Received: 25 September 2017 | Revised: 29 November 2017 | Accepted: 29 November 2017

DOI: 10.1111/jfd.12774

ORIGINAL ARTICLE

Rapid detection and differentiation of carp oedema virus and

cyprinid herpes virus-3 in koi and common carp

H Soliman | M El-Matbouli

Clinical Division of Fish Medicine,

University of Veterinary Medicine, Vienna, Abstract
Austria Carp oedema virus (CEV) and koi herpes virus (KHV) are of major concern to com-
Correspondence mon carp breeders and koi enthusiasts worldwide. The viruses cause diseases that
H Soliman, Clinical Division of Fish exhibit similar external signs; thus, it is difficult to distinguish between them clini-
Medicine, University of Veterinary Medicine,
Vienna, Austria. cally. In this study, we developed and optimized rapid and accurate single- and mul-
Email: [email protected] tiplex isothermal diagnostic tools, based on recombinase polymerase amplification
(RPA), for detection and differentiation of CEV and KHV. The assays were combined
with a lateral flow dipstick to enable visual detection of amplification products and
simplify post-amplification analysis. Both CEV- and KHV-RPA assays were specific
for their target virus. The lower detection limits of the assays were similar to those
of established diagnostic PCR tests for the viruses. A sample preparation method
was optimized to eliminate the need for total DNA extraction from fish tissues. The
estimated time to perform these RPA assays, from receiving the sample to having a
result, is 50 min, compared to 10 and 7 hr for CEV- and KHV-PCR tests, respec-
tively. The assays can be performed in field situations to improve screening of fish
and reduce spread of these viruses and thereby enhance the common carp and koi
industries.

KEYWORDS
carp oedema virus, cyprinid herpesvirus 3, diagnosis, fish, recombinase polymerase
amplification

1 | INTRODUCTION disease was restricted to Japan until 2013, when it was reported
from both koi and common carp in many European countries (Hae-
Diseases cause direct losses of fish and a decrease in growth rate, nen, Way, Stone, & Engelsma, 2013; Jung-Schroers et al., 2015;
both of which increase costs and reduce profits in aquaculture Lewisch, Gorgoglione, Way, & El-Matbouli, 2015; Matras et al.,
(Blanco, Gibello, & Fern
andez-Garayz
abal, 2000). Viruses are one of 2017; Pretto et al., 2015; Vesely, Pokorova, Reschova, & Piackova,
the most significant limiting factors for aquaculture production 2015; Way & Stone, 2013), Brazil (Viadanna, Pilarski, Hesami, &
(Crane & Hyatt, 2011). Currently, koi herpesvirus (KHV) and carp Waltzek, 2015) and USA (Waltzek et al., 2014). The causative agent
oedema virus (CEV) are two of the most destructive viral diseases is a double-stranded DNA virus assumed to belong to family Poxviri-
affecting common carp and koi. dae, based on transmission electron microscopy (Miyazaki, Isshiki, &
Koi sleepy disease (KSD) is an emerging problem, first reported Katsuyuki, 2005; Oyamatsu, Hata et al., 1997). Common carp and
in koi (Cyprinus carpio) in Japan (Ono, Nagai, & Sugai, 1986; Oya- koi are the only known species susceptible to CEV and show clinical
matsu, Hata, Yamada, Sano, & Fukuda, 1997). The disease was disease when the water temperature is 6–9 and 15–25°C respec-
described as viral oedema of carp and koi sleepy disease based on tively; mortality can reach 75%–100% in juvenile koi (Miyazaki et al.,
the clinical signs (Oyamatsu, Hata et al., 1997). Originally detected in 2005; Oyamatsu, Hata et al., 1997; Way & Stone, 2013). Clinical
1974 (Murakami, Shitanaka, Toshida, & Matsuzato, 1976), the signs of CEV-infected fish are lethargy, skin haemorrhages with

J Fish Dis. 2018;1–12. wileyonlinelibrary.com/journal/jfd © 2018 John Wiley & Sons Ltd | 1
2 | SOLIMAN AND EL-MATBOULI

oedema of the underlying tissues, enophthalmos and pale swollen Baeumner, 2011; Kim & Easley, 2011). Accordingly, different isother-
gills (Miyazaki et al., 2005; Oyamatsu, Hata et al., 1997). KSD diag- mal nucleic acid amplification methods have been developed, and
nosis relies on detection of viral DNA by PCR as the virus has not these can meet or exceed PCR-based approaches in terms of sensi-
been isolated in tissue culture (Adamek et al., 2016; Matras et al., tivity, specificity and throughput (James & Macdonald, 2015). Recom-
2017; Oyamatsu, Matoyama, Yamamoto, & Fukuda, 1997). binase polymerase amplification (RPA) is a promising isothermal
Koi herpes virus disease (KHVD) is considered a highly conta- nucleic acid amplification technique, which relies on a combination of
gious viral disease, which threatens common carp and koi popula- recombinase, single-strand binding protein and strand-displacing
tions (Hedrick et al., 2000). KHVD has been reported from various DNA polymerase for DNA amplification at a constant temperature
countries worldwide (reviewed in: Michel, Fournier, Lieffrig, Costes, between 37 and 42°C (Piepenburg, Williams, Stemple, & Armes,
& Vanderplasschen, 2010; Gotesman, Kattlun, Bergmann, & El-Mat- 2006). RPA utilizes recombinase protein to form a complex with the
bouli, 2013). Arguably, koi exhibitions and intense national and inter- primers; this complex promotes primer binding to the homologous
national trade of live fish, without veterinary supervision, have target sequence of double-stranded DNA, with displacement of the
played a major role in global spread the virus (Gilad et al., 2003; non-template strand and its stabilization by ssDNA-binding proteins.
Hedrick, 1996). The aetiological agent of this disease, koi herpesvirus Synthesis proceeds with a strand-displacing polymerase, which initi-
(KHV; the scientific name is cyprinid herpesvirus 3, CyHV-3), was ates synthesis of the complementary DNA strand (Piepenburg et al.,
assigned to the family Alloherpesviridae, genus Cyprinivirus based on 2006). RPA runs at low temperatures and does not follow Watson–
the homology of its genome to other aquatic herpesviruses (Aoki Crick DNA base-pairing rules and hence has minimal undesired ampli-
et al., 2007; Waltzek et al., 2005). Owing to its contagiousness and fication products that could otherwise impede amplification of the
the significant economic losses that it has caused to both the com- target (Sharma, Hoshika, Hutter, Bradley, & Benner, 2014).
mon carp and koi industries, KHVD is listed as a notifiable disease Therefore, KSD and KHVD are emerging diseases that threaten-
by the World Organization for Animal Health (OIE, 2016). All age ing common carp and koi industries worldwide. Both diseases have
groups of common carp and koi are susceptible to KHV infection similar clinical signs and thus cannot be distinguished clinically, and
and exhibit high morbidity and mortality (Bretzinger, Fischer-Scherl, both are difficult to isolate on cell culture. While specific PCR assays
Oumouna, Hoffmann, & Truyen, 1999; Perelberg et al., 2003; Sano exist, these require skilled technicians and specific equipment to per-
et al., 2004). Clinical signs of KHVD are often non-specific, and form. Accordingly, we developed an isothermal DNA amplification
include pale or discoloured skin, enophthalmos, haemorrhages on the assay using recombinase polymerase amplification, for rapid, sensi-
skin and base of the fins, discoloration and necrosis of the gills tive and simultaneous detection and differentiation of CEV and
(Gray, Mullis, Lapatra, Groff, & Goodwin, 2002; Hedrick et al., 2000; KHV, from common carp and koi tissues.
Oh et al., 2001). Like other herpesviruses, a latent KHV infection
can be activated by stressors (Bergmann & Kempter, 2011; Mina-
2 | MATERIALS AND METHODS
moto, Honjo, & Kawabata, 2009). KHV has been isolated on a lim-
ited number of cell lines, which are difficult to handle (OIE 2016);
2.1 | DNA templates
thus, virus isolation is not considered a consistent diagnostic method
for KHVD (Haenen, Way, Bergmann, & Ariel, 2004). Accordingly, Koi herpesvirus was isolated in our laboratory (Clinical Division of
diagnosis of KHVD relies on viral DNA-based detection methods, Fish Medicine, University of Veterinary Medicine, Vienna, Austria)
which are more sensitive than virus isolation or immunodiagnostic from diseased common carp (using gills, spleen, kidney and brain tis-
assays (OIE 2016). Various endpoint PCRs, nested PCRs and real- sues homogenate) on common carp brain (CCB) cell line (Neukirch,
time PCR assays have been developed and validated for detection of Bottcher, & Bunnarjirakul, 1999). After observation of cytopathic
KHV (Bercovier et al., 2005; El-Matbouli, Rucker, & Soliman, 2007; effects onto the CCB cell line, virus purification was performed using
Engelsma et al., 2013; Gilad et al., 2002, 2004; Gray et al., 2002; the sucrose gradient ultracentrifugation method described by Gilad
Ishioka et al., 2005; Yuasa, Sano, Kurita, Ito, & Iida, 2005). Further- et al. (2002) and modified by Dong et al. (2011). Genomic KHV-DNA
more, different isothermal amplification assays were also developed was extracted from the purified virus and CCB cells infected with
(Gunimaladevi, Kono, Venugopal, & Sakai, 2004; Prescott, Reed, & KHV using QIAamp DNA Mini kit (QIAGEN GmbH) according to the
Jin, 2016; Soliman & El-Matbouli, 2005, 2009, 2010). manufacturer’s instructions. Gills, spleen, kidney and brain were col-
Nucleic acid amplification assays are considered standard for lected for sampling purposes from koi with confirmed CEV infection,
diagnosis of many infectious diseases (Rohrman & Richards-Kortum, and common carp with confirmed KHV infection. Total DNA
2015). These techniques have greater sensitivity and specificity than extracted using a DNeasy Blood and Tissue kit (QIAGEN GmbH),
antibody-based tests and produce results faster than culture-based using the manufacturer’s animal tissue protocol. Genomic DNA from
tests (Crannell et al., 2016). PCR is the oldest and the gold standard specific pathogen-free (SPF) common carp and non-infected CCB cells
technique for nucleic acid amplification (Oste, 1988). However, were used to test specificity of the assay. Cyprinid herpesvirus-1
despite its advantages, PCR requires expensive instruments, repeated, (CyHV-1) and Cyprinid herpesvirus-2 (CyHV-2) genomic DNA was
precise, temperature-dependent steps during amplification of the tar- kindly provided by Dr. Bergmann; Friedrich-Loeffler-Institute, Greif-
get sequence and takes several hours to produce a result (Asiello & swald-Insel Riems, Germany. cDNA from both Epithelioma Papulosum
SOLIMAN AND EL-MATBOULI | 3

Cyprini (EPC) cells infected with spring viraemia of carp (SVC) virus and (2005). Plasmids were linearized with Not I (Thermo fisher Scientific)
common carp tissues with confirmed SVC infection, and DNA from a and purified using a QIAquick PCR Purification Kit (QIAGEN GmbH).
diagnostic sample positive for, CyHV-2, were also used to test speci-
ficity and cross-reactivity of the newly developed RPA assay.
2.3 | RPA oligonucleotide primers and probe design

2.2 | Cloning and sequencing of CEV- and KHV- 2.3.1 | CEV oligonucleotide primers and probes
PCR products
We designed the RPA primer and probe set based on the CEV P4a
Two end point PCRs were performed to amplify two fragments from gene sequence (Oyamatsu, 1996), to amplify a specific 262-bp frag-
CEV and KHV. The CEV fragment, encoding for 1254 bp of P4a core ment (Table 1). To detect the RPA products on a lateral flow device,
protein gene, amplified using 250 ng of DNA and the forward primer the reverse primer was labelled at its 50 -end with biotin, while the
“CEV-For-B” (Table 1) according to Matras et al. (2017) and the probe was labelled at its 50 -end with a FAM group and at its 30 -end
reverse primer “CEV-R1” (Table 1) that was developed by Oyamatsu, with a polymerase extension blocking group (C3-spacer). The probe
Matoyama et al. (1997). The thermal profile used included an initial was also modified internally by replacing one nucleotide with
denaturation step at 95°C for 5 min followed by 35 cycles at 95°C tetrahydrofuran (THF; also referred to as dSpacer). We used existing
for 1 min, 55°C for 1 min and 72°C for 2 min, and a final extension nested PCR primers (Table 1) for amplification of a 478-bp fragment
step at 72°C for 10 min. from the CEV P4a gene, utilizing endpoint PCR (Matras et al., 2017).
The KHV fragment encoding for 409 bp of the thymidine kinase
gene using 250 ng of DNA and primers KHV-TKf/KHV-TKr (Table 1)
2.3.2 | KHV oligonucleotide primers and probes
that were developed by Bercovier et al. (2005).
PCR products were cloned into pCRâ4-TOPOâ vector (Thermo We designed KHV-specific primers and probe (Table 1) to amplify a
fisher Scientific) and transformed into One ShotTM TOP10 chemically 132-bp fragment from the KHV thymidine kinase (TK) gene
competent Escherichia coli using a TOPO TA Cloningâ Kit (Thermo sequence (GenBank accession number AJ535112). To enable detec-
fisher Scientific) according to the manufacturer’s protocols. Plasmids tion by lateral flow, the reverse primer was labelled with digoxigenin
â
were isolated with the QIAprep spin Miniprep kit (QIAGEN GmbH) at its 50 -end, and 30 -end labelling and probe modification were made
following the manufacturer’s instructions, and inserts were as for CEV (above). Diagnostic PCR primers were used to amplify a
sequenced (LGC Genomics) using T7 and SP6 promoter sequencing 409-bp segment of the KHV-TK gene according to Bercovier et al.
primers. Obtained sequences were compared to sequences published (2005) (Table 1). All primers and probes used in this study were syn-
by Oyamatsu (1996) and sequences published by Bercovier et al. thesized by Eurofins Genomics (Ebersberg, Germany).

T A B L E 1 List of oligonucleotides used during this study

Genome Primer
Primer name Primer sequence (50 –30 ) Position length References
CEV-RPA-F TGCATCAAAAGCAACAACTTGACGAGGGAATG 781–812 32 bp This work
CEV-RPA-R Biotin CTCCTAAAAGTGCAGCAGCTCTTGCTTCAATC 1,012–1,043 32 bp
CEV-RPA-P FAM GCTACAATTCCAAGAGCATAATGATATTCAA ZATCTA GTTTAATTTG- 872–919 47 bp
(C3spacer)
CEV-R1 TGCAGGTTGCTCCTAATCC 1,254–1,272 19 bp Oyamatsu,
Matoyama
et al. (1997)
CEV-For-B ATGGAGTATCCAAAGTACTTAG 54–75 22 bp Matras et al.
CEV-Rev-J CTCTTCACTATTGTGACTTTG 561–581 21 bp (2017)

CEV-For-B- GTTATCAATGAAATTTGTGTATTG 82–105 24 bp

Internal
CEV-Rev-J- TAGCAAAGTACTACCTCATCC 539–559 21 bp
Internal
KHV-RPA-F CGAGGTGATGCAGCGTCTGGAGGAATACGACGCC 201–234 34 bp This work
KHV-RPA-R Digoxigenin GTCCCCGTCCAGCGCCGCCACGATCACGTACTTG 303–336 34 bp
KHV-RPA-P FAM CCGTCGACGAGGGACAGTTCTTCCCCGACCTZTACGAGGGAGTCGTGC- 239–286 48 bp
(C3spacer)
KHV-TK-F GGGTTACCTGTACGAG 189–204 16 Bercovier
KHV-TK-R CACCCAGTAGAT TATGC 582–598 17 et al. (2005)

FAM: 6-Carboxyfluorescein.
4 | SOLIMAN AND EL-MATBOULI

both DNA template (250 ng from KHV- & CEV-DNA mix) and nucle-
2.4 | Recombinase polymerase amplification assay
ase-free water. The reaction was performed as for singleplex.
optimization

2.4.1 | Singleplex RPA reaction 2.5 | Evaluation of RPA amplification time and
temperature
Carp oedema virus- and KHV-singleplex RPA reactions were per-
formed in 50 ll total volume, using the TwistAmp nfo kit (TwistDX To determine the optimum amplification temperature and time, sin-
Ltd., Cambridge, UK). Each reaction contained 29.5 ll rehydration gleplex- and multiplex-RPA reactions were tested at different incu-
buffer, 420 nM each of RPA primers, 120 nM RPA probe, 2.5 ll mag- bation temperatures: room temperature, 35, 38, 40, 45 and 50°C.
nesium acetate and 13.2 ll of both DNA template (250 ng) and Then, once the optimum temperature was determined, the optimum
nuclease-free water. The DNA used for optimization of the KHV-RPA amplification time was tested at incubation periods of 5, 10, 15, 20,
assay was extracted from the purified CyHV-3 that propagated in 25 and 30 min.
CCB cell line, while DNA used for optimization of the CEV-RPA was
extracted from confirmed CEV-infected fish tissues. All reagents
2.6 | Detection of the RPA amplification products
except for the magnesium acetate were pipetted first into a 0.2-ml
reaction tube, which contained a dried enzyme pellet. To start the Recombinase polymerase amplification amplification products were
reaction, magnesium acetate was added and then the tubes were detected by visual inspection of a colorimetric signal on a nucleic
incubated at 38°C for 4 min. The reaction mixtures were then mixed acid lateral flow dipstick. We used a HybriDetect 2T (Milenia Biotec,
briefly and re-incubated at the same temperature for another 16 min. Giessen, Germany), which has the ability to simultaneously detect
All tests were performed under the same conditions in triplicate. two different analytes with two different labels. RPA amplification
products (2 ll) were mixed with 98 ll assay buffer (19 phosphate-
buffered saline, PBS, with 0.1% Tween 20). Subsequently, 10 ll of
2.4.2 | Multiplex-RPA reaction
diluted RPA product was pipetted directly on the sample application
The CEV-/KHV-RPA multiplex reaction was performed in 50 ll using area of the dipstick, which was then placed in 200 ll assay buffer at
the TwistAmp nfo kit (TwistDX Ltd., Cambridge, UK). Again, reagents room temperature for 5 min. After incubation, the dipsticks were
were pipetted into a reaction tube, which contained a dried enzyme removed and the results were interpreted immediately. The Hybri-
pellet: 29.5 ll rehydration buffer, 280 nM each of KHV-RPA pri- Detect 2T dipstick contains three line positions; one control line (C)
mers, 80 nM KHV-RPA probe, 140 nM each of CEV-RPA primers, and two test line positions (T1 & T2). For a read to be valid, a colour
60 nM RPA CEV probe, 2.5 ll magnesium acetate and 13.1 ll of signal must be produced on the control line; any strip that did not

T A B L E 2 Clinical samples that used for diagnostic sensitivity of the CEV-/KHV-RPA assays
Samplesa,b Fish species CEV-RPA assay CEV (nested PCR) CEV Genogroup KHV-RPA assay KHV-PCR
AUST-1 Common carp +ve ve/+ve II ve ve
AUST-2 Common carp +ve +ve/+ve II ve ve
AUST-3 Common carp +ve +ve/+ve II ve ve
AUST-4 Koi +ve +ve/+ve II ve ve
AUST-5 Koi +ve ve/+ve II ve ve
AUST-6 Koi +ve +ve/+ve II ve ve
AUST-7 Koi +ve ve/+ve II ve ve
AUST-8 Koi +ve +ve/+ve I ve ve
AUST-9 Koi +ve ve/+ve II ve ve
AUST-10 Common carp ve – – +ve +ve
AUST-11 Common carp ve – – +ve +ve
AUST-12 Koi ve – – +ve +ve
AUST-13 Koi ve – – +ve +ve
AUST-14 Koi ve – – +ve +ve
AUST-(15–35) Common carp ve – – ve ve
AUST-(36–100) Koi ve – – ve ve

+ve, positive; ve, negative; ve/+ve, negative in the first round and positive in the second round in the nested PCR.
a
All the fish were from Austria and demonstrated brachial lesions.
b
Tissues (gills, spleen, kidney and brain) were sampled from each fish, homogenized and used for DNA extraction which used for PCR and RPA assays.
SOLIMAN AND EL-MATBOULI | 5

have a positive control line was discarded. For the singleplex assay, The aforementioned DNA and cDNA templates were also used
a positive result was indicated by colour signals on both control and to test the specificity of CEV-RPA assay using DNA extracted from
either of the test lines (T1 for KHV or T2 for CEV); a negative result a koi with a confirmed CEV infection as a positive control and the
was indicated by a signal only at the control line position. other DNA/cDNA templates as negative control.
For the multiplex assay, a positive result was indicated by either All of these templates (250 ng of DNA/cDNA for each reaction)
two signals: the control position, plus either the T1-line position were tested under the optimal conditions determined for each assay.
(indicating KHV infection) or T2-line (CEV infection); or three signals:
the control line, T1- and T2-lines, which indicated mixed KHV and
2.8 | Analytical sensitivity of the RPA assay
CEV infections.
The limit of detection of the KHV- and CEV-RPA assays was deter-
mined using 10-fold serial dilutions of KHV- and CEV-plasmid DNA
2.7 | Analytical specificity of the RPA assay
(pDNA) to provide 2.1 9 100–2.1 9 108 and 1.8 9 100–1.8 9 109
Initially, we compared the designed primers against virus sequences KHV- and CEV-DNA copies respectively, both with and without
in GenBank sequences. We then evaluated the specificity of the prior mixing with 100 ng of SPF common carp genomic DNA. The
CEV- and KHV-RPA assays. For KHV-RPA assay specificity, genomic KHV- and CEV-RPA limit of detection was compared against the
DNA extracted from purified KHV, CCB cells infected with KHV and commonly used and OIE-recommended PCR assay of KHV (Ber-
common carp tissues with confirmed KHV infection were used as covier et al., 2005) and the established nested PCR assay in the sci-
positive controls. For negative controls, DNA extracted from CyHV- entific literature for detection of CEV (Matras et al., 2017). All these
1, CyHV-2, a goldfish with confirmed CyHV-2 infection, a koi with a reactions were performed according to the determined optimal con-
confirmed CEV infection, non-infected CCB cells and SPF common ditions for each assay and incubated at 38°C for 20 min.
carp were used. Additionally, cDNA from infected EPC cells with
SVC virus and a common carp with a confirmed SVC infection were
2.9 | Diagnostic specificity and sensitivity
also used as negative control.
Diagnostic sensitivity and specificity of the RPA assays were deter-
mined, after optimization of reaction conditions for the CEV- and
KHV-singleplex- and multiplex-RPA assays, using a total of 100 ran-
dom clinical retrospective samples from 74 koi and 26 common carp

(a) (b) (c)

F I G U R E 1 Singleplex and multiplex CEV-/KHV-RPA assay.

Colour signals on the lateral flow dipstick (LFD), which indicates
amplification of both carp oedema virus (CEV) and koi herpesvirus F I G U R E 2 Effect of temperature on the developed recombinase
(KHV) (a), only KHV (b), or only CEV (c) DNA using specific polymerase amplification (RPA) assays. The RPA assay could detect
recombinase polymerase amplification (RPA) primers and probes. C- target DNA after incubation in the range 35–45°C (signals appeared
Line = control line, which indicates that the LFD functioned on both control and test lines); the assay did not generate a signal at
correctly. No signals were observed in either test position on the either room temperature or 50°C (signal appeared on only the
dipstick when no-template control (NTC) was used. T1- control line). C-line = control line, which indicated that the lateral
Line = location of signal of KHV amplicon. T2-Line = location of flow dipstick (LFD) functioned correctly. T2-line = location of CEV
signal of amplified CEV-DNA amplicon. RT, room temperature; NTC, no-template control
6 | SOLIMAN AND EL-MATBOULI

cases that had been submitted to our clinic (Clinical Division of Fish highest intensity signal on the test band was seen at 38°C; thus, this
Medicine, University of Veterinary Medicine, Vienna, Austria) from temperature was used for all following tests. Evaluation of the RPA
May 2015 to April 2017 for diagnosis of both viruses (Table 2). amplification time revealed that obvious signals were generated
These samples were categorized as CEV/KHV positive or negative under both singleplex and multiplex conditions, when incubated for
based on the reference standard diagnostic PCR assays; KHV con- 10, 15, 20, 25 and 30 min (Figure 3), while no signal was detected
ventional PCR assay (Bercovier et al., 2005), CEV-nested PCR assay at 5 min. As a balance between sensitivity and rapidity, we chose
(Matras et al., 2017). Moreover, the detection limit of the developed 20 min as the optimal time; thus the CEV-RPA, KHV-RPA singleplex
assays in clinical samples was investigated using 10-fold serial dilu- and multiplex assays performed optimally at 38°C for 20 min.
tions of 100 ng DNA from CEV-positive (for CEV-RPA assay) and
KHV-positive (for KHV-RPA assay) clinical samples. All these reac-
3.2 | Analytical specificity and sensitivity of the
tions were performed according to the determined optimal condi-
CEV- and KHV-RPA assays
tions for each assay. Diagnostic sensitivity (probability of a positive
test result in a CEV/KHV-infected fish, using a gold standard test as No false-positive signals were observed with any other of the
reference) and diagnostic specificity (probability of a negative result tested viral DNA/cDNA or the host carp DNA (Figures 4a,b). Fur-
in a non-infected fish) and the positive predictive values (probability thermore, BLAST analysis of the designed primers and probes
of a fish testing positive of actually being CEV/KHV-infected) and demonstrated 100% identity with sequences ascribed to the target
negative predictive values (probability of an individual testing nega- viruses only, which confirmed the specificity of the CEV- and
tive of not being infected) were calculated as previously described KHV-RPA assays.
(Olveira, Soares, Engrola, Dopazo, & Bandın, 2008; Vazquez, Cutrin, The CEV- and KHV-RPA singleplex and multiplex assays had a
Olveira, & Dopazo, 2017). lower detection limit for pDNA of 1.8 and 21 copies respectively,
either in the presence or absence of 100 ng of SPF common carp
genomic DNA, which is similar to the lower detection limit of the
2.10 | Direct RPA
CEV-nested PCR (Figure 5) and KHV-PCR assay (Figure 6).
To eliminate the time-consuming and laborious DNA extraction step,
another sample preparation method was tested. Tissues homoge-
nates of the diagnostic samples were mixed with carbonate/bicar-
bonate buffer according to Soliman and El-Matbouli (2009), and then
50 ll of this homogenate was placed in sterile DNase/RNase-free,
thin-walled 0.2 ml polypropylene microfuge tubes and incubated at
50°C for 15 min. Tubes were then washed three times with 200 ll
phosphate-buffered saline containing 0.05% Tween-20 (PBS-T). The
47.5 ll RPA master mix (containing rehydration buffer, primers,
probe and water only) was then added to the tubes, incubated at
95°C for 10 min and then placed on ice for 2–3 min. This mixture
was used to rehydrate the lyophilized RPA enzyme, and the reaction
tube was incubated at the estimated RPA temperature. We refer to
this sample preparation method as “direct RPA.” We compared the
singleplex- and multiplex-RPA assays with samples used in direct
RPA, and DNA extracted from the samples.

3 | RESULTS

3.1 | Optimization of the CEV- and KHV-RPA

singleplex and multiplex assays
Assay results for primers and probe designed for carp oedema virus
(Figure 1c) and KHV (Figure 1b) amplified their respective targets as
expected, under both singleplex and multiplex (Figure 1a) reaction F I G U R E 3 Effect of amplification time on the recombinase
conditions. No signals were observed in either test position on the polymerase amplification (RPA) assays. Figure shows that the RPA
assay could amplify target DNA within 10, 15, 20, 25 and 30 min,
dipstick when no-template control (NTC) was used. Both single- and
which is shown as a colour signal on both control and test lines;
multiplex reactions functioned at temperatures of 35, 38, 40 and 5 min was insufficient to amplify the target DNA (signal only on the
45°C (Figure 2). No amplification signals were detected when the control line). C-line = control line. T1-line = location of KHV
assays were performed either at room temperature, or 50°C. The amplicon
SOLIMAN AND EL-MATBOULI | 7

(a) (b)

F I G U R E 4 Specificity of the carp oedema virus (CEV)- and koi herpesvirus (KHV)-recombinase polymerase amplification (RPA) assay.
Specific amplification of CEV-DNA or of KHV-DNA is indicated by a colour signal on both control and test lines for CEV-positive samples only
(a), or test lines for KHV-positive samples (b) and not with other fish pathogens DNA/cDNA or genomic fish DNA (which showed only one
colour signal, on the control line). C-line = control line, T1-line = location of KHV amplicon, T2-line = location of CEV amplicon. In figure (a):
Lane-1 = DNA from koi tissues with confirmed CEV infection & Lane-5 = DNA from purified KHV. In figure (b): Lane-1 = DNA from purified
KHV & Lane-5 = DNA from koi tissues with confirmed CEV infection. In both figures (a and b): Lane-2 = DNA from CCB cells infected with
KHV. Lane-3 = DNA from common carp tissues with confirmed KHV infection. Lane-4 = DNA from non-infected CCB cells. Lane-6 = DNA
from CyHV-1. Lane-7 = DNA from CyHV-2. Lane-8 = DNA from goldfish with confirmed CyHV-2 infection. Lane-9 = cDNA from EPC cells
infected with SVCV. Lane-10 = cDNA from common carp tissues with confirmed SVCV infection. Lane-11 = SPF common carp genomic DNA

4 | DISCUSSION
3.3 | Diagnostic specificity and sensitivity of the
developed singleplex- and multiplex-RPA assays
In the past, our clinic has examined many common carp and koi
Diagnostic specificity and sensitivity were evaluated using 100 clinical cases that had typical clinical signs of KHV infection, yet which
samples against standard protocols routinely used for diagnosis of tested negative for the virus. Given the re-emergence of CEV, we
CEV/KHV as a reference. Each of 100 clinical common carp and koi retrospectively tested many of the mystery cases using the CEV-spe-
samples was tested by both the single- and multiplex CEV- and KHV- cific diagnostic PCR and determined that CEV was the causative
RPA assays. The assays accurately detected viral DNA in samples that agent (Lewisch et al., 2015).
had previously tested positive by the reference diagnostic PCR assays, Established diagnostic assays are based on PCR or real-time PCR,
Bercovier et al. (2005) and Matras et al. (2017) for KHV and CEV which are techniques that are time-consuming and require expensive
respectively (nine positive for CEV and five positive for KHV), with no instruments; thus, these assays are not appropriate for small clinic or
false positives or negatives (Table 2). Additionally, both the singleplex amateur CEV disease surveys or surveillance. Hence, we sought to
and multiplex CEV-RPA assay could detect CEV in the clinical samples develop a simple, rapid and specific field test to detect CEV-DNA
4
till the DNA dilution of 10 . However, the singleplex and multiplex with sensitivity equal to or better than the diagnostic PCR. Ideally,
KHV-RPA assays could detect KHV in the clinical samples till the DNA this assay would also detect and differentiate between CEV and
dilution of 107 and 105 respectively (Data not shown). The diagnos- KHV, the other serious virus that affects common carp and koi, and
tic sensitivity and specificity were 100%, and the positive and negative thus aid in disease surveillance and control strategies.
predictive values were also 100%. Single- and multiplex-RPA assays We based our assay on the recombinase polymerase amplifica-
produced the same results for each sample. Moreover, the tissue tion (RPA) technique, for isothermal detection in both single- and
homogenate of each sample tested using the direct binding method multiplex assays for CEV and KHV viral DNA. One advantage of
produced the same result as extracted DNA. RPA over other molecular diagnostic assays is that it can detect low
8 | SOLIMAN AND EL-MATBOULI

F I G U R E 5 Sensitivity of the carp oedema virus (CEV)-

recombinase polymerase amplification (RPA) assay compared with
standard PCR assay. The figure shows the lower detection limit of F I G U R E 6 Sensitivity of the koi herpesvirus (KHV)-recombinase
the developed CEV-RPA assay compared with the diagnostic nested polymerase amplification (RPA) assay compared with standard PCR
PCR assay. A plasmid-bearing target sequence for CEV-RPA and assay. The figure shows the lower detection limit of the developed
PCR from a proven CEV-negative case was diluted to provide target KHV-RPA assay compared with the diagnostic PCR assay. A plasmid-
copy numbers of 1.8 9 109, 1.8 9 108, 1.8 9 107, 1.8 9 106, bearing target sequence for KHV-PCR and RPA from a purified virus
1.8 9 105, 1.8 9 104, 1.8 9 103, 1.8 9 102, 1.8 9 101 and was diluted to provide target copy numbers of 2.1 9 108,
1.8 9 100 per reaction for lanes 1–10 respectively. Lane 2.1 9 107, 2.1 9 106, 2.1 9 105, 2.1 9 104, 2.1 9 103, 2.1 9 102,
11 = Plasmid vector. Lane 12 = No-template control. Both assays 2.1 9 101 and 2.1 9 100 per reaction for lanes 1–9 respectively.
could detect down to 1.8 copies of pDNA that contain the target Lane 10 = Plasmid vector. Lane 11 = No-template control. Both
CEV fragment, which is indicated respectively by presence of a PCR RPA and PCR assays could detect down to 21 copies from the
band at 478 bp, and presence of two colour signals on the LFD. C- pDNA that contain target KHV fragment, which is indicated
line = control. T2-line = location of CEV amplicon. Mar = 100-bp respectively by presence of a band at 409 bp in PCR and presence
DNA ladder (Invitrogen) of two colour signals on the LFD. C-line = control. T1-line = location
of KHV amplicon. Mar = 100-bp DNA ladder (Invitrogen)

concentrations of nucleic acid in a short time, 10–20 min, with high

specificity and sensitivity (Piepenburg et al., 2006). We selected the probes specific to each virus, to reduce the risk of false-positive
thymidine kinase and P4a genes as targets for our RPA primers and results that may arise by primer dimers. Initially, we tested different
probes, for KHV and CEV respectively. Thymidine kinase gene is concentrations of primers and probes in singleplex assays and used
essential for virulence of KHV and other herpesviruses (Bercovier the best performing combination in a multiplex assay. This approach
et al., 2005; Boivin, Coulombe, & Rivest, 2002). The P4a gene is was not successful, in that our initial multiplex assay did not detect
essential for assembly of the nucleoprotein complex of pox virus viral DNA. Accordingly, we trialled different primer and probe con-
(Heljasvaara et al., 2001) and is the only known sequence for the centrations under multiplex conditions until we found the best com-
CEV till now. These are the same gene targets that are used in the bination that could detect DNA of both viruses simultaneously.
established diagnostic PCR assays and thus facilitated a measure of Use of a lateral flow dipstick for detection of amplification prod-
direct comparison between PCR and RPA assay sensitivity. ucts enhances the specificity and rapidity of the RPA method (Post-
We designed the RPA primers to generate only short amplicons, huma-Trumpie, Korf, & van Amerongen, 2009). The different primer
which should be produced in a relatively shorter time to improve and probe tags are recognized by antibodies specific to these tags,
speed of the assay (Head et al., 2014). The CEV and KHV primers at specific positions on the dipstick, with detection indicated by a
were 32 and 34 bp respectively and near the minimum length colorimetric signal. The lateral flow dipstick that we used has three
required by the recombinase protein for incorporation of oligonu- line positions: a control line to demonstrate the proper flow of a
cleotides into duplex DNA (Piepenburg et al., 2006). We used differ- sample through the strip, the first test line, which contains digoxige-
ent tags (biotin and digoxigenin) on the 50 -ends of the reverse nen ligands (which detect the KHV amplicons), and the second test
primers to enable discrimination between the different viral ampli- line, which contains biotin ligands (for detection of CEV amplicons).
cons using the lateral flow dipstick. Similarly, we used modified The colorimetric signal was detectable by the naked eye, which not
SOLIMAN AND EL-MATBOULI | 9

only saved time but also eliminates the need for any other post- reduced the duration of the CEV- and KHV-RPA assays to about
amplification detection protocol (e.g., gel or qPCR analysis) and 50 min from receiving the sample to interpretation of the result. This
trained personnel to interpret the results (Sun et al., 2016). sample preparation method was validated by testing all the common
Although we demonstrated that the singleplex- and multiplex- carp and koi samples that had been submitted to us for KHV or CEV
RPA assays functioned over a wide range of temperatures and times, diagnosis (100 samples): we obtained identical results from direct
we chose 38°C and 20 min as the optimum amplification conditions RPA and from extracted DNA, compared with the original diagnostic
for enzyme performance and speed, without reducing sensitivity of PCR.
the assay. Knowing that the assay can perform well outside these
values makes it robust and flexible under clinical or field conditions
and leads to more successful application of the RPA diagnostic test 5 | CONCLUSIONS
(Prescott et al., 2016).
We showed that the analytical sensitivities of both singleplex We have demonstrated a rapid, sensitive and specific isothermal
and multiplex CEV-RPA assays were similar to the diagnostic nested nucleic acid detection assay for detection and differentiation between
PCR developed by CEFAS and reported by Matras et al. (2017). the two viruses that threaten the common carp and koi industry, CEV
Compared with PCR, RPA has some fundamental advantages, includ- and KHV. We suggest that the CEV- and KHV-singleplex- or multi-
ing the ability to function in the presence of many known PCR inhi- plex-RPA assays and dipstick detection method are suitable for wide-
bitors (Kersting, Rausch, Bier, & von Nickisch-Rosenegk, 2014; spread non-laboratory use in monitoring movement of imported or
Rohrman & Richards-Kortum, 2015). Additionally, the crowding exported koi or common carp to control spreading of these viruses, as
agent in the RPA formulation, high molecular weight polyethylene it only takes 50 min to test a sample and no equipment is required
glycol, enhances the enzyme catalytic activity and improves sensitiv- except heating block to provide a constant temperature.
ity, efficiency and specificity of the reaction (Lareu, Harve, & Raghu-
nath, 2007; Minton, 1983; Sasaki, Miyoshi, & Sugimoto, 2006;
ACKNOWLEDGEMENTS
Zimmerman & Harrison, 1987). Also, RPA is much faster to perform:
20 min, compared with 5 hr for the CEV-nested PCR. For KHV, the We thank Dr. Sven Bergmann (National Reference Laboratory for
lower detection limit of the RPA assay was equivalent to Bercovier Fish Diseases, Germany) for providing us with DNA of CyHV-1 and
et al. (2005) PCR assay. This performance is slightly worse than CyHV-2 to test the specificity of our assays; and Dr. Stephen Atkin-
another viral RPA assay: the KHV-RPA assay developed by Prescott son (Oregon State University, USA) for English editing of the manu-
et al. (2016) can detect down to 10 virions; however, this is not a script. This study was funded by the University of Veterinary
like-for-like comparison as the assays target different genes. When Medicine (PP291-ELM).
multiplexed, the sensitivity of the assay for KHV in clinical samples
was reduced by 100-fold, which may be attributed to some degree
ORCID
of incompatibility between the CEV and KHV primers (Crannell
et al., 2016). Nevertheless, we demonstrated that the KHV-RPA H Soliman http://orcid.org/0000-0003-1641-6759
assay still had adequate sensitivity to identify every clinical sample
that had tested positive by PCR assay.
We optimized another aspect of the assay workflow—that of REFERENCES
sample preparation, by eliminating the time-consuming and laborious
Adamek, M., Jung-Schroers, V., Hellmann, J., Teitge, F., Bergmann, S. M.,
DNA extraction step. We demonstrated that virus particles that Runge, M., . . . Steinhagen, D. (2016). Concentration of carp edema
were present in the fish tissue homogenate could be adsorbed on virus (CEV) DNA in koi tissues affected by koi sleepy disease (KSD).
the surface of the microfuge tube when incubated at 50°C for Diseases of Aquatic Organisms, 119, 245–251. https://doi.org/10.
3354/dao02994
15 min, a result in concordance with Soliman and El-Matbouli
Aoki, T., Hirono, I., Kurokawa, K., Fukuda, H., Nahary, R., Eldar, A., . . .
(2009). Wang and Tschen (1994) showed that virus binding to a Hedrick, R. P. (2007). Genome sequences of three koi herpesvirus
plastic tube could be detected after 1 min and reach the maximum isolates representing the expanding distribution of an emerging dis-
level after 10 min of incubation. This phenomenon has been attribu- ease threatening koi and common carp worldwide. Journal of Virology,
81, 5058–5065. https://doi.org/10.1128/JVI.00146-07
ted to weak but stable conformation that enhances adsorption of
Asiello, P. J., & Baeumner, A. J. (2011). Miniaturized isothermal nucleic
proteins on a support, by increasing the entropy (Poncin-Epaillard
acid amplification, a review. Lab on a Chip, 11, 1420–1430. https://d
et al., 2012): when in contact with a hydrophobic surface, viral pro- oi.org/10.1039/c0lc00666a
tein adsorbs and unfolds to spread its hydrophobic core and reduce Bercovier, H., Fishman, Y., Nahary, R., Sinai, S., Zlotkin, A., Eyngor, M., . . .
the net hydrophobic surface area of the system in the solvent (Cas- Hedrick, R. P. (2005). Cloning of the koi herpesvirus (KHV) gene
encoding thymidine kinase and its use for a highly sensitive PCR
tells & van Tassel, 2005). The unfolding of the protein is accompa-
based diagnosis. BMC Microbiology, 5, 13. https://doi.org/10.1186/
nied by release of water molecules from the interface, which leads 1471-2180-5-13
to a net entropy gain (Patel et al., 2012). We took advantage of this Bergmann, S. M., & Kempter, J. (2011). Detection of koi herpesvirus
phenomenon through a simple sample incubation step and thereby (KHV) after reactivation in persistently infected common carp
10 | SOLIMAN AND EL-MATBOULI

(Cyprinus carpio L.) using non-lethal sampling methods. Bulletin of the Haenen, O. L. M., Way, K., Bergmann, S. M., & Ariel, E. (2004). The emer-
European Association of Fish Pathologists, 31, 92–100. gence of koi herpesvirus and its significance to European aquacul-
Blanco, M. M., Gibello, A., & Fern
andez-Garayz
abal, J. F. (2000). Influence ture. Bulletin of the European Association of Fish Pathologists, 24, 293–
of fish health management: Bases, procedures and economic implica- 307.
tions. Global quality assessment in Mediterranean aquaculture (pp. 45– Haenen, O., Way, K., Stone, D., & Engelsma, M. (2013). [Koi sleepy dis-
49). Zaragoza, Spain: CIHEAM (Cahiers Options Me
diterrane
ennes; n. ease found for the first time in koi carps in The Netherlands]. Tijd-
51). schrift voor Diergeneeskunde, 5, 27–29 (in Dutch).
Boivin, G., Coulombe, Z., & Rivest, S. (2002). Intranasal herpes simplex Head, S. R., Komori, H. K., LaMere, S. A., Whisenant, T., Van Nieuwer-
virus type 2 inoculation causes a profound thymidine kinase depen- burgh, F., Salomon, D. R., & Ordoukhanian, P. (2014). Library con-
dent cerebral inflammatory response in the mouse hindbrain. Euro- struction for next-generation sequencing: Overviews and challenges.
pean Journal of Neuroscience, 16, 29–43. https://doi.org/10.1046/j. BioTechniques, 56, 61-passim.
1460-9568.2002.02057.x Hedrick, R. P. (1996). Movement of pathogens with the international
Bretzinger, A., Fischer-Scherl, T., Oumouna, M., Hoffmann, R., & Truyen, trade of live fish; Problems and solutions. Revue Scientifique et Tech-
U. (1999). Mass mortalities in koi carp, Cyprinus carpio, associated nique, 15, 523–531. https://doi.org/10.20506/rst.15.2.938
with gill and skin disease. European Association of Fish Pathologists, Hedrick, R. P., Gilad, O., Yun, S., Spangenberg, J. V., Marty, G. D., Nord-
19, 182–185. hausen, R. W., . . . Eldar, A. (2000). A herpesvirus associated with
Castells, V., & van Tassel, P. R. (2005). Conformational transition free mass mortality of juvenile and adult koi, a strain of common carp.
energy profiles of an adsorbed, lattice model protein by multicanonical Journal of Aquatic Animal Health, 12, 44–57. https://doi.org/10.1577/
Monte Carlo simulation. Journal of Chemical Physics, 122, 4707–4716. 1548-8667(2000)012<0044:AHAWMM>2.0.CO;2
Crane, M., & Hyatt, A. (2011). Viruses of fish: An overview of significant Heljasvaara, R., Rodriguez, D., Risco, C., Carrascosa, J., Esteban, M., &
pathogens. Viruses, 3, 2025–2046. https://doi.org/10.3390/ Rodriguez, J. (2001). The major core protein P4a (A10L Gene) of vac-
v3112025 cinia virus is essential for correct assembly of viral DNA into the
Crannell, Z., Castellanos-Gonzalez, A., Nair, G., Mejia, R., White, A. C., & nucleoprotein complex to form immature viral particles. Journal of
Richards-Kortum, R. (2016). Multiplexed recombinase polymerase Virology, 75, 5778–5795. https://doi.org/10.1128/JVI.75.13.5778-
amplification assay to detect intestinal protozoa. Analytical Chemistry, 5795.2001
88, 1610–1616. https://doi.org/10.1021/acs.analchem.5b03267 Ishioka, T., Yoshizumi, M., Izumi, S., Suzuki, K., Suzuki, H., Kozawa, K., . . .
Dong, C., Weng, S., Li, W., Li, X., Yi, Y., Liang, Q., & He, J. (2011). Charac- Kimura, H. (2005). Detection and sequence analysis of DNA poly-
terization of a new cell line from caudal fin of koi, Cyprinus carpio merase and major envelope protein genes in koi herpesviruses
koi and first isolation of cyprinid herpesvirus 3 in China. Virus derived from Cyprinus carpio in Gunma prefecture, Japan. Veterinary
Research, 161, 140–149. https://doi.org/10.1016/j.virusres.2011.07. Microbiology, 110, 27–33. https://doi.org/10.1016/j.vetmic.2005.07.
016 002
El-Matbouli, M., Rucker, U., & Soliman, H. (2007). Detection of Cyprinid James, A., & Macdonald, J. (2015). Recombinase polymerase amplifica-
herpesvirus-3 (CyHV-3) DNA in infected fish tissues by nested poly- tion: Emergence as a critical molecular technology for rapid, low-
merase chain reaction. Diseases of Aquatic Organisms, 78, 23–28. resource diagnostics. Expert Review of Molecular Diagnostics, 15,
https://doi.org/10.3354/dao01858 1475–1489. https://doi.org/10.1586/14737159.2015.1090877
Engelsma, M. Y., Way, K., Dodge, M. J., Voorbergen-Laarman, M., Pan- Jung-Schroers, V., Adamek, M., Teitge, F., Hellmann, J., Bergmann, S. M.,
zarin, V., Abbadi, M., . . . Stone, D. (2013). Detection of novel strains Schu €tze, H., . . . Steinhagen, D. (2015). Another potential carp killer?
of cyprinid herpesvirus closely related to koi herpesvirus. Diseases of Carp edema virus disease in Germany. BMC Veterinary Research, 11,
Aquatic Organisms, 107, 113–120. https://doi.org/10.3354/dao02666 114. https://doi.org/10.1186/s12917-015-0424-7
Gilad, O., Yun, S., Adkison, M., Way, K., Willits, N., Bercovier, H., & Kersting, S., Rausch, V., Bier, F., & von Nickisch-Rosenegk, M. (2014).
Hedrick, R. (2003). Molecular comparison of isolates of an emerging Rapid detection of Plasmodium falciparum with isothermal recombi-
fish pathogen, koi herpesvirus, and the effect of water temperature nase polymerase amplification and lateral flow analysis. Malaria Jour-
on mortality of experimentally infected koi. Journal of General Virol- nal, 13, 99. https://doi.org/10.1186/1475-2875-13-99
ogy, 84, 2661–2668. https://doi.org/10.1099/vir.0.19323-0 Kim, J., & Easley, C. J. (2011). Isothermal DNA amplification in bioanaly-
Gilad, O., Yun, S., Andree, K., Adkison, M., Zlotkin, A., Bercovier, H., . . . sis: Strategies and applications. Bioanalysis, 3, 227–239. https://doi.
Hedrick, R. (2002). Initial characteristics of koi herpesvirus and devel- org/10.4155/bio.10.172
opment of a polymerase chain reaction assay to detect the virus in Lareu, R. R., Harve, K. S., & Raghunath, M. (2007). Emulating a
koi, Cyprinus carpio koi. Diseases of Aquatic Organisms, 48, 101–108. crowded intracellular environment in vitro dramatically improves
https://doi.org/10.3354/dao048101 RT-PCR performance. Biochemical and Biophysical Research
Gilad, O., Yun, S., Zagmutt-Vergara, F. J., Leutenegger, C. M., Bercovier, Communications, 363, 171–177. https://doi.org/10.1016/j.bbrc.2007.
H., & Hedrick, R. P. (2004). Concentrations of a koi herpesvirus 08.156
(KHV) in tissues of experimentally infected Cyprinus carpio koi as Lewisch, E., Gorgoglione, B., Way, K., & El-Matbouli, M. (2015). Carp
assessed by real-time TaqMan PCR. Diseases of Aquatic Organisms, edema virus/koi sleepy disease: An emerging disease in Central-East
60, 179–187. https://doi.org/10.3354/dao060179 Europe. Transboundary and Emerging Diseases, 62, 6–12. https://doi.
Gotesman, M., Kattlun, J., Bergmann, S., & El-Matbouli, M. (2013). CyHV- org/10.1111/tbed.12293
3: The third cyprinid herpesvirus. Diseases of Aquatic Organisms, 105, Matras, M., Borzym, E., Stone, D., Way, K., Stachnik, M., Maj-Paluch, J.,
163–174. https://doi.org/10.3354/dao02614 . . . Reichert, M. (2017). Carp edema virus in Polish aquaculture – Evi-
Gray, W., Mullis, L., Lapatra, S., Groff, J., & Goodwin, A. (2002). Detec- dence of significant sequence divergence and a new lineage in com-
tion of koi herpesvirus DNA in tissue of infected fish. Journal of Fish mon carp Cyprinus carpio (L.). Journal of Fish Diseases, 40, 319–325.
Diseases, 25, 171–178. https://doi.org/10.1046/j.1365-2761.2002. https://doi.org/10.1111/jfd.12518
00355.x Michel, B., Fournier, G., Lieffrig, F., Costes, B., & Vanderplasschen, A.
Gunimaladevi, I., Kono, T., Venugopal, M. N., & Sakai, M. (2004). Detec- (2010). Cyprinid herpesvirus 3. Emerging Infectious Diseases, 16,
tion of koi herpesvirus in common carp, Cyprinus carpio L., by loop- 1835–1843. https://doi.org/10.3201/eid1612.100593
mediated isothermal amplification. Journal of Fish Diseases, 27, 583– Minamoto, T., Honjo, M. N., & Kawabata, Z. I. (2009). Seasonal distribu-
589. https://doi.org/10.1111/j.1365-2761.2004.00578.x tion of cyprinid herpesvirus 3 in lake Biwa, Japan. Applied and
SOLIMAN AND EL-MATBOULI | 11

Environmental Microbiology, 75, 6900–6904. https://doi.org/10.1128/ amplification. Journal of Aquatic Animal Health, 28, 173–180.
AEM.01411-09 https://doi.org/10.1080/08997659.2016.1185048
Minton, A. P. (1983). The effect of volume occupancy upon the thermo- Pretto, T., Abbadi, M., Panzarin, V., Quartesan, R., Manfrin, A., & Toffan,
dynamic activity of proteins: Some biochemical consequences. Molec- A. (2015). Carp edema virus (CEV): First detection in Italy. 17th Interna-
ular and Cellular Biochemistry, 55, 119–140. https://doi.org/10.1007/ tional Conference on Diseases of Fish and Shellfish, Abstract and
BF00673707 poster, p. 343. Las Palmas, Gran Canaria, Organized by European
Miyazaki, T., Isshiki, T., & Katsuyuki, H. (2005). Histopathological and Association of Fish Pathologists.
electron microscopy studies on sleepy disease of koi Cyprinus carpio Rohrman, B., & Richards-Kortum, R. (2015). Inhibition of recombinase
koi in Japan. Diseases of Aquatic Organisms, 65, 197–207. https://doi. polymerase amplification by background DNA: A lateral flow-based
org/10.3354/dao065197 method for enriching target DNA. Analytical Chemistry, 87, 1963–
Murakami, Y., Shitanaka, M., Toshida, S., & Matsuzato, T. (1976). Studies 1967. https://doi.org/10.1021/ac504365v
on mass mortality of juvenile carp: About mass mortality showing Sano, M., Ito, T., Kurita, J., Yanai, T., Watanabe, N., Miwa, S., & Iida, T.
oedema. Bulletin of Hiroshima Fresh Water Fish Experiment Station, (2004). First detection of koi herpesvirus in cultured common carp
19–33 (in Japanese, English Abstract). Cyprinus carpio in Japan. Journal of Fish Pathology, 39, 165–167.
Neukirch, M., Bottcher, K., & Bunnarjirakul, S. (1999). Isolation of a virus https://doi.org/10.3147/jsfp.39.165
from koi with altered gills. Bulletin of the European Association of Fish Sasaki, Y., Miyoshi, D., & Sugimoto, N. (2006). Effect of molecular crowd-
Pathologists, 19, 221–224. ing on DNA polymerase activity. Biotechnology Journal, 1, 440–446.
Oh, M. J., Jung, S. J., Choi, T. J., Kim, H. R., Rajendran, K. V., Kim, Y. J., https://doi.org/10.1002/(ISSN)1860-7314
. . . Chun, S. K. (2001). A viral disease occurring in cultured carp Cypri- Sharma, N., Hoshika, S., Hutter, D., Bradley, K. M., & Benner, S. A.
nus carpio in Korea. Journal of Fish pathology, 36, 147–151. https://d (2014). Recombinase-based isothermal amplification of nucleic acids
oi.org/10.3147/jsfp.36.147 with self-avoiding molecular recognition systems (SAMRS). ChemBio-
OIE (2016). Manual of diagnostic tests for aquatic animals – 16.08.2016. Chem, 15, 2268–2274. https://doi.org/10.1002/cbic.201402250
Paris: OIE. Retrieved from http://www.oie.int/fileadmin/Home/eng/ Soliman, H., & El-Matbouli, M. (2005). An inexpensive and rapid diagnos-
Health_standards/aahm/current/chapitre_koi_herpesvirus.pdf tic method of the koi herpesvirus (KHV) infection by a loop-mediated
Olveira, J. G., Soares, F., Engrola, S., Dopazo, C. P., & Bandın, I. (2008). isothermal amplification method. Virology Journal, 2, 83. https://doi.
Antemortem versus postmortem detection of betanodavirus in org/10.1186/1743-422X-2-83
Senegalese sole (Solea senegalensis). Journal of Veterinary Diagnostic Soliman, H., & El-Matbouli, M. (2009). Immunocapture and direct binding
Investigation, 20, 215–219. https://doi.org/10.1177/1040638708 loop mediated isothermal amplification simplify molecular diagnosis
02000212 of cyprinid herpesvirus-3. Journal of Virological Methods, 162, 91–95.
Ono, S., Nagai, A., & Sugai, N. (1986). A histopathological study on juve- https://doi.org/10.1016/j.jviromet.2009.07.021
nile colorcarp, Cyprinus carpio, showing edema. Journal of Fish Pathol- Soliman, H., & El-Matbouli, M. (2010). Loop mediated isothermal amplifi-
ogy, 21, 167–175. https://doi.org/10.3147/jsfp.21.167 cation combined with nucleic acid lateral flow strip for diagnosis of
Oste, C. (1988). Polymerase chain reaction. BioTechniques, 6, 162–167. Cyprinid herpes virus-3. Molecular and Cellular Probes, 24, 38–43.
Oyamatsu, T. (1996). Study on edema disease of carp. Ph.D. thesis, Univer- https://doi.org/10.1016/j.mcp.2009.09.002
sity of Fisheries, Tokyo. Dissertation No. 142. Sun, K., Xing, W., Yu, X., Fu, W., Wang, Y., Zou, M., . . . Xu, D. (2016).
Oyamatsu, T., Hata, N., Yamada, K., Sano, T., & Fukuda, H. (1997). An Recombinase polymerase amplification combined with a lateral flow
Etiological study on mass mortality of cultured color carp juveniles dipstick for rapid and visual detection of Schistosoma japonicum. Para-
showing edema. Journal of Fish Pathology, 32, 81–88. https://doi.org/ sites and Vectors, 9, 476. https://doi.org/10.1186/s13071-016-1745-5
10.3147/jsfp.32.81 Vazquez, D., Cutrin, J. M., Olveira, J. G., & Dopazo, C. P. (2017). Design
Oyamatsu, T., Matoyama, H. N., Yamamoto, K., & Fukuda, H. (1997). A and validation of a RT-qPCR procedure for diagnosis and quantifica-
trial for the detection of Carp Edema Virus by using polymerase tion of most types of infectious pancreatic necrosis virus using a sin-
chain reaction. Suisanzoshoku, 45, 247–251 (in Japanese, English gle pair of degenerated primers. Journal of Fish Diseases, 40, 1155–
Abstract). 1167. https://doi.org/10.1111/jfd.12590
Patel, A. J., Varilly, P., Jamadagni, S. N., Hagan, M., Chandler, D., & Vesely, T., Pokorova, D., Reschova, S., & Piackova, V. (2015). Detection of
Garde, S. (2012). Sitting at the edge: How biomolecules use carp edema virus in common carp (Cyprinus carpio) and koi in the Czech
hydrophobicity to tune their interactions and function. The Journal Republic. In 17th International Conference on Diseases of Fish and
of Physical Chemistry B, 116, 2498–2503. https://doi.org/10.1021/ Shellfish, Abstract and poster, p. 346. Las Palmas, Gran Canaria,
jp2107523 Organized by European Association of Fish Pathologists.
Perelberg, A., Smirnov, M., Hutoran, M., Diamant, A., Bejerano, Y., & Viadanna, P., Pilarski, F., Hesami, S., & Waltzek, T. (2015). First report of
Kotler, M. (2003). Epidemiological description of a new viral disease Carp Edema Virus (CEV) in South American Koi. 40th Eastern Fish
afflicting cultured Cyprinus carpio in Israel. Israeli Journal of Aquacul- Health Workshop, Charleston, NC.
ture, 55, 5–12. Waltzek, T. B., Gotesman, M., Steckler, N., Spears, S., Shelley, J., &
Piepenburg, O., Williams, C., Stemple, D., & Armes, N. (2006). DNA Yanong, R. P. E. (2014). Overview of DNA viruses impacting ornamental
detection using recombination proteins. PLoS Biology, 4, e204. aquaculture. Portland, OR: ISAAH.
https://doi.org/10.1371/journal.pbio.0040204 Waltzek, T. B., Kelley, G. O., Stone, D. M., Way, K., Hanson, L., Fukuda,
Poncin-Epaillard, F., Vrlinic, T., Debarnot, D., Mozetic, M., Coudreuse, A., H., . . . Hedrick, R. P. (2005). Koi herpes virus represents a third cypri-
Legeay, G., . . . Zorzi, W. (2012). Surface treatment of polymeric nid herpes virus (CyHV-3) in the family Herpesviridae. Journal of Gen-
materials controlling the adhesion of biomolecules. Journal of Function eral Virology, 86, 1659–1667. https://doi.org/10.1099/vir.0.80982-0
Biomaterials, 3, 528–543. https://doi.org/10.3390/jfb3030528 Wang, C., & Tschen, S. (1994). Affinity capture-polymerase chain reaction
Posthuma-Trumpie, G. A., Korf, J., & van Amerongen, A. (2009). Lateral for quantitation of hepatitis B virus DNA. Nucleic Acids Research, 22,
flow (immuno)assay: Its strengths, weaknesses, opportunities and 4837–4839. https://doi.org/10.1093/nar/22.22.4837
threats. A literature survey. Analytical and Bioanalytical Chemistry, Way, K., & Stone, D. (2013). Emergence of carp edema virus-like (CEV
393, 569–582. https://doi.org/10.1007/s00216-008-2287-2 like) disease in the UK. CEFAS Finfish News, 15, 32–34.
Prescott, M. A., Reed, A. N., & Jin, L. (2016). Rapid detection of Cyprinid Yuasa, K., Sano, M., Kurita, J., Ito, T., & Iida, T. (2005). Improvement of a
herpesvirus 3 in latently infected koi by recombinase polymerase PCR method with the SphI-5 primer set for the detection of koi
12 | SOLIMAN AND EL-MATBOULI

herpesvirus (KHV). Journal of Fish Pathology, 40, 37–39. https://doi.

org/10.3147/jsfp.40.37
How to cite this article: Soliman H, El-Matbouli M. Rapid
Zimmerman, S. B., & Harrison, B. (1987). Macromolecular crowding
increases binding of DNA polymerase to DNA: An adaptive detection and differentiation of carp oedema virus and
effect. Proceedings of the National Academy of Sciences of the Uni- cyprinid herpes virus-3 in koi and common carp. J Fish Dis.
ted States of America, 84, 1871–1875. https://doi.org/10.1073/pna 2018;00:1–12. https://doi.org/10.1111/jfd.12774
s.84.7.1871