Received: 3 September 2021 | Revised: 30 December 2021 | Accepted: 30 December 2021

DOI: 10.1111/are.15739

ORIGINAL ARTICLE

Effects of dietary protein substitution of fishmeal with black

soldier fly larval meal on growth and physiological responses of
juvenile striped catfish, Pangasianodon hypophthalmus

Chandrasekaran Sudha1,2 | Baboonsundaram Ahilan2 | Nathan Felix3 |

Arumugam Uma2,4 | Elangovan Prabu3

1
Department of Fisheries, Government of
Tamil Nadu, Chennai, India Abstract
2
TNJFU -­Dr. M.G.R. Fisheries College and A 10-­week feeding trial was conducted to determine the effects of dietary black sol-
Research Institute, Chennai, India
3
dier fly larval meal (BSFLM) on growth performances, digestive enzyme activity, hae-
TNJFU -­Directorate of Incubation
and Vocational Training in Aquaculture, matological responses and muscle growth-­related gene expression of juvenile striped
Chennai, India catfish (Pangasianodon hypophthalmus). Six isonitrogenous and isolipidic diets were
4
TNJFU -­State Referral Laboratory for
formulated with BSFLM to replace fishmeal at 0 per cent (T0), 20 per cent (T20), 40
Aquatic Animal Health, Chennai, India
per cent (T40), 60 per cent (T60), 80 per cent (T80) and 100 per cent (T100). A total of
Correspondence
540 fingerlings were randomly distributed into 18 tanks and fed thrice a day. Growth
Chandrasekaran Sudha, Dr. M.G.R.
Fisheries College and Research Institute, performance and feed utilization of fish fed T20, T40 and T60 diets were not signifi-
Tamil Nadu Dr. J. Jayalalithaa Fisheries
cantly different from T0 diet. However, increasing the percentage of fishmeal replace-
University (TNJFU), Ponneri, Chennai,
Tamil Nadu, India. ment with BSFLM to 100% at an inclusion level of 292 g/kg resulted in a substantial
Email: [email protected]
reduction in growth and feed efficiency of striped catfish. Fish fed T80 and T100
diets had significantly lower whole-­body crude protein, crude lipid, total cholesterol
and triglyceride value than fish fed other experimental diets, while dietary inclusion
of BSFLM had no significant effect on the whole-­body amino acid profile, haema-
tological responses and intestinal and liver protease and amylase activity of striped
catfish. However, lipase activity was increased in fish fed T80 and T100 diets. T80
and T100 hepatocytes were shown to have greater congestion in histology than other
groups. The relative expression of MyoD and myogenin was significantly maximized in
fish fed the T60 diet. Fishmeal may be replaced with BSFLM up to 60 per cent at an
inclusion level of 174 g/kg in the diet of juvenile striped catfish.

KEYWORDS
black soldier fly larval meal, fishmeal, glucose, myogenin, striped catfish, weight gain

1 | I NTRO D U C TI O N been responsible for a significant rise in the supply of fish for human
consumption, aided in part by the availability of aquafeed (FAO, 2018).
Aquaculture is the world's fastest-­
growing food-­
producing sec- The demand for aquafeeds is increasing as worldwide aquaculture
tor. It accounts for about half of the world's food fish consumption. production rises. The persistent fall in wild fish catches combined with
Aquaculture has grown in popularity, and global consumption of growing demand for livestock and aquaculture feeds has resulted in a
farmed fish has risen in recent decades. Aquaculture production has rapid decrease in fishmeal (FM) and fish oil (FO) availability.

2204 | © 2022 John Wiley & Sons Ltd wileyonlinelibrary.com/journal/are Aquaculture Research. 2022;53:2204–2217.
 |

13652109, 2022, 6, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/are.15739 by CAPES, Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
SUDHA et al. 2205

The identification, development and utilization of sustainable and and Govt of India on Care and Use of Animals in Scientific Research.
alternate protein sources to FM remain a top priority as the aquacul- This study was approved by the ethical committee of Tamil Nadu Dr. J.
ture industry grows and cannot continue to rely on finite stocks of Jayalalithaa Fisheries University, Nagapattinam, Tamil Nadu, India.
wild-­caught fish. Insects have been determined to be an environmen-
tally beneficial, renewable and sustainable alternative protein source
with a desirable quantity, quality and nutritional composition for aqua- 2.2 | Experimental diets
feed production (Henry et al., 2015). Insect protein meal is extremely
nutritious with high fat, protein and mineral content varying by species Six isonitrogenous (312.5 g/kg) and isolipidic (77.35 g/kg) experi-
(Rumpold & Schlüter, 2013). It is said to have a high protein efficiency mental diets were prepared to replace FM with BSFLM. FM (T0)
ratio, as well as be less expensive than traditional protein sources protein was replaced with BSFLM protein at 0 per cent (T0), 20 per
(Ssepuuya et al., 2017). Larvae of insects such as locusts (Locusta mi- cent (T20), 40 per cent (T40), 60 per cent (T60), 80 per cent (T80)
gratoria), grasshoppers (Zonocerus variegatus), termites (Macrotermes and 100 per cent (T100). Dietary ingredients were finely ground and
spp.), yellow mealworms (Tenebrio molitor), Asiatic rhinoceros beetles thoroughly mixed using a vertical ingredient mixer (Jinan Sunpring
(Oryctes rhinoceros), domesticated silkworms (Bombyx mori), housefly Machinery), and then extruded at 100–­105°C using a twin-­screw
(Musca domestica), mosquitoes (Culex pipiens) and black soldier fly extruder (KK Lifesciences) to produce 2-­mm floating pellets. The
(Hermetia illucens) have been tested and found to be suitable as an experimental diets were produced in aquafeed extrusion mill at
alternate protein source in the diets of farmed fish species (Ipinmoroti TNJFU-­DIVA, Muttukadu, Chennai, India. The pellets were collected
et al., 2019; Kroeckel et al., 2012; Ogunji et al., 2008; Sogbesan & and stored in airtight container after drying. Dietary ingredient and
Ugwumba, 2008; Wang et al., 2017; Xiao et al., 2018). chemical composition, and amino acid profile of the experimental
One of the most promising ways is the growth of black soldier diets are shown in Table 1 and Table 2, respectively.
fly (BSF) larvae as fish feed, which has the added benefit of using or-
ganic wastes (Diener et al., 2009) and presents a viable option for safe
human and animal management (Yu et al., 2009). BSF larvae devour 2.3 | Experimental fish and feeding trial
slaughterhouse by-­products, organic wastes and domestic animal ex-
crement, as well as kitchen wastes (Myers et al., 2014). BSF larval meal The feeding trial was conducted at the Tamil Nadu Dr. J. Jayalalithaa
(BSFLM) also exhibits necessary amino acid patterns that are similar to Fisheries University's Aquatic Research Farm Facility (ARFF). Striped
FM (Henry et al., 2015), making it a suitable choice for long-­term mass catfish fry were procured from a local fish farm in Chennai, India
manufacturing (Ssepuuya et al., 2017). Several fish feeding trials have (3.1 ± 0.2 g per fish). The fish were nursed with a commercial diet for
shown that replacing FM with BSFLM in aqua diets has no negative 10 weeks to acclimatize to the rearing environment. After 10 weeks,
effects on growth performance (Cummins et al., 2017; Dumas et al., the experimental fish were fasted for 24 h and weighed before the
2018; Lock et al., 2016; Renna et al., 2017). feeding experiment. The experiment was conducted in triplicate, and
Striped catfish is one of the species that has been successfully intro- a total of eighteen 500-­L circular fibreglass tanks (FRP) were used
duced into the wild for many years. Increased culture of this species will for the feeding trial. Each tank was stocked with 30 juvenile fish
continue to be a major component of aquaculture production. Striped (5.04 ± 0.22). Aeration was continuously provided throughout the ex-
catfish has high meat content, taste and low price, and high market de- perimental period using a 5 HP air blower (Everest Pvt). Feeding was
mand. The development of fishmeal-­free cost-­efficient feed will boost done three times a day (09.00, 13.00 and 17.00 hours) until appar-
the overall production of striped catfish species. Although several stud- ent satiation. The feeding experiment was conducted for 70 days. The
ies have been conducted to replace FM with BSFLM in different fish water temperature, dissolved oxygen, pH and ammonia content were
species, to the best of our knowledge, no study has been conducted to all maintained at 28.2 ± 1.55°C, 6.58 ± 1.25 mg/L, 7.26 ± 0.32 mg/L
replace FM with BSFLM in the diet of striped catfish. In this context, and 0.10 ± 0.02 mg/L, respectively, on a weekly basis.
this study aimed to determine the effects of dietary replacement of FM
with BSFLM on growth performance, feed utilization, serum biochem-
ical parameters, digestive enzyme activities and muscle growth-­related 2.4 | Sampling
gene expression in striped catfish, Pangasianodon hypophthalmus.
Before the experiment, the initial fish samples were collected and
analysed for proximate composition. Fish were fasted for 24 h be-
2 | M ATE R I A L A N D M E TH O DS fore being anaesthetized with an overdose of MS222 at the end of
the experiment (Sigma-­Aldrich). To compute growth parameters and
2.1 | Ethical statement survival, all fish were measured for final body weight (FBW), fish
number, body length and total length. The following equations were
The experiment was conducted following the procedures of CPCSEA used to determine the growth-­related indicators and feed utilization:
(Committee for the Purpose of Control and Supervision of Experiments on
Animals), Ministry of Environment and Forests (Animal Welfare Division) Weight gain (g) = Final body weight (g) − Initial body weight (g)
 |

13652109, 2022, 6, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/are.15739 by CAPES, Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
2206 SUDHA et al.

TA B L E 1 Formulation and chemical composition of the experimental diets (g/kg of diet)

Ingredients T0 T20 T40 T60 T80 T100

a
Fishmeal 200 160 120 80 40 0
b
BSF meal 0 58 116 174 232 290
Soya bean meala 175 175 175 175 175 175
a
Corn gluten meal 125 125 125 125 125 125
Corn floura 387 379 371 363 355 347
a
Cassava starch 30 30 30 30 30 30
Crude sardine oilc 53 43 33 23 13 3
a
Di calcium phosphate 10 10 10 10 10 10
Mineral premixd 5 5 5 5 5 5
e
Vitamin premix 5 5 5 5 5 5
Saltc 10 10 10 10 10 10
Proximate composition (g/kg of dry matter)
FM BSFLM
Dry matter 924.3 946.9 943.4 944.5 944.6 942.8 944.3 944.2
Crude protein 568.2 397.6 312.6 312.9 312.6 312.4 312.1 312.4
Crude lipid 98.0 243.3 77.2 77.5 77.2 77.5 77.5 77.2
Crude fibre 10.0 96.2 28.9 28.4 28.1 29.2 29.1 29.1
Total ash 203.6 147.1 85.5 86.2 86.2 86.9 87.3 87.2
Gross energy 4,238 5,181 4,050 4,054 4,056 4,054 4,052 4,054
Kcal/kg
a
National Co-­operative Consumers' Federation of India, Chennai, India.
b
Eco care Agrovet, Puducherry, India.
c
Local market, Chennai, India.
d
Composition of vitamin premix (quantity/kg): Vit. A—­10,000,000 IU; Vit. B1—­5,000 mg; Vit. B2—­5,000 mg; Vit. B3—­6,000 mg; Vit. B5—­6,000 mg;
Vit. B6—­6,000 mg; Vit. C—­60,000 mg; Vit. D3—­2,000,000 IU; Vit. E—­10,000 EU; and Vit. H—­200 mg.
e
Composition of mineral premix (quantity/kg): magnesium—­2,800 mg; iodine—­7.4 mg; iron—­7,400 mg; copper—­1,200 mg; manganese—­11,600 mg;
zinc—­9,800 mg; cobalt chloride—­4 mg; potassium—­100 mg; selenium—­4 mg; calcium carbonate—­27.25%; phosphorus—­7.45 mg; sulphur—­0.7 mg;
sodium—­6 mg; Calpan—­200 mg; aluminium—­1,500 mg; and choline chloride—­10,000 mg.

Daily weight gain (DWG) (g) =

(Final weight − Initial weight) 2.5 | Proximate composition
Duration of rearing periods (Days)

Proximate composition of experimental diets was analysed before

Survival (SR) (% ) =
Total numberof fishes survived
× 100 starting the feeding trial. Proximate composition of whole body of
Total number of fishes stocked
fish was determined at the start and end of the experiment using
Association of Official Analytical Chemists techniques (AOAC, 2010).
Specific growth rate (SGR %per day) =
After oven drying at 105°C to a constant dry weight, moisture content
[ln(Final weight of fish) − ln(Initial weight of fish)]
× 100 was assessed. The micro-­Kjeldahl device (Foss Kjeltec 2200; Hillerød,
duration of rearing period (days)
Denmark) was used to determine the crude protein content. Petroleum

Feed conversion ratio (FCR) =

Amount offeed given (g) ether extraction in the Soxhlet equipment for 16 h was used to deter-
Weight gain (g) mine total lipid content. The weight loss after incineration of samples
at 550°C for 6 h in a muffle furnace was used to calculate the ash
Weight gain (g) content (Heraeus Instruments K1252; Hanau, Germany).
Protein effeciency Ratio (PER) =
Total protein fed (g)

Thermal growth coefficient (TGC) = 2.6 | Amino acid analysis

1 1
[ ]
Final weight 3 − Initial weight 3
[ ◦ ] × 100 Amino acid profile of experimental diets was analysed before
Mean water Temperature ( C) × duration of days
starting the feeding trial. For the investigation of whole-­
b ody
[ ] amino acid content, three fish from each tank were slaughtered
Condition factor (CF) = Body weight (g)∕Body length3 (cm) × 100
at random. Following the method of Ishida et al. (1981), the
 |

13652109, 2022, 6, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/are.15739 by CAPES, Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
SUDHA et al. 2207

TA B L E 2 Amino acid composition of

FM BSFLM T0 T20 T40 T60 T80 T100
the experimental diets (g/kg)
Essential amino acids
Arginine 34.3 21.5 20.7 18.3 19.3 18.9 16.7 17.1
Histidine 16.5 12.1 10.4 10.3 10.6 10.7 10.5 10.2
Isoleucine 24.6 19.2 16.4 16.3 16.5 16.5 16.3 16.1
Leucine 43.3 35.8 41.9 45.7 46 48.4 49.7 51.5
Lysine 40.6 28.2 18.4 18.1 18.1 17.8 17.7 17.5
Methionine 14.8 9.82 5.8 5.6 5.6 5.5 5.4 5.2
Phenylalanine 25.5 22.5 19.5 19.5 19.5 19.5 19.5 19.6
Threonine 22.4 14.9 14 13.7 13.9 13.9 13.7 13.5
Tryptophan 3.8 1.2 2.8 2.7 2.5 2.4 2.4 2.3
Valine 28.9 19.8 18.6 18.5 18.4 18.3 18.4 18.2
Non-­essential amino acids
Cysteine 5.7 4.1 5.4 5.3 5.4 5.2 5.3 5.1
Tyrosine 21.2 14.2 14.1 14.1 14.1 14.1 14.2 14.2
Glutamic 69.9 38.6 65.3 66.5 67.2 68.3 68.3 68.1
Aspartic 58.2 44.2 33.6 31.9 32.9 32.8 31 29.9
Glycine 51.9 19.2 16.2 15.5 15.9 15.8 15.3 14.8
Serine 23.1 13.2 17.8 17.6 17.8 17.9 17.6 17.6
Alanine 40.6 24.8 22.9 23.4 23.2 24.6 25.3 25.2

amino acid profile of experimental diets and the whole body was method (Drabkin, 1946) was used to quantify haemoglobin (Hb)
evaluated using UPLC (Model Waters ACQUITY UPLC, Waters, concentrations, while the microhaematocrit method was used to
Massachusetts, USA). About 50 mg of material was transferred determine haematocrit (Ht) (Nelson & Morris, 1989). According to
to an ampule (Borosil Glass Works) and sealed under a stream Wintrobe (1934), the derived blood indices of mean corpuscular
of nitrogen gas before being neutralized with 6 N HCl and fil- volume (MCV), mean corpuscular haemoglobin (MCH) and mean
tered through a 0.2-­m PTFE filter. Following stepwise gradient corpuscular haemoglobin concentration (MCHC) were determined
elution, the materials were derivatized using an AccQ-­Tag Ultra as follows:
Derivatization Kit and separated using a Waters ACQUITY UPLC
MCV (per μl) = (Ht × 10) ∕RBCs
equipped with a 2.1 × 100 mm column fitted with 1.7 m AccQ-­
Tag Ultra C18. The amino acids were quantified using the amino
MCH (% ) = (Hb × 10) ∕RBCs
acid standard H (Product # NCI 0180) (Waters Corporation) and
the absorbance values at 260 nm recorded using a tuneable UV
MCHC (g per dl) = (Hb × 100) ∕Ht
detector and analysed using Empower 2. Simultaneously, amino
acid standards were also conducted for calibration. After alkaline
digestion of the material with lithium hydroxide, tryptophan was Blood from non-­EDTA-­coated tubes was left to clot at 4°C for
calculated. 2 h before being centrifuged at 3,500 × g for 25 min at 4°C in a
refrigerated centrifuge to obtain serum (Eppendorf Centrifuge
5804 R). Three fish serum samples were pooled at random for anal-
2.7 | Haematobiochemical assays ysis using an automated biochemical analyser (ERBA, Mannheim,
Germany). Total protein (TP, g/L), albumin (ALB, g/L), globulin (GLO,
Approximately 3 fish per tank (n = 3 fish per tank, n = 3 triplicate g/L), glucose (GLU, mmol/L), total cholesterol (TCHO, mmol/L) and
per treatment) were selected for haematological analysis at the end triglyceride (TG, mmol/L) were analysed among serum biochemical
of the feeding trial. To prevent blood clots, a one-­ml syringe was parameters.
used to collect blood that had been prewashed with a 10% ethylen-
ediaminetetraacetic acid (EDTA) solution. The syringe was used to
draw blood from the caudal arch, and the blood was promptly trans- 2.8 | Digestive enzyme activities
ferred to an EDTA-­coated container for haematological examina-
tion. A Neubauer haemocytometer was used to count the red blood Three fish from each tank (n = 3 fish per tank, n = 3 triplicate per
cells (RBCs) and white blood cells (WBCs). The cyanmethemoglobin treatment) were randomly selected, and liver and intestine samples
 |

13652109, 2022, 6, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/are.15739 by CAPES, Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
2208 SUDHA et al.

were removed, pooled, weighed and homogenized with cold phos- at 95°C for 10 min, followed by 40 cycles of 15-­s denaturation at
phate buffer (pH 7.8), and 0.5 ml of Tween-­20 was added, and the 95°C, annealing at 60–­62°C for 30 s and extension at 72°C for 30 s,
supernatant was centrifuged at 3,070 × g for 5 min. Until the enzyme and ended with a dissolution curve. The threshold cycle (Ct) values ac-
assay, the supernatant was kept at −20°C. quired by amplification were assessed, and a relative expression level
The Lowry, Rosebrough and Farr technique was used to assess of a certain gene was presented as 2−ΔΔCt (Livak & Schmittgen, 2001).
protease activity (1951). Clark (1964) used starch as the substrate to To compare the relative expression levels of the genes, the expression
measure amylase activity using the 3,5-­dinitrosalicylic acid colorimet- of the housekeeping gene 18S rDNA was employed.
ric technique. Cherry and Crandall (1932) determined lipase activity by
measuring fatty acid release caused by enzymatic hydrolysis of olive oil.
Using a spectrophotometer (Lambda 25 UV Win Lab V 6.0), enzyme 2.11 | Statistical analysis
activity was measured as changes in absorbance and represented as
specific activity (Umg-­1 protein-­1). One unit of enzyme activity was ex- All the data were presented as means ± standard deviations (SD).
pressed as 1 µg of tyrosine, maltose and fatty acids released per minute. One-­way analysis of variance was used to assess all of the data,
followed by Tukey's test. Differences were considered statistically
significant when p < 0.05. spss 20.0 for Windows was used for all
2.9 | Histological observation of liver analyses (SPSS).

The liver samples were collected and fixed in 10% neutral buffered
formalin (n = 3 fish per tank). Subsequently, the fixed samples were 3 | R E S U LT S
then dried in ethanol, infiltrated in xylene and embedded in paraffin,
as per conventional histological practices. Using a rotary microtome, 3.1 | Growth performances and feed utilization
the samples were sectioned serially (5 µm thick), stained with hae-
matoxylin and eosin and photographed using a stereo zoom micro- Growth performances and feed utilization parameters of striped
scope (Olympus BX50). catfish after 70 days of feeding trial are given in Table 4. The treat-
ments had a significant effect on the growth and feed utilization of
the fish. FBW, SGR, DWG, FCR and PER of fish fed T20, T40 and T60
2.10 | Quantitative real-­time PCR (qRT-­PCR) diets were not significantly different from T0 after 70 days of feed-
ing trial (p > 0.05). When striped catfish were fed with the T60 diet,
At the end of the feeding trial, total RNA was isolated from muscle tis- the maximum values were attained, which were not significantly dif-
sue (n = 3 fish per tank) according to the manufacturer's protocol using ferent from the T0 diet. Fish fed T80 and T100 diets had significantly
RNAiso Plus (Takara Bio, Otsu, Shiga, Japan). Following the manufac- lower growth performances and feed utilization than those fed other
turer's procedure, the first-­strand complementary DNA (cDNA) was experimental diets. No significant differences were observed in the
produced from 2 µg of total RNA using the first-­strand cDNA synthe- SR of fish fed different experimental diets.
sis kit (Thermo Scientific). For relative gene expression investigations,
Prabu et al.’s (2021) methods were used (Table 3). 20 ng of cDNA tem-
plate, 10 μM of each primer (forward and reverse) and 1x SYBR Green 3.2 | Whole-­body composition and amino
PCR Master Mix Kit (Takara Bio) were used in a 20 μl quantitative acid profile
real-­time polymerase chain reaction (qRT-­PCR). The qRT-­PCR was per-
formed in a Bio-­Rad C1000 Touch Thermal Cycler–­CFX96 Real-­time The whole-­body composition of fish fed with control and graded
PCR (Bio-­Rad, Foster City, California, USA) with an initial denaturation levels of BSFLM-­supplemented diets is presented in Table 5. In all

TA B L E 3 Primers used for qRT-­PCR

GenBank
analysis of selected genes of striped
Gene name number Primer sequence (5′−3′)
catfish fed experimental diets
Myogenic factor (MyoD) GU246722 Forward: CCACCTGTCAGACAACCAGA
Reverse: ACTGCGTTCGCTCTTCAGAC
Myogenin GU246725 Forward: CTCAACCAGCAGGACACTGA
Reverse: ATCCTCGCTGCTGTAGCTCT
Myostatin 1 FJ972683 Forward: TCCACATGACCCTGCAGAC
Reverse: TGCACCACACATACTCCTCATC
18S ribosomal DNA (18SrDNA) JF698683 Forward: GGACACGGAAAGGATTGACAG
Reverse:
GTTCGTTATCGGAATTAACCAGAC
 |

13652109, 2022, 6, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/are.15739 by CAPES, Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
SUDHA et al. 2209

TA B L E 4 Effect of replacing FM with BSFLM on growth performance and feed utilization of striped catfish

Dietary treatments

T0 T20 T40 T60 T80 T100 p value

IBW (g/fish) 5.01 ± 0.29 5.11 ± 0.22 5.05 ± 0.25 5.07 ± 0.16 5.0 ± 0.18 4.97 ± 0.21 0.970
FBW (g/fish) 48.07 ± 0.15a 48.3 ± 0.46a 48.17 ± 0.4a 48.67 ± 0.25a 39.87 ± 0.21b 38.17 ± 0.51c <0.001
a a a a b c
Weight gain (g/fish) 43.06 ± 0.17 43.19 ± 0.45 43.12 ± 0.5 43.6 ± 0.35 34.87 ± 0.31 33.2 ± 0.35 <0.001
Survival (%) 100 ± 0 100 ± 0 100 ± 0 98.89 ± 1.92 100 ± 0 98.89 ± 1.92 0.571
a a a a b c
DWG (g/fish) 0.62 ± 0 0.62 ± 0.01 0.62 ± 0.01 0.62 ± 0 0.5 ± 0 0.47 ± 0 <0.001
SGR (% per day) 3.23 ± 0.08a 3.21 ± 0.06a 3.22 ± 0.07a 3.23 ± 0.05a 2.97 ± 0.05b 2.91 ± 0.04b <0.001
c c c c b a
FCR 1.24 ± 0.01 1.23 ± 0 1.22 ± 0 1.21 ± 0 1.55 ± 0.01 1.6 ± 0.04 <0.001
PER 2.25 ± 0.02a 2.28 ± 0.01a 2.29 ± 0.01a 2.31 ± 0.01a 1.76 ± 0.02b 1.7 ± 0.03c <0.001
a a a a b b
TGC 0.98 ± 0.01 0.98 ± 0.01 0.98 ± 0.02 0.99 ± 0.01 0.87 ± 0.01 0.85 ± 0.01 <0.001
CF 0.67 ± 0.02 0.65 ± 0.02 0.66 ± 0.02 0.67 ± 0.02 0.67 ± 0.01 0.62 ± 0.02 0.050

Note: values are means ± SD (n = 3). Values in the same line with different superscript letters are significantly different (p < 0.05).
Abbreviations: FBW, final body weight; IBW, initial body weight.

groups except T100, no significant changes (p > 0.05) in moisture fish fed the control diet compared with other experimental diets.
were observed. Significantly lowest crude protein and crude lipid Striped catfish fed the T100 diet had significantly lower triglyceride
were observed in fish fed T80 and T100 diets, while no significant and total cholesterol levels, whereas those fed the T0 diet had the
differences were observed in whole-­body ash content of fish fed highest values.
control and graded levels of BSFLM-­supplemented diets. No sig-
nificant differences were observed in the whole-­body essential and
non-­essential AA profiles of fish fed diets with different levels of 3.6 | Muscle growth-­related gene expression
BSFLM-­supplemented diet and control diet (Table 6).
Relative expression of MyoD, myogenin and myostatin in juvenile
striped catfish fed with graded levels of dietary BSFLM is shown in
3.3 | Digestive enzyme Figure 2. The relative expression of MyoD, myogenin and myostatin
in the white skeletal muscle of fish from different treatments was
Dietary treatments had no effect on protease and amylase activity significantly affected (p < 0.05) by dietary supplementation with
in the liver and intestine (p > 0.05), although intestinal lipase activity BSFLM. The relative expression of MyoD and myogenin was signif-
in fish fed T80 and T100 diets was significantly higher (p < 0.05) than icantly upregulated in fish fed the T60 diet than in fish fed other
that in fish fed T0, T20, T40 and T60 diets (Table 7). treatment diets (Figure 2a,b). In comparison with other diets, my-
ostatin expression was downregulated in fish fed T0, T20 and T60
diets (Figure 2c).
3.4 | Histomorphology of liver

Figure 1 shows the histological appearance of hepatocytes. 4 | DISCUSSION

Hepatocytes (Figure 1, T0–­T60) were loose and polyhedral in shape
with vacuolated cytoplasm, with no evidence of inflammatory cell In this present study, the replacement of FM with BSFLM up to 60
infiltration. T80 and T100 hepatocytes were shown to have more per cent had no negative impact on growth performance and feed
congestion than T0, T20, T40 and T60 hepatocytes. utilization of striped catfish. These findings support a previous study
that reported that BSF prepupal meal may replace up to 45 per cent
of FM in the diet of juvenile European seabass without compromis-
3.5 | Haematology and serum biochemical ing growth performances (Magalhães et al., 2017). In this present
parameter study, replacing FM with BSFLM resulted in a linear decrease in
growth. However, no negative impact on growth performances and
Hb, Ht, WBC, RBC, MCV, MCH and MCHC levels were not signifi- feed utilization was observed in fish fed BSFLM-­supplemented diets
cantly different among the dietary groups (Table 8). T100 had sig- to replace FM up to 60 per cent. The inclusion of 60 g/kg BSF pre-
nificantly lower serum total protein, albumin and A/G ratio than the pupae in the diet of channel catfish (Newton et al., 2005), 150 g/kg
other groups (Table 8). The lowest glucose content was observed in (St-­Hilaire et al., 2007) or 180–­360 g/kg BSF prepupae in the diet of
 |

13652109, 2022, 6, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/are.15739 by CAPES, Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
2210 SUDHA et al.

rainbow trout (Sealey et al., 2011), and 50–­250 g/kg BSF prepupae
in the diet of Atlantic salmon (Lock et al., 2016) resulted in similar

<0.001
<0.001
p value

0.001

0.283
growth rate comparable to fish fed the fishmeal-­based diet. BSFLM
protein may be utilized to replace 48 per cent of fishmeal in the diet
of yellow catfish without impairing the fish growth performance, ac-
cording to Xiao et al. (2018). Similarly, Anvo et al. (2017) found that
using Cirina butyrospermi as a 50 per cent replacement for fishmeal

b
b

33.37 ± 0.25
155.5 ± 1.32
674.8 ± 0.15

102 ± 1.00 c
had no effect on Clarias gariepinus growth performances and nutri-
ent consumption. In African catfish and Atlantic salmon, a total re-
T100

placement of fishmeal with Gryllus bimaculatus (cricket) and Hermetia

illucens (black soldier fly) larval meal at an inclusion level of 350 g/kg
and 147.5 g/kg, respectively, has been recorded (Belghit et al., 2019;
Taufek et al., 2016). When the level of BSFLM in the diet was in-
b

102.93 ± 0.80 c
156.83 ± 1.26
a

33.23 ± 1.08
685.1 ± 0.31

creased above 174 g/kg in the current study, a minor decrease in

growth, SGR, FCR and PER was observed, which could be linked to
the high fibre content, of which chitin is a prominent component.
T80

Several other studies have found that chitin has an inhibitory ef-
fect on nutritional digestion and absorption, resulting in growth
retardation in different fish species (Alegbeleye et al., 2012; Anvo
a

111.7 ± 0.61b

et al., 2017; St-­Hilaire et al., 2007), and inclusion levels of more than
162.7 ± 2.07

Note: Values are means ± SD (n = 3). Values in the same line with different superscript letters are significantly different (p < 0.05).
a

34.6 ± 0.35
685.6 ± 0.3

330 g/kg were reported to drastically reduce the diet's palatability,

protein digestibility, feed intake and growth performance in turbot
T60

(Kroeckel et al., 2012). The reduced growth observed in BSFLM-­

TA B L E 5 Whole-­body chemical composition (g/kg of wet weight) of striped catfish fed experimental diets.

fed fish was previously attributed to a decrease in feed palatability

(Karapanagiotidis et al., 2014; Kroeckel et al., 2012). Furthermore,
111.03 ± 0.95b

when compared to the control group, the condition factor and sur-
a
682.0 ± 0.04

34.83 ± 0.91
a

vival of striped catfish (Pangasianodon hypophthalmus) revealed no

162 ± 1.73

differences (p > 0.05). Similar results were found in Clarias gariepi-

T40

nus fed diets supplemented with BSFLM to replace 100 per cent FM
(Adeoye et al., 2020).
The moisture and ash content of striped catfish did not alter sig-
nificantly among all diets, which was similar to a recent study on
a

114.9 ± 2.65ab
161.67 ± 0.58
a

Nile tilapia (Oreochromis niloticus) (Devic et al., 2018); when fish were
683.0 ± 0.17

34.2 ± 1.75

fed a BSF prepupal diet, crude lipid content reduced considerably.

Kroeckel et al. (2012) discovered that increasing the inclusion of
T20

BSF prepupal meal in the diet reduces the whole-­body lipid content
of turbot. The lipid content of rainbow trout (Oncorhynchus mykiss;
Walbaum) fillets decreased as the level of Tenebrio molitor larval meal
a

116.83 ± 1.53a

in the diet increased (Belforti et al., 2015).

162.57 ± 2.32
a
683.1 ± 0.27

34.17 ± 0.12

The essential amino acid (EAA) profiles of Diptera are similar to

FM, which is believed to have the best EAA profile of any fish protein
(Henry et al., 2015). Nonetheless, there are some significant discrep-
T0

ancies between the protein content and EAA composition of BSFLM

in the limited studies that have been reported (Makkar et al., 2014;
Sealey et al., 2011; St-­Hilaire et al., 2007). This could be due to changes
153.4
Initial

728.1

38.1
79.9

in EAA composition among BSFLM from different sources, different

larval/pupal stages used, diet, rearing circumstances and other param-
eters such as processing procedure. Almost all bug meals are poor in
Dietary treatments

lysine and tryptophan for fish, as well as threonine and sulphur-­amino

Crude protein

acids, with the exception of BSFLM (Makkar et al., 2014). The lysine
Crude lipid
Moisture

Total ash

and methionine contents of the BSFLM utilized in this investigation

were similar to the predicted needs for striped catfish. As a result, the
EAA composition of all diets met the species' requirements.
 |

13652109, 2022, 6, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/are.15739 by CAPES, Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
SUDHA et al. 2211

TA B L E 6 Whole-­body amino acid profile (g/kg wet weight) of striped catfish fed experimental diets

p
Initial T0 T20 T40 T60 T80 T100 value

Essential amino acids

Arginine 20.6 ± 0.2 20.7 ± 0.1 20.57 ± 0.21 20.6 ± 0.1 20.53 ± 0.12 20.7 ± 0.1 20.6 ± 0.2 0.648
Histidine 8.8 ± 0.1 8.83 ± 0.06 8.73 ± 0.06 8.77 ± 0.06 8.8 ± 0 8.83 ± 0.06 8.8 ± 0.1 0.378
Isoleucine 15.1 ± 0.26 15.07 ± 0.29 15.07 ± 0.29 14.93 ± 0.06 14.93 ± 0.06 15.07 ± 0.29 15.1 ± 0.26 0.901
Leucine 22.23 ± 0.31 22.5 ± 0 22.23 ± 0.31 22.37 ± 0.12 22.5 ± 0 22.5 ± 0.5 22.23 ± 0.31 0.642
Lysine 8.57 ± 0.15 8.53 ± 0.06 8.43 ± 0.21 8.67 ± 0.21 8.3 ± 0.17 8.3 ± 0.1 8.57 ± 0.15 0.081
Methionine 6.5 ± 0.17 6.27 ± 0.06 6.53 ± 0.15 6.47 ± 0.12 6.47 ± 0.15 6.63 ± 0.15 6.5 ± 0.17 0.117
Phenylalanine 12.17 ± 0.15 12.27 ± 0.12 12.07 ± 0.12 12.13 ± 0.12 12.2 ± 0 12.23 ± 0.06 12.17 ± 0.15 0.292
Threonine 17.1 ± 0.3 17.27 ± 0.15 17 ± 0.35 17 ± 0.17 17.2 ± 0.17 17.07 ± 0.25 17.1 ± 0.3 0.706
Tryptophan 4.2 ± 0.1 4.3 ± 0.17 4.37 ± 0.15 4.33 ± 0.25 4.37 ± 0.15 4.3 ± 0.1 4.2 ± 0.1 0.817
Valine 17.37 ± 0.21 17.5 ± 0.1 17.27 ± 0.06 17.37 ± 0.21 17.33 ± 0.12 17.23 ± 0.32 17.37 ± 0.21 0.617
Non-­essential amino acids
Cysteine 10.67 ± 0.58 11.33 ± 1.53 11.67 ± 1.15 11.33 ± 1.53 11 ± 0 11 ± 0 10.67 ± 0.58 0.874
Tyrosine 11.33 ± 1.53 12.33 ± 1.15 12.33 ± 2.31 12.33 ± 1.15 11 ± 0 11.67 ± 1.15 11.33 ± 1.53 0.749
Glutamic 44.8 ± 0.4 44.93 ± 0.23 44.53 ± 0.23 44.67 ± 0.23 44.8 ± 0 45.07 ± 0.23 44.8 ± 0.4 0.206
Aspartic 40.8 ± 0.1 40.73 ± 0.06 40.83 ± 0.12 40.77 ± 0.12 40.73 ± 0.06 40.67 ± 0.25 40.8 ± 0.1 0.719
Glycine 25.2 ± 0.1 25.17 ± 0.15 25.23 ± 0.06 25.2 ± 0.1 25.13 ± 0.06 25.17 ± 0.06 25.2 ± 0.1 0.831
Serine 17.2 ± 0.2 17.13 ± 0.23 17.13 ± 0.12 17.07 ± 0.12 17 ± 0 17.2 ± 0.2 17.2 ± 0.2 0.645
Alanine 20.93 ± 0.15 20.93 ± 0.12 21 ± 0.17 20.87 ± 0.12 20.8 ± 0 20.93 ± 0.15 20.93 ± 0.15 0.555

Note: Values are means ± SD (n = 3). Values in the same line with different superscript letters are significantly different (p < 0.05).

TA B L E 7 Digestive enzyme activity of striped catfish juveniles fed different experimental diets

Parameters T0 T20 T40 T60 T80 T100 p value

1
Intestine Protease 4.12 ± 0.03 4.1 ± 0.01 4.58 ± 0.4 4.35 ± 0.42 4.88 ± 0.08 4.34 ± 0.42 0.057
Liver 2.35 ± 0.07 2.73 ± 0.45 2.55 ± 0.25 2.35 ± 0.17 2.24 ± 0.16 2.11 ± 0.1 0.078
Intestine Amylase2 0.55 ± 0.02 0.48 ± 0.05 0.54 ± 0.04 0.5 ± 0.01 0.53 ± 0.01 0.52 ± 0.03 0.074
Liver 2.27 ± 0.02a 2.08 ± 0.05b 2.05 ± 0.05b 2.16 ± 0.11ab 2.06 ± 0.06b 2.16 ± 0.09ab 0.015
Intestine Lipase3 0.74 ± 0.01e 0.94 ± 0.04d 1.04 ± 0.02c 1.0 ± 0.03cd 1.44 ± 0.03b 1.54 ± 0.02a <0.001
Liver 0.14 ± 0.05c 0.19 ± 0.02bc 0.26 ± 0.02b 0.27 ± 0.01a 0.3 ± 0.03a 0.28 ± 0.03a <0.001

Note: Values are means ± SD (n = 3). Values in the same line with different superscript letters are significantly different (p < 0.05)
1
Protease as micromole of tyrosine released min−1 mg−1 protein.
2
Amylase as micromole of maltose released min−1 mg−1 protein.
3
Lipase as units mg−1 protein.

The intestinal and liver activities of protease and amylase did Fish fed BSFLM-­containing diets showed histological effects on
not differ significantly among the diets. Intestinal lipase activity, the liver, which might be explained by chitin in the BSFLM. Chitin
on the contrary, increased with BSFLM supplementation and was has been shown to cause fat build-­up in the liver (Zarantoniello
considerably higher in the T100 diet. Fatty acids have recently et al., 2018). In contrast, supplementation of BSFLM up to 60% re-
been discovered to operate as signalling molecules, regulating placement of FM in Pangasianodon hypophthalmus diets has been
lipid metabolic pathways such as lipases (Papackova & Cahova, shown to have no deleterious effects on hepatic histomorphology.
2015). It is probable that the fatty acids in BSFLM are incompati- A 50 per cent full-­fat BSFL meal supplied in diets resulted in no in-
ble with Pangasianodon hypophthalmus digestion and that the fish flammatory responses in the liver of Zebrafish (Zarantoniello et al.,
must release additional lipases to help with fat breakdown. This 2018). Another two recent studies indicated that including a par-
finding was similar to that found in a study on Monopterus albus tially defatted BSFLM in the diet of rainbow trout (Oncorhynchus
(Hu et al., 2020). mykiss) at levels of 26.4 per cent or 40 per cent had no effect on
 |

13652109, 2022, 6, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/are.15739 by CAPES, Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
2212 SUDHA et al.

F I G U R E 1 Histological appearance
of liver (T0–­T100) stained with
haematoxylin–­eosin stain. Hepatocytes
were loose and polyhedral in shape with
vacuolated cytoplasm, and no obvious
inflammatory cell infiltration was detected
in T0–­T60 diet. Hepatocytes in T80 and
T100 were shown to have congestion of
hepatocytes as compared to T0, T20, T40
and T60

T0 T20

T40 T60

T80 T100

the intestinal histology of the fish (Dumas et al., 2018; Renna et al., fishmeal was replaced with BSFL meal in Atlantic salmon (Belghit
2017). However, hepatic slices from fish given T80 and T100 diets et al., 2019) no changes were found in PCV and Hb. Furthermore,
revealed varying degrees of hepatocyte congestion in this inves- the RBC, Hb and PCV levels obtained were within the range previ-
tigation, Similarly, when the replacement levels of dietary FM by ously reported for C. gariepinus by other researchers (Okore et al.,
defatted BSFLM in the diet of Jian carp approached 75%, Li et al. 2016; Taufek et al., 2016). Increased serum total protein and glob-
(2017) detected minor hepatic necrosis, dietary stress and intestine ulin levels indicate a fish's health and immune function (Fawole
histological damage (Cyprinus carpio var. Jian). Because the results of et al., 2017; Kumar et al., 2007). Chitin contained in insect meal
different research differ, a high substitution of FM by BSFLM in fish has been shown to act as an immunopotentiator in animals, includ-
diets should be avoided if there are any negative effects or harm to ing fish and shrimp (Gasco et al., 2016; Motte et al., 2019; Xiao
hepatic and intestinal health. et al., 2018). However, no significant difference was observed in
Blood analysis has been recognized as an effective approach serum total protein and A/G ratio between fish fed T0, T20, T40
in analysing the effect of component substitution on fish health and T60 diets in the current investigation. The fact that fish fed
status in various studies and species (Adeparusi & Ajayi, 2004; the BSFLM had lower TCHO and TG concentrations than those
Fagbenro et al., 2013; Fawole et al., 2017; Shamna et al., 2017). In fed the FM in this study suggested that dietary BSFLM could lower
the current study, no significant difference in Hb, Ht, RBC, WBC, blood lipid levels. In Jian carp (Cyprinus carpio var. Jian) (Li et al.,
MCH, MCHC and MCV indices was found between the T0, T20, 2017) and European seabass (Dicentrarchus labrax) (Magalhães
T40, T60, T80 and T100 dietary groups, indicating the ability of fish et al., 2017), dietary replacement of FM with BSFL meal resulted in
to use BSFLM without jeopardizing physiological functions such as lower blood TCHO concentration. Hu et al. (2018) also found that
oxygen delivery to important organs, ability to defend the body BSFL meal reduces TG levels in young Japanese seabass. Chitin of
against external contaminants, and overall health. Similarly, when BSFL meal has been shown to have cholesterol-­lowering qualities
 SUDHA et al.

TA B L E 8 Haematological and biochemical parameters of striped catfish juveniles fed different experimental diets

T0 T20 T40 T60 T80 T100 p value

Haematological parameters
Hb (g/dl) 9.37 ± 0.38 9.47 ± 0.31 9.53 ± 0.12 9.27 ± 0.15 9.23 ± 0.15 8.57 ± 0.47 0.313
WBC 1,000/cu mm) 30.13 ± 0.65 30.17 ± 0.6 30.23 ± 0.51 29.83 ± 0.35 30.03 ± 0.12 30.03 ± 0.86 0.963
RBC (million/cu mm) 2.21 ± 0.04 2.23 ± 0.01 2.2 ± 0.01 2.23 ± 0.03 2.21 ± 0.02 2.21 ± 0.03 0.637
Ht (%) 23.6 ± 0.2 23.47 ± 0.35 23.57 ± 0.15 23.47 ± 0.15 23.27 ± 0.15 23.1 ± 0 0.065
MCV (fl) 106.65 ± 2.24 105.07 ± 1.36 107.12 ± 0.71 105.4 ± 0.98 105.12 ± 0.71 104.38 ± 1.44 0.188
MCH (picograms) 42.33 ± 1.21 42.4 ± 1.28 43.34 ± 0.71 41.63 ± 1.17 41.72 ± 0.71 41.27 ± 0.57 0.212
MCHC (g/dl) 39.71 ± 1.62 40.35 ± 0.76 40.46 ± 0.71 39.49 ± 0.89 39.68 ± 0.43 39.54 ± 0.25 0.649
Biochemical parameters
TP (g/dl) 5.06 ± 0.04a 5.04 ± 0.03a 5.11 ± 0.04a 5.04 ± 0.04a 3.85 ± 0.16b 3.73 ± 0.2b <0.001
a a a a b b
ALB (g/dl) 1.19 ± 0.13 1.13 ± 0.02 1.22 ± 0.03 1.1 ± 0.06 0.58 ± 0.05 0.64 ± 0.04 <0.001
GLO (g/dl) 4.46 ± 0.21a 4.42 ± 0.13a 4.53 ± 0.04a 4.2 ± 0.18a 3.37 ± 0.16b 3.55 ± 0.22b <0.001
a a a a b b
A/G ratio 0.27 ± 0.02 0.26 ± 0.01 0.27 ± 0 0.26 ± 0 0.17 ± 0.02 0.18 ± 0.01 <0.001
GLU (mg/dl) 139.2 ± 1.51b 140.94 ± 1.59ab 145.71 ± 1.12a 144.42 ± 2.94a 142.19 ± 1.99ab 143.62 ± 1.6ab 0.012
a a b b b b
TCHO (mg/dl) 168.13 ± 0.64 165.1 ± 0.82 140.5 ± 0.3 140.3 ± 0.87 139.9 ± 0.89 135.57 ± 2.86 <0.001
TG (mg/dl) 506.77 ± 3.69a 509.53 ± 1.12a 455.37 ± 0.97b 433.23 ± 3.33c 435.33 ± 9.48c 430.31 ± 4.26c <0.001

Note: Values are means ± SD (n = 3). Values in the same line with different superscript letters are significantly different (p < 0.05).
| 2213

13652109, 2022, 6, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/are.15739 by CAPES, Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
 |

13652109, 2022, 6, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/are.15739 by CAPES, Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
2214 SUDHA et al.

(a) Myo D related to the level of serum cholesterol to some extent (Kaushik
5
Relative mRNA expression
et al., 1995). However, raising BSFLM to 100% reduces triglyceride
a levels, which could be related to the presence of chitin, which has
4
been shown to have a role in triglyceride hydrolysis (Zhang et al.,

3 2008), thereby boosting lipid utilization.

Aquaculture is a production-­driven industry, and output is de-
2 b bc pendent on muscular growth. As a result, the proliferation of white
bc
bc muscle fibres serves as a growth indicator and is responsible for an
1 c increase in body weight. Adult myoblasts, also known as myosatellite
cells, are myogenic precursor cells that play a role in the plasticity
0 of fish muscle formation (Rowlerson & Veggetti, 2001). As a result,
T0 T20 T40 T60 T80 T100 myogenic regulatory factors (MRFs) play an important role in muscle
Treatment growth control; the MyoD, Myf5, myogenic and MRF4 superfami-
lies all govern muscle growth pathways (Asaduzzaman et al., 2017;
(b) Myogenin Watabe, 2001). Fish growth has been observed to be aided by these
5
Relative mRNA expression

myogenic regulatory elements. Meanwhile, myostatin inhibits mus-

a cle cell development and differentiation and has a deleterious impact
4
on myogenesis (Rescan, 2001). In juveniles of striped catfish, MyoD,
b myogenin and myostatin gene expressions were examined after sev-
3
enty days with varied BSFLM diets. The present study examined the
effect of dietary protein on the gene expression of MyoD, myogenin
2
b b b and myostatin, which are key transcription factors that govern myo-
b satellite. In this study, the relative expression of MyoD and myogenin
1
was higher in fish fed T60 diets than other diets, indicating that re-
0 placing FM with BSFLM at a level up to 60 per cent has a positive im-
T0 T20 T40 T60 T80 T100 pact on fish growth through increased satellite cell proliferation and
Treatment differentiation. The present study observed increased expression of
the MyoD gene in response to dietary protein levels, which adds to
(c) Myostatin our understanding of feed (protein)-­driven myogenesis. Several pre-
2.0
Relative mRNA expression

vious researches attempted to draw a link between muscle growth

a and the MyoD gene. During the early stages of embryogenesis in the
1.5 flounder (Paralichthys olivaceus), MyoD expression was identified in
ab precursor muscle cells (Zhang et al., 2006). During distinct growth
b
ab periods, Johansen and Overturf (2005) found continual differential
1.0 b
b MRF (MyoD, Myf5, myogenin and MRF4) expression in rainbow trout
(Oncorhynchus mykiss) skeletal muscle. Myostatin expression, on the
0.5 contrary, was significantly altered (p < 0.05) and was downregulated
by the treatment. Several studies have found that myostatin has a
0.0 negative influence on fish growth, which was corroborated by the
T0 T20 T40 T60 T80 T100 current study, which found that myostatin relative expression was
Treatment lower than MyoD and myogenin. These findings show that adequate
dietary BSFLM supplementation in the T60 diet reduces myostatin
F I G U R E 2 Relative expression of (a) MyoD, (b) myogenin and (c) expression while increasing fish muscle growth.
myostatin in the white skeletal muscle tissue of striped catfish fed
different levels of BSFLM supplementation. Values are mean ± SD
represented by vertical error bars for each treatment (n = 9).
Different letters indicate significant (p < 0.05) differences among 5 | CO N C LU S I O N
treatments determined using Tukey's test
Juvenile striped catfish fed BSFLM-­supplemented diets improved
the growth performances and feed utilization. Dietary BSFLM
in fish (Chen et al., 2014; Shiau & Yu, 1999). Chitin may interfere supplementation enhanced the relative expression of muscle
with cholesterol absorption by adhering to lipid micelles and re- growth-­related genes. BSFLM has been shown to be a good sub-
ducing their absorption, according to Khoushab and Yamabhai stitute for fishmeal in the diet of striped catfish without affecting
(2010). Furthermore, the level of dietary cholesterol may be growth performances and physiological responses. However, when
 |

13652109, 2022, 6, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/are.15739 by CAPES, Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
SUDHA et al. 2215

replacement by Cirina butyrospermi caterpillar's meal in practical

replacement levels exceed 60 per cent, hepatocytes show histo- diets for Clarias gariepinus fingerlings. Aquaculture Research, 48(10),
pathological damage and a lower value of relative mRNA expression 5243–­5250. https://doi.org/10.1111/are.13337
of muscle growth-­related genes. In conclusion, our study suggests AOAC (2010). Association of official analytical chemists –­Official methods
of analysis (18th ed.). AOAC.
that BSFLM can be used to replace fishmeal protein up to 60 per-
Asaduzzaman, M., Ikeda, D., Abol-­Munafi, A. B., Bulbul, M., Ali, M. E.,
centage without affecting growth performances and feed utilization
Kinoshita, S., Watabe, S., & Kader, M. A. (2017). Dietary supple-
of striped catfish. mentation of inosine monophosphate promotes cellular growth of
muscle and upregulates growth-­related gene expression in Nile ti-
AC K N OW L E D G E M E N T lapia Oreochromis niloticus. Aquaculture, 468, 297–­3 06. https://doi.
org/10.1016/j.aquac​ulture.2016.10.033
I am grateful to the Department of Fisheries, Government of Tamil
Belforti, M., Gai, F., Lussiana, C., Renna, M., Malfatto, V., Rotolo, L.,
Nadu, India, for rendering the support in conducting this study. I & Zoccarato, I. (2015). Tenebrio molitor meal in rainbow trout
sincerely thank Tamil Nadu Dr. J. Jayalalithaa Fisheries University, (Oncorhynchus mykiss) diets: Effects on animal performance, nu-
Nagapattinam, Tamil Nadu, India, for the grants and facilities of- trient digestibility and chemical composition of fillets. Italian
Journal of Animal Science, 14(4), 4170. https://doi.org/10.4081/
fered. I would like to extend my gratefulness to Eco care Agrovet,
ijas.2015.4170
Puducherry, India, for supplying the black soldier fly larval meal. Belghit, I., Liland, N. S., Gjesdal, P., Biancarosa, I., Menchetti, E., Li, Y.,
Waagbø, R., Krogdahl, Å., & Lock, E.-­J. (2019). Black soldier fly lar-
C O N FL I C T O F I N T E R E S T vae meal can replace fish meal in diets of sea-­water phase Atlantic
salmon (Salmo salar). Aquaculture, 503, 609–­619. https://doi.
The authors declare that they have no conflict of interest.
org/10.1016/j.aquac​ulture.2018.12.032
Chen, Y., Zhu, X., Yang, Y., Han, D., Jin, J., & Xie, S. (2014). Effect of dietary
AU T H O R C O N T R I B U T I O N chitosan on growth performance, haematology, immune response,
This study was conducted in cooperation between all authors. intestine morphology, intestine microbiota and disease resistance
in gibel carp (C arassius auratus gibelio). Aquaculture Nutrition, 20(5),
Chandrasekaran Sudha: conducted the feeding trial, analyzed the
532–­546. https://doi.org/10.1111/anu.12106
data and drafted the manuscript. Baboonsundaram Ahilan: con- Cherry, I. S., & Crandall, L. A. Jr (1932). The specificity of pancreatic li-
ceptualized and designed the study, and corrected the manuscript. pase: Its appearance in the blood after pancreatic injury. American
Nathan Felix: formulated the experimental diets and corrected the Journal of Physiology-­Legacy Content, 100, 266–­ 273. https://doi.
org/10.1152/ajple​gacy.1932.100.2.266
manuscript. Arumugam Uma: carried out the gene expression analy-
Clark, J. M. (1964). Experimental biochemistry (p. 228). W. H. Freeman and
sis part and corrected the manuscript. Elangovan Prabu: analysed
Company.
the data for statistical analysis and corrected the manuscript. Cummins, V. C. Jr, Rawles, S. D., Thompson, K. R., Velasquez, A.,
Kobayashi, Y., Hager, J., & Webster, C. D. (2017). Evaluation of black
DATA AVA I L A B I L I T Y S TAT E M E N T soldier fly (Hermetia illucens) larvae meal as partial or total replace-
ment of marine fish meal in practical diets for Pacific white shrimp
The data that support the findings of this study are available within
(Litopenaeus vannamei). Aquaculture, 473, 337–­ 3 44. https://doi.
the article. org/10.1016/j.aquac​ulture.2017.02.022
Devic, E., Leschen, W., Murray, F., & Little, D. C. (2018). Growth perfor-
ORCID mance, feed utilization and body composition of advanced nursing
Nile tilapia (Oreochromis niloticus) fed diets containing Black Soldier
Chandrasekaran Sudha https://orcid.org/0000-0003-3807-0234
Fly (Hermetia illucens) larvae meal. Aquaculture Nutrition, 24(1), 416–­
Nathan Felix https://orcid.org/0000-0003-3530-5923 423. https://doi.org/10.1111/anu.12573
Arumugam Uma https://orcid.org/0000-0002-9429-4075 Diener, S., Zurbrügg, C., & Tockner, K. (2009). Conversion of organic
Elangovan Prabu https://orcid.org/0000-0002-1612-1638 material by black soldier fly larvae: Establishing optimal feeding
rates. Waste Management & Research, 27(6), 603–­610. https://doi.
org/10.1177/07342​42X09​103838
REFERENCES Drabkin, D. L. (1946). Spectrophotometric studies XIV. The crystallo-
Adeoye, A. A., Akegbejo-­Samsons, Y., Fawole, F. J., & Davies, S. J. (2020). graphic and optical properties of the hemoglobin of man in com-
Preliminary assessment of black soldier fly (Hermetia illucens) lar- parison with those of other species. Journal of Biological Chemistry,
val meal in the diet of African catfish (Clarias gariepinus): Impact 164(2), 703–­723.
on growth, body index, and hematological parameters. Journal Dumas, A., Raggi, T., Barkhouse, J., Lewis, E., & Weltzien, E. (2018). The
of the World Aquaculture Society, 51(4), 1024–­ 1033. https://doi. oil fraction and partially defatted meal of black soldier fly larvae
org/10.1111/jwas.12691 (Hermetia illucens) affect differently growth performance, feed ef-
Adeparusi, E. O., & Ajayi, A. D. (2004). Haematological characteristics of ficiency, nutrient deposition, blood glucose and lipid digestibility
Nile tilapia (Oreochromis niloticus) fed differently processed lima of rainbow trout (Oncorhynchus mykiss). Aquaculture, 492, 24–­3 4.
bean (Phaseolus lunatus L.) diets. Journal of Research Science and https://doi.org/10.1016/j.aquac​ulture.2018.03.038
Management, 2(1), 73–­8 0. Fagbenro, O. A., Adeparusi, E. O., & Jimoh, W. A. (2013). Haematological
Alegbeleye, W. O., Obasa, S. O., Olude, O. O., Otubu, K., & Jimoh, W. profile of blood of African catfish (Clarias gariepinus, Burchell, 1822)
(2012). Preliminary evaluation of the nutritive value of the varie- fed sunflower and sesame meal based diets. Journal of Fisheries and
gated grasshopper (Zonocerus variegatus L.) for African catfish Clarias Aquatic Science, 8, 80–­86. http://hdl.handle.net/1834/38229
gariepinus (Burchell. 1822) fingerlings. Aquaculture Research, 43(3), FAO (2018). Food and Agricultural Organization of the United Nations. The
412–­420. https://doi.org/10.1111/j.1365-­2109.2011.02844.x State of World Fisheries and Aquaculture FAO.
Anvo, M. P. M., Aboua, B. R. D., Compaoré, I., Sissao, R., Zoungrana-­ Fawole, F., Sahu, N., Jain, K., Gupta, S., Rajendran, K., Shamna, N., &
Kaboré, C. Y., Kouamelan, E. P., & Toguyéni, A. (2017). Fish meal Poojary, N. (2017). Haemato-­biochemical, non-­specific immunity,
 |

13652109, 2022, 6, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/are.15739 by CAPES, Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
2216 SUDHA et al.

antioxidant capacity and histopathological changes in Labeo rohita 2−ΔΔCT method. Methods, 25(4), 402–­4 08. https://doi.org/10.1006/
fingerlings fed rubber protein isolate. Fish Physiology & Biochemistry, meth.2001.1262
43(3), https://doi.org/10.1111/are.12829 Lock, E., Arsiwalla, T., & Waagbø, R. (2016). Insect larvae meal as an al-
Gasco, L., Henry, M., Piccolo, G., Marono, S., Gai, F., Renna, M., Lussiana, ternative source of nutrients in the diet of Atlantic salmon (Salmo
C., Antonopoulou, E., Mola, P., & Chatzifotis, S. (2016). Tenebrio salar) postsmolt. Aquaculture Nutrition, 22(6), 1202–­1213. https://
molitor meal in diets for European sea bass (Dicentrarchus labrax doi.org/10.1111/anu.12343
L.) juveniles: Growth performance, whole body composition and in Lowry, O., Rosebrough, N., Farr, A., & Randall, R. (1951). Protein mea-
vivo apparent digestibility. Animal Feed Science and Technology, 220, surement with the Folin phenol reagent. Journal of Biological
34–­45. https://doi.org/10.1016/j.anife​edsci.2016.07.003 Chemistry, 193, 265–­275. https://doi.org/10.1016/S0021​
Henry, M., Gasco, L., Piccolo, G., & Fountoulaki, E. (2015). Review on the -­9258(19)52451​- ­6
use of insects in the diet of farmed fish: Past and future. Animal Magalhães, R., Sánchez-­López, A., Leal, R. S., Martínez-­Llorens, S., Oliva-­
Feed Science and Technology, 203, 1–­22. https://doi.org/10.1016/j. Teles, A., & Peres, H. (2017). Black soldier fly (Hermetia illucens)
anife​edsci.2015.03.001 pre-­pupae meal as a fish meal replacement in diets for European
Hu, J., Wang, G., Mo, W., Huang, Y., Li, G., Li, Z., & Zhao, H. (2018). Effects seabass (Dicentrarchus labrax). Aquaculture, 476, 79–­85. https://doi.
of fish meal replacement by black soldier fly (Hermetia illucens L.) org/10.1016/j.aquac​ulture.2017.04.021
larvae meal on growth performance, body composition, plasma bio- Makkar, H., Tran, G., Heuzé, V., & Ankers, P. (2014). Uso de insectos como
chemical indexes and tissue structure of juvenile Lateolabrax japoni- alimento para animales. Animal Feed Sciences & Technologies, 197, 1–­
cas. Chinese Journal of Animal Nutrition, 30(2), 613–­623. 33. https://doi.org/10.1016/j.anife​edsci.2014.07.008
Hu, Y., Huang, Y., Tang, T., Zhong, L., Chu, W., Dai, Z., Chen, K., & Hu, Y. Motte, C., Rios, A., Lefebvre, T., Do, H., Henry, M., & Jintasataporn,
(2020). Effect of partial black soldier fly (Hermetia illucens L.) lar- O. (2019). Replacing fish meal with defatted insect meal (Yellow
vae meal replacement of fish meal in practical diets on the growth, Mealworm Tenebrio molitor) improves the growth and immunity
digestive enzyme and related gene expression for rice field eel of pacific white shrimp (Litopenaeus vannamei). Animals, 9(5), 258.
(Monopterus albus). Aquaculture Reports, 17, 100345. https://doi. https://doi.org/10.3390/ani90​50258
org/10.1016/j.aqrep.2020.100345 Myers, H. M., Tomberlin, J. K., Lambert, B. D., & Kattes, D. (2014).
Ipinmoroti, M., Akanmu, O., & Iyiola, A. (2019). Utilisation of house fly Development of black soldier fly (Diptera: Stratiomyidae) larvae fed
maggots (Musca domestica) as replacement for fish meal in the diets dairy manure. Environmental Entomology, 37(1), 11–­15. https://doi.
of Clarias gariepinus juveniles. Journal of Insects as Food and Feed, org/10.1093/ee/37.1.11
5(2), 69–­76. https://doi.org/10.3920/JIFF2​017.0057 Nelson, D. A., & Morris, M. W. (1989). Basic methodology: Hematology
Ishida, Y., Fujita, T., & Asai, K. (1981). New detection and separation and coagulation, part IV. In D. A. Nelson, & J. B. Henry (Eds.), Clinical
method for amino acids by high-­performance liquid chromatog- diagnosis, management by laboratory methods seventeenth (pp. 578–­
raphy. Journal of Chromatography A, 204, 143–­ 148. https://doi. 625). W.B. Saunders Company.
org/10.1016/S0021​-­9673(00)81650​-­7 Newton, G., Sheppard, D., Watson, D., Burtle, G., Dove, C., Tomberlin,
Johansen, K. A., & Overturf, K. (2005). Sequence, conservation, and quan- J., & Thelen, E. (2005). The black soldier fly, Hermetia illucens, as
titative expression of rainbow trout Myf5. Comparative Biochemistry a manure management/resource recovery tool. In Paper presented
and Physiology Part B: Biochemistry and Molecular Biology, 140(4), at the Symposium on the state of the science of Animal Manure and
533–­541. https://doi.org/10.1016/j.cbpc.2004.11.016 Waste Management.
Karapanagiotidis, I. T., Daskalopoulou, E., Vogiatzis, I., Rumbos, C., Ogunji, J., Kloas, W., Wirth, M., Neumann, N., & Pietsch, C. (2008).
Mente, E., & Athanassiou, C. (2014). Substitution of fishmeal by fly Effect of housefly maggot meal (magmeal) diets on the perfor-
Hermetia illucens prepupae meal in the diet of gilthead seabream mance, concentration of plasma glucose, cortisol and blood char-
(Sparus aurata). Proceedings of the HydroMedit, 110–­114. acteristics of Oreochromis niloticus fingerlings. Journal of Animal
Kaushik, S., Cravedi, J. P., Lalles, J., Sumpter, J., Fauconneau, B., & Physiology and Animal Nutrition, 92(4), 511–­ 518. https://doi.
Laroche, M. (1995). Partial or total replacement of fish meal by org/10.1111/j.1439-­0396.2007.00745.x
soybean protein on growth, protein utilization, potential estro- Okore, O., Ekedo, C., Ubiaru, P., & Uzodinma, K. (2016). Growth and
genic or antigenic effects, cholesterolemia and flesh quality in rain- haematological studies of African catfish (Clarias gariepinus) ju-
bow trout, Oncorhynchus mykiss. Aquaculture, 133(3–­4), 257–­274. veniles fed with Housefly larva (Musca domestica) as feed sup-
https://doi.org/10.1016/0044-­8 486(94)00403​-­B plement. International Journal of Agriculture and Earth Science,
Khoushab, F., & Yamabhai, M. (2010). Chitin research revisited. Marine 2(3), 21–­3 0.
Drugs, 8(7), 1988–­2012. https://doi.org/10.3390/md807​1988 Papackova, Z., & Cahova, M. (2015). Fatty acid signaling: The new function
Kroeckel, S., Harjes, A.-­G ., Roth, I., Katz, H., Wuertz, S., Susenbeth, A., of intracellular lipases. International Journal of Molecular Sciences,
& Schulz, C. (2012). When a turbot catches a fly: Evaluation of a 16(2), 3831–­3855. https://doi.org/10.3390/ijms1​6023831
pre-­pupae meal of the Black Soldier Fly (Hermetia illucens) as fish Prabu, E., Felix, N., & Uma, A. (2021). Dietary arginine requirement in
meal substitute—­Growth performance and chitin degradation in diets of GIFT strain of Nile tilapia, Oreochromis niloticus: Effects
juvenile turbot (Psetta maxima). Aquaculture, 364, 345–­352. https:// on growth performance, whole-­body composition, growth-­related
doi.org/10.1016/j.aquac​ulture.2012.08.041 gene expression and haemato-­biochemical responses. Aquaculture
Kumar, V., Sahu, N., Pal, A., & Kumar, S. (2007). Immunomodulation of Research. https://doi.org/10.1111/are.15315
Labeo rohita juveniles due to dietary gelatinized and non-­gelatinized Renna, M., Schiavone, A., Gai, F., Dabbou, S., Lussiana, C., Malfatto, V.,
starch. Fish & Shellfish Immunology, 23(2), 341–­ 353. https://doi. Prearo, M., Capucchio, M. T., Biasato, I., Biasibetti, E., De Marco, M.,
org/10.1016/j.fsi.2006.11.008 Brugiapaglia, A., Zoccarato, I., & Gasco, L. (2017). Evaluation of the
Li, S., Ji, H., Zhang, B., Zhou, J., & Yu, H. (2017). Defatted black soldier suitability of a partially defatted black soldier fly (Hermetia illucens
fly (Hermetia illucens) larvae meal in diets for juvenile Jian carp L.) larvae meal as ingredient for rainbow trout (Oncorhynchus mykiss
(Cyprinus carpio var. Jian): Growth performance, antioxidant en- Walbaum) diets. Journal of Animal Science and Biotechnology, 8(1),
zyme activities, digestive enzyme activities, intestine and hepato- 1–­13. https://doi.org/10.1186/s4010​4-­017-­0191-­3
pancreas histological structure. Aquaculture, 477, 62–­70. https:// Rescan, P.-­Y. (2001). Regulation and functions of myogenic regula-
doi.org/10.1016/j.aquac​ulture.2017.04.015 tory factors in lower vertebrates. Comparative Biochemistry and
Livak, K. J., & Schmittgen, T. D. (2001). Analysis of relative gene Physiology Part B: Biochemistry and Molecular Biology, 130(1), 1–­12.
expression data using real-­ time quantitative PCR and the https://doi.org/10.1016/S1096​- ­4959(01)00412​-­2
 |

13652109, 2022, 6, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/are.15739 by CAPES, Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
SUDHA et al. 2217

Rowlerson, A., & Veggetti, A. (2001). Cellular mechanisms of post-­ Wang, L., Li, J., Jin, J., Zhu, F., Roffeis, M., & Zhang, X. (2017). A com-
embryonic muscle growth in aquaculture species. Muscle develop- prehensive evaluation of replacing fishmeal with housefly (Musca
ment and growth (pp. 103–­140). Academic Press. domestica) maggot meal in the diet of Nile tilapia (Oreochromis ni-
Rumpold, B. A., & Schlüter, O. K. (2013). Potential and challenges of loticus): Growth performance, flesh quality, innate immunity and
insects as an innovative source for food and feed production. water environment. Aquaculture Nutrition, 23(5), 983–­993. https://
Innovative Food Science & Emerging Technologies, 17, 1–­11. https:// doi.org/10.1111/anu.12466
doi.org/10.1016/j.ifset.2012.11.005 Watabe, S. (2001). Myogenic regulatory factors. In I. A. Johnston (Ed.),
Sealey, W. M., Gaylord, T. G., Barrows, F. T., Tomberlin, J. K., McGuire, Muscle development and growth (pp. 19–­41). Academic Press.
M. A., Ross, C., & St-­Hilaire, S. (2011). Sensory analysis of rainbow Wintrobe, M. M. (1934). Variations in the size and hemoglobin con-
trout, Oncorhynchus mykiss, fed enriched black soldier fly pre- tent of erythrocytes in the blood of various vertebrates. Folia
pupae, Hermetia illucens. Journal of the World Aquaculture Society, Haematologica, 51(32), 32–­49.
42(1), 34–­45. https://doi.org/10.1111/j.1749-­7345.2010.00441.x Xiao, X., Jin, P., Zheng, L., Cai, M., Yu, Z., Yu, J., & Zhang, J. (2018). Effects
Shamna, N., Sardar, P., Sahu, N. P., Phulia, V., Rajesh, M., Fawole, F. J., Pal, of black soldier fly (Hermetia illucens) larvae meal protein as a
A. K., & Angel, G. (2017). Heamato-­immunological and physiological fishmeal replacement on the growth and immune index of yellow
responses of Labeo rohita fingerlings to dietary fermented Jatropha catfish (Pelteobagrus fulvidraco). Aquaculture Research, 49(4), 1569–­
curcas protein concentrate. Animal Feed Science and Technology, 1577. https://doi.org/10.1111/are.13611
232, 198–­206. https://doi.org/10.1016/j.anife​edsci.2016.10.020 Yu, G., Chen, Y., Yu, Z., & Cheng, P. (2009). Research progress on the
Shiau, S.-­Y., & Yu, Y.-­P. (1999). Dietary supplementation of chitin and chi- larvae and prepupae of black soldier fly Hermetia illucens used as
tosan depresses growth in tilapia, Oreochromis niloticus × O. aureus. animal feedstuff. Chinese Bulletin of Entomology, 46(1), 41–­45.
Aquaculture, 179(1–­4), 439–­4 46. https://doi.org/10.1016/S0044​ Zarantoniello, M., Bruni, L., Randazzo, B., Vargas, A., Gioacchini, G., Truzzi,
-­8 486(99)00177​-­5 C., & Cardinaletti, G. (2018). Partial dietary inclusion of Hermetia illu-
Sogbesan, A., & Ugwumba, A. (2008). Nutritional evaluation of termite cens (Black Soldier Fly) full-­fat prepupae in zebrafish feed: Biometric,
(Macrotermes subhyalinus) meal as animal protein supplements histological, biochemical, and molecular implications. Zebrafish, 15(5),
in the diets of Heterobranchus longifilis (Valenciennes, 1840) fin- 519–­532. https://doi.org/10.1089/zeb.2018.1596
gerlings. Turkish Journal of Fisheries and Aquatic Sciences, 8(1), Zhang, J., Liu, J., Li, L., & Xia, W. (2008). Dietary chitosan improves hyper-
149–­158. cholesterolemia in rats fed high-­fat diets. Nutrition Research, 28(6),
Ssepuuya, G., Namulawa, V., Mbabazi, D., Mugerwa, S., Fuuna, P., 383–­390. https://doi.org/10.1016/j.nutres.2007.12.013
Nampijja, Z., Ekesi, S., Fiaboe, K., & Nakimbugwe, D. (2017). Use of Zhang, Y., Tan, X., Zhang, P.-­J., & Xu, Y. (2006). Characterization of muscle-­
insects for fish and poultry compound feed in sub-­Saharan Africa–­a regulatory gene, MyoD, from flounder (Paralichthys olivaceus) and analysis
systematic review. Journal of Insects as Food and Feed, 3(4), 289–­ of its expression patterns during embryogenesis. Marine Biotechnology,
302. https://doi.org/10.3920/JIFF2​017.0007 8(2), 139–­148. https://doi.org/10.1007/s1012​6-­005-­5042-­0
St-­Hilaire, S., Sheppard, C., Tomberlin, J. K., Irving, S., Newton, L.,
Mcguire, M. A., Mosley, E. E., Hardy, R. W., & Sealey, W. (2007).
Fly prepupae as a feedstuff for rainbow trout, Oncorhynchus mykiss.
How to cite this article: Sudha, C., Ahilan, B., Felix, N., Uma,
Journal of the World Aquaculture Society, 38(1), 59–­67. https://doi.
org/10.1111/j.1749-­7345.2006.00073.x
A., & Prabu, E. (2022). Effects of dietary protein substitution
Taufek, N. M., Aspani, F., Muin, H., Raji, A. A., Razak, S. A., & Alias, Z. of fishmeal with black soldier fly larval meal on growth and
(2016). The effect of dietary cricket meal (Gryllus bimaculatus) on physiological responses of juvenile striped catfish,
growth performance, antioxidant enzyme activities, and haemato- Pangasianodon hypophthalmus. Aquaculture Research, 53,
logical response of African catfish (Clarias gariepinus). Fish Physiology
2204–­2217. https://doi.org/10.1111/are.15739
and Biochemistry, 42(4), 1143–­1155. https://doi.org/10.1007/s1069​
5-­016-­0204-­8