viruses

Article
Development and Characterization of a Genetically Stable
Infectious Clone for a Genotype I Isolate of Dengue Virus
Serotype 1
Mingyue Hu 1,2 , Tiantian Wu 2 , Yang Yang 2 , Tongling Chen 2 , Jiawei Hao 2 , Youchuan Wei 1 , Tingrong Luo 1 ,
De Wu 3, * and Yi-Ping Li 2,4, *

1 College of Animal Sciences and Veterinary Medicine, Guangxi University, Nanning 530004, China
2 Institute of Human Virology, Department of Pathogen Biology and Biosecurity, Key Laboratory of Tropical
Disease Control of Ministry of Education, Zhongshan School of Medicine, Sun Yat-sen University,
Guangzhou 510080, China
3 Institute of Pathogenic Microbiology, Center for Disease Control and Prevention of Guangdong,
Guangzhou 511430, China
4 Department of Infectious Diseases, The Third Affiliated Hospital of Sun Yat-sen University,
Guangzhou 510630, China
* Correspondence: [email protected] (D.W.); [email protected] (Y.-P.L.)

Abstract: Dengue virus (DENV) is primarily transmitted by the bite of an infected mosquito of
Aedes aegypti and Aedes albopictus, and symptoms caused may range from mild dengue fever to
severe dengue hemorrhagic fever and dengue shock syndrome. Reverse genetic system represents
a valuable tool for the study of DENV virology, infection, pathogenesis, etc. Here, we generated
and characterized an eukaryotic-activated full-length infectious cDNA clone for a DENV serotype
1 (DENV-1) isolate, D19044, collected in 2019. Initially, nearly the full genome was determined by
Citation: Hu, M.; Wu, T.; Yang, Y.; sequencing overlapping RT-PCR products, and was classified to be genotype I DENV-1. D19044
Chen, T.; Hao, J.; Wei, Y.; Luo, T.; Wu, wild-type cDNA clone (D19044_WT) was assembled by four subgenomic fragments, in a specific
D.; Li, Y.-P. Development and order, into a low-copy vector downstream the CMV promoter. D19044_WT released the infectious
Characterization of a Genetically virus at a low level (1.26 × 103 focus forming units per milliliter [FFU/mL]) following plasmid
Stable Infectious Clone for a transfection of BHK-21 cells. Further adaptation by consecutive virus passages up to passage 37, and
Genotype I Isolate of Dengue Virus
seven amino acid substitutions (7M) were identified from passage-recovered viruses. The addition
Serotype 1. Viruses 2022, 14, 2073.
of 7M (D19044_7M) greatly improved viral titer (7.5 × 104 FFU/mL) in transfected BHK-21 culture,
https://doi.org/10.3390/
and virus infections in 293T, Huh7.5.1, and C6/36 cells were also efficient. D19044_7M plasmid was
v14092073
genetically stable in transformant bacteria after five transformation-purification cycles, which did not
Academic Editor: Qiang Ding change the capacity of producing infectious virus. Moreover, the D19044_7M virus was inhibited by
Received: 2 September 2022
mycophenolic acid in a dose-dependent manner. In conclusion, we have developed a DNA-launched
Accepted: 16 September 2022 full-length infectious clone for a genotype I isolate of DENV-1, with genetic stability in transformant
Published: 18 September 2022 bacteria, thus providing a useful tool for the study of DENV-1.

Publisher’s Note: MDPI stays neutral

Keywords: dengue virus; reverse genetics; infectious clone; amino acid substitution; genetically stable
with regard to jurisdictional claims in
published maps and institutional affil-
iations.

1. Introduction
Dengue virus (DENV) belongs to the genus Flavivirus of the family Flaviviridae. It is
Copyright: © 2022 by the authors. the most widespread arbovirus mainly transmitted by Aedes aegypti and Aedes albopictus.
Licensee MDPI, Basel, Switzerland. DENV infection can cause a spectrum of diseases varying from mild dengue fever to
This article is an open access article severe diseases, such as dengue haemorrhagic fever (DHF) and dengue shock syndrome
distributed under the terms and (DSS) [1,2]. With global warming and active commercial and traveling flows, the vector
conditions of the Creative Commons mosquitoes have expanded unexpectedly, increasing the risk of global DENV prevalence.
Attribution (CC BY) license (https://
In the past 50 years, the incidence of dengue fever has soared 30 times [3]. The World Health
creativecommons.org/licenses/by/
Organization (WHO) reports that DENV infection has been identified in 128 countries,
4.0/).

Viruses 2022, 14, 2073. https://doi.org/10.3390/v14092073 https://www.mdpi.com/journal/viruses

Viruses 2022, 14, 2073 2 of 17

mostly in tropical and subtropical regions [1,4,5]. In 2019, the WHO announced dengue as
one of the top ten threats to global health [6].
Four serotypes of DENV (DENV-1-4) have transmission cycles in humans, and serotypes
differ from each other by 30–35% amino acid (aa) sequence [7,8]. Antibody-dependent
enhancement (ADE) and cross-reactive T cell-mediated cytotoxicity may occur when a
secondary infection caused by a heterogenous serotype virus [9] or other flaviviruses [10–13].
ADE is believed as an important risk factor of DHF and DSS [10]. To date, only one vaccine
was licensed for DENV, however the issues of effectiveness and safety remain, and it has not
been widely used [14]. Moreover, there is no an antiviral drug available for DENV infection.
DENV-1 has five genotypes, I-V, varying by approximately 3% at amino acid level and
6% at nucleotide level [7,8,15]. The emergence of a highly divergent isolate suggested the
existence of genotype VI DENV-1, and it may have circulated in multiple regions in China
and other countries [16]. Genotype I is the most prevalent genotype of DENV-1 responsible
for several major outbreaks in south China since 2000 [1], however only few DENV-1
and one genotype I infectious clones (DENV1-3_C_0268-96, Thailand, 1996) have been
developed previously [17]. Reverse genetic systems representative of different serotypes
and prevalent isolates will provide valuable tools for the studies of molecular virology,
virus-host interactions, viral pathogenesis, cross-species transmission, vaccine and antiviral
drugs. Given the antigenic and genetic diversity of DENV, an infectious cDNA clone of
clinical isolate from recent outbreaks will be highly relevant, especially for genotype I of
DENV-1. However, some technical challenges exist in the construction of a genome length
cDNA clone for DENV and other flaviviruses, such as Zika virus (ZIKV), into a plasmid
vector, as the viral cDNA sequence may contain cryptic prokaryotic promoters leading
to unexpected transcription and expression of proteins toxic or lethal to the transformant
recipient bacteria [18–20]. As a consequence, the replication of plasmid becomes unstable
in the transformant E. coli bacteria, and it remains a challenge to overcome the instability of
genomic cDNA in bacteria.
In this study, we constructed and adapted a full-length infectious clone of DENV-1
genotype I isolate, D19044, for efficient virus production in cultured cells. The genetic
stability in transformant bacteria and responsiveness to antiviral compound were also
proven. D19044 was isolated in 2019 from an endemic in Jieyang city, Guangdong province,
China; thus, this clone will be highly relevant for the study of DENV-1 in prevalence and
those close-related endemics.

2. Materials and Methods

2.1. Cells and DENV-Infected Serum
Huh7.5.1 cells were provided by Dr. Francis Chisari (The Scripps Research Institute,
La Jolla, CA, USA) and Dr. Jin Zhong (Institut Pasteur of Shanghai, Shanghai, China).
C6/36 cells were provided by Dr. Ping Zhang (Sun Yat-sen University, Guangzhou, China).
BHK-21, A549, 293T, and Vero (Vero, originally refers to ATCC No. CCL-81) cells were
maintained in our laboratory. BHK-21, A549, 293T, Huh7.5.1, and Vero cells were cultured
in a high-glucose Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10%
fetal bovine serum (FBS) and 1% penicillin/streptomycin, and incubated at 37 ◦ C with
5% CO2 . C6/36 cells were maintained in a high-glucose DMEM supplemented with 10%
FBS, 1% penicillin/streptomycin, and 1 × Non-Essential Amino Acids Solution (Gibco,
CA, USA), and incubated at 28 ◦ C with 5% CO2 . The cells used for experiments were
tested routinely by mycoplasma-specific PCR to ensure free of mycoplasma contamination.
The DENV-1-infected serum was collected from a patient (no. D19044) by Guangdong
Provincial Center for Disease Prevention and Control, China, for the purpose of disease
surveillance and prevention, during an endemic in Jieyang city, Guangdong, China, in 2019.

2.2. Determination of Viral Genome Sequence and Construction of Full-Length cDNA Clone
The patient serum (no. D19044) was inoculated to C6/36 cells and the culture su-
pernatant from day 6 was divided into two parts. One part of supernatant was assigned
Viruses 2022, 14, 2073 3 of 17

for sequencing analysis and subjected to RNA extraction using MagZol Reagent (Ma-
gen, Guangzhou, China). The nearly full-length genomic cDNA was synthesized by
reverse transcription using SuperScript III Reverse Transcriptase (Invitrogen, CA, USA)
(primers R6260*/R10654*) (Table 1). Four overlapping PCRs covering the ORF and par-
tial 50 UTR and 30 UTR sequences were performed using primers F17/R3347, F2724/R4897,
F4755/R8347, F7485/R10544, F-50 UTR/R-50 UTR, and F-30 UTR/R-30 UTR (Table 1). The PCR
fragments were sequenced by Sanger sequencing method, and nearly full-length genome
(nucleotides [nts] 50 to 10508; GenBank no. OP315653) was determined and confirmed
by aligning to DENV-1 sequences from GenBank (MT076934.1, KY057373.1, MG679801.1,
KY672944.1, KY926849.1, MF405201.1, KX225491.1, KP406801.1, AF226685.2, AY732483.1,
and NC_001477.1).

Table 1. Primers were used for RT-PCR of DENV-1 isolate, D19044.

Primers Position Sequence (50 -30 ) Product Length (nt)

F17 17–37 GGACCGACAAGAACAGTTTCG
3331
R3347 3324–3347 CATGAATTATCTTCCCTGTGACTG
F2724 2724–2743 AAATGATTAGGCCACAACCC
2174
R4897 4877–4897 AATGGCTCCAACTTCACCTTC
F4755 4755–4778 ATGGAGGAGGTTGGAGGCTTCAAG
3593
R8347 8324–8347 GCCTAGGTCCACGTCTCTTTCATA
F7485 7485–7510 TTTCCATGGCAAACATTTTCAGAGGA
3060
R10544 10,524–10,544 GTTGTGTCTTGGGAGGGGTCT
F-50 UTR Vector-15 gagctcgtttagtgaaccgtcAGTTGTTAGTCTACG
70
R-50 UTR 15–49 AAGCTTCCGATTTGAAACTGTTCTTGTCGGTCCAC
F-30 UTR 10,509–10,529 ACTAGTGGTTAGAGGAGACCC
277
R-30 UTR Vector ttcggatgcccaggtcggaccgcgaggaggtggagat
R6260 * 6239–6260 CCACGTCCATGTTCTCCTCCAA
R10654 * 10,633–10,654 GGTCTCTCCCAGCGTCAATATG
*, the primers were used for reverse transcription. Lowercases indicate the sequences priming to the vector sequence.

To assemble full-length D19044 wild-type cDNA clone (D19044_WT), nts 1–49 and
10,509–10,735 were synthesized identical to a DENV-1 isolate, GZ2002 (GenBank accession
number, JN205310.1) [21]. Amino acid substitutions were engineered into the D19044_WT
by fusion PCR or gene synthesis, such as D19044_4M and D19044_7M (GenBank no.
OP315654). Using partial 50 UTR and 30 UTR sequences from isolate GZ2002 avoided
performing rapid amplification of cDNA 50 ends (50 RACE) and 30 RACE to determine
the terminus sequences of D19044 genome. Although the secondary and tertiary RNA
structures in the 50 UTR and 30 UTR of DENV and other flaviviruses play fundamental
roles in viral replication and translation [22], the sequences from GZ2002 (nts 1–49 and
10,509–10,735) were located in the conserved regions of DENV genome [23]; D19044 had
no difference with GZ2002 in the 50 UTR nts 50–94 and only differed by 11 nts in the
30 UTR nts 10,274–10,508, which were identified in this study. D19044 shared 91.36% and
96.93% sequence identity with GZ2002 at nucleotide and amino acid levels, respectively.
In addition, GZ2002 was isolated also from Guangdong province, China, in 2002 [21]. To
construct the full-length cDNA clone, we divided the D19044 genome into four subgenomic
fragments: fragment A (nts 1–2805, SacI-BsrGI), fragment B (nts 2724–4897, BsrGI-BsrGI),
fragment C (nts 4755–8347, BsrGI-ClaI), and fragment D (nts 7485–10735, ClaI-RsrII). These
four fragments were assembled into pTight vector by in-fusion cloning using a One Step
Cloning Kit (Vazyme, Nanjing, China), and surprisingly the cloning succeeded only when
fragments were assembled in the order of D, C, A, B. All restriction endonucleases were
purchased (New England Biolabs, NEB, MA, USA). The pTight vector was originally
modified from pBR322, which contains seven repeated tetracycline-response elements
(7 × TRE) located upstream of the minimal cytomegalovirus (CMVmin) promoter sequence,
and it was used previously for cloning a DENV-2, DENV-2-pTight (provided by Dr. Andrew
Yueh, National Health Research Institutes, Taiwan, China) [19].
Viruses 2022, 14, 2073 4 of 17

2.3. Transformation and Purification of Plasmids

Full-length D19044 cDNA clone plasmid was transformed into competent Turbo bacteria
(NEB, MA, USA) and plated on solid 2 × YT medium plates containing ampicillin (15 µg/mL)
at 28 ◦ C for 24 h. The colonies were selected and cultured in liquid 2 × YT medium with
ampicillin (15 µg/mL) at 28 ◦ C for 20 h. The plasmid was extracted by HiPure Plasmid Mini
kit (Magen, Guangzhou, China) and confirmed by Sanger sequencing analysis.

2.4. Phylogenetic Analysis of D19044 and Other DENV Sequences

The sequence of D19044 virus was generated by Sanger sequencing four overlapping
RT-PCR products (above). Twelve DENV-1 genotypes I–V isolates with complete genome
sequences available in GenBank and other eight sequences from DENV-2, -3, and -4 (two
sequences for each) were selected for phylogenetic analysis. Sequences representative of
DENV serotypes 2–4 were selected, especially for those with infectious clones developed.
The phylogenetic tree was made based on the ORF nucleotide sequences using the neighbor-
joining method in the Molecular Evolutionary Genetics Analysis (MEGA, version 6, Kimura
2-parameter). The Basic Local Alignment Search Tool (BLAST, version +2.13.0) was used to
analyze the sequences homology to D19044.

2.5. Virus Stock Preparation, Infection Experiment, and Virus Passage

Virus stock was made by transfection and infection of BHK-21 cells. Briefly, BHK-21
cells were seeded to 12-well plates 16–20 h prior to transfection and allowed to grow to
80% confluence for transfection. One microgram of D19044_7M plasmid (or D19044_4M;
D19044_WT) and 0.5 µg of pTet-off plasmid were mixed and incubated in 200 µL of Opti-
MEM medium containing 2.25 µL of ExFect transfection reagent (Vazyme, Nanjing, China)
for 20 min. The plasmid mix was transfected to BHK-21 cells and cultured at 37 ◦ C for 6 h,
and then transfection medium was replaced with DMEM supplemented with 2% FBS and
left for 2 days. The transfected culture was split every 2 days and supernatant was harvested
at days 2, 4, 6, and 8, filtered (0.2 µm), and stored at −80 ◦ C for later use. To expand the
virus stock or perform infection experiment, transfection-derived supernatant virus was
inoculated to naïve BHK-21 cells or other cell lines for 2 h, and then infection supernatant
was replaced with DMEM with 2% FBS. The cultured supernatant was harvested at time
points as required and stored at −80 ◦ C.
To adapt the virus for efficient infection in culture, we continuously passaged the
virus to naïve BHK-21 cells. Briefly, naïve BHK-21 cells were inoculated with transfection-
derived virus supernatant in DMEM with 2% FBS for 72 h. Culture supernatant was
collected, filtered (0.2 µm), and designated as first passage virus. The first passage virus
was inoculated to naïve BHK-21 cells for 72 h to generate second passage virus. We
consecutively passaged the virus until a fast virus spread and more intense fluorescence
DENV-positive cells were detected through IFA in the culture. The passage-recovered
viruses were stored at −80 ◦ C and viruses from passages 21, 36, and 37 were subjected
to RNA extraction using MagZol Reagent (Magen, Guangzhou, China). The cDNA was
synthesized by reverse transcription using SuperScript III Reverse Transcriptase (Invitrogen,
CA, USA) and amplified by four overlapping fragments (Section 2.2 and Table 1). The PCR
products were analyzed by Sanger sequencing to identify if any substitution had occurred.

2.6. Virus Titration and Indirect Immunofluorescence Foci Assay (IFA)

The DENV titer was determined by indirect immunofluorescence foci assay (IFA)
using BHK-21 cells [24,25] and expressed as focus forming unit per ml (FFU/mL). Briefly,
BHK-21 cells were seeded in 96-well plates (4 × 103 cells/well) and grown for 16–20 h.
The virus supernatant was prepared as 10-fold serial dilutions in DMEM (from 100 to 106
dilutions), inoculated to BHK-21 cells, and left at 37 ◦ C for 2 h. The cells were then washed
once with DMEM, and incubated in DMEM containing 2% FBS for 48 h. Then, the culture
supernatant was removed, and the cells were fixed using methanol (−20 ◦ C) for 10–15 min.
The fixed cells were incubated with DENV NS3 antibody (1:2000 dilution; GTX124252,
Viruses 2022, 14, 2073 5 of 17

GeneTex, CA, USA) at 4 ◦ C overnight. To visualize DENV infected cells, the secondary
antibody Alex Fluor 488 Goat Anti-Mouse IgG (H + L) (1:1000; Invitrogen, CA, USA) and
cell nucleus staining dye Hoechst 33258 (1:1000; Invitrogen, CA, USA) were added at room
temperature and incubated for 1 h. The numbers of FFU were manually counted using a
fluorescence microscope (Leica Microsystems, DMI 4000B, Weizla, Germany).

2.7. Cytotoxicity Assay

BHK-21 cells were seeded in a 96-well plate (4 × 103 cells/well) and incubated for
16–20 h. The cells were incubated with different concentrations of drugs for 48 h, and 10 µL
of Cell Counting Kit-8 (CCK8, Dojindo, Kumamoto, Japan) was added to each well, gently
shaken and incubated at 37 ◦ C for 90 min. The optical density (OD450 ) was measured by a
microplate reader (BioTek ELx800, Vermont, Germany).

2.8. Antiviral Drug Treatment

Mycophenolic acid (MPA, T1335, TargetMol, Shanghai, China) was dissolved to 10 mM
using DMSO, aliquoted, and stored at −80 ◦ C. Moxifloxacin hydrochloride (Tianjin Chas-
esun Pharmaceutical, Tianjin, China) was preserved at room temperature. Before treatment
experiment, drugs were diluted to different concentrations (below cytotoxicity concentra-
tion) required for experiments using DMEM with 2% FBS. For antiviral treatment, BHK-21
cells were seeded in a 96-well plate (4 × 103 cells/well) and cultured for 16–20 h. The cells
were infected with virus dilution at multiplicity of infection (MOI) of 0.1 containing drug
of different concentration for 2 h. The treatment medium was removed, and the cells were
washed with DMEM and incubated in DMEM with 2% FBS containing drugs for 48 h. The
cells were fixed and subjected to IFA, and the FFU were enumerated for each well.

3. Results
3.1. Genome Sequence of DENV-1 Genotype I Isolate, D19044
DENV-1-infected serum D19044 was collected from a patient in Jieyang city, Guang-
dong province, China, in 2019. The patient serum was inoculated to C6/36 cells, and culture
supernatant was collected at day 6 post infection. A part of C6/36 culture supernatant
was inoculated to Vero cells and consecutively passaged up to 16 passages, followed by
13 passages in BHK-21 cells; unfortunately, the virus did not spread up in the cultures, with-
out detectable viral titers. The other part of supernatant was subjected to RNA extraction
and amplified by four overlapping DENV-1-specific RT-PCRs (Table 1). The PCR products
were analyzed by Sanger sequencing, and the sequence covering genome nucleotides (nts)
50-10508 was obtained and designated D19044 wild-type (WT) sequence (OP315653). The
D19044 WT sequence was phylogenetically analyzed against twelve sequences of DENV-1
genotypes I-V and eight sequences of DENV-2, -3, and -4 (two sequences for each) from
GenBank (Figure 1). The results showed that D19044 was genetically close to the strain
UI13412 (KC172835.1), which belongs to genotype I of DENV-1 (Figure 1). BLAST analysis
revealed that D19044 was highly homologous to GZ8H/2019180/2019/I (MW261838.1), a
clinical serum from Guangzhou in 2019, differing by 13 nucleotides and 2 amino acids (nt
T1650C in E sequence with aa change I519T; G9452A in NS5, V3120I). Additionally, D19044
shared 97.8% and 99.49% identity at nucleotide and amino acids levels with infectious clone
of genotype I isolate DENV1-3 C_0268-96 (OK605755.1), respectively [17]. Thus, D19044
was a genotype I isolate of DENV-1 recently prevalent in south China.
 GZ8H/2019180/2019/I (MW261838.1), a clinical serum from Guangzhou in 2019, differing
by 13 nucleotides and 2 amino acids (nt T1650C in E sequence with aa change I519T;
G9452A in NS5, V3120I). Additionally, D19044 shared 97.8% and 99.49% identity at nu-
cleotide and amino acids levels with infectious clone of genotype I isolate DENV1-3
Viruses 2022, 14, 2073 C_0268-96 (OK605755.1), respectively [17]. Thus, D19044 was a genotype I isolate
6 of of
17
DENV-1 recently prevalent in south China.

Figure 1. Phylogenetic analysis of D19044 and other DENV isolates. The isolates of genotypes
Figure 1. Phylogenetic
I-V DENV-1 analysis
with complete of D19044
genome and other
sequences DENVfrom
available isolates. The isolates
GenBank of genotypes
were selected I-V
to make
DENV-1 with complete genome sequences available from GenBank were selected to make phylo-
phylogenetic analysis. Of DENV-2, -3, and -4, two sequences representative of each serotype were
genetic analysis. Of DENV-2, -3, and -4, two sequences representative of each serotype were se-
selected, especially for those with infectious clones developed. The phylogenetic tree is made based
lected, especially for those with infectious clones developed. The phylogenetic tree is made based
on the
on the ORF
ORF nucleotide
nucleotide sequences using neighbor-joining
sequences using neighbor-joining method.
method. A A solid
solid triangle (N) highlights
triangle (▲) highlights
the D19044 isolate of this study. A circle (○) indicates that the infectious clone of the isolate
the D19044 isolate of this study. A circle (#) indicates that the infectious clone of the has been
isolate has
developed.
been developed.

3.2. Construction of Full-Length D19044 cDNA Clone

3.2. Construction of Full-Length D19044 cDNA Clone
To overcome the instability of DENV cDNA clone in transformant E. coli bacteria,
To overcome the instability of DENV cDNA clone in transformant E. coli bacteria, we
we selected a low-copy plasmid pTight, which was modified from pBR322 [19,20]. We
selected a low-copy plasmid pTight, which was modified from pBR322 [19,20]. We and
and others have previously used this vector for development of infectious clones of JEV,
others have previously used this vector for development of infectious clones of JEV,
DENV, and ZIKV [18,19]. To construct a D19044 full-length clone, we divided its genomic
DENV, and ZIKV [18,19]. To construct a D19044 full-length clone, we divided its genomic
cDNA into four fragments A, B, C, and D, by restriction sites (Figure 2A); fragment A was
cDNA into four fragments A, B, C, and D, by restriction sites (Figure 2A); fragment A was
fused from sub-fragments A1 and A2, while D was a fusion of D1 and D2 (Figure 2A and
fused from sub-fragments A1 and A2, while D was a fusion of D1 and D2 (Figure 2A and
Section 2). Partial sequences of 50 UTR (nts 1–49, mainly A1 fragment) and 30 UTR (nts 10,509–
10,735, D2 fragment) were obtained from(nts
Section 2). Partial sequences of 5′UTR 1-49,
isolate mainly(JN205310)
GZ2002 A1 fragment) and 3′UTR (nts
[21]. Inexplicably, we
10509-10735, D2 fragment) were obtained from isolate GZ2002 (JN205310)
found that the cloning was restricted and selective by the order of fragment cloning [21]. Inexplica-
into the
bly, wevector.
pTight found When
that the cloning was
fragments wererestricted
cloned inandtheselective
order of C by→ theDorder
→ A, of fragment
namely clon-
fragment
A was first cloned into the vector to get pTight-A, followed by adding D to pTight_A A,
ing into the pTight vector. When fragments were cloned in the order of C → D → to
namely fragment A was first cloned into the vector to get pTight-A,
make pTight_A-D, then C was added in to get pTight_A-C-D, all 70 colonies from threefollowed by adding
D to pTight_A
independent to make pTight_A-D, experiments
ligation-transformation then C was addedcarriedinmultiple
to get pTight_A-C-D,
nucleotides and/or all 70
colonies from three independent ligation-transformation experiments carried
amino acid substitutions or deletions. In subsequent attempts, we tested different orders of multiple
nucleotides and/or
fragment cloning andamino
foundacid
that substitutions or deletions.
D19044 full-length clone couldIn subsequent
be constructed attempts,
only in thewe
tested different orders of fragment cloning and found that D19044 full-length
order B → A → C → D, namely D was first cloned to get pTight_D, followed by adding C clone could
be constructed
to make only in
pTight_C-D, andthe order
then B →AAto→
adding C →pTight_A-C-D.
obtain D, namely D was firstB cloned
Finally, was addedto getto
pTight_D, followed D19044
generate full-length by adding C to make
wild-type cDNApTight_C-D, and then
clone (D19044_WT). Alladding
subclones A to
andobtain
final
pTight_A-C-D.
D19044_WT clone Finally, B was added
were confirmed to generate
by Sanger full-length
sequencing (FigureD19044
2A). wild-type cDNA
Viruses 2022, 14, x FOR PEER REVIEW 7 of 18

Viruses 2022, 14, 2073 clone (D19044_WT). All subclones and final D19044_WT clone were confirmed by Sanger
7 of 17
sequencing (Figure 2A).

Figure 2. Construction of D19044 clone and its capacity to generate infectious virus particles.
Figure 2. Construction of D19044 clone and its capacity to generate infectious virus particles. (A)
(A) Schematic diagram of construction of full-length D19044 cDNA clone. The full-length genome
Schematic diagram of construction of full-length D19044 cDNA clone. The full-length genome was
was illustrated and divided into four overlapping subgenomic fragments (A–D) for the convenience
Viruses 2022, 14, 2073 8 of 17

of cloning, of which fragment (A) was subdivided into A1 and A2, and (D) was subdivided into D1
and D2. The key restriction sites and nucleotide positions are indicated for fragment A (nts 1-2805,
SacI-BsrGI), B (nts 2724-4897, BsrGI-BsrGI), C (nts 4755-8347, BsrGI-ClaI) and D (nts 7485-10735, ClaI-
RsrII). The pTight vector contains 7 × TRE and CMVmin, as well as hepatitis D virus ribosome (HDVr).
The order of cloning fragments was as the followings: B → A → C → D (see Results), as indicated
by solid lines in the constructs. Finally, a full-length D19044 wild-type (D19044_WT) clone was
made. (B) D19044_WT clone released infectious virus particles from BHK-21 cells. The D19044_WT
clone plasmid was transfected into BHK-21 cells, and DENV-1 positive cells were monitored by
immunofluorescence assay (IFA) for DENV NS3 protein (green) and cell nuclei (blue). The images
were taken from one transfection experiment. Bar, scale 100 µm. (C) The viral titer of D19044_WT
after transfection of BHK-21 cells. The culture supernatant collected at different time points of post
transfection (p.t.) and subjected to FFU assay. The mean ± standard error of the mean (SEM) from
three independent experiments are shown. An asterisk (*) indicates the viral titer was below the limit
of detection (LOD; < 0.69 log10 FFU/mL).

3.3. Transfection of D19044 Clone Plasmid Produced Infectious DENV Particles

To test the capacity of producing infectious particles for D19044_WT clone, we trans-
fected D19044_WT plasmid together with pTet-off plasmid into five different types of
cells, A549, 293T, Huh7.5.1, Vero, and BHK-21 cells. The plasmid of pTet-off expresses the
tet-responsive transcriptional activator (tTA), which will bind to a tet-responsive element
(TRE) in the pTight plasmid to activate the CMVmin promoter-controlled transcription
to produce viral genomic RNA, thus initiating translation and replication of D19044_WT
RNA [18,19]. The results showed that only the BHK-21 culture showed a greater number of
DENV positive cells with intense fluorescence by the IFA method (Figure 2B), and other cell
cultures showed weak or undistinguishable fluorescence signals. Thus, we selected BHK-21
cells for subsequent experiments, without further optimizing the transfection for other cell
lines. Noting that, we did not observe apparent cytopathic effect or cell death in infected
culture and did not succeed for plaque forming assay, as described previously [18], thus
we monitored D19044 virus infection by NS3-specific immunofluorescence method in this
study. The culture supernatant was collected at days 2, 4, 6, and 8 post transfection (p.t.),
and viral titers were determined by inoculating supernatant to naïve BHK-21 cells for FFU
assay. The results showed that D19044_WT transfection of BHK-21 cells released infectious
virus, however, the viral titer was low (1.26 × 103 FFU/mL; day 8 p.t.) (Figure 2C).
To further adapt the D19044_WT virus, we continuously passaged the virus to naïve
BHK-21 cells, determined the viral titer regularly, and found that the viral titer rose slightly
at passage 13 (47 days from transfection; ~8 × 103 FFU/mL), claiming a further adaptation.
When reaching passage 34, the viral titer rose significantly (3.9 × 105 FFU/mL), thus we
expanded this virus stock in the following passages and terminated at passage 37. To
identify adaptive acid substitution that may have acquired for the enhanced viral titer, we
sequenced D19044 ORF region for passages 21, 36, and 37 by Sanger sequencing. Seven
amino acid substitutions (7M) were identified, including G2084A (aa change G664K in E),
C4410T (T1439M in NS2B), and G6143A (D2017N in NS3) in the 21th passage virus, T7161C
(V2356A in NS4B) and C7689T (S2532F in NS5) in the 36th passage virus, and A1125C
(K344T in E) and C1416T (T441I in E) in the 37th passage virus (Table 2).

3.4. Efficient Virus Production of D19044 Clone Carrying Amino Acid Substitutions
To test the adaptation effect of passage-derived amino acid substitutions, we engi-
neered them back into a D19044_WT clone. Since V2356A was partially changed in passage
21 (1 × 103 FFU/mL) and became completely changed in passage 36, we initiated to test
the effect of four amino acid substitutions (4M, G664K/T1439M/D2017N/V2356A) and
7M in D19044_WT and designated D19044_4M and D19044_7M, respectively (Figure 3A).
Both plasmids were transformed into competent Turbo E. coli bacteria and transformant
colonies appeared after 24 h incubation. D19044_7M acquired G3384T (aa R1097L in NS1),
which may stabilize its sequence in bacteria, and we kept this change in D19044_7M clone.
Viruses 2022, 14, 2073 9 of 17

Table 2. Amino acid substitutions identified in the recovered viruses after serial passages.

Number of Passage Nucleotide Position Nucleotide Change * Gene Region Amino Acid Position Amino Acid Change
21 2084 G–A E 664 Glu–Lys
21 4410 C–T NS2B 1439 Thr–Met
21 6143 G–A NS3 2017 Asp–Asn
36 7161 T–C/t NS4B 2356 Val–Ala
36 7689 C–C/t NS5 2532 Ser–Phe
37 1125 A–C E 344 Lys–Thr
37 1416 C–T/c E 441 Thr–Ile
*, Capital letters indicate complete change (or >50% change) in sequencing reads; lowercases indicate a minor
change (<50%) in sequencing reads.

To determine whether amino acid substitutions enhance virus production, we trans-

fected D19044_4M, D19044_7M, and D19044_WT clones into BHK-21 cells and exam-
ined the viral titers of culture supernatant at different time points post transfection (p.t.)
(Figure 3B,C). D19044_4M and D19044_7M produced DENV, with detectable titers at
day 2 p.t., while D19044_WT was undetectable. At day 4 p.t., virus spread and titers
of D19044_7M were higher than that of D19044_4M and D19044_WT by 5.1~8-fold; at
days 6 and 8, D19044_4M and D19044_7M were higher than D19044_WT by 16.5~20.7 and
29.8~60.1 fold, respectively (Figure 3C). D19044_7M reached peak titer (7.5 × 104 FFU/mL)
at day 8 p.t. and higher than D19044_4M (2.24 × 104 FFU/mL) (Figure 3C). The recovered
viruses were confirmed by sequencing analysis, and all amino acid substitutions engi-
neered were maintained. Thus, passage-recovered amino acid substitutions promoted
virus production of D19044 clone, and D19044_7M represented most efficient clone for
subsequent experiments.
Since DENV-2 clones were used in the field more frequently, we compared virus
production of D19044_7M to a DENV-2 infectious clone, 16681, by plasmid transfection of
BHK-21 cells [19,26,27]. The results showed that D19044_7M produced lower viral titers
than 16681 clone at days 2, 4, and 6, but surpassed 16681 at day 8 (Figure 3D). Noting that,
16681 tended to cause cell death from day 6 p.t., whereas D19044_7M did not apparently
cause cell death, which may contribute to a higher titer for D19044_7M at day 8 (Figure 3D).

3.5. D19044_7M Clone Was Genetically Stable in Bacteria after Multiple

Transformation-Purification Cycles
It is an unsolicited issue that flavivirus cDNA encounters instability in transformant
recipient bacteria [20,28,29], thus we proceed to test the bacterial stability of D19044_7M
clone by repeating transformation-purification cycles (TPC) as previous described [18].
Briefly, D19044_7M plasmid was transformed into Turbo competent bacteria, single colonies
were picked and cultured in 2 × YT broth, and plasmid DNA was extracted and trans-
formed into competent Turbo bacteria again. We repeated five rounds of the transformation-
purification procedure and confirmed the sequence of plasmid. One amino acid substitution
was identified (NS4B, nt C7158G, aa A2355G) in the recovered plasmid and designated
D19044_7M/5TPC.
Next, we tested the capacity of producing viral particles for D19044_7M/5TPC in
comparison to D19044_7M. Both clones released infectious viruses with comparable viral
titers at days 2, 4, 6, and 8 following plasmid transfection of BHK-21 cells. Peak viral
titers peaked at day 8 (1 × 105 FFU/mL), indicating that A2355G did not affect production
of infectious virus (Figure 4). Moreover, no other deletion and amino acid substitution
was found in the genome, especially in substitution- and deletion-prone region, prM-
E-NS1 [18,30]. Thus, we considered D19044_7M recombinant was genetically stable in
bacteria, feasible for molecular manipulation.
 Viruses 2022, 14, x FOR PEER REVIEW 10 of 18
Viruses 2022, 14, 2073 10 of 17

A 5’UTR
C prM E NS1 NS2A NS2B NS3 NS4A NS4B NS5
3’UTR
1 10735
T441I
K344T G664K T1439M D2017N V2356A S2532F

B
D19044 Day 2 Day 4 Day 6 Day 8

WT

+4M

+7M

C D

Figure 3. Amino acid substitutions improved the virus production of D19044 clone. (A) Diagram
Figure 3.genome
of DENV-1 Amino acidwithsubstitutions
seven amino improved the virus production
acid substitutions of D19044
(7M) identified clone.
from (A) Diagram of
passage-recovered
DENV-1
viruses. (B) genome with seven amino
IFA of D19044_WT, acid substitutions
D19044_4M, (7M) identified
and D19044_7M from passage-recovered
after plasmid transfection of BHK-vi-
ruses. DENV-1
21 cells. (B) IFA ofNS3
D19044_WT, D19044_4M,
protein (green) andnuclei
and cell D19044_7M
(blue) after
wereplasmid transfection
visualized. of BHK-21
Bar, scale 100 µm.
(C) cells. DENV-1
The DENV NS3
titer ofprotein
culture(green) and cellThree
supernatant. nucleiD19044
(blue) were
clonesvisualized.
(D19044_WT,Bar, scale
_4M,100 μm.
and (C) The
_7M) were
DENV titer of culture supernatant. Three D19044 clones (D19044_WT, _4M, and _7M) were trans-
transfected into BHK-21 cells, and the supernatant were collected for FFU assay at time points as
fected into BHK-21 cells, and the supernatant were collected for FFU assay at time points as indi-
indicated.
cated. The means± ±
Themeans SEM SEM of three
of three independent
independent experiments
experiments are shown.
are shown. A “#”Aindicates
“#” indicates thewas
the titer titer
wasbelow
belowLOD LOD (<0.69 loglog
(<0.69 10FFU/mL).
10 FFU/mL).(D) Comparison of viraloftiters
(D) Comparison viralreleased by D19044_7M
titers released and DENV-
by D19044_7M and
2 clone
DENV-2 16681.
clone BHK-21
16681. cells were
BHK-21 cells transfected with D19044_7M
were transfected and DENV-2
with D19044_7M 16681 plasmids,
and DENV-2 and the
16681 plasmids,
andsupernatant were were
the supernatant collected for FFU
collected for assay at time
FFU assay at points as indicated.
time points The means
as indicated. ± SEM±ofSEM
The means threeof
three independent experiments are shown. In panels C and D, statistics analyses were performed
using multiple comparison test in a two-way ANOVA. ** p < 0.01; *** p < 0.001; **** p < 0.0001.
Viruses 2022, 14, x FOR PEER REVIEW 12 of 18
Viruses 2022, 14, 2073 11 of 17

D19044_7M
6.0 D19044_7M/5TPC ns

Viral titer (Log10 FFU/ml)

ns
5.0
ns
4.0
3.0
ns
2.0
1.0

0.0
2 4 6 8
Days post transfection
Figure 4. D19044_7M clone were genetically stable in the transformant bacteria. D19044_7M clone
Figure 4. D19044_7M clone were genetically stable in the transformant bacteria. D19044_7M clone
plasmid that have gone through five rounds of transformation-purification cycle (5TPC) produced
plasmid that have gone through five rounds of transformation-purification cycle (5TPC) produced
infectious virus comparable to D19044_7M clone. The viral titers were determined by FFU assay. The
infectious virus comparable to D19044_7M clone. The viral titers were determined by FFU assay.
means
The means± ±SEM
SEMofof
three independent
three independentexperiments areare
experiments shown. Statistics
shown. analysis
Statistics were
analysis performed
were using
performed
multiple comparison test in a two-way ANOVA. ns, no significance.
using multiple comparison test in a two-way ANOVA. ns, no significance.
3.6. Differential Efficiency of D19044_7M and D19044_WT in Various Vell Lines
3.6. Differential Efficiency of D19044_7M and D19044_WT in Various Vell Lines
Since D19044_7M was generated by adapting D19044_WT in BHK-21 cells through se-
rialSince D19044_7M
passages was generated
and it carried seven amino byacid
adapting D19044_WT
substitutions, in BHK-21
we wanted to testcells through
whether it was
serial passages and it carried seven amino acid substitutions, we wanted
capable of infecting other cell lines. We infected BHK-21, Huh7.5.1, 293T, and C6/36 cells to test whether
it with
was capable
same MOI of infecting
of virusesother
(MOI cell lines.~70%
= 0.01; We infected
culture BHK-21,
confluence)Huh7.5.1, 293T, andthe
and determined C6/36
viral
cells with
titers same MOI
released at daysof viruses (MOI
2, 4, 6, and = 0.01;
8 p.i. ~70%
(Figure 5).culture confluence)
The results showedand thatdetermined
all cell lines the
were
viral titersby
infected released at days
both viruses, 2, 4, 6, D19044_7M
however and 8 p.i. (Figure
was more 5). The results
efficient showed Huh7.5.1,
in BHK-21, that all cell
and
lines
C6/36 cells (peak titers, 1 × 10 –10 FFU/mL) than in 293T cells (1 × 10in
were infected by both viruses,
5.3 however
5.9 D19044_7M was more efficient 4.0BHK-21,
FFU/mL)
Huh7.5.1, and C6/36
(Figure 5A–D). cells (peak
D19044_WT wastiters, 1 × 105.3less
apparently –105.9 FFU/mL)
efficient thanthan in 293T cells
D19044_7M (1 × 104.0
by 75~268-fold
FFU/mL)
in BHK-21, (Figure 5A–D).and
Huh7.5.1, D19044_WT
293T cellswas apparently
at days 4 and 6,less efficient
however than to
similar D19044_7M
D19044_7M byin
75~268-fold
C6/36 cellsin(~2-folds)
BHK-21,(Figure
Huh7.5.1,
5A–D).andTogether,
293T cells at days 4was
D19044_7M andmore
6, however
adapted for similar to
infection
D19044_7M in C6/36 cells (~2-folds) (Figure 5A–D). Together,
of vertebrate cell lines, without loss infectivity to the mosquito cell line. D19044_7M was more
adapted for infection of vertebrate cell lines, without loss infectivity to the mosquito cell
line.
3.7. D19044_7M Virus Was Inhibited by Antiviral Compound
An infectious clone provides a valuable tool for the study of various aspects of DENV
virology, of which one most expected may be its feasibility for testing antivirals. We pro-
ceeded to test its responsiveness against mycophenolic acid (MPA). MPA inhibits DENV in-
fection by preventing accumulation of positive- and negative-strand RNAs [2] and has been
shown to suppress ZIKV infection in different cell types [31,32]. Moxifloxacin hydrochloride
was selected as the negative control, which is used for treatment of pulmonary infections
and has no inhibition to flaviviruses [33]. The antiviral treatment was performed below the
cytotoxic concentration of the drugs (BHK-21 cells, MPA CC50 = 1.087 µM) (Figure 6A,B).
BHK-21 cells in 96-well plates were infected with D19044_WT and D19044_7M (MOI = 0.1)
and then treated with drugs of serial dilution. The results showed that D19044_7M (IC50
= 0.04827 µM) and D19044_WT (IC50 = 0.04657 µM) were inhibited by MPA in a dose-
dependent manner; the IC50 comparable for both viruses indicate that amino acid sub-
stitutions (7M) did not affect viral response to MPA treatment (Figure 6C). Moxifloxacin
hydrochloride did not inhibit virus infection (Figure 6D). Together, these data demonstrate
that D19044_7M could serve as a tool for the study of anti-DENV drugs.
 Viruses 2022, 14, x FOR PEER REVIEW

Viruses 2022, 14, 2073 12 of 17

A B

C D

Figure 5. Virus production of D19044_WT and D19044_7M in various cell lines. BHK-21 cells (A),
Huh7.5.1 cells (B), 293T cells (C), and C6/36 cells (D) were infected with D19044_WT and D19044_7M
Figure 5. Virus production of D19044_WT and D19044_7M in various cell lines. BHK
(MOI = 0.001). The viral titers released in supernatant were determined by FFU assay. A “#” indicates
Huh7.5.1 cells (B), 293T cells (C), and C6/36 cells (D) were infected with D19
the titer was below LOD (<0.69 log10 FFU/mL). The means ± SEM of three independent experiments
D19044_7M (MOI = 0.001). The viral titers released in supernatant were determined
are shown. Statistics analysis were performed using multiple comparison test in a two-way ANOVA.
A “#” indicates the titer was below LOD (<0.69 log10FFU/mL). The means ± SEM of th
** p < 0.01; *** p < 0.001; **** p < 0.0001.
ent experiments are shown. Statistics analysis were performed using multiple compa
two-way ANOVA. ** p＜0.01; *** p＜0.001; **** p＜0.0001.

3.7. D19044_7M Virus Was Inhibited by Antiviral Compound

An infectious clone provides a valuable tool for the study of various aspe
virology, of which one most expected may be its feasibility for testing antivir
ceeded to test its responsiveness against mycophenolic acid (MPA). MPA inh
infection by preventing accumulation of positive- and negative-strand RNAs
been shown to suppress ZIKV infection in different cell types [31,32]. Moxiflo
chloride was selected as the negative control, which is used for treatment of
infections and has no inhibition to flaviviruses [33]. The antiviral treatme
formed below the cytotoxic concentration of the drugs (BHK-21 cells, MPA
μM) (Figure 6A,B). BHK-21 cells in 96-well plates were infected with D190
D19044_7M (MOI = 0.1) and then treated with drugs of serial dilution. The res
 that D19044_7M (IC50 = 0.04827 μM) and D19044_WT (IC50 = 0.04657 μM) were inhibited by
MPA in a dose-dependent manner; the IC50 comparable for both viruses indicate that
amino acid substitutions (7M) did not affect viral response to MPA treatment (Figure 6C).
Viruses 2022, 14, 2073 Moxifloxacin hydrochloride did not inhibit virus infection (Figure 6D). Together,
13 of 17 these
data demonstrate that D19044_7M could serve as a tool for the study of anti-DENV drugs.

Figure 6. D19044 was inhibited antiviral compound in a dose-dependent manner. (A,B) The cell
Figure 6.ofD19044
viability BHK-21was cellsinhibited
under theantiviral
treatmentcompound in a dose-dependent
of mycophenolic manner. (A,B)
acid (MPA) and moxifloxacin hy-The cell
viability of BHK-21 cells under the treatment of mycophenolic acid (MPA) and moxifloxacin hydro-
drochloride. (C) MPA inhibited D19044_7M and D19044_WT in a dose-dependent manner with
chloride.
comparable (C)IC
MPA inhibited
50 (0.04827 µM D19044_7M and D19044_WT
and 0.04657 µM). in a hydrochloride
(D) Moxifloxacin dose-dependent did manner with com-
not inhibit
parable
D19044_7M IC50and
(0.04827
D19044_WT μM viruses.
and 0.04657 μM).
In C and (D) Moxifloxacin
D, BHK-21 hydrochloride
cells were infected did and
with D19044_7M not inhibit
D19044_7M
D19044_WT and withD19044_WT
MOI of 0.1 forviruses.
2 h, andIn C and
then D, BHK-21
incubated cells were
with drugs infected
of different with D19044_7M
concentrations for and
D19044_WT with MOI of 0.1 for 2 h, and then incubated with drugs of different concentrations for
48 h. The infection rates were examined by IFA and normalized to the nontreated mock controls. The
48 h. The
means infection
± SEM of fourrates were examined
determinations by IFA and normalized to the nontreated mock controls.
are shown.
The means ± SEM of four determinations are shown.
4. Discussion
In this study, we constructed a DNA-launched full-length infectious clone for a DENV-
4. Discussion
1 genotype I isolate, D19044. Through serial passages in cell culture, seven amino acid
In this (7M)
substitutions study,wereweidentified
constructed a DNA-launched
and subsequently demonstratedfull-length infectious
to promote clone for a
efficient virus
DENV-1
production genotype I isolate,
in vitro. The D19044. Through
final D19044_7M clone was serial
able passages in cell culture,
to release infectious virusesseven
with amino
acid
peaksubstitutions
titers of 7.5 × (7M) were identified
104 FFU/mL and subsequently
and was genetically demonstrated
stable in transformant to promote
bacteria, thus effi-
cient virus production in vitro. The final D19044_7M clone was able to release infectious
enabling its usefulness to the field. Both D19044_WT and D19044_7M virus showed infections
viruses with293T,
to BHK-21, peak titers ofand
Huh7.5.1, 7.5 C6/36
× 104 FFU/mL
cells, and and
werewas genetically
inhibited by MPAstable
drug inin atransformant
dose-
dependent manner. The development of a full-length infectious cDNA
bacteria, thus enabling its usefulness to the field. Both D19044_WT and D19044_7M virus clone for a clinical
isolate provides a useful tool for the study of DENV, especially for the serotype I DENV-1.
showed infections to BHK-21, 293T, Huh7.5.1, and C6/36 cells, and were inhibited by MPA
There are different ways to develop infectious clones for DENV isolates, and vector
drug in aplays
selection dose-dependent manner. The
a key role for assembling development
a full-length cDNAofclonea full-length infectious
with genetic stability cDNA
clone
in transformant bacteria. Different plasmid vectors have been used, including high copy for the
for a clinical isolate provides a useful tool for the study of DENV, especially
serotype I DENV-1.
number plasmid vector for a DENV-2 isolate [26], low copy number plasmid vectors
There are
for DENV-1 different
[34], DENV-2ways toand
[27,35], develop
DENV-4 infectious clonesartificial
[36], bacterial for DENV isolates, and
chromosomes for vector
selection plays a key role for assembling a full-length cDNA clone with genetic stability
DENV-1 [37] and DENV-2 [38]. Yeast artificial chromosomes [39] and shuttle vector [40–42]
in transformant
have also been used.bacteria. Different
Recently, plasmid
20 infectious vectors
clones haveDENV-1-4
covering been used, including
were constructedhigh copy
using the circular polymerase extension reaction method [17,43], thus wisely bypassing
Viruses 2022, 14, 2073 14 of 17

propagation of flavivirus cDNA in bacteria and yeast, which was previously used for
developing infectious clones of flaviviruses. In addition to vector selection, other strategies
to stabilize the cDNA clones include inserting intron sequences to interrupt the putative
E. coli promoters (ECP) [28,44] or introducing silent substitutions into the putative ECP
sequence [18,20]. Moreover, methods avoiding transformation step have also been applied,
such as long PCR [45], infectious-subgenomic-amplicons [46], and subgenomic plasmid
recombination method (SuPReMe) [47].
We selected pTight vector to construct the D19044 full-length clone, as this vector is a
low copy number plasmid originally modified from pBR322 [19], containing 7 × TRE and
CMVmin promoter upstream of the cloned viral cDNA sequence. The 7 × TRE could inhibit
the potential ECP activity that a viral cDNA sequence may have, thus permitting plasmid
replication in bacteria and making laboratory manipulation feasible [18,19]. The CMVmin
promoter-controlled vector allows a DNA-launched production of viral genomic RNA
transcripts by plasmid transfection of eukaryotic cells, thus avoiding in vitro transcription
and RNA manipulation. In addition, the CMVmin promoter vector also showed advantages
in maintaining the stability of flavivirus genome in transformant bacteria, such as C41 and
Turbo E. coli bacteria [18,19]. Nevertheless, although these elements noticeably reduced
the ECP activity, we identified deletions, neucleotide and/or amino acid substitutions, or
recombination in transformation-recovered plasmids, mainly in prM-E-NS1 region, when
we ligated four fragments (A, B, C, and D) in the order of C → D → A. Thus, we tried
different orders of assembling and only succeeded when these fragments were cloned in
the order of B → A → C → D (Figure 2A). Noted that, colonies with mutagenesis events
generally showed abnormal manifestation, such as a faster growth and a larger colony
size; mutagenesis events may have eliminated or reduced toxic proteins producing in
bacteria, thus bacteria gained a growth benefit. In contrast, bacteria colonies carrying
correct viral cDNA usually grew slower, became identifiable after 24 h incubation, and had
a smaller size. Through the use of the pTight vector and a specific order of fragment cloning,
we generated a D19044_7M clone with genetic stability in the transformant bacteria. A
full-length clone genetically stable in bacteria is vitally important and allows its utility for
molecular manipulation.
Adaptive amino acid substitutions are often required to improve virus production
of infectious clones [18,48,49]. D19044_WT clone showed a slow virus spread and low-
level infectious virus after transfection (Figures 2 and 3), but became efficient after a
number of virus passages (e.g., up to 34-37 passages, 3.9 × 105 FFU/mL). Seven amino acid
substitutions (7M) were identified (Table 2) and proven to greatly improve virus production
(1 × 105 FFU/mL). Therefore, the acquisition of adaptive amino acid substitutions by
serial viral passage in the culture is a strategy recommendable for making an efficient
infectious clone for DENV and other RNA viruses. Here, it is interesting that addition
of 7M improved the virus infection greatly in the cell lines from human and Hamster
Syrian, but to a less extent in mosquito C6/36 cells (Figure 5D). D19044_WT virus infected
mosquito C6/36 cells more efficiently than other cell lines, suggesting that this virus may
be more adaptive to C6/36 cells or mosquitos’ phycological environment than in other
species. These results may be due to the fact that the D19044_WT virus was generated
from the cDNA clone constructed from infected-C6/36 cells after 6 days. It is unknown
whether there was adaptive substitution(s) had been introduced into the viral genome
for an efficient infection of C6/36 cells (without patient serum adequate for sequencing).
However, in this case, 7M had proven a potential in culture adaptation of cross-species,
thus the functional roles of 7M in the viral life cycle and cross-species adaptation in vitro
and in vivo warrant future investigations.
The wild-type virus used in this study was generated from D19044_WT cDNA clone
that was made from infection supernatant of C3/36 cells (day 6), due to a limited volume
of patient serum available. The C6/36-deirived supernatant showed very low infection in
Vero and BHK-21 cells after a number of passages without detectable viral titers, thus we
were unable to compare the infection of D19044_7M and original serum virus in cultured
Viruses 2022, 14, 2073 15 of 17

cells. In addition, the functional roles of 7M and potential effect of partial 50 UTR and 30 UTR
sequences from GZ2002 used in D19044_7M clone were not explored. These limitations of
this study warrant future investigations towards an in-depth characterization and utility of
D19044_7M clone.
In summary, we have developed an efficient infectious clone for a genotype I DENV-1
isolate that was recently prevalent in south China. Given that genotype I virus is pre-
dominantly circulating in different regions and is responsible for several major outbreaks,
D19044_7M will be highly relevant for the study of DENV-1.

Author Contributions: Conceptualization, Y.-P.L. and T.L.; investigation, M.H., T.W., Y.Y., T.C., J.H.,
D.W.; data analysis, M.H., T.W., Y.Y., Y.W., and Y.-P.L.; resources, D.W. and Y.-P.L.; data curation, M.H.
and Y.-P.L.; original draft preparation, M.H., T.W. and Y.-P.L.; review and editing, Y.-P.L.; supervision,
Y.-P.L.; funding acquisition, Y.-P.L. All authors have read and agreed to the published version of
the manuscript.
Funding: This work was supported by National Key R&D Program of China (No. 2020YFC1200100).
Institutional Review Board Statement: Not applicable.
Informed Consent Statement: Not applicable.
Data Availability Statement: All experimental data are present in the manuscript. Sequence data
has been deposited in GenBank. Plasmids are available upon request.
Acknowledgments: We thank Andrew Yueh (National Health Research Institutes, Taiwan, China)
for providing the modified pTight-DENV-2 clone, Frank Chisari (The Scripps Research Institute, CA,
USA) and Jin Zhong (Institut Pasteur of Shanghai, Shanghai, China) for providing Huh7.5.1 cells,
and Ping Zhang (Sun Yat-sen University, Guangzhou, China) for providing C6/36 cells. Hongying
Chen (Northwest A&F University, Xianyang, China) for providing Turbo competent bacteria.
Conflicts of Interest: Authors declare no conflict of interest exists.

References
1. Wu, T.; Wu, Z.; Li, Y.P. Dengue fever and dengue virus in the People’s Republic of China. Rev. Med. Virol. 2022, 32, e2245.
[CrossRef] [PubMed]
2. Diamond, M.S.; Zachariah, M.; Harris, E. Mycophenolic Acid Inhibits Dengue Virus Infection by Preventing Replication of Viral
RNA. Virology 2002, 304, 211–221. [CrossRef] [PubMed]
3. Guo, C.; Zhou, Z.; Wen, Z.; Liu, Y.; Zeng, C.; Xiao, D.; Ou, M.; Han, Y.; Huang, S.; Liu, D.; et al. Global Epidemiology of Dengue
Outbreaks in 1990–2015: A Systematic Review and Meta-Analysis. Front. Cell. Infect. Microbiol. 2017, 7, 317. [CrossRef] [PubMed]
4. Zhang, Z.; Rong, L.; Li, Y.-P. Flaviviridae Viruses and Oxidative Stress: Implications for Viral Pathogenesis. Oxidative Med. Cell.
Longev. 2019, 2019, 1409582. [CrossRef]
5. Wilder-Smith, A. Dengue vaccine development: Status and future. Bundesgesundheitsblatt Gesundh. Gesundh. 2020, 63, 40–44.
[CrossRef]
6. WHO. Ten Threats to Global Health in 2019. WHO Spotlight 2019. Available online: https://www.who.int/news-room/
spotlight/ten-threats-to-global-health-in-2019 (accessed on 29 May 2022).
7. Holmes, E.C.; Twiddy, S.S. The origin, emergence and evolutionary genetics of dengue virus. Infect. Genet. Evol. 2003, 3, 19–28.
[CrossRef]
8. Rico-Hesse, R. Molecular evolution and distribution of dengue viruses type 1 and 2 in nature. Virology 1990, 174, 479–493.
[CrossRef]
9. Guzman, M.G.; Harris, E. Dengue. Lancet 2015, 385, 453–465. [CrossRef]
10. Khetarpal, N.; Khanna, I. Dengue Fever: Causes, Complications, and Vaccine Strategies. J. Immunol. Res. 2016, 2016, 6803098.
[CrossRef]
11. Langerak, T.; Mumtaz, N.; Tolk, V.I.; Van Gorp, E.C.M.; Martina, B.E.; Rockx, B.; Koopmans, M.P.G. The possible role of
cross-reactive dengue virus antibodies in Zika virus pathogenesis. PLOS Pathog. 2019, 15, e1007640. [CrossRef]
12. Mishra, N.; Boudewijns, R.; Schmid, M.A.; Marques, R.E.; Sharma, S.; Neyts, J.; Dallmeier, K. A Chimeric Japanese Encephalitis
Vaccine Protects against Lethal Yellow Fever Virus Infection without Inducing Neutralizing Antibodies. mBio 2020, 11, e02494-19.
[CrossRef] [PubMed]
13. Shukla, R.; Ramasamy, V.; Shanmugam, R.K.; Ahuja, R.; Khanna, N. Antibody-Dependent Enhancement: A Challenge for
Developing a Safe Dengue Vaccine. Front. Cell. Infect. Microbiol. 2020, 10, 572681. [CrossRef] [PubMed]
14. Halstead, S.B.; Dans, L.F. Dengue infection and advances in dengue vaccines for children. Lancet Child Adolesc. Health 2019, 3,
734–741. [CrossRef]
Viruses 2022, 14, 2073 16 of 17

15. Thai, K.T.D.; Henn, M.R.; Zody, M.C.; Tricou, V.; Nguyet, N.M.; Charlebois, P.; Lennon, N.J.; Green, L.; de Vries, P.J.; Hien, T.T.;
et al. High-Resolution Analysis of Intrahost Genetic Diversity in Dengue Virus Serotype 1 Infection Identifies Mixed Infections. J.
Virol. 2012, 86, 835–843. [CrossRef] [PubMed]
16. Pyke, A.T.; Moore, P.R.; Taylor, C.T.; Hall-Mendelin, S.; Cameron, J.N.; Hewitson, G.R.; Pukallus, D.S.; Huang, B.; Warrilow, D.;
van den Hurk, A.F. Highly divergent dengue virus type 1 genotype sets a new distance record. Sci. Rep. 2016, 6, 22356. [CrossRef]
[PubMed]
17. Tamura, T.; Zhang, J.; Madan, V.; Biswas, A.; Schwoerer, M.P.; Cafiero, T.R.; Heller, B.L.; Wang, W.; Ploss, A. Generation and
characterization of genetically and antigenically diverse infectious clones of dengue virus serotypes 1–4. Emerg. Microbes Infect.
2022, 11, 227–239. [CrossRef]
18. Chen, Y.; Liu, T.; Zhang, Z.; Chen, M.; Rong, L.; Ma, L.; Yu, B.; Wu, D.; Zhang, P.; Zhu, X.; et al. Novel genetically stable infectious
clone for a Zika virus clinical isolate and identification of RNA elements essential for virus production. Virus Res. 2018, 257, 14–24.
[CrossRef]
19. Pu, S.-Y.; Wu, R.-H.; Tsai, M.-H.; Yang, C.-C.; Chang, C.-M.; Yueh, A. A novel approach to propagate flavivirus infectious
cDNA clones in bacteria by introducing tandem repeat sequences upstream of virus genome. J. Gen. Virol. 2014, 95, 1493–1503.
[CrossRef] [PubMed]
20. Pu, S.-Y.; Wu, R.-H.; Yang, C.-C.; Jao, T.-M.; Tsai, M.-H.; Wang, J.-C.; Lin, H.-M.; Chao, Y.-S.; Yueh, A. Successful Propagation of
Flavivirus Infectious cDNAs by a Novel Method to Reduce the Cryptic Bacterial Promoter Activity of Virus Genomes. J. Virol.
2011, 85, 2927–2941. [CrossRef] [PubMed]
21. Fang, X.; Zhang, J.; Zhu, J.; Hu, Z.; Liu, J.; Yang, J.; Yuan, W.; Shang, W.; Rao, X. Genomic phylogenetic analysis of one Dengue
virus type 1 strain GZ2002 isolated in Guangzhou. China J. Mod. Med. 2012, 22, 25–33.
22. de Borba, L.; Villordo, S.M.; Iglesias, N.G.; Filomatori, C.V.; Gebhard, L.G.; Gamarnik, A.V. Overlapping Local and Long-Range
RNA-RNA Interactions Modulate Dengue Virus Genome Cyclization and Replication. J. Virol. 2015, 89, 3430–3437. [CrossRef]
[PubMed]
23. Ng, W.C.; Soto-Acosta, R.; Bradrick, S.S.; Garcia-Blanco, M.A.; Ooi, E.E. The 5’ and 3’ Untranslated Regions of the Flaviviral
Genome. Viruses 2017, 9, 137. [CrossRef]
24. Payne, A.F.; Binduga-Gajewska, I.; Kauffman, E.B.; Kramer, L.D. Quantitation of flaviviruses by fluorescent focus assay. J. Virol.
Methods 2006, 134, 183–189. [CrossRef] [PubMed]
25. Schoepp, R.J.; Beaty, B.J. Titration of dengue viruses by immunofluorescence in microtiter plates. J. Clin. Microbiol. 1984, 20,
1017–1019. [CrossRef]
26. Sriburi, R.; Keelapang, P.; Duangchinda, T.; Pruksakorn, S.; Maneekarn, N.; Malasit, P.; Sittisombut, N. Construction of infectious
dengue 2 virus cDNA clones using high copy number plasmid. J. Virol. Methods 2001, 92, 71–82. [CrossRef]
27. Kinney, R.M.; Butrapet, S.; Chang, G.-J.J.; Tsuchiya, K.R.; Roehrig, J.; Bhamarapravati, N.; Gubler, D.J. Construction of Infectious
cDNA Clones for Dengue 2 Virus: Strain 16681 and Its Attenuated Vaccine Derivative, Strain PDK-53. Virology 1997, 230, 300–308.
[CrossRef] [PubMed]
28. Li, G.; Jin, H.; Nie, X.; Zhao, Y.; Feng, N.; Cao, Z.; Tan, S.; Zhang, B.; Gai, W.; Yan, F.; et al. Development of a reverse genetics
system for Japanese encephalitis virus strain SA14-14-2. Virus Genes 2019, 55, 550–556. [CrossRef] [PubMed]
29. Mishin, V.P.; Cominelli, F.; Yamshchikov, V.F. A ‘minima’ approach in design of flavivirus infectious DNA. Virus Res. 2001, 81,
113–123. [CrossRef]
30. Schwarz, M.C.; Sourisseau, M.; Espino, M.M.; Gray, E.S.; Chambers, M.T.; Tortorella, D.; Evans, M.J. Rescue of the 1947 Zika Virus
Prototype Strain with a Cytomegalovirus Promoter-Driven cDNA Clone. mSphere 2016, 1, e00246-16. [CrossRef] [PubMed]
31. Barrows, N.J.; Campos, R.K.; Powell, S.T.; Prasanth, K.R.; Schott-Lerner, G.; Soto-Acosta, R.; Galarza-Muñoz, G.; McGrath, E.L.;
Urrabaz-Garza, R.; Gao, J.; et al. A Screen of FDA-Approved Drugs for Inhibitors of Zika Virus Infection. Cell Host Microbe 2016,
20, 259–270. [CrossRef] [PubMed]
32. Dong, S.; Kang, S.; Dimopoulos, G. Identification of anti-flaviviral drugs with mosquitocidal and anti-Zika virus activity in Aedes
aegypti. PLoS Negl. Trop. Dis. 2019, 13, e0007681. [CrossRef]
33. Shandil, R.K.; Jayaram, R.; Kaur, P.; Gaonkar, S.; Suresh, B.L.; Mahesh, B.N.; Jayashree, R.; Nandi, V.; Bharath, S.; Balasubramanian,
V. Moxifloxacin, ofloxacin, sparfloxacin, and ciprofloxacin against Mycobacterium tuberculosis: Evaluation of in vitro and
pharmacodynamic indices that best predict in vivo efficacy. Antimicrob. Agents Chemother. 2007, 51, 576–582. [CrossRef]
34. Gallichotte, E.N.; Menachery, V.D.; Yount, B.L., Jr.; Widman, D.G.; Dinnon, K.H., III; Hartman, S.; de Silva, A.M.; Baric, R.S.
Epitope Addition and Ablation via Manipulation of a Dengue Virus Serotype 1 Infectious Clone. mSphere 2017, 2, e00380-16.
[CrossRef] [PubMed]
35. Davidson, A.D. Development and Application of Dengue Virus Reverse Genetic Systems. Methods Mol. Biol. 2014, 1138, 113–130.
[CrossRef] [PubMed]
36. Lai, C.J.; Zhao, B.T.; Hori, H.; Bray, M. Infectious RNA transcribed from stably cloned full-length cDNA of dengue type 4 virus.
Proc. Natl. Acad. Sci. USA 1991, 88, 5139–5143. [CrossRef] [PubMed]
37. Suzuki, R.; de Borba, L.; Duarte dos Santos, C.N.; Mason, P.W. Construction of an infectious cDNA clone for a Brazilian prototype
strain of dengue virus type 1: Characterization of a temperature-sensitive mutation in NS1. Virology 2007, 362, 374–383. [CrossRef]
[PubMed]
Viruses 2022, 14, 2073 17 of 17

38. Usme-Ciro, J.A.; Lopera, J.A.; Enjuanes, L.; Almazán, F.; Gallego-Gomez, J.C. Development of a novel DNA-launched dengue
virus type 2 infectious clone assembled in a bacterial artificial chromosome. Virus Res. 2014, 180, 12–22. [CrossRef] [PubMed]
39. Polo, S.; Ketner, G.; Levis, R.; Falgout, B. Infectious RNA transcripts from full-length dengue virus type 2 cDNA clones made in
yeast. J. Virol. 1997, 71, 5366–5374. [CrossRef]
40. Kelly, E.P.; Puri, B.; Sun, W.; Falgout, B. Identification of mutations in a candidate dengue 4 vaccine strain 341750 PDK20 and
construction of a full-length cDNA clone of the PDK20 vaccine candidate. Vaccine 2010, 28, 3030–3037. [CrossRef]
41. Puri, B.; Polo, S.; Hayes, C.G.; Falgout, B. Construction of a full length infectious clone for dengue-1 virus Western Pacific, 74
strain. Virus Genes 2000, 20, 57–63. [CrossRef] [PubMed]
42. Santos, J.; Cordeiro, M.T.; Bertani, G.R.; Marques, E.; Gil, L.H.V.G. Construction and characterisation of a complete reverse
genetics system of dengue virus type 3. Mem. Inst. Oswaldo Cruz 2013, 108, 983–991. [CrossRef] [PubMed]
43. Quan, J.; Tian, J. Circular Polymerase Extension Cloning of Complex Gene Libraries and Pathways. PLoS ONE 2009, 4, e6441.
[CrossRef] [PubMed]
44. Guo, J.; He, Y.; Wang, X.; Jiang, B.; Lin, X.; Wang, M.; Jia, R.; Zhu, D.; Liu, M.; Zhao, X.; et al. Stabilization of a full-length infectious
cDNA clone for duck Tembusu virus by insertion of an intron. J. Virol. Methods 2020, 283, 113922. [CrossRef]
45. Govindarajan, D.; Guan, L.; Meschino, S.; Fridman, A.; Bagchi, A.; Pak, I.; ter Meulen, J.; Casimiro, D.R.; Bett, A.J. A Rapid
and Improved Method to Generate Recombinant Dengue Virus Vaccine Candidates. PLoS ONE 2016, 11, e0152209. [CrossRef]
[PubMed]
46. Aubry, F.; Nougairède, A.; De Fabritus, L.; Querat, G.; Gould, E.A.; De Lamballerie, X. Single-stranded positive-sense RNA
viruses generated in days using infectious subgenomic amplicons. J. Gen. Virol. 2014, 95, 2462–2467. [CrossRef] [PubMed]
47. Driouich, J.-S.; Ali, S.M.; Amroun, A.; Aubry, F.; De Lamballerie, X.; Nougairède, A. SuPReMe: A rapid reverse genetics method
to generate clonal populations of recombinant RNA viruses. Emerg. Microbes Infect. 2018, 7, 40. [CrossRef] [PubMed]
48. Chen, M.; Zheng, F.; Yuan, G.; Duan, X.; Rong, L.; Liu, J.; Feng, S.; Wang, Z.; Wang, M.; Feng, Y.; et al. Development of an
Infectious Cell Culture System for Hepatitis C Virus Genotype 6a Clinical Isolate Using a Novel Strategy and Its Sensitivity to
Direct-Acting Antivirals. Front. Microbiol. 2018, 9, 2950. [CrossRef]
49. Li, J.; Zhou, Q.; Rong, L.; Rong, D.; Yang, Y.; Hao, J.; Zhang, Z.; Ma, L.; Rao, G.; Zhou, Y.; et al. Development of cell culture
infectious clones for hepatitis C virus genotype 1b and transcription analysis of 1b-infected hepatoma cells. Antivir. Res. 2021,
193, 105136. [CrossRef] [PubMed]