18/04/2016

A
CODE

Regd. Office : Aakash Tower, Plot No.-4, Sec-11, MLU, Dwarka, New Delhi-110075
Ph.: 011-47623456 Fax : 011-47623472

MM : 720 Test Series : Test – 9 (Objective) Time : 3 Hrs.

(for AIPMT - 2016 )
Topics Covered :
Physics : Magnetic Effects of Current and Magnetism

Chemistry : General Principles and Processes of Isolation of Elements, p-Block Elements (Group 15-18), d and f
Block Elements, Coordination Compounds
Botany : Molecular Basis of Inheritance

Zoology : Evolution

Instructions :
(i) Use Blue/Black ball point pen only to darken the appropriate circle.
(ii) Mark should be dark and should completely fill the circle.
(iii) Dark only one circle for each entry.
(iv) Dark the circle in the space provided only.
(v) Rough work must not be done on the Answer sheet and do not use white-fluid or any other rubbing material on
Answer sheet.
(vi) Each question carries 4 marks. For every wrong response 1 mark shall be deducted from total score.

PHYSICS
Choose the correct answer :
1. A proton, deutron and an alpha particle with same 3. A long wire carries a steady current. It is bent into
momentum enter a region of uniform magnetic field coil of one turn such that magnetic field at centre is B.
at right angle to the field. The ratio of radii of their If same wire bent into smaller radius of 4 turns then
circular path is
magnetic field at centre will be
(1) 1 : 1 : 1
(2) 2 : 2 : 1 B
(1) 4B (2)
(3) 1 : 1 : 2 4
(4) 1 : 1 : 4
2. For diamagnetic material, the dependence of B
(3) (4) 16B
magnetic susceptibility on absolute temperature given 16
as
4. A charged particle enters in a region of magnetic field
(1) X  T
in perpendicular direction, then its
1
(2) X  (1) KE changes but momentum remains constant
T
(3) X  T 0 (2) Momentum changes but KE remains constant

1 (3) Both KE and momentum remain constant

(4) X  2
T (4) Both KE and momentum will change
(1)
Test-9 (Code A) Test Series for Medical - 2016
5. To convert an ammeter into voltmeter, we must 10. A charge q moving in a circular orbit of radius r
connect with ammeter makes n revolution per second, the magnetic field
(1) Low resistance in series produced at centre will be

(2) High resistance in series 0qn 0 n 2 q

(3) Low resistance in parallel (1) (2)
2r 2r
(4) High resistance in parallel
6. A beam of electrons and protons move parallel to  0 nq
(3) Zero (4)
each other in opposite direction, then they 2r
(1) Attract each other 11. A current carrying circular coil of magnetic dipole
(2) Repel each other moment M is placed in region of magnetic field B
with its plane parallel to magnetic field, then its
(3) Neither attract nor repel
potential energy will be
(4) First repel then attract
(1) MB (2) –MB
7. Magnetic dipole moment of system of two circular
current loops is (3) Zero (4) –2MB
12. A circular wire of radius r carries a current i. The
energy density at centre of loop is
i
i
r 0 i 2 0 i 2
(1) (2)
r2 2r 2

0 i 2 0 i 2
(1) Zero (2) 2r2i (3) (4)
4r 2 8r 2
(3) 2r 2 i (4) 2 2r 2 i 13. A uniform electric field and a uniform magnetic field
8. The wire loop formed by joining two semicircular are acting in same direction in given region. If a
sections of radius R and 2R carries current i, as proton is projected in direction of two fields then its
shown in figure. The magnetic field at centre will be path will be
(1) Straight line (2) Circular
2R (3) Helical (4) Parabolic
14. The area enclosed in the hysteresis loop is
proportional to
R
(1) Magnetic energy per unit volume
0 i 0 i
(1) (2) (2) Thermal energy per unit volume
2R 4R
(3) Electrical energy per unit volume
0 i 20 i
(3) (4) (4) Mechanical energy per unit volume
8R R
15. The lines joining same value of horizontal component
9. Two small bar magnets each of magnetic moment M of magnetic field of Earth are
are placed as shown in figure, the magnetic dipole
moment of system (1) Aclinic line (2) Isogonic line

S (3) Isodynamic line (4) Isoclinic line

16. At a place true dip is 45º and apparent dip is 60º.
60 If plane of dip circle is rotated by 90º, then dip
N S shown by it will be

N 1 3
(1) 30º (2) cos
2
(1) M (2) M 2
M 1 2 1 2
(3) M 3 (4) (3) cot (4) sin
2 3 3

(2)
Test Series for Medical - 2016 Test-9 (Code A)
17. A U-shaped wire having current i is placed in region 23. A semicircular wire of radius R carrying current I is
of magnetic field as shown in figure, the magnetic placed in uniform magnetic field B, as shown in
force acting on wire is figure, then force acting on wire will be
B
l i
i
r B
C

i
l (1) RiB (2) 2iRB
(3) Zero (4) 2RiB
(1)  r  2l  Bi (2)  r  2l  Bi
24. The variation of magnetic field due to current carrying
(3) 2Bir (4) 2Bil solid rod with distance from axis given as

18. A current in tangent galvanometer produces

(1) B (2) B
deflection of 30º. If plane of coil of tangent
galvanometer is rotated by 90º, then new deflection
with same current will be
(1) 30º (2) 60º
(3) Zero (4) 45º x x
x=R x=R
19. Two circular coils having radius in the ratio 1 : 2 and
number of turns in ratio 1 : 4 are connected in series
(3) B (4) B
then ratio of magnetic field at centre
(1) 1 : 2 (2) 2 : 1
(3) 1 : 4 (4) 4 : 1
20. A horizontal wire carries current from east to west x x
x=R x=R
then number of neutral points obtained is
(1) One 25. If a current carrying closed loop is placed in region
of magnetic field, then force and torque acting on
(2) Two loop are
(3) Infinite
i
(4) Neutral point not obtained
B
21. A thin bar magnet has magnetic dipole moment M is i
bent at mid-point so that angle between both parts
at bent is 60º, the new magnetic dipole moment will (1) F = 0, T = 0 (2) F = 0, T  0
be
(3) F  0, T = 0 (4) F  0, T  0
M
(1) M (2) 26. Gyromagnetic ratio of circulating electron is
2
e e
(3) 2M (4) M 3 (1) (2)
m 2m
22. The magnetic field applied in cyclotron is 3.14 T. The
frequency of electric field that must be applied 2e e
between dee’s to accelerate proton is approximately (3) (4)
m 4m
(1) 107 Hz 27. Dimensional formula of Bohr magneton is
(2) 5 × 107 Hz (1) [AL–2] (2) [AL]
(3) 2.5 × 107 Hz (3) [AL2] (4) [A–1L2]
(4) 5 × 108 Hz
(3)
Test-9 (Code A) Test Series for Medical - 2016
28. A square current loop of side l and having current
has magnetic dipole moment is 35. A bar magnet of magnetic dipole moment  5iˆ
ampere-m 2 is placed in region of magnetic field
(1) Zero (2) il 2 
 
B  2iˆ  3 jˆ  4kˆ tesla, the magnitude of torque
il 2 il 2 acting on magnet is
(3) (4)
2 4
(1) Zero
29. For a bar magnet, ratio of magnetic length and
(2) 10 Nm
geometrical length is
(3) 15 Nm
1 3
(1) (2) (4) 25 Nm
2 4
36. A charge particle moves in region of magnetic field,
6 9 the direction of magnetic force acting is
(3) (4)
7 10
y
30. When plane of dip circle is rotated by 90º from
magnetic meridian gradually, then dip shown by it v
(1) Increases
+q

(2) Decreases
x
(3) First increases then decreases
(1) Positive x-axis
(4) First decreases then increases
(2) Negative x-axis
31. At a place vertical component of magnetic field of
earth is 3 times that of horizontal component, (3) Positive z-axis
then angle of dip at that place will be (4) Negative z-axis
(1) 30º (2) 45º 37. Two long parallel wires having current I and 3I are
(3) 60º (4) 90º placed at a distance d apart as shown in figure. The
net magnetic field at point P is zero, then distance
32. When a bar magnet is kept its magnetic dipole x is
moment anti-parallel to horizontal component of
magnetic field of earth then number of neutral point
obtained will be
I 3I
(1) One (2) Two P
x
(3) Four (4) Infinite d
33. Two charge particles having same mass and charge
enter in region of magnetic field in perpendicular with d d
(1) (2)
speed V1 and V2 in such a way V1 V2 , then their 3 4
time period are related as
d d
(1) T1 = T2 (2) T1 > T2 (3) (4)
6 8
(3) T1 < T2 (4) T 1 T2
38. A charge particle passes undeflected in region of
34. A magnetic field exerts force on a charge particle crossed electric and magnetic field. If electric field is
switched off while magnetic field is maintained then
(1) Always charge particle will move in
(2) Never (1) Circular path
(3) When charge particle moves along magnetic (2) Parabolic path
field
(3) Straight path
(4) When charge particle moves across magnetic
field (4) Elliptical path

(4)
Test Series for Medical - 2016 Test-9 (Code A)
39. A long straight wire carrying current is placed in 43. Variation of magnetic field with distance from centre
horizontal plane near a square loop carrying same along axis of current carrying ring is given as
current as shown in figure, force between them is
(1) B (2) B

I I

x x
(1) Attractive
B B
(2) Repulsive
(3) Zero (3) (4)
(4) First attractive then repulsive
x x
40. Curie law is obeyed by iron
44. Two infinite parallel wires are lying at distance of
(1) At Curie temperature
1 m. If the current flowing in each wire is 1 ampere
(2) Below Curie temperature then force per unit length between them is
(3) Above Curie temperature (1) 2 × 10–7 N
(4) At all temperature (2) 2 × 10–8 N
41. If number of turns, area of coil and magnetic field in (3) 2 × 10–9 N
moving coil galvanometer becomes doubled then
(4) 2 × 10–11 N
current sensitivity becomes
45. A magnet of length 3l and magnetic moment M is
(1) Half (2) Double
broken into two parts of length l and 2l. They are
(3) Four times (4) Eight times now placed perpendicular to each other. The
magnetic dipole moment of combination is
42. A rectangular coil of 500 turns and area 2  10–4m2
carries 100 mA current. It is suspended in a uniform
M 3 2M
magnetic field of 10–3 tesla. If plane of coil makes an (1) (2)
angle 60° with it, then torque on coil is 7 3

(1) 5  10–4 N-m (2) 5  10–5 N-m

M 3 M 5
(3) 5  10–6 N-m (4) 5  10–7 N-m (3) (4)
5 3

CHEMISTRY
46. Which of the following does not contain magnesium? 48. Purification of bauxite ore containing chief impurities
of Fe2O3 can be done by
(1) Carnallite
(2) Dolomite (1) Bayer’s process (2) Serpeck’s process
(3) Magnesite (3) Hall’s process (4) All of these
(4) Malachite 49. For the following reaction
47. Correct match among the following are
4Ag  8NaCN  2H2O  O2  A
Column I Column II (complex)

a. Frothers (i) KCN

Zn
b. Depressant (ii) K-ethyl xanthate   B  Ag 
(complex)
c. Collectors (iii) CaCO3
Correct for the above reaction is/are
d. Basic flux (iv) Pine oil
(1) Co-ordination number is 4 in complex B
(1) a(i), b(iii), c(iv), d(ii)
(2) a(iv), b(i), c(ii), d(iii) (2) Process is oxidation-reduction

(3) a(iv), b(ii), c(iii), d(i) (3) Complex ‘A’ is soluble

(4) a(i), b(iii), c(ii), d(iv) (4) All are correct
(5)
Test-9 (Code A) Test Series for Medical - 2016

50. For which of the following reaction  G° versus 57. Reactions occurs in the blast furnace during the
temperature have negative slope? extraction of Fe are

(1) C(s) + O2(g)  CO2(g)  1073 K

(1) Fe2 O3  3CO  2Fe  3CO2
1
(2) CO(g)  O2 (g)  CO2 (g)  1073 K
(2) Fe2 O3  3C  2Fe  3CO
2

1 (3) CaO  SiO2  CaSiO3

(3) C(s)  O2 (g)  CO(g)
2
(4) All of these
(4) Mg(s) + O2(g)  MgO(s)
58. Incorrect match among the following are :-
51. Thomas slag is
a. Purification of Ni – Van Arkel method
(1) Calcium silicate
(2) Calcium phosphate b. Zn, Cd, Hg – Distillation method

(3) Tricalcium phosphate and calcium silicate c. Si, Ge, Ga – Zone refining
(4) Calcium ammonium phosphate d. Lanthanoid separation – Chromatography
52. Which of the following reaction occur in reverberatory (1) b, c only (2) a only
furnace?
(3) c only (4) a, d only

(1) CuCO3 . Cu(OH)2  2CuO  H2O  CO2
59. NH3 + Cl2 A + HCl
 (excess)
(2) 2PbS  3O2  2PbO  2SO2 H2O


(B) + 3HOCl
(3) ZnS  2O2   ZnSO 4
H2O + CrCl3
(4) All of these
C
53. Correct for the following graph is/are (green ppt.)

Correct for the reaction (green ppt) is

l O3
2/3 A 2
l+ O2  (1) A = NH4Cl, B = NCl3
4/3 A
G° gO
 2M (2) A = NCl3, B = N2
+ O2
2Mg (3) A = N2, C = Cr(OH)3
(4) A = NCl3, B = NH3, C = Cr(OH)3
1673 K
60. NaOH can absorb
T
(1) Mg will be good reducing agent below 1673 K (1) N2O5 (2) N2O
(2) Al will be good reducing agent below 1673 K (3) NO (4) All of these
(3) Al2O3 will be good reducing agent after 1673 K 61. H2N–CONH2 + HNO2  gas
(4) Both (1) & (3) Gas can be
54. Which of the following metals is not extracted by
(1) N2 (2) N2O
electrolysis?
(3) NO (4) NO2
(1) Na (2) Al
(3) Cu (4) Fe Cu + HNO3 Cu(NO3)2 + gas A
62. dil
< 250
55. Copper matte is Product C
Cu + HNO3 Cu(NO3)2 + gas B
(1) Cu2S + FeSiO3 (2) Cu2S + FeO Conc

(3) Cu2S + FeS (4) FeSiO3 + Cu

Correct for the above reaction is
56. Maximum percentage of iron is present in
(1) A = NO (2) C = N2O3
(1) Cast iron (2) Pig iron
(3) B = NO2 (4) All of these
(3) Wrought iron (4) Steel
(6)
Test Series for Medical - 2016 Test-9 (Code A)

Cold 74. Correct match among the following are

63 P2 O5  H2O   Pr oduct A
(a) ClO4– > ClO3– > ClO2– > ClO– Stability order
Product A is
(1) Orthophosphoric acid (b) Cl2 > Br2 > F2 > I2 Bond strength

(2) Metaphosphoric acid (c) OF2 < OCl2 < ClO2 Bond angle
(3) Pyrophosphoric acid (d) l– > Br– > Cl– Reducing power
(4) Hypophosphoric acid
(1) (a), (b), (d) (2) (b), (d)
64. The catalyst used in the contact process is
(3) (a), (c), (d) (4) All of these
(1) Fe2O3 (2) V2O5
75. Hydrolysis of which of the following is not the
(3) SO3 (4) Ag2O
example of redox reaction?
65. Number of P–O–P bonds present in P4O6 are
(1) XeF3 (2) XeF4
(1) 4 (2) 5
(3) XeF6 (4) XeO2F2
(3) 6 (4) 8
66. The hybridisation of S in SF4 is: 76. Iron may be rendered passive by treatment with a
concentrated solution of
(1) dsp2 (2) sp3
(1) KSCN (2) H2C2O4
(3) sp3d (4) sp3d2
67. Oxidation state of NO in brown ring complex is (3) Hg2(NO3)2 (4) HNO3

(1) 0 (2) +1 77. The calomel is

(3) +2 (4) –1 (1) HgCl2
68. Which of the following does not contain S–S
(2) Hg2Cl2
linkage?
(1) H2S2O3 (2) H2S2O6 (3) Hg2(NO3)2

(3) H2S2O8 (4) All of these (4) HgSO4

69. O3 can oxidise 78. Aqua-regia reacts with Pt to yield
(1) K4[Fe(CN)6] (2) BaO2
(1) Pt(NO3)4 (2) H2PtCl6
(3) HgO (4) KMnO4
(3) PtCl4 (4) PtCl2
70. The anhydride of HClO4 is
79. Which of the following ions, the colour is due to
(1) Cl2O (2) ClO2
d-d transition?
(3) Cl2O6 (4) Cl2O7
(1) CrO42– (2) Cr2O72–
71. Consider the following statements
(3) MnO42– (4) MnO4
(a) OF2 is an acid anhydride
(b) Bleaching action of SO2 is due to reduction Na2CO3 + O2 H2SO4
80. Chromite ore A B
(c) Ozone reacts with moist iodine to form HIO3 NaOH

Incorrect among the following is/are Correct among the following are
(1) (a), (b) (2) (b), (c) (1) A = Cr2O42–
(3) (a), (c) (4) (a) only (2) B = Cr2O72–
72. Acidified KIO3 converts into I2 by
(3) A = CrO42–
(1) O3 (2) KMnO4
(4) Both (2) & (3)
(3) SO2 (4) H2SO4
73. Which of the following pair are mixed anhydride? 81. Test of ozone (O3) can be done by

(1) Cl2O, ClO2 (2) ClO2, Cl2O6 (1) Ag (2) Hg

(3) NO2, Cl2O6 (4) Both (2) & (3) (3) Au (4) Cu
(7)
Test-9 (Code A) Test Series for Medical - 2016
82. Bordeaux mixture is 87. Consider the following statement
(1) CaSO4 + Cu(OH)2 (2) CuSO4 + Ca(OH)2 4
(a)  t  0
(3) CuSO4 + CaO (4) CuO + CaO 9
83. Amongst the following which have the highest (b) d x2 –y 2  d xy (square planar complex)
paramagnetism?
(1) [Cr(H2O)6]3+ (2) [Fe(H2O)6]2+ (c) CFSE of 4d is 50% more than 3d

(3) [Cu(H2O)4]2+ (4) [Zn(H2O)6]2+ (d) Zeise’s salt is  bonded complex

84. Which of the following complex will show Incorrect statement is/are
geometrical as well as optical isomerism? (1) a, b only (2) a, b & c
(1) [Pt(NH3)2Cl2] (2) [Cu(NH3)4]2+ (3) a, d (4) d only
(3) [Cr(en)2Cl2]+ (4) [Co(NH3)4Cl2] 88 [Ni(CO)4] is diamagnetic. Correct statement for the
complex is
85. NiCl2 + NH4OH + dimethylglyoxime  A (1) (C–O) bond length during complex formation
Complex
increases
Correct statement for complex A is/are
(2) CO will act as strong field ligand
(1) Coordination number of metal ion is 4
(3) Complex have tetrahedral geometry
(2) Two five membered and two six membered rings
(4) All of these
are present
89. CuCl is insoluble in water but it dissolve in KCl
(3) Colour of the precipitate is red
solution. This is due to the formation of complex
(4) All are correct
(1) K2[CuCl3] (2) K3[CuCl4]
86. Which of the following configuration of ions has zero
(3) K[CuCl2] (4) All of these
CFSE in both strong and weak field ligands in
octahedral complex? 90. CFSE (0) will be maximum in
(1) d 10 (2) d8 (1) [Co(H2O)6]3+ (2) [Co(NH3)6]3+
(3) d 6 (4) d 4 (3) [Co(CN)6]3– (4) [Co(C2O4)3]3–

BOTANY
91. DNA differs from RNA in possessing (1) Last peptide bond formation takes place
between glycine and leucine
(1) Cytosine (2) Guanine
(3) Thymine (4) 5 methyl uracil (2) Ribosome moves from codon to codon along the
mRNA
92. Find the correct match.
(3) First amino acid is proline present at A-site
(1)  174 phage - 5386 ribose sugars in genetic
material (4) Last codon of mRNA is CUU
(2)  phage - 97004 ribonucleotides 94. In DNA molecule two polynucleotide chains are
(3) E. coli - 4.6 × 106 base pairs different in

(4) Human - 3.3 × 109 nucleotides in genome (1) Number of purine and pyrimidine bases
93. Find out the correct statement w.r.t. diagram (2) Polarity
representing translation in bacteria.
(3) Molecular weight

(4) More than one option is correct

95. Central Dogma was proposed by

(1) Francis Crick

(2) James Watson

(3) F. Miescher

(4) Erwin Chargaff

(8)
Test Series for Medical - 2016 Test-9 (Code A)
96. Find the correct statement w.r.t. DNA 102. Meselson and Stahl performed their experiment in
1958 by using E.coli and
(1) Always form a double helical structure made up
of two strands (1) Growth medium containing radioactive sulphur

(2) It is an acidic substance present in nucleus was (2) Growth medium containing radioactive
first identified by F. Miescher in 1869 phosphorus

(3) Phosphate group is linked to 5 – OH of the (3) Growth medium containing heavy isotope of
nitrogen
same nucleoside by glycosidic linkage for back-
bone formation (4) Growth medium containing cesium chloride and
thymidine
(4) All four deoxynucleotides are always equally
present in both the strands 103. DNA replication is
97. Nucleosome consists of all, except (1) Polymerisation of nucleotides by RNA
dependent DNA polymerase activity
(1) 400 nucleotides
(2) Energetically very expensive process
(2) Basic proteins
(3) An important process of central dogma to form
(3) Lysine and aspartic acid rich proteins RNA and proteins
(4) Histone octamer (4) Polymerisation of nucleotides catalysed by
polymerase enzyme in one direction, that is
98. Mark correct one w.r.t. euchromatin.
3  5
(1) Transcriptionally inactive
104. How many enzymes or proteins are concerned with
(2) Densely packed chromatin DNA replication in E.coli?

(3) Lightly stained chromatin Poly A polymerase, Polynucleotide phosphorylase,

(4) More than one option is correct P r i mas e , To po i s o mer a s e, RNA l i ga s e,
Aminoacyl-tRNA synthetase, DNA polymerase
99. The unequivocal proof that DNA is the genetic
material came from the experiment of. (1) 2 (2) 3

(1) Avery, MacLeod and McCarty, they worked with (3) 4 (4) 5
E.coli 105. Mark the mis-matched pair.
(2) Frederick Griffith, he worked with Streptococcus (1) Release factor – Termination of
pneumoniae translation
(3) Avery, MacLeod and McCarty, they worked with (2) Mini-satellites – Exons
Bacteriophage
(3) Guanyl transferase – Capping of hnRNA
(4) Hershey and Chase, they worked with
(4) Split gene arrangement – Ancient feature of
bacteriophage and bacteria
genome
100. Which of the following feature is represented by
106. Find odd one w.r.t structure of transcription unit.
chemically less reactive and structurally more stable
nucleic acid? (1) Promoter

(1) 3 OH group (2) Terminator

(2) Catalytic nature (3) mRNA

(3) Scope of rapid mutation (4) Structural gene

107. “The DNA sequence coding for tRNA and rRNA
(4) Direct involvement in protein synthesis
molecule also define a gene” and segment of DNA
101. The DNA in nucleoid is organised in coding for a polypeptide could be said as
(1) Small loops held by histones (1) UTR
(2) Large loops held by nucleosomes (2) Cistron

(3) Small loops held by basic proteins (3) VNTR

(4) Large loops held by polyamines (4) Intron

(9)
Test-9 (Code A) Test Series for Medical - 2016
108. Find the correct statement w.r.t. transcription 115. Which of the following enzymes did not affect
transformation in bacteria?
(1) There is single DNA dependent RNA polymerase
that catalyses transcription of all types of RNA (1) Nuclease, Protease
in plant cell (2) DNase, RNase
(2) Elongation is controlled by sigma factor (3) Protease, RNase
(3) Rho factor terminates the transcription, when it (4) RNase, DNase, Protease
associates with DNA polymerase enzyme
116. In DNA fingerprinting, the ‘probe’ is
(4) Alteration of specification of RNA polymerase is
due to association of  or  factor during (1) Radioactive single stranded DNA molecule
transcription (2) Radioactive double stranded DNA molecule
109. Teminism is concerned with________activity. (3) Radioactive single stranded RNA molecule
(1) DNA dependent DNA polymerase
(4) Radioactive double stranded RNA molecule
(2) RNA dependent RNA polymerase
117. In lac operon system, -galactosidase is coded by
(3) RNA dependent DNA polymerase
(1) i-gene (2) a-gene
(4) DNA dependent RNA polymerase
(3) z-gene (4) y-gene
110. Complementary sequence of genetic codon is
present on/in 118. Find correct statement w.r.t. capping
(1) rRNA (1) Attachment of ribosomes on mRNA during
(2) mRNA protein synthesis
(3) tRNA (2) Binding of SSB proteins during replication on
(4) More than one option is correct single strands of DNA
111. How many of the following statements are correct (3) Addition of unusual nucleotide to heterogenous
w.r.t. genetic code? nuclear RNA
a. The codon is read in mRNA in a contiguous (4) Binding of RNA polymerase with promoter site
fashion
119. How many amino acids can be polymerised by given
b. All 64 codons are specific for amino acids.
mRNA sequence during translation in a bacteria?
c. UGG is ambiguous and degenerate codon
5AUGUCCACGAUAGACUGAUAA3
d. Due to degnerate code, prediction of mRNA is
not accurate. (1) Two (2) Six
(1) One (2) Two (3) Three (4) Five
(3) Three (4) Four 120. A very ambitious project of sequencing of human
112. The adapter molecule is genome was launched in the year
(1) Soluble RNA (1) 1990
(2) tRNA (2) 2003
(3) mRNA
(3) 2006
(4) More than one option is correct
(4) 1953
113. In eukaryotic cells, charging of tRNA occurs in
121. Find odd one w.r.t salient feature of human genome
(1) Cytoplasm (2) Nucleoplasm
(1) Human genome contains 316.4 million base pair
(3) Ribosomes (4) Nucleolus
114. RNA with unusual bases is/are (2) Less than 2 percent of the genome code for
proteins
(1) hnRNA
(2) tRNA (3) Most genes present on chromosome 1
(3) mRNA (4) Large portion of the human genome made up of
(4) More than one option is correct repeated sequences
(10)
Test Series for Medical - 2016 Test-9 (Code A)
122. Find the incorrect match 129. Read the following statements.
(1) SNPs-Single Nucleotide Polymorphism A. Severo Ochoa enzyme is helpful in
polymerisation of RNA in template independent
(2) ESTs-Expressed Sequence Tags manner.
(3) VNTRs-Variable Number of Tandem Repeats B. Regulation of lac operon by repressor is referred
to as negative regulation.
(4) UTRs-Untranscribed Regions
Mark correct option
123. A : Regulation of transcription is the primary step for (1) Only A is correct
regulation of gene expression in prokaryotes.
(2) Both statements are incorrect
B : Tryptophan operon is under negative regulation.
(3) Both statements are correct
(1) A & B both are correct
(4) Only B is correct
(2) Only A correct
130. Some mutations can be silent because of
(3) A & B both are incorrect
(1) Non-ambiguous codon
(4) Only B correct
(2) Degeneracy of codon
124. Find the correct sequence of various steps of DNA
(3) Termination codon
fingerprinting technique
(4) Dual function of codon
A. Digestion of DNA by restriction endonucleases
131. Allolactose in lac operon acts as
B. Hybridisation using labelled VNTR probe
(1) Corepressor (2) Inhibitor
C. Autoradiography
(3) Inducer (4) Repressor
D. Blotting
132. Mark odd one (w.r.t. regulation of gene expression in
(1) A  B  C  D
eukaryotes)
(2) A  D  B  C
(1) Translational level
(3) B  C  A  D
(2) Formation of primary transcript
(4) B  D  A  C
(3) Regulation of splicing
125. Lalji Singh and V.K. Kashyap are Indian experts in
the field of (4) Transport of mRNA from nucleolus to cytoplasm

(1) Operon concept 133. Which of the following is matched wrongly?

(2) DNA fingerprinting (1) SSR – Microsatellites

(3) Genetic code (2) Auxotroph – Nutritional mutants

(4) Human genome project (3) trp operon – Structural genes code five
enzymes
126. How many hydrogen bonds are present in dsDNA
with three helices in which 20% nucleotides are (4) Hogness box – TATA box
thymine?
134. The beads-on-string is/are
(1) 24 (2) 54
(1) Exons are interrupted by introns
(3) 78 (4) 100
(2) Polymerase on transcription units
127. Anticodon for the codon which has dual functions
during translation is (3) Nucleosomes in chromatin

(1) AUG (2) UAC (4) Growing polypeptide chain in large subunit of
ribosome
(3) GUA (4) GAG
135. Which one of the following antibiotic inhibits peptidyl
128. RNA polymerase-I transcribes all, except transferase activity?
(1) 5SrRNA (1) Tetracycline
(2) 5.8SrRNA (2) Chloramphenicol
(3) 18SrRNA (3) Streptomycin
(4) 28SrRNA (4) Neomycin
(11)
Test-9 (Code A) Test Series for Medical - 2016

ZOOLOGY
136. S. Miller created electric discharge in a closed flask 144. Bottle neck effect and founder effect are two special
containing CH4, H2, NH3 and water vapours at 800ºC cases of
and observed formation of
(1) Gene mutation
(1) Fats (2) Amino acids
(2) Genetic recombination
(3) Nucleic acids (4) Polysaccharides
(3) Sewall Wright effect
137. Identify the naturalist who worked in Malay
Archipelago and came to similar conclusions as (4) Natural selection
Darwin, around the same time
145. Find the mismatch of different categories of humans
(1) Alfred Wallace (2) Lamarck with their cranial capacity
(3) Hugo De Vries (4) Gregor Mendel
(1) Australopithecines - 500 cc
138. Whales, bats, cheetah and humans share
similarities in (2) Homo habilis – 650 - 800 cc

(1) Pattern of bones of hindlimbs (3) Homo erectus – 700 - 850 cc

(2) Presence of body hairs (4) Homo sapiens – 1400 cc

(3) Gestation period 146. How many of following structures are vestigeal in
(4) Pattern of bones of forelimbs humans?

139. Which of following reptile is not related to group Wisdom tooth, Caudal vertebrae, Ear pinna,
dinosauria?
Vermiform appendix, nictitating membrane
(1) Tyrannosaurus (2) Triceratops
(1) Two (2) Three
(3) Ichthyosaurs (4) Brachiosaurus
(3) Four (4) Five
140. In a collection of moths made in 1850s, i.e. before
industrialisation set in, it was observed that there 147. Arrange the following fossils from oldest to recent
were
(a) Peking man (b) Cromagnon man
(1) More melanised moths than white-winged moths
(c) Neanderthal man (d) Habilis man
(2) More white-winged moths than melanised moths
(3) All melanised moths (1) a  b  c  d (2) d  a  c  b

(4) All white-winged moths (3) c  d  b  a (4) b  d  c  a

141. Choose an example of evolution by anthropogenic 148. When we describe the story of life on earth, we treat
action evolution as a consequence of the process called
(1) Evolution of finches in Galapagos island (1) Natural selection (2) Adaptive radiation
(2) Evolution of marsupials in Australia (3) Genetic drift (4) Gene migration
(3) Evolution of antibiotic resistant microbes
149. Choose the incorrect match
(4) Evolution of horse
(1) Vestigeal organs = Ear pinna in man
142. The phenomenon of adaptive radiation can be
examplified by (2) Atavism = Tail in new born human baby
(1) Darwin finches (3) Homology = Mouth parts of insects
(2) Industrial melanism (4) Analogy = Tendrils in different plants
(3) Australian marsupials 150. The presence of gill slits in the embryos of all
(4) Both (1) & (3) vertebrates supports the
143. Evolution explained by Darwin was gradual while de (1) Biogenetic law
Vries believed mutations caused speciation. The
term used by de Vries for mutations was (2) Theory of pangenesis

(1) Saltation (2) Sports (3) Theory of panspermia

(3) Demes (4) Moulds (4) Theory of germplasm
(12)
Test Series for Medical - 2016 Test-9 (Code A)
151. Match the following connecting links 157. Which of the following sequences was proposed by
Column I Column II Darwin for organic evolution?
(a) Neopilina (i) Between non-chordates (a) Natural selection
and chordates (b) Struggle for existence
(b) Peripatus (ii) Between annelida and (c) Appearance of variations
mollusca (d) Overproduction
(c) Chimaera (iii) Between annelida and (1) d  b  c  a (2) abcd
arthropoda
(3) d  a  b  c (4) bacd
(d) Balanoglossus (iv) Between bony fishes
158. Match the following columns
and cartilaginous
fishes Column I Column II
(1) a(iii), b(iv), c(i), d(ii) (2) a(ii), b(iii), c(iv), d(i) (a) Origin of life (i) Darwin
(b) Philosophique (ii) Huxley
(3) a(ii), b(i), c(iii), d(iv) (4) a(i), b(ii), c(iii), d(iv)
zoologique
152. Which one can be considered as phylogenetically (c) Origin of species (iii) Oparin
more closer relative of mammals?
(d) Man’s place in (iv) Lamarck
(1) Therapsids (2) Thecodonts nature
(3) Pelycosaurs (4) Dinosaurs (1) a(i), b(ii), c(iii), d(iv) (2) a(iii), b(iv), c(i), d(ii)
153. Lamarckism is supported by following examples, (3) a(iv), b(i), c(iv), d(iii) (4) a(iii), b(i), c(ii), d(i)
except 159. If change in gene frequency occurs by chance, it is
(1) Lack of pigment in cave-dwelling animals called
(2) Melanism in peppered moth (1) Natural selection (2) Gene migration

(3) Absence of limbs in snakes (3) Genetic drift (4) Genetic recombination

(4) Presence of webbed toes in aquatic birds 160. The animals called_____evolved into the first
amphibians. Fill the blank space
154. Identify the first prehistoric man to make use of fire
(1) Lobefinned fishes (2) Jawless fishes
for hunting, defence and cooking
(3) Chimaera (4) Elasmobranchs
(1) Dryopithecus
161. Given below are few examples of living fossils,
(2) Australopithecus except
(3) Homo erectus (1) Neopilina (2) Limulus
(4) Homo sapiens neanderthalensis (3) Locusta (4) Sphenodon
155. Find the incorrect statement 162. Which of following cannot be related to human
evolution?
(1) Analogous organs have evolved due to
convergent evolution (1) Development of chin
(2) The tendency of population to remain in genetic (2) Increase in cranial capacity
equilibrium may be disturbed by lack of random (3) Decrease in number of fingers & toes
mating
(4) Upright posture
(3) Genetic drift operates in small isolated
163. Which of following reptiles does not belong to
population sauropsids?
(4) Darwinian variations are random and (1) Snakes (2) Dinosaurs
directionless
(3) Turtles (4) Pelycosaurs
156. Which of following laws states that animals which are
164. Early Greek thinkers thought units of life called
warm blooded become larger in size in the northern
spores were transferred to different planets including
and colder parts of their range?
earth from outer space. It is true according to
(1) Dollo’s law (1) Theory of special creation
(2) Bergman’s law (2) Theory of catastrophism
(3) Allen’s law (3) Theory of panspermia
(4) Cope’s law (4) Theory of spontaneous generation
(13)
Test-9 (Code A) Test Series for Medical - 2016
165. Tendrils of Cucurbita and thorn of Bougainvillea are 173. If nature selects more individuals with mean
characteristics compared to variants, which kind of
(1) Homologous organs that have evolved due to
selection is said to be operating?
convergent evolution
(1) Stabilising (2) Directional
(2) Homologous organs that have evolved due to
divergent evolution (3) Disruptive (4) Balancing
(3) Analogous organs that have evolved due to 174. The autogenous transformation of a species with
convergent evolution passage of time due to piling up of variations is
called
(4) Analogous organs that have evolved due to
divergent evolution (1) Cladogenesis
166. Which of following is not an Australian marsupial? (2) Anagenesis
(1) Kangaroo (2) Wombat (3) Stasigenesis

(3) Lemur (4) Bandicoot (4) Multiplicative speciation

167. Which of following example represents discontinuous 175. Which of following is genus of extinct vascular land
distribution of closely related species? plants of Devonian period and is thought to be a part
of the group from which modern ferns and seed
(1) Egg laying mammals (2) Marsupials plants evolved?
(3) Lung fishes (4) All of these (1) Zosterophyllum (2) Rhynia
168. Darwin’s theory of ‘natural selection’ is not based on (3) Psilophyton (4) Lycopods
cencept of
176. When hybrid zygotes fail to develop further, it is
(1) Branching descent case of
(2) Doctrine of appetency (1) Hybrid inviability (2) Hybrid sterility
(3) Natural selection (3) Hybrid breakdown (4) Temporal isolation
(4) Struggle for existence 177. The first human like being, the hominid, was Homo
habilis which had all the following characteristics,
169. Given below are few examples of connecting links,
except
except
(1) It is also called handy man
(1) Peripatus (2) Balanoglossus
(2) It probably did not eat meat
(3) Platypus (4) Balaenoptera
(3) Cranial capacity was 650–800 cc
170. Which of following chordate has a simple purse-like
body that show no trace to chordate connection but (4) It was ape like with semierect posture
its larva possesses all the important chordate 178. Identify a bioindicator plant which is tolerant to zinc
characteristics?
(1) Agrostis tenuis (2) Astragalus
(1) Branchiostoma (2) Herdmania
(3) Impatiens balsamina (4) Haplopappus
(3) Petromyzon (4) Balanoglossus
179. Incorrect option regarding evolution of horse is
171. Darwin’s theory of pangenesis was rejected by
(1) Lengthening of limbs in general
(1) Theory of continuity of germplasm
(2) Enlargement of brain
(2) Theory of Panspermia
(3) Increase in the complexity and size of molar
(3) Mutation theory teeth
(4) Theory of inheritance of acquired characters (4) Progressive increase in number of toes
172. Which of following is unrelated to Darwinian theory? 180. What was the most significant trend in the evolution
(1) Origin of species as a result of large, of homo sapiens from his ancestors?
discontinuous variations which appear suddenly (1) Binocular vision
(2) Struggle for existence (2) Shortening of jaws
(3) Survival of the fittest (3) Upright posture
(4) Origin of species by natural selection (4) Increasing cranial capacity

  
(14)
Test Series for Medical - 2016 Test-9 (Code A)

18/04/2016
A
CODE

Regd. Office : Aakash Tower, Plot No.-4, Sec-11, MLU, Dwarka, New Delhi-110075
Ph.: 011-47623456 Fax : 011-47623472
MM : 720 Test Series : Test – 9 (Objective) Time : 3 Hrs.
(for AIPMT - 2016 )
ANSWERS
1. (2) 37. (2) 73. (4) 109. (3) 145. (3)
2. (3) 38. (1) 74. (4) 110. (3) 146. (3)
3. (4) 39. (2) 75. (3) 111. (2) 147. (2)
4. (2) 40. (3) 76. (4) 112. (4) 148. (1)
5. (2) 41. (4) 77. (2) 113. (1) 149. (1)
6. (1) 42. (3) 78. (2) 114. (4) 150. (1)
7. (3) 43. (3) 79. (3) 115. (3) 151. (2)
8. (3) 44. (1) 80. (4) 116. (1) 152. (1)
9. (3) 45. (4) 81. (2) 117. (3) 153. (2)
10. (1) 46. (4) 82. (2) 118. (3) 154. (3)
11. (3) 47. (2) 83. (2) 119. (4) 155. (4)
12. (4) 48. (1) 84. (3) 120. (1) 156. (2)
13. (1) 49. (4) 85. (4) 121. (1) 157. (1)
14. (2) 50. (3) 86. (1) 122. (4) 158. (2)
15. (3) 51. (3) 87. (4) 123. (1) 159. (3)
16. (3) 52. (4) 88. (4) 124. (2) 160. (1)
17. (3) 53. (1) 89. (4) 125. (2) 161. (3)
18. (3) 54. (4) 90. (3) 126. (3) 162. (3)
19. (1) 55. (3) 91. (4) 127. (2) 163. (4)
20. (1) 56. (3) 92. (3) 128. (1) 164. (3)
21. (2) 57. (4) 93. (2) 129. (3) 165. (2)
22. (2) 58. (2) 94. (4) 130. (2) 166. (3)
23. (3) 59. (4) 95. (1) 131. (3) 167. (3)
24. (2) 60. (1) 96. (2) 132. (4) 168. (2)
25. (2) 61. (1) 97. (3) 133. (3) 169. (4)
26. (2) 62. (4) 98. (3) 134. (3) 170. (2)
27. (3) 63. (2) 99. (4) 135. (2) 171. (1)
28. (2) 64. (2) 100. (1) 136. (2) 172. (1)
29. (3) 65. (3) 101. (4) 137. (1) 173. (1)
30. (1) 66. (3) 102. (3) 138. (4) 174. (2)
31. (3) 67. (2) 103. (2) 139. (3) 175. (3)
32. (2) 68. (3) 104. (2) 140. (2) 176. (1)
33. (1) 69. (1) 105. (2) 141. (3) 177. (4)
34. (4) 70. (4) 106. (3) 142. (4) 178. (3)
35. (4) 71. (4) 107. (2) 143. (1) 179. (4)
36. (2) 72. (3) 108. (4) 144. (3) 180. (4)

(15)
 18/04/2016
A
CODE

Regd. Office : Aakash Tower, Plot No.-4, Sec-11, MLU, Dwarka, New Delhi-110075
Ph.: 011-47623456 Fax : 011-47623472

MM : 720 Test Series : Test – 9 (Objective) Time : 3 Hrs.

(for AIPMT - 2016 )

Answers and Hints

PHYSICS
1. Answer (2) 17. Answer (3)
18. Answer (3)
mv P
r  
qB qB 19. Answer (1)
20. Answer (1)
1 1 1 1
rp  rd  r     1 1  2  2  1 21. Answer (2)
e e 2e 2
22. Answer (2)
2. Answer (3)
Frequency of electric field = frequency of charge
3. Answer (4) particle.
B2 = x2B0
23. Answer (3)
4. Answer (2)
F = iBl (end to end)
5. Answer (2)
24. Answer (2)
6. Answer (1)
25. Answer (2)
7. Answer (3)
26. Answer (2)
8. Answer (3)
27. Answer (3)
9. Answer (3)
28. Answer (2)
10. Answer (1)
29. Answer (3)
0 i  qn
B=  0 30. Answer (1)
2r 2r
31. Answer (3)
11. Answer (3)
32. Answer (2)
12. Answer (4)
33. Answer (1)
2
B
Energy density = 2  2m
0 Time period T = , Independent of velocity.
qB
13. Answer (1)
34. Answer (4)
14. Answer (2)
35. Answer (4)
15. Answer (3)
 
16. Answer (3)   M B

cot = cot 2   cot 2  36. Answer (2)

(1)
37. Answer (2) 42. Answer (3)
38. Answer (1)  = NiAB sin,  = Angle between magnetic field
and normal to plane of coil.
39. Answer (2)
43. Answer (3)
40. Answer (3) 44. Answer (1)
41. Answer (4) 45. Answer (4)

CHEMISTRY
46. Answer (4) 60. Answer (1)
47. Answer (2) N2O5 is acidic in nature
Fact 61. Answer (1)
48. Answer (1) HNO2
NH2CONH2 N 2 + CO 2 + H 2O
Fact
62. Answer (4)
49. Answer (4)
Gas A = NO
A = [Ag(CN)2]–
<250K
B = [Zn(CN)4]2– Gas B = NO2 NO + NO2 N 2 O3
50. Answer (3) 63. Answer (2)
1 1 Metaphosphoric acid HPO3
S = 1–    +ve
2 2 64. Answer (2)
 G will become –ve on increasing temperature 65. Answer (3)
51. Answer (3) Fact
Fact 66. Answer (3)
52. Answer (4) Fact
Both roasting and calcination done in reverberatory 67. Answer (2)
furnace
2
53. Answer (1) ⎡ 1 +1 ⎤
Brown ring complex ⎢Fe (H2O)5 NO ⎥
⎣ ⎦
GMgO  GAl2O3 below 1673 K
NO have + 1 oxidation state
 Mg will be good reducing agent below 1673 K
68. Answer (3)
54. Answer (4)
O O
Fact
O S S O
55. Answer (3) O O
HO OH
Fast
69. Answer (1)
56. Answer (3)
+2 O3 +3
Pig iron contain 4% of carbon K4[Fe(CN)6] K3[Fe(CN)6]
57. Answer (4) 70. Answer (4)
58. Answer (2) 71. Answer (4)
Purification of Ni is done by Mond’s process Fact
59. Answer (4) 72. Answer (3)
Fact
NH3 + Cl2 NCl3 + HCl
excess 73. Answer (4)
H2O
Fact
NH3 + HOCl
74. Answer (4)
H2O CrCl3
75. Answer (3)
Cr(OH)3
+6 +6
(green ppt) XeF6 + H 2O XeO3
(2)
76. Answer (4) 84. Answer (3)
Fact 85. Answer (4)
77. Answer (2)
O HO
78. Answer (2)
[H2PtCl6] H3C C N N C CH3
Ni2+
79. Answer (3) H3C C N N C CH3
MnO42– have one unpaired electron
OH O
80. Answer (4) Brown ring Complex
FeO.Cr2O3 + Na2CO3 + O2
86. Answer (1)
H2SO4

 Na2CrO4   Na Cr O

NaOH 2 2 7 87. Answer (4)
81. Answer (2) 88. Answer (4)
O3 + Hg  HgO + O2 89. Answer (4)
82. Answer (2) 90. Answer (3)
83. Answer (2) CN– ion is strong field ligand

BOTANY
91. Answer (4) 108. Answer (4)
Thymine is 5 methyl uracil (Sigma) (  ) and Rho () factor alternate the
specification of RNA polymerase.
92. Answer (3)
109. Answer (3)
3.3  109 bp in human genome
110. Answer (3)
93. Answer (2)
tRNA has anticodon
Nitrogenous bases linked to sugar moiety and
project inside the backbone. 111. Answer (2)
94. Answer (4) 112. Answer (4)
95. Answer (1) 113. Answer (1)
96. Answer (2) 114. Answer (4)
97. Answer (3) Unusual base present in tRNA and mRNA.
Basic amino acid residuces lysine and arginines. 115. Answer (3)
98. Answer (3) 116. Answer (1)
Loosely packed DNA in euchromatin stains lightly. 117. Answer (3)
99. Answer (4) 118. Answer (3)
100. Answer (1) 119. Answer (4)
DNA has 3–OH group. 5’AUGUCCACGAUAGACUGAUAA3’
101. Answer (4) 120. Answer (1)
102. Answer (3) 121. Answer (1)
They grew E.coli in a medium containing 15NH
4CI Human genome contains 3164.7 million nucleotides.
103. Answer (2) 122. Answer (4)
104. Answer (2) UTRs – Untranslated regions
105. Answer (2) 123. Answer (1)
106. Answer (3) 124. Answer (2)
107. Answer (2) 125. Answer (2)
(3)
126. Answer (3) 131. Answer (3)
127. Answer (2) Allolactose acts as inducer.
128. Answer (1) 132. Answer (4)
129. Answer (3) 133. Answer (3)
130. Answer (2) 134. Answer (3)
Silent-mutation is due to degeneracy of codon 135. Answer (2)

ZOOLOGY
136. Answer (2) 160. Answer (1)
137. Answer (1) Coelacanth (lobefinned fishes) evolved into first
amphibians.
138. Answer (4)
161. Answer (3)
Fore-limbs of whales, bat, cheetah and humans show
homology 162. Answer (3)
139. Answer (3) 163. Answer (4)
140. Answer (2) Pelycosaurs belong to synapsid reptiles
164. Answer (3)
Before industrialisation set in, thick growth of almost
white coloured lichen covered the trees, in that 165. Answer (2)
background the white winged moths survived. 166. Answer (3)
141. Answer (3) 167. Answer (3)
142. Answer (4) Lung fishes are distributed in South America, Africa
143. Answer (1) and Australia
168. Answer (2)
144. Answer (3)
Doctrine of appetency is a concept of Lamarckian
Genetic drift is also called as Sewall Wright effect.
theory.
145. Answer (3) 169. Answer (4)
146. Answer (3) Balaenoptera (blue whale) is not a connecting link.
147. Answer (2) 170. Answer (2)
148. Answer (1) Notochord is present in tail of larva in Herdmania.
149. Answer (1) 171. Answer (1)
Auricular muscles of pinna are vestigeal in man. 172. Answer (1)
150. Answer (1) 173. Answer (1)
151. Answer (2) Natural selection can lead to stabilisation, directional
change or disruption.
152. Answer (1)
174. Answer (2)
153. Answer (2)
Phyletic speciation is also called as Anagenesis.
Melanism in peppered moth is an example of natural
selection. 175. Answer (3)
176. Answer (1)
154. Answer (3)
177. Answer (4)
155. Answer (4)
It had bipedal locomotion and moved erect.
Darwinian variations are small and directional
178. Answer (3)
156. Answer (2)
Impatiens balsamina grows around zinc mines in
157. Answer (1) Udaipur, Rajasthan.
158. Answer (2) 179. Answer (4)
159. Answer (3) The number of finger and toes decreased during
Change in gene frequency by chance factors is horse evolution
called genetic drift 180. Answer (4)

  
(4)