*P14*

Name:
School:
Address:
Class:
Teacher:

Pre-Leaving Certiϐicate Examination, 2018

Triailscrúdú na hArdteistiméireachta, 2018

BIOLOGY – HIGHER LEVEL

TIME: 3 HOURS

Section A Answer any ϐive questions from this section.

Each question carries 20 marks.
Write your answers in the spaces provided on this examination paper.

Section B Answer any two questions from this section.

Each question carries 30 marks.
Write your answers in the spaces provided on this examination paper.

Section C Answer any four questions from this section.

Each question carries 60 marks.
Write your answers in the answer book.

Total: 400 marks

It is recommended that you spend not more than 30 minutes on Section A and 30
minutes on Section B, leaving 120 minutes for Section C.

You must return this examination paper with your answer book at the end
of the examination.

Page 1 of 16 [OVER]
 Section A
Answer any ϐive questions.
Write your answers in the spaces provided.

1. Answer any five of the following parts (a) to (f):

(a) In living cells, biomolecules can be built up to form larger biomolecules. What term is
used to describe this process?

(b) Name the part of a lipid molecule that is replaced by a phosphate group to form
a phospholipid.

(c) Name one storage carbohydrate found in plants.

(d) Would you expect an enzyme to give a posi ve result for the Biuret test? Explain your
answer.

(e) What property of water is responsible for the efficiency of both swea ng and
transpira on as a method of temperature regula on?

(f) Iron is an example of a trace element. Explain this statement.

2. (a) What is biology?

(b) In the scien fic method, what is the rela onship between an hypothesis and an
experiment?

(c) Explain the importance of double-blind tes ng.

(d) Why is it important to repeat experiments?

(e) Comment on the importance of sample size when conduc ng an experiment.

(f) What informa on should be contained in the conclusion of an experiment?

Page 2 of 16
3.

(a) Is the cell shown in the diagram an example of a prokaryo c or a eukaryo c cell?
Explain your answer.

Type of cell:

Explana on:

(b) Name the carbohydrate that is a component of cell walls.

(c) With reference to the above diagram, explain why this cell can be described as turgid.

(d) Under what condi ons do plant cells become turgid?

(e) How would you know by looking at a leaf that the cells were losing their turgidity?
State one possible reason for the loss of turgidity in a plant.

Reason:

(f) Can animal cells become turgid?

Explain your answer:

Page 3 of 16 [OVER]
4. (a) Describe the role played by energised electrons in the light stage of photosynthesis.

(b) Describe how NADP– is formed.

(c) During which stage of photosynthesis does photolysis of water occur?

(d) Explain the role played by NADPH in the produc on of glucose.

(e) Why is ATP converted to ADP during this process?

(f) The dark stage of photosynthesis is controlled by enzymes but the light stage is not.
Will both of these stages be affected by a change in temperature?

Explain your answer:

Page 4 of 16
5. (a) In what part of the heart is the pacemaker located?

(b) State one loca on of a semi-lunar valve, and describe its func on.

Loca on:

Func on:

(c) A pulse is usually easily detected at the wrist. Explain why.

(d) Why is there no need for arteries to contain valves?

(e) State two lifestyle choices a person could make which would improve heart health.

1.

2.

6. (a) In what part of the skeleton is the pelvic girdle located?

(b) Name one of the long bones found in the arm.

(c) Name the part of the bone in which fat is stored.

(d) 1. Explain what is meant by an antagonis c muscle pair.

2. Why is it necessary for most muscles to work in pairs?

(e) In joints, explain

1. the func on of ligaments

2. the role of synovial fluid

Page 5 of 16 [OVER]
 Section B
Answer any two questions.
Write your answers in the spaces provided.
Part (a) carries 6 marks and part (b) carries 24 marks in each question in
this section.

7. (a) (i) Name the kingdom to which yeast belongs.

(ii) Name one other member of this kingdom.

(b) Answer the following ques ons in rela on to the growth of leaf yeasts in the
laboratory.

(i) Apart from a source of nutri on, give one other func on of the agar.

(ii) How can you be certain that the leaf is the only possible source of the yeasts?

(iii) Before you put the plates aside for a few days, what step did you take to prevent
contamina on of the laboratory by the yeasts?

(iv) How were the plates disposed of at the end of the inves ga on?

(c) Answer the following ques ons in rela on to the experiment you carried out to
inves gate anaerobic respira on in yeast.

(i) Name two steps you took to ensure anaerobic condi ons.

1.

2.

(ii) What visible sign is there that fermenta on is taking place?

(iii) If the apparatus was placed in an ice-bath, what effect would this have on the
rate of respira on?

Explain your answer:

Page 6 of 16
8. (a) (i) Enzymes catalyse reac ons by lowering the ac va on energy of the reac on.
Explain the underlined term.

(ii) Most human enzymes exhibit op mal ac vity at pH 7. Name one enzyme found
in the body that has a significantly different op mum pH.

(b) During the course of your prac cal inves ga ons you inves gated the effect of both pH
and temperature on the rate of enzyme ac on.

(i) Name the enzyme you used, and the reac on it catalyses.

Enzyme:

Reac on:

(ii) When inves ga ng the effect of temperature on enzyme ac on, explain how you
ensured the temperature was kept at or below 10°C.

(iii) Suggest why a buffer solu on might be used in this inves ga on.

(iv) When inves ga ng the effect of pH on enzyme ac on, suggest how in the
absence of a suitable buffer, the pH of the solu on could be altered.

(v) Explain how you measured enzyme ac vity, in the case of the enzyme you have
named in (i) above.

(vi) The diagram opposite shows a typical curve for

Enzyme acƟvity

the result of an inves ga on into the effect of

temperature on enzyme ac vity. Explain why
there is a drama c fall off in enzyme ac vity
at temperatures above 40°C.

10 15 20 25 30 35 40 45 50
Temperature (°C)

(vii) Does this graph represent the results you would expect if the enzyme was of
human origin? Explain your answer.

(viii) Why has enzyme ac vity dropped to zero at 50°C?

Page 7 of 16 [OVER]
9. (a) Life involves the interac on of a number of characteris cs, two of which are excre on
and reproduc on. Explain the importance of each of these characteris cs to living
organisms.

(b) Answer the following in rela on to inves ga ons you carried out.

(i) You discover a plant you don’t recognise while carrying out an ecological survey.
How might you a empt to iden fy it?

(ii) Name the plant you used when inves ga ng the rate of photosynthesis. State
one reason this plant was suitable for this inves ga on.

Plant:

Reason:

(iii) How do you prevent cells drying out while examining them under the microscope?

(iv) When selec ng a dicot stem, suggest why you should select a non-woody stem.

(v) When incuba ng the plates to which IAA has been added, suggest a reason for
posi oning them so that they remain standing on their edges.

(vi) What would you be inves ga ng if you used a selec vely permeable membrane?

(vii) What gas does limewater test for?

(viii) DNA molecules appear in solu on a er freezer cold ethanol is added. What does
this indicate?

Page 8 of 16
 Section C
Answer any four questions.
Write your answers in the answer book.

10. (a) (i) For a new species to be formed what condi on must be met by all the offspring?

(ii) Varia ons occur between all members of a species. Give one example of varia on
in humans.

(iii) Name one cause of this varia on. (9)

(b) In rabbits, black eye (B) is dominant to red eye (b) and long ears (L) are dominant to
short ears (l).

(i) A black-eyed rabbit with long ears was crossed with a red-eyed rabbit with short
ears. The offspring of this cross included some rabbits with black eyes and short
ears, while others had red eyes and long ears. Assuming the genes are not linked
and using the symbols given above, write out the genotype of the black-eyed
long-eared parent.

(ii) What percentage of the offspring have genotypes that differ from the parents?
Write out the genotype of these rabbits.

(iii) If the above genes were linked, explain how the percentage you have indicated in
your answer to part (ii) would change.

(iv) Some of the black-eyed short-eared rabbits are then crossed with the red-eyed
long-eared rabbits. Again assuming the genes are not linked,
1. What percentage of the offspring of this cross are homozygous for short ears?
2. What percentage of the rabbits have black eyes and long ears?
3. What percentage of the black-eyed offspring are heterozygous for this trait?

(v) Would you expect short ears to be an advantage or a disadvantage to the rabbits?
Give a reason for your answer. (27)

Page 9 of 16 [OVER]
(c) DNA profiling involves the examina on of a sample of DNA for a pa ern or band to
compare. One technique for DNA profiling uses polymorphisms called short tandem
repeats (or STRs). These are regions of non-coding DNA that contain repeats of the
same nucleo de sequence. For example, ACTTACTTACTTACTTACTTACTT is an STR
where the nucleo de sequence ACTT is repeated six mes. STRs are found at different
places in a person’s DNA.

(i) Explain the term non-coding DNA.

(ii) Name the sugar found in DNA nucleo des.

(iii) What is the func on of restric on enzymes in the process of DNA profiling?

(iv) Write out the complementary base pair sequence of the STR ACTT. Name the
type of bonding found between complementary base pairs.

A B C D

(v) A hair follicle was recovered from a crime scene, and the DNA profile above was
obtained from it. Profile A was obtained from the hair follicle. Profile B belongs to
the homeowner. Profiles C and D represent the two suspects in the case. Which
of the suspects, C or D, was responsible for the crime? Explain your answer.

(vi) Could the homeowner and suspect D be related? Explain your answer.

(vii) Apart from forensic science, name one other use of DNA profiling.
(24)

Page 10 of 16
11. (a) (i) In what form is most carbon dioxide transported in the plasma?

(ii) Name the process by which gaseous exchange takes place in the alveoli.

(iii) State one effect an increase in the produc on of carbon dioxide would have on
the breathing rate. (9)

(b) The diagram shows a longitudinal sec on through Renal Cortex

a kidney. artery

(i) In which part of the kidney is the Bowman’s Renal Renal

capsule containing the glomerulus located? vein pelvis

(ii) Blood entering the glomerulus is under high

pressure. State one reason for this.
Ureter Medulla
(iii) Explain why proteins are absent from the
glomerular filtrate. PioM

(iv) The majority of reabsorp on of useful substances takes place in the proximal
convoluted tubule. The cells lining the tubule have the following features:
1. large numbers of mitochondria,
2. numerous microvilli.
Explain how each of these features aid the reabsorp on process.

(v) Glucose is found in the glomerular filtrate when it enters the proximal convoluted
tubule. Name a method of tes ng urine for glucose. Would you expect the result
to be posi ve if the kidneys are func oning normally? Explain your answer.

(vi) Explain what happens if the brain detects a decrease in the concentra on of
water in the blood. (27)

(c) (i) What term is used to describe the process by which organisms maintain a
constant internal environment?

(ii) All living organisms need to maintain their internal temperature within a narrow
range. Explain why this is necessary.

(iii) State one way in which plants respond to an increase in temperature.

(iv) The diagram shows a

transverse sec on of a leaf.
Explain the func on of:
1. the waxy cu cle, Upper
Epidermis Waxy CuƟcle
2. the airspaces.
Spongy
(v) What is the func on of Mesophyll
Mesophyll
the stomata? Explain the
rela onship between Palisade
the stomata and the guard Mesophyll
Lower
cells. Epidermis
Waxy CuƟcle
(vi) Name the structures Air
present on the stem which Space
have the same func on Stoma
as the stomata. Guard Cell with (24)
Chloroplasts

Page 11 of 16 [OVER]
12. (a) The diagram below shows the structure of a human sperm.

Acrosome Nucleus Collar Flagellum

(contains diges ve (contains 23 (contains (allows sperm
enzymes) chromosomes) mitochondria) to swim)

Head Middle Tail

(i) Why in your opinion does the sperm need the diges ve enzymes?

(ii) The sperm is surrounded by seminal fluid. Name one gland responsible for the
produc on of this fluid.

(iii) Only one sperm fer lises the egg. How does the egg prevent the entry of more
than one sperm? (9)

(b) Follicle s mula ng hormone and luteinising hormone are sex hormones found in both
males and females. In males their site of ac on is the testes.

(i) Where are the hormones named above produced? How do they travel from the
site you have named to the testes?

(ii) State the effect brought about in the testes by follicle s mula ng hormone.

(iii) In the case of luteinising hormone in females state:

1. its site of ac on,
2. the hormone responsible for its produc on,
3. two effects it is responsible for causing.

(iv) The World Health Organisa on recommends that babies be breas ed exclusively
for the first six months. Breas eeding benefits the baby for a number of reasons,
including the fact that it contains an bodies and also protec ve agents against
pathogens, e.g. interferon.
1. Explain the underlined term.
2. State the type of immunity conferred on the baby by consuming breast milk.
(27)

(c) (i) The s gma of plants that are wind pollinated tend to hang outside the flower and
have a feathery structure. Explain how each of these features aids pollina on by
wind.

(ii) State one reason cross-pollina on is more beneficial to plants than self-pollina on.

(iii) Explain the link between hay fever and pollen.

(iv) Many plants can also reproduce by means of vegeta ve reproduc on. From the
point of view of the plant in the wild, state one advantage and one disadvantage
of this type of reproduc on.

(v) Name two methods of natural vegeta ve propaga on. In each case name a plant
that uses this type of propaga on and indicate which part of the plant is being used.
(24)

Page 12 of 16
13. (a) (i) All living organisms sense and respond to environmental changes. Explain why
this ability to respond is so important.

(ii) Name two methods by which plants protect themselves from adverse
environmental condi ons. (9)

(b) (i) Describe the rela onship between the Schwann cells and the myelin sheath.

(ii) What is a synapse?

(iii) Why are neurotransmi er chemicals required to carry a nerve impulse across a
synapse? How are these neurotransmi ers ac vated?

(iv) Describe the fate of the neurotransmi ers a er the impulse has crossed the
synapse.

(v) Neurotransmi ers are only produced on one side of the synapse. What do you
think is the significance of this?

(vi) In the case of either Parkinson’s disease or paralysis, state one possible cause and
one possible treatment. Iden fy clearly to which disease your answer refers. (27)

(c) Tropic responses in plants are controlled by growth regulators.

(i) Explain the importance of tropic responses to plants.

(ii) Give two ways in which the responses controlled by growth regulators are similar
to the responses controlled by hormones in humans.

(iii) Auxin is an example of a growth regulator produced in shoot and root ps.
1. Name the type of ssue which produces it.
2. Explain how it reaches its site of ac on.
3. Apart from its role in tropic responses, give one other func on of auxin.

(iv) When inves ga ng the effects of auxin on different parts of the plant it was
discovered that at concentra ons that s mulate shoot growth, root growth was
greatly inhibited. Give one way this informa on could be of use to gardeners.

(v) Give one way in which the use of growth regulators can be an advantage in
hor culture. (24)

Page 13 of 16 [OVER]
14. Answer any two of (a), (b), (c). (30, 30)

(a) Answer the following ques ons from your knowledge of respira on.
(i) In what part of the cell is pyruvate produced?
(ii) In the absence of oxygen, pyruvate is converted to lac c acid in animal ssue.
Name this ssue.
(iii) Describe the conversion that pyruvate must undergo before it can enter Kreb’s
cycle. During this conversion a molecule is given off which may be of use to
plants. Explain.
(iv) NADH is produced as a result of a series of reac ons that occur during Kreb’s
Cycle. The NADH then enters the electron transport chain and undergoes a
series of reac ons which result in the forma on of energy in the form of ATP and
water as a waste product. Describe the series of reac ons that result in the
forma on of both of these products.
(v) State one way in which the structure of the inner membrane of the
mitochondrion is adapted to increase the produc on of ATP. Explain why this
structural adapta on causes an increase in its produc on.

(b) Read the following extract and answer the ques ons that follow.

Coeliac disease is a long-term autoimmune disorder that can occur in people who are
genetically predisposed. It is caused by a reaction to gluten, which are various proteins
found in wheat and in other grains such as barley and rye. Upon exposure to gluten,
an abnormal immune response may lead to the production of several different antibodies
that can affect a number of different organs. In the small intestine this causes an
inflammatory reaction, which is mediated by T cells, and may produce shortening of the
villi lining the small intestine. As a result, the body’s ability to absorb nutrients, minerals,
and fat-soluble vitamins is reduced. If left untreated coeliac disease can lead to the
development of a range of other autoimmune disorders, such as Type 1 diabetes and
multiple sclerosis.

(i) Explain the underlined term.

(ii) Is coeliac disease an inherited condi on? Explain your answer.
(iii) In people suffering from coeliac disease gluten may be defined as an an gen.
Explain.
(iv) Name
1. the body system responsible for the produc on of T cells,
2. the type of T cells responsible for recognising gluten,
3. the type of cell responsible for the produc on of an bodies.
(v) What effect of the inflammatory process reduces the body’s ability to absorb
nutrients?
(vi) Name one vitamin whose absorp on will
1. be reduced as a result of this disease,
2. be unaffected by the disease.

(c) All living organisms are composed of one or more cells, and each cell contains a variety
of internal structures called organelles.
(i) Explain the underlined terms.
(ii) Name the organelle on which amino acids are assembled to form proteins.
(iii) Dermal ssue and ground ssue are both found in plants. In the case of each
ssue type name,
1. one func on it performs,
2. one place in a plant where it may be found.
(iv) Plants can be divided into two groups, monocots and dicots. What forms the
basis of this division?
(v) Describe dicot plants in terms of
1. their flower parts,
2. their leaf vena on.
Page 14 of 16
15. Answer any two of (a), (b), (c). (30, 30)

(a) Study the diagram below of the food web and answer the following ques ons.

Hawk Lion

Bird Owl
Snake
Fox
Frog
Caterpillar
Deer
Grass hopper
Rabbit

Green plants

(i) What is a food web?

(ii) Iden fy two primary consumers from the food web shown, and indicate why
these organisms are classified as primary consumers.

(iii) Using the food web above, write out three separate food chains in which the
hawk occupies a different trophic each me.

(iv) Popula on size is controlled by a number of factors, including compe on.

Explain the underlined term and illustrate your answer with an example from the
food web above.

(v) Apart from compe on, name one abio c factor that could influence popula on
size.

(b) (i) Explain what you understand by the term nutrient recycling.

(ii) State two ways in which carbon dioxide is returned to the atmosphere by micro-
organisms.

(iii) Dis nguish between the role played by nitrogen-fixing bacteria and nitrifying
bacteria in the nitrogen cycle.

(iv) Name the group of micro-organisms within the nitrogen cycle which return
nitrogen to the air.

(v) Apart from protein, name one other molecule present in all living organisms that
contains nitrogen.

(vi) Name the compound excreted by animals which results in the return of nitrogen
to the environment.

(vii) Name one way in which nitrogen can be ar ficially added to the soil.

Page 15 of 16
(c) (i) Explain what is meant by the term pollutant.

(ii) Comment on the role of micro-organisms in pollu on control.

(iii) In terms of nutri on, many bacteria are autotrophic and can use one of two
different sources of energy to make their food. State the two sources of energy
they can use.

(iv) Bacteria can also be classified as faculta ve anaerobes or obligate anaerobes.

Explain the difference between these two groups.

(v) The diagram below shows a typical growth curve for bacteria.
1. Explain why some bacterial cells survive.
2. During con nuous flow batch processing, condi ons are adjusted to ensure
the bacteria remain at the log stage of the growth curve. Explain why this is
desirable.
3. In batch flow processing, at what stage of the growth curve is the product
removed?

Sta onary
Numbers of bacteria

Log Death

Lag Survival

Time (days)

Page 16 of 16