Lysophosphatidylcholine 16 0 Mediates Chronic.14

Research Paper
Lysophosphatidylcholine 16:0 mediates chronic

joint pain associated to rheumatic diseases through
Downloaded from http://journals.lww.com/pain by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW
acid-sensing ion channel 3

Florian Jacquota, Spiro Khouryb, Bonnie Labrumc, Kévin Delanoec, Ludivine Pidouxc, Julie Barbiera,
nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 09/19/2022
Lauriane Delaya, Agathe Baylea, Youssef Aissounia, David A. Barrierea, Kim Kultimad, Eva Freyhultd, Anders Hugoe,
Eva Kosekf,g, Aisha S. Ahmedh, Alexandra Jurczaki, Eric Linguegliac, Camilla I. Svenssoni, Véronique Breuilj,
Thierry Ferreirab, Fabien Marchanda, Emmanuel Devalc,*
Abstract
Rheumatic diseases are often associated to debilitating chronic pain, which remains difficult to treat and requires new therapeutic
strategies. We had previously identified lysophosphatidylcholine (LPC) in the synovial fluids from few patients and shown its effect as
a positive modulator of acid-sensing ion channel 3 (ASIC3) able to induce acute cutaneous pain in rodents. However, the possible
involvement of LPC in chronic joint pain remained completely unknown. Here, we show, from 2 independent cohorts of patients with
painful rheumatic diseases, that the synovial fluid levels of LPC are significantly elevated, especially the LPC16:0 species, compared
with postmortem control subjects. Moreover, LPC16:0 levels correlated with pain outcomes in a cohort of osteoarthritis patients.
However, LPC16:0 do not appear to be the hallmark of a particular joint disease because similar levels are found in the synovial fluids
of a second cohort of patients with various rheumatic diseases. The mechanism of action was next explored by developing a
pathology-derived rodent model. Intra-articular injections of LPC16:0 is a triggering factor of chronic joint pain in both male and
female mice, ultimately leading to persistent pain and anxiety-like behaviors. All these effects are dependent on ASIC3 channels,
which drive sufficient peripheral inputs to generate spinal sensitization processes. This study brings evidences from mouse and
human supporting a role for LPC16:0 via ASIC3 channels in chronic pain arising from joints, with potential implications for pain
management in osteoarthritis and possibly across other rheumatic diseases.
Keywords: Chronic pain, Joint, Osteoarthritis, Lysophosphatidylcholine, Lipid, Acid-sensing ion channels, Sodium channels
1. Introduction
pathophysiology of joint pain, with careful identification of the
Chronic joint pain is the primary reason why patients seek care triggering factors and associated mechanisms.
from rheumatologists, representing a heavy burden for modern In the past 2 decades, signaling lipids have been shown to
societies.4,14 In addition to economical costs, chronic joint pain contribute to the onset and maintenance of pain. Lysophosphati-
considerably impairs the patients’ quality of life, leading to dylcholine (LPC) and lysophosphatidic acid (LPA), the most
disabilities and psychological distress.4,36 Despite major ad- prominent lysoglycerophospholipids,41 are emerging as potential
vances in inflammatory arthritis therapies, most patients, direct pain mediators, besides well-known thromboxanes, leukotri-
especially those suffering from osteoarthritis (OA), continue to enes and prostaglandins.15,32 Lysophosphatidic acid has been
experience life-disabling pain. The development of new thera- already identified as a key promoter of nerve demyelination and
peutic strategies requires a better understanding of the certainly of neuropathic pain.22,52 Paradoxically, LPA receptor
Sponsorships or competing interests that may be relevant to content are disclosed at the end of this article.
F. Jacquot, S. Khoury, B. Labrum contributed equally to this work.
a
Université Clermont Auvergne, Inserm U1107 Neuro-Dol, Pharmacologie Fondamentale et Clinique de la Douleur, Clermont-Ferrand, France, b Lipotoxicity and
Channelopathies (LiTch)—ConicMeds, Université de Poitiers, France, c Université Côte d’Azur, CNRS, IPMC, LabEx ICST, FHU InovPain, France, e Orthocenter, Stockholm,
Sweden, d Department of Medical Sciences, Uppsala University, Uppsala, Sweden, f Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, Sweden,
g
Department of Surgical Sciences, Uppsala University, Uppsala, Sweden, h Department of Molecular Medicine and Surgery, Karolinska Institutet, Stockholm, Sweden,
i
Department of Physiology and Pharmacology, Center for Molecular Medicine, Karolinska Institutet, Stockholm, Sweden, j CHU-Nice, Hôpital Pasteur, France
*Corresponding author. Address: IPMC, UMR 7275 CNRS/Université Côte d’Azur, 660 route des lucioles, 06560 Valbonne, France. E-mail address: [email protected]
(E. Deval).
Supplemental digital content is available for this article. Direct URL citations appear in the printed text and are provided in the HTML and PDF versions of this article on the
journal’s Web site (www.painjournalonline.com).
PAIN 163 (2022) 1999–2013
Copyright © 2022 The Author(s). Published by Wolters Kluwer Health, Inc. on behalf of the International Association for the Study of Pain. This is an open access article
distributed under the terms of the Creative Commons Attribution-Non Commercial-No Derivatives License 4.0 (CCBY-NC-ND), where it is permissible to download and share
the work provided it is properly cited. The work cannot be changed in any way or used commercially without permission from the journal.
http://dx.doi.org/10.1097/j.pain.0000000000002596
October 2022
· Volume 163
· Number 10 www.painjournalonline.com 1999
2000
·
F. Jacquot et al. 163 (2022) 1999–2013 PAIN®
signaling has also documented physiological roles in myelinating 2.1.2. Cohort of patients with different joint diseases (second
cells during nervous system development.54–56 The role of LPC in cohort)
pain remains more elusive because its effects could be partially Fifty patients suffering from different painful joint diseases (32
mediated by LPA through the action of autotaxin, the LPC-to-LPA women and 18 men, average age, 68.6 years, range, 26-94 years),
converting enzyme.50,51 Nevertheless, some studies support a recruited in the Rheumatology Department of Nice University
direct role of LPC in pain associated to its ability to activate/potentiate Hospital, France, participated and were distributed as follow:
pain-related ion channels.2,12,15,31,32 We already reported high levels rheumatoid arthritis (RA, n 5 6), chondrocalcinosis (CCA, n 5 12),
of LPC in the synovial fluids of painful joint patients,32 and an spondyloarthritis (SPA, n 5 5), psoriatic arthritis (n 5 4), gout (n 5
overactivation of the conversion pathway of PC-to-LPC has been 5), and OA (n 5 18). All subjects provided informed consent before
recently observed in OA patients.57 Lysophosphatidylcholine seems inclusion, and the study was approved by the Nice University
also important in pain originating from muscles.18 Institutional Review Board for Research on Human Subjects. By
Lysophosphatidylcholine is able to activate and potentiate contrast with the first OA cohort, information about medications
pain-related acid-sensing ion channel 3 (ASIC3),32 a subtype of was not available for all patients excluding the possibility to perform
the ASIC channel family, widely expressed in nociceptors and correlation studies between LPC levels in synovial fluids and patient
also gated by extracellular protons.53 Acid-sensing ion channel 3 pain outcomes. The study has been conducted in accordance with
have been involved in animal models of inflammatory and the French national regulations regarding patient consent and
noninflammatory pain,9,43 especially in the development of ethical review. The study was registered in the ClinicalTrials.gov
chronic pain states originating from joints20,23,48 and mus- protocol registration system (NCT 01867840). All samples were
cles.18,44,45 Genetic deletion of ASIC3 reduced secondary pain obtained from patients with acute knee joint effusion requiring joint
behaviors in different models of arthritis, such as intra-articular puncture for diagnosis and/or treatment. The synovial fluids
complete Freund adjuvant (CFA) or carrageenan, and in collagen remaining after biological analysis for patients’ care were included
antibodies–induced arthritis model.17,20,21,46 However, its direct in the present study and frozen at 280˚C for future analysis.
role in inflammation is still debated with proresolving and
worsening effects reported.17,46 Blockade of ASIC3 with
APETx210 attenuated both disease and pain progression of the 2.1.3. Postmortem control subjects
early phase in a OA rat model.23 Finally, ASIC3-dependent pain
Ten postmortem specimens with no history of knee or hip OA or
behaviors can be induced upon injection of LPC in rodent paw or
inflammatory rheumatic diseases were included as controls.
muscle.18,32 Here, we investigated the clinical relevance of LPC in
Synovial fluid from the knee joint was collected during an autopsy
chronic joint pain and explored its mechanism of action involving
procedure and immediately frozen at 280˚C for future analysis.
peripheral ASIC3 channels following intra-articular administra-
tions of LPC16:0 in mice.
2.1.4. Questionnaires
2. Methods Only OA patients from the first cohort completed questionnaires
and scales within a week before the operation. Global pain intensity
2.1. Patient cohorts
at the day of examination (visual analogue scale [VAS] global) and
2.1.1. Cohort of patients with osteoarthritis (first cohort) pain in the affected knee (VAS knee) were all scored using 100-mm
VAS, with 0 indicating “no pain” and 100 indicating “the worst
Thirty-five patients with knee OA (16 women and 19 men,
imaginable pain.” The severity of patient-reported symptoms was
average age, 64.8 years, range 49‐73 years) participated. This
assessed by Knee injury and Osteoarthritis Outcome Score
study was approved by the Regional Ethical Review Board in
(KOOS), which consists of 5 subscales: (1) pain, (2) other
Stockholm, Sweden (reference number 2011/2036-31-1,
symptoms, (3) activity in daily living, (4) function in sport and
2012/2006-32) and followed the guidelines of the Declaration
recreation, and (5) knee-related quality of life.38,39 Each KOOS
of Helsinki. All patients were recruited consecutively from the
subscale contains questions scored from 0 to 4, and the average
waiting list for total knee replacement at Ortho Center, Upplands
score of all 5 KOOS subscales was calculated and used for the
Väsby, Sweden. The patient inclusion criteria were 25 to 75
analysis.
years of age, radiologically verified knee OA, and the presence of
knee pain as the dominant pain symptom and a motivation for
surgical procedure. The patients were excluded if they suffered 2.1.5. Patient demographic data and
from chronic pain due to causes other than knee OA (eg, lysophosphatidylcholine concentrations
fibromyalgia, degenerative disc disease, disc herniation, in-
flammatory rheumatic disease, or neurologic disease) or in case The demographic data (age, sex, body mass index [BMI]) and
of previous knee surgery planned for total knee replacement. LPC concentrations found in patients synovial fluids from the first
(OA patients) and the second cohorts, as well as in postmortem
Information regarding medication was collected from all
patients. Eight patients were taking analgesics (3 codeine, 2 control specimens, are reported in supplementary tables 1 and 3
tramadol, 2 buprenorphin plaster, 1 ketobemidone), 12 were (available at http://links.lww.com/PAIN/B579). Part of the data of
taking acetaminophen, and 16 had previously been taking the first cohort (age, sex, BMI, VAS global, VAS knee, KOOS
nonsteroidal anti-inflammatory drugs at demand; however, assessment, and interleukin [IL]-6 levels in the knee synovial
these had been stopped 14 days before the surgical procedure. fluids) have also been reported elsewhere.26
All patients received 2 g of acetaminophen (paracetamol) and 10
mg of oxycodone orally as premedication before the operation. 2.2. Lipidomic analysis of patient samples
All participants were informed about the study procedure, and
written consent was obtained. Knee joint synovial fluid was 2.2.1. Chemical and lipid standards
collected during surgery and immediately frozen at 280˚C for Chloroform (CHCl3), methanol (CH3OH), and formic acid
future analysis. (HCOOH) were obtained from Sigma Aldrich (Saint Quentitn
October 2022
· Volume 163
Fallavier, France). Water (H2O) used for lipid extraction was from resolution full-scan experiments was performed with the help of
Milli-Q quality. Lysophosphatidylcholine standards were pur- ALEX Software.19
chased from Avanti Polar Lipids via Sigma Aldrich and then
prepared at the appropriate concentration and stored at 220˚C. 2.3. Animals and behavioral experiments
2.3.1. Animals
2.2.2. Lipid extraction Experiments were performed on adult male and/or female
All patients’ samples were processed in the same manner by the C57Bl6J wild‐type (WT) mice (Janvier Labs, Le Genest, France)
same laboratory as follow. Extraction of lipids from human as well as ASIC3-knockout (ASIC32/2) and WT littermates
synovial fluid (HSF) samples was adapted from the Folch (ASIC31/1), breed in animal facilities of IPMC and UCA Medicine
method.13 Fifty microliters of each patient sample were diluted School with agreements no. C061525 and no. C63115.15,
with water to a final volume of 1 mL. The diluted samples were respectively. Animals were kept with a 12‐hour light/dark cycle
then transferred into glass tubes (Pyrex Labware) and vortexed with ad libitum access to food and water and were acclimated to
for 1 minute. Lipids were extracted using 4-mL chloroform housing and husbandry conditions for at least 1 week before
(CHCl3)/methanol (CH3OH) (2:1, vol/vol) and shaken with an experiments. All experiments followed guidelines of the In-
orbital shaker (IKA VX basic Vibrax, Sigma-Aldrich) at 1500 rpm ternational Association for the Study of Pain.59 All the protocols
for 2 hours at room temperature. After centrifugation for 10 used were approved by the local ethical committees (CIEPAL-
minutes with a swingout centrifuge at 410 g, aqueous phases Azur and CEMEA-Auvergne) and the French government
were eliminated, and lipid-containing organic phases were (agreements no. 02595.02, APAFIS#13499, APAFIS#17387) in
supplemented with 1 mL of a 4:1 (vol/vol) 2N KCl/CH3OH accordance with European Communities Council Directive for the
solution. Samples were shaken for 10 minutes at 1500 rpm, care of laboratory animals (86/609/EEC).
centrifuged for 5 minutes, and the upper aqueous phases were
eliminated. The resulting organic phases were complemented 2.3.2. Joint pain models
with 1 mL of a 3:48:47 (vol/vol/vol) CHCl3/CH3OH/H2O solution,
Monoarthritis was induced by a single intra-articular injection of
shaken for 10 minutes and centrifuged for 5 minutes. The
12 mL of CFA (heat-killed Mycobacterium butyricum 2 mg/mL,
aqueous phases were eliminated, and the organic phases
Sigma) under isoflurane (2.5%) anesthesia and was used as a
containing whole lipids were transferred into new glass tubes.
positive control. Concerning the LPC-induced joint pain model,
Lipid extracts were then evaporated until dryness at 60˚C under a
mice received 2 consecutive intra-articular injections of saline
stream of nitrogen, redissolved in 500 mL CHCl3/CH3OH (1:2, vol/
solutions containing either LPC16:0 (10 or 20 nmol; Avanti polar
vol) and stored at 220˚C until further analysis.
lipds, Coger, France) or vehicle (EtOH 2%-4%), 5 days apart,
within the ankle or knee joints (10 mL) under isoflurane (2.5%)
anesthesia. The mechanical (von Frey test) and heat (thermal test)
2.2.3. Mass spectrometry analysis of lysophosphatidylcholine
pain thresholds, as well as the weight-bearing between hind
Lipid extracts were diluted once in CHCl3/CH3OH (1:2, vol/vol) paws (static weight-bearing test) were measured before and after
before addition of 1% (vol/vol) formic acid. An optimized quantity LPC/CFA/vehicle injections over a month period (see figures for
of the internal standard LPC13:0 (0.1 mg of LPC13:0 for 100 mL of schematic protocol of experiments).
lipid extract) was added to each sample to quantify LPC species.
Diluted lipid extracts were analyzed in the positive ion mode by
direct infusion on a SYNAPT G2 High-Definition Mass Spec- 2.3.3. Pharmacological experiments
trometer (Waters Corporation, Milford, MA) equipped with an The autotaxin inhibitor S32826 (Biotechne, France), was injected
Electrospray Ionization Source. The flow rate was 5 mL/minute. All in mice ankles (10 nmol) either at the time of the first LPC16:
High Resolution full-scan mass spectrometry (MS) experiments 0 injection or 5 days after the second LPC16:0 injection. When
were acquired in profile mode over 1 minute with a normal S32826 was coinjected with the first LPC16:0 administration,
dynamic range from 300 to 1200 m/z. Ionization conditions in mechanical allodynia was assessed from 30 to 240 minutes post
positive ion mode have been optimized, and all LPC species, injection. For experiments where S32826 was administrated 5
including the LPC internal standard, were detected as protonated days after the second LPC16:0 injection, the mechanical
ions [M 1 H]1. allodynia was assessed 30 and 60 minutes post injection.
Identification of LPC species was based on their exact masses APETx2 (Smartox, Saint-Égrève, France), the ASIC3 pharmaco-
in the full-scan spectrum and on tandem MS experiments in the logical inhibitor,10 was coinjected in mice knees together with
positive ion mode. Tandem mass spectrometry/MS fragmenta- LPC16:0 (0.1 nmol APETx2 1 20 nmol LPC16:0), either at the first
tion was performed by collision-induced-dissociation, which or the second intra-articular administration of LPC16:0.
notably allowed to obtain structural information about LPC
species by identifying the choline polar head group (characteristic
2.3.4. Mechanical sensitivity
and prominent fragment ion for all LPC species with m/z 184).
Lysophosphatidylcholine species were quantified by normal- Mechanical sensitivity was evaluated by performing von Frey
izing the intensity of the protonated ion [M 1 H]1 corresponding tests. Two types of von Frey tests were used, the classical
to each LPC individual species in the full-scan spectrum to the up–down method of Dixon11 modified by Chaplan7 with von Frey
intensity of the internal standard LPC 13:0 [M 1 H]1 and filaments (Bioseb, Vitrolles, France) and the dynamic plantar
multiplying by the amount of the internal LPC standard. In aesthesiometer (Ugo Basile, Gemonio, Italy). For both methods,
addition, corrections were applied to the data for isotopic overlap. freely moving animals were placed in individual plastic boxes on a
Total LPC amount was calculated by summing the quantities of all wire mesh surface, so that von Frey mechanical stimuli could be
individual LPC species. All spectra were recorded with MassLynx applied to the plantar surfaces of their hind paws. For up–down
software© (Version 4.1, Waters). Data processing for high- von Frey experiments, animals followed an habituation period
2002
·
before a set of calibrated von Frey filaments ranging from 0.02 to Animals were left undisturbed during 30 minutes in a quiet room.
1.4 g was applied to the plantar surface of each hind paw, At the end, mice were removed, and the numbers of buried
alternatively or only on the ipsilateral hind paw, until withdrawal or marbles were quantified. A marble was considered as buried
licking of the paw to the stimulus. The 50% paw mechanical when at least 50% of its surface was covered with litter.
threshold was evaluated before (Baseline) and at different time
points after the first and second LPC16:0 or vehicle injections, or 2.3.7.4. Hole board test
after the CFA injection. For experiments using the dynamic The hole board test consists of a board (39.5 3 39.5 cm) with 16
plantar aesthesiometer, a ramp of force was applied through a equidistant holes, 3 cm in diameter, equally distributed through-
single filament (up to 7.5 g in 10 seconds), and paw withdrawal out the platform and placed 70 cm above the floor. Mice were
thresholds (g) were measured in duplicate. A mean withdrawal individually placed randomly on one corner of the board facing
threshold was then calculated for each animal hind paw. Three away the experimenter and videotaped. The number of head dips
baseline measures were made prior LPC16:0 or vehicle intra- in the holes was quantified for 5 minutes by a blind experimenter.
articular injections, the third baseline measure served as the
reference mechanical withdrawal threshold for statistical
2.4. Immunohistochemistry on tibiotarsal joints
analyses. and amygdala
At day 28, 4 and 5 mice of the vehicle and LPC16:0 10 nmol
2.3.5. Heat sensitivity groups, respectively, were terminally anaesthetized using a
Heat sensitivity in mice was assessed by the paw immersion test mixture of ketamine/xylazine and quickly perfused transcardially
using a thermoregulated water bath maintained at 46.0 6 0.2˚C. with saline followed by 4% paraformaldehyde (PFA). Ipsilateral
Mice were maintained under a soft cloth except the ipsilateral hind tibiotarsal joints were excised, post fixed in 4% PFA in phosphate
paw, which was immersed in water until withdrawal (a cutoff of 30 buffer (0.1 M, pH 7.4) for 48 hours at 4˚C and decalcified in 10%
seconds was used to avoid any potential tissue damage). ethylenediaminetetraacetic acid (pH 7.6, Sigma) during 2 weeks
at 4˚C as previously described.5 Brain was also excised and post
fixed in 4% PFA in phosphate buffer (0.1 M, pH 7.4) for 24 hours at
2.3.6. Weight-bearing experiments 4˚C. After cryoprotection (PB-Sucrose 30%) for at least 48 hours,
Static weight-bearing apparatus (Bioseb) was used to evaluate samples were included in Tissue-Tek OCT cryo embedding
spontaneous weight distribution between hind paws, which compound.
could be considered as a measure of ongoing pain. Following 2 Twenty-micrometer, cryostat-thick, frozen sections of joints were
training sessions to habituate animals, mice were placed in a processed, mounted on Superfrost slides, blocked with phosphate
plastic glass enclosure so that each hind paw rested on separate buffered saline (PBS), bovine serum albumin (BSA) 1% and,
transducer pads. Once mice were settled in correct position, the incubated with primary antibodies in PBS 1 Triton 0.2% overnight
force exerted by each hind paw was measured over a period of 5 at room temperature following 3 washes in PBS. Monocytes,
seconds. Weight-bearing differences were recorded as an macrophages, and osteoclasts lineage was labeled with a rat
average of 4/5 trials and expressed as contralateral/ipsilateral antibody against myeloid protein CD68 (1:1,000; AbD Serotec,
ratio. The weight distribution was assessed before (baseline) and #MCA1957, Oxford, United Kingdom) and peptide-rich sensory
at different time points following vehicle, CFA or LPC injections. nerve fibers with a rabbit anti-calcitonin gene-related peptide (CGRP)
(1:2,000, Calbiochem, Meudon, France, #PC205L). After washes,
sections were incubated with the corresponding secondary
2.3.7. Assessment of anxiety-like behaviors antibody (1:1,000, AlexaFluor 488 and AlexaFluor 546 for CD68
and CGRP, respectively, Molecular Probes, Eugene, OR). After PBS
2.3.7.1. Open field test washes, sections were then coverslipped with fluorescent mounting
medium (Dako, Glostrup, Denmark) and observed with Nikon
Mice were individually placed in the middle of an open field (50 3 50
Eclipse Ni-E microscope. Quantitative analyses were performed with
3 50 cm) under dim light conditions (30 lux). The distance travelled
NIS-Elements software and at least 3 to 6 sections per joint per
and the velocity were automatically calculated during the 5 minutes
animal (n 5 4-5 per group) were quantified using regions of interest
of testing period as well as the time spent in the center for each
(ROIs) on tibiotarsal joint. Results are presented as the mean intensity
mouse (Ethovision XT 13; Noldus, Wageningen, the Netherlands).
of signal per joint area in one ROI (2500 3 2500 mm) for CD68 and in
2.3.7.2. Elevated plus maze 2 ROIs (570 3 570 mm) for CGRP.
Transverse sections (30 mm) of the brain containing the
The elevated plus maze (EPM) consists of 4 arms, 2 opposite open amygdala were cut on a cryotome (Microm HM450; Thermo
arms (37.5 3 5 cm) and 2 opposite closed arms (37.5 3 5 cm with Scientific, Illkirch, France). Free floating sections of the amygdala
20 cm high walls), joined by a common central platform (5 3 5 cm), were stained for c-Fos immunohistochemistry as follows: after 3
subjected to an equal illumination (30 lux). The maze was elevated washes in tris buffered saline (TBS) 0.05M pH 7.6, sections were
to 60 cm above the floor. Each mouse was placed randomly into incubated for 1 hour in a blocking solution (TBS 0.05M, BSA 3%,
the center of the EPM facing an open arm. The time spent into the Triton 0.4%, donkey serum 1%) and then overnight at 4˚C with a
open arms, considered when head, gravity center and tail points rabbit primary antibody anti-Fos (1:2000 in TBST; Santa Cruz,
were located within the arm, was automatically recorded for 5 Santa Cruz, CA). After 3 washes in TBS 0.05M, sections were
minutes and calculated for each animal (Ethovision XT 13; Noldus). incubated for 2 hours with the appropriate secondary antibody
(AlexaFluor 488 goat anti-rabbit IgG; 1:1000; Molecular Probes).
2.3.7.3. Marble burying test Sections were then washed in TBS 0.05M, mounted on gelatin-
Briefly, mice were individually placed in the experimental cage coated slides and coverslipped with Dako fluorescent mounting
(42.5 3 27.6 3 15.3 cm) containing 20 marbles (4 lines of 5 medium. From each animal, 3 to 6 sections were randomly
equidistant marbles) disposed on the top of 5-cm-thickness litter. selected for counting c-Fos–positive cells in the ipsilateral side of
October 2022
· Volume 163
the BLA (n 5 4 per group) observed with Nikon Eclipse Ni-E (radiance photons per second per square centimeter per steradian)
microscope by a blinded investigator, and an average of these per incident excitation power (microwatt per square centimeter).
counts was taken.
2.8. Cell culture and transfection
2.5. Electronic microscopy Human embryonic kidney (HEK) 293 cell line was grown in DMEM
medium (Lonza BioWhittaker) supplemented with 10% of heat-
Potential demyelination of the saphenous nerve was assessed at

inactivated fetal bovine serum (Biowest) and 1% of antibiotics
day 7, after the 2 knee injections of 20 nmol of LPC16:0 or vehicle
(penicillin 1 streptomycin, Lonza BioWhittaker). One day after
using electronic microscopy as previously described.35 Briefly, 4
plating, cells were transfected with pIRES2-rASIC1a-EGFP,
animals in each group were terminally anesthetized and perfused
pIRES2-rASIC3-EGFP, or pIRES2-hASIC3a-EGFP vector using
with PAF4%/2.5% glutaraldehyde (diluted with 0.1 M sodium
the JetPEI reagent according to the supplier’s protocol (Polyplus

cacodylate buffer). A segment of the saphenous nerve was
transfection SA, Illkirch, France). Fluorescent cells were used for
isolated proximal to the ipsilateral knee joint from vehicle and
patch-clamp recordings 2 to 4 days after transfection.
LPC16:0 groups and processed for electronic microscopy to
evaluate
pffiffiffi the G ratio. This was calculated using the equation
G 5 Rr , where r is the internal axonal radius, and R is the total 2.9. Primary culture of dorsal root ganglia neurons
axonal radius.
Lumbar dorsal root ganglia (DRG L1-L6) were rapidly
dissected out from euthanized adult male C57Bl6J (Janvier
2.6. Quantitative Polymerase Chain Reaction Lab, at least 8 weeks of age) and ASIC32/2 mice, and placed in
cold Ca-free/Mg-free HBSS medium (Corning) supplemented
At days 14 and 28, 4 to 6 mice from each of the different groups
with 10 mM glucose and 5 mM 2-[4-(2-Hydroxyethyl)-1-
(LPC16:0 10 nmol at days 14 and 28, CFA only at day 14 or vehicle at
piperazinyl]-ethanesulfonic acid (HEPES, pH 7.5 with NaOH).
days 14 and 28) were terminally anesthetized using a mixture of
After removing the roots, DRGs were enzymatically dissoci-
ketamine/xylazine, and ankle joints were dissected out and muscles
ated at 37˚C for 2 3 20 minutes in the HBSS solution
and tendons trimmed. Samples were then flash frozen in liquid
supplemented with calcium (CaCl2 5 mM) and containing
nitrogen and stored at 280˚C until use. Frozen joints were pulverized
collagenase type II (Gibco, ThermoFisher, Les Ulis, France)
with a biopulverizer (BioSpec, Bartlesville, OK) followed by RNA
and dispase (Gibco, France). Dorsal root ganglia were then
extraction with TRIzol using Tissue Lyser II (30 Hz frequency for 2
mechanically triturated and washed in a complete neurobasal A
minutes with 2 cycles, Qiagen, Hilden, Germany). Equal amounts of
(NBA) medium (Gibco Invitrogen supplemented with 2% B27, 2 mM
RNA from each sample were reverse transcribed in 20 mL to
L-glutamine and 1% antibiotics: penicillin 1 streptomycin, Lonza
produce complementary DNA (cDNA) using High Capacity cDNA
BioWhittaker), before being plated in 35-mm petri dishes. Neurons
Reverse Transcription Kit (Applied Biosystems, Foster City, CA)
were then kept in culture at 37˚C for 1 week with one-third of the
following the manufacturer’s recommendation. SYBR Green–based
culture medium renewed every 2 days (complete NBA supplemented
detection was carried out on a real-time polymerase chain reaction
with 10 ng/mL NT3, 2 ng/mL glial cell line-derived neurotrophic factor
instrument (Biorad CFX96 Touch, France) for Il6 (Interleukin-6; F-
(GDNF), 10 ng/mL brain-derived neurotrophic factor (BDNF), 100 ng/
ACCGCTATGAAGTTCCTCTC, R-GTATCCTCTGTGAAGTCTCCTC),
mL nerve growth factor (NGF) and 100 nM retinoic acid) and were
Tnf (tumor necrosis factor; F-GACCCTCACACTCAGATCATCTTCT,
used for patch clamp experiments at least 2 days after plating.
R-CCTCCACTTGGTGGTTTGCT), Apc5 (tartrate-resistant
acid phosphatase; F-CACATAGCCCACACCGTTCTC, R-
TGCCTACCTGTGTGGACATGA), and Tnfsf11 (receptor activator of 2.10. Patch clamp experiments
nuclear factor kappa-B ligand; F-TCTCAGATGTCTCTTTTCGTCCAC,
The whole-cell configuration of the patch clamp technique was
R- CTCAGTGTCATGGAAGAGCTG). In each experiment, samples
used to record either membrane currents (voltage clamp) or
were assayed in triplicate. Data were analyzed using the threshold
membrane potentials (current clamp). The patch pipettes were
cycle (Ct) relative quantification method. Relative quantities were
made by heating and pulling borosilicate glass tubes (Hilgenberg,
determined using the equation: RQ 5 2 2 DDCt . RNA 18S (F-
Malsfeld, Germany) with a vertical P830 puller (Narishige, Tokyo,
GCCGCTAGAGGTGAA, R-CATTCTTGGCAAATG) was used as
Japan), so that the pipette resistances were comprised between
housekeeping gene.
3 and 7MV. Patch pipettes were filled with an intracellular solution
containing either 135 mM KCl, 2.5 mM ATP-Na2, 2.1 mM CaCl2,
5 mM EGTA, 2 mM MgCl2, 10 mM HEPES, pH 7.3 with KOH for
2.7. In vivo imaging
DRG neurons or 135 mM KCl, 5 mM NaCl, 5 mM EGTA, 2 mM
Inflammation and bone remodeling were assessed in vivo using an MgCl2, 10 mM HEPES, pH 7.3 with KOH for HEK cells. Cells were
IVIS Spectrum small animal imaging system (Perkin Elmer, Waltham, bathed into an extracellular solution made of 145 mM NaCl, 5 mM
MA). Each mouse received 2 nmol of MMPSense 680 (150 mL; Perkin KCl, 2 mM CaCl2, 2 mM MgCl2, and 10 mM HEPES for HEK cells,
Elmer) or Cat K 680 FAST (100 mL; Perkin Elmer) by intravenous route and this medium was supplemented with 10 mM glucose for DRG
at day 7 and day 14, after LPC16:0 (10 nmol) or vehicle, to assess neurons. pH of extracellular solutions were adjusted to different
inflammation and bone remodeling, respectively (n 5 5 in each values with NMDG-Cl, including the control pH 7.4 solution and
group). Six hours or 24 hours later for Cat K 680 or MMP680, the test pH 6.6 solution. During patch-clamp recordings, the cell
respectively, acquisition was performed under isoflurane anesthesia under investigation was continuously superfused with extracel-
(1.5%). Imaging was performed using the ex/em 5 675/720 nm lular solutions using a homemade 8-outlet system digitally
band-pass filters. Quantification analysis was performed with Living controlled by solenoid valves (Warner Instruments, Hamden,
Image Software (Perkin Elmer) using fixed-sized rectangular ROI CT), allowing rapid changes of the immediate cell environment
focused on ipsilateral or contralateral tibiotarsal joint of the hind paws. from control to test solutions. Electrophysiological signals
Results are presented as the total counts of radiance efficiency generated by patch-clamped cells were amplified and low-pass
2004
·
filtered at 2 kHz using an Axopatch 200B amplifier (Molecular compared with control specimens (35.2 6 2.4 mM vs 16.3 6
Devices, Berkshire, United Kingdom), digitized with a 1550 A-D/ 1.5 mM; Fig. 1B). Correlation studies were conducted between
D-A converter (Molecular Devices), sampled at 20 kHz and stored LPC16:0 concentrations and pain outcomes, including VAS (global
on a computer using Clampex software (V10.7, Molecular and knee VAS) and KOOS, with data adjusted for patients’ age,
Devices). Analyses of these electrophysiological signals were gender, BMI, and synovial fluid IL-6 level (supplementary table 2,
then made offline using Clampfit software (V10.7, Molecular available at http://links.lww.com/PAIN/B579). Significant correla-
Devices). GFP1 HEK cells were considered as positively trans- tions between LPC16:0 concentrations and pain (VAS) were
fected when the peak amplitudes of pH6.6-evoked ASIC1a or observed (P 5 0.016 or P 5 0.031 for VAS knee and VAS global,
ASIC3 currents were $ 200 pA. Nontransfected cells corre- respectively, supplementary table 2, available at http://links.lww.
sponded to GFP2 cells with a pH6.6-evoked current , 200 pA. com/PAIN/B579), and an inverse correlation with KOOS question-
Dorsal root ganglia neurons were considered as ASIC1 when naire almost reached statistical significance (P 5 0.060, supple-
they exhibited a transient pH6.6-evoked current with a peak mentary table 2, available at http://links.lww.com/PAIN/B579).
amplitude $ 20 pA; otherwise, they were considered as ASIC2. Including or excluding IL-6 levels in the analysis of variance did not
have drastic impact on the association between LPC16:0 and pain
2.11. In vivo electrophysiological recordings of spinal dorsal measures (P 5 0.016/0.019, P 5 0.031/0.066 and P 5 0.060/
horn neurons 0.080 for VAS knee, VAS global and KOOS, respectively). In line
with this, there were no significant correlations between LPC16:
Single unit extracellular recordings of lumbar dorsal horn neurons 0 and IL-6 levels in synovial fluids (supplementary table 2, available
were made using tungsten paralyn-coated electrodes (0.5MV at http://links.lww.com/PAIN/B579), indicating that LPC16:0 in-
impedance, WPI, Hertfordshire, United Kingdom). The tip of a volvement in patient pain outcomes was not associated to an IL-
recording electrode was initially placed at the dorsal surface of the 6–dependent inflammation in this first OA cohort. Previously, OA
spinal cord using a micromanipulator (M2E, France), and this symptom severity in this cohort, including pain, correlated with IL-6
initial position corresponded to 0 mm on the micromanipulator’s levels in the synovial fluid but was inversely associated to IL-6 levels
micrometer. The electrode was then progressively moved down in the cerebrospinal fluid.26
into the dorsal horn until the receptive field of a spinal neuron was We next assessed whether increase of LPC16:0 knee synovial
localized on the ipsilateral plantar hind paw using mechanical fluid levels could be the hallmark of painful joint pathologies
stimulations including nonnoxious brushing and noxious pinch- associated with inflammation in a second heterogeneous cohort of
ing. In this study, experiments were focused on 2 types of spinal patients with different joint diseases (Figs. 1C and D; supplemen-
neurons that were distinguished as follow: (1) low threshold (LT) tary table 3, available at http://links.lww.com/PAIN/B579). The
neurons only responding to non-noxious sensory stimulations data from these 50 patients, irrespective of the disease, showed a
and (2) high-threshold (HT) neurons that dynamically respond to distribution of LPC species (Fig. 1C) similar to the first OA cohort
noxious stimulations. The depth of spinal neurons recorded in this (Fig. 1B), with a total LPC concentration of 93.6 6 6.7 mM (Fig. 1C,
study was 80 6 16 mm (range from 10 to 228 mm) and 202 6 inset), significantly higher than control specimens (Fig. 1A, P 5
21 mm (range from 10 mm to 571 mm) for LT and HT neurons, 0.0007, unpaired t test). Lysophosphatidylcholine 16:0 was also
respectively. Activities of neurons were sampled at 20 kHz, the major contributor to this elevated LPC level, with an average
filtered (0.3-30 kHz band pass) and amplified using a DAM80 concentration of 41.9 6 3.1 mM (Fig. 1C) significantly higher than
amplifier (WPI, Europe), digitized with a A/D-D/A converter (1401 control specimens (Fig. 1B, P 5 0.0006, unpaired t test). When the
data acquisition system, Cambridge Electronic Design, Cam- analysis was made according to the patients’ diseases (Fig. 1D
bridge, United Kingdom), and recorded on a computer using and supplementary Fig. 1, available at http://links.lww.com/PAIN/
Spike 2 software (Cambridge Electronic Design). B579), LPC16:0 levels in the different subgroups of patients were
similar, except a difference between CCA and SPA patients.
2.12. Statistical analysis Importantly, OA patients from this second cohort displayed an
elevated level of LPC16:0 similar to the first OA cohort and
Data are presented as mean 6 SEM. Significant differences
significantly different from control specimens (Fig. 1D, inset).
between the data sets are evaluated using P values, which were
calculated using either parametric or nonparametric tests followed
by adequate post hoc tests (see figure legends). Statistical analyses 3.2. Intra-articular LPC16:0 injections induce persistent pain
were performed using GraphPad Prism software. Association and anxiety-like behaviors in mice
between VAS knee, VAS global, KOOS, and LPC16:0 content was As LPC16:0 concentration was higher in the synovial fluids of joint
assessed using analysis of variance using age, gender, BMI, and IL- pain patients (Fig. 1), we investigated its potential pronociceptive
6 as covariates. The analysis was performed using R 3.6.3. and associated anxiogenic effects in mice. Two ankle intra-
Differences between sets of data and correlations were considered articular injections of LPC16:0 were made 5 days apart (Figs.
significant when P values were less or equal to 0.05. 2A–E and supplementary Fig. 2, available at http://links.lww.
com/PAIN/B579), and a single ankle CFA injection was used as a
3. Results positive control. The dose of LPC16:0 injected (10 nmol)
corresponded to the amount of lipids we had previously shown
3.1. Patients with painful joint diseases exhibit high levels of to generate acute pain-like behaviors following intraplantar
knee synovial LPC16:0
injection in mice,32 and it was in the lower range of quantities
The knee synovial fluids of 35 OA patients from a first cohort assessed here in patient synovial fluids. The first LPC16:0 injection
(supplementary table 1, available at http://links.lww.com/PAIN/ induced short-lasting ipsilateral mechanical allodynia compared
B579) displayed significantly higher concentrations of LPC with vehicle, whereas the second injection led to a long-lasting
compared with control specimens (77.4 6 5.0 mM and 40.0 6 mechanical allodynia until the end of the protocol (day 28), which
3.4 mM, respectively; Fig. 1A), with LPC16:0 being the most remained ipsilateral, similar to CFA (Fig. 2B and supplementary
represented species and the only one significantly increased Fig. 2A, available at http://links.lww.com/PAIN/B579) and
October 2022
· Volume 163
Figure 1. Levels of LPC16:0 are increased in synovial fluids of patients suffering from joint pain. Quantifications of LPC species were performed in knee human
synovial fluid (HSF) samples. Total lipids were extracted from HSF samples and analyzed by direct infusion in mass spectrometry (MS) using an electrospray
ionization source (ESI) in the positive ion mode (see “Methods” section for details). (A) Comparison of total LPC concentrations (mM) between a first cohort of
patients with osteoarthritis (OA, n 5 35 patients) and postmortem control subjects (n 5 10), showing significantly higher levels of LPC in patients compared with
control specimens (***P 5 0,0003, unpaired t test). (B) Distribution of the different LPC species concentrations (mM) in the HSF of OA patients and postmortem
control specimens. Although mean concentrations of most LPC species were higher in the HSF of OA patients, LPC16:0 was the most abundant and the only one
to be significantly elevated compared with postmortem control subjects (***P , 0.0001, 2-way ANOVA followed by a Sidak multiple comparison test). (C)
Distribution of the different LPC species concentrations (mM) in the HSF of a second cohort of patients suffering from different joint pathologies (n 5 50), showing
significantly higher level of LPC16:0 compared with the others species (****P , 0.0001, One-way ANOVA followed by a Dunnet multiple comparison test). Inset:
Total LPC concentration in HSF of the second cohort of patients. (D) LPC16:0 concentrations in the different subgroups of patients from the second cohort:
rheumatoid arthritis (RA, n 5 6), gout (n 5 5), CCA (n 5 12), psoriatic arthritis (n 5 4), SPA (n 5 5), and OA (n 5 18). The LPC16:0 concentrations in all the different
subgroups of patients are comparable, except a difference between CCA and SPA (*, P , 0.05, Kruskal–Wallis test followed by a Dunn multiple comparison test).
Inset: LPC16:0 concentrations in HSF of OA patients from the first and second cohort are similar and higher than control postmortem (***P , 0.001 and ****P ,
0.0001, 1-way ANOVA followed by a Tukey multiple comparison test). ANOVA, analysis of variance; CCA, chondrocalcinosis; HSF, human synovial fluid; LPC,
lysophosphatidylcholine; OA, osteoarthritis; SPA, spondyloarthritis.
consistent with models based on local intra-articular injections in increased thigmotactism. This is in good agreement with what
mice. The second injection was also associated to weight- was shown previously on locomotor impairments following CFA
bearing deficit and thermal hyperalgesia (Fig. 2C and supple- intraplantar injections.42 The development of anxiety-like behav-
mentary Fig. 2B, available at http://links.lww.com/PAIN/B579). iors was demonstrated in both LPC16:0 and CFA groups in the
Importantly, the effect of intra-articular LPC16:0 was not due to its EPM, hole board, and marble burying tests (Fig. 2G, supple-
conversion to LPA by autotaxin because neither cotreeatment nor mentary Fig. 2D–E, available at http://links.lww.com/PAIN/B579)
posttreatment with an autotaxin inhibitor (S32826) altered its and was associated to increased neuronal activity within the
pronociceptive effect (Figs. 2D and E). Because joint pain is often amygdala (supplementary Fig. 3, available at http://links.lww.
associated with comorbidities such as anxiety,36 we therefore com/PAIN/B579).
assessed anxiety-like behaviors in our model of LPC16:0-
induced persistent joint pain at days 19 to 23 (Figs. 2F and G
3.3. Intra-articular LPC16:0 does not cause peripheral nerve
and supplementary Fig. 2C-E, available at http://links.lww.com/
sprouting, inflammation, or bone alterations
PAIN/B579). LPC16:0 or CFA induced a significant decrease in
the time spent in the center of an open field without any locomotor No peptidergic nerve fibers sprouting (CGRP staining, Fig. 3A)
impairment (Fig. 2F and supplementary Fig. 2C), indicating nor cell infiltration (CD681 macrophage lineage cells influx,
2006
·
Fig. 3B) were observed in the joint of LPC16:0 mice compared 0 knee injections (supplementary Fig. 6F, available at http://links.
with control at day 28. When potential LPC16:0-induced joint lww.com/PAIN/B579). When mechanical thresholds were
inflammation was evaluated, no fluorescence increase of the assessed with the dynamic plantar aesthesiometer test,
MMP680 matrix metalloprotease marker was observed at day 7 LPC16:0 knees injections (20 nmol) also induced long-lasting
in the ipsilateral joint of LPC16:0 mice compared with the ipsilateral allodynia in both male and female wild-type mice,
contralateral joint and control mice (Fig. 3C). A potential LPC16: which was clearly secondary to the injection site (Fig. 6C,
0-induced bone remodeling was also investigated and no supplementary Fig. 6G, available at http://links.lww.com/PAIN/
increase in the cathepsin K activity was detected at day 14 in B579). As for the ankle joint, LPC16:0 knee injection–induced
the ipsilateral joints of LPC16:0 mice compared with the pain was significantly reduced in both male and female ASIC32/2
contralateral ones and control mice (Fig. 3D). In good agreement mice compared with WT (Fig. 6D). This long-lasting pain state
with these observations, II6 and Tnf messenger RNA levels in the was also significantly reduced in male WT when APETx2, an
ipsilateral joint of LPC16:0-injected mice were similar to controls ASIC3 blocker,10,32 was coinjected with LPC16:0 either at the
at days 14 and 28, whereas an increase was observed in CFA first or the second administration, further supporting an effect
mice, as expected (Figs. 3E and F). Finally, Apc5 and Tnfsf11 primarily mediated through peripheral ASIC3 activation (Fig. 6E).
messenger RNA levels in the joints of LPC16:0 mice were also Finally, 2 LPC16:0 intra-articular injections were necessary to
similar to control at days 14 and 28 (Figs. 3G and H). These induce persistent pain as for the ankle (supplementary Fig. 6H,
results indicate no change in peripheral nerve sprouting, bone available at http://links.lww.com/PAIN/B579). These results
alterations, or apparent inflammation following intra-articular support a similar LPC-induced ASIC3-dependent persistent pain
LPC16:0 in the subacute and chronic stages of pain behaviors. state upon 2 intra-articular knee or ankle injections of LPC16:0,
suggesting a central sensitization process. The activity of spinal
dorsal horn neurons was therefore recorded in vivo following
3.4. The in vivo pronociceptive effects of LPC16:0 are largely LPC16:0 knee injections in WT mice (Figs. 6F–H). Electrophys-
dependent on acid-sensing ion channel 3 in a sex- iological recordings clearly demonstrated a sensitization of spinal
independent manner
HT but not LT neurons associated to LPC16:0 knee injections,
LPC16:0 activated rat and human ASIC3 in transfected HEK293 which correlated with persistent secondary allodynia.
cells32 (supplementary Fig. 4A–C, available at http://links.lww.
com/PAIN/B579) and induced an ASIC3-dependent depolarizing
4. Discussion
current in mouse DRG neurons (Figs. 4A–D). The in vivo
involvement of this channel in pain and anxiety-like behaviors Here, we identify LPC16:0 as the major LPC species in HSFs and
following intra-articular LPC16:0 injections was thus investigated a critical trigger of chronic joint pain through peripheral ASIC3
using wild-type (ASIC31/1) and ASIC3-knockout (ASIC32/2) channel activation in mice. Compared with control specimens,
mice (Fig. 5 and supplementary Fig. 5, available at http://links. the knee synovial fluids from a first cohort of OA patients
lww.com/PAIN/B579). LPC16:0 injections induced long-lasting displayed an elevated LPC16:0 content, which correlated with
mechanical allodynia and thermal hyperalgesia in both male and their knee and global pain (VAS knee and VAS global), regardless
female ASIC31/1 mice, indicating no sex dimorphism (fig. 5A-B of age, gender, BMI, and IL-6 synovial fluid levels. Correlation with
and supplementary Fig. 5A-B, available at http://links.lww.com/ knee injury and osteoarthritis outcome score (KOOS) almost
PAIN/B579). These pain behaviors were significantly reduced in reach statistical significance (P 5 0.060). This absence of a
both male and female ASIC32/2 mice. The persistent LPC16:0- statistically significant correlation can be explained by the more
induced pain state was also associated to anxiety-like behaviors holistic nature of the patient’s overall OA experience assessed by
assessed between days 19 and 23 in male and female ASIC31/1 this questionnaire. A specific increase in LPC16:0 content was
mice, which were significantly reduced in ASIC32/2 mice, as further confirmed in a second cohort of patients with different joint
shown in the EPM and marble burying tests (Fig. 5C-F). Finally, diseases, including OA but also other pathologies such as RA,
LPC16:0 did not alter locomotor behaviors in both ASIC31/1 and suggesting that LPC is probably not the hallmark of a particular
ASIC32/2 mice at day 20 (supplementary Fig. 5C, D, available at joint pathology. Previous works also reported an increase in
http://links.lww.com/PAIN/B579). Thus, the development of plasma and/or synovial LPC contents in OA and RA pa-
LPC16:0-induced pain and associated anxiety-like behaviors tients27,28,57 but without any information on its possible
were mediated by ASIC3 in both sexes. contribution to chronic joint pain.
We demonstrate that ankle or knee intra-articular administra-
tions of LPC16:0 in mice led to the development of chronic pain
3.5. LPC16:0 injections into mouse knee joint also produce as well as anxiety-like behaviors, independently of the LPC-to-
persistent pain-like behaviors, which are associated to spinal LPA conversion by autotaxin, excluding a role of LPA in these
neuron sensitization
effects. Our data support a direct role of LPC16:0 as a triggering
LPC16:0 was injected into mouse knee joint to determine factor of pain-like behaviors in this new preclinical model of
whether the results obtained with the ankle can be extended to persistent joint pain. Because the levels of LPC16:0 correlated
other joints (Fig. 6 and supplementary Fig. 6, available at http:// with pain outcomes in OA patients, these data could be also
links.lww.com/PAIN/B579). Mice injected in the knee (Fig. 6A) relevant in humans. The persistent pain state in mice did not seem
with LPC16:0 at 10 or 20 nmol developed dose-dependent to be associated with nerve sprouting, demyelination, or in-
mechanical allodynia (Fig. 6B), weight-bearing deficit, and flammatory processes because no changes in CGRP joint
thermal hyperalgesia (supplementary Fig. 6A and B, available at staining, nerve fiber G ratio, in vivo metalloprotease activity, or
http://links.lww.com/PAIN/B579), associated with anxiety-like expression of TNF and IL-6 were observed in joints following
behaviors (supplementary Fig. 6C and D) not because of LPC16:0 administrations. Hung et al.18 also failed to observe any
locomotor impairment (supplementary Fig. 6E, available at inflammatory signs following intramuscular administration of
http://links.lww.com/PAIN/B579). We also did not observe any LPC16:0 in mice. The elevated level of LPC, especially LPC16:
saphenous nerve demyelination33,47 following 20 nmol of LPC16: 0, in the synovial fluid of OA patients could therefore explain why
October 2022
· Volume 163
Figure 2. Lysophosphatidylcholine injections into mouse ankle joints produce long-lasting pain-like behaviors associated with anxiety-related behaviors. (A)
Timeline of the experimental procedures used. (B) Effect of intra-articular ankle injections of LPC16:0 (10 nmol), CFA or vehicle (Veh) on mechanical allodynia in
male mice. Ipsilateral mechanical paw withdrawal threshold was assessed using the up and down method with von Frey filament from D1 to D28. Results are
expressed as 50% mechanical threshold (n 5 8-16 mice per group; ****P , 0.0001 for Veh vs CFA; ###P , 0.001 and ####P , 0.0001 for Veh vs LPC16:0; &&P ,
0.01 and &&&&P , 0.0001 for CFA vs LPC16:0; 2-way ANOVA followed by a Tukey post hoc test). (C) Effect of intra-articular injections of LPC16:0 (10 nmol), CFA or
vehicle on weight-bearing in male mice. Results are expressed as the weight ratio between the ipsilateral and contralateral hind paws (n 5 8 mice per group; ****P
, 0.0001 for Veh vs CFA; ###P , 0.001 and ####P , 0.0001 for Veh vs LPC16:0; &&P , 0.01, &&&P , 0.001, and &&&&P , 0.0001 for CFA vs LPC16:0; 2-way
ANOVA followed by a Tukey post hoc test). (D) The autotaxin inhibitor S32826 (ATXi) was co-injected at the dose of 10 nmol with LPC16:0 (10 nmol, I1) and
mechanical paw withdrawal thresholds were assessed from 30 to 240 minutes post injection (n 5 8 mice per group, *P , 0.05 and ****P , 0.0001, 2-way ANOVA
followed by a Tukey post hoc test). (E) S32826 was injected at D10, ie, after the 2 injections of LPC16:0 (10 nmol) 5 days apart (I1/I2), in the same ankle joint, and
mechanical paw withdrawal thresholds were assessed at 30 and 60 minutes post injection (n 5 8 per group, *P , 0.05 and ****P , 0.0001, 2-way ANOVA followed
by a Tukey post hoc test). (F–G) Effect of intra-articular injections of LPC16:0 (10 nmol), CFA or vehicle on the time spent in the center of an open field test at D20 (F)
and on the time spent in the open arms in the elevated plus maze test at D23 (G). The open field and elevated plus maze test lasted 5 minutes and the time spent in
the center and the open arms, respectively, was automatically calculated using Ethovision XT 13 (Noldus). One-way ANOVA followed by Tukey post hoc tests with
**P , 0.01, ***P , 0.001, and ***P , 0.0001 (n 5 8 mice per group). ANOVA, analysis of variance; CFA, complete Freund adjuvant; LPC, lysophosphatidylcholine.
2008
·
Figure 3. LPC16:0 injections into mouse ankle are not associated to peripheral nerve sprouting, inflammation, nor bone alterations. (A–B) Analysis of CGRP and
CD68 expression in the ipsilateral tibiotarsal joint at D28, following intra-articular administrations of LPC16:0 (10 nmol) or vehicle in male mice. Top, representative
photomicrographs of CGRP (A) and CD68 (B) staining in vehicle and LPC16:0-treated mice. Bottom, quantification of CGRP-positive fibers (A) in 2 ROIs (570 3
570 mm) and of CD68-positive cells (B) in one ROI (2500 3 2500 mm) from the ipsilateral tibiotarsal joint of vehicle and LPC16:0-injected mice. Results are
expressed as a mean intensity (n 5 4 for each group, no significant differences, Mann–Whitney tests). (C–D) Evaluation of the effect of LPC16:0 (10 nmol) or vehicle
on inflammation and bone remodeling using in vivo fluorescent imaging for metalloprotease (MMP680) activity at D7 (C) and cathepsin K activity at D14 (D),
respectively, in the ipsilateral and contralateral hind paws of male mice. Upper panels, illustrations; Lower panels, MMP680 ratio quantification (C) and cathepsin K
activity ratio quantification (D). Data from n 5 5 animals per group (no significant differences, Kruskal–Wallis tests followed by Dunn multiple comparison tests).
(E–H) Relative levels of IL6 (E), Tnf (F), Apc5 (TRAP) (G), and Tnfsf11 (RANK-L) (H) messenger RNA expressed in the ipsilateral joint, determined by quantitative
polymerase chain reaction after intra-articular injections of LPC16:0 (10 nmol, D14 and D28), CFA (D14), and vehicle (D14/D28; n 5 4-6 for each group, **P , 0.01,
Kruskal–Wallis tests followed by Dunn multiple comparison tests). CFA, complete Freund adjuvant; LPC, lysophosphatidylcholine; ROI, region of interest.
they still suffered from chronic joint pain despite well controlled expression of TRAP and RANK-L was observed in our model,
inflammation and possibly even in the absence of it, as supported indicating that LPC16:0 also did not lead to bone alterations/
here by the lack of correlation between LPC16:0 and IL-6 levels in remodeling, which could contribute to chronic joint pain as
patient synovial fluids. No change in cathepsin K activity and joint already suggested in rheumatic diseases such as OA34,40,58 and
October 2022
· Volume 163
Figure 4. LPC16:0 induces a noninactivating, ASIC3-dependent current associated with membrane depolarization in mouse DRG neurons. Whole-cell patch
clamp experiments performed on WT and ASIC3 knockout (A3KO) DRG neurons expressing (ASIC1) or not expressing (ASIC2) a pH6.6-evoked ASIC current.
(A–B) Native pH6.6-evoked ASIC currents recorded at 280 mV in DRG neurons from wild-type (WT ASIC1, A) and ASIC3-knockout (A3KO ASIC1, B) mice. Insets
show the effect of LPC16:0 (5 mM) applied for 30 seconds on the same neurons. (C) Analysis of the current densities measured after 10-, 20-, and 30-second
applications of LPC16:0 onto WT ASIC1, WT ASIC2, A3KO ASIC1, and A3KO ASIC- neurons (see methods, n 5 7-16; ****P , 0.0001 compared with WT ASIC-,
####
P , 0.0001 compared with A3KO ASIC1 and &&&&P , 0.0001 compared with A3KO ASIC-; Three-way ANOVA followed by a Tukey multiple comparison test).
Inset shows the AUC calculated over 30-second period from the baseline fixed at 0 (n 5 7-16, **P , 0.01, 1-way ANOVA followed by a Tukey multiple comparison
test). (D) Membrane potential changes associated with 30-second application of LPC16:0 on WT ASIC1, WT ASIC2, A3KO ASIC1, and A3KO ASIC- neurons (n
5 7-19; **P , 0.01, ***P , 0.001, and ****P , 0.0001, 1-way ANOVA followed by a Tukey multiple comparison test). ANOVA, analysis of variance; ASIC3, acid-
sensing ion channel 3; DRG, dorsal root ganglia; LPC, lysophosphatidylcholine; WT, wild‐type.
RA.24 This might explain the lack of clear correlation between joint Both inflammatory and noninflammatory components could
damage and pain in OA.3,16 therefore participate in systemic pain and its chronicity in
Chronic joint pain associated with rheumatic diseases is rheumatic diseases, but their respective contributions and/or
generally considered to be mainly under inflammatory condition. triggering roles still remain to be determined. In addition, our data
However, there is a frequent disconnect between disease activity indicate that intra-articular LPC16:0 administrations are not
such as inflammation and chronic joint pain especially in RA.29 associated to joint inflammatory processes in the subacute stage
Indeed, despite the success of conventional disease-modifying of pain behaviors, but we cannot completely rule out an effect of
antirheumatic drugs, alone or in combination with biologic inflammation in the hyperacute stage following intra-articular LPC
agents, on disease activity, a significant number of patients still injection.
complain from persistent pain, and more than 60% are not The pronociceptive effects of LPC16:0 following joint admin-
satisfied by their pain management.37,49 In addition, joint pain is istration in mice are dependent on peripheral ASIC3 channel in a
an early marker of an emerging RA before any evident sign of sex-independent manner. Indeed, both pain and anxiety-like
inflammation.6 This discrepancy between disease activity and behaviors were significantly reduced in both male and female
pain indicates that synovitis is not the only driver of joint pain at ASIC3 KO mice, or following local pharmacological inhibition of
least in RA1,25 but that additional mechanisms are at play. Our these channels. The contribution of ASIC3 in the development of
LPC-induced chronic joint pain model in mice is actually not a pain-like behaviors evoked by LPC16:0 appeared to be more
model of rheumatic disease per se because it is not associated pronounced following injections into the knee than into the ankle
with any evident signs of inflammation nor joint damages, but of mice. Such a difference might illustrate a predominant role of
rather a model of joint pain (arthralgia), one of the main symptoms ASIC3 in the development of secondary hypersensitivity, as
of rheumatic diseases. We show that LPC within joints is a critical proposed previously.20,44 Because pain measurements were
triggering factor of pain but is not sufficient by itself to mimic the taken at the plantar level, they were clearly associated to
whole clinical status of a particular rheumatic disease. This latest secondary pain following knee injections; however, they more
point is actually an advantage because it allows identification of a likely reflected a mixture of primary and secondary pain for ankle
new potential noninflammatory nociceptive pathway in rheumatic injections. ASIC3, which was constitutively activated by LPC16:
diseases besides the well-described inflammatory mechanisms. 0 in cultured DRG neurons, induced a sustained membrane
2010
·
Figure 5. Acid-sensing ion channel 3 is crucial for the development of both pain and anxiety-like behaviors induced by LPC16:0 injections into mouse ankle joints
of male and female mice. Time course effect of intra-articular ankle injections of LPC16:0 (10 nmol) or vehicle in male (A) or female (B) ASIC31/1 and ASIC32/2
mice. Mechanical paw withdrawal threshold was assessed using the up and down method with von Frey filaments from D1 to D28 and from D1 to D26, for male
and female mice, respectively (n 5 7-8 mice per group, ****P , 0.0001 for ASIC31/1 Veh vs ASIC31/1 LPC16:0; #P , 0.05, ##P , 0.01, ###P , 0.001, and ####P ,
0.0001 for ASIC32/2 LPC16:0 vs ASIC31/1 Veh (♂) or ASIC32/2 Veh (♀); &&P , 0.01 and &&&&P , 0.0001 for ASIC31/1 LPC16:0 vs ASIC32/2 LPC16:0; 2-way
ANOVA followed by Tukey post hoc tests). In (A), both male ASIC31/1 and male ASIC32/2 mice (Supplementary Fig. 5E, available at http://links.lww.com/PAIN/
B579), did not exhibit any changes in mechanical paw withdrawal threshold following vehicle injections. (C–F) Effect of intra-articular ankle injections of LPC16:
0 (10 nmol) or vehicle on the time spent in the open arm in the elevated plus maze test at D23 (C–D), on the number of buried marble in the marble burying test at
D19 (E–F), in male (C–E) or female (D–F) ASIC31/1 and ASIC32/2 mice. The elevated plus maze test lasted 5 minutes and the time spent in the open arm was
automatically calculated using Ethovision XT 13 (Noldus). The marble burying test lasted 30 minutes and was analyzed by a blind experimenter (n 5 7-8 mice per
group, *P , 0.05, **P , 0.01, and ****P , 0.0001, 1-way ANOVA followed by Tukey post hoc tests). ANOVA, analysis of variance; LPC, lysophosphatidylcholine.
depolarization similar to the ASIC3-dependent depolarization we in sensory nerve endings of deep tissues appears to be a key step
already shown to sensitize these neurons.8 It is thus very likely that for the development of chronic pain. The effect of LPC16:0 on
intra-articular injections of LPC16:0 could drive an ASIC3- ASIC3 expressed in joint nociceptors probably results in the
dependent nociceptive input leading to a persistent pain state sensitization of dorsal horn neurons as supported by the
originating from joints. ASIC3 has been already associated to enhanced output of spinal HT nociceptive, but not LT, neurons.
long-lasting pain states following repeated acid injections in Central sensitization was also proposed to occur after repeated
rodent joints48 and muscles44 and more recently following LPC intramuscular injections of LPC16:0 in mice, which induced
injections in mouse muscle.18 The stimulation of ASIC3 channels increased expression of c-fos and pERK in spinal dorsal horn
October 2022
· Volume 163
Figure 6. Lysophosphatidylcholine knee injections generate persistent secondary mechanical allodynia associated with sensitization of spinal dorsal horn neuron
activity. (A) Timeline of the experimental procedures used. (B) Effect of intra-articular knee administrations of LPC16:0 (10 and 20 nmol), or vehicle (Veh) on
mechanical allodynia in the ipsilateral paw of male mice. Paw withdrawal thresholds (PWTs) were assessed using the up and down method with von Frey filament
from D1 to D21. Results are expressed as 50% mechanical thresholds (n 5 8 mice per group; *P , 0.05 and **P , 0.01 for LPC16:0 10 nmol vs Veh, ####P ,
0.0001 for LPC16:0 20 nmol vs Veh and &&P , 0.01 for LPC16:0 20 nmol vs LPC16:0 10 nmol; 2-way ANOVA followed by a Tukey post hoc test). (C) Ipsilateral paw
PWTs of female and male WT mice injected twice in the knees with LPC16:0 (20 nmol) or vehicle (Veh) were assessed using a dynamic plantar aesthesiometer (n 5
6 mice per group; *P , 0.05, ***P , 0.001, and ****P , 0.0001 for WT female Veh vs WT female LPC16:0; ####P , 0.0001 for WT male Veh vs WT male LPC16:0;
3-way ANOVA test followed by a Tukey multiple comparison test). (D) Ipsilateral PWTs of female and male, WT and ASIC32/2 mice injected twice with LPC16:0 (n
5 5-18 mice per group; *P , 0.05, and **P , 0.01 for female WT LPC16:0 vs ASIC32/2 LPC16:0; ###P , 0.001, and ####P , 0.0001 for male WT LPC16:0 vs
ASIC32/2 LPC16:0; 3-way ANOVA test followed by a Tukey multiple comparison test). (E) Ipsilateral PWTs of male WT mice injected twice with LPC16:0 or vehicle,
with or without coinjection of APETx2 (0.1 nmol) at the first or the second injection (n 5 6-12 per group; ****P , 0.0001 for WT Veh vs WT LPC16:0; #P , 0.05, ###P
, 0.01, and ####P , 0.0001 for WT Veh 1 APETx2/Veh vs WT LPC16:0 1 APETx2/LPC16:0; &&P , 0.01, and &&&&P , 0.0001 for WT Veh/Veh1APETx2 vs WT
LPC16:0/LPC16:0 1 APETx2; 2-way ANOVA test followed by a Tukey multiple comparison test; $$$$P , 0.0001 for main effects on curves, 2-way ANOVA test
followed by a Tukey multiple comparison test). (F) Mean number of action potentials (APs) emitted by spinal low threshold neurons (LTNs) following light brushing of
their receptive fields, located on the plantar surface. Spinal LTN-evoked activities were not different whether they were recorded ipsilaterally or contralaterally to the
knees injected twice with LPC16:0 or vehicle (n 5 3-10 LTNs, no significant differences, Kruskal–Wallis test followed by a Dunn post hoc test). (G) Frequencies of
APs emitted by spinal HTNs following pinching (n 5 8-14 HTNs; **P , 0.01, ***P , 0.001, and ****P , 0.0001, 1-way ANOVA followed by a Tukey multiple
comparison test). (H) Mean number of APs evoked by spinal HTNs following application of von Frey filaments of increasing strength (n 5 8-14 HTNs; *P , 0.05,
***P , 0.001, and ****P , 0.0001 for ipsi LPC16:0 vs ipsi vehicle; #P , 0.05, ##P , 0.01, and ####P , 0.0001 for ipsi LPC16:0 vs Contra LPC16:0; $P , 0.05, $$P ,
0.01, $$$P , 0.001, and $$$$P , 0.0001 for ipsi LPC16:0 vs contra vehicle; 3-way ANOVA test followed by a Tukey multiple comparison test). ANOVA, analysis of
variance; ASIC3, acid-sensing ion channel 3; LPC, lysophosphatidylcholine; WT, wild type.
2012
·
neurons.18 Moreover, several clinical studies demonstrated the collected patient samples (Swedish cohort); A.S. Ahmed, performed
presence of central sensitization in OA patients.30 patient data and sample collection (Swedish cohort); E. Kosek, PI for
To conclude, LPC16:0 could be involved in joint pain from patient data and sample collection (Sweden) and critical reading of
different etiologies of inflammatory and noninflammatory origins the manuscript; K. Kultima and E. Freyhult helped in data analysis
and more generally across rheumatic musculoskeletal diseases. related to patients and critical reading of the manuscript; S. Khoury
However, it remains to be demonstrated whether an elevated and T. Ferreira conceived, designed and performed lipidomic
level of LPC16:0 could be used as an objective biomarker of experiments, and analyzed data; B. Labrum designed, performed
chronic joint pain across different etiologies. Our data bring both and analyzed behavioral experiments using the dynamic aesthesi-
human and rodent evidences for a crucial role of this lipid in ometer; K. Delanoe and L. Pidoux designed, performed and
chronic joint pain and identify LPC-activated ASIC3 channels as analyzed electrophysiological experiments; E. Lingueglia helped in
promising targets for chronic joint pain management. experimental design and critical reading of the manuscript; V. Breuil
coordinated the clinical aspects of the study (French cohort); E. Deval

conceived, designed, performed and analyzed experiments, and
Conflict of interest statement
wrote the manuscript. All authors participated in the critical reading of
E. Kosek reports grants from Donation from Lundblad family, the manuscript and give their consent for this final draft.
personal fees from Eli Lilly, personal fees from Sandoz, personal
fees from UCB Pharma, outside the submitted work. The
remaining authors have no conflicts of interest to declare. Appendix A. Supplemental digital content
Supplemental digital content associated with this article can be
Acknowledgements found online at http://links.lww.com/PAIN/B579.
The authors thank Drs A. Baron, S. Diochot, J. Noel, and
M. Salinas for helpful discussions, V. Friend and J. Salvi-Leyral Article history:
for technical support, and V. Berthieux for secretarial assistance. Received 14 September 2021
The authors also thank Tycho Tullberg, MD, PhD, CEO of Received in revised form 7 December 2021
Stockholm Spine Center during the data collection period for Accepted 8 December 2021
generous support and for providing research facilities at Available online 27 January 2022
Stockholm Spine Center. The authors thank orthopaedic
surgeons Ingemar Gladh and Per Gerdin for patient recruitment References
and taking tissue samples during surgery at Ortho Center, [1] Altawil R, Saevarsdottir S, Wedren S, Alfredsson L, Klareskog L, Lampa J.
Stockholm. Furthermore, the authors thank Carola Skärvinge, Remaining pain in early rheumatoid arthritis patients treated with
research nurse at Stockholm Spine Center for excellent logistic methotrexate. Arthritis Care Res (Hoboken) 2016;68:1061–8.
assistance and Azar Baharpoor, Department of Physiology and [2] Andersson DA, Nash M, Bevan S. Modulation of the cold-activated
channel TRPM8 by lysophospholipids and polyunsaturated fatty acids.
Pharmacology, Karolinska Insitutet for support and laboratory
J Neurosci 2007;27:3347–55.
assistance. [3] Barr AJ, Campbell TM, Hopkinson D, Kingsbury SR, Bowes MA,
This work was supported by the Centre National de la Recherche Conaghan PG. A systematic review of the relationship between
Scientifique (CNRS), the Institut National de la Santé et de la subchondral bone features, pain and structural pathology in peripheral
Recherche Médicale (INSERM), the Association Française contre joint osteoarthritis. Arthritis Res Ther 2015;17:228.
[4] Breivik H, Collett B, Ventafridda V, Cohen R, Gallacher D. Survey of
les Myopathies (AFM grant #19618), the Agence Nationale de la chronic pain in Europe: prevalence, impact on daily life, and treatment.
Recherche (ANR-11-LABX-0015-01 and ANR-17-CE16-0018) Eur J Pain 2006;10:287–333.
and the NeuroMod Institute of University Côte d’Azur (UCA). This [5] Castaneda-Corral G, Jimenez-Andrade JM, Bloom AP, Taylor RN, Mantyh
work was also supported by the Conseil Regional Auvergne- WG, Kaczmarska MJ, Ghilardi JR, Mantyh PW. The majority of myelinated
and unmyelinated sensory nerve fibers that innervate bone express the
Rhone-Alpes (project Ressourcement S3, Arth-Innov) and Feder
tropomyosin receptor kinase A. Neuroscience 2011;178:196–207.
as well as the French government IDEX-ISITE initiative 16-IDEX- [6] Catrina AI, Svensson CI, Malmstrom V, Schett G, Klareskog L.
0001 (CAP 20-25). The authors thank the multimodal imaging Mechanisms leading from systemic autoimmunity to joint-specific
platform IVIA and CICS, Clermont-Ferrand, France, for in vivo disease in rheumatoid arthritis. Nat Rev Rheumatol 2017;13:79–86.
imaging and electronic microscopy, respectively. The study has [7] Chaplan SR, Bach FW, Pogrel JW, Chung JM, Yaksh TL. Quantitative
assessment of tactile allodynia in the rat paw. J Neurosci Methods 1994;
also received funding from Stockholm County Council, Swedish 53:55–63.
research Council (K2013-52X-22,199-01-3), and Eli Lilly, USA. [8] Deval E, Baron A, Lingueglia E, Mazarguil H, Zajac JM, Lazdunski M.
The research leading to these results has also received funding Effects of neuropeptide SF and related peptides on acid sensing ion
from the European Union Seventh Framework Programme (FP7/ channel 3 and sensory neuron excitability. Neuropharmacology 2003;44:
662–71.
2007–2013) under grant agreement no. 602919 and from a
[9] Deval E, Lingueglia E. Acid-Sensing Ion Channels and nociception in the
generous donation from Leif Lundblad and family. peripheral and central nervous systems. Neuropharmacology 2015;94:49–57.
Author contributions: F. Jacquot, designed, performed and [10] Diochot S, Baron A, Rash LD, Deval E, Escoubas P, Scarzello S, Salinas M,
analyzed behavioral experiments as well as in vivo imaging; Lazdunski M. A new sea anemone peptide, APETx2, inhibits ASIC3, a major
L. Delay, A. Bayle performed and analyzed behavioral experiment; acid-sensitive channel in sensory neurons. Embo J 2004;23:1516–25.
[11] Dixon WJ. The up-and-down method for small samples. J Am Stat Assoc
J. Barbier performed and analyzed the electronic microscopy and 1965;60:967.
immunohistochemistry experiments; Y. Aissouni and A. Jurczak did [12] Flemming PK, Dedman AM, Xu SZ, Li J, Zeng F, Naylor J, Benham CD,
quantitative polymerase chain reaction experiments; D.A. Barriere Bateson AN, Muraki K, Beech DJ. Sensing of lysophospholipids by
helped in experimental design and critical reading of the manuscript; TRPC5 calcium channel. J Biol Chem 2006;281:4977–82.
[13] Folch J, Lees M, Sloane Stanley GH. A simple method for the isolation and
F. Marchand conceived, designed and analyzed behavioral exper-
purification of total lipides from animal tissues. J Biol Chem 1957;226:
iments and wrote manuscript; C.I. Svensson helped in quantitative 497–509.
polymerase chain reaction experiment, experimental design and [14] Gaskin DJ, Richard P. The economic costs of pain in the United States.
critical reading of the manuscript; A. Hugo, diagnosed patients and J Pain 2012;13:715–24.
October 2022
· Volume 163
[15] Gentry C, Stoakley N, Andersson DA, Bevan S. The roles of iPLA2, TRPM8 administered outcome measure. J Orthop Sports Phys Ther 1998;28:
and TRPA1 in chemically induced cold hypersensitivity. Mol Pain 2010;6:4. 88–96.
[16] Hannan MT, Felson DT, Pincus T. Analysis of the discordance between [39] Roos EM, Toksvig-Larsen S. Knee injury and Osteoarthritis Outcome
radiographic changes and knee pain in osteoarthritis of the knee. Score (KOOS)—validation and comparison to the WOMAC in total knee
J Rheumatol 2000;27:1513–17. replacement. Health Qual Life Outcomes 2003;1:17.
[17] Hsieh WS, Kung CC, Huang SL, Lin SC, Sun WH. TDAG8, TRPV1, and [40] Sagar DR, Ashraf S, Xu L, Burston JJ, Menhinick MR, Poulter CL, Bennett
ASIC3 involved in establishing hyperalgesic priming in experimental AJ, Walsh DA, Chapman V. Osteoprotegerin reduces the development of
rheumatoid arthritis. Sci Rep 2017;7:8870. pain behaviour and joint pathology in a model of osteoarthritis. Ann
[18] Hung CH, Lee CH, Tsai MH, Chen CH, Lin HF, Hsu CY, Lai CL, Chen CC. Rheum Dis 2014;73:1558–65.
Activation of acid-sensing ion channel 3 by lysophosphatidylcholine 16: [41] Sevastou I, Kaffe E, Mouratis MA, Aidinis V. Lysoglycerophospholipids in
0 mediates psychological stress-induced fibromyalgia-like pain. Ann chronic inflammatory disorders: the PLA(2)/LPC and ATX/LPA axes.
Rheum Dis 2020;79:1644–56. Biochim Biophys Acta 2013;1831:42–60.
[19] Husen P, Tarasov K, Katafiasz M, Sokol E, Vogt J, Baumgart J, Nitsch R, [42] Sheahan TD, Siuda ER, Bruchas MR, Shepherd AJ, Mohapatra DP,
Ekroos K, Ejsing CS. Analysis of lipid experiments (ALEX): a software Gereau RW IV, Golden JP. Inflammation and nerve injury minimally affect
framework for analysis of high-resolution shotgun lipidomics data. PLoS mouse voluntary behaviors proposed as indicators of pain. Neurobiol
One 2013;8:e79736. Pain 2017;2:1–12.
[20] Ikeuchi M, Kolker SJ, Burnes LA, Walder RY, Sluka KA. Role of ASIC3 in [43] Sluka KA, Gregory NS. The dichotomized role for acid sensing ion
the primary and secondary hyperalgesia produced by joint inflammation channels in musculoskeletal pain and inflammation. Neuropharmacology
in mice. PAIN 2008;137:662–9. 2015;94:58–63.
[21] Ikeuchi M, Kolker SJ, Sluka KA. Acid-sensing ion channel 3 expression in [44] Sluka KA, Price MP, Breese NM, Stucky CL, Wemmie JA, Welsh MJ.
mouse knee joint afferents and effects of carrageenan-induced arthritis. Chronic hyperalgesia induced by repeated acid injections in muscle is
J Pain 2009;10:336–42. abolished by the loss of ASIC3, but not ASIC1. PAIN 2003;106:229–39.
[22] Inoue M, Rashid MH, Fujita R, Contos JJ, Chun J, Ueda H. Initiation of [45] Sluka KA, Radhakrishnan R, Benson CJ, Eshcol JO, Price MP, Babinski
neuropathic pain requires lysophosphatidic acid receptor signaling. Nat K, Audette KM, Yeomans DC, Wilson SP. ASIC3 in muscle mediates
Med 2004;10:712–18. mechanical, but not heat, hyperalgesia associated with muscle
[23] Izumi M, Ikeuchi M, Ji Q, Tani T. Local ASIC3 modulates pain and disease inflammation. PAIN 2007;129:102–12.
progression in a rat model of osteoarthritis. J Biomed Sci 2012;19:77. [46] Sluka KA, Rasmussen LA, Edgar MM, O’Donnell JM, Walder RY, Kolker
[24] Kleyer A, Finzel S, Rech J, Manger B, Krieter M, Faustini F, Araujo E, SJ, Boyle DL, Firestein GS. Acid-sensing ion channel 3 deficiency
Hueber AJ, Harre U, Engelke K, Schett G. Bone loss before the clinical increases inflammation but decreases pain behavior in murine arthritis.
onset of rheumatoid arthritis in subjects with anticitrullinated protein Arthritis Rheum 2013;65:1194–202.
antibodies. Ann Rheum Dis 2014;73:854–60. [47] Smith ME, Kocsis JD, Waxman SG. Myelin protein metabolism in
[25] Koop SM, ten Klooster PM, Vonkeman HE, Steunebrink LM, van de Laar demyelination and remyelination in the sciatic nerve. Brain Res 1983;270:
MA. Neuropathic-like pain features and cross-sectional associations in
37–44.
rheumatoid arthritis. Arthritis Res Ther 2015;17:237.
[48] Sugimura N, Ikeuchi M, Izumi M, Kawano T, Aso K, Kato T, Ushida T,
[26] Kosek E, Finn A, Ultenius C, Hugo A, Svensson C, Ahmed AS. Differences
Yokoyama M, Tani T. Repeated intra-articular injections of acidic saline
in neuroimmune signalling between male and female patients suffering
produce long-lasting joint pain and widespread hyperalgesia. Eur J Pain
from knee osteoarthritis. J Neuroimmunol 2018;321:49–60.
2015;19:629–38.
[27] Kosinska MK, Liebisch G, Lochnit G, Wilhelm J, Klein H, Kaesser U,
[49] Taylor P, Manger B, Alvaro-Gracia J, Johnstone R, Gomez-Reino J,
Lasczkowski G, Rickert M, Schmitz G, Steinmeyer J. A lipidomic study of
Eberhardt E, Wolfe F, Schwartzman S, Furfaro N, Kavanaugh A. Patient
phospholipid classes and species in human synovial fluid. Arthritis Rheum
perceptions concerning pain management in the treatment of rheumatoid
2013;65:2323–33.
arthritis. J Int Med Res 2010;38:1213–24.
[28] Kosinska MK, Mastbergen SC, Liebisch G, Wilhelm J, Dettmeyer RB,
[50] Tokumura A, Majima E, Kariya Y, Tominaga K, Kogure K, Yasuda K,
Ishaque B, Rickert M, Schmitz G, Lafeber FP, Steinmeyer J. Comparative
Fukuzawa K. Identification of human plasma lysophospholipase D, a
lipidomic analysis of synovial fluid in human and canine osteoarthritis.
lysophosphatidic acid-producing enzyme, as autotaxin, a multifunctional
Osteoarthritis Cartilage 2016;24:1470–8.
[29] Lee YC, Cui J, Lu B, Frits ML, Iannaccone CK, Shadick NA, Weinblatt ME, phosphodiesterase. J Biol Chem 2002;277:39436–42.
Solomon DH. Pain persists in DAS28 rheumatoid arthritis remission but [51] Umezu-Goto M, Kishi Y, Taira A, Hama K, Dohmae N, Takio K, Yamori T,
not in ACR/EULAR remission: a longitudinal observational study. Arthritis Mills GB, Inoue K, Aoki J, Arai H. Autotaxin has lysophospholipase D
Res Ther 2011;13:R83. activity leading to tumor cell growth and motility by lysophosphatidic acid
[30] Lluch E, Torres R, Nijs J, Van Oosterwijck J. Evidence for central production. J Cell Biol 2002;158:227–33.
sensitization in patients with osteoarthritis pain: a systematic literature [52] Velasco M, O’Sullivan C, Sheridan GK. Lysophosphatidic acid receptors
review. Eur J Pain 2014;18:1367–75. (LPARs): potential targets for the treatment of neuropathic pain.
[31] Maingret F, Patel AJ, Lesage F, Lazdunski M, Honore E. Neuropharmacology 2017;113:608–17.
Lysophospholipids open the two-pore domain mechano-gated K(1) [53] Waldmann R, Bassilana F, de Weille J, Champigny G, Heurteaux C,
channels TREK-1 and TRAAK. J Biol Chem 2000;275:10128–33. Lazdunski M. Molecular cloning of a non-inactivating proton-gated Na1
[32] Marra S, Ferru-Clement R, Breuil V, Delaunay A, Christin M, Friend V, channel specific for sensory neurons. J Biol Chem 1997;272:20975–8.
Sebille S, Cognard C, Ferreira T, Roux C, Euller-Ziegler L, Noel J, [54] Weiner JA, Chun J. Schwann cell survival mediated by the signaling
Lingueglia E, Deval E. Non-acidic activation of pain-related Acid-Sensing phospholipid lysophosphatidic acid. Proc Natl Acad Sci U S A 1999;96:
Ion Channel 3 by lipids. EMBO J 2016;35:414–28. 5233–8.
[33] Meiri H, Steinberg R, Medalion B. Detection of sodium channel [55] Weiner JA, Fukushima N, Contos JJ, Scherer SS, Chun J. Regulation of
distribution in rat sciatic nerve following lysophosphatidylcholine- Schwann cell morphology and adhesion by receptor-mediated
induced demyelination. J Membr Biol 1986;92:47–56. lysophosphatidic acid signaling. J Neurosci 2001;21:7069–78.
[34] Nwosu LN, Allen M, Wyatt L, Huebner JL, Chapman V, Walsh DA, Kraus [56] Weiner JA, Hecht JH, Chun J. Lysophosphatidic acid receptor gene vzg-
VB. Pain prediction by serum biomarkers of bone turnover in people with 1/lpA1/edg-2 is expressed by mature oligodendrocytes during
knee osteoarthritis: an observational study of TRAcP5b and cathepsin K myelination in the postnatal murine brain. J Comp Neurol 1998;398:
in OA. Osteoarthritis Cartilage 2017;25:858–65. 587–98.
[35] O’Brien MS, Philpott HTA, McDougall JJ. Targeting the Nav1.8 ion [57] Zhai G, Pelletier JP, Liu M, Aitken D, Randell E, Rahman P, Jones G,
channel engenders sex-specific responses in lysophosphatidic acid- Martel-Pelletier J. Activation of the phosphatidylcholine to
induced joint neuropathy. PAIN 2019;160:269–78. lysophosphatidylcholine pathway is associated with osteoarthritis knee
[36] O’Brien T, Breivik H. The impact of chronic pain-European patients’ cartilage volume loss over time. Sci Rep 2019;9:9648.
perspective over 12 months. Scand J Pain 2012;3:23–9. [58] Zhu S, Zhu J, Zhen G, Hu Y, An S, Li Y, Zheng Q, Chen Z, Yang Y, Wan M,
[37] Radawski C, Genovese MC, Hauber B, Nowell WB, Hollis K, Gaich CL, Skolasky RL, Cao Y, Wu T, Gao B, Yang M, Gao M, Kuliwaba J, Ni S,
DeLozier AM, Gavigan K, Reynolds M, Cardoso A, Curtis JR. Patient Wang L, Wu C, Findlay D, Eltzschig HK, Ouyang HW, Crane J, Zhou FQ,
perceptions of unmet medical need in rheumatoid arthritis: a cross- Guan Y, Dong X, Cao X. Subchondral bone osteoclasts induce sensory
sectional survey in the USA. Rheumatol Ther 2019;6:461–71. innervation and osteoarthritis pain. J Clin Invest 2019;129:1076–93.
[38] Roos EM, Roos HP, Lohmander LS, Ekdahl C, Beynnon BD. Knee Injury [59] Zimmermann M. Ethical guidelines for investigations of experimental pain
and Osteoarthritis Outcome Score (KOOS)—development of a self- in conscious animals. PAIN 1983;16:109–10.

Lysophosphatidylcholine 16 0 Mediates Chronic.14

Uploaded by

Copyright:

Available Formats

Lysophosphatidylcholine 16 0 Mediates Chronic.14

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Lysophosphatidylcholine 16 0 Mediates Chronic.14

Uploaded by

Copyright:

Available Formats

Research Paper

Lysophosphatidylcholine 16:0 mediates chronic

acid-sensing ion channel 3

Potential demyelination of the saphenous nerve was assessed at

the JetPEI reagent according to the supplier’s protocol (Polyplus

coordinated the clinical aspects of the study (French cohort); E. Deval

You might also like