Elife 85752 v2

RESEARCH ARTICLE
Glial-dependent clustering of voltage-

gated ion channels in Drosophila
precedes myelin formation
Simone Rey1†, Henrike Ohm1†, Frederieke Moschref1‡, Dagmar Zeuschner2,
Marit Praetz1, Christian Klämbt1*
1
Institut für Neuro- und Verhaltensbiologie; Röntgenstraße, Münster, Germany;
2
Max-Planck Institut für molekulare Biomedizin; Wissenschaftliches Service-Labor für
Elektronenmikroskopie; Röntgenstraße, Muenster, Germany
Abstract Neuronal information conductance often involves the transmission of action potentials.
The spreading of action potentials along the axonal process of a neuron is based on three physical
parameters: the axial resistance of the axon, the axonal insulation by glial membranes, and the
positioning of voltage-gated ion channels. In vertebrates, myelin and channel clustering allow fast
saltatory conductance. Here, we show that in Drosophila melanogaster voltage-gated sodium and
potassium channels, Para and Shal, co-localize and cluster in an area resembling the axon initial
segment. The local enrichment of Para but not of Shal localization depends on the presence of
peripheral wrapping glial cells. In larvae, relatively low levels of Para channels are needed to allow
*For correspondence: proper signal transduction and nerves are simply wrapped by glial cells. In adults, the concentration
[email protected]
of Para increases and is prominently found at the axon initial segment of motor neurons. Concomi-
†
These authors contributed tantly, these axon domains are covered by a mesh of glial processes forming a lacunar structure that
equally to this work possibly serves as an ion reservoir. Directly flanking this domain glial processes forming the lacunar
Present address: ‡Max-Planck area appear to collapse and closely apposed stacks of glial cell processes can be detected, resem-
Institut für Multidisziplinäre bling a myelin-like insulation. Thus, Drosophila development may reflect the evolution of myelin
Naturwissenschaften; Hermann which forms in response to increased levels of clustered voltage-gated ion channels.
Rein-Str, Göttingen, Germany
Competing interest: The authors

declare that no competing Editor's evaluation
interests exist. Here, the authors characterize axon-initial segment-like structures in Drosophila using a variety of
Funding: See page 18
approaches spanning molecular genetic, confocal and super-resolution imaging, and ultrastructure.
These important findings advance our understanding of how myelin evolved with potentially early
Received: 22 December 2022
roles in organizing ion channel clustering in axons. The convincing evidence supporting the conclu-
Preprinted: 09 January 2023
sions includes advanced imaging combined with molecular genetic approaches, which will be of
Accepted: 22 May 2023
Published: 06 June 2023
significant interest to neuroscientists and cell biologists.
Reviewing Editor: Dion K

Dickman, University of Southern
California, United States
Introduction
‍ ‍Copyright Rey, Ohm et al. This
A functional nervous system requires the processing and transmission of information in the form of
article is distributed under the
changing membrane potentials. To convey information along axons, neurons generate action poten-
terms of the Creative Commons
Attribution License, which tials by opening of evolutionarily conserved voltage-gated sodium and potassium channels (Moran
permits unrestricted use and et al., 2015). Once an action potential is generated, it travels toward the synapse and the speed
redistribution provided that the of information transfer is of obvious importance. It is long established that axonal conductance
original author and source are velocity depends on the resistance within the axon, which inversely correlates with its diameter. In
credited. addition, it depends on the resistance across the axonal membrane, which is increased by extensive
Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752 1 of 25

Research article Developmental Biology | Neuroscience
glial wrapping. Furthermore, spacing of voltage-gated ion channels contributes to axonal conduction
velocity (Eshed-Eisenbach and Peles, 2021; Freeman et al., 2016; Hodgkin and Huxley, 1952).
In vertebrates, unmyelinated axons generally have a small diameter with evenly distributed voltage-
gated ion channels along their plasma membrane, and in consequence their conductance velocity is
slow (Castelfranco and Hartline, 2015). To speed up conductance, axons grow to a larger diameter
and show a clustering of voltage-gated ion channels at the axon initial segment (AIS) and the nodes of
Ranvier. Together with the insulating glial-derived myelin sheet, this allows fast saltatory conductance
(Arancibia-Cárcamo et al., 2017; Castelfranco and Hartline, 2015; Cohen et al., 2020; Dutta et al.,
2018; Eshed-Eisenbach and Peles, 2021).
In invertebrates, mechanisms to increase conductance speed are thought to be limited by radial
axonal growth, as seen in the giant fiber system of Drosophila or the giant axon of the squid (Allen
et al., 2006; Hartline and Colman, 2007). No saltatory conductance has been described for inver-
tebrates and it is assumed that voltage-gated ion channels distribute relatively evenly along axonal
membranes. Nevertheless, myelin-like structures were found in several invertebrate species, including
annelids, crustacean, and insects (Coggeshall and Fawcett, 1964; Davis et al., 1999; Günther, 1976;
Hama, 1959; Hama, 1966; Hess, 1958; Heuser and Doggenweiler, 1966; Levi et al., 1966; Roots,
2008; Roots and Lane, 1983; Wigglesworth, 1959; Wilson and Hartline, 2011). However, it is
unknown whether such myelin-like structures also impact the distribution of ion channels.
To address how glial cells affect axonal conductance velocity we turned to Drosophila. In the larvae,
peripheral axons are engulfed by a single glial wrap resembling Remak fibers in the mammalian PNS (Matzat
et al., 2015; Nave and Werner, 2014; Stork et al., 2008). In addition to insulating axons, we found that
glial cells promote radial axonal growth. In the absence of wrapping glia axons are not only thin, but they
are also characterized by a severe reduction in conductance velocity, which is stronger than predicted by the
reduced axonal diameter (Hodgkin and Huxley, 1952; Kottmeier et al., 2020). Thus, wrapping glial cells
might control localization of voltage-gated ion channels along the axonal plasma membrane.
Results
Distribution of the voltage-gated sodium channel Para
The Drosophila genome harbors only one voltage-gated sodium channel called Paralytic (Para), which is
required for the generation of all action potentials (Kroll et al., 2015). To study the localization of Para and
to test whether Drosophila glia affects its localization, we and others tagged the endogenous para locus with
all predicted isoforms being modified (Ravenscroft et al., 2020; Venken et al., 2011; Figure 1A). In param-
Cherry
flies, monomeric Cherry (mCherry) is inserted close to the Para N-terminus (Figure 1A). Homozygous
or hemizygous paramCherry flies are viable with only mildly affected channel function (Figure 1B; Ravenscroft
et al., 2020; Venken et al., 2011). ParamCherry localizes along many CNS and PNS axons of the larval nervous
system (Figure 1—figure supplement 1A–C; Ravenscroft et al., 2020; Venken et al., 2011).
To independently assay Para localization, we generated antibodies against an N-terminal epitope shared
by all predicted Para isoforms (Figure 1A). In western blots, anti-Para antibodies detect a band of the
expected size (>250 kDa), which is shifted toward a higher molecular weight in protein extracts of homozy-
gous paramCherry animals (Figure 1—figure supplement 1D). Immunohistochemistry detects Para localization
in control first instar larvae but not in age-matched para null mutant animals, further validating the speci-
ficity of the antibodies (Figure 1D–E’). Whereas the pre-immune serum fails to detect any specific proteins
(Figure 1F), anti-Para antibody staining of third instar larval filets revealed the localization of Para in the CNS
and the PNS (Figure 1G) similar to what was noted for ParamCherry localization (Figure 1C). Thus, we anticipate
that endogenously mCherry-tagged Para protein reflects the wild typic Para localization.
To test a possible differential distribution of Para in either sensory or motor axons, we utilized
RNAi to remove mCherry expression in heterozygous paramCherry females. This leaves the wild type
para allele intact and circumvents the early lethal phenotype associated with loss of para. Knockdown
of mCherry expression in glutamatergic motor neurons (Mahr and Aberle, 2006) reveals paramCherry
expression in cholinergic sensory neurons of third instar larvae. Here, Para appears to evenly localize
along the abdominal nerves and is found at many processes within the CNS (Figure 2A). In contrast,
silencing paramCherry in cholinergic neurons (Salvaterra and Kitamoto, 2001) reveals a predominant
localization of Para in an axonal segment of motor axons at the PNS/CNS boundary of third instar
larvae (Figure 2B), as suggested before (Ravenscroft et al., 2020).

Figure 1. Localization of Paralytic (Para) voltage-gated ion channels in the larval nervous system. (A) Schematic view on the para gene. Alternative
splicing at the circled exons results in the generation of more than 60 Para isoforms. All isoforms share a common N-terminus. Here, the MiMIC insertion
MI08578 allows tagging of the endogenous para gene. The peptide sequence AEHEKQKELERKRAEGE (positions 33–49) that was used for immunization
is indicated by a green star, the MiMIC insertion is indicated by a magenta star. (B) Homozygous paramCherry, paraApex2 or paraST76 flies were tested for
temperature-induced paralysis. The recovery time is indicated. (C) Third instar larval paramCherry nervous system stained for Cherry localization. ParamCherry
is detected in the ventral nerve cord (vnc) and diffusely along peripheral nerves (arrows). (D,D’) Affinity purified anti-Para antibodies detect a protein
in the CNS of dissected 24-hr-old wild type first instar larvae. (E,E’) No protein is found in the CNS of dissected age-matched para mutant animals.
(F) Third instar larval nervous system stained with the pre-immune control. (G) Third instar larval nervous system stained with affinity purified anti-Para
antibodies. Scale bars are as indicated.
The online version of this article includes the following source data and figure supplement(s) for figure 1:
Figure supplement 1. Ensheathing- / wrapping glia in Drosophila and characterization of Para protein.
Figure supplement 1—source data 1. Four images of western blots, with and without marker bands, are provided.
Differential localization of voltage-gated potassium channels

Several genes encode voltage-gated potassium channels. Using endogenously tagged proteins, we find
the Shaker potassium channel mostly in the synaptic neuropil regions (Figure 2C). The distribution of Shab
resembles ParamCherry localization in sensory axons (Figure 2A and D), whereas Shal localizes in a pattern
similar to Para localization on motor axons (Figure 2B and E). Thus, Drosophila larval motor axons appear
to have an axonal segment resembling the vertebrate AIS harboring both voltage-gated sodium and potas-
sium channels.
We then analyzed the localization of Para in the adult CNS. Here, too, global Para localization, as
detected by anti-Para antibodies, matched the ParamCherry signal (Figure 2F and G). To differentiate

Figure 2. Differential localization of voltage-gated ion channels in Drosophila. (A) Third instar larvae with the
genotype [paramCherry; OK371-Gal4, UAS-mCherrydsRNA]. paramCherry expression is suppressed in all glutamatergic
neurons and thus, ParamCherry localization along axons of cholinergic sensory neurons becomes visible. (B) Third
instar larvae with the genotype [paramCherry; Chat-Gal4, UAS-mCherrydsRNA]. Here, expression of paramCherry is
suppressed in all cholinergic neurons which reveals Paralytic (Para) localization in motor neurons. Note the
prominent Para localization at the CNS/PNS transition point (arrowheads). (C) Third instar larval shakerGFP nervous
system stained for GFP localization. Shaker is found in the neuropil (dashed areas). (D) Third instar larval shabGFP
nervous system stained for GFP localization. Shab is distributed evenly along all peripheral axons. (E) Third instar
larval shalGFP nervous system stained for GFP localization. Shal localizes similar as Para on motor axons. Scale bars
are 100 µm. (F) Adult paramCherry ventral nerve cord stained for Para localization. ParamCherry localizes prominently
along segments of peripheral nerves (arrow) as they enter thoracic neuromeres. Note that some axons entering
the CNS neuropil show only a weak Para signal (open arrowhead). (G) Control (Oregon R) adult ventral nerve
cord stained for Para protein localization using purified anti-Para antibodies. Note the differential localization
Figure 2 continued on next page

Figure 2 continued
of Para along axons entering the nerve (arrow, open arrowhead). (H) Ventral nerve cord of an adult fly with the
genotype [paraFlpTag-GFP; Ok371-Gal4, UAS-flp]. The boxed area is shown enlarged in (H’). The arrowheads point to
high density of Para. (I) Ventral nerve cord of an adult fly with the genotype [paraFlpTag-GFP; Chat-Gal4, UAS-flp]. The
boxed area is shown enlarged in (H’). Note that Para localization is reduced as soon as axons enter the neuropil
(arrows). Scale bars are as indicated.
between Para expression in motor and sensory neurons, we employed the recently developed FlpTag
technique (Fendl et al., 2020). Here, cell type-specific expression of the Flp recombinase induces the
inversion of a GFP-encoding exon located in the gene of interest. In paraFlpTag flies (Fendl et al., 2020),
Flp expression in all motor neurons results in strong labeling of Para localization at a small part of the
axon as it leaves the neuropil (Figure 2H and H’, arrowheads), indicating that an AIS is also found
in adult motor axons. In contrast, expression of Flp in all sensory neurons using Chat-Gal4 UAS-flp
reveals an even Para decoration of axons as they enter the CNS which fades out when axons reach
into the neuropil (Figure 2I,I’, arrows).
Figure 3. Clustered localization of Paralytic (Para) along motor axons. (A) High-resolution Airyscan analysis of ParamCherry and (B) HRP localization in an
adult nerve. The boxed area is shown in higher magnification below (A’,B’). Note the clustered appearance of ParamCherry, clusters are about 0.6–0.8 µm
apart (arrowheads). (C,C’) Primary wild type neural cells cultured for 7 days stained for Repo (magenta) to label glial nuclei, HRP (cyan) to label neuronal
cell membranes and anti-Para antibodies (green). The Para protein localizes in a dotted fashion. (D) Ventral nerve cord of a third instar larva with the
genotype [paraFlpTag-GFP; 94G06-Gal4, UAS-flp]. The arrow points to a single neuronal cell body found in every hemineuromer. (E) Higher magnification of
single ParaGFP expressing axons. Note the dotted arrangement of ParaGFP along motor axons (arrowheads). (F,F’) Ventral nerve cord of a third instar larva
with the genotype [paraFlpTag-GFP; 94G06-Gal4, UAS-flp] imaged with super-resolution. The dashed box is shown in high magnification in (F’). Arrows point
to clusters of Para protein. Scale bars are as indicated. (G) Quantification of Para cluster distance using super-resolution imaging (ParaFlpTag::GFP, average
distance is 620 nm, n=91 clusters on 3 axons, 2 larvae) or electron microscopy (ParaApex2, average distance is 706 nm, n=64 clusters on 8 axons 4 animals,
Mann-Whitney U-test, p=0.0747, two-tailed). Scale bars are as indicated.

High-resolution imaging reveals clustered localization of Para along

motor axons
To obtain a higher spatial resolution of Para distribution, we used high-resolution Airyscan microscopy. In
adult nerves, ParamCherry localization distal to the AIS is found in a clustered arrangement (Figure 3A–B’,
arrowheads). To exclude that cluster formation is due to the fluorescence protein moiety, we performed anti-
Para immunohistochemistry on primary Drosophila neural cells in culture, where axons form small fascicles
with few accompanying glial cells (Figure 3C and C’). When such cultures are stained for Para distribution,
we find Para channels localized in small clusters with a spacing of about 0.6–0.8 µm. However, in these
neuronal cultures we cannot clearly define the number of Para expressing axons in a fascicle.
To further improve spatial resolution, we combined high-resolution imaging with the FlpTag labeling
method. We restricted Flp expression to only one motor neuron in each larval hemineuromer using
94G06-Gal4 (Jenett et al., 2012; Pérez-Moreno and O’Kane, 2019), which results in the expression
of GFP-tagged Para channels in only a single neuron. Whereas weak expression is noted around the
nucleus, strong expression is seen in the AIS (Figure 3D, arrow, asterisks). Flanking the strong expres-
sion along the AIS, a clustered localization of ParaGFP could be noted (Figure 3E, arrowheads). Further
super-resolution imaging of single motor axons decorated with GFP-tagged Para showed an average
spacing of 0.620 µm (Figure 3F, F’, and G, n=91 clusters on 3 axons, quantification using Fiji). Interest-
ingly, Para clusters appear to be organized along lines at the motor axon which was also found when
analyzing the distribution of Para at the electron microscopic level (see below).
In sensory neurons increased Para localization is found at dendrites and

the AIS
Having shown that in motor axons Para is concentrated in a clustered arrangement in an AIS of motor
axons, we wondered whether similar distribution can be found in sensory axons. For this we expressed flp
in multidendritic sensory neurons using the pickpocket Gal4 driver (ppk-Gal4). This allows labeling of the
v’ada neurons (Figure 4A). Low levels of Para protein localize to the cell body and the distal shaft of the
axon. Along the descending axon, Para localization increases only in some distance to the soma (Figure 4A,
B, and C). However, para expression in sensory neurons is not as strong as in motor axons which may
correspond to the notion that sensory axons are usually smaller axons. The relatively low expression levels
did not allow super-resolution imaging and thus, we could not address whether Para is found in a clustered
organization along axons of ppk positive sensory neurons. Interestingly, however, within some of the v’ada
dendrites, Para accumulates in distinct clusters (Figure 4A’ and B’, arrows).
In conclusion, the above data show the presence of an AIS in Drosophila motor and sensory axons.
In motor axons, where this domain likely serves as a spike initiation zone (Günay et al., 2015), Para
channels are organized in a clustered arrangement.
Electron microscopic analysis of Para cluster formation

To determine the distribution of Para on the subcellular level, we integrated an Apex2 encoding exon in
the para locus, which allows generating local osmiophilic diaminobenzidine (DAB) precipitates that are
detectable in the electron microscope (Lam et al., 2015). The insertion of an Apex2 encoding exon in the
N-terminus of Para affected para function less strongly than the insertion of an mCherry exon and resulted
in a very weak hypomorphic para allele (Figure 1A and B). In adult flies, ParaApex2 is expressed in sufficient
intensity to be detected along axons using the electron microscope. In small diameter peripheral axonal
segments, weak ParaApex2 directed DAB precipitates are found (Figure 5A, white arrowheads). In contrast, in
large diameter axons next to the CNS/PNS boundary intense DAB precipitates can be detected (Figure 5B).
When we performed serial sectioning, the intensity of DAB labeling varied (Figure 5B–D), possibly reflecting
the clustered localization of Para that we had found using the confocal microscope. We next determined
the distribution of DAB precipitates along the circumference of an axon over 16 consecutive cross sections
(Figure 5E and F). The resulting surface plot shows ParaApex2 localization of a small segment of the axon in a
3D space. This suggests that ParaApex2 clusters are organized in two lines along the ≈2.4 µm axonal circum-
ference (Figure 5F and G), resembling the distribution of ParamCherry clusters along lines as detected using
super-resolution light microscopy (Figure 3F). To further address the spacing of ParaApex2 clusters along the
longitudinal axis of the axon, we performed longitudinal sections of Para-rich axon segments and deter-
mined the staining intensity along the plasma membrane by using Fiji (Figure 5H,I). Here, again a spatial
modulation of the Para staining intensity is apparent, with a spacing of 0.706 µm (Figure 5I; see Figure 3G

Figure 4. Localization of Paralytic (Para) along sensory axons. (A,A’) Ventral pickpocket expressing sensory neuron
(v’ada) of a third instar larva with the genotype [paraFlpTag-GFP; ppk-Gal4, UAS-flp, UAS-tdTomato] stained for GFP
(green), HRP (magenta), and tdTomato (white). The dashed boxes are shown in higher magnification in (B,C). The
asterisk denotes the position of the neuronal cell soma. The filled arrows indicate localized Para along some of
the dendritic processes. The open arrowhead points to a dendritic process lacking Para localization. Note that
Para localization along the descending axon becomes prominent only after about 50 µm (open arrow). (B,B’)
Magnification of the neuronal soma attached dendrites. (C,C’) Descending axon of the v’ada neuron. Note that the
strong Para signal starts 50 µm distal to the cell soma and fades out after 100 µm (open arrows). Scale bars are as
indicated.

Figure 5. A glial lacunar system surrounds the axon initial segment. (A) Weak Paralytic (Para) expression can be detected on paraApex2 expressing small
axons (arrowheads) running in fascicles within the nerve. (B–D) Cross sections through the same axon at various positions. Distance between individual
sections (B,C) is 15 µm, distance between (C,D) is 6.5 µm. Note the intense labeling of the axonal membrane is changing between the different sections.
(E) Cross section, to determine the staining intensity along the membrane (below the blue line), a corresponding ROI was defined and (F) quantified
using Fiji. (G) Surface plot of ParaApex2 distribution along 16 consecutive axonal cross sections. For details, see Materials and methods. The intensity
of diaminobenzidine (DAB) precipitates is transformed to different colors. Note that Para clusters are organized in two longitudinal lines across the
axonal membrane surface. (H) Longitudinal section of a paraApex2 expressing axon. The staining intensity along the membrane (above the blue line) was
quantified using Fiji. (I) Staining intensity of the membrane stretch shown in (H). Note the regular increase in staining intensity every 0.6–0.8 µm. For
quantification see Figure 3G. Scale bars are as indicated.

Figure 6. Organization of the lacuna forming tract glial. (A,B) Apex2 expression directed by 75H03-Gal4. Axons (asterisks) are engulfed by lacunar
structures that are largely formed by the tract glia. (C) Maximum projection of a confocal image stack. 75H03-Gal4 directed expression of GFP labels
the ensheathing/wrapping or tract glia. Note that GFP expression ends proximal to the dissection cut (white dashed circles). (D–F) multicolor flipout
(MCFO2) analysis of the nrv2-Gal4, R90C03-Gal80 positive wrapping glia. Note that glial cells tile the nerve roots with no gaps in between. Scale bars
are as indicated.
The online version of this article includes the following figure supplement(s) for figure 6:
Figure supplement 1. Glial cell types involved in lacuna formation.
for quantification, n=54 cluster distances on 6 axons), which is similar to what we determined by confocal
microscopy.
Para-rich axon segments are embedded in a lacunar system formed by

tract glia
Interestingly, the large caliber axons decorated with highest levels of Para protein are embedded in a mesh-
like glial organization, that resembles the lacunar system described earlier for the cockroach (Figure 5B–D,
Figure 6A, B; Wigglesworth, 1960). The Drosophila glial lacunar system is characterized by intensive
formation of glial processes around axons which are always larger than 0.5 µm in diameter (Figure 6A, B,
asterisks). Glial cell processes have an average thickness of 35 nm (Figure 6A, B, n=189 processes, 4 nerves
from 3 animals).
Next, we determined which glial cell type forms these lacunar structures. In the larva, the central
ensheathing/wrapping glial cells express the 83E12-Gal4 driver (Peco et al., 2016; Pogodalla et al.,
2021), whereas the peripheral wrapping glial cells can be addressed using the nrv2-Gal4 90C03-Gal80
driver (Kottmeier et al., 2020; Matzat et al., 2015; Stork et al., 2008; Figure 1—figure supplement
1A and B). In adults – but not in larvae – a specialized group of glial cells is found at the CNS/PNS
boundary, called tract glia (Kremer et al., 2017) which overlaps with both the central ensheathing glia

and the peripheral wrapping glia (Figure 6—figure supplement 1). Interestingly, a similarly distinct
group of glial cells has been identified in the vertebrate nervous system (Fontenas and Kucenas,
2017; Kucenas et al., 2008; Kucenas et al., 2009). The position of the lacunae coincides with the
location of the tract glial cells (Kremer et al., 2017) (compare Figures 2H, 6C). These glial cells express
75H03-Gal4, 83E12-Gal4 as well as the nrv2-Gal4 90C03-Gal80 driver (Figure 6—figure supplement
1). Multicolor flipout (MCFO2) labeling experiments (Nern et al., 2015) indicate tiling of these glial
cells along the nerve with no overlap and no spaces in between individual glial cells (Figure 6D–F). To
further determine which glial cell forms the lacunar structures, we generated flies harboring a UAS-
Myr-Flag-Apex2-NES transgene (Apex2Myr, see Materials and methods) and expressed the myristoy-
lated Apex2 with the different Gal4 drivers mentioned above. These experiments confirmed that most
of the lacunar system is indeed generated by tract glial cell processes (Figure 6A, B).
Thus, in large caliber motor axons, most of the Para voltage-gated sodium channels is positioned close to
the lacunar system, which had been previously speculated to serve as an extracellular ion reservoir needed
for sustained generation of action potentials (Chandra and Singh, 1983; Leech and Swales, 1987; Maddrell
and Treherne, 1967; Treherne and Schofield, 1981; Van Harreveld et al., 1969; Wigglesworth, 1960).
Myelin in the leg nerve is found close to the CNS

In vertebrates, clustering of voltage-gated ion channels occurs on the edges of myelinated axonal segments
(internodes) (Arancibia-Cárcamo et al., 2017; Castelfranco and Hartline, 2015; Cohen et al., 2020;
Dutta et al., 2018; Eshed-Eisenbach and Peles, 2021). Here, myelin not only participates in positioning of
voltage-gated ion channels but also increases electric insulation and thus contributes to a faster conductance
velocity. In Drosophila highest conductance velocity is likely to be required during fast and well-tuned loco-
motion in adults. Thus, we focused our search for myelin-like structures on adult leg nerves. Most of the 760
axons within an adult leg run in a single large nerve that exit the CNS at well-defined positions (Figure 7A-C,
Figure 7—figure supplement 1A). Unlike the organization in larval nerves, axons running in the leg nerves
are found in distinct zones depending on their diameter (Figure 7B and C). At the position of the femur,
large axons are always covered by a single glial sheet. Small diameter axons are generally not individually
wrapped but rather engulfed as a fascicle (Figure 7B and D). At the coxa, close to the CNS, we noted that
large diameter axons were occasionally flanked by several glial membrane sheets (Figure 7E, asterisk). Up
to 15 flat glial membrane sheets with a thickness of about 28 nm are found along larger axons (Figure 7E,F,
Figure 7—figure supplement 1B). Axons with an intermediate diameter show individual glial wrapping with
a single or very few glial sheets (Figure 7E and H). To quantify the occurrence of myelin-like structures we
made semi-serial distal to proximal sections of six nerves every 5 µm across the entire lacunar area spanning
40–60 µm (Figure 7—figure supplement 2). The position where lacunar structures were first identified was
set as zero. We then counted the occurrence of myelin-like structures in every section that we defined as ≥4
glial layers in close apposition. Here, we noted an increase in the number of myelin-like structures at the
distal end of the lacunae (Figure 7—figure supplement 2B, Figure 7—figure supplement 3). No myelin-
like structures were found at proximal positions close to the neuropil. The position of the up to four myelin-
like structures found within a section plane was variable and could be either at the margin of the lacunae
(Figure 7—figure supplement 3A) or could be found separating an area with small axons from an area
with large axons (Figure 7—figure supplement 3B), or close to the blood-brain barrier (Figure 7—figure
supplement 3C). In rare cases we noted formation of myelin-like membrane stacks without contact to axons
in the lacunar region (Figure 7—figure supplement 3D). Myelin-like sheets contact serval axons (Figure 7—
figure supplement 3A–C, E and F) but can also engulf single large axons with varying complexity of the
membrane stacks (Figure 7—figure supplement 3G–H, Figure 7—figure supplement 4).
Myelin can be formed by central tract glia and peripheral wrapping glia
To determine which glial cell type is able to form myelin-like structures, we expressed Apex2Myr in
specific glial cell types and analyzed whether DAB positive myelin-like stacks of glial cell processes
can be detected in the electron microscope. Upon expression of Apex2Myr in CNS-derived tract glia
75H03-Gal4 DAB positive myelin stacks can be detected (Figure 7G (black arrowhead), Figure 7I,
Figure 7—figure supplement 3, Figure 7—figure supplement 5). The finding that 75H03-Gal4
directed Apex2 labeling can be found next to unlabeled glial sheets (Figure 7G, white arrowhead)
suggests that peripheral wrapping glial cells can also form myelin-like structures in the leg nerve.
Drosophila myelin-like membrane stacks are generated by extensive membrane folding providing the

Figure 7. Drosophila wrapping glia form myelin. (A) Drosophila leg of a 3-week-old fly with wrapping glial nuclei in green, the cuticle is stained by
autofluorescence, the genotype is [nrv2-Gal4, UAS-lamGFP]. (B–K) Electron microscopic images of sections taken from 3-week-old female flies. (B)
Section at the level of the femur. (C) Electron microscopic section at the level of the coxa. In some areas, an increased amount of glial membranes can
be detected close to large caliber axons (box with white dashed lines, enlarged as an inlay). (D,E,G) Cross sections through a 2 weeks adult leg of a fly
with the genotype [75H03-Gal4, UAS-Myr-Flag-Apex2-NES]. Glial cell processes are stained by the presence of Apex2 which generates an osmiophilic
diaminobenzidine (DAB) precipitate. (D) Small caliber axons (ax) are engulfed by a single glial process as fascicle. Larger axons are individually wrapped
(asterisk). (E) Large caliber axons are surrounded by glial membrane stacks. The asterisk denotes an axon engulfed by a few glial wraps (red dots). (F) Up
to 15 densely packed membrane sheets are found (see inlay for enlargement). (G) Darkly stained tract glia membrane stacks (black arrowhead) can be
Figure 7 continued on next page

Figure 7 continued
found next to unlabeled membrane stacks (white arrowhead), suggesting that myelin-like structures can be derived from both, central and peripheral
wrapping glial cells. (H) High-pressure freezing preparation showing a single axon covered by myelin-like membrane sheets in a lacunar area (asterisks).
(I) Note the bulged appearance of the growing tip of the glial cell processes that form the myelin-like structures (arrowheads). The inlay shows a highly
organized membrane stacking. (J,K) High-pressure freezing preparation of prefixed samples to reduce tissue preparation artifacts. Note the compact
formation of membrane layers. The white dashed area is shown in (K). Scale bars are as indicated.
Figure supplement 1. Count of axons in Drosophila leg nerves and measurement of glial cell process width.
Figure supplement 2. Extent of the lacunar system.
Figure supplement 3. Quantification of myelin distribution in the leg nerve.
Figure supplement 4. Multilayered myelin-like structures are formed around single axons in the adult nervous system.
Figure supplement 5. Formation of myelin-like structures in the adult CNS of Drosophila.
disadvantage that axons are not entirely insulated (Figure 7I, Figure 7—figure supplements 4 and 5).
However, we occasionally do find axons encircled by multiple glial wraps (Figure 7H, Figure 7—figure
supplements 4 and 5). Interestingly, in some areas we noted almost compacted glial membrane
sheets (Figure 7F,I, inlay boxed areas).
To further validate these findings we performed additional high-pressure freezing of prefixed samples
to optimize tissue preservation (Möbius et al., 2016; Sosinsky et al., 2008). In such specimens compact
stackings of thin glial membrane sheets can be detected, too (Figure 7J and K). In the compacted areas
(Figure 7I–K), the interperiodic distance of the different glial layers is about 30 nm, which is considerably
more than the interperiodic distance of 13 nm found in mouse peripheral myelin (Fledrich et al., 2018). The
unique compact appearance of vertebrate myelin is mediated by the myelin basic protein (MBP) (Nave and
Werner, 2021). In contrast to vertebrate myelin where extra- and intercellular space is removed, fly myelin-
like structures only show an irregular compaction of the extracellular space.
Para localization depends on wrapping glial cells

Next, we wanted to test whether wrapping glial cells participate in the control of positioning voltage-gated
ion channels. To address this, we ablated either peripheral wrapping glia or central ensheathing glia including
the tract glia by directing the expression of the proapoptotic gene hid (Kottmeier et al., 2020; Pogodalla
et al., 2021) and assayed the distribution of Shal and Para. Ablation of central or peripheral wrapping glial
cells does not affect the distribution of the voltage-gated potassium channel Shal (Figure 8—figure supple-
ment 1). Likewise, removal of the CNS-specific ensheathing glia does not affect Para localization in the larval
nervous system (Figure 8—figure supplement 2A–E). In contrast, upon ablation of the peripheral wrapping
glia a marked change in Para protein localization becomes obvious (Figure 8—figure supplement 2A–B’).
In control larvae, anti-Para antibodies detect only a weak labeling of segmental nerves, but all nerves are
intensely decorated with Para in wrapping glia ablated larvae. Whereas in wild type control larvae, 2.5 times
more Para protein is found at the CNS/PNS transition zone compared to nerve segments on the muscle
field, an almost even distribution is noted in glia ablated larvae (Figure 8C). In addition to the redistribution
of Para protein along the axon, we also noted a twofold increase of para mRNA levels in further qRT-PCR
experiments (Figure 8D).
Taken together, even in the small insect Drosophila melanogaster, myelin-like structures are formed
(Figure 9). They are preferentially found distally to a lacunar region. The lacunae are formed by glial
cell processes and comprise a large extracellular liquid filled space (Figure 9). Para voltage-gated
sodium channels are differentially localized along sensory and motor neurons. In sensory neurons, Para
expression is generally weaker and concentrates in an AIS but is also found in dendritic processes. In
motor neurons Para localization is enriched in axonal segments that are running within the glial lacunar
system. Interestingly, glia ablation experiments indicate that normal para mRNA expression as well as
Para protein localization is dependent on the presence of wrapping glial cell processes. This suggests
a signaling pathway from glia to the regulation of para transcription.

Figure 8. Localization of the voltage-gated sodium channel depends on glia. (A,A’) Third instar larval filet preparation with the genotype [nrv2-Gal4,
UAS-CD8-GFP; R90C03-Gal80] showing the localization of Paralytic (Para) as detected using the anti-Para antibody in a control larva. (B,B’) Third instar
larval filet preparation with the genotype [nrv2-Gal4, UAS-hid; R90C03-Gal80] showing the localization of Para as detected using the anti-Para antibody
in a wrapping glia ablated larva. The white dashed boxes were used for quantification of Para fluorescence intensity in the CNS/PNS transition zone in
relation to its expression in the muscle field area. The yellow boxed areas are shown in higher magnification (A’,B’). Note the increased localization of
Para along the peripheral nerve at the level of the muscle field (asterisks). Scale bars are as indicated. (C) Quantification of Para fluorescence intensity
in the CNS/PNS transition area and the muscle field area in control and wrapping glia ablated larvae (n=10 larval filets, 3 nerves/filet). To exclude a
possible influence seen in individual animals, the average fluorescence intensities along nerves of each individual were compared. Note, Para distributes
more evenly along the axon in the absence of wrapping glia (p=0,0003; Mann-Whitney U-test). (D) Quantification of para mRNA expression using qRT-
PCR in control and wrapping glia ablated larvae (n=7, with 15–20 brains each). para ct-values were normalized to ct-values of control gene, RPL32. Note,
the significant increase in para mRNA expression upon wrapping glia ablation (p=0,0006, Mann-Whitney U-test). Scale bars are as indicated.
Figure supplement 1. Glia ablation does not affect the localization of the voltage-gated potassium channel Shal.
Figure supplement 2. Ablation of central ensheathing glia does not affect positioning of Paralytic (Para) at the axon initial segment (AIS).
Discussion
In the vertebrate nervous system, saltatory conductance allows very fast spreading of information.
This requires localized distribution of voltage-gated ion channels and concomitantly, the formation of
the myelin sheath. The evolution of this complex structure is unclear. Here, we report glial-dependent

Figure 9. Organization of the axon initial segment (AIS) in Drosophila motor axons. Voltage-gated sodium
channels are preferentially positioned at the AIS of the motor axon. (A) In the larval nervous system positioning
is mediated by the peripheral wrapping glia. (B) In adults these cells form myelin-like structures, which fray out in
the lacunae which represent a reservoir possibly needed for ion homeostasis during sustained action potential
generation.

localization of voltage-gated ion channels at an AIS-like domain of peripheral Drosophila larval motor
axons. As more channels accumulate in adults, a lacunar system and adjacent myelin-like structures
are formed by central tract glia and peripheral wrapping glia.
In myelinated axons of vertebrates, voltage-gated Na+ and K+ channels are clustered at the AIS and
the nodes of Ranvier (Amor et al., 2014; Freeman et al., 2016; Nelson and Jenkins, 2017). In inverte-
brate neurons, the AIS corresponds to the spike initiation zone located distal to the soma and distal to the
dendrite branching point. Such segments were found in Caenorhabditis elegans (Eichel et al., 2022) and
have been previously postulated for Drosophila neurons due to the localization of a giant ankyrin, which in all
systems appears to be an important scaffolding protein at the AIS, as well as the presence of voltage-gated
ion channels (Dubessy et al., 2019; Freeman et al., 2015; Jegla et al., 2016; Ravenscroft et al., 2020;
Trunova et al., 2011). Moreover, recent modeling approaches at the example of the pioneering aCC motor
neuron predicted the localization of voltage-gated ion channels at the CNS/PNS boundary (Günay et al.,
2015), which very well matches the localization of the voltage-gated ion channels Para and Shal, as reported
here. Interestingly, in Drosophila para mRNA expression as well as Para protein localization depend on the
presence of peripheral wrapping glia. In glia ablated nerves, Para expression is increased and decorates the
entire axonal membrane. This loss of a clustered distribution may contribute to the pronounced reduction
in axonal conductance velocity noted earlier in such glia ablated animals (Kottmeier et al., 2020). In addi-
tion, we found an increased para mRNA expression. How glial cells control Para localization and how this is
then transduced to an increased expression of para remains to be further studied. Since alterations in glial
differentiation caused by manipulation of FGF-receptor signaling specifically in peripheral wrapping glia
does not cause a change in Para expression or localization (Figure 8—figure supplement 2F–H), proteins
secreted by wrapping glia might be needed for the correct positioning of voltage-gated ion channels (Yuan
and Ganetzky, 1999).
In the adult nervous system, the AIS-like domain is embedded in glial lacunar regions formed by wrap-
ping glial cell processes. The increased expression of Para within the AIS-like segments of adult brains is
expected to generate strong ephaptic coupling forces (Rey et al., 2022; Rey et al., 2021). These are caused
by ion flux through open channels which generate an electric field that is able to influence the gating of
ion channels in closely neighboring axons (Arvanitaki, 1942; Krnjevic, 1986; Rasminsky, 1980). Ephaptic
coupling helps to synchronize firing axons (Anastassiou and Koch, 2015; Anastassiou et al., 2011; Han
et al., 2018; Shneider and Pekker, 2015), but is also detrimental to the precision of neuronal signaling in
closely apposed axons (Arvanitaki, 1942; Kottmeier et al., 2020).
Ephaptic coupling is counteracted by the glial lacunar system, that spatially separates axons and
adds more levels of wrapping. Furthermore, it was postulated that the lacunar system provides a
large extracellular ion reservoir (Wigglesworth, 1960). Given the tight apposition of axonal and glial
membranes with most parts of the nerve, which is in the range of 20 nm, only a very small interstitial
fluid volume is normally present. Thus, action potential generation would deplete sodium and potas-
sium ions very fast, and would prevent sustained neuronal activity. The development of lacunar struc-
tures might therefore provide sufficient amount of ion and at the same time physically separates axons
to reduce the likelihood of ephaptic coupling. It will be interesting to test this hypothesis in the future.
Close to the lacunar structures we detected myelin-like structures. It appears that the glial processes
that form the lacunae collapse to form compact myelin-like membrane sheets. Interestingly, myelin-
like structures are not formed at the lateral borders of the lacunae but rather form at its distal end. This
indicates that insulation is likely not a key function of the myelin-like structures, but rather these struc-
tures originate as a consequence of the collapsed lacunar system. Concomitant with the occurrence of
the myelin-like differentiations we note a decrease in the Para ion channel density. At the same time,
the need for a large ion reservoir decreases, favoring the formation of myelin-like structures.
A hallmark of vertebrate myelin is the spiral growth of the insulating glial membrane. This is generally not
observed in large fly nerves where glial membrane sheets rather fold back than spirally grow around a single
axon. Compared to myelinated vertebrate axons, this provides the disadvantage that axons are not entirely
insulated. However, spiral growth can be seen in small nerves where less extensive wrapping is noted. An
additional unique feature of vertebrate myelin is its compact organization which is mediated by the MBP
(Nave and Werner, 2021). In contrast to vertebrate myelin where extra- and intercellular space is removed,
fly myelin-like structures only show a compaction of the extracellular space, which is expected to increase
resistance as the number of freely moving ions is diminished. A fully compact myelin state would require
MBP-like proteins which have not been identified in the fly genome.

In conclusion, the evolution of myelin appears reflected in the different developmental stages of
Drosophila. First, voltage-gated ion channels are clustered at the AIS with the help of Drosophila glia.
Second, upon increased expression of such ion channels in the adult nervous system, an ion reservoir might
be formed by the lacunar system. The collapse of glial processes in the non-lacunar regions then provides
the basis of myelin formation. In the future, it will be interesting to identify glial-derived signals that ensure
channel positioning and determine how neuronal signaling adjusts channel expression and triggers forma-
tion of myelin.
Materials and methods

Drosophila genetics
All fly stocks were raised and kept at room temperature (RT) on standard Drosophila food. All crosses
were raised at 25°C.
To determine temperature sensitivity, five 3-day-old male and female flies were transferred to an
empty vial with a foam plug. The vials were incubated in a water bath at 42°C for 1 min and then
placed at RT. Flies were monitored every 15 s for 5 min. At least 100 males and females for each
genotype were tested.
For MCFO experiments early, white pupae were collected, put in a fresh vial and heat shocked at
37°C for 1 hr. Pupae were placed back to 25°C and dissected a few days after hatching.
To generate paramCherry flies we employed the MiMIC insertion strain paraMi8578 generated by the Bellen
lab and we injected pBS-KS-attB1-2-PT-SA-SD-0-mCherry (DGRC Stock 1299; https://dgrc.bio.indiana.
edu//stock/1299; RRID:DGRC_1299; Venken et al., 2011) into embryos with the following genotype: y
w Φ31/paraMi08578. Following crosses to FM7c, y w flies were tested by PCR to identify successful insertion
events.
To generate paraApex2 flies, we first removed mCherry encoding sequences from pBS-KS-attB1-2-PT-
SA-SD-0-mCherry (DGRC#1299) using restriction enzymes and then inserted the apex2 coding sequence
(Addgene #49386, using the primers AAGGATCCGGAAAGTCTTACCCAACTGT and AAGGATCCGGCA
TCAGCAAACCCAAG). pBS-KS-attB1-2-PT-SA-SD-0-Apex2 was used to establish a paraApex2 as described
above. Flies were tested via single-fly PCR. To generate UAS-Myr-Flag-Apex2 flies, we cloned Apex2 using
the primers CACCgactacaaggatgacgacgataa and cagggtcaggcgctcc into pUAST_Myr_rfA_attB, which was
then inserted into the landing site 86Fb using established protocols (Bischof et al., 2007).
Western blot analysis

Ten adult fly heads were homogenized in 50 µl RIPA buffer on ice. They were centrifuged at 4°C for
20 min at 13,000 rpm. The supernatant was mixed with 5× reducing Lämmli buffer and incubated
for 5 min at 65°C. Fifteen µl of the samples were separated to an 8% SDS-gel and subsequently
blotted onto a PVDF membrane (Amersham Hybond-P PVDF Membrane, GE Healthcare). Anti-Para
antibodies were generated against the following N-terminal sequence (CAEHEKQKELERKRAEGE),
affinity purified, and were used in a 1/1000 dilution. Experiments were repeated three times.
Cell culture
Primary neural cell culture was preformed as described (Prokop et al., 2012). In brief, three to five
stage 11 embryos were collected, chemically dechorionized, and homogenized in 100 µl dispersion
medium. Following sedimentation for 5 min at 600 × g, cells were resuspended in 30 µl culture medium
and applied to a glass bottom chamber (MatTek), sealed with a ConA-coated coverslip. Cultures were
grown for 5–7 days. Experiments were repeated three times.
qPCR
RNA was isolated from dissected larval brains using the RNeasy mini kit (QIAGEN) and cDNA was synthe-
sized using Quantitect Reverse Transcription Kit (QIAGEN) according to the manufacturer’s instructions.
qPCR for all samples was performed using a Taqman gene expression assay (Life Technologies) in a StepOne
Real-Time PCR System (Thermo Fisher, para: Dm01813740_m1, RPL32: Dm02151827_g1). RPL32 was used
as a housekeeping gene. Expression levels of Para were normalized to RPL32.
Immunohistochemistry
Larval filets: L3 wandering larvae were collected in PBS on ice. Larvae were placed on a silicon pad
and attached with two needles at both ends, with the dorsal side facing up. They were cut with a

fine scissor at the posterior end. Following opening with a long cut from the posterior to the anterior
end the tissue was stretched and attached to the silicon pad with additional four to six needles. Gut,
fat body, and trachea were removed. Adult brains: Adult flies were anesthetized with CO2 and were
dipped into 70% ethanol. The head capsule was cut open with fine scissors and the tissue surrounding
the brain removed with forceps. Legs and wings were cut off and the thorax opened at the dorsal
side. The ventral nerve cord was carefully freed from the tissue. For fixation, dissected samples were
either covered for 3 min with Bouin’s solution or for 20 min with 4% PFA in PBS. Following washing
with PBT samples were incubated for 1 hr in 10% goat serum in PBT. Primary antibody incubation was
at 4°C followed. The following antibodies were used: anti-Para N-term, this study; anti-dsRed (Takara),
anti-GFP (Abcam, Invitrogen), anti-Rumpel (Yildirim et al., 2022), anti-Repo (Hybridoma bank), rabbit
α-V5 (1:500, Sigma-Aldrich), mouse α-HA (1:1000, Covance), rat α-Flag (1:200, Novus Biologicals).
The appropriate secondary antibodies (Thermo Fisher) were incubated for 3 hr at RT. The tissues were
covered with Vectashield mounting solution (Vector Laboratories) and stored at 4°C until imaging
using an LSM880 Airyscan microscope, or a Elyra 7 microscope (Carl Zeiss AG Elyra 7 imaging, lateral
resolution 80 nm with a voxel size of 30 nm × 30 nm × 100 nm). All stainings were repeated >5 times.
High-pressure freezing
Three-week-old female flies were used with head, legs, and tip of abdomen removed. Following fixa-
tion in 4% formaldehyde (FA) in 0.1 M PHEM in a mild vacuum (–200 mbar), at RT for 45 min and three
washes in 0.1 PHEM, the tissue was embedded in 3% low melting agarose for vibratome sectioning
(Leica, VTS1200S). Samples were cut in PBS into 200 μm thick cross sections with 1 mm/s, 1.25 mm
amplitude, and were placed into lecithin-coated 6 mm planchettes, filled with 20% PVP in 0.1 M PHEM
and high-pressure frozen (Leica, HPM100). Seven specimens were sectioned. Freeze substitution was
performed in 1 %OsO4, 0.2% glutaraldehyde, 3% water in acetone at –90°C and stepwise dehydrated
over 3 days. Samples were embedded in mixtures of acetone and epon.
DAB staining and electron microscopy

Flies were injected with 4% FA in 0.1 M HEPES buffer and fixed at RT for 45 min. Following washes and
incubation in 20 mM glycine in 0.1 M HEPES, samples were incubated in 0.05% DAB in 0.1 M HEPES at RT
for 40 min; 0.03% H2O2 was added and the reaction was stopped after 5–10 min. The tissue was then fixed in
4% FA and 0.2% glutaraldehyde in 0.1 M HEPES at RT for 3 hr. After three times rinsing the tissue was fixed
in 4% FA at RT overnight. The FA was replaced by 2% OsO4 in 0.1 M HEPES for 1 hr on ice (dark). Uranyl
acetate staining was performed en bloque using a 2% solution in H2O for 30 min (dark). Following an EtOH
series (50%, 70%, 80%, 90%, and 96%) on ice for 3 min each step, final dehydration was done at RT with
2×100% EtOH for 15 min and two times propylene oxide for 30 min. Grids of high-pressure frozen samples
were additionally counterstained with uranyl acetate and lead citrate. Following slow epon infiltration spec-
imens were embedded in flat molds and polymerized at 60°C for 2 days.
Six specimens from three different fixation experiments were sectioned. Ultrathin sections were cut
using a 35° ultra knife (Diatome) and collected in formvar-coated one slot copper grids. For imaging
a Zeiss TEM 900 at 80 kV in combination with a Morada camera (EMSIS, Münster, Germany) operated
by the software iTEM. Image processing was done using Adobe Photoshop and Fiji. Ultrathin sections
of high-pressure frozen samples were examined at a Tecnai 12 biotwin (Thermo Fisher Scientific) and
imaged with a 2K CCD veleta camera (EMSIS, Münster, Germany).
To plot the Para distribution across the axonal surface, an axon was serially sectioned (≈70 nm
section thickness) and imaged. The images were cropped to the size of the axon in Fiji and aligned
using Affinity Photo (software version 1.10.5.1342). The rotated/aligned images were loaded into Fiji
and the segmented line tool was used to create ROIs on top of the axonal membrane in every section.
The ROI was set to have the same starting point for the measurement. ParaApex2 staining intensity
was measured along the circumference of an axon on 16 sequentially sectioned EM images. The
relative gray values were binned by a factor of 100. This was then interpolated in 3D. We used bihar-
monic spline interpolation from the MATLAB Curve Fitting Toolbox (software version 9.13.0.2105380
(R2022b) Update 2) to generate a surface plot.
Script:
x=ParaE(:,1);

y=ParaE(:,3);
z=ParaE(:,2);
xlin = linspace(min(x), max(x), 100);
ylin = linspace(min(y), max(y), 100);
[X,Y]=meshgrid(xlin, ylin);
% Z=griddata(x,y,z,X,Y,'natural');
% Z=griddata(x,y,z,X,Y,'cubic');
Z=griddata(x,y,z,X,Y,'v4');
mesh(X,Y,Z)
axis tight; hold on
plot3(x,y,z,'.','MarkerSize',15)
Acknowledgements
We are grateful to all our colleagues for many discussions and P Deing, K Krukkert, K Mildner, and
E Naffin for excellent technical assistance. T Zobel for help using the Elyra 7 microscope. B Zalc
and KA. Nave for critical reading of the manuscript and many thoughtful suggestions. This work
was supported by the Deutsche Forschungsgemeinschaft through funds to CK. (SFB 1348, B5, Kl
588/29).
Additional information
Funding
Funder Grant reference number Author
Deutsche SFB 1348 B5 Christian Klämbt

Forschungsgemeinschaft
Deutsche Kl 588 / 29 Christian Klämbt

Forschungsgemeinschaft
The funders had no role in study design, data collection and interpretation, or the
decision to submit the work for publication.
Author contributions
Simone Rey, Henrike Ohm, Conceptualization, Formal analysis, Investigation, Methodology, Writing
– review and editing; Frederieke Moschref, Investigation, Methodology, Writing – review and editing;
Dagmar Zeuschner, Methodology, Writing – review and editing; Marit Praetz, Formal analysis, Visu-
alization; Christian Klämbt, Conceptualization, Supervision, Writing - original draft, Writing – review
and editing
Author ORCIDs
Simone Rey ‍ ‍http://orcid.org/0000-0002-0130-6744
Henrike Ohm ‍ ‍http://orcid.org/0009-0000-9156-3527
Dagmar Zeuschner ‍ ‍http://orcid.org/0000-0002-6712-0192
Christian Klämbt ‍ ‍http://orcid.org/0000-0002-6349-5800
Decision letter and Author response

Decision letter https://doi.org/10.7554/eLife.85752.sa1
Author response https://doi.org/10.7554/eLife.85752.sa2
Additional files
Supplementary files
• MDAR checklist

Data availability
All imaging and source data are available through: https://doi.org/10.57860/min_prj_000008. All
Drosophila strains reported are available upon request to CK.
The following dataset was generated:
Author(s) Year Dataset title Dataset URL Database and Identifier
Ohm H, Rey S 2023 Raw image data of all https://doi.org/ OMERO, 10.57860/min_
publication figures 10.57860/min_prj_ prj_000008
000008
References
Allen MJ, Godenschwege TA, Tanouye MA, Phelan P. 2006. Making an escape: development and function of the
Drosophila giant fibre system. Seminars in Cell & Developmental Biology 17:31–41. DOI: https://doi.org/10.
1016/j.semcdb.2005.11.011, PMID: 16378740
Amor V, Feinberg K, Eshed-Eisenbach Y, Vainshtein A, Frechter S, Grumet M, Rosenbluth J, Peles E. 2014.
Long-term maintenance of Na+ channels at nodes of Ranvier depends on glial contact mediated by gliomedin
and NrCAM. The Journal of Neuroscience 34:5089–5098. DOI: https://doi.org/10.1523/JNEUROSCI.4752-13.
2014, PMID: 24719088
Anastassiou CA, Perin R, Markram H, Koch C. 2011. Ephaptic coupling of cortical neurons. Nature Neuroscience
14:217–223. DOI: https://doi.org/10.1038/nn.2727, PMID: 21240273
Anastassiou CA, Koch C. 2015. Ephaptic coupling to endogenous electric field activity: why bother Current
Opinion in Neurobiology 31:95–103. DOI: https://doi.org/10.1016/j.conb.2014.09.002, PMID: 25265066
Arancibia-Cárcamo IL, Ford MC, Cossell L, Ishida K, Tohyama K, Attwell D. 2017. Node of Ranvier length as a
potential regulator of myelinated axon conduction speed. eLife 6:e23329. DOI: https://doi.org/10.7554/eLife.
23329, PMID: 28130923
Arvanitaki A. 1942. Effects evoked in an axon by the activity of a contiguous one. Journal of Neurophysiology
5:89–108. DOI: https://doi.org/10.1152/jn.1942.5.2.89
Bischof J, Maeda RK, Hediger M, Karch F, Basler K. 2007. An optimized transgenesis system for Drosophila using
germ-line-specific Phic31 Integrases. PNAS 104:3312–3317. DOI: https://doi.org/10.1073/pnas.0611511104,
PMID: 17360644
Bittern J, Pogodalla N, Ohm H, Brüser L, Kottmeier R, Schirmeier S, Klämbt C. 2021. Neuron-Glia interaction in
the Drosophila nervous system. Developmental Neurobiology 81:438–452. DOI: https://doi.org/10.1002/dneu.
22737, PMID: 32096904
Castelfranco AM, Hartline DK. 2015. The evolution of vertebrate and invertebrate myelin: a theoretical
computational study. Journal of Computational Neuroscience 38:521–538. DOI: https://doi.org/10.1007/
s10827-015-0552-x, PMID: 25832903
Chandra P, Singh YN. 1983. Role of the Perineurium and glial lacunar system in nutrition and storage of nutrients
in the central nervous system of Spodoptera litura fabr. (Lepidoptera: Noctulidae) at the time of reorganisation
of the neural lamella during metamorphosis. Folia Histochemica et Cytochemica 21:59–65 PMID: 6223867.
Coggeshall RE, Fawcett DW. 1964. The fine structure of the central nervous system of the leech, Hirudo
medicinalis. Journal of Neurophysiology 27:229–289. DOI: https://doi.org/10.1152/jn.1964.27.2.229, PMID:
14129772
Cohen CCH, Popovic MA, Klooster J, Weil MT, Möbius W, Nave KA, Kole MHP. 2020. Saltatory conduction along
myelinated axons involves a periaxonal nanocircuit. Cell 180:311–322. DOI: https://doi.org/10.1016/j.cell.2019.
11.039, PMID: 31883793
Davis AD, Weatherby TM, Hartline DK, Lenz PH. 1999. Myelin-like sheaths in copepod axons. Nature 398:571.
DOI: https://doi.org/10.1038/19212, PMID: 10217140
Dubessy AL, Mazuir E, Rappeneau Q, Ou S, Abi Ghanem C, Piquand K, Aigrot MS, Thétiot M, Desmazières A,
Chan E, Fitzgibbon M, Fleming M, Krauss R, Zalc B, Ranscht B, Lubetzki C, Sol-Foulon N. 2019. Role of a
Contactin multi-molecular complex secreted by oligodendrocytes in nodal protein clustering in the CNS. Glia
67:2248–2263. DOI: https://doi.org/10.1002/glia.23681, PMID: 31328333
Dutta DJ, Woo DH, Lee PR, Pajevic S, Bukalo O, Huffman WC, Wake H, Basser PJ, SheikhBahaei S, Lazarevic V,
Smith JC, Fields RD. 2018. Regulation of myelin structure and conduction velocity by perinodal astrocytes.
PNAS 115:11832–11837. DOI: https://doi.org/10.1073/pnas.1811013115, PMID: 30373833
Eichel K, Uenaka T, Belapurkar V, Lu R, Cheng S, Pak JS, Taylor CA, Südhof TC, Malenka R, Wernig M, Özkan E,
Perrais D, Shen K. 2022. Endocytosis in the axon initial segment maintains neuronal polarity. Nature 609:128–
135. DOI: https://doi.org/10.1038/s41586-022-05074-5, PMID: 35978188
Eshed-Eisenbach Y, Peles E. 2021. The clustering of voltage-gated sodium channels in various excitable
membranes. Developmental Neurobiology 81:427–437. DOI: https://doi.org/10.1002/dneu.22728, PMID:
31859465
Fendl S, Vieira RM, Borst A. 2020. Conditional protein tagging methods reveal highly specific subcellular
distribution of ion channels in motion-sensing neurons. eLife 9:e62953. DOI: https://doi.org/10.7554/eLife.
62953, PMID: 33079061

Fledrich R, Abdelaal T, Rasch L, Bansal V, Schütza V, Brügger B, Lüchtenborg C, Prukop T, Stenzel J, Rahman RU,
Hermes D, Ewers D, Möbius W, Ruhwedel T, Katona I, Weis J, Klein D, Martini R, Brück W, Müller WC, et al.
2018. Targeting myelin lipid metabolism as a potential therapeutic strategy in a model of Cmt1A neuropathy.
Nature Communications 9:3025. DOI: https://doi.org/10.1038/s41467-018-05420-0, PMID: 30072689
Fontenas L, Kucenas S. 2017. Livin' on the edge: Glia shape nervous system transition zones. Current Opinion in
Neurobiology 47:44–51. DOI: https://doi.org/10.1016/j.conb.2017.09.008, PMID: 28957729
Freeman SA, Desmazières A, Simonnet J, Gatta M, Pfeiffer F, Aigrot MS, Rappeneau Q, Guerreiro S, Michel PP,
Yanagawa Y, Barbin G, Brophy PJ, Fricker D, Lubetzki C, Sol-Foulon N. 2015. Acceleration of conduction
velocity linked to clustering of nodal components precedes myelination. PNAS 112:E321–E328. DOI: https://
doi.org/10.1073/pnas.1419099112, PMID: 25561543
Freeman SA, Desmazières A, Fricker D, Lubetzki C, Sol-Foulon N. 2016. Mechanisms of sodium channel
clustering and its influence on axonal impulse conduction. Cellular and Molecular Life Sciences 73:723–735.
DOI: https://doi.org/10.1007/s00018-015-2081-1, PMID: 26514731
Gisselbrecht S, Skeath JB, Doe CQ, Michelson AM. 1996. Heartless Encodes a fibroblast growth factor receptor
(Dfr1/DFGF-R2) involved in the directional migration of early mesodermal cells in the Drosophila embryo.
Genes & Development 10:3003–3017. DOI: https://doi.org/10.1101/gad.10.23.3003, PMID: 8957001
Günay C, Sieling FH, Dharmar L, Lin WH, Wolfram V, Marley R, Baines RA, Prinz AA. 2015. Distal spike initiation
zone location estimation by morphological simulation of ionic current filtering demonstrated in a novel model
of an identified Drosophila motoneuron. PLOS Computational Biology 11:e1004189. DOI: https://doi.org/10.
1371/journal.pcbi.1004189, PMID: 25978332
Günther J. 1976. Impulse conduction in the myelinated giant fibers of the earthworm structure and function of
the dorsal nodes in the median giant fiber. The Journal of Comparative Neurology 168:505–531. DOI: https://
doi.org/10.1002/cne.901680405, PMID: 939820
Hama K. 1959. Some observations on the fine structure of the giant nerve fibers of the earthworm, Eisenia
foetida. The Journal of Biophysical and Biochemical Cytology 6:61–66. DOI: https://doi.org/10.1083/jcb.6.1.61,
PMID: 13673048
Hama K. 1966. The fine structure of the Schwann cell sheath of the nerve fiber in the shrimp (Penaeus japonicus).
The Journal of Cell Biology 31:624–632. DOI: https://doi.org/10.1083/jcb.31.3.624, PMID: 5971650
Han KS, Guo C, Chen CH, Witter L, Osorno T, Regehr WG. 2018. Ephaptic coupling promotes synchronous firing
of cerebellar Purkinje cells. Neuron 100:564–578. DOI: https://doi.org/10.1016/j.neuron.2018.09.018, PMID:
30293822
Hartline DK, Colman DR. 2007. Rapid conduction and the evolution of giant axons and myelinated fibers.
Current Biology 17:R29–R35. DOI: https://doi.org/10.1016/j.cub.2006.11.042, PMID: 17208176
Herzmann S, Krumkamp R, Rode S, Kintrup C, Rumpf S. 2017. PAR-1 promotes Microtubule breakdown during
dendrite pruning in Drosophila. The EMBO Journal 36:1981–1991. DOI: https://doi.org/10.15252/embj.
201695890, PMID: 28554895
Hess A. 1958. The fine structure and morphological organization of the peripheral nerve-fibres and trunke of the
cockroach (Periplaneta Americana). Journal of Cell Science s3-99:333–340. DOI: https://doi.org/10.1242/jcs.
s3-99.47.333
Heuser JE, Doggenweiler CF. 1966. The fine structural organization of nerve fibers, sheaths, and glial cells in the
prawn, Palaemonetes vulgaris. The Journal of Cell Biology 30:381–403. DOI: https://doi.org/10.1083/jcb.30.2.
381, PMID: 5968976
Hodgkin AL, Huxley AF. 1952. A quantitative description of membrane current and its application to conduction
and excitation in nerve. The Journal of Physiology 117:500–544. DOI: https://doi.org/10.1113/jphysiol.1952.
sp004764, PMID: 12991237
Igaki T, Kanuka H, Inohara N, Sawamoto K, Núñez G, Okano H, Miura M. 2000. Drob-1, a Drosophila member of
the Bcl-2/CED-9 family that promotes cell death. PNAS 97:662–667. DOI: https://doi.org/10.1073/pnas.97.2.
662, PMID: 10639136
Jegla T, Nguyen MM, Feng C, Goetschius DJ, Luna E, van Rossum DB, Kamel B, Pisupati A, Milner ES, Rolls MM.
2016. Bilaterian giant ankyrins have a common evolutionary origin and play a conserved role in Patterning the
axon initial segment. PLOS Genetics 12:e1006457. DOI: https://doi.org/10.1371/journal.pgen.1006457, PMID:
27911898
Jenett A, Rubin GM, Ngo T-TB, Shepherd D, Murphy C, Dionne H, Pfeiffer BD, Cavallaro A, Hall D, Jeter J,
Iyer N, Fetter D, Hausenfluck JH, Peng H, Trautman ET, Svirskas RR, Myers EW, Iwinski ZR, Aso Y,
DePasquale GM, et al. 2012. A Gal4-driver line resource for Drosophila Neurobiology. Cell Reports 2:991–
1001. DOI: https://doi.org/10.1016/j.celrep.2012.09.011, PMID: 23063364
Kottmeier R, Bittern J, Schoofs A, Scheiwe F, Matzat T, Pankratz M, Klämbt C. 2020. Wrapping glia regulates
neuronal signaling speed and precision in the peripheral nervous system of Drosophila. Nature
Communications 11:4491. DOI: https://doi.org/10.1038/s41467-020-18291-1, PMID: 32901033
Kremer MC, Jung C, Batelli S, Rubin GM, Gaul U. 2017. The glia of the adult Drosophila nervous system. Glia
65:606–638. DOI: https://doi.org/10.1002/glia.23115, PMID: 28133822
Krnjevic K. 1986. Ephaptic interactions: A significant mode of communications in the brain. Physiology 1:28–29.
DOI: https://doi.org/10.1152/physiologyonline.1986.1.1.28
Kroll JR, Saras A, Tanouye MA. 2015. Drosophila sodium channel mutations: contributions to seizure-
susceptibility. Experimental Neurology 274:80–87. DOI: https://doi.org/10.1016/j.expneurol.2015.06.018,
PMID: 26093037

Kucenas S, Takada N, Park HC, Woodruff E, Broadie K, Appel B. 2008. CNS-derived glia ensheath peripheral
nerves and mediate motor root development. Nature Neuroscience 11:143–151. DOI: https://doi.org/10.1038/
nn2025, PMID: 18176560
Kucenas S, Wang WD, Knapik EW, Appel B. 2009. A selective glial barrier at motor axon exit points prevents
oligodendrocyte migration from the spinal cord. The Journal of Neuroscience 29:15187–15194. DOI: https://
doi.org/10.1523/JNEUROSCI.4193-09.2009, PMID: 19955371
Lam SS, Martell JD, Kamer KJ, Deerinck TJ, Ellisman MH, Mootha VK, Ting AY. 2015. Directed evolution of
Apex2 for electron microscopy and proximity labeling. Nature Methods 12:51–54. DOI: https://doi.org/10.
1038/nmeth.3179, PMID: 25419960
Leech CA, Swales LS. 1987. Enzyme effects on the connective tissues of an insect central nervous system. Tissue
& Cell 19:587–598. DOI: https://doi.org/10.1016/0040-8166(87)90050-4, PMID: 18620213
Levi JU, Cowden RR, Collins GH. 1966. The microscopic anatomy and ultrastructure of the nervous system in
the earthworm (Lumbricus sp.) with emphasis on the relationship between glial cells and neurons. The
Journal of Comparative Neurology 127:489–510. DOI: https://doi.org/10.1002/cne.901270405, PMID:
4165525
Maddrell SH, Treherne JE. 1967. The ultrastructure of the perineurium in two insect species, Carausius morosus
and Periplaneta americana. Journal of Cell Science 2:119–128. DOI: https://doi.org/10.1242/jcs.2.1.119, PMID:
6031002
Mahr A, Aberle H. 2006. The expression pattern of the Drosophila vesicular glutamate transporter: a marker
protein for motoneurons and glutamatergic centers in the brain. Gene Expression Patterns 6:299–309. DOI:
https://doi.org/10.1016/j.modgep.2005.07.006, PMID: 16378756
Matzat T, Sieglitz F, Kottmeier R, Babatz F, Engelen D, Klämbt C. 2015. Axonal wrapping in the Drosophila PNS
is controlled by glia-derived neuregulin homolog vein. Development 142:1336–1345. DOI: https://doi.org/10.
1242/dev.116616, PMID: 25758464
Möbius W, Nave KA, Werner HB. 2016. Electron microscopy of myelin: structure preservation by high-pressure
freezing. Brain Research 1641:92–100. DOI: https://doi.org/10.1016/j.brainres.2016.02.027, PMID: 26920467
Moran Y, Barzilai MG, Liebeskind BJ, Zakon HH. 2015. Evolution of voltage-gated ion channels at the
emergence of Metazoa. The Journal of Experimental Biology 218:515–525. DOI: https://doi.org/10.1242/jeb.
110270, PMID: 25696815
Nave KA, Werner HB. 2014. Myelination of the nervous system: mechanisms and functions. Annual Review of
Cell and Developmental Biology 30:503–533. DOI: https://doi.org/10.1146/annurev-cellbio-100913-013101,
PMID: 25288117
Nave KA, Werner HB. 2021. Ensheathment and myelination of axons: evolution of glial functions. Annual Review
of Neuroscience 44:197–219. DOI: https://doi.org/10.1146/annurev-neuro-100120-122621, PMID: 33722070
Nelson AD, Jenkins PM. 2017. Axonal membranes and their domains: assembly and function of the axon initial
segment and node of Ranvier. Frontiers in Cellular Neuroscience 11:136. DOI: https://doi.org/10.3389/fncel.
2017.00136, PMID: 28536506
Nern A, Pfeiffer BD, Rubin GM. 2015. Optimized tools for multicolor stochastic labeling reveal diverse
stereotyped cell arrangements in the fly visual system. PNAS 112:E2967–E2976. DOI: https://doi.org/10.1073/
pnas.1506763112, PMID: 25964354
Peco E, Davla S, Camp D, Stacey SM, Landgraf M, van Meyel DJ. 2016. Drosophila Astrocytes cover specific
territories of the CNS neuropil and are instructed to differentiate by Prospero, a key effector of notch.
Development 143:1170–1181. DOI: https://doi.org/10.1242/dev.133165, PMID: 26893340
Pérez-Moreno JJ, O’Kane CJ. 2019. Gal4 drivers specific for type IB and type is motor neurons in Drosophila.
G3: Genes, Genomes, Genetics 9:453–462. DOI: https://doi.org/10.1534/g3.118.200809
Pogodalla N, Kranenburg H, Rey S, Rodrigues S, Cardona A, Klämbt C. 2021. Drosophila Ssheavy-Spectrin is
required in polarized ensheathing glia that form a diffusion-barrier around the neuropil. Nature
Communications 12:6357. DOI: https://doi.org/10.1038/s41467-021-26462-x, PMID: 34737284
Prokop A, Küppers-Munther B, Sánchez-Soriano N. 2012. Using primary neuron cultures of Drosophila to analyze
neuronal circuit formation and function. Hassan BA (Ed). The Making and Un-Making of Neuronal Circuits in
Drosophila Humana Press. p. 225–247. DOI: https://doi.org/10.1007/978-1-61779-830-6
Rasminsky M. 1980. Ephaptic transmission between single nerve fibres in the spinal nerve roots of dystrophic
mice. The Journal of Physiology 305:151–169. DOI: https://doi.org/10.1113/jphysiol.1980.sp013356, PMID:
6255143
Ravenscroft TA, Janssens J, Lee PT, Tepe B, Marcogliese PC, Makhzami S, Holmes TC, Aerts S, Bellen HJ. 2020.
Drosophila voltage-gated sodium channels are only expressed in active neurons and are localized to distal
axonal initial segment-like domains. The Journal of Neuroscience 40:7999–8024. DOI: https://doi.org/10.1523/
JNEUROSCI.0142-20.2020, PMID: 32928889
Rey S, Zalc B, Klämbt C. 2021. Evolution of glial wrapping: A new hypothesis. Developmental Neurobiology
81:453–463. DOI: https://doi.org/10.1002/dneu.22739, PMID: 32133794
Rey S, Ohm H, Klämbt C. 2022. Axonal ion homeostasis and glial differentiation. The FEBS Journal:16594. DOI:
https://doi.org/10.1111/febs.16594, PMID: 35943294
Roots BI, Lane NJ. 1983. Myelinating glia of earthworm giant axons: thermally induced intramembranous
changes. Tissue and Cell 15:695–709. DOI: https://doi.org/10.1016/0040-8166(83)90044-7
Roots BI. 2008. The phylogeny of Invertebrates and the evolution of myelin. Neuron Glia Biology 4:101–109.
DOI: https://doi.org/10.1017/S1740925X0900012X, PMID: 19508741

Salvaterra PM, Kitamoto T. 2001. Drosophila cholinergic neurons and processes visualized with Gal4/UAS-GFP
brain research. Brain Research. Gene Expression Patterns 1:73–82. DOI: https://doi.org/10.1016/s1567-133x(
01)00011-4, PMID: 15018821
Shneider MN, Pekker M. 2015. Correlation of action potentials in adjacent neurons. Physical Biology 12:066009.
DOI: https://doi.org/10.1088/1478-3975/12/6/066009, PMID: 26599368
Sosinsky GE, Crum J, Jones YZ, Lanman J, Smarr B, Terada M, Martone ME, Deerinck TJ, Johnson JE,
Ellisman MH. 2008. The combination of chemical fixation procedures with high pressure freezing and freeze
substitution preserves highly labile tissue ultrastructure for electron tomography applications. Journal of
Structural Biology 161:359–371. DOI: https://doi.org/10.1016/j.jsb.2007.09.002, PMID: 17962040
Stork T, Engelen D, Krudewig A, Silies M, Bainton RJ, Klämbt C. 2008. Organization and function of the
blood-brain barrier in Drosophila. The Journal of Neuroscience 28:587–597. DOI: https://doi.org/10.1523/
JNEUROSCI.4367-07.2008, PMID: 18199760
Sun B, Xu P, Salvaterra PM. 1999. Dynamic visualization of nervous system in live Drosophila. PNAS 96:10438–
10443. DOI: https://doi.org/10.1073/pnas.96.18.10438, PMID: 10468627
Treherne JE, Schofield PK. 1981. Mechanisms of ionic homeostasis in the central nervous system of an insect.
The Journal of Experimental Biology 95:61–73. DOI: https://doi.org/10.1242/jeb.95.1.61, PMID: 7334320
Trunova S, Baek B, Giniger E. 2011. Cdk5 regulates the size of an axon initial segment-like compartment in
mushroom body neurons of the Drosophila central brain. The Journal of Neuroscience 31:10451–10462. DOI:
https://doi.org/10.1523/JNEUROSCI.0117-11.2011, PMID: 21775591
Van Harreveld A, Khattab FI, Steiner J. 1969. Extracellular space in the central nervous system of the leech,
Mooreobdella fervida. Journal of Neurobiology 1:23–40. DOI: https://doi.org/10.1002/neu.480010104, PMID:
4334643
Venken KJT, Schulze KL, Haelterman NA, Pan H, He Y, Evans-Holm M, Carlson JW, Levis RW, Spradling AC,
Hoskins RA, Bellen HJ. 2011. Mimic: a highly versatile transposon insertion resource for engineering Drosophila
melanogaster genes. Nature Methods 8:737–743. DOI: https://doi.org/10.1038/nmeth.1662, PMID: 21985007
Wigglesworth VB. 1959. The histology of the nervous system of an insect, Rhodnius prolixus. Quarterly Journal
of Microscopical Science 100:299–313. DOI: https://doi.org/10.1242/jcs.s3-100.50.299
Wigglesworth VB. 1960. The nutrition of the central nervous system in the cockroach Periplaneta americana L.
The role of perineurium and glial cells in the mobilization of reserves. Journal of Experimental Biology
37:500–512. DOI: https://doi.org/10.1242/jeb.37.3.500
Wilson CH, Hartline DK. 2011. Novel organization and development of Copepod myelin. II. Nonglial origin. The
Journal of Comparative Neurology 519:3281–3305. DOI: https://doi.org/10.1002/cne.22699, PMID: 21674501
Yildirim K, Winkler B, Pogodalla N, Mackensen S, Baldenius M, Garcia L, Naffin E, Rodrigues S, Klämbt C. 2022.
Redundant functions of the Slc5A transporters Rumpel, Bumpel, and Kumpel in ensheathing glial cells. Biology
Open 11:bio059128. DOI: https://doi.org/10.1242/bio.059128, PMID: 34897385
Yuan LL, Ganetzky B. 1999. A glial-neuronal signaling pathway revealed by mutations in a neurexin-related
protein. Science 283:1343–1345. DOI: https://doi.org/10.1126/science.283.5406.1343, PMID: 10037607

Appendix 1
Appendix 1—key resources table

Reagent type (species)
or resource Designation Source or reference Identifiers Additional information
Genetic reagent Bloomington

(Drosophila y[1] w[*] Mi{MIC}MI08578a Mi{MIC} Drosophila Stock
melanogaster) MI08578b Center BDSC51087

(Drosophila y[1] w[*] Mi{FlpStop}para[MI08578- Drosophila Stock
melanogaster) FlpStop.D]/FM7c Center BDSC67680
Genetic reagent
(Drosophila
melanogaster) Para-mCherry This study Figures 1, 2
Genetic reagent
(Drosophila
melanogaster) Para-Apex This study Figures 1, 5
Genetic reagent
(Drosophila
melanogaster) Para-FlpTag GFP/Fm7i Fendl et al., 2020

(Drosophila y[1] w[*]; Mi{PT-GFSTF.1} Drosophila Stock
melanogaster) Shal[MI00446-GFSTF.1] Center BDSC60149

(Drosophila y[1] w[*] Mi{PT-GFSTF.2}Sh[MI10885- Drosophila Stock
melanogaster) GFSTF.2]/FM7j, B[1] Center BDSC59423
Genetic reagent y[1] w[*]; Mi{PT-GFSTF.1} Bloomington

(Drosophila Shab[MI00848-GFSTF.1]/TM6C, Drosophila Stock
melanogaster) Sb[1] Tb[1] Center BDSC60514

(Drosophila y[1] sc[*] v[1] sev[21]; P{y[+t7.7] Drosophila Stock
melanogaster) v[+t1.8]=VALIUM20-mCherry}attP2 Center BDSC35785
Genetic reagent
(Drosophila Kottmeier et al.,
melanogaster) UAS-CD8GFP II; R90C03Gal80 III 2020
Genetic reagent
melanogaster) UAS-Hid/CyOw; R90C03Gal80 III 2020
Genetic reagent
(Drosophila
melanogaster) UAS-lacZ NLS II Y. Hirmoi
Genetic reagent
(Drosophila Gisselbrecht et al.,
melanogaster) UAS-lambda-Htl 1996

(Drosophila Drosophila Stock
melanogaster) UAS-htlDN II Center BDSC5366

melanogaster) UAS-CD8GFP II Center BDSC5137

melanogaster) UAS-CD8mCherry II Center BDSC 27391
Genetic reagent
(Drosophila
melanogaster) UAS-Hid II Igaki et al., 2000

melanogaster) UAS-Flp Center BDSC 4539
Genetic reagent
(Drosophila
melanogaster) UAS-Myr-Flag-APEX2-NES86Fb III This study Figures 6, 7
Genetic reagent
(Drosophila pBPhsFLP2::pEST/I;; UAS HA, FLAG,
melanogaster) V5, OLLAS/III Nern et al., 2015
Appendix 1 Continued on next page

Appendix 1 Continued
Genetic reagent
(Drosophila Salvaterra and
melanogaster) ChAT-Gal4 Kitamoto, 2001
Genetic reagent
(Drosophila Mahr and Aberle,
melanogaster) OK371-Gal4 2006

melanogaster) GMR94G06Gal4 III Center BDSC40701
Genetic reagent
(Drosophila
melanogaster) Nrv2Gal4 II Sun et al., 1999
Genetic reagent
melanogaster) Nrv2Gal4 II; R90C03Gal80 III 2020
Genetic reagent
(Drosophila Nrv2Gal4 II; R90C03Gal80, UAS- Kottmeier et al.,
melanogaster) CD8Cherry III 2020
Genetic reagent
(Drosophila
melanogaster) GMR83E12_AD II; Repo4.3_DBD III Bittern et al., 2021

melanogaster) GMR75H03-Gal4 III Center BDSC39908
Genetic reagent
(Drosophila Herzmann et al.,
melanogaster) ppkGal4, AUS-tdTomato III 2017

melanogaster) lexAop-Flp III Center BDSC55819

(Drosophila w[*]; TI{2A-lexA::GAD}VGlut[2A- Drosophila Stock
melanogaster) lexA]/CyO Center BDSC84442

ST76
melanogaster) Para Center BDSC26701

melanogaster) Oregon R Center BDSC5
IF (1:1000), WB (1:1000)
Antibody Anti-Para N-term (rabbit, polyclonal) This study Figures 1, 2, 3
Cat#632496
Antibody Anti-dsRed (rabbit, polyclonal) Takara RRID:AB_10013483 IF (1:1000)
Cat#ab13970
Antibody Anti-GFP (chicken, polyclonal) Abcam RRID:AB_300798 IF(1:500)
Cat#A-11122
Antibody Anti-GFP (rabbit, polyclonal) Invitrogen RRID:AB_221569 IF(1:1000)
Antibody Anti-Rumpel (rabbit, polyclonal) Yildirim et al., 2022 IF(1:1000)
Cat#8D12
Antibody Anti-Repo (mouse, monoclonal) Hybridoma Bank RRID: AB_528448 IF(1:5)
Cat#V8137-.2MG
Antibody Anti-V5 (rabbit, polyclonal) Sigma-Aldrich RRID:AB_261889 IF(1:500)
Covance Cat#MMS-101R
Antibody Anti-HA (mouse, monoclonal) BioLegend RRID:AB_291262 IF(1:1000)
Cat#NBP1-06712SS
Antibody Anti-Flag (rat, monoclonal) Novus Biologicals RRID:AB_162598 IF(1:200)
FluoTag-X4 anti-GFP (Alpaca, NanoTag Cat#N0304

Antibody monoclonal) Biotechnologies RRID:AB_2905516 IF(1:500)
FluoTag-X4 anti-RFP (Alpaca, NanoTag Cat#N0404

Antibody monoclonal) Biotechnologies RRID:AB_2744638 IF(1:500)
Appendix 1 Continued on next page

Appendix 1 Continued
Anti-rabbit Alexa 488 (goat, Cat#A-11008

Antibody polyclonal) Thermo Fisher RRID:AB_143165 IF(1:1000)
Anti-rabbit Alexa 568 (goat, Cat#A-11011

Anti-chicken Alexa 488 (goat, Cat#A-11039,

Anti-mouse Alexa 488 (goat, Cat#A-11001,

Anti-HRP Alexa 647 (goat, Cat#123-605-021,

Cat#31460
Antibody Anti-rabbit HRP (goat, polyclonal) Invitrogen RRID:AB_228341 WB(1:5000)
Recombinant DNA pBS-KS-attB1-2-PT-SA-SD-0- Drosophila Genome

reagent mCherry Research Centre DGRC#1299
Recombinant DNA
reagent pBS-KS-attB1-2-PT-SA-SD-0-Apex2 This study Generation of transgenic fly
Sequence-based AAGGATCCGGAAAGTCTTACCCAA
reagent BamH1 Apex2 fwd This study PCR primer CTGT
Sequence-based AAGGATCCGGCATCAGCAAA
reagent BamH1 Apex2 rev This study PCR primer CCCAAG
Sequence-based GCGTAAGCTACCTTAATCTCAAGA
reagent MiLF Venken et al., 2011 PCR primer AGAG
Sequence-based CGCGGCGTAATGTGATTTACTATC
reagent MiLR Venken et al., 2011 PCR primer ATAC
Sequence-based
reagent mCherry-Seq fwd PCR primer ACGGCGAGTTCATCTACAAG
Sequence-based
reagent mCherry-Seq rev PCR primer TTCAGCCTCTGCTTGATCTC
Sequence-based
reagent Apex253_rev1 This study PCR primer AGCTCAAAATAGGGAACTCCG
Sequence-based
reagent Apex286_fwd1 This study PCR primer TACCAGTTGGCTGGCGTTGTT
Sequence-based Thermo Fisher Cat#4331182

reagent Para qPCR Primer Scientific Dm01813740_m1
Sequence-based Thermo Fisher Cat#4331182

reagent RPL32 qPCR Primer Scientific Dm02151827_g1
Commercial assay
or kit RNeasy Kit QIAGEN Cat#74104
Commercial assay
or kit Quantitect Reverse Transcription Kit QIAGEN Cat#205313
Commercial assay Taqman gene expression assay, Thermo Fisher

or kit Universal Master Mix II, with UNG Scientific Cat#4440038
GraphPad Software,
Software algorithm GraphPad PRISM USA Version 6.0
https://imagej.net/
Software algorithm Fiji software/fiji/
Software algorithm ZEN Software Zeiss Black version
Software algorithm Affinity Photo Serif (Europe)
Software algorithm MATLAB The MathWorks, Inc
Software algorithm Photoshop CS6 Adobe

Elife 85752 v2

Uploaded by

Copyright:

Available Formats

Elife 85752 v2

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Elife 85752 v2

Uploaded by

Copyright:

Available Formats

RESEARCH ARTICLE

Glial-­dependent clustering of voltage-­

Competing interest: The authors

Reviewing Editor: Dion K

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752  1 of 25

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752  2 of 25

Differential localization of voltage-gated potassium channels

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752  3 of 25

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752  4 of 25

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752  5 of 25

High-resolution imaging reveals clustered localization of Para along

In sensory neurons increased Para localization is found at dendrites and

Electron microscopic analysis of Para cluster formation

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752  6 of 25

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752  7 of 25

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752  8 of 25

Para-rich axon segments are embedded in a lacunar system formed by

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752  9 of 25

Myelin in the leg nerve is found close to the CNS

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752  10 of 25

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752  11 of 25

Para localization depends on wrapping glial cells

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752  12 of 25

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752  13 of 25

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752  14 of 25

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752  15 of 25

Materials and methods

Western blot analysis

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752  16 of 25

DAB staining and electron microscopy

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752  17 of 25

Deutsche SFB 1348 B5 Christian Klämbt

Deutsche Kl 588 / 29 Christian Klämbt

Decision letter and Author response

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752  18 of 25

The following dataset was generated:

Author(s) Year Dataset title Dataset URL Database and Identifier

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752  19 of 25

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752  20 of 25

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752  21 of 25

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752  22 of 25

Appendix 1—key resources table

Genetic reagent Bloomington

Genetic reagent Bloomington

Genetic reagent Bloomington

Genetic reagent Bloomington

Genetic reagent y[1] w[*]; Mi{PT-­GFSTF.1} Bloomington

Genetic reagent Bloomington

Genetic reagent Bloomington

Genetic reagent Bloomington

Genetic reagent Bloomington

Genetic reagent Bloomington

Appendix 1 Continued on next page

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752  23 of 25

Genetic reagent Bloomington

Genetic reagent Bloomington

Genetic reagent Bloomington

Genetic reagent Bloomington

Genetic reagent Bloomington

Glial-dependent clustering of voltage-

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752 1 of 25

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752 2 of 25

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752 3 of 25

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752 4 of 25

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752 5 of 25

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752 6 of 25

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752 7 of 25

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752 8 of 25

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752 9 of 25

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752 10 of 25

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752 11 of 25

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752 12 of 25

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752 13 of 25

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752 14 of 25

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752 15 of 25

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752 16 of 25

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752 17 of 25

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752 18 of 25

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752 19 of 25

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752 20 of 25

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752 21 of 25

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752 22 of 25

Genetic reagent y[1] w[*]; Mi{PT-GFSTF.1} Bloomington

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752 23 of 25

Antibody Anti-Rumpel (rabbit, polyclonal) Yildirim et al., 2022 IF(1:1000)

FluoTag-X4 anti-GFP (Alpaca, NanoTag Cat#N0304

FluoTag-X4 anti-RFP (Alpaca, NanoTag Cat#N0404

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752 24 of 25

Anti-rabbit Alexa 488 (goat, Cat#A-11008

Anti-rabbit Alexa 568 (goat, Cat#A-11011

Anti-chicken Alexa 488 (goat, Cat#A-11039,

Anti-mouse Alexa 488 (goat, Cat#A-11001,

Anti-HRP Alexa 647 (goat, Cat#123-605-021,

Recombinant DNA pBS-KS-attB1-2-PT-SA-SD-0- Drosophila Genome

Sequence-based Thermo Fisher Cat#4331182

Sequence-based Thermo Fisher Cat#4331182

Rey, Ohm et al. eLife 2023;12:e85752. DOI: https://doi.org/10.7554/eLife.85752 25 of 25