Biochemistry

Biochemistry
B 1. The inhibition in a noncompetitive reaction:

a. competes with the active site of the enzyme c. increases the rate of reaction
b. binds simultaneously with substrate other than the active site d. both b and c
A 2. The order and sequence of amino acid in a polypeptide determines what protein structure?
a. primary b. secondary c. tertiary d. quaternary
B 3. Amino acids that cannot be synthesized in the organism are called _____
a. non essential amino acids c. standard amino acids
b. essential amino acids d. alpha amino acids
A 4. Which hormone regulates the level of blood sodium?

a. aldosterone b. sterol c. corticosteroid d. cortisone
A 5. It is a precursor of vitamin A
a. B-carotene b. retinol c. retinal d. opium
C 6. Which of the following is a precursor of vitamin D?

a. prostaglandin b. linoleic acid c. cholesterol d. aldosterone
A 7. Which of these class enzymes introduces a double bond by the removal of hydrogen?
a. dehydrogenase b. dehydrolase c. decarboxylase d. lipase
A 8. The ionic property of amino acid is exhibited by its

a. zwitterions form b. NH2 group c. COO group d. positively charged groups
D 9. All of the following are simple proteins except:

a. glutelins b. globulins c. albumins d. glycoproteins
C 10.The simplest monosaccharide is __________

a. erythrose b. starch c. glyceraldehydes d. arabinose
C 11. Denaturation of protein is a result of:

a. cleavage of the peptide bond b. formation of H-bond c. breaking of H-bond d. none of these
A 12. Competitive inhibition is a ______ reaction

a. reversible b. irreversible c. pH and temperature d. none of these
A 13. In the Seliwanoff’s test, the reaction of resorcinol and acid on the sugar forms
a. hydroxymethyl furfural b. pyranose c. hydrazine d. purine
A 14. High concentration of neutral salts causes the precipitation of proteins. This is called _______
a. salting out b. salting in c. coagulation d. both b and c
A 15. The type of enzyme inhibition reaction whereby the inhibitor competes with the substrate at the active site:
a. competitive inhibition b. noncompetitive inhibition c. reversible inhibition d. incomplete inhibition
C 16. The following are waxes except:

a. beeswax b. sperm oil c. bile acids d. lanolin
A 17. The inactive form of enzymes are called:

a. zymogens b. apoenzymes c. cofactor d. both b and c
D 18. Which of the following amino acids has no alpha amino group?
a. proline b. hydroxyproline c. glycine d. both a and b
B 19. An enzyme is a substance which
a. convert heat to energy b. act as a catalyst c. change chemically in reaction d. is not specific in reaction
B 20. Milk curdling enzyme present in gastric juice of infants:

a. pepsin b. rennin c. trypsin d. maltase
A 21. Carbohydrates are

a. polyhydroxyaldehydes / polyhydroxyketones c. hemiacetals
b. polyhydroxy acids d. polymers of amino acids
C 22. Insulin is usually classified as:

a. protein b. enzyme c. hormone d. carbohydrates
A 23. What amount of glucose is present in the human blood?

a. 60 to 90 mg in 100 ml blood c. 2% of the total human body weight
b. 5 to 6 g in 100 ml blood d. none of these
A 24. It is the organelle which serves as the site of the electron transport chain.
a. mitochondria b. ribosome c. nucleus d. lysosome
C 25. The end product of the hydrolysis of glycogen is:

a. galactose b. fructose c. glucose d. arabinose
C 26. Iodine test is a reaction which may be used to identify carbohydrates. The reaction is due to
MANOR Review Center 66

Biochemistry
a. presence of the free aldehyde group c. presence of amylose portion
b presence of alcohol group d. presence of glucose
B 27. Benedict’s reagent yield positive result to:

a. monosaccharide only b. reducing sugars c. sucrose d. polysaccharides
B 28. Hypertonic solutions will cause the cell to:

a. swell b. shrink c. burst d. undergo hemolysis
A 29. Rancidity of fats maybe due to :

a. oxidation b. hydrogenation c. saponification d. condensation
C 30. The deficiency of this hormone causes diabetes mellitus:

a. progesterone b. testosterone c. insulin d. glucagons
A 31. The active proteolytic enzyme in gastric juice is:

a. pepsin b. trypsin c. maltase d. catalase
B 32. The site of oxidation reaction in electron transport chain is in the

a. nucleus b. mitochondrion c. ribosome d. golgi bodies
B 33. Protein digestion starts in the

a. mouth b. stomach c. intestine d. pancreas
A 34. The conversion of an amino acid to sugar is:

a. gluconeogenesis b. glycolysis c. glycogenesis d. glycogenolysisp
B 35. Which of the following is not an amino acid?

a. leucine b. choline c. valine d. glycine
A 36. The protein part of the enzyme molecule is the:

a. apoenzyme b. coenzyme c. cofactor d. holoenzyme
C 37. Optimum temperature for enzyme activity in the body:

a. 40oC b. 60oC c. 37oC d. 10oC
B 38. Glucose is stored in the liver as:

a. galactose b. glycogen c. lactose d. fructose
B 39. The enzyme conformation adapts to the incoming substrate in

a. Lock and Key theory b. Induced fit theory c. competitive inhibition d. noncompetitive inhibition
B 40. The process of converting glucose into glycogen is called:

a. gluconeogenesis b. glycogenesis c. glycolysis d. glycogenolysis
A 41. All are pyrimidine bases except:

a. guanine b. cytosine c. uracil d. thymine
B 42. Glucose, amino acid and fatty acid enter the citric acid cycle by their conversion into:
a. pyruvate b. acetyl CoA c. acetoacetyl CoA d. palmitic acid
A 43. A hormone which stimulates glycogenesis:

a. insulin b. glucagons c. epinephrine d. vasopressin
A 44. Chemicals extracted from organism such as bacteria and can inhibit growth or destroy other microorganism:
a. antibiotic b. enzyme c. hormone d. vitamins
C 45. The gland or tissue that regulates the blood glucose level:
a. parathyroid b. thyroid c. pancreas d. adrenal
D 46. Which vitamin is formed in the body by exposure to ultraviolet irradiation or sunlight?
a. vitamin A b. vitamin B c. Vitamin C d. vitamin D
C 47. Excess vitamin A and D is stored in the body, but excess vitamin B and C is readily excreted. What
property shows this?
a. vit. C and B are water-soluble b. vit. A and D are fat –soluble c. both a and b d. none of these
A 48. It is the entire genetic make up of an organism

a. gene b. anticodon c. codon d. mutation
B 49. The vitamin which is used in the prevention of degenerative changes in the central nervous system:
a. vit. A b. vit. B complex c. vit. C d. vit. D
A 50. It is a model which best explains the enzyme-substrate action:

a. lock and key b. molecular c. VSEPR d. Kreb

Biochemistry
D 51. The activation of pepsinogen requires:

a. pepsin b. NaOH c. enterokinase d. HCl
B 52. DNA is primarily found in the

a. cytosol b. nucleus/mitochondria c. cell wall d. endoplasmic reticulum
B 53. It is the enzyme which hydrolyzes starch to dextrin and maltose:

a. catalase b. amylase c. pepsin d. lactase
D 54. A synthetic DNA is called

a. replicated DNA b. plasmid c. Gene d. recombinant DNA
B 55. Hydrolysis of ATP is an

a. energy requiring reaction c. no energy is involved
b. energy producing reaction d. energy is absorbed
C 56. Which of the following is a characteristic of lipid?

a. zwitterions b. amphiphilic c. hydrophobic d. hydrophilic
A 57. It is a condition that results when sugar level is below normal

a. hypoglycemia b. hyperglycemia c. ketonuria d. uremia
A 58. An example of globular protein

A. albumin b. collagen c. fibrin d. silk
A 59. Complementary base pairs in the DNA double helix are bonded by
a. H-bond b. ester bond c. Van der Waals d. dipole- dipole
C 60. Which nitrogen base is not found in DNA?

a. thymine b. cytosine c. uracil d. guanine
C 61. An organic cofactor in an enzyme

a. vitamins b. coenzymes c. a and b d. none of these
B 62. At what stage of glucose oxidation is most of the energy produced?

a. glycolysis b. aerobic stage c. glycogenesis d. glygenolysis
D 63. The best known building blocks of RNA and DNA are:
a. purines b. pyrimidines c. fatty acids d. a and b
C 64. It is responsible for the storage and transmission of genetic information

a. adenine b. RNA c. DNA d. nucleic acid
C 65. Build up of urea in the kidney is called

a. ketonuria b. glycemia c. uremia d. all of these
A 66. The transfer of genetic information from DNA by the formation of mRNA
a. transcription b. translation c. trans-amination d. replication
D 67. What is the end product of electron transport chain?

a. oxygen b. hydrogen c. carbon dioxide d. water
B 68. The energy producing reaction

a. metabolic b. catabolic c. anabolic d. all of these
A 69. It is the molecule that directs the activity of the cells

a. DNA b. RNA c. nucleoproteins d. hormones
C 70. The sugar involved in DNA

a. ribose b. pentose c. deoxyribose d. xylose
C 71. The common metabolic pathway is

a. glycolysis b. beta oxidation c. Kreb’s cycle d. glucogenesis
B 72. Rosenheim’s test is used to detect the presence of:

a. ethanolamine b. choline c. cholesterol d. glycone moiety
C 73. Detects the presence of alpha amino acids:

a. Biuret b. Molisch c. Ninhydrin d. Hopkins-cole
B 74. The process of producing fats from acetyl Co-A is called:

a. glycolysis b. lipogenesis c. glycogenolysis d. glucogenesis

Biochemistry
A 75. The following are test reagents to detect the presence of amino acids, except:
a. Grignard’s b. Xanthoproteic c. Millon-Nasse d. Sakaguchi
A 76. The condition that lowers the pH of the blood due to starvation is called
a. acidosis b. alkalosis c. hyperglycemia d. glycosuria
B 77. The substance responsible for the emulsion of fats is:

a. HCl b. bile acids c. pepsin d. trypsin
B 78. Hubl’s solution if used to ascertain degree of:

a. saturation b. unsaturation c. peroxidation d. acidity
B 79. IUPAC name of acrolein:
a. pentenal b. propenal c. hexanal d. acetone
C 80. The positive indication for the presence of glycerol in acrolein test:
a. yellow colored solution c. silver mirror formed in the test tube
b. black markings in filter paper d. play of colors from blue to shades of red
B 81. Cerebrosides are positive in the following tests, except:

a. Molisch b. Biuret c. Lassaigne’s d. none of the above
B 82. Osmic test is used to detect the presence of ____ in lipids:

a. metals b. prostate groups c. unsaturated groups d. glycerol
A 83. The most sensitive chemical test to detect the presence of cholesterol:
a. Liebermann-Burchard c. Formaldehyde-sulkfuric acid
b. Salkowski reaction d. Colorimetric spectrophotometry
D 84. The following are phopholipids, except:

a. plasmalogen b. lecithin c. cephalin d. choline
C 85. A mixed triglyceride contains:

a. three similar fatty acids esterified with glycerol c. three different fatty acids esterified with glycerol
b. two similar fatty acids esterified with glycerol d. all of the above choices
B 86. The central compound found in the structure of sphingolipids:

a. glycerol b. sphingosine c. ceramide d. phosphocholine
A 87. Lipid whose specific test is the Furter-Meyer test:

a. tocopherol b. retinal c. sphingomyelin d. cerebroside
A 88. Precipitate of _____ indicates the presence of phospholipids in the lipid sample:
a. ammonium phosphomolybdate c. phosphorus triiodide
b. phosphorus periodate d. phospho-ammonium sulfate complex
B 89. The following are glycolipids, except:

a. globosides b. phosphatides c. gangliosides d. cerebrosides
B 90. The parent compound of phospholipids:

a. glycerol b. phosphatidic acid c. ethanolamine d. none of the above
D 91. A non-pentose sugar which is also positive for Tollen’s phloroglucinol test:
a. galactose b. glucose c. fructose d. cellobiose
C 92. The reagent present in Molisch test which is responsible for the dehydration reaction:
a. sodium canbonate b. magnesiumstearate c. sulfuric acid d. NaOH
C 93. ID test to detect the presence of glycogen:

a. phloroglucinol b. molisch c. iodine d. seliwanoff
C 94. The only sugar readily forms insoluble osazone crystals:

a. lactose b. sucrose c. mannose d. sucrose
D 95. Important structural material found in the exoskeletons of many lower animals:
a. chnondroitin b. heparin c. hyaluronic acid d. chitin
B 96. Hydrolysis of osazones produce:

a. phenylhydrazones b. ozones c. sugars d. none of the above
C 97. General term for a group of polysaccharides present on the primary cell wall:
a. xanthan b. mucilage c. pectin d. carageenan
C 98. Specific test for galactose, due to the formation of highly insoluble crystals:
a. phenylhydrazine test b. fermentation c. mucic acid d. molisch
A 99. Type of RNA which serves as template for the amino acid sequence being synthesized:
a. mRNA b. tRNA c. rRnNA d. none of the above

Biochemistry
B 100. Positive indication for Anthrone test:
a. purple ring b. blue-green color c. effervescence d. yellow ppt
B 101. Differentiating test between helical and linear polysaccharides:

a. Molisch b. iodine c. Schweitzer d. fermentation
C 102. The difference between Benedict’s and Barfoed’s test reagent lies in:
a. sequestering agent used b. active component used c. pH of the solution d. alkali used
C 103. Hydrolytic product of chitin:

a. iduronatet b. acetylgalactosamine c. acetylglucosamine d. glucuronic acid
C 104. Glucose and fructose are:

a. anomers b. epimers c. geometric isomers d. allosteres
B 105. The complementary strand of CGACCTTGATCGACGTCGA:

a. TCGTTCCAGCTAGTAACTAG c. AGCAAGGTCGATCATGATC
b. GCTGGAACTAGCTGCAGCT d. ATCAAGGTCGATCATGATC
C 106. Alkaline bismuth reagent is used to detect the presence of:

a. polysaccharides b. disaccharides c. reducing sugars d. glycitols
D 107. Action of dilute alkali on sugars:

a. dehydration b. hyperconjunction c. hydrolysis d. tautomerization
A 108. The following are the components of DNA nucleosides, except:

a. phosphoric acid b. sugar c. adenine d. cytosine
A 109. Central dogma concept wherein the RNA molecule is used as template for the synthesis of DNA molecule:
a. transcription b. translation c. mutation d. none of the above
D 110. The following proteins are present in egg white, except:

a. ovomucin b. ovoglobulin c. albumin d. osseomucoid
C 111. Anaerobic glycolysis occurs in the:

a. nucleus b. mitochondria c. cytoplasm d. lysosomes
D 112. Ketogenic amino acids:

a. leucine b. tyrosine c. phenylalamine d. all of the above
B 113. Osazone test is also known as:

a. Nylander’s test b. Kowarsky test c. Trommer’s test d. Folin’s test
A 114. Genetic defect characterized by mental retardation and cataract, since the unmetabolized sugar is toxic to
The lens of the eyes:
a. galactosemia b. fructosemia c. pentosuria d. fructosuria
D 115. Body functions of lipids:

a. transformation into proteins and carbohydrates c. insulation and paddings for organs
b. catabolism to provide body with heat and energy d. all of the above
B 116. Pyridoxine is a compound of this enzyme:

a. enolase b. decarboxylase c. hydrogenase d. isomerase
B 117. The following are neutral amino acids, except:

a. methionine b. lysine c. threonine d. leucine
D 118. In man, the principal end product of protein metabolism is:

a. uric acid b. lactic acid c. pyruvic acid d. urea
B 119. Condition wherein acetone accumulates in the blood:

a. ketosuria b. ketonemia c. ketosis d. ketonuria
A 120. Glutamine is a _____ amino acid :

a. neutral b. basic c. acidic d. racemin
B 121. Oxidation product of ketone bodies

a. reduced sugars b. carbon dioxide c. alcohols d. aldehydes
C 122. Phosphoprotein found in egg yolk:

a. ovocasein b. tendomucoid c. vitelin d. avidin
C 123. Amino acids positive for Sakaguchi reaction:

a. gelatin b. alanine c. arginine d. tyrosine
B 124. Histidine is negative for:

Biochemistry
a. Pauly reaction b. Sodium Nitroprusside c. Ninhydrine d. Xanthoproteic
C 125. An official simple protein obtained from corn:

a. glutelion b. gliadin c. zein d. maize
C 126. Principle involved in the isolation of casein milk:

a. salting in b. salting out c. isoelectric precipitation d. none of the above
A 127. Process of converting liver glycogen into blood glucose:

a. glycogenolysis b. gluconeogenesis c. glycolysis d. glycogenesis
B 128. Genetic information is stored and carried in all cells by:

a. single-stranded DNA c. double-stranded RNA
b. double-stranded DNA d. single-stranded circular DNA
B 129. Principal site for the synthesis of urea:

a. kidney b. liver c. spleen d. intestinal mucosa
C 130. Pentose present in gum Arabic:

a. xylose b. ribose c. arabinose d. threose
C 131. Which of the following is responsible for the transfer of genetic information?
a. ATP b. GTP c. DNA d. RNA
C 132. Only form of inorganic nitrogen which can be utilized by living cells:
a. urea b. ornithine c. ammonia d. nitrogen gas
A 133. The following are essential amino acids, except:

a. tyrosine b. lysine c. methionine d. arginine
C 134. The chief end product of purine metabolism in man:

a. CO b. urea c. uric acid d. ammonia
D 135. The principal end product of protein metabolism:

a. carbon dioxide b. ammonia c. hippuric acid d. urea
B 136. Presence of glucose in appreciable amounts in the urine:

a. Hematuria b. glycosuria c. glycosemia d. albuminuria
D 137. The following are the tests for kidney efficiency, except:
a. phenylsulfophthelein test b. urea clearance test c. water output test d. crystallization method
B 138. Growth hormone is also known as:

a. thyrotropic hormone b. somatotropin c. gonadotropin d. interstitial stimulating
hormone
A 139. What is the anti-codon in tRNA that corresponds to the codon ACG in mRNA?
a. UGC b. TGC c. GCA d. CGU
A 140. Condition wherein bile pigment is present in excess in the blood:

a. jaundice b. hepatitis c. cirrhosis d. cystic fibrosis
B 141. The following are non-essential amino acids, except:

a. glycine b. leucine c. cysteine d. glutamine
B 142. Principal digestive constituent of the gastric juice:

a. trypsin b. pepsin c. gastrin d. enterokinase
B 143. Condition wherein the concentration of uric acid accumulates in blood reaches as high as 15 mg%:
a. leukemia b. gout c. murexia d. any of the above
C 144. The study of the composition and the chemical processes occurring in the living matter is:
a. qualitative chemistry c biochemistry e. inorganic chemistry
b. organic chemistry d. quantitative chemistry
A 145. What is wobble?

a. the ability of certain anticodons to pair with codons that differ at the third base
b. an error in translation induced by streptomycin
c. a mechanism that allows for a peptide extension in the 50S sub-unit of the ribosome
d. thermal motions leading to local denaturation of the DNA double helix
C 146. The most important function of HCl in the stomach is:

a. hydrolysis of protein c. activation of pepsinogen e. stimulation of pancreatic secretion
b. neutralization of chyme d. destruction of bacteria

Biochemistry
C 147. Transamination is:

a. conversion of amino acid to hydroxy acid c. conversion of amino acids to keto acids
b. loss of ammonia from amino acid d. formation of ammonium salt from ammonia
A 148. The lipid that is converted to Vitamin D2 upon irradiation:

a. ergosterol b. glycerol c. cholesterol d. all of the above
A 149. The metabolic degradation of hemoglobin takes place principally in:

a. the reticuloendothilial system c. the white blood cells
b. the red blood cells d. the liver cell
C 150. The amino acid that is an important precursor of hemoglobin is:

a. alanine b. proline c. glycine d. cysteine
C 151. Serine is converted to ethanolamine by the removal of:

a. oxygen b. ammonia c. carbon dioxide d. a carboxyl group
C 152. Ninhydrin gives a blue coloration with:

a. proteins b. carbohydrates c. amino acids d. simple sugars
A 153. Which is the monomer unit of proteins?
a. amino acid b. monosaccharide c. fatty acid d. purine
A 154. The proteinase that is found mostly in gastric juice of young animals:
a. rennin c. steapsin e. none of the above
b. pepsin d. ptyalin
B 155. Conjugated proteins which are a combination of amino acids and carbohydrates:
a. nucleoproteins b. glycoproteins c. phosphoproteins d. chromoproteins
A 156. Gamma decarboxylation of aspartic acid produces:

a. alanine b. asparagines c. glutamic acid d. glycine
B 157. Rotation of polarized light is caused by solutions of all of the following amino acids, except:
a. alanine b. glycine c. leucine d. valine
A 158. It is a disease due to protein deficiency:

a. Kwashiorkor b. diabetes c. albuminuria d. jaundice
C 159. Which of the following amino acids is not essential in mammals?

a. phenylaline b. lysine c. tyrosine d. methionine
D 160. The following are examples of chromoprotein, except:

a. chlorophyll b. hemoglobin c. cytochromes d. heparin
D 161. For the amino acid cysteine, choose the appropriate description of its side chain:
a. acidic b. basic c. aromatic d. sulfur-containing
C 162. Which of the following amino acids has a net positive charge at physiologic pH?
a. cysteine b. glutamic acid c. lysine d. valine
D 163. Sickle cell anemia is the clinical manifestation of homozygous genes for an abnormal hemoglobin molecule.
The mutational event responsible for the mutation in the beta chain is:
a. crossing over b. insertion c. deletion d. point mutation
C 164. When starches are heated , they produce:

a. sugars b. glycogen c. dextrins d. disaccharides
B 165. Check the incorrect statement:

a. ribose is an aldopentose c. galactose is an aldohexose
b. maltose is a ketohexose d. glucose is an aldohexose
A 166. The reducing property of sugars is due to this group:

a. aldehyde b. nitro c. carboxyl d. methyl
D 167. The monosaccharide most rapidly absorbed from the small intestine is:
a. glucose b. fructose c. mannose d. galactose
C 168. A condition known as atherosclerosis results as an accumulation in the blood vessels of

a. calcium b. pathogens c. cholesterol d. ketones
C 169. Ketoses can be differentiated from aldoses by this test:

a. Molisch’s test b. Benedict’s test c. Seliwanoff’s test d. Tollen’s test

Biochemistry
C 170. The clinical test for the determination of cholesterol:
a. Liebermann-Burchard b. Salkowski c. both a and b d. none of the above
C 171. Concentrated dehydrating acids change monosaccharides to:

a. simple sugars b. saccharic acids c. furfurals d. uronic acids e. aldaric acids
C 172. A mucopolysaccharide which possesses an anticoagulant property:

a. pectin b. hyaluronic acid c. heparin d. chitin e. chondroitin sulfate
A 173. Which of the following is the test for reducing sugars for urine?
a. Benedict’s test b. acrolein test c. Biuret test d. Brown Ring test
B 174. Lactose can be differentiated from fructose by:

a. Mucic acid test b. Barfoed’s test c. Fehling’s test d. Iodine test e. Tollen’s test
B 175. Polymers that are responsible for the metabolic capabilities and morphology of organisms are:
a. carbohydrates b. proteins c. polysaccharides d. nucleic acid
B 176. The product obtained from the partial hydrolysis of collagen:

a. myosin b. gelatin c. actin d. fibrinogen e. thrombin
B 177. The main carbohydrate of the blood is:

a. D-fructose b. D-glucose c. mannitol d. sorbitol
B 178. A normal value of glucose in the blood:

a. 100 to 200 mg% b. 80–120 mg% c. 50–75 mg% d. 200–300 mg%
B 179. Butter becomes rancid upon exposure to air due to formation of:
a. acetic acid b. butyric acid c. formic acid d. propionic acid
C 180. The cholesterol molecule is:

a. an aromatic ring b. a straight chain acid c. a steroid d. A tocopherol
C 181. Which of the following is a phospholipid?

a. glycogen b. prostaglandin c. sphingomyelin d. oleic acid
B
C 182. The passage of the end products of digestion from the small intestine into the blood stream:
a. metabolism b. digestion c. absorption d. oxidation e. reduction
A 183. Endocrine gland that is a small oval body situated at the base of the brain:
a. hypophysis b. pancreas c. adrenal d. none of the above
A 184. Cellular elements of the blood devoid of nucleus:

a. RBC b. WBC c. thrombocytes d. all of the above
C 185. Is the sum total of all activities directed towards the maintenance of life:
a. catabolism b. anabolism c. metabolism d. photosynthesis e. fermentation
C 186. This substance accumulates in the muscles as a result of vigorous exercise:

a. muscle glycogen b. amino acids c. lactic acid d. glucose
B 187. A common intermediate of metabolism of carbohydrates, fatty acids and amino acids is:
a. glycerol b. acetyl CoA c. acetoacetate d. oxaloacetate e. acetylcholine
B 188. The principal site of glucose production in the human body is the :
a. blood b. liver c. pituitary gland d. small intestine
A 189. The major buffer of the extracellular fluid:

a. bicarbonate-carbon dioxide b. amino acids c. phosphate d. none of the above
C 190. Separates from cells when blood is coagulated:

a. fibrinogen b. plasma c. serum d. thrombin e. none of the above
Blood consists of solid elements, the red and white blood cells and the platelets, suspended in a liquid medium
,the plasma. Once the blood has clotted (coagulated), the remaining liquid phase (serum) lacks the clotting factors that are
normally present in plasma but have been consumed during the process of coagulation. (2, p. 707)
C 191. Glycolipids found in high concentrations in the brain and nerve cells especially in the myelin sheath:
a. lecithin b. cephalins c. cerebrosides d. sphingolipids
A 192. Alcohol in the body is :

a. oxidized to CO2 and HOH c. excreted by kidneys
b. excreted mainly by lungs d. excreted by large intestine
C 193. Which of the following tissues contains the enzyme glucose-6-phosphatase and is able to supply glucose to
the blood?
a. heart b. brain c. liver d. none of the above
D 194. Complete digestion of all foodstuffs occurs in the :

a. large intestine b. stomach c. mouth d. small intestine e. pancreas
Biochemistry
B 195. This compound is not a normal constituent of urine:

a. sodium chloride b. albumin c. urea d. uric acid
A 196. Decomposition of carbohydrates brought about by the action of enzymes liberating ethyl alcohol and CO2:
a. fermentation b. adsorption c. detoxification d. hydrolysis
e. saponification
C 197. Blood clotting can be prevented by:

a. sodium chloride b. potassium chloride c. sodium citrate
D 198. This hormone elevates blood sugar concentration:

a. insulin b. progesterone c. estrogen d. glucagons
B 199. Deficiency in this vitamin causes red blood cell fragility:

a. vitamin A b. vitamin K c. Vitamin D d. vitamin E
C 200. The end-product in the hydrolysis of glycogen is:

a. galactose b. mannose c. glucose d. arabinose
A 201. In which form is glucose stored in the liver?

a. glycogen b. glucose (unchanged) c. sucrose d. starch
B 202. Which of the following is NOT an ID test for proteins and amino acids?
a. Ninhydrin b. Bial’s c. Biuret d. Xanthoproteic
D 203. What vitamin deficiency causes pellagra?

a. riboflavin b. thiamin c. pantothenic acid d. nicotinic acid
D 204. All are pyrimidine base, except:

a. cytosine b. thymine c. uracil d. guanine
B 205. The sugar that yields only glucose when hydrolyzed is:
a. galactose b. maltose c. fructose d. sucrose
D 206. Which is not a B-complex vitamin?

a. folic acid b. nicotinic acid c. riboflavin d. ascorbic acid
A 207. The following sugars are aldohexoses except:

a. fructose b. galactose c. glucose d. mannose
D 208. All the amino acid below contain sulfur, except:

a. cystine b. methionine c. cysteine d. glycine
A 209. The following are essential fatty acids, except:

a. oleic acid b. linoleic acid c. linolenic acid d. arachidonic acid
D 210. This test detects the presence of two or more peptide bonds:
a. Ninhydrin b. Fehling’s c. Tollen’s d. Biuret
B 211. This vitamin easily undergoes oxidation:

a. vitamin A b. vitamin C c. vitamin B12 d. vitamin B1
B 212. The end product of anaerobic glucose metabolism is:

a. pyruvate b. lactate c. carbon dioxide d. water
A 213. The inactive form of an enzyme is sometimes called:

a. zymogen b. holoenzyme c. apoenzyme d. coenzyme
(2, p. 101)
A 214. Photosynthesis is a process involved in the manufacture of:

a. carbohydrates b. fats c. proteins d. all of the above
B 215. The major extracellular cation is:

a. potassium b. sodium c. calcium d. iron
B 216. Which sugar will not give a red precipitate with cupric oxide when heated with Benedict’s solution?
a. glucose b. sucrose c. maltose d. fructose
A 217. Night blindness is a symptom of a deficiency in this vitamin:

a. vitamin A b. vitamin C c. vitamin B d. vitamin D
D 218. The activation of pepsinogen requires:

a. NaOH b. bicarbonate c. acetic acid d. HCl
D 219. Nucleosides upon hydrolysis will yield:

a. adenine + phosphate b. quanine + phosphate c. histones + ribose d. cytosine + ribose

Biochemistry
C 220. Protein digestion starts in the:

a. mouth b. small intestine c. stomach d. large intestine
C 221. Major form of utilizable energy in all cells:

a. ADP b. GDP c. ATP d. GTP
A 222. Which of the following supplies the highest amount of energy per gram?
a. fat b. glycogen c. protein d. starch
A 223. The following are proteins in milk, except:

a. rennin b. casein c. lactoalbumin d. lactoglobulin
B 224. The conversion of beta carotene to vitamin A is carried out in the:

a. liver b. small intestine c. lungs d. pancreas
A 225. This sugar is also called an “invert sugar”:

a. sucrose b. fructose c. glucose d. galactose
A 226. What type of sugar is found in nucleic acids?

a. riboses b. glucoses c. mannoses d. galactoses
D 227. The biochemical function of hemoglobin is:

a. defense b. regulatory c. structural d. oxygen transport
C 228. The following enzymes catalyze hydrolysis reactions, except:

a. proteases b. esterases c. transaminases d. nucleases
C 229. Porphyrins are involved in the building of:

a. bones b. muscles c. blood d. connective tissue
B 230. Which among the following sugar is sweetest?

a. glucose b. fructose c. sucrose d. galactoseA
A 231. Information and control centers of the cell:
a. nucleoproteins b. enzymes c. carbohydrates d. lipids
A 232. Hydrolysis of nucleoproteins will yield:

a. Nucleic acids and histones c. nucleic acid and purines
b. nucleic acid and sugar d. nucleic acid and pyrimidines
C 233. The condition wherein protein is found in the urine is:

a. glycosuria b. ketonuria c. proteinuria d. dysuria
A
A 234. Alpha-hydroxy propionic acid is:

a. lactic acid b. aminoacetic acid c. ascorbic acid d. pyruvic acid
B 235. This test detects the presence of indole rings:

a. Molisch b. Hopkin’s cole c. Millon’s d. Ninhydrin
C 236. The steps of central states:

a. replication, translation and transcription c. replication, transcription and translation
b. replication, transcription and transmission d. transcription, translation and replication
B 237. Reverse transcription takes place in:

a. bacteria b. viruses c. algae d. molds
D 238. The number of chromosomes in the human cells is:

a. 41 b. 42 c. 43 d. 46
A 239. Digestion of starch starts in the :

a. mouth b. stomach c. small intestine d. large intestine
During mastication, salivary a-amylase (ptyalin) acts briefly on dietary starch in a random manner breaking some a-
(1,4) bonds. Remember that carbohydrates are the only dietary component for which degradation begins in the mouth
D 240. The ordered steps in protein synthesis is:

a. transcription, transplantation, activation, elongation c. initiation, activation, elongation, termination
b. activation, elongation, initiation, termination d. activation, initiation, elongation, termination
D 241. Genetic code is:

a. universal b. composed of 3 nucleotides c. continuous d. all are correct
B 242. Which of the following is called transamination?

a. conversion of amino acids to hydroxy acids c. lose of ammonia from amino acids
b. conversion of amino acids to keto acids d. formation of ammonium salts from ammonia
A 243. Dextran is:

Biochemistry
a. carbohydrate b. glucose polymer c. glycoside d. protein
B 244. A genetic disease due to defective mechanism for pyrimidine dimmers:

a. phenyl ketonuria b. xeroderma pigmentosum c. albinism d. N-glycosyl linkage
D 245. The type of RNA molecule that brings amino acids to the site of protein synthesis is:
a. rRNA b. aRNA c. mRNA d. tRNA
D 246. Most allergies are caused by:

a. Error in the immune system b. histamines produced by the body c. dust d. all of the above
B 247. RNA which plays an important role in the structure and biosynthetic function of ribosome:
a. mRNA b. rRNA c. tRNA d. DNA
D 248. In the secondary structure of RNA:

a. adenine will always pair with thymine c .cytosine will always pair with uracil;
b. cytosine will always pair with thymine d. adenine will always pair with uracil
D 249. A nucleic acid is made up of:

a. sugar, nucleoside and a base c. nitrogenous base, amino acid and sugar
b. proteins, sugar and a phosphate group d. nitrogenous base, phosphate and sugar
C 250. Bond between 2 amino acids

a. glycosidic bond b. N-glycosyl linkage c. peptide bond d. hydrogen bond
A 251. Which of the following is not a test for protein?

a. acrolein b. Biuret c. Millons d. xanthoproteic
A 252. Acetyl CoA combines with oxaloacetate to form:

a. citrate b. carnitine c. acyl-carnitine d. none of the above
B 253. The proteins that make the fur, wool, claws and feathers:
a. collagen b. keratin c. silk d. none of the above
B 254. Liquid vegetable oils may be transformed into solid fats by the process of:
a. oxidation b. hydrogenation c. substitution d. reduction
B 255. The chemical messengers produced by the endocrine glands:

a. genes b. hormones c. vitamins d. enzymes
A 256. It is the sugar found in milk:

a. lactose b. maltose c. sucrose d. raffinose
C 257. Prostaglandins are synthesized from:

a. oleic b. stearic c. essential fatty acid d. non-essential fatty acid
C 258. Amino acid at an isoelectric point exists as:

a. acid b. base c. zwitterions d. none of the above
B 259. The color of the skin, hair and eyes is due to pigment called:
a. cytochrome b. melanin c. keratin d. heparin
B 260 Starches are partially digested in the mouth by:

a. protease b. ptyalin c. pepsionogen d. pepsin
C 261. The only element in living matter from strong multiple bonds readily are:
a. oxygen b. nitrogen c. carbon d. all of the above
A 262. Serotonin, a neurotransmitter, is derived from the amino acid:

a. tryptophan b. threonine c. tyrosine d. phenylalanine
A 263. Alkaline hydrolysis of fat:

a. saponification b. hydrogenation c. alkalinization d. hydroxylation e. all of the above
C 264. The main center of biosynthesis of nucleic acid is the:

a. cell wall b. cytoplasm c. nucleus d. none of the above
A 265. Normal pH of the blood:

a. 7.4-7.45 b. 6.6-6.9 c. 5.5-6.6 d. 4.8-8
A 266. Known as good cholesterol:

a. HDL b. ergocalciferol c. ACTH d. LDL
A 267. Blood minus its cellular components:

a. plasma b. serum c. hemoglobin d. fibrin

Biochemistry
B 268. Which of the following is not an amino acid:

a. leucine b. choline c. valine d. lysine
A 269. Are globular proteins, except:

a. collagen b. serum albumins c. serum globulins d. hemoglobin
D 270. The precursor of vitamin A is:

a. arachidonic acid b. isoprene c. naphtoquinone d. carotene
B 271. Are fibrous proteins, except:

a. keratin b. histones c. elastin d. collagen
C 272. A type of antibodies that plays an important role in allergic response which causes anaphylactic shock,
hayfever and asthma:
a. IgA b. IgM c. IgE d. IgG
C 273. An inherited disease that affect red blood cells:

a. albinism b. hyperglycemia c. sickle cell anemia d. hypoglycemia
D 274. Are esters of fatty acids with glycerol:

a. phospholipids b. glycolipids c. waxes d. fats
A 275. The metallic salt of a high fatty acid:

a. soap b. detergent c. inorganic salt d. glycerin
A 276. The following are enzymes found in pancreatic juice, except:

a. papain b. trypsin c. chymotrypsin d. carboxypolypepticase
C 277. The following are pathological constituents of urine, except:

a. glucose b. albumin c. creatinine d. blood
D 278. All of the following carbohydrates are considered to be polysaccharide, except:

a. heparin b. starch c. glycogen d. maltose
C 279. Which of the following hormones promotes rapid glycogenolysis in both liver and muscle:
a. ACTH b. glutemine c. epinephrine d. prolactin
D 280. Fruity odor of urine is indicative of acetone bodies, a diagnostic value in case of acidosis in:
a. diabetes insipidus b. porphyria c. cretinism d. diabetes mellitus
B 281. Rotation of polarized light is caused by solutions of all of the following amino acids, except:
a. alanine b. glycine c. leucine d. valine
C 282. The precursor of vitamin D3:

a. ergosterol b. stigmasterol c. 7-dehydrocholesterol d. cholesterol
B 283. The enzyme present in the stomach which hydrolyzes proteins:

a. trypsin b. pepsin c. amylopsin d. enterokinase
B 284. The reaction that takes place in cytoplasm:

a. aerobic b. anaerobic c. oxidation d. reduction
C 285. Compounds of protein with a carbohydrate component:

a. lipoproteins b. phosphoproteins c. glycoproteins d. nucleoproteins
D 286. What amino acid functions as a hormone?

a. valine b. leucine c. alanine d. thyroxine
C 287. The pathway that occurs in the mitochondria:

a. urea cycle b. citric acid cycle c. glycolysis d. fatty acid cycle
C 288. Carbohydrates that cannot be hydrolyzed to compounds with simpler molecules:

a. oligosaccharides b. disaccharides c. monosaccharides d. polysaccharides
B 289. In the metabolism of protein, the liver:

a. synthesizes amino acids b. breaks down amino acid c. absorbs blood d. stores amino acid
B 290. What is the stage of glucose oxidation that requires oxygen?

a. anaerobic b. aerobic c. catabolic d. anabolic
B 291. An important protein in contractile muscle:

Biochemistry
a. keratin b. myosin c. elastin d. fibrin
C 292. Which is the main constituent of the group substance in the connective tissue?
a. heparin b. fructosan c. hyaluronic acid d. mannosan
C 293. Raffinose, an important non-reducing sugar, is a:

a. monosaccharide b. disaccharide c. trisaccharide d. tetrasaccharide
A 294. Non-protein molecules that are often associated with proteins are called:
a. prosthetic group b. side chain c. zwitterions d. casein
A 295. They are chemical messengers:

a. hormones b. enzymes c. vitamins d. amino acids
C 296. It is a polysaccharide:
a. lactose b. maltose c. amylose d. fructose
B 297. Which sugar contains an aldehyde group?

a. ketose b. aldose c. sorbitol d. mannitol
1. This type of inhibition is recognized by its characteristic effect on maximal velocity (Vmax). Vmax is decreased in
the presence of a noncompetitive inhibitor. Noncompetitive inhibition occurs when the inhibitor and the substrate
bind at different sites on the enzyme. (1, p.55)
2. The polypeptide backbone generally forms regular arrangements of amino acids that are located near to each
other in the linear sequence and these arrangements refer to the secondary structure of the polypeptide.
Examples are α-helix, β-sheet and β-bend. Tertiary refers to the folding of the domains and the final arrangement
of domains in the polypeptide. Quaternary refers to the arrangement of the polypeptide subunits which may be
structurally identical or totally unrelated. (1, pp.13-22)
3. Essential fatty acids cannot be synthesized in the organism and thus, they have to be obtained from diet. Two
fatty acids are essential in humans: linoleic acid, the precursor of the prostaglandins, and linolenic acid.
Arachidonic acid becomes essential if its precursor, linoleic acid is missing. (1, p. 173)
4. Aldosterone’s primary effect is on the kidney tubules where it stimulates sodium retention and potassium
excretion. Secretion of aldosterone from the adrenal cortex is induced not by ACTH but by the Na/K ratio of the
body and by angiotensin. (1, p. 226)
5. Plant foods contain beta carotene which can be oxidatively cleaved in the intestine to yield two molecules of
retinal. This cleavage which utilizes molecular oxygen is enhanced by the presence of bile salts. (1, p. 331; 2, p.
614)
6. 7-Dehydrocholesterol, an intermediate in cholesterol synthesis, is converted to cholecalciferol (Vitamin D3) in the
dermis and epidermis of humans exposed to sunlight. (1, p. 335)
7. Dehydrogenase is an example of an oxidoreductase enzyme which in general, catalyzes an oxidation-reduction
reactions. (1, p.47)
8. The zwitterions form is the dipolar form of the amino acid. An amino acid contains both the NH3+ and the COO-
terminal ends. (1 p. 9)
9. Glycoproteins are proteins to which oligosaccharides are covalently attached. The oligosaccharide components of
the glycoproteins are generally branched heteropolymers composed primarily of D-hexoses with the addition in
some cases of neuraminic acid and L-fucose. (1, p. 157)
10. Glyceraldehyde is composed of three carbons while erythrose is of 4 carbons and arabinose, of 5 carbons.
Starch is a polysaccharide. (1, p. 119)

Biochemistry
11. Protein denaturation results in the unfolding and disorganization of the protein’s structure which are not
accompanied by the hydrolysis of peptide bonds. Denaturating agents include heat, organic solvents, mechanical
mixing, strong acids or bases, detergents and ions of heavy metals such as lead and mercury. (1, p.23)
12. This type of inhibition occurs when the inhibitor binds reversibly to the same site that the substrate would normally
occupy (active site) and therefore competes with the substrate for that site. The effect of a competitive inhibitor is
reversed by increasing the concentration of the substrate. (1, p. 54)
13. This will result in loss of water and formation of furfural derivatives. Seliwanoff’s test is a test for fructose where a
red precipitate indicates a (+) result. (4, pp. 77, 86)
14. Generally, proteins are precipitated from solution by salts of the heavy metals (HgCl2, AgNO3, CuSO4), by certain
acids some of which are called alkaloidal reagents, by concentrated solutions of such salts as ammonium sulfate,
sodium sulfate and sodium chloride and by ethyl and methyl alcohol. (4, p. 181)
15. This type of inhibition occurs when the inhibitor binds reversibly to the same site that the substrate would normally
occupy (active site) and therefore competes with the substrate for that site. The effect of a competitive inhibitor is
reversed by increasing the concentration of the substrate. (1, p. 54)
16. Bile acids are the most important organic components of bile. They contain 24 carbons with two or three hydroxyl
groups and a side chain that terminates in a carboxyl group. They have both polar and non polar face and can act
as emulsifying agents in the intestine. They provide the only significant mechanism for cholesterol excretion-both
as a metabolic product of cholesterol and as an essential solubilizer for cholesterol excretion in bile. (1, p. 210)
17. Apoenzyme refers to the protein portion of the holoenzyme (enzyme with the cofactor). In the absence of an
appropriate cofactor, the apoenzyme typically does not show biologic activity. (1, p.48)
18. Their side chains and the alpha-amino group form a ring structure and thus, they differ from other amino acids in
that they contain an imino group rather than an amino group. (1, p. 3)
19. An enzyme acts as a catalyst. It allows a reaction to proceed rapidly under conditions prevailing in the cell by
providing an alternate reaction pathway with a lower free energy of activation. It does not change the free
energies of the reactants or products and therefore does not change the equilibrium of the reaction. (1, p. 49)
20. Rennin is important in the digestive processes of infants because it prevents the rapid passage of milk from the
stomach. In the presence of calcium, rennin changes the casein of milk irreversibly to a paracasein which is then
acted on by pepsin. (2, p. 636)
21. Carbohydrates with an aldehyde as their most oxidized functional group are called aldoses while those with keto
group are called ketoses. (1, p. 119)
22. Insulin is a polypeptide hormone produced by the beta cells of the Islets of Langerhans, clusters of cells that
comprise about 1% of the mass of the pancreas. Its metabolic effects are anabolic favoring synthesis of glycogen,
triacylglycerols and protein. (1, p. 269)
23. A
24. The electron transport chain is present in the inner mitochondrial membrane and is the final common pathway by
which electrons derived from different fuels of the body flow to oxygen. Electron transport and ATP synthesis by
oxidative phosphorylation proceed continuously in all cells of the body that contain mitochondria. (1, p. 66)
25. When glycogen is degraded the primary product is glucose 1-phosphate, obtained by breaking a-1,4 glycosidic
bonds. Also, free glucose is released from each a-1,6-linked glucosyl residue. (1, p. 139)
26. C
27. In the presence of reducing sugars, the entire solution will be filled with a precipitate which may be red, yellow or
green in color depending on the amount of sugar present. (4, p. 83)
28. If the cell is placed in a hypertonic solution, water will flow out of the cell into the extracellular fluid, concentrating
the intracellular fluid and diluting the extracellular fluid. The cell will shrink until the two concentrations will be
equal. (5, p. 304)
29. Oxidative rancidity proceeds by a virtue of chain reaction. The unsaturated fat first combines with oxygen to form
a peroxide. This intermediate either spontaneously breaks down to an aldehyde or forms such a compound after
interaction with water. The aldehyde in turn autoxidizes to a peracid, which oxidizes new unsaturated linkages
simultaneously with its transformation to an ordinary acid. (4, p. 118)
30. Diabetes is not one disease but rather is a heterogenous group of syndromes characterized by an elevation of
blood glucose caused by a relative or absolute deficiency in insulin. Metabolic alterations caused by inadequate
release of insulin are aggravated by an excess of glucagons. (1, p. 295)
31. This acid stable endopeptidase is secreted by the serous cells of the stomach as an inactive zymogen,
pepsinogen. Pepsinogen is activated to pepsin either by HCl or autocatalytically by other pepsin molecules that
have already been activated. (1, p. 231-232)
32. The electron transport chain is present in the inner mitochondrial membrane and is the final common pathway by
which electrons derived from different fuels of the body flow to oxygen. Electron transport and ATP synthesis by
oxidative phosphorylation proceed continuously in all cells of the body that contain mitochondria. (1, p. 66)
33. The digestion of proteins begins in the stomach which secretes gastric juice, a unique solution containing HCl and
the proenzyme pepsinogen. Proteins are too large to be absorbed by the intestine and therefore must be
hydrolyzed to yield their constituent amino acids which can be absorbed. (1, p. 231)
34. The formation of glucose does not occur by a simple reversal of glycolysis, because the overall equilibrium of
glycolysis strongly favors pyruvate formation. Glucose is synthesized by a special pathway, gluconeogenesis. (1,
p. 99)
35. Choline is a nitrogenous base. (4, p. 113)
36. Apoenzyme refers to the protein portion of the holoenzyme (enzyme with the cofactor). In the absence of an
appropriate cofactor, the apoenzyme typically does not show biologic activity. (1, p.48)
37. Normal body temperature is about 37oC.
38. Glycogen is a branched-chain homopolysaccharide made exclusively from a-D-glucose. The main stores of
glycogen in the body are found in the skeletal muscle and liver. The function of liver glycogen is to maintain the
blood glucose concentration particularly during early stages of a fast. (1, p. 135)
39. B
40. This process occurs in the cytosol and requires energy supplied by ATP (for the phosphorylation of glucose) and
uridine triphosphate. (1, p. 136)
41. Guanine is a purine base. Adenine is another purine base. 91, p. 343)
42. The Citric acid cycle, also known as the Krebs cycle, plays several roles in metabolism and its central function is
the oxidation of acetyl CoA to CO2 and H2O. Acetyl CoA is derived from the metabolism of fuel molecules such
as amino acids, fatty acids and carbohydrates. This oxidation accounts for about two-thirds of the total oxygen
consumption and ATP production. (1, p. 105)

Biochemistry
43. The effectrs of insulin on glucose metabolism are most prominent in three tissues: liver, muscle and adipose. In
the muscle and liver, insulin increases glycogen synthesis. (1, p. 273)
44. An antibiotic is a drug that kills or slows the growth of bacteria. Antibiotics are one class of antimicrobials, a larger
group which also includes anti-viral, anti-fungal, and anti-parasitic drugs. They are relatively harmless to the host,
and therefore can be used to treat infections. The term, coined by Selman Waksman, originally described only
those formulations derived from living organisms, in contradistinction to "chemotherapeutic agents", which were
purely synthetic. (http://en.wikipedia.org)
45. Glucagon and insulin are two hormones secreted by the alpha cells and beta cells of the pancreatic islets
respectively. Glucagon acts to maintain blood glucose levels by activation of hepatic glycogenolysis and
gluconeogenesis. On the other hand, insulin decreases the production of glucose by inhibiting gluconeogenesis
and breakdown of glycogen. 91, p. 273)
46. 7-Dehydrocholesterol, an intermediate in cholesterol synthesis, is converted to cholecalciferol (Vitamin D3) in the
47. Vitamins A and D are fat-soluble. These vitamins are released, absorbed and transported with the fat of the diet.
They are not readily excreted in the urine and significant quantities are stored in the liver and adipose tissue.
Consumption of these in excess of the RDA can lead to toxicity. The water-soluble vitamins like B and C are not
toxic, except as noted, and the amounts stored in the body id usually small. When ingested in excess of the
body’s needs, they are readily excreted in the urine and therefore must be continually supplied in the diet. (1, p.
321)
48. A
49. (4, p. 639)
50. A
51. Pepsin, an acid stable endopeptidase is secreted by the serous cells of the stomach as an inactive zymogen,
pepsinogen. Pepsinogen is activated to pepsin either by HCl or autocatalytically by other pepsin molecules that
have already been activated. (1, p. 231-232)
52. DNA is present not only in chromosomes in the nucleus of eukaryotic organisms but also in the mitochondria and
in the chloroplasts of plants. DNA is a polydeoxyribonucleotide that contains many monodeoxyribonucleotides
covalently linked by 3’,5’-phosphodiester bonds. (1, p. 357)
53. In the course of digestion of starch by salivary or pancreatic a-amylase, there is first formed soluble starch, then
dextrins giving blue or red colors with iodine, next achroodextrins, giving no color with iodine and finally maltose.
The amylase apparently catalyzes the hydrolytic splitting of every other glycoside bond thus producing maltose
units. (4, p. 95)
54. Using the enzyme DNA, sticky ends of a DNA fragment of interest can be covalently joined with other DNA
fragments that have sticky ends produced by cleavage with the same restriction endonuclease. The hybrid
combination of two fragments is called a recombinant DNA molecule. (1, p. 404)
55. The standard free energy of hydrolysis of ATP is approximately -7300 cal/mol for each of the two terminal
phosphate groups. Because of this large, negative standard free energy, ATP is called a high-energy phosphate
compound. Thus, hydrolysis of ATP is an energy producing reaction. (1, p. 65)
56. Lipids are a heterogenous group of water-insoluble (hydrophobic) organic molecules that can be extracted from
tissues by nonpolar solvents. (1, p. 163)
57. Transient hypoglycemia can cause cerebral dysfunction whereas severe hypoglycemia can cause brain death.
The most important hormone changes in combating hypoglycemia are elevated glucagons and epinephrine
combined with the diminished release of insulin. (1, p. 276)
58. Albumin is a globular protein as well as globulins. Albumins include ovalbumin from egg white, serum albumin
from blood serum, and lactalbumin from milk. (4, pp. 190-191)
59. The base pairs are held together by hydrogen bonds: two between Adenine and Thymine and three between
Cytosine and Guanine. The hydrogen bonds plus the hydrophobic interactions between the stacked bases,
stabilize the structure of the double helix. (1, p. 359)
60. Both DNA and RNA contain the same purine bases: adenine and guanine. Both also contain the pyrimidine
cytosine but they differ in the second pyrimidine base: DNA contains thymine whereas RNA contains uracil. (1, p.
343)
61. Some enzymes associate with a non protein cofactor that is needed for enzymatic activity. Commonly
encountered cofactors are metal ions (Zn and Fe ions) and organic molecules, known as coenzymes, that are
often derivatives of vitamins (for example, NAD+, FAD, coenzyme A). (1, p. 48)
62. Aerobic glycolysis requires the oxidation of most of the NADH by electron transport chain. Free energy is released
as electrons are transferred along the electron transport chain from an electron donor to an acceptor. (1, p. 69,96)
63. Nucleotides (ribonucleoside and deoxyribonucleoside phosphates) are essential for all cells, for without them,
neither DNA nor RNA can be produced. Nucleotides are composed of a nitrogenous base, a pentose
monosaccharide and one, two or three phosphate groups. The nitrogen-containing bases belong to the two
families of compounds: purines and pyrimidines. (1, p. 343)
64. The DNA encodes the information that directs the development of an organism which may involve production of
billions of cells. Each of these cells is specialized, expressing only those functions that are required for it to
perform its role in maintaining the organism. The DNA must be able not only to replicate precisely each time a cell
divides but also to have the information that it contains be selectively expressed. RNA participates in the
expression of the genetic information stored in the DNA. (1, p. 357)
65. Presence of ketones in urine suggests ketonuria while glycemia suggests presence of glucose in blood.
66. The genetic master plan of an organism is contained in the sequence of deoxyribonucleotides that constitute the
DNA. However, it is through the RNA “working copies” of the DNA that the master plan is expressed. The copying
process, which uses one of the two DNA strands as a template is called transcription. The mRNAs, which are
transcripts of certain regions of the DNA are translated into sequences of amino acids- the polypeptide chains. (1,
p. 377)
67. Each carrier of the ETC can receive electrons from an electron donor and can subsequently donate electrons to
the next carrier in the chain, ultimately to combine with oxygen and protons to form water. (1, p. 67)
68. Catabolic reactions serve to capture chemical energy (in the form of ATP) from the degradation of energy-rich fuel
molecules. Energy generation by degradation of complex molecules occurs in three stages: hydrolysis of complex
molecules into component building blocks, conversion of building blocks to simple intermediates and oxidation of
acetyl CoA. (1, p. 77)
69. The DNA encodes the information that directs the development of an organism which may involve production of

Biochemistry
divides but also to have the information that it contains be selectively expressed. (1, p. 357)
70. Ribose is involved in RNA while deoxyribose in DNA.
71. The Citric acid cycle, also known as the Krebs cycle, plays several roles in metabolism and its central function is
the oxidation of acetyl CoA to CO2 and H2O. Acetyl CoA is derived from the metabolism of fuel molecules such
as amino acids, fatty acids and carbohydrates. This oxidation accounts for about two-thirds of the total oxygen
consumption and ATP production. (1, p. 105)
72. B
73. The amino acids in general react with the compound ninhydrin (triketohydrindene) to yield carbon dioxide,
ammonia, and usually aldehyde containing one less carbon atom than the original amino acid. This test gives a
(+) blue color with proteins, peptones, peptides, amino acids and other primary amines including ammonia. (4, pp.
139, 181)
74. B
75. Xanthoproteic test gives a (+) yellow color to tryptophan and tyrosine. The reaction is due to the presence of the
phenyl group, with which the nitric acid forms certain nitro modifications. Millon-Nasse gives a (+) deep red color
to tyrosine due to the presence of hydroxyphenyl group. Hopkins-Cole gives a (+) reddish violet color at the zone
of contact of two fluids with tryptophan. (4, p. 179)
76. A
77. Bile acids are the most important organic components of bile. They contain 24 carbons with two or three hydroxyl
groups and a side chain that terminates in a carboxyl group. They have both polar and non polar face and can act
as emulsifying agents in the intestine. They provide the only significant mechanism for cholesterol excretion-both
as a metabolic product of cholesterol and as an essential solubilizer for cholesterol excretion in bile. (1, p. 210)
78. This is used in the Iodine Absorption Test. The solution will be decolorized if unsaturated acids are present. This
is due to the absorption of the iodine. The test should be controlled by shaking chloroform and iodine solution to
which no acid has been added. (4, p. 125)
79. B
80. C
81. Biuret test is given by those substances whose molecules contain two carbamyl (-CONH2) groups joined either
directly together or through a single atom of nitrogen or carbon. Proteins respond positively since there are pairs
of CONH groups in the molecule. (4, p. 180)
82. B
83. A
84. Phospholipids are lipids which on hydrolysis yield fatty acids, phosphoric acid and sometimes, but not always,
glycerol and a nitrogenous base. Choline is a nitrogenous base. (4, p. 113)
85. They occur more commonly than simple glycerides. (4, p. 117)
86. Glycosphingolipids which contain sphingosine and sugar residues as well as fatty acids, account for 5-10% of the
lipids of the plasma membrane. (2, p. 245)
87. A
88. A
89. Almost all glycolipids are derivatives of ceramides in which a molecule of fatty acid is attached to the
aminoalcohol, sphingosine. They are more precisely called glycosphingolipids. Globosides, gangliosides and
cerebrosides are examples. (1, p. 199-201)
90. The phosphate group on phosphatidic acid (PA) can be esterified to another compound containing an alcohol
group. Examples are phosphatidylserine (serine + PA); phosphatidylethanolamine ( ethanolamine + PA);
phosphatidylglycerol (glycerol + PA). (1, p. 191-192)
91. D
92. The formation of reddish violet zone at the junction is due to the formation of furfural and furfural derivatives by the
acid (H2SO4) on the sugar. (4, p. 82)
93. Glycogen ordinarily gives a red color with iodine although some forms of glycogen which give blue or purple colors
are known. These color differences are apparently related to the extent of chain branching, the blue color
representing relatively unbranched chains and the red color with iodine corresponding to highly branched chains.
(4, p. 97)
94. When a solution of reducing sugar is heated with phenylhydrazine, yellow crystalline compounds called osazones
are formed. Glucose, fructose and mannose will yield the same osazone because of similarities in their molecular
structures. Mannose will rapidly form an insoluble white phenylhydrazone at room temperature, the only common
sugar to do so. (4, p. 79, 82)
95. It is found in insects, crabs and lobster shells, etc. It serves a function in inverterbrates similar to that served by
cellulose in plants. It yields glucosamine and acetic acid on complete hydrolysis. (4, p. 98)
96. B
97. Pectins are colloidal carbohydrates which with the proper concentration of acid and of sugar form gels. On
hydrolysis, pectin yields galacturonic acid, arabinose, galactose, acetic acid and methyl alcohol. (4, p. 105)
98. Upon oxidation with nitric acid, galactose yields mucic acid. Mucic acid is COOH (CHOH)4 COOH, the H and OH
groups on carbon atoms 2 to 5 having the same spatial configuration as for galactose itself. (4, p. 71)
99. The mRNA carries the genetic information from the DNA to the cytosol where it is used as a template for protein
synthesis. It comprises only about 5% of the RNA in the cell yet is by far the most heterogenous type of RNA in
terms of size. (1, p. 379)
100. B
101. B
102. C
103.It is found in insects, crabs and lobster shells, etc. It serves a function in inverterbrates similar to that served by
cellulose in plants. It yields glucosamine and acetic acid on complete hydrolysis. (4, p. 98)
104. C
105.The bases of one strand are paired with the bases of the second strand so that an adenine is always paired with
thymine, whereas cytosine is always paired with a guanine. One polynucleotide chain of the DNA double helix is
always the complement of the other. (1, p. 359)
106. C
107. D
108.The addition of a pentose sugar to a base produces a nucleoside. The bases can be adenine, cytosine, guanine
or thymine. (1, p. 343-344)

Biochemistry
109.The genetic master plan of an organism is contained in the sequence of deoxyribonucleotides that constitute the
DNA. However, it is through the RNA “working copies” of the DNA that the master plan is expressed. The copying
process, which uses one of the two DNA strands as a template is called transcription. The mRNAs, which are
transcripts of certain regions of the DNA are translated into sequences of amino acids- the polypeptide chains. (1,
p. 377)
110. D
111. C
112. D
113. B
114.Galactosemia is a recessive disorder which refers to the accumulation of galactose 1 phosphate and galactitol in
nerve tissue, lens, liver, and kidney causing liver damage, severe mental retardation and cataracts. Management
includes rapid diagnosis and removal of galactose (therefore lactose) from diet. (1, p. 132)
115. D
116. B
117.The side chains of the basic amino acids like lysine, accept protons. At physiologic pH the side chains of lysine
are fully ionized and positively charged. (1, p. 5)
118.Urea is the major disposal form of amino groups derived from amino acids and accounts for about 90% of the
nitrogen-containing components of urine. It diffuses from the liver and is transported in the blood to the kidneys
where it is filtered and excreted in the urine. (1, p. 238)
119.This happens when the rate of formation of ketone bodies is greater than the rate of their use such that the levels
begin to rise in the blood. This is common in cases of starvation or severe diabetes mellitus. (1, p. 188)
120.Glutamine belongs to the group of amino acids with uncharged polar side chains. They have zero net charge at
neutral pH. (1, pp. 3-4)
121. B
122. C
123. C
124. B
125. C
126. C
127.Glycogen is a branched-chain homopolysaccharide made exclusively from a-D-glucose. The main stores of
glycogen in the body are found in the skeletal muscle and liver. The function of liver glycogen is to maintain the
blood glucose concentration particularly during early stages of a fast. (1, p. 135)
128.The DNA encodes the information that directs the development of an organism which may involve production of
divides but also to have the information that it contains be selectively expressed. It exists as a double stranded
molecule where the two strands wind around each other forming a double helix. (1, p. 357)
129.Urea is produced by the liver and then is transported in the blood to the kidneys for excretion in the urine. One
nitrogen of urea molecule is supplied y free NH3 and the other nitrogen by aspartate. The carbon and oxygen of
urea are derived from CO2. (1, p. 236)
130. C
131.The DNA encodes the information that directs the development of an organism which may involve production of
divides but also to have the information that it contains be selectively expressed. It exists as a double stranded
molecule where the two strands wind around each other forming a double helix. (1, p. 357)
132.Ammonia is produced from the metabolism of a variety of compounds. Though ammonia is involved in the
formation if urea in the liver, the level of ammonia in the blood must be kept low because even slightly elevated
concentrations are toxic to CNS. (1, p. 239)
133.Essential amino acids must be supplied specifically in the diet since the tissues are unable to synthesize them
while the non-essential amino acids are also supplied in the diet but they can also be formed from intermediates
by transamination using the amino nitrogen from other surplus amino acids. The 9 essential amino acids are:
histidine, leucine, isoleucine, lysine, methionine, phenylalanine, threonine, tryptophan, arginine and valine. (2, pp.
159, 627)
134.Purine nucleotides are sequentially degraded by the removal or alteration of portions of the nucleotide. The end
product of purine catabolism in humans is uric acid. Mammals other than primates oxidize uric acid further to
allantoin which in some animals other than mammals may be further degraded to urea or even ammonia. (1, p.
348)
135.Urea is the major disposal form of amino groups derived from amino acids and accounts for about 90% of the
nitrogen-containing components of urine. It diffuses from the liver and is transported in the blood to the kidneys
where it is filtered and excreted in the urine. (1, p. 238)
136.Glucosuria or glycosuria is the presence of appreciable amounts of glucose in the urine. Hematuria and
albuminuria refer to the presence of blood and albumin in the urine respectively. Glycosemia refers to the
presence of glucose in the blood.
137. D
138. B
139.Each tRNA molecule contains a three-base nucleotide sequence-the anti-codon –that recognizes a specific codon
on the mRNA. This codon specifies the insertion into the growing peptide chain of the amino acid carried by the
tRNA. Adenine (A) corresponds to Uracil (U), Cytosine (C) to Guanine (G) and Guanine (G) to Cytosine (C) in
RNA. (1, p. 392)
140.Bilirubin and its derivatives are collectively termed bile pigments. Jaundice, also known as icterus, refers to the
yellow color of the skin and sclerae caused by the deposition of bilirubin secondary to increased bilirubin levels in
the blood. It is not a disease itself but is usually a symptom of an underlying disorder. (1, p. 262)

Biochemistry
159, 627)
142.Pepsin is produced in the chief cells as the inactive zymogen, pepsinogen. This is activated to pepsin by H+ which
splits off a protective polypeptide to expose active pepsin; and by pepsin which rapidly activates further molecules
of pepsinogen (autocatalysis). (2, p. 636)
143.Gout is characterized by hyperuricemia (high levels of uric acid in the blood) with recurrent attacks of acute
arthritic joint inflammation caused by the deposition of uric acid crystals. (1, p. 350)
144.Biochemistry can be defined more formally as the “science concerned with the chemical basis of life”. (1, p. 1)
145.The mechanism by which tRNAs can recognize more than one codon for a specific amino acid is described by the
“wobble” hypothesis in which the base at the 5’end of the anticodon (the “first” base of the anti-codon) is not as
spatially defined as the other two bases. Movement of that first base allows non-traditional base pairing with the
3’-base of the codon (the “last” base of the codon. This movement is called “wobble” and allows a single tRNA to
recognize more than one codon. (1, p. 394)
146.Pepsin is produced in the chief cells as the inactive zymogen, pepsinogen. This is activated to pepsin by H+ which
splits off a protective polypeptide to expose active pepsin; and by pepsin which rapidly activates further molecules
of pepsinogen (autocatalysis). Pepsin initiates protein digestion by splitting denatured proteins into large
polypeptide derivatives. (2, p. 636)
147.This is the first step in the catabolism of most amino acids. It refers to the transfer of their alpha-amino group to
alpha-ketoglutarate which gives the products, alpha-keto acid and glutamate. (1, p. 234)
148.Ergosterol occurs in plants. UV irradiation cleaves the B ring giving rise to Vit D2 or ergocalciferol. (2, p. 617)
149. A
150.All the carbon and nitrogen atoms of porphyrin molecule are provided by two simple building blocks: glycine and
succinyl CoA. They condense to form ALA (amino levulinic acid) in a reaction catalyzed by ALA synthase. This
reaction requires pyridoxal phosphate as a coenzyme and is the rate limiting step in porphyrin biosynthesis. (1, p.
259)
151. C
152.The amino acids in general react with the compound ninhydrin (triketohydrindene) to yield carbon dioxide,
ammonia, and usually aldehyde containing one less carbon atom than the original amino acid. This test gives a
(+) blue color with proteins, peptones, peptides, amino acids and other primary amines including ammonia. (4, pp.
139, 181)
153.In proteins, amino acids are joined covalently by peptide bonds which are amide linkages between the a-carboxyl
group of one amino acid and the a-amino group of another. (1, p. 13)
154.Rennin is important in the digestive processes of infants because it prevents the rapid passage of milk from the
acted on by pepsin. (2, p. 636)
155.Glycoproteins are proteins to which oligosaccharides are covalently attached. The oligosaccharide components of
156. A
157.The alpha carbon of each amjno acid is attached to four different chemical groups and is thus a chiral or optically
active carbon atom. Glycine is an exception because its alpha carbon has two hydrogen substituents and thus is
optically inactive. (1, p. 6)
158.Kwashiorkor is caused by inadequate intake of protein in the presence of adequate intake of calories. It is usually
seen in children after weaning at about one year of age, when their diet consists predominantly of carbohydrates.
Symptoms include edema, skin lesions, depigmented hair, anorexia, enlarged fatty liver and decreased plasma
albumin concentration. (1, p. 317)
159, 627)
160.Heparin is a glycosaminoglycan and is an intracellular component of mast cells that line arteries, especially in liver,
lungs and skin.. It also serves as an anticoagulant. (1, p. 149)
161.The side chain of cysteine contains a sulfhydryl group (-SH) which is an important component of the active site of
many enzymes. In proteins, the –SH groups of two cysteines can become oxidized to form a dimmer, cystine
which contains a covalent cross-link called disulfide bond (-S-S). (1, p. 3)
162.At physiologic pH, the side chain of lysine is fully ionized and is positively charged. Lysine is an amino acid with a
basic side chain capable of accepting protons. (1, p. 5)
163.This is caused by mutation of a single base out of the 3 x 10 9 in the genome, a T-to-A DNA substitution which in
turn results in an A-to-U change in the mRNA corresponding to the sixth codon of the β-globin gene. (2, p. 476)
164.Dextrins are substances formed in the course of hydrolytic breakdown of starch. (2, p. 141)
165.Maltose is a disaccharide yielding two glucose units on hydrolysis. (2, p. 140)
166.If the oxygen on the anomeric carbon (the carbonyl group) of a sugar (like that of the aldehyde) is not attached to
any other structure, the sugar is a reducing sugar. A reducing sugar can react with chemical agents (Benedict’s
solution) and reduce the reactive component. (1, p. 121)
167. D
168.Cholesterol is probably the best known steroid because of its association with atherosclerosis. (2, p.253)
169.This will result in loss of water and formation of furfural derivatives. Seliwanoff’s test is a test for fructose (ketose)
where a red precipitate indicates a (+) result. (4, pp. 77, 86)
170. C
171.Monosaccharides are relatively stable in dilute acids but treatment with strong acids results in the loss of water
and formation of furfural and furfural derivatives. (4, p. 77)
172.Heparin is an anticoagulant found in the liver, spleen lung, thymus and blood. (4, p. 104)
173.In the presence of reducing sugars, the entire solution will be filled with a precipitate which may be red, yellow or
green in color depending on the amount of sugar present.
174. B
175. B
176.B
177.B
178.B

Biochemistry
179.B
180. C
181.Sphingomyelins are lipids containing the nitrogenous base sphingosine, a single fatty acid molecule, phosphoric
acid and choline but no glycerol. (4, p. 113)
182.C
183.A
184.A
185.C
186.C
187.B
188.B
189.A
190.C
191.C
192.A
193.C
194.D
195.B
196.A
197.C
198.D
199.B
200.C
201.A
202.B
203.Deficiency pf niacin or nicotinic acid causes pellagra, a disease involving the skin, GI tract and CNS. The
symptoms progress through the 3 Ds: Dermatitis, Diarrhea, Dementia, and if untreated, death. (1, p. 324)
204.Guanine is a purine base. (1, p. 349)
205.Maltose yields two glucose when hydrolyzed. (2, p. 135)
206.Folic acid is Vit B9, nicotinic acid is B3 and riboflavin is B2. Ascorbic acid is Vit C. (1, pp. 321-329)
207.Fructose is a ketohexose. (2, p. 135)
208. D
209.Two fatty acids are essential in humans: linolenic and linoleic acid. Arachidonic acid becomes essential if its
precursor, linoleic acid is missing in diet. (1, p. 173)
210.Biuret test is given by those substances whose molecules contain two carbamyl (-CONH2) groups joined either
directly together or through a single atom of nitrogen or carbon. Proteins respond positively since there are pairs
of CONH groups in the molecule. (4, p. 180)
211.When vitamin C or ascorbic acid acts as a donor of reducing equivalents, it is oxidized to dehydroascorbic acid,
which itself can act as a source of vitamin. (2, p. 612)
212.Lactate, formed by the action of lactate dehydrogenase, is the final product of anaerobic glycolysis in eukaryotic
cells. The formation of lactate is the major fate for pyruvate in RBCs, lens, cornea, kidney medulla, testes and
leukocytes.
213.Certain proteins are manufactured and secreted in the form of inactive precursor proteins known as proproteins.
When the proteins are enzymes, the preproteins are termed proenzymes or zymogens.
214. A
215.Sodium is the principal cation in the ECF. Potassium is the principal cation in the intracellular fluid. (2, p. 630)
216.Carbohydrates possessing a free or potentially free aldehyde or ketone group have the property of readily
reducing the ions of certain metals such as copper. When blue cupric hydroxide, suspended in alkaline medium
is heated, it is converted to insoluble black cupric oxide. In the presence of sugars, the cupric hydroxide is
reduced to insoluble red cuprous oxide. Sucrose is not a reducing sugar. (4, p. 78)
217.Night blindness is one of the earliest signs of vitamin A deficiency. The visual threshold is increased making it
difficult to see in dim light. Prolonged deficiency leads to an irreversible loss in the number of visual cells. (1, p.
333)
218.The digestion of proteins begins in the stomach which secretes gastric juice, a unique solution containing HCl and
the proenzyme pepsinogen. Pepsinogen is activated to pepsin either by HCl or autocatalytically by other pepsin
molecules that have already been activated. (1, p. 231-232)
219.Nucleosides are composed of a pentose sugar (ribose) and a base (adenine, cytosine, guanine, thymine or uracil).
220.Protein digestion begins in the stomach. As a result of contact with gastric HCl, proteins are denatured; ie. The
tertiary protein structure is lost as a result of the destruction of hydrogen bonds. This allows the polypeptide chain
to unfold making it more accessible to the actions of proteolytic enzymes. (2, pp. 635-636)
221.ATP acts as the energy currency of the cell, transferring free energy derived from substances of higher energy
potential to those of lower energy potential. (2, p. 115)
222.Rennin is important in the digestive processes of infants because it prevents the rapid passage of milk from the
acted on by pepsin. (2, p. 636). It is found in the stomach and not in milk.
223. A
224.Plant foods contain beta carotene which can be oxidatively cleaved in the intestine to yield two molecules of
retinal. This cleavage which utilizes molecular oxygen is enhanced by the presence of bile salts. (1, p. 331; 2, p.
614)
225.The hydrolysis of sucrose into glucose and fructose is frequently called inversion and thus, sucrose is called the
invert sugar. The hydrolysis may be produced by bacteria, enzymes and certain weak acids. (4, p. 91)
226.Two major types of nucleic acid are recognized in all cells, whether plant, animal or bacterial. These are generally
differentiated by the kind of carbohydrate present, 2-deoxyribose or ribose. (4, p. 199)
227.Hemoglobin is found exclusively in RBCs where its main function is to transport oxygen from the lungs to the
capillaries of the tissues. (1, p. 27)
228.Transaminases are important in transamination. This is the first step in the catabolism of most amino acids. It
refers to the transfer of their alpha-amino group to alpha-ketoglutarate which gives the products, alpha-keto acid
and glutamate.

Biochemistry
229.Porphyrins are cyclic compounds that readily bind metal ions usually Fe2+ or Fe3+. The most prevalent
metalloporphyrin in humans is heme which id the prosthetic group for hemoglobin, myoglobin and cytochromes.
(1, p. 257)
230.Fructose is found in fruit juices and honey. (2, p. 139)
231.A
232.Histones are small proteins that are positively charged at physiologic pH due to their high content of lysine and
arginine. (1, p. 372)
233.Glycosuria is presence of glucose in urine; ketonuria is the presence of ketones in urine; dysuria means pain on
voiding.
234. A
235.B
236.Genetic information, stored in chromosomes, and transmitted to daughter cells through DNA replication is
expressed through transcription to RNA and in the case of mRNA, subsequent translation into polypeptide chains.
This flow of information from DNA to RNA to protein is termed as “central dogma”. (1, p. 389)
237.RNA is the genetic material of certain viruses. In certain circumstances, the information in RNA can be transcribed
into DNA in a process known as reverse transcription. (1, p. 13)
238.A typical human cell contains chromosomes. (1, p. 371)
239.The pathway of protein synthesis is called translation because the “language” of the nucleotide sequence on the
mRNA is translated into the language of an amino acid sequence. This is divided into initiation, elongation, and
termination.
240.D
241.The genetic code is a dictionary that gives the correspondence between a sequence of nucleotide bases and a
consequence of amino acids. Each individual word is composed of three nucleotide bases. Characteristics of the
genetic code include specificity, universality, redundancy and non-overlapping and commaless. (1, pp. 389-391)
242.This is the first step in the catabolism of most amino acids. It refers to the transfer of their alpha-amino group to
alpha-ketoglutarate which gives the products, alpha-keto acid and glutamate. (1, p. 234)
243.Dextran is a polysaccharide produced by the action of certain bacteria on sucrose. It consist almost entirely of D-
glucose units joined in chains by 1,6-glycoside bonds with evidence for occasional cross linking between chains
by the formation of 1,4 bonds. (4, p. 103)
244.Pyrimidine dimmers can be formed in the skin cells of humans exposed to unfiltered sunlight. In xeroderma
pigmentosum, the cells can’t repair the damaged DNA resulting in extensive accumulation of mutations and
consequently skin cancers. (1, p. 374)
245.Transfer RNAs (tRNAs) the smallest of the three major species of RNA molecules, serve as adaptor molecules
that carry specific amino acid to the site of protein synthesis. They recognize the genetic code word that specifies
the addition of its amino acid to the growing peptide chain. (1, p. 379)
246.This results from IgE-dependent release of mediators (histamine, prostaglandins, leukotrienes, cytokines) from
sensitized basophils and mast cells on contact with appropriate antigen (allergen). (3, p. 727)
247.Ribosomal RNA (rRNA) is found in association with a number of different proteins as components of the
ribosomes- the complex structures that serve as the sites for protein synthesis. (1, p. 379)
248.Uracil, instead of thymine is contained in RNA, and thus, adenine will pair with uracil. (1, p. 378)
249.Nucleotides are composed of a nitrogenous base, a pentose monosaccharide and one, two or three phosphate
groups.
250.In proteins, amino acids are joined covalently by peptide bonds, which are amide linkages between the a-carboxyl
group of one amino acid and the a-amino group of another. (1, p. 13)
251. A
252.The condensation of acetyl CoA and oxaloacetate to form citrate is catalyzed by citrate synthase. In addition to
being an intermediate in the citric acid cycle, citrate provides a source of acetyl CoA for the cytosolic synthesis of
fatty acids. 91, pp. 106-107)
253.The alpha keratins are proteins that form tough fibers. They are found in the hair, nails and outer epidermal layer
of mammals. Alpha keratin is rich in cysteine which provides covalent disulfide cross-links between adjacent
polypeptide chains thus producing fibers that are insoluble and resistant to stretching. (1, p. 45)
254.B
255. B
256.Lactose is the principal sugar found in milk. It is a disaccharide composed of glucose and galactose. (1, p. 307)
257.The dietary precursor of prostaglandins is the essential fatty acid, linoleic acid. It is converted to the immediate
precursors of the prostaglandins- 20 carbon, polyunsaturated fatty acids containing 3,4 or 5 double bonds.
Arachidonic acid is the precursor of the predominant classes of prostaglandins. (1, p. 185)
258.The zwitterions form is the dipolar form of the amino acid. An amino acid contains both the NH3+ and the COO-
terminal ends. (1 p. 9).
259.Melanin is a pigment that occurs in a number of tissues in the body, particularly in the eye, hair, skin. The first
step in melanin formation from tyrosine is a hydroxylation to form dopa, catalyzed by the copper-containing
enzyme tyrosinase. Subsequent reactions leading to the formation of brown and black pigments are thought to be
catalyzed by tyrosinase or to occur spontaneously. (1, p. 267)
260.During mastication, salivary a-amylase (ptyalin) acts briefly on dietary starch in a random manner breaking some
a-(1,4) bonds. Remember that carbohydrates are the only dietary component for which degradation begins in the
mouth.
261. C
262.Serotonin is synthesized from tryptophan. It has multiple physiologic roles including pain perception, normal and
abnormal behaviors, including affective disorders and regulation of sleep, temperature and blood pressure. (1, p.
265)
263.A
264.Nucleic acids are required for the storage and expression of genetic information. There are two chemically distinct
types of nucleic acids- DNA and RNA. (1, p. 357)
265. A
266.HDL particles are excellent acceptors of unesterified cholesterol from the surface of cell membranes and from
other circulating lipoproteins. (1, p. 221)
267.Blood consists of solid elements, the red and white blood cells and the platelets, suspended in a liquid medium
,the plasma. Once the blood has clotted (coagulated), the remaining liquid phase (serum) lacks the clotting factors
that are normally present in plasma but have been consumed during the process of coagulation. (2, p. 707)

Biochemistry
268.Leucine, valine and lysine are all amino acids. Leucine and valine have non polar side chains while lysine has a
basic side chain. (1, pp. 2-4)
269.Collagen, elastin, and keratin are examples of common, well-characterized fibrous proteins. They have structural
functions in the body. (1, p. 38)
270.Plant foods contain B-carotene, which can be oxidatively cleaved in the intestine to yield two molecules of retinal.
However, in humans, the conversion is inefficient and vitamin A activity of B-carotene is only about one sixth that
of retinol.
271.Collagen, elastin, and keratin are examples of common, well-characterized fibrous proteins. They have structural
functions in the body. Collagen and elastin are found as components of skin, connective tissue, sclera and cornea
of eye and blood vessel walls whereas keratin is found in skin and hair. (1, p. 38)
272.Diseases of immediate type hypersensitivity result from IgE-dependent release of mediators from sensitized
basophils and mast cells on contact with appropriate antigen (allergen). Associated disorders include anaphylaxis,
allergic rhinitis, urticaria, asthma and eczematous (atopic) dermatitis. (3, p. 727)
273.Sickle cell anemia is the clinical manifestation of homozygous genes for an abnormal hemoglobin molecule. This
is caused by mutation of a single base out of the 3 x 10 9 in the genome, a T-to-A DNA substitution which in turn
results in an A-to-U change in the mRNA corresponding to the sixth codon of the β-globin gene. (2, p. 476)
274.Monoacylglycerols, diacylglycerols and triacylglycerols (formerly called –glycerides) consist of one, two or three
molecules of fatty acid esterified to a molecule of glycerol. Fatty acids are esterified through their carboxyl groups
resulting in a loss of negative charge and formation of a “neutral fat”. (1, p. 179)
275. A
276.Pancreatic secretion is a nonviscid watery fluid that is similar to saliva in its content of water and contains some
protein and other organic and inorganic compounds. The following are the enzymes that can be found: trypsin,
chymotrypsin, elastase, carboxypeptidase, pancreatic amylase, lipase. (2, p. 640)
277.Creatine and phosphocreatine spontaneously cyclize at as low but constant rate to form creatinine which is
excreted in the urine. The amount of creatinine excreted by the body is proportional to the amoun of creatine
phosphate content of the body. Any rise in blood creatinine is a sensitive indicator of kidney malfunction because
creatinine is normally rapidly removed from the blood and is excreted in urine. (1, p. 265)
278.Maltose is a disaccharide composed of two glucose units. It is also a product of enzymic digestion of
polysaccharides. It is found in significant quantities in beer and malt liquors. (1, p. 307)
279.The binding of hormones like epinephrine and glucagons to their specific cell-membrane receptors signals the
need for glycogen to be degraded—either to elevate blood glucose levels or to provide energy in exercising
muscles. This is a result of the cAMP-mediated activation of cAMP-dependent protein kinase. (1, p. 143)
280.Acidosis is indicated by a low pH due to the greatly increased production of acetoacetic acid and B-hydrobutyric
acid. This reflects the abnormalities in the metabolism of carbohydrate, lipid and protein that occur when plasma
levels of insulin are sharply reduced like in diabetes mellitus. (2, p. 827)
281.The alpha carbon of each amjno acid is attached to four different chemical groups and is thus a chiral or optically
active carbon atom. Glycine is an exception because its alpha carbon has two hydrogen substituents and thus is
optically inactive
282.7-Dehydrocholesterol, an intermediate in the cholesterol synthesis, is converted to cholecalciferol (Vit. D3) in the
283.The digestion of proteins begins in the stomach which secretes gastric juice, a unique solution containing HCl and
the proenzyme pepsinogen. Proteins are too large to be absorbed by the intestine and therefore must be
hydrolyzed to yield their constituent amino acids which can be absorbed. (1, p. 231)
284.Aerobic reactions occur in the mitochondria.
285.Glycoproteins are proteins to which oligosaccharides are covalently attached. The oligosaccharide components of
286.The thyroid gland produces two iodoamino acid hormones, 3,5,3’-thriiodothyronine (T3) and 3,5,3’5’-
tetraiodothyronine (T4, thyroxine), which have long been recognized for their importance in regulating general
metabolism, development and tissue differentiation. (2, p. 533)
287.Glycolysis is at the hub of carbohydrate metabolism where virtually all sugars ultimately can be converted to
glucose. Pyruvate is the end product of glycolysis in cells with mitonchondria and an adequate supply of oxygen.
(1, p. 87)
288.Monosaccharides are those carbohydrates that can’t be hydrolyzed into simpler carbohydrates. They may be
subdivided into trioses, tetroses, pentoses, hexoses, heptoses or octoses depending on the number of carbon
atoms they possess and as aldoses or ketoses depending on whether the aldehyde or ketone group is present. (2,
p. 135)
289.During the absorptive period, the liver takes up carbohydrates, lipids and most amino acids. These nutrients are
metabolized, stored or routed to other tissues. During this period, more amino acids are present than the liver can
use in synthesis of proteins and other nitrogen-containing molecules. The surplus amino acids are either released
into the blood for all tissues to use in protein synthesis or are deaminated with the resulting carbon skeletons being
degraded by the liver. Excess amino acids are not stored. (1, pp. 283-285; 2, p. 300)
290.Under aerobic conditions, pyruvate is taken up into mitochondria and after conversion to acetyl coA is oxidized to
CO2 by the citric acid cycle. (1, p. 180)
291.The two major muscle proteins are actin and myosin. Myosin contributes 55% of muscle protein by weight and
forms the thick filaments. (2, p. 689-690)
292.Hyaluronic acid is especially high in concentration in embryonic tissues and is thought to play an important role in
permitting cell migration during morphogenesis and wound repair. Its ability to attract water into the extracellular
matrix and thereby “loosen up” may be important in this regard. The high concentrations of hyaluronic acid and
chondroitin sulfates present in cartilage contribute to its compressibility. (2, p. 678)
293.Raffinose, also called melitose or melitriose is a trisaccharide. It is found in cotton seed, Australian manna, and
molasses obtained in the preparation of beet sugar. (4, p. 93)
294.A prosthetic group is a tightly bound coenzyme that does not dissociate from the enzyme. (1, p. 48)
295. A
296.Amylose is one of the 2 chief constituents of starch, a polysaccharide. It has a non-branching helical structure.
297.Aldoases are carbohydrates with an aldehyde as their most oxidized functional group. (1, p. 119)

Biochemistry

Biochemistry

Uploaded by

Copyright:

Available Formats

Biochemistry

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Biochemistry

Uploaded by

Copyright:

Available Formats

Biochemistry

B 1. The inhibition in a noncompetitive reaction:

A 4. Which hormone regulates the level of blood sodium?

C 6. Which of the following is a precursor of vitamin D?

A 8. The ionic property of amino acid is exhibited by its

D 9. All of the following are simple proteins except:

C 10.The simplest monosaccharide is __________

C 11. Denaturation of protein is a result of:

A 12. Competitive inhibition is a ______ reaction

C 16. The following are waxes except:

A 17. The inactive form of enzymes are called:

B 20. Milk curdling enzyme present in gastric juice of infants:

A 21. Carbohydrates are

C 22. Insulin is usually classified as:

A 23. What amount of glucose is present in the human blood?

C 25. The end product of the hydrolysis of glycogen is:

MANOR Review Center 66

B 27. Benedict’s reagent yield positive result to:

B 28. Hypertonic solutions will cause the cell to:

A 29. Rancidity of fats maybe due to :

C 30. The deficiency of this hormone causes diabetes mellitus:

A 31. The active proteolytic enzyme in gastric juice is:

B 32. The site of oxidation reaction in electron transport chain is in the

B 33. Protein digestion starts in the

A 34. The conversion of an amino acid to sugar is:

B 35. Which of the following is not an amino acid?

A 36. The protein part of the enzyme molecule is the:

C 37. Optimum temperature for enzyme activity in the body:

B 38. Glucose is stored in the liver as:

B 39. The enzyme conformation adapts to the incoming substrate in

B 40. The process of converting glucose into glycogen is called:

A 41. All are pyrimidine bases except:

A 43. A hormone which stimulates glycogenesis:

A 48. It is the entire genetic make up of an organism

A 50. It is a model which best explains the enzyme-substrate action:

MANOR Review Center 67

D 51. The activation of pepsinogen requires:

B 52. DNA is primarily found in the

B 53. It is the enzyme which hydrolyzes starch to dextrin and maltose:

D 54. A synthetic DNA is called

B 55. Hydrolysis of ATP is an

C 56. Which of the following is a characteristic of lipid?

A 57. It is a condition that results when sugar level is below normal

A 58. An example of globular protein

C 60. Which nitrogen base is not found in DNA?

C 61. An organic cofactor in an enzyme

B 62. At what stage of glucose oxidation is most of the energy produced?

C 64. It is responsible for the storage and transmission of genetic information

C 65. Build up of urea in the kidney is called

D 67. What is the end product of electron transport chain?

B 68. The energy producing reaction

A 69. It is the molecule that directs the activity of the cells

C 70. The sugar involved in DNA

C 71. The common metabolic pathway is

B 72. Rosenheim’s test is used to detect the presence of:

C 73. Detects the presence of alpha amino acids:

B 74. The process of producing fats from acetyl Co-A is called:

MANOR Review Center 68

B 77. The substance responsible for the emulsion of fats is:

B 78. Hubl’s solution if used to ascertain degree of: