answer: 2
188. Given below are two statements : Statement I : The cerebral hemispheres are connected by nerve tract known as
corpus callosum. Statement II : The brain stem consists of the medulla oblongata, pons and qerebrum. In the light
of the above statements, choose the most appropriate answer from the options given below :
(1) Statement I is correct but Statement II is incorrect. (2) Statement I is incorrect but Statement II is correct.
(3) Both Statement I and Statement II are correct. (4) Both Statement I and Statement II are incorrect.
Answer: 1
189. Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis.
(1) (1) FSH, Sertoli cells, Leydig cells, spermatogenesis.
(2) (2) ICSH, Leydig cells, Sertoli cells, spermatogenesis.
(3) (3) FSH, Leydig cells, Sertoli cells, spermiogenesis
(4) (4) ICSH, Interstitial cells, Leydig cells, spermiogenesis.
Answer: 3
(1) A-III, B-IV, C-I, D-II (2) A-IV, B-III, C-I, D-II (3) A-II, B-IV, C-I, DÌ-III (4) A-III, B-II, C-IV, D-I
Answer: 2
(1) A-III, B-IV, C-II, D-I (2) A-III, B-IV, C-I, D-II (3) A-I, B-III, C-II, D-IV
(4) A-IV, B-II, C-I, D-III
Answer: 2
(1) A-III, B-IV, C-I, D-II (2) A-II, B-I, C-IV, D-III (3) A-II, B-I, C-III, D-IV
(4) A-IV, B-III, C-I, D-II
Answer: 1
193. Given below are two statements : Statement I : Bone marrow is the main lymphoid organ where all blood cells
including lymphocytes are produced. Statement II : Both bone marrow and thymus provide micro environments for
the development and maturation of T-lymphocytes. In the light of the above statements, choose the most
appropriate answer from the options given below:
(1) Statement I is correct but Statement II is incorrect. (2) Statement I is incorrect but Statement II is correct.
(3) Both Statement I and Statement II are correct. (4) Both Statement I and Statement II are incorrect.
Answer: 3
194. Match List I with List II related to digestive system of cockroach. Choose the correct answer
from the options given below:
(1) A-IV, B-III, C-II, D-I (2) A-III, B-II, C-IV, D-I (3) A-IV, B-II, C-III, D-I
(4) A-I, B-II, C-III, D-IV
Answer: 3
195. Choose the correct statement given below regarding juxta medullary nephron.
(1) Loop of Henle of juxta medullary nephron runs deep into medulla.
(2) Juxta medullary nephrons outnumber the cortical nephrons.
(3) Juxta medullary nephrons are located in the columns of Bertini.
(4) Renal corpuscle of juxta medullary nephron lies in the outer portion of the renal medulla.
Answer: 1
196. Match List I with List II : Choose the correctfanswer from the options given below :
(1) A-II, B-III, CHI, D-IV (2) A-IV, B-II, C-I, D-III (3) A-I, B-III, C-IV, D-II
(4) A-III, B-II, C-IV, D-I
Answer: 4
197. As per ABO bleop grouping system, the blood group of father B , mother is A and child is O . Their respedifie
+ + +
genotype can be
A. I /I /i
Bi Ai
i
B. I I /I I /ii
B B A A
C. I I /iI /I
A B A Bi
D. I /I /I
Ai Bi A
E. iI /I I /I I Choose the mostlappropriate answer from the options given befow :

B A
F1
B
(1) C & B only (2) D & E only (3) A only (4) B only
Answer: 1
198. Given below are two statements :

Statement I : Gause's competitive exl principle states that two closely related speci, competing for different
C lSi ,
resources cannot ex indefinitely? Statement I : According to Gause's principh, during competition, the inferior
i
will be elimingatey This may betrue if resources are limiting. In the light bf the above statements, choose correct
answer from the options given below:
(1) Statement I is true but Statement II is false (2) Statement I is false but Statement II is true
(3) Both Statement I and Statement II are true (4) Both Statement I and Statement II are false
Answer: 2
199. Regarding catalytic cycle of an enzyme actio select the qorrect sequential steps :
A. Substrate enzyme complex formation.
B. Free enzyme ready to bind with anoth substrate.
C. Release of products.
D. Chemical bonds of the substrate broken.
E. Substrate binding to activÃÂ¨ site.
Choose the correct answer from the options give below :
(1) B, A, C , D, E (2) E, D, C , B, A (3) $E, A, D, C, B (4) $A , E , B , D , C,
Answer: 3
200. Given belou are two statements :

Statementh: Mitochondria and chloroplasts s both doubleqmembrane bound organelles.
Statemenf II : Inner membrane of mitochondr is relatively less permeable, as compared chloroplast.
In the light of the above statements, choose themo appropriateanswer from the options given below
(1) Statement I is correct but Statement I incortect. (2) Statement I is incorrect but Statement II correct
9
(3) Bothistatement I and Statement II are corred (4) Both Statement I and Statement I incorrect. 19
Answer: 1

Esophageal Disease

Uploaded by

Copyright:

Available Formats

Esophageal Disease

Uploaded by

Document Information

Original Description:

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Esophageal Disease

Uploaded by

Copyright:

Available Formats

05/05/2024, 18:58 Test - Parishrama NEET Academy

Parishrama NEET Academy

(1) 4.4mT (2) 44T (3) 44mT (4) 4.4T

4 Non- Magnetic D 0 < χ < ε (a small positive number)

4. An unpolarised light beam strikes a glass surface at Brewster's angle. Then

(1) 40mm (2) 8mm (3) 4mm (4) 0.4mm

(1) 6N (2) 10N (3) zero (4) 4 N

11. The graph which shows alge variation of (

wavelength of a free particle):

12. In the following circuit, the equivalent capacitance between terminal A

13. In the above diagram, a strong bar magnet is moving towards

(1) 20.7cm (2) 72.0 cm (3) 8.5 cm (4) 17.5 cm

24. The mass of a planet is 1

27. A particle moving with uniform speed in a circular path maintains :

(1) 1.98mN (2) 99N (3) 19.8mN (4) 198N

of magnetic moment of the needle is x × 10 Am ; then the value of ' x ' is :

(1) 4 : 1 (2) 1 : 4 (3) 1 : 2 (4) 2 : 1

of Charles's law represented as dotted lines,

(1) (2) (3) (4)

41. A force defined by F = αt

42. A metallic bar of Young's modulus, 0.5 × 10

length 1m and area of cross-section 10 −3

(1) (2) (3)

52. Which reaction is NOT a redox reaction?

53. Intramolecular hydrogen bonding is present in

54. Fehling's solution ' A ' is

56. Match The Following

(1) 2,3-dimethylbutane (2) 2,2-dimethylbutane (3) n-hexane (4) 2-methylpentane

62. Arrange the followipg elements in increasing order of electronegatirity:

64. Given below are two statements :

65. Given below are two statements:

Choosethe correct options from the given below:

M . Then, which of the following is correct?

73. Which plot of ln k vs 1

(1) (2) (3) (4)

74. In which of the follawing equilibria, K and K are NOT equal? p c

75. Given below are two statements

(1) (3) (4)

(1) −4x (2) − x 4

78. In which of the following processes entropy increases?

(1) A, C and D (2) C and D (3) A and C (4) A, B and D

80. Match List I with List II.

81. Given below are two statements:

83. The highest number of helium atoms is in

84. The most stable carbocation among the following is:

89. For the given reaction:

Statement II : CÃÂ³nplex [C o(N H ) ] has only 3

choose the correct answer fpop the options given belÃÂ³w:

92. Identify the correct answer.

Choose the corfect answer from the options given below:

(1) E, C , D, B, A (2) E, A, B, C,D (3) B, A, D, C , E (4) B, C , A, D, E

94. Identify the major product C formed in the following

2N O (g) ⇌ N2(g) + O 2(g)

atmosphere to 10 atmosphere is:

(1) 31.5 g (2) 0.0315 g (3) 3.15 g (4) 0.315 g

99. Major products A and B formed in the

100. The pair of lanthanoid ions which are diamagnetic is

101. Identify the set of correct statements:

Statement II : CÃÂ³nplex [C o(N H ) ] has only 3

choose the correct answer fpop the options given belÃÂ³w: