University of Nebraska - Lincoln

DigitalCommons@University of Nebraska - Lincoln

Papers in Microbiology Papers in the Biological Sciences

4-1-2007

Effect of Farnesol on a Mouse Model of Systemic Candidiasis,

Determined by Use of a DPP3 Knockout Mutant of Candida
albicans
Dhammika H.M.L.P. Navarathna
University of Nebraska-Lincoln

Jacob M. Hornby
University of Nebraska-Lincoln, [email protected]

Navasona Krishnan
University of Nebraska-Lincoln

Anne M. Parkhurst
University of Nebraska-Lincoln, [email protected]

Gerald E. Duhamel
University of Nebraska-Lincoln, [email protected]

See next page for additional authors

Follow this and additional works at: https://digitalcommons.unl.edu/bioscimicro

Part of the Microbiology Commons

Navarathna, Dhammika H.M.L.P.; Hornby, Jacob M.; Krishnan, Navasona; Parkhurst, Anne M.; Duhamel,
Gerald E.; and Nickerson, Kenneth W., "Effect of Farnesol on a Mouse Model of Systemic Candidiasis,
Determined by Use of a DPP3 Knockout Mutant of Candida albicans" (2007). Papers in Microbiology. 51.
https://digitalcommons.unl.edu/bioscimicro/51

This Article is brought to you for free and open access by the Papers in the Biological Sciences at
DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Papers in Microbiology by an
authorized administrator of DigitalCommons@University of Nebraska - Lincoln.
Authors
Dhammika H.M.L.P. Navarathna, Jacob M. Hornby, Navasona Krishnan, Anne M. Parkhurst, Gerald E.
Duhamel, and Kenneth W. Nickerson

This article is available at DigitalCommons@University of Nebraska - Lincoln: https://digitalcommons.unl.edu/

bioscimicro/51
INFECTION AND IMMUNITY, Apr. 2007, p. 1609–1618 Vol. 75, No. 4
0019-9567/07/$08.00⫹0 doi:10.1128/IAI.01182-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Effect of Farnesol on a Mouse Model of Systemic Candidiasis,

Determined by Use of a DPP3 Knockout Mutant of
Candida albicans䌤
Dhammika H. M. L. P. Navarathna,1,2 Jacob M. Hornby,1† Navasona Krishnan,4 Anne Parkhurst,3
Gerald E. Duhamel,2 and Kenneth W. Nickerson1*
School of Biological Sciences,1 Department of Veterinary and Biomedical Sciences,2 Department of Statistics,3 and Department of
Biochemistry,4 University of Nebraska, Lincoln, Nebraska
Received 27 July 2006/Returned for modification 2 September 2006/Accepted 20 January 2007

This work extends our previous observation that the fungus Candida albicans secretes micromolar levels of

Downloaded from iai.asm.org at UNIV OF NEBRASKA-LINCOLN on September 5, 2007

farnesol and that accumulation of farnesol in vitro prevents the yeast-to-mycelium conversion in a quorum-
sensing manner. What does farnesol do in vivo? The purpose of this study was to determine the role of farnesol
during infection with a well-established mouse model of systemic candidiasis with C. albicans A72 administered
by tail vein injection. This question was addressed by altering both endogenous and exogenous farnesol. For
endogenous farnesol, we created a knockout mutation in DPP3, the gene encoding a phosphatase which
converts farnesyl pyrophosphate to farnesol. This mutant (KWN2) produced six times less farnesol and was ca.
4.2 times less pathogenic than its SN152 parent. The strain with DPP3 reconstituted (KWN4) regained both
its farnesol production levels and pathogenicity. These mutants (KWN1 to KWN4) retained their full dimor-
phic capability. With regard to exogenous farnesol, farnesol was administered either intraperitoneally (i.p.) or
orally in the drinking water. Mice receiving C. albicans intravenously and farnesol (20 mM) orally had
enhanced mortality (P < 0.03). Similarly, mice (n ⴝ 40) injected with 1.0 ml of 20 mM farnesol i.p. had
enhanced mortality (P < 0.03), and the onset of mortality was 30 h sooner than for mice which received a
control injection without farnesol. The effect of i.p. farnesol was more pronounced (P < 0.04) when mice were
inoculated with a sublethal dose of C. albicans. These mice started to die 4 days earlier, and the percent survival
on day 6 postinoculation (p.i.) was five times lower than for mice receiving C. albicans with control i.p.
injections. In all experiments, mice administered farnesol alone or Tween 80 alone remained normal through-
out a 14-day observation period. Finally, beginning at 12 h p.i., higher numbers of C. albicans cells were
detected in kidneys from mice receiving i.p. farnesol than in those from mice receiving control i.p. injections.
Thus, reduced endogenous farnesol decreased virulence, while providing exogenous farnesol increased viru-
lence. Taken together, these data suggest that farnesol may play a role in disease pathogenesis, either directly
or indirectly, and thus may represent a newly identified virulence factor.

Candida albicans is a dimorphic commensal fungus which is (32) and evasion of host defense mechanisms (21); also, mu-
localized primarily in the gastrointestinal tract (20). It is a tants which can be regulated in vivo in their ability to undergo
medically important opportunistic pathogen, particularly for the yeast-to-hypha transition were avirulent under conditions
immunocompromised individuals (16), and can invade a wide that inhibited this transition (43); (ii) phenotypic switching
range of organ systems during systemic infections. For healthy, (47)—vaginal candidiasis is increased by high-frequency
immunocompetent individuals, it is an opportunistic pathogen switching between white and opaque colony morphologies
only. However, Calderone and Gow (6), Navarro-Garcia et al. (48); (iii) epithelial adhesion—King et al. (17) first demon-
(28), Naglik et al. (26), and Odds et al. (33) have detailed the strated that C. albicans cells have greater adherence than do
contributions of virulence factors in candidiasis. These viru- cells of other Candida species, and their ability to interact with
lence factors could either promote Candida invasion or affect mucosal epithelia correlates with their relative virulence (6);
host defense mechanisms. It is likely that the virulence of C. and (iv) production of extracellular enzymes, both membrane-
albicans is multifactorial. Therefore, pathogenesis is the sum of
damaging phospholipase B (1, 22) and the secretory aspartyl
the attributes of the fungus, environmental conditions, and the
proteases. Secretory aspartyl proteases are expressed during
effectiveness of host defenses (6, 26, 28, 33). Virulence factors
human disease and are thought to be important virulence de-
which have been recognized so far include the following: (i)
terminants (8, 26, 39).
morphogenesis—yeast-to-hypha switching is associated with
Recently Hornby et al. (12) identified farnesol as an extra-
pathogenesis (5), presumably because it enables tissue invasion
cellular quorum-sensing molecule produced by C. albicans, and
these findings were independently confirmed by others (35,
* Corresponding author. Mailing address: School of Biological Sci- 36). Farnesol prevented mycelial development under growing
ences, University of Nebraska, Lincoln, NE 68588-0666. Phone: (402) conditions (12) and in a differentiation assay using three chem-
472-2253. Fax: (402) 472-8722. E-mail: [email protected].
ically distinct triggers for germ tube formation: L-proline, N-
† Present address: Division of Natural Sciences, Lewis-Clark State
College, Lewiston, ID 83501. acetylglucosamine, or serum (12). For all in vitro assays, far-
䌤
Published ahead of print on 5 February 2007. nesol prevented the yeast-to-mycelium conversion, resulting in

1609
1610 NAVARATHNA ET AL. INFECT. IMMUN.

actively budding yeasts without influencing cellular growth aspen shavings as bedding material (laboratory-grade Sano-Chips; Harlan Tek-
rates (12). Recognizing that free farnesol is not normally de- lad, Madison, WI), and maintained on a 12-h light/dark cycle in heated, ther-
mostatically controlled rooms for the duration of the studies. The mice were fed
tected in human plasma (41), Hornby et al. (12) proposed two a commercial rodent diet (4% Mouse/Rat Diet 7001; Harlan Teklad, Madison,
competing hypotheses regarding the role of farnesol in disease WI) ad libitum. Tap water was provided in glass bottles fitted with stainless-steel
pathogenesis. The first hypothesis suggested that the shift from nipples mounted in rubber corks. After a 7- to 10-day observation period, each
yeasts to mycelia might be a critical step in pathogenesis and group of mice was inoculated intravenously in the lateral caudal tail vein using a
27-gauge needle with 0.1 ml containing the appropriate concentration of C.
that exogenous farnesol could block this transition, thus acting
albicans cells. The degree of clinical illness in each mouse was evaluated three
as a therapeutic compound. An alternate hypothesis suggested times daily. In each experiment, mice that had severe clinical signs of illness were
that the farnesol excreted during infection would alter the euthanized immediately by placing them in a closed chamber filled with CO2 gas
membrane fluidity of host cells, allowing C. albicans to pene- and processed for complete necropsy and collection of tissues for histopatho-
trate host tissues and thus indirectly acting as a virulence fac- logical, microbiological, and toxicological examinations. At the conclusion of the
experiment, all remaining mice were similarly euthanized for complete necropsy.
tor. The latter model is based on the lipophilic properties of
The experimental protocol, housing, and care of the mice were in accordance
free farnesol, which would favor membrane localization. with approved guidelines of the University of Nebraska—Lincoln Institutional
The idea that farnesol might promote virulence is supported Animal Care and Use Committee.
by a recent study from our laboratory (27) on the pathogenicity Farnesol administration. Commercial mixed isomers or E,E-farnesol (Sigma,
St. Louis, MO) was diluted in 0.5% (vol/vol) of Tween 80 (Sigma) in sterile,

Downloaded from iai.asm.org at UNIV OF NEBRASKA-LINCOLN on September 5, 2007

of C. albicans cells pretreated with subinhibitory concentra-
nonpyrogenic saline. The mixed isomers were used when farnesol was adminis-
tions (0.5 to 1 ␮M) of fluconazole. Previous studies (14) indi- tered orally. All other experiments used E,E-farnesol. The solubility of farnesol
cated that these cells secreted 10 times more farnesol than did in water is only 1.2 mM (18), and therefore, Tween 80 was used to increase the
untreated cells. Significantly, these fluconazole-pretreated cells concentration of farnesol which could be used. Farnesol (20 mM) was adminis-
were also 4.2 to 8.5 times more lethal (P ⬍ 0.001) than un- tered either orally in the drinking water (without saline) or by intraperitoneal
(i.p.) injections. Mice received 1.0 ml of 20 mM farnesol (4.4 mg) by intraperi-
treated cells in a mouse tail vein injection model of dissemi-
toneal (i.p.) injection. Water intake was monitored daily by the weight of the
nated candidiasis (27). One explanation, but certainly not the water bottles for both the control and treated mice.
only explanation, for this enhanced pathogenicity is that it is DPP3 knockout. To knock out the DPP3 gene, we adapted the strategy re-
caused in some unknown fashion by the excess farnesol ex- ported by Noble and Johnson (31) using strain SN152, which is auxotrophic for
creted by the treated cells (14, 27). arginine, leucine, and histidine. This strategy is shown in Fig. 1. See Table 1 for
the sequences of all PCR primers. The sequences of both copies of DPP3 and
The purpose of the present study was to determine whether their respective flanking regions are identical in the diploid C. albicans genome
farnesol affected the progression of disseminated candidiasis (Candida DB and CGD databases). The first step of the scheme involved am-
with a well-established mouse model and, if it did so, whether plification of the two 350-bp flanking regions of DPP3 using a template of
it would act in a therapeutic or virulence-promoting manner. SC5314 genomic DNA and primers 1 and 3 or 4 and 6 (Fig. 1) in separate
reactions. These primers are designated DPP1, -3, -4, and -6, respectively, in
We analyzed the effect of farnesol administered by different
Table 1.
routes, both endogenous and exogenous, and concluded that Plasmids pSN40 (containing Candida maltosa LEU2) and pSN52 (containing
farnesol excretion contributes to the virulence of C. albicans. Candida dubliniensis HIS1), kindly provided by Alexander Johnson, were trans-
This is the first time that a fungal quorum-sensing molecule has formed into Escherichia coli cells, and following growth, the plasmids were
been suggested to play a role in C. albicans infection. It is also harvested. Universal primers 2 and 5 were used to amplify the HIS1 and LEU2
cassettes from these plasmids (31). The 5⬘ tails of primers 2 and 3 and primers
the first investigation of DPP3 gene function in C. albicans, 4 and 5 are complementary, as is required for the fusion reaction. The upstream
showing its role in farnesol production. and downstream 350-bp sequences for DPP3 and the respective selectable mark-
ers (His1 or Leu2) were combined, and the fusion products were amplified with
primers 1 and 6 (Fig. 1B).
MATERIALS AND METHODS PCR conditions to make the DNA fragments required for the DPP3 gene
C. albicans strain and growth conditions. Candida albicans strain A72 (ATCC disruption were as follows. In the first round of PCRs, 50-␮l reaction mixtures
MYA-2430) is a well-characterized farnesol-producing and farnesol-responsive combined 1 ␮l of Klen Tac LA DNA polymerase (BD Bioscience) in 1⫻ Klen
strain that has been used in previous in vitro studies (12, 13, 27, 45). This strain Tac buffer with 3 ␮l of 10 mM deoxynucleoside triphosphate, 1 ␮l of each primer
was originally isolated from a patient by Antonio Cassone (Rome, Italy). C. (100 ng/␮l), and 1 ␮l of template DNA. The template for the flanking sequences
albicans strains 10231 and SN152 were obtained from the American Type Cul- was SC5314 genomic DNA, and the templates for the C. maltosa LEU2 and C.
ture Collection (Rockville, MD) and Alexander Johnson, respectively. For chal- dubliniensis HIS1 markers were pSN40 and pSN52, respectively. The reaction
lenge, C. albicans cells were grown for 24 to 30 h in 50 ml of mGSB medium at conditions were 93°C for 5 min and then 35 cycles of 93°C for 30 s, 45°C for 45 s,
30°C with aeration as previously described (12). For strains with auxotrophic and 72°C for 3 min, followed by a final 72°C for 10 min. All products were gel
requirements, mGSB was supplemented with the required amino acid at 40 purified on a 1% agarose gel, and the QIAquick gel extraction kit (QIAGEN)
␮g/ml, i.e., Arg for KWN2, Arg and Leu for KWN1, Arg and His for KWN3, and was used to obtain ultrapurified DNA fragments. The PCR conditions for the
Arg, Leu, and His for SN152 and KWN4. Cells were harvested by centrifugation fusion reactions were identical to the above method except that the PCR elon-
at 4,750 ⫻ g for 10 min and washed three times with 50 ml of sterile, nonpyro- gation reaction was extended to 72°C for 4.5 min. Template DNA consisted of 1
genic normal saline, before adjusting to the proper concentration in nonpyro- ␮l of the upstream and downstream fragments and a marker DNA fragment (C.
genic sterile saline (Abbott Laboratories, North Chicago) using a Petroff- maltosa LEU2 or C. dubliniensis HIS1). Because of the complementary overhangs
Hausser counter. All strains were tested in vitro, i.e., stimulation by created in the initial DNA products, the fragments and markers anneal together.
N-acetylglucosamine at 37°C (12), to be sure that their germ tube-forming ability Primers 1 and 6 amplified the fusion reactions (Fig. 1B), whereupon the fusion
was ⱖ95%. Samples were stored at 4°C overnight prior to injection. For strain PCR products were gel purified using the QIAquic gel extraction kit (QIAGEN).
A72, the 50% lethal doses (LD50s) were found to be identical for cells stored The HIS1-containing fusion product was transformed into SN152 using the
overnight and cells which were used immediately. Farnesol concentrations in the lithium acetate method (Fig. 1A). Transformants were plated on selective me-
culture supernatants were determined by gas chromatography/mass spectrometry dium (yeast nitrogen base without amino acids but with arginine and leucine)
as described previously (12–14). where only transformed cells will grow. KWN1 was selected.
Mice and their inoculation with C. albicans. Mouse infections followed the Genomic DNA from the single-copy-deleted mutant (KWN1) was harvested
procedures recommended by Odds et al. (34). Outbred, 4- to 6-week-old (20 to and checked for the correct insertion into one copy of DPP3 (Fig. 2, lanes B and
25 g), CF-1 female mice obtained from a commercial supplier (Charles River C). After confirming the single-copy knockout, the fusion product with the C.
Laboratories, Wilmington, MA) were randomly allocated to groups of five to six maltosa LEU2 marker was transformed into KWN1 to knock out the other allele
animals and placed in polycarbonate cages with stainless-steel wire tops, using of DPP3. Transformants were plated on selective medium (yeast nitrogen base
VOL. 75, 2007 FARNESOL AND VIRULENCE IN CANDIDEMIA 1611

FIG. 1. Strategy used to disrupt and then reconstitute C. albicans DPP3. It merges the fusion PCR and heterologous marker protocols of Noble Downloaded from iai.asm.org at UNIV OF NEBRASKA-LINCOLN on September 5, 2007
and Johnson (31) with the SAT1 flipper protocols of Reu␤ et al. (37). (A) Schematic diagram showing the method used to disrupt both alleles of
DPP3. (B) Construction of disruption fragments for homologous recombination. Primers 1 and 3 and primers 4 and 6 were used to amplify the
350-bp flanking sequences upstream and downstream of DPP3, respectively. Primers 2 and 5 were used to amplify the two selectable markers. Red
and green tails of primers are complementary sequences (31) needed for mutual primed synthesis in the fusion reaction. (C) 5⬘ and 3⬘ junctions
of the selectable marker integration sites were confirmed using the primers mentioned. (D) Structure of the deletion cassette from pSFS2ADPP3
(top) in which the SAT1 flipper is inserted between two downstream fragments of DPP3. The genomic structure of KWN2 (middle) shows that the
DPP3 allele has been replaced by one of the auxotrophic markers His1 and Leu2 (cross-hatched). Complementation of the DPP3 allele replacing
the His1 marker (after flip-mediated excision of the nourseothricin marker) was used to create KWN3 (lower). dwstream, downstream.

without amino acids but with arginine) where only transformed cells will grow. 3⬘ LEU2 junction. Confirmation of correct insertion in DPP3 was provided by
KWN2 was selected. detecting PCR products of the expected size (Fig. 2). As a final check to confirm
To confirm that the HIS1 and LEU2 cassettes had been inserted correctly, the the absence of DPP3 or a similar gene, possibly due to gene duplication in the
following primer pairs were used to span the junction sites (Table 1 and Fig. 1C): evolutionary process, the DPP3 check left and right primers (Table 1) were used
HIS1 Left (near primer 2) and DPP3 upstream check for the HIS1 5⬘ junction; to amplify an 856-internal-base-pair region of the 921-bp sequence of DPP3.
HIS1 Right (near primer 5) and DPP3 downstream check for the HIS1 3⬘ Genomic DNA from KWN2 was used as the test sample and genomic DNA from
junction; LEU2 Left (near primer 2) and DPP3 upstream check for the LEU2 5⬘ SN152 as the positive control. A southern hybridization confirmed the complete
junction; and LEU2 Right (near primer 5) and DPP3 downstream check for the absence of DPP3 (Fig. 3).
1612 NAVARATHNA ET AL. INFECT. IMMUN.

TABLE 1. Sequences of synthetic oligonucleotides used in this study

a
Sequence Name Reference

GTTCCATCAAATTATTCATTC DPP1 This study

ccgctgctaggcgcgccgtgACCAGTGTGATGGATATCTGC Universal primer 2 (for HIS1, LEU2, and ARG4 cassettes) 31
cacggcgcgcctagcagcggGATGAAAATGTGTAGAGTGTG DPP3 This study
gtcagcggccgcatccctgcTCAATAGGTTACTACTTAGC DPP4 This study
gcagggatgcggccgctgacAGCTCGGATCCACTAGTAACG Universal primer 5 (for HIS1, LEU2, and ARG4 cassettes) 31
AGCAGGTCAAGATGCAATG DPP6 This study
ATTAGATACGTTGGTGGTTC HIS1 Left (near primer 2) 31
AACACAACTGCACAATCTGG HIS1 Right (near primer 5) 31
AGAATTCCCAACTTTGTCTG LEU2 Left (near primer 2) 31
AAACTTTGAACCCGGCTGCG LEU2 Right (near primer 5) 31
TGGGATAAGCCTCATACATGC DPP3 Upstream Check This study
CAAAGGGAACAAGATGAAGCA DPP3 Downstream Check This study
GGGGGTTTAAATCACCAACA DPP3 Check Left This study
CACACATTAGTGGAAATGTC DPP3 Check Right This study
GGATAAGGGCCCTCATACATGCAA DPP3 complement 1 This study

Downloaded from iai.asm.org at UNIV OF NEBRASKA-LINCOLN on September 5, 2007

TCAAGCTCGAGGTAATTCAGAAAAGAA DPP3 complement 2 This study
CCCACCGCGGCTAGTCTTGGTCTA DPP3 complement 3 This study
CCATAGAGCTCATTCTTTCAAGTGGGTA DPP3 complement 4 This study
a
Sequences in lower case correspond to exogenous, complementary sequences introduced for mutually primed synthesis in the second round of fusion PCR.
Underlined segments introduce desired restriction sites in the process of constructing pSFS2ADPP3.

DPP3 complementation method. (i) Plasmid construction. The pSFS2A plas- specific recombinase under the control of the C. albicans MAL2 promoter. The
mid was kindly provided by Joachim Morschhauser of the University of Wiirz- cassette is flanked by direct repeats of the minimal recombination target sites of
burg, Germany. This plasmid has a gene deletion or complementation cassette, the FLP recombinase. The SAT1 flipper cassette has been designed to contain a
called the SAT1 flipper cassette, which contains the nourseothricin marker few unique restriction sites on the left (ApaI and XhoI) and right (SacI and
caSAT1 and the C. albicans-adapted FLP gene (caFLP), which encodes a site- SacII) borders that can be used to clone target sequences for homologous
recombination (37). The DPP3 complementation cassette was constructed as
follows. An ApaI-XhoI fragment of the complete C. albicans DPP3 sequence as

FIG. 2. Confirmation of the correct integration sites for the select-

able markers used to knock out DPP3. His1dpp upstream check, the FIG. 3. Southern analysis of ClaI-digested genomic DNA of
HIS1 Left and DPP3 upstream check primers were used to amplify SN152, KWN2, and KWN4 with two DPP3-specific probes. The two
the upstream region of the construct; His1dpp downstream check, the probes hybridize with the bp ⫺350 and ⫹456 regions of the gene,
HIS1 Right and DPP3 downstream check primers were used to amplify which has a single restriction site for ClaI at nucleotide 514. The sizes
the downstream region of the construct; Leu2dpp upstream check, the of the hybridizing fragments (in kb) are given on the left side of the
LEU2 Left and DPP3 upstream check primers were used to amplify blot. Fragments corresponding to hybridization at 3.7 kb are identical
the upstream region of the construct; Leu2dpp downstream check, the in size for the parent strain (SN152) and the complemented strain
LEU2 Right and DPP3 downstream check primers were used to am- (KWN4). The KWN4 fragment corresponding to the other probe,
plify the downstream region of the construct. hybridizing at 5 kb, is slightly different from that of the parent strain.
VOL. 75, 2007 FARNESOL AND VIRULENCE IN CANDIDEMIA 1613

well as 0.5 kb of upstream and 0.46 kb of downstream flanking sequences for the TABLE 2. Altered pathogenicity by strains of C. albicans altered in
DPP3 alleles were amplified using primers DPP3 complement 1 and 2 (Table 1). their levels of farnesol production
A SacII-SacI DPP3 downstream fragment from position ⫹20 to ⫹476 was am-
plified with primers DPP3 complement 3 and 4 (Table 1). DPP3 together with up- Amt of farnesol LD50a
and downstream fragments was cloned on the left side of the SAT1 flipper and Strain produced
(␮g/g 关dry wt兴) 3 days p.i. 7 days p.i. 14 days p.i.
the DPP3 downstream fragment was cloned on the right side of the SAT1 flipper
(Fig. 1D) to generate pSFS2ADPP3. The SAT1 flipper cassette and the cloned SN152 10.9 ⫾ 1.7 1.9 ⫻ 10 6
7.9 ⫻ 10 5
5 ⫻ 104
parts of the plasmids were sequenced at the University of Nebraska, Lincoln, KWN1 1.65 ⫾ 0.5 — — —
sequencing facility to confirm accurate cloning. KWN2 1.79 ⫾ 1 7.9 ⫻ 106 1.9 ⫻ 106 5 ⫻ 105
(ii) C. albicans transformation to reconstitute DPP3. Transformation for KWN3 11.5 ⫾ 4.4 — — —
complementation was done according to the method of Reu␤ et al. (37). Briefly, KWN4 21.2 ⫾ 1.2 2 ⫻ 106 — —
the insert from pSFS2ADPP3 was excised as an ApaI-SacI fragment and gel ATCC 10231 Undetectedb 1.2 ⫻ 107 — —
purified. Approximately 1 ␮g (5 ␮l) of the linear DNA fragment was mixed with
a
40 ␮l of electrocompetent KWN2 cells and subjected to electroporation (0.2-cm LD50 for KWN4 was obtained from Fig. 4. All other LD50s were calculated
cuvette; 1.8 kV). These electroporated KWN2 cells were washed with 1 ml of 1 (see Materials and Methods) from experiments where mice were inoculated with
M sorbitol, resuspended in 1 ml of yeast extract-peptone-dextrose (YPD), and five different cell densities (104 to 108 cells/ml). Note that the other two LD50s
obtained from Fig. 4 (2 ⫻ 106 for both SN152 after 3 days and KWN2 after 7
incubated for 4 h at 30°C with shaking at 200 rpm. The cells were spread on YPD
days) agree very well with the values from the five inoculum-level experiments.
plates containing 200 ␮g/ml nourseothricin and inoculated at 30°C. Resistant —, not done.
colonies were picked after 1 day and reinoculated into YPD liquid medium with b

Downloaded from iai.asm.org at UNIV OF NEBRASKA-LINCOLN on September 5, 2007

See reference 14.
200 ␮g/ml nourseothricin. Eight cultures from individual colonies were streaked
on synthetic dextrose agar (SD)-plus-Arg, SD-plus-Arg-and-His, and SD-plus-
Arg-and-Leu plates to determine which copy of DPP3 had been reintegrated.
After confirming that one of the markers introduced into SN152 had been lost, mance liquid chromatography (HPLC) method to detect fluorescent farnesol in
that strain was named KWN3. KWN3 was inoculated into YPD liquid medium mouse serum. Shchepin et al. (44) designed a farnesol analog which exhibits
without selective pressure to allow FLP-mediated excision of the SAT1 flipper absorption and emission near 360 and 450 nm, respectively. This molecule is
cassette as described by Reu␤ et al. (37). Then, serially diluted KWN3 was biologically active in that it has 12% of the activity of farnesol in blocking the
spread on YPD plates containing 25 ␮g/ml nourseothricin and allowed to grow yeast-to-mycelium transition by C. albicans (44). However, the fluorescent far-
for 2 days to identify those smaller colonies that are nourseothricin sensitive due nesol was only partially soluble in 0.5% Tween 80. For this preliminary experi-
to FLP-mediated excision of CaSAT1. These colonies were reinoculated into ment, we suspended 130 mg of fluorescent farnesol in 30 ml of 0.5% Tween 80
yeast peptone maltose liquid medium to make sure that the MAL2 promoter was (equivalent to 20 mM) and injected 1 ml per mouse of the solubilized portion i.p.
activated for caFLP expression. This precaution was taken in case there were any into 27 mice. At time points of 10 min and 1, 3, 6, 12, 18, 24, 48, and 72 h p.i.,
nonexcised CaSAT1 cassettes remaining. These cells were restreaked on YPD three mice were euthanized and their serum (200 ␮l) collected. Serum of four
containing 200 ␮g/ml nourseothricin (where they should not grow) to make sure untreated mice was collected as a negative control.
that FLP-mediated excision had occurred and then transformed again with the For each time point, the serum samples were pooled, extracted with ethyl
same ApaI-SacI fragment to make KWN4, with fully reconstituted DPP3. acetate, and fractionated on an HPLC system (ISCO, Lincoln, NE) with a C18
Nourseothricin was obtained from Werner BioAgents (Jena, Germany). reverse-phase column (Vydac) and a fluorescence detector (ISCO) set at an
Southern hybridization. Genomic DNA from SN152, KWN2, and KWN4 was excitation of 360 nm and an emission of 450 nm. We detected twin peaks for
isolated for Southern hybridization. Both alleles of DPP3 have ClaI restriction fluorescent farnesol at ca. 13.3 and 15.3 min of retention time using acetonitrile
cut sites at nucleotide 514. Approximately 10 ␮g of DNA was digested with ClaI, and water for the mobile phase. The mobile-phase gradient went from 30 to 50%
separated on 1% agarose gels, and transferred to a membrane. Two gel-purified acetonitrile (1 to 5 min), 50% acetonitrile (5 to 15 min), 50 to 100% acetonitrile
DPP3 fragments were used as probes to confirm gene knockout and comple- (15 to 20 min), and 100 to 30% acetonitrile (20 to 25 min). A standard curve was
mentation. These were the upstream fragment (350 bp) generated by primers constructed with fluorescent farnesol added to normal mouse serum at concen-
DPP1 and DPP3 and the SacII-SacI downstream fragment (456 bp) generated by trations of 2.3 to 230 ␮M; more than 98% was detected by HPLC.
primers DPP3 complement 3 and complement 4. C. albicans isolation and quantitative determination. Three mice from each
Determination of C. albicans LD50s. The LD50s for C. albicans A72, SN152, group were euthanized at 1, 3, 6, 12, 18, 24, or 48 h to determine the fungal
KWN2, and 10231 were determined by the Kärber method (23). Strains of C. burden in their kidneys. At the time of necropsy, kidneys were harvested from
albicans were inoculated into mGSB medium, grown overnight at 30°C, washed each mouse and placed in sterile Eppendorf tubes. The tissues were kept at 4°C
three times with nonpyrogenic, sterile saline, and counted with a Petroff-Hausser until the next day, when each kidney was weighed and homogenized in 2.0 ml of
counter. Five groups of five mice each were intravenously (i.v.) challenged by tail nonpyrogenic sterile saline. Then, 0.1 ml of the homogenate was spread on
vein injection with 0.1 ml of sterile saline containing either 104, 105, 106, 107, or triplicate plates of Nickerson’s medium, also known as BiGGY agar, a selective
108 yeast cells. Mortality was recorded continuously for 7 to 14 days postinocu- and differential medium for C. albicans (30). After 48 h of incubation at 30°C,
lation (p.i.), and the LD50 was calculated by the Kärber method (23). For C. colony number, morphology, and color were recorded and numbers of CFU per
albicans A72, the calculated LD50 was approximately 1.3 ⫻ 106 cells at 3 days p.i. gram of tissue was estimated. C. albicans appears as brown to black colonies with
This protocol was modified slightly to achieve a sublethal challenge. C. albicans no pigment diffusion and no sheen (30).
A72 was transferred in mGSB nine times over a 9-month period. These cells still
had germ tube-forming ability of ⱖ95%, but their LD50 at 3 days p.i. had
RESULTS
increased to 1.0 ⫻ 107 cells. In this case, 1.3 ⫻ 106 cells was a sublethal injection.
For the pathogenicity experiment comparing strains SN152, KWN2, and Reduced endogenous farnesol reduces virulence in mice. We
KWN4 (50 mice total), each group of 15 mice was inoculated with 2 ⫻ 106
cells of the indicated strain. Five mice were kept as a negative control. The
disrupted the first DPP3 locus with C. dubliniensis HIS1 (Fig.
injection dose of 2 ⫻ 106 cells was chosen to coincide with the 3-day LD50 of 1A) and then confirmed that it had been inserted correctly by
SN152 (Table 2). the presence of the expected upstream (Fig. 2, lane B) and
Statistical analysis. The main parameter measured was the time (h) from i.v. downstream (Fig. 2, lane C) HIS1/DPP3 junction sequences.
inoculation to death or euthanasia because of severe clinical signs. The data were
This heterozygous mutant was named KWN1, and it was used
plotted as Kaplan-Meier survival curves and analyzed using LIFETEST and
proportional hazards regression (PHREG) procedures (42). The LIFETEST to disrupt the other allele of DPP3 with C. maltosa LEU2. This
assesses model assumptions using three nonparametric tests, log-rank, Wilcoxon, double-knockout mutant was named KWN2. We confirmed
and likelihood ratio tests, to determine whether two or more treatment groups that the LEU2 marker had been inserted correctly by the
are different. PHREG performs Cox regression analysis of survival data using the presence of the expected upstream (Fig. 2, lane D) and down-
proportional hazards model. The resulting regression coefficients are an estimate
of the exponent of the hazard ratios or relative risk.
stream (Fig. 2, lane E) LEU2/DPP3 junction sequences. Fi-
Fluorescent farnesol in sera. In order to determine how much farnesol gets to nally, the overall success of the DPP3 gene knockout was
the bloodstream and how long it remains there, we developed a high-perfor- confirmed by its presence in SN152 and its absence in KWN2
1614 NAVARATHNA ET AL. INFECT. IMMUN.

each other (P ⬍ 0.96), but they were both significantly different

(P ⬍ 0.0014 or 0.0017, respectively) from the KWN2 group.
The PHREG hazard ratio estimates indicated that SN152 and
KWN4 cells had 4.1 and 4.2 times higher lethality than KWN2
cells, respectively.
Mutants altered in farnesol production have unaltered cell
and colony morphology. The four strains altered in their far-
nesol production levels, KWN1 to -4, appeared normal in their
dimorphic abilities. That is, at 30°C they grew as yeasts in both
YPD and mGSB media (12) and at 37°C they formed ⱖ95%
germ tubes in 2.5 mM N-acetylglucosamine buffer (12) and
filamentous colonies on spider medium (24). No further tests
on cell morphology were conducted.
Additionally, C. albicans ATCC 10231, a natural strain
which produces farnesoic acid (35) but not farnesol (14), also

Downloaded from iai.asm.org at UNIV OF NEBRASKA-LINCOLN on September 5, 2007

exhibited normal cell and colony morphology. However, it did
FIG. 4. Altered pathogenicity for C. albicans strains with DPP3 exhibit reduced pathogenicity. The LD50 dose for strain 10231
removed and restored. Fifteen mice per group, each injected with 2 ⫻ after 3 days was 1.2 ⫻ 107 cells (Table 2). The reduced viru-
106 cells. E, SN152 parent; Œ, KWN2; F, KWN4. lence of 10231 compared to those of other wild-type strains was
also observed by Kretschmar et al. (19).
Nontoxicity of exogenous farnesol. The safety of farnesol
as determined by both PCR (data not shown) and Southern administered orally in the drinking water (20 mM without
hybridization (Fig. 3). Survival curves for the two strains were saline) and intraperitoneally (1 ml of 20 mM) was evaluated.
then compared with that for immunocompetent mice. The Because farnesol was diluted in Tween 80, the effect of i.p.
calculated LD50s for strains SN152 and KWN2 are presented administration of Tween 80 alone was also evaluated. Farnesol
in Table 2. Comparison of the SN152 parent with the DPP3 and Tween 80 had a negligible toxic effect on the mice. In each
double-knockout mutant shows that the mutant produced ca. experiment, the weight of individual mice and the consumption
six times less farnesol and was 4, 2.4, and 10 times less patho- of water in control and treated groups were recorded daily for
genic to mice at 3, 7, and 14 days, respectively (Table 2). 14 days. Irrespective of the route of administration and the
Pathogenicity was restored when DPP3 was reconstituted concentration of farnesol and Tween 80, there was no diarrhea
(Fig. 4). The first reconstituted strain (KWN3) regained a or mortality. Furthermore, there were no significant differ-
single copy of DPP3 while losing the His marker. The HIS ences in either weight gain or water consumption between the
marker was the first to be integrated in place of one of the control and treated groups throughout the 14-day observation
DPP3 alleles (creating KWN1) and the first to be replaced period. Additionally, significant gross changes were not seen in
(creating KWN3). Next, KWN3 was transformed, regaining a control and treated mice examined at necropsy on day 14 p.i.
second copy of DPP3 while losing the Leu marker. KWN4, like These results are consistent with those of a previous study (2),
SN152, is auxotrophic for Arg, His, and Leu. The accuracy of which found that the LD50 of i.p. farnesol for mice was 2.95
these genetic manipulations was confirmed by two methods: g/kg of body weight, which corresponds to 75 mg for a 25-g
PCR amplification of the His or Leu junctions and Southern mouse. For comparison, 1 ml of 20 mM farnesol contains only
hybridization. Southern hybridization (Fig. 3) confirmed the 4.4 mg of farnesol.
absence of DPP3 in KWN2 and the reintegration of DPP3 in Exogenous oral farnesol increases mouse mortality. The
KWN4. For SN152, probes for the up- and downstream re- effect of farnesol by oral delivery was investigated (Fig. 5).
gions of DPP3 (Fig. 1D) hybridized in the southern blot at Seven mice per group were challenged with an LD50 dose of C.
approximately 6.0 kb and 3.7 kb. The same probes for KWN2 albicans. The first group received C. albicans and regular drink-
hybridized to fragments at approximately 2 kb and 7 kb, re- ing water, while the second group received farnesol orally (20
spectively (Fig. 3). SN152 and the complemented strain mM farnesol–Tween 80 in the drinking water). Figure 5 dem-
(KWN4) had one hybridization band of the same size at 3.7 kb onstrates enhanced mortality (P ⫽ 0.036) for the group receiv-
(Fig. 3), but the probe corresponding to the 6-kb fragment in ing oral farnesol. Thus, exogenous farnesol acts to enhance the
SN152 hybridized with a fragment of approximately 5.0 kb in virulence of C. albicans.
the reconstituted strain KWN4. One reason that the hybrid- Exogenous i.p. farnesol increases mouse mortality. Farnesol
ization bands are of different sizes for SN152 and KWN4 (Fig. given i.p. affected both the onset of mouse mortality and the
3) is that during complementation the SAT1 flipping technique percent survival (Fig. 6). Forty mice per group were inocu-
(37) causes the 460-bp downstream fragment to be duplicated. lated i.v. with 1.3 ⫻ 106 C. albicans cells, with a 1.0-ml i.p.
However, any doubt regarding the correct integration of DPP3 injection of either 20 mM farnesol or 0.5% Tween 80–saline
is removed by the disappearance of the auxotrophic markers (vol/vol). Farnesol enhanced the lethality of the systemic
which disrupted the gene originally (Fig. 1). Candida infection; the onset of mortality was 30 h sooner for
For the reconstituted strains, the farnesol production level mice injected with farnesol (Fig. 6). In all cases the kidneys
was restored to parental levels in KWN3 and doubled in showed the same histopathology regardless of the route
KWN4 (Table 2). With regard to mouse pathogenicity (Fig. 4), (oral versus i.p.) of farnesol delivery. The data were ana-
the SN152 and KWN4 survival curves were not different from lyzed according to the log-rank, Wilcoxon, and likelihood
VOL. 75, 2007 FARNESOL AND VIRULENCE IN CANDIDEMIA 1615

Downloaded from iai.asm.org at UNIV OF NEBRASKA-LINCOLN on September 5, 2007

FIG. 5. Effect of orally administered mixed isomers of farnesol on FIG. 7. Effect of i.p. administered E,E-farnesol on mouse mortality
mouse mortality caused by intravenous administration of wild-type C. caused by sublethal levels of wild-type C. albicans A72. Each group
albicans A72. E, LD50 (1.3 ⫻ 106) of C. albicans-only control; x, LD50 contained 15 replicates. E, sublethal C. albicans given i.v. with a single
of C. albicans with farnesol in drinking water; each group contained i.p. injection (1 ml) of 0.5% Tween 80 in sterile saline; F, sublethal C.
seven replicates. Farnesol oral and i.v. control groups showed 100% albicans with a single i.p. injection (1 ml) of 20 mM farnesol. The
survival. farnesol i.p. and 0.5% Tween 80 i.p. controls (with no C. albicans)
showed no mortality.

ratio tests. All three tests revealed that the survival curves
with and without i.p. farnesol differed from each other (P ⫽
0.031). In all mouse experiments (Fig. 4 to 7), the farnesol- on percent survival was significant (P ⫽ 0.048). From this
only, Tween 80-only, and no-treatment control groups (five experiment we conclude that farnesol alone is responsible for
mice per group) showed no mortality and had similar pat- the enhanced C. albicans pathogenesis.
terns of weight gain. Time course of fluorescent farnesol in serum. A fluorescent
A second experiment (Fig. 7) used 15 mice per group with a analog of farnesol with five conjugated double bonds (44) was
sublethal C. albicans challenge. Both groups were challenged used to determine how much i.p. farnesol gets into the blood-
with C. albicans and a 1-ml i.p. injection of either farnesol or stream and how long it remains there. Serum samples were
0.5% Tween 80–saline (vol/vol). Mice administered farnesol analyzed by HPLC. The fluorescent farnesol was detected 10
i.p. started to die 4 days earlier, and by day 6 p.i. the percent min following i.p. injection. The levels reached a maximum (ca.
survival was five times lower than that for the no-farnesol 1 ␮M) after 1 h, were barely detectable at 6 h, and had com-
control mice (Fig. 7). The effect of i.p. farnesol administration pletely disappeared by 12 h. This rapid appearance and disap-
pearance of the fluorescent farnesol is likely relevant for dis-
ease progression, particularly in the early stages following i.p.
injection of farnesol (Fig. 6). Robert et al. (38), using very
similar experimental conditions, found that 98% of the in-
jected C. albicans cells had been cleared from the bloodstream
within 3 min and they were almost all gone within 15 min. For
Fig. 6 and 7, the farnesol i.p. injections occurred ca. 5 min after
the tail vein injections of C. albicans.
Exogenous i.p. farnesol speeds up kidney colonization. We
examined kidney colonization over time for 48 h p.i. (Fig. 8).
Two groups of 24 mice were administered C. albicans i.v.
accompanied by 1.0 ml of either 0.5% (vol/vol) Tween 80–
saline or 20 mM farnesol i.p. Kidneys from mice with i.p.
farnesol had ⬎2 ⫻ 104 CFU/g by 12 h, whereas those from
mice without farnesol required 48 h to reach this level (Fig. 8).
By this time the entire kidney was fully colonized by C. albi-
cans, both grossly and by histopathology. Farnesol i.p. did not
alter C. albicans morphology in kidneys. Extensive filamenta-
FIG. 6. Effect of i.p. administered E,E-farnesol on mouse mortality tion was observed for all organs examined, i.e., kidney, liver,
caused by intravenous administration of wild-type C. albicans A72. spleen, and brain. Finally, we note the congruence in timing for
Each group of treatments had 40 replicates. All control groups con-
the disappearance of fluorescent farnesol from the serum by
tained five replicates. E, C. albicans LD50 (1.3 ⫻ 106) dose, i.v. only; F,
C. albicans LD50 and 1 ml of i.p. 20 mM farnesol. Farnesol i.p. control 12 h, coinciding with the more-rapid kidney colonization (Fig.
and the 0.5% Tween 80 i.p. control never showed mortality. 8), and more rapid onset of lethality (Fig. 5).
1616 NAVARATHNA ET AL. INFECT. IMMUN.

Tween 80; and (v) the more-rapid onset of mortality among

mice administered farnesol concurrently with C. albicans cor-
related with a more-rapid kidney colonization as measured by
higher numbers of CFU of C. albicans on kidneys. For these
reasons we suggest that farnesol fits the definition of a viru-
lence factor (7) and that it be added to the list of virulence
factors for C. albicans (9, 28, 33). Although we prefer the idea
that DPP3 exerts its effect on pathogenicity through a change
in farnesol levels, we cannot rule out other cell activities that
may require the Dpp3 isoprenoid phosphate phosphatase.
C. albicans is a diploid organism. In the progression from
SN152 to KWN1 and KWN2, we knocked out one copy of
DPP3 and then the other, while for KWN3 and KWN4, we
restored one copy and then another. For C. albicans SC5314,
the two copies of the DPP3 structural gene have identical

Downloaded from iai.asm.org at UNIV OF NEBRASKA-LINCOLN on September 5, 2007

sequences. Yet the farnesol production levels (Table 2) for
FIG. 8. Time course of kidney infection by C. albicans A72 with or these mutants suggest that the gene removed in making KWN1
without i.p. farnesol. E, C. albicans, 1.3 ⫻ 106 cells, i.v. only; F, C.
was active whereas that removed in making KWN2 was not
albicans, i.v., with 1 ml of 20 mM farnesol i.p. Each value is the average
for three kidneys from three mice. Undiluted kidney homogenate (100 and, by extension, KWN3 and -4 were both reconstituted with
␮l) was plated onto BiGGY agar plates (30). Values of 20,000 CFU/g active genes. The likelihood of this scenario is supported by the
of kidney correspond to actual plate counts of ⱖ800 CFU, deemed too high frequency of haploinsufficiency mutants found by Uhl et
numerous to count. al. (51) in a transposon mutagenesis study. For these mutants,
knocking out a single copy of the gene is sufficient to generate
the observed phenotype (51). Our farnesol production data
DISCUSSION (Table 2) suggest that DPP3 fits this category.
Our evidence suggests that farnesol, as produced by A72 and
This work demonstrates that farnesol, both endogenous and most other strains of C. albicans (14), contributes to fungal
exogenous, accelerates the mortality of candidemia. Past stud- pathogenicity. In contrast, farnesoic acid, as produced by strain
ies have shown that C. albicans produces farnesol in vitro (12) 10231 (35), does not. In our parallel tests, the LD50 dose for
and that increased production of farnesol in vivo is accompa- A72 (27) was ca. 10-fold lower than that for 10231 (Table 2).
nied by increased virulence of C. albicans (27). In this regard, Perhaps some of the C. albicans strains found by others to be
we previously showed that C. albicans cells pretreated with 0.5 naturally attenuated in mouse virulence (33) are also deficient
to 1.0 ␮M fluconazole produced 6 to 12 times more farnesol in farnesol production. This difference in effectiveness between
(14) and were 4.2 to 8.5 times more lethal (27) than untreated farnesol and farnesoic acid may be because farnesol is li-
cells. To substantiate this observation on the importance of pophilic and able to cross membranes, whereas farnesoic acid
farnesol, we sought an alternate method for studying the is ionic. Indeed, animals such as rats and mice remove farnesol
pathogenicity of C. albicans cells differing in their farnesol by converting it to farnesoic acid and a highly soluble farnesol-
excretion levels. This method employed a knockout mutant derived dicarboxylic acid prior to excretion in the urine (3).
defective in the phosphatase which converts farnesyl diphos- It has been established that dimorphism is strongly associ-
phate to farnesol (11, 49, 50). Two such genes have been ated with fungal invasiveness and dissemination for both ani-
identified for Saccharomyces cerevisiae, DPP1 (50) and LPP1 mal models (25, 43) and, via histopathology, human patients
(49). Their homologs in C. albicans are DPP3 and DPP2, re- (6). With regard to farnesol’s mode of action as a virulence
spectively (Candida DB database). We chose to knock out factor, no firm conclusions can be made yet. However, five
DPP3, because in S. cerevisiae (11) the rates for dephosphor- ideas seem pertinent. First, farnesol is an autoregulator of
ylation of farnesyl diphosphate catalyzed by particulate frac- Candida dimorphism in vitro (12). There is, of course, no
tions from the lpp1⌬, dpp1⌬, and double-knockout lpp1⌬ assurance that the in vitro mode of action preventing germ
dpp1⌬ strains were 85, 25, and 8%, respectively (11). tube formation and the in vivo mode of action are related.
We used the gene deletion system developed by Noble and Indeed, the predominant cell types in infected kidneys are
Johnson (31). This system has the essential feature that the filamentous, i.e., pseudohyphae and hyphae. Second, farnesol
multiply auxotrophic parent (SN152) is still pathogenic for could promote invasiveness by altering the membrane fluidity
mice (31), and its LD50 is close to that of strain A72 (27). We of host cells. The lipophilic properties of free farnesol would
have now shown the following: (i) a double-knockout strain favor its membrane localization. For instance, Cole et al. (10)
with a mutated DPP3 gene, which encodes a farnesyl-PP phos- describe the likely intercellular transmigration (termed per-
phatase (11), produced 6 times less farnesol and was ca. 4.2 sorption) whereby yeast cells of C. albicans cross the mucosal
times less pathogenic than its SN152 parent; (ii) when DPP3 barrier into the bloodstream. As another case in point, Saidi et
was reconstituted, both farnesol production and pathogenicity al. (40) found that gingival fibroblasts lost viability when
were regained; (iii) farnesol is harmless by itself; (iv) mice treated with ⬎10 ␮M farnesol. Third, if farnesol contributes to
challenged with C. albicans in the presence of i.p. farnesol died the lysis of even a few red blood cells, the iron made available
earlier and had a lower percent survival (P ⬍ 0.03) than did could enhance pathogenicity. Animals often sequester iron in
control mice receiving C. albicans with an i.p. injection of an attempt to starve iron-requiring pathogens (52), and thus,
VOL. 75, 2007 FARNESOL AND VIRULENCE IN CANDIDEMIA 1617

red blood cell lysis would make critical iron supplies available fining the basic concepts of virulence and pathogenicity. Infect. Immun.
67:3703–3713.
to those pathogens. C. albicans does not produce an iron- 8. Cassone, A., F. DeBernardis, F. Mondello, T. Ceddia, and L. Agatensi. 1987.
binding siderophore (15), but it can use hemin as an iron Evidence for a correlation between proteinase secretion and vulvovaginal
source (15). The bacterium Staphylococcus aureus uses hemo- candidiasis. J. Infect. Dis. 156:777–783.
9. Chauhan, N., J.-P. Latge, and R. Calderone. 2006. Signalling and oxidant
lysin to punch holes in host red blood cells and then acquires adaptation in Candida albicans and Aspergillus fumigatus. Nat. Rev. Micro-
iron from the hemoglobin released (46). Perhaps C. albicans biol. 4:435–444.
uses farnesol to punch holes in host red blood cells for similar 10. Cole, G. T., K. R. Seshan, K. T. Lynn, and M. Franco. 1993. Gastrointestinal
candidiasis: histopathology of Candida-host interactions in a murine model.
reasons. Fourth, farnesol could protect C. albicans cells from Mycol. Res. 97:385–408.
destruction following ingestion by professional phagocytes by 11. Faulkner, A., X. Chen, J. Rush, B. Horazdovsky, C. J. Waechter, G. M.
countering their oxidative burst. Westwater et al. (53) showed Carman, and P. C. Sternweis. 1999. The LPP1 and DPP1 gene products
account for most of the isoprenoid phosphate phosphatase activities in Sac-
that in vitro farnesol protected yeast cells from oxidative stress charomyces cerevisiae. J. Biol. Chem. 274:14831–14837.
from both hydrogen peroxide and superoxide anion-generating 12. Hornby, J. M., E. C. Jensen, A. D. Lisec, J. J. Tasto, B. Jahnke, R.
agents. Fifth, farnesol could interfere with aspects of host de- Shoemaker, P. Dussault, and K. W. Nickerson. 2001. Quorum sensing in the
dimorphic fungus Candida albicans is mediated by farnesol. Appl. Environ.
fense necessary for the animals to survive pathogenesis. It is Microbiol. 67:2982–2992.
known that C. albicans infections delay induction of proinflam- 13. Hornby, J. M., B. W. Kebaara, and K. W. Nickerson. 2003. Farnesol biosyn-
thesis in Candida albicans: cellular response to sterol inhibition by zaragozic

Downloaded from iai.asm.org at UNIV OF NEBRASKA-LINCOLN on September 5, 2007

matory cytokines, thus giving C. albicans an advantage during acid B. Antimicrob. Agents Chemother. 47:2366–2369.
invasion compared with other fungi. For instance, the survival 14. Hornby, J. M., and K. W. Nickerson. 2004. Enhanced production of farnesol
of Candida glabrata-infected mice was associated with rapid by Candida albicans treated with four azole antibiotics. Antimicrob. Agents
Chemother. 48:2305–2307.
induction of three proinflammatory cytokines, tumor necrosis 15. Howard, D. H. 1999. Acquisition, transport, and storage of iron by patho-
factor alpha, interleukin-12, and interferon gamma (4), and of genic fungi. Clin. Microbiol. Rev. 12:394–404.
equal importance, the lack of induction for the anti-inflamma- 16. Jarvis, W. R., and W. J. Martone. 1992. Predominant pathogens in hospital
infections. Antimicrob. Agents Chemother. 29:19–24.
tory cytokine interleukin-10 (4). Thus, farnesol could interfere 17. King, R. D., J. C. Lee, and A. L. Morris. 1980. Adherence of Candida
with the induction of appropriate cytokines by the host. Finally, albicans and other Candida species to mucosal epithelium. Infect. Immun.
these possible mechanisms are not mutually exclusive; farnesol 27:667–674.
18. Knobloch, K., A. Pauli, B. Iberl, N. Weis, and H. Weigand. 1988. Mode of
could have multiple modes of action during pathogenesis action of essential oil components on whole cells of bacteria and fungi in
which are operative at different times. plate tests, p. 287–299. In P. Schreier (ed.), Bioflavour ’87. Walter de
In summary, we have identified the first gene, DPP3, having Gruyter, Berlin, Germany.
19. Kretschmar, M., B. Hube, T. Bertsch, D. Sanglard, R. Merker, M. Schröder,
a role in farnesol production by C. albicans, made a knockout H. Hof, and T. Nichterlein. 1999. Germ tubes and proteinase activity con-
mutant of that gene, and shown that the gene product farnesol tribute to virulence of Candida albicans in murine peritonitis. Infect. Immun.
acts as a virulence factor as well as a quorum-sensing molecule 67:6637–6642.
20. Kumamoto, C. A., and M. D. Vinces. 2005. Alternative Candida albicans
(29). Thus, if there is any antifungal therapeutic potential for lifestyles: growth on surfaces. Annu. Rev. Microbiol. 59:113–133.
farnesol (35) or its analogs (45), they would likely be restricted 21. Leberer, E., K. Ziegelbauer, A. Schmidt, D. Harcus, D. Dignard, J. Ash, L.
Johnson, and D. Y. Thomas. 1997. Virulance and hyphal formation of Can-
to topical applications. dida albicans require the Ste20p-like protein kinase cacla4p. Curr. Biol.
7:539–546.
ACKNOWLEDGMENTS 22. Leidich, D. D., A. S. Ibrahim, Y. Fu, A. Koul, C. Jessup, J. Vitullo, W. Fonzi,
F. Mirbod, S. Nakashima, Y. Nozawa, and M. A. Ghannoum. 1998. Cloning
We thank Alexander Johnson and Suzanne Noble for providing the and disruption of ca PLB1, a phospholipase B gene involved in the patho-
strains and plasmids needed for the fusion PCR knockout mutagene- genicity of Candida albicans. J. Biol. Chem. 273:26078–26086.
sis, Joachim Morschhäuser for the plasmid containing the SAT1 flipper 23. Lennette, E. H. 1964. General principles underlying laboratory diagnosis of
cassette, and Patrick Dussault and Roman Shchepin for synthesizing viral and rickettsial infections, p. 1–66. In E. H. Lennette and N. J. Schmidt
the fluorescent farnesol. (ed.), Diagnostic procedures for viral and rickettsial diseases, 3rd ed. Amer-
ican Public Health Association, Inc., New York, NY.
This work was supported by grants from the National Science Foun-
24. Liu, H., J. Köhler, and G. R. Fink. 1994. Suppression of hyphal formation in
dation (grant number MCB-0110999), the University of Nebraska To- Candida albicans by mutation of a STE12 homolog. Science 266:1723–1726.
bacco Settlement Biomedical Research Enhancement Fund, the John 25. Lo, H.-J., J. R. Kohler, B. DiDomenoco, D. Loebenberg, A. Cacciapuoti, and
C. and Nettie V. David Memorial Trust Fund, and the Farnesol and G. R. Fink. 1997. Nonfilamentous C. albicans mutants are avirulent. Cell
Candida albicans Research Fund, University of Nebraska Foundation. 90:939–949.
26. Naglik, J. R., S. J. Challacombe, and B. Hube. 2003. Candida albicans
REFERENCES secreted aspartyl proteinases in virulence and pathogenesis. Microbiol. Mol.
1. Barrett-Bee, K., Y. Hayes, R. G. Wilson, and J. F. Ryley. 1985. A comparision Biol. 67:400–428.
of phospholipase activity, cellular adherence and pathogenicity of yeasts. 27. Navarathna, D. H. M. L. P., J. M. Hornby, N. Hoerrmann, A. M. Parkhurst,
J. Gen. Microbiol. 131:1217–1221. G. E. Duhamel, and K. W. Nickerson. 2005. Enhanced pathogenicity of
2. Binet, L., P. Binet, M. Miocque, H. Morin, C. Pechery, and M. Roux. 1972. Candida albicans pretreated with sub-inhibitory concentrations of flucon-
Le Farnésol, substance psycho-sédative et spasmolytique. Thérapie 27:893– azole in a mouse model of disseminated candidiasis. J. Antimicrob. Che-
905. mother. 56:1156–1159.
3. Bostedor, R. G., J. D. Karkas, B. H. Arison, V. S. Bansal, S. Vaidya, J. I. 28. Navarro-Garcia, F., M. Sanchez, C. Nombela, and J. Pla. 2001. Virulence
Germershausen, M. M. Kurtz, and J. D. Bergstrom. 1997. Farnesol-derived genes in the pathogenic yeast Candida albicans. FEMS Microbiol. Rev.
dicarboxylic acids in the urine of animals treated with zaragozic acid A or 25:245–268.
with farnesol. J. Biol. Chem. 272:9197–9203. 29. Nickerson, K. W., A. L. Atkin, and J. M. Hornby. 2006. Quorum sensing in
4. Brieland, J., D. Essig, C. Jackson, D. Frank, D. Loebenberg, F. Menzel, B. dimorphic fungi: farnesol and beyond. Appl. Environ. Microbiol. 72:3805–
Arnold, B. DiDomenico, and R. Hare. 2001. Comparision of pathogenesis 3813.
and host immune response to Candida glabrata and Candida albicans in 30. Nickerson, W. J. 1953. Reduction of inorganic substances by yeasts. J. Infect.
systemically infected immunocompetent mice. Infect. Immun. 69:5046–5055. Dis. 93:43–56.
5. Brown, A. J. P., and N. A. R. Gow. 1999. Regulatory networks controlling 31. Noble, S. M., and A. D. Johnson. 2005. Strains and strategies for large-scale
Candida albicans morphogenesis. Trends Microbiol. 7:333–338. gene deletion studies of the diploid human fungal pathogen Candida albi-
6. Calderone, R., and N. A. R. Gow. 2002. Host recognition by Candida species, cans. Eukaryot. Cell 4:298–309.
p. 67–86. In Richard. A. Calderone (ed.), Candida and candidiasis. ASM 32. Odds, F. C. 1988. Candida and candidiasis, Balliere Tindall, London, United
Press, Washington, DC. Kingdom.
7. Casadevall, A., and L.-A. Pirofski. 1999. Host-pathogen interactions: rede- 33. Odds, F. C., N. A. R. Gow, and A. J. P. Brown. 2006. Toward a molecular
1618 NAVARATHNA ET AL. INFECT. IMMUN.

understanding of Candida albicans virulence, p. 305–319. In J. Heitman, (ed.), 44. Shchepin, R., R. Dumitru, K. W. Nickerson, M. Lund, and P. H. Dussault.
Molecular principles of fungal pathogenesis. ASM Press, Washington, DC. 2005. Biologically active fluorescent farnesol analogs. Chem. Biol. 12:639–
34. Odds, F. C., L. Van Nuffel, and N. A. R. Gow. 2000. Survival in experimental 641.
Candida albicans infections depends on inoculum growth conditions as well 45. Shchepin, R., J. M. Hornby, E. Burger, T. Niessen, P. Dussault, and K. W.
as animal host. Microbiology 146:1881–1889. Nickerson. 2003. Quorum sensing in Candida albicans: probing farnesol’s
35. Oh, K.-B., H. Miyazawa, T. Naito, and H. Matsuoka. 2001. Purification and mode of action with 40 natural and synthetic farnesol analogs. Chem. Biol.
characterization of an autoregulatory substance capable of regulating the 10:743–750.
morphological transition in Candida albicans. Proc. Natl. Acad. Sci. USA 46. Skaar, E. P., M. Humayun, T. Bae, K. L. DeBord, and O. Schneewind. 2004.
98:4664–4668. Iron-source preference of Staphylococcus aureus infections. Science 305:
36. Ramage, G., S. P. Saville, B. L. Wickes, and J. L. Lopez-Ribot. 2002. Inhi- 1626–1629.
bition of Candida albicans biofilm formation by farnesol, a quorum-sensing 47. Soll, D. R. 2002. Phenotypic switching, p. 123–142. In R. A. Calderone (ed.),
molecule. Appl. Environ. Microbiol. 68:5459–5463. Candida and candidiasis. ASM Press, Washington, DC.
37. Reu␤, O., A. Vik, R. Kolter, and J. Morschhäuser. 2004. The SAT1 flipper, 48. Soll, D. R. 1988. High frequency switching in Candida albicans and its
an optimized tool for gene disruption in Candida albicans. Gene 341:119– relation to vaginal candidiasis. Am. J. Obstet. Gynecol. 158:997–1001.
127.
49. Toke, D. A., W. L. Bennett, D. A. Dillon, W.-I. Wu, X. Chen, D. B. Ostrander,
38. Robert, R., S. Nail, A. Marot-Leblond, J. Cottin, M. Miegeville, S. Quenouillere,
J. Oshiro, A. Cremesti, D. R. Voelker, A. S. Fischl, and G. M. Carman. 1998.
C. Mahaza, and J. M. Senet. 2000. Adherence of platelets to Candida species
Isolation and characterization of the Saccharomyces cerevisiae DPP1 gene
in vivo. Infect. Immun. 68:570–576.
encoding diacyglycerol phosphate phosphatase. J. Biol. Chem. 273:3278–
39. Ross, I. K., F. DeBernardis, G. W. Emerson, A. Cassone, and P. A. Sullivan.
1990. The secreted aspartate proteinase of Candida albicans: physiology of 3284.
secretion and virulence of proteinase-deficient mutant. J. Gen. Microbiol. 50. Toke, D. A., W. L. Bennett, J. Oshiro, W.-I. Wu, D. R. Voelker, and G. M.

Downloaded from iai.asm.org at UNIV OF NEBRASKA-LINCOLN on September 5, 2007

136:687–694. Carman. 1998. Isolation and characterization of the Saccharomyces cerevisiae
40. Saidi, S., C. Luitaud, and M. Rouabhia. 2006. In vitro synergistic effect of LPP1 gene encoding a Mg2⫹-independent phosphatidate phosphatase.
farnesol and human gingival cells against Candida albicans. Yeast 23:673– J. Biol. Chem. 273:14331–14338.
687. 51. Uhl, M. A., M. Biery, N. Craig, and A. D. Johnson. 2003. Haploinsufficiency-
41. Saisho, Y., A. Morimoto, and T. Umeda. 1997. Determination of farnesyl based large-scale forward genetic analysis of filamentous growth in the dip-
pyrophosphate in dog and human plasma by high-performance liquid chro- loid human fungal pathogen C. albicans. EMBO J. 22:2668–2678.
matography with fluorescence detection. Anal. Biochem. 252:89–95. 52. Weinberg, E. D. 1966. Roles of metallic ions in host-parasite interactions.
42. SAS. 1999. SAS/STAT user’s guide, version 8. SAS Institute Inc., Cary, NC. Bacteriol. Rev. 30:136–151.
43. Saville, S. P., A. L. Lazzell, C. Monteagudo, and J. L. Lopez-Ribot. 2003. 53. Westwater, C., E. Balish, and D. A. Schofield. 2005. Candida albicans-con-
Engineered control of cell morphology in vivo reveals distinct roles for yeast ditioned medium protects yeast cells from oxidative stress: a possible link
and filamentous forms of Candida albicans during infection. Eukaryot. Cell. between quorum sensing and oxidative stress resistance. Eukaryot. Cell
2:1053–1060. 4:1654–1661.

Editor: A. Casadevall