Plant Methods BioMed Central

Methodology Open Access

Protocol: a highly sensitive RT-PCR method for detection and
quantification of microRNAs
Erika Varkonyi-Gasic*, Rongmei Wu, Marion Wood, Eric F Walton and
Roger P Hellens

Address: HortResearch, Mt Albert Research Centre, Private Bag 92169, Auckland, New Zealand
Email: Erika Varkonyi-Gasic* - [email protected]; Rongmei Wu - [email protected];
Marion Wood - [email protected]; Eric F Walton - [email protected]; Roger P Hellens - [email protected]
* Corresponding author

Published: 12 October 2007 Received: 18 July 2007

Accepted: 12 October 2007
Plant Methods 2007, 3:12 doi:10.1186/1746-4811-3-12
This article is available from: http://www.plantmethods.com/content/3/1/12
© 2007 Varkonyi-Gasic et al; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0),
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract
MicroRNAs (miRNAs) are a class of small non-coding RNAs with a critical role in development and
environmental responses. Efficient and reliable detection of miRNAs is an essential step towards
understanding their roles in specific cells and tissues. However, gel-based assays currently used to
detect miRNAs are very limited in terms of throughput, sensitivity and specificity. Here we provide
protocols for detection and quantification of miRNAs by RT-PCR. We describe an end-point and
real-time looped RT-PCR procedure and demonstrate detection of miRNAs from as little as 20 pg
of plant tissue total RNA and from total RNA isolated from as little as 0.1 μl of phloem sap. In
addition, we have developed an alternative real-time PCR assay that can further improve specificity
when detecting low abundant miRNAs. Using this assay, we have demonstrated that miRNAs are
differentially expressed in the phloem sap and the surrounding vascular tissue. This method enables
fast, sensitive and specific miRNA expression profiling and is suitable for facilitation of high-
throughput detection and quantification of miRNA expression.

Introduction Currently, over 4000 miRNA sequences from vertebrates,

MicroRNAs (miRNAs) are families of short non-coding flies, worms, plants and viruses are annotated in the
transcripts, arising from larger precursors with a character- Sanger Centre miRBase Database [version 9.0, October
istic hairpin secondary structure [reviewed in [1]]. 2006; [7]]. In animals, miRNAs appear predominantly to
Together with short interfering RNAs (siRNAs), miRNAs inhibit translation by targeting partially complementary
belong to a class of 19- to 25-nucleotide (nt) small RNAs sequences located within the 3' untranslated region (UTR)
that are essential for genome stability, development and of mRNA [reviewed in [8]]. The majority of animal miR-
differentiation, disease, cellular communication, signal- NAs appear to be operating at several levels, regulating
ing, and adaptive responses to biotic and abiotic stress [1- multiple targets implicated in various molecular functions
4]. A large proportion of miRNAs are highly conserved and biological processes [1]. In plants, miRNAs repress
among distantly related species, from worms to mammals gene expression by acting either on near-perfect comple-
in the animal kingdom [1], and mosses to high flowering mentary sequences in mRNA coding region to guide cleav-
eudicots in plants [5,6]. age and translational repression [9-12], or in at least one
example, on DNA to guide chromatin remodelling [13].

Page 1 of 12
(page number not for citation purposes)
Plant Methods 2007, 3:12 http://www.plantmethods.com/content/3/1/12

The majority of plant miRNA targets are developmentally ysis of a large number of miRNAs. Alternatively, qRT-PCR
important transcription factors [14,15] and stress-regu- miRNA detection kits and primer sets are commercially
lated genes [16,17]. Thus, ectopic expression of miRNAs available, but are very costly and thus not suitable for
[9,10,13,18-20] or misexpression of miRNA-resistant tar- high-throughput miRNA analysis. Indeed, the available
get mRNAs can induce strong developmental phenotypes plant miRNA expression data are mainly results of gel-
[reviewed in [21]]. It has been proposed that plant miR- based assays.
NAs act mainly by clearing of the mRNA of the target reg-
ulatory genes during the cell-fate changes [15,22,23]. Here we describe and provide protocols for an end-point
There is also evidence for quantitative action of plant miR- and real-time looped RT-PCR procedure. We demonstrate
NAs in quenching the target gene activity rather than elim- detection of miRNAs from as little as 20 pg of plant tissue
inating it completely [24,25]. Furthermore, several total RNA and from total RNA isolated from as little as 0.1
miRNAs were detected in the phloem sap, suggesting a μl of phloem sap.
long-distance signaling role [26], in contrast to several
miRNAs with demonstrated cell-autonomous expression The expression of a miRNA was detected using a two-step
and effects [27,28]. process. First, the stem-loop RT primer designed accord-
ing to Chen et al. [31] was hybridized to the miRNA mol-
This complexity in miRNA modes of action demonstrates ecule, and then reverse transcribed in a pulsed RT
that reliable detection and quantification of miRNA reaction. Next, the RT product was amplified using a
expression in specific tissues is essential for better under- miRNA-specific forward primer and the universal reverse
standing of miRNA-mediated gene regulation. Although primer (Figure 1A). The amplification product was visual-
miRNA represent a relatively abundant class of transcripts, ized on an agarose gel by ethidium bromide staining. The
their expression levels vary greatly among different cells amplification was also performed in real-time, using the
and tissues. Conventional technologies such as cloning, SYBR Green I assay (Figure 1B). In addition, we have
northern hybridization and microarray analysis are developed a Universal ProbeLibrary (UPL; Roche Diag-
widely used but may not be sensitive enough to detect less nostics) RT-PCR method for miRNA detection and quan-
abundant miRNAs. Furthermore, intensive small RNA tification that provides increased specificity when
sequencing revealed a very complex small RNA popula- analysing expression of low abundant miRNAs (Figure
tion in plants. Unlike mammals, which have relatively 1C).
simple small RNA populations comprising mainly miR-
NAs and no siRNAs [29], plants have a hugely complex Materials
small RNA fraction. It is comprised of both miRNAs and Plant material and phloem sap collection
endogenous siRNAs derived from repetitive sequences, Arabidopsis thaliana Columbia, Cucurbita maxima 'Crown'
intergenic regions and genes [14,30]. This complexity (pumpkin) and Cucumis sativus 'Telegraf' (cucumber)
renders miRNAs highly under-represented in the small plants were grown in a greenhouse under natural daylight
RNA fraction and further affects detection methods such conditions. Phloem sap was collected from well-watered
as cloning and microarray hybridization. plants, as previously described [26].

Poor sensitivity and low throughput of conventional tech- miRNA sequences, primers and probes
nologies can be overcome by using a sensitive reverse tran- Plant miRNA genes were selected from the Sanger Insti-
scription-polymerase chain reaction (RT-PCR) detection tute miRBase Sequence Database [33]. UPL probe #21 was
method. However, because of their small size, detection obtained from universal probe library database (Roche
of miRNAs by PCR is technically demanding. A number of Diagnostics). Stem-loop RT primers were designed
specific quantitative RT-PCR (qRT-PCR) techniques were according to Chen et al. [31]. Sequence data are presented
developed and optimised for miRNA detection, including in Table 1.
real-time methods based upon reverse transcription (RT)
reaction with a stem-loop primer followed by a TaqMan NOTE: The specificity of stem-loop RT primers to individual
PCR analysis [31,32]. The stem-loop reverse transcription miRNA is conferred by a six nucleotide extension at the 3' end;
primers provide better specificity and sensitivity than lin- this extension is a reverse complement of the last six nucleotides
ear primers because of base stacking and spatial constraint at the 3' end of the miRNA (Figure 1A). Forward primers are
of the stem-loop structure [31]. Detection sensitivity is specific to the miRNA sequence but exclude the last six nucleo-
further increased by a pulsed RT reaction [32]. However, tides at the 3' end of the miRNA. A 5' extension of 5–7 nucleo-
these methods were optimized for detection of mamma- tides is added to each forward primer to increase the melting
lian miRNAs and require individual miRNA-specific fluo- temperature; these sequences were chosen randomly and are
rescent probes, making them very costly to many relatively GC-rich. We used standard primer design software to
laboratories and not amenable for high-throughput anal- assess the quality of forward primers.

Page 2 of 12
(page number not for citation purposes)
Plant Methods 2007, 3:12 http://www.plantmethods.com/content/3/1/12

Figure 1 showing stem-loop RT-PCR miRNA assays

Schematic
Schematic showing stem-loop RT-PCR miRNA assays. A. Stem-loop RT followed by end-point PCR. Stem-loop RT
primers bind to the 3' portion of miRNA molecules, initiating reverse transcription of the miRNA. Then, the RT product is
amplified using a miRNA specific forward primer and the universal reverse primer. B. SYBR Green I assay. C. Universal
ProbeLibrary (UPL) probe assay. Highlighted in yellow is the UPL probe #21 binding site.

Protocols the NanoDrop ND-1000 Spectrophotometer (NanoDrop Tech-

Equipment nologies, Wilmington, DE).
Standard laboratory equipment including a thermal cycler
is required for pulsed reverse transcription and end-point For RNA gel blot analyses, HMW RNA was separated on a for-
PCRs. A real-time thermal cycler is required for SYBR maldehyde-containing 1% agarose gel and transferred over-
Green I and UPL probe assays. All our reverse transcrip- night to a Hybond-N+ membrane (GE Healthcare, formerly
tion reactions and end-point PCR analyses were per- Amersham Biosciences, Buckinghamshire, UK). LMW RNA
formed on Mastercycler (Eppendorf, Hamburg, was separated on a 7 M urea/15% polyacrylamide gel and
Germany). All real-time PCR analyses were performed on transferred overnight to a Hybond-XL membrane (GE Health-
LightCycler 1.5 (Roche Diagnostics, Mannheim, Ger- care). The membranes were UV cross-linked and prehybridized
many). at 40–45°C for 1 h in hybridization buffer (0.5 M Na2HPO4,
1 mM EDTA, 1% BSA, and 7% SDS). DNA oligo probes were
RNA template end labeled by the forward reaction using 10 units of T4 poly-
RNA should be handled according to standard laboratory nucleotide kinase (Invitrogen) with the supplied buffer, to
practices to avoid RNase contamination. Avoid RNA puri- which was added 300 nM [γ-32P]ATP (3000 Ci/mmol) for 10
fication methods that use RNA-binding glass-fiber filters min at 37°C. Unincorporated 32P-label was removed using
that do not quantitatively recover small RNA species. In ProbeQuant G-50 microcolumns (GE Healthcare). Probes
our hands, both non-denatured RNA and RNA denatured were denatured at 94°C for 5 min, added to the hybridisation
by incubation at 65°C for 5 minutes produced similar buffer and hybridisation was allowed to proceed at 40°C over-
results. night. The membrane was then washed twice, 15 min each in
2× SSC, 0.1% SDS at 50°C. Hybridization signal was
NOTE: Total RNA used in our experiments was isolated using detected using a Typhoon scanner (GE Healthcare).
the TRIzol reagent (Invitrogen, Carlsbad, CA). High molecular
weight (HMW)RNA was purified with RNAqueous kit Stem-loop pulsed reverse transcription protocol
(Ambion, Austin, TX). Low molecular weight (LMW)RNA 1. Prepare an RT master mix by scaling the volumes listed
present in the flow-through was precipitated as described previ- below to the desired number of RT reactions. If testing
ously [26]. The concentration of RNA was determined using many RNA samples for one miRNA, prepare a 'no RNA'

Page 3 of 12
(page number not for citation purposes)
Plant Methods 2007, 3:12 http://www.plantmethods.com/content/3/1/12

Table 1: miRNA, primer and probe sequences

miR156 miRNA sequence UGACAGAAGAGAGUGAGCAC

Antisense probe GTGCTCACTCTCTTCTGTCA
Sense probe TGACAGAAGAGAGTGAGCAC
RT primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGTGCTC
Forward primer GCGGCGGTGACAGAAGAGAGT
UPL RT primer GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACGTGCTC

miR156RC RT primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGACAG

Forward primer GCGGCGTGTGCTCACTCTCT

miR159 miRNA sequence UUUGGAUUGAAGGGAGCUCUA

Antisense probe TAGAGCTCCCTTCAATCCAAA
Sense probe TTTGGATTGAAGGGAGCTCTA
RT primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTAGAGC
Forward primer CGGCGGTTTGGATTGAAGGGA
UPL RT primer GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACTAGAGC

miR159RC RT primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTTTGGA

Forward primer CGGCGGTAGAGCTCCCTTCAA

miR167 miRNA sequence UGAAGCUGCCAGCAUGAUCUA

Antisense probe TAGATCATGCTGGCAGCTTCA
Sense probe TGAAGCTGCCAGCATGATCTA
RT primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTAGATC
Forward primer TCGCGTGAAGCTGCCAGCAT
UPL RT primer GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACTAGATC

miR167RC RT primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGAAGC

Forward primer GGCGGTAGATCATGCTGGCA

miR171 miRNA sequence UGAUUGAGCCGCGCCAAUAUC

Antisense probe GATATTGGCGCGGCTCAATCA
RT primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGATATT
Forward primer TTCCTTGATTGAGCCGCGCC
UPL RT primer GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACGATATT

miR166 miRNA sequence UCGGACCAGGCUUCAUUCCCC

RT primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGGGAA
Forward primer TCGCTTCGGACCAGGCTTCA
UPL RT primer GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACGGGGAA

Universal Reverse primer GTGCAGGGTCCGAGGT

CmRBS Forward primer ATGGCTTCCATCGTCTCATCCGCC

Reverse primer TTGTCGAAGCCAATGACTCTGATGAA

CmPP16 Forward primer GTGGTAAAGGACTTCAAGCCCACGACC

Reverse primer ATGGGTTTGAAGAAGCCAAGCCACTTA

UPL probe #21 reverse complement sequence is highlighted in bold.

master mix; if testing for many different miRNAs in one • For a 'no RNA' master mix, add the following
sample, prepare a 'no RT primer' master mix. Include 10% components to a nuclease-free microcentrifuge
overage to cover pipetting errors. Also prepare the minus tube:
RT controls by omitting reverse transcriptase from the
reactions and water controls by adding nuclease-free 0.5 μl 10 mM dNTP mix
water in place of RNA. Keep on ice and work in the cold
room if handling large number of samples. 11.15 μl nuclease-free water

Page 4 of 12
(page number not for citation purposes)
Plant Methods 2007, 3:12 http://www.plantmethods.com/content/3/1/12

1 μl of appropriate stem-loop RT primer (1 End-point PCR protocol

μM) 1. Prepare a PCR master mix by scaling the volumes
listed below to the desired number of amplification
• For a 'no RT primer' master mix, add the follow- reactions. Include 10% overage to cover pipetting
ing components to a nuclease-free microcentrifuge errors. Also prepare water controls by adding nuclease-
tube: free water in place of the RT product.

0.5 μl 10 mM dNTP mix • Add the following components to a nuclease-free

microcentrifuge tube:
11.15 μl nuclease-free water
15.4 μl nuclease-free water
1 μl of appropriate RNA template
2 μl 10× PCR buffer
• Heat mixture to 65°C for 5 minutes and incubate
on ice for 2 minutes. 0.4 μl 10 mM dNTP mix

• Centrifuge briefly to bring solution to the bottom 0.4 μl forward primer (10 μM)
of the tube and add:
0.4 μl reverse primer (10 μM)
4 μl 5× First-Strand buffer
0.4 μl Advantage 2 Polymerase mix
2 μl 0.1 M DTT
• Mix gently and centrifuge to bring solution to the
0.1 μl RNaseOUT (40 units/μl) bottom of the tube.

0.25 μl SuperScript III RT (200 units/μl) 2. Aliquot 19 μl of the PCR master mix into PCR tubes
and add 1 μl RT product.
• Mix gently and centrifuge to bring solution to the
bottom of the tube. 3. Place reactions in a preheated (94°C) thermal cycler
heat block and incubate at 94°C for 2 min, followed
2. Assemble the RT reaction. by 20–40 cycles of 94°C for 15 s and 60°C for 1 min.

• Aliquot the appropriate amount of the RT master 4. Analyse reaction products by electrophoresis on a
mix (19 μl). 4% agarose gel in 1× TAE.

• Add 1 μl RNA template to 'no RNA' master mix or NOTE: We tested several commercial thermostable DNA
polymerases. In our hands, the most consistent results were
• Add 1 μl of appropriate stem-loop RT primer (1 obtained using Advantage 2 PCR Polymerase Mix (Clontech,
μM) to 'no RT primer' master mix Mountain View, CA).

• Mix gently and centrifuge to bring solution to the miRNA SYBR Green I assay protocol
bottom of the tube. 1. Prepare 5× LightCycler FastStart SYBR Green I mas-
ter mix (Roche Diagnostics) according to manufac-
3. Perform pulsed RT: turer's instructions.

• Load thermal cycler and incubate for 30 min at 2. Prepare a PCR master mix by scaling the volumes
16°C, followed by pulsed RT of 60 cycles at 30°C listed below to the desired number of amplification
for 30 s, 42°C for 30 s and 50°C for 1 s. reactions. Include 10% overage to cover pipetting
errors.
• Incubate at 85°C for 5 min to inactivate the
reverse transcriptase. • Add the following components to a nuclease-free
microcentrifuge tube:
NOTE: RT reaction volume can be scaled down to 10 μl.
12 μl nuclease-free water

Page 5 of 12
(page number not for citation purposes)
Plant Methods 2007, 3:12 http://www.plantmethods.com/content/3/1/12

4 μl SYBR Green I master mix miRNA UPL probe assay protocol

1. Prepare 5× LightCycler TaqMan master mix (Roche
1 μl forward primer (10 μM) Diagnostics) according to manufacturer's instructions.

1 μl reverse primer (10 μM) 2. Prepare a PCR master mix by scaling the volumes
listed below to the desired number of amplification
• Mix gently and centrifuge to bring solution to the reactions. Include 10% overage to cover pipetting
bottom of the tube. errors.

• Store in cooling block or on ice. • Add the following components to a nuclease-free

microcentrifuge tube:
3. Perform real-time PCR:
11.8 μl nuclease-free water
• Place required number of LightCycler capillaries
in precooled centrifuge adapters. 4 μl TaqMan master mix

• Pipet 18 μl master mix into each LightCycler cap- 1 μl forward primer (10 μM)
illary.
1 μl reverse primer (10 μM)
• Add 2 μl RT product.
0.2 μl UPL probe #21 (10 μM)
• Seal each capillary with a stopper.
• Mix gently and centrifuge to bring solution to the
• Place capillaries into the LightCycler carousel bottom of the tube.
and spin in the carousel centrifuge.
• Store in cooling block or on ice.
• Incubate samples at 95°C for 5 min, followed by
35–45 cycles of 95°C for 5 s, 60°C for 10 s, and 3. Perform real-time PCR as described for miRNA
72°C for 1 s. SYBR Green I assay (omit melting curve analysis).

• For melting curve analysis, denature samples at 4. Analyse results using the LightCycler software as
95°C, then cool to 65°C at 20°C per second. Col- described above.
lect fluorescence signals at 530 nm wavelength
continuously from 65°C to 95°C at 0.2°C per sec- Comments
ond. The sensitivity of stem-loop RT-PCR assays
Gel blot analyses of Arabidopsis seedling shoot RNA dilu-
4. Analyse results using the LightCycler software. tion series established that the abundant plant miRNAs
(miR156, miR159 and miR167) can be detected from as
• Prepare standard curves for each primer set by little as 2 μg of total RNA (Figure 2A). To establish the sen-
using dilution series of the experimental sample sitivity of the stem-loop RT-PCR, further step-wise dilu-
expected to have the highest expression. Use at tions of total RNA obtained from Arabidopsis seedling
least 3 points (or one point per log of concentra- shoots were prepared. This amplification was performed
tion whichever is greater). in a semi-quantitative manner, using 20–35 cycles (Figure
2B). This analysis showed that miR156, miR159 and
• Alternatively, standard curves can be prepared miR167 can be detected from as little as 20 pg total RNA
from dilution series of an appropriate RNA oligo- after 35 cycles of PCR. At this number of cycles, no ampli-
nucleotide, e.g. when detecting artificial miRNAs fication or a weak band of primer-dimers was obtained in
or siRNAs. minus-RT control and in stem-loop RT-PCR reactions
with primers designed to amplify the reverse complement
• Perform a Relative Quantification-Monocolor (RC) strand of miRNA. Similarly, no amplification was
Analysis. obtained from the water control (data not shown). How-
ever, 40 or more cycles of PCR often gave rise to some
NOTE: PCR reaction volume can be scaled down to 10 μl. Per- non-specific amplification in control reactions (data not
form PCR in at least three replicates. shown). Therefore, all further end-point amplification
reactions were limited to 35 cycles.

Page 6 of 12
(page number not for citation purposes)
Plant Methods 2007, 3:12 http://www.plantmethods.com/content/3/1/12

Figure
The sensitivity
2 of the stem-loop RT-PCR assay
The sensitivity of the stem-loop RT-PCR assay. A. Gel blot analyses of miR156, miR159 and miR167 expression. AS,
antisense probe; S, sense probe. B. Stem-loop RT-PCR analyses of miR156, miR159 and miR167 expression. The amounts of
RNA used for reverse transcription reactions are indicated on the top. PCR cycle numbers are indicated on the left.

The specificity of stem-loop RT-PCR assays obtained with cucumber tissue RNA (data not shown).
PCR amplification methods can lack specificity for mature These results suggest that the stem-loop RT-PCR assay is
miRNAs. Mature miRNAs are processed from large capped highly specific for mature miRNAs.
and polyadenylated transcripts (primary or pri-miRNA)
that first give rise to short-lived hairpin intermediates Detection of miRNAs from small amounts of tissue and
(pre-miRNA) and finally to mature single stranded miR- phloem sap RNA
NAs. In some instances, total RNA contains large amounts We further analysed the expression of several miRNAs in
of pri-miRNAs, as established for pri-miR156 in pumpkin pumpkin tissues. RNA gel blot analysis suggested higher
and cucumber tissues (Figure 3A). RNA gel blot analyses expression in leaf than in the shoot apex or stem tissue for
clearly show higher expression of pri-miR156 in the shoot miR156; highest expression in the shoot apex, followed
tip and stem than in leaf tissue, and higher expression of by leaf and low expression in the stem tissue for miR159;
mature miRNA in leaf than in shoot tip and stem. To miR167 and miR171 showed similar levels of expression
investigate the ability of stem-loop RT-PCR assays to dif- across all analysed tissues (Figure 4A). Comparable results
ferentiate between mature miRNAs and their pri-miRNAs, were obtained using 28 cycles of stem-loop RT-PCR (Fig-
the reactions were performed using pumpkin tissue total ure 4B).
RNA and the high molecular weight (HMW) and low
molecular weight (LMW) RNA purified from total RNA. To test the ability of the stem-loop RT-PCR assay to detect
Similar amounts of amplification product from total and miRNA sequences in very small amounts of rare biologi-
LMW RNA were obtained after 25 and 30 cycles (Figure cal samples, pumpkin and cucumber phloem sap RNA
3B). The slightly more efficient amplification of total RNA were used. The RNA concentration in pumpkin and
than LMW RNA was the result of RNA losses during puri- cucumber phloem sap is in the range of 300–400 ng/ml
fication, as only 60–75% RNA was recovered. Some [26]. Phloem sap is enriched for some miRNAs and siR-
amplification visible in the HMW RNA fraction is more NAs. miR156, miR159 and miR167 were cloned from the
likely to be the result of contamination of the HMW RNA sap RNA and were detectable in RNA derived from 1 ml of
with LMW RNA, rather than amplification of the primary the sap by RNA gel blot analysis [26]. The stem-loop RT-
miRNA, as there is less amplification in the shoot tip PCR identified miR156, miR159 and miR167 in RNA
HMW RNA than in leaf HMW RNA. Similar results were purified from as little as 0.1 μl phloem sap (Figure 4C).

Page 7 of 12
(page number not for citation purposes)
Plant Methods 2007, 3:12 http://www.plantmethods.com/content/3/1/12

Figure
The specificity
3 of the stem-loop RT-PCR assay
The specificity of the stem-loop RT-PCR assay. A. Gel blot analysis of pri- and mature miR156 expression. High molecu-
lar weight (H) and low molecular weight (L) RNA were purified from 20 μg of total RNA, separated by electrophoresis, trans-
ferred and hybridised with miR156 antisense probe. B. Stem-loop RT-PCR analyses of miR156 expression. 200 ng total RNA
(T), high molecular weight RNA purified from 200 ng total RNA (H) and low molecular weight RNA purified from 200 ng total
RNA (L) were subjected to stem-loop RT PCR. The amount of input RNA as measured by NanoDrop is indicated below. PCR
cycle numbers are indicated to the left. SA, shoot apex; S, stem: L, leaf.

Figure 4 of miRNAs in tissue and phloem sap

Detection
Detection of miRNAs in tissue and phloem sap. A. Gel blot analyses of miRNA expression in pumpkin shoot apex (SA),
leaf (L) and stem (S). An ethidium bromide-stained prominent band of tRNA was used as the loading control (LC). B. Stem-
loop end-point RT-PCR analyses of miRNA expression. miRNAs were amplified using 28 cycles of PCR. Pumpkin RUBISCO
(CmRBS) mRNA was amplified using 30 cycles of standard PCR. C. Stem-loop end-point RT-PCR analyses of miRNA expres-
sion in pumpkin phloem sap. The number of PCR cycles is indicated on the top. miR156, miR159 and miR167, but not miR171
were detected.

Page 8 of 12
(page number not for citation purposes)
Plant Methods 2007, 3:12 http://www.plantmethods.com/content/3/1/12

miR171, previously shown not to be phloem-mobile

[26,27], could not be detected in the phloem sap RNA by
this assay.

Real-time detection of miRNAs using the SYBR Green I

assay and UPL probe assay
An aliquot of cDNA previously used to establish the sen-
sitivity of end-point PCRs was amplified in real-time,
using 35 cycles of the SYBR Green I assay (Figure 5). We
were again able to detect miR156, miR159 and miR167
from as little as 20 pg total RNA without significant ampli-
fication in minus-RT control and the water control. How-
ever, a larger number of amplification cycles often
resulted in non-specific amplification in the 40–80 bp
range that was difficult to distinguish from the desired
amplification product. These non-specific products were
found in the minus-RT and water controls and were often
indistinguishable from the specific PCR products by melt-
ing-curve analysis.

Dual labeled hydrolysis probes such as TaqMan (Applied

Biosystems) and more recently UPL (Roche Diagnostics)
are routinely used to increase specificity of real-time quan-
titative PCR (qPCR) assays. TaqMan probes have been
used successfully to detect mammalian miRNAs [31,32].
However, a unique TaqMan probe is required for each
miRNA sequence, which may be impractical when screen-
ing large numbers of miRNAs. To investigate the efficiency
of a single, universal hybridization probe, we developed a
miRNA UPL probe assay that utilises a short hydrolysis
probe of 8 nucleotides, of which one is a locked nucleic
acid (LNA) to increase binding specificity and melting
temperature. The stem-loop oligonucleotides were rede-
signed to include a UPL probe #21 (Roche Diagnostics)
reverse complement sequence in the stem region between
the miRNA-specific sequence and the universal reverse
oligonucleotide sequence (Figure 1C). Pulsed stem-loop
RT reactions were performed on an RNA dilution series,
followed by UPL qPCR.

We compared miR166 amplification curves obtained

using SYBR Green I assay and the UPL probe assay. At 40
cycles of SYBR Green I assay amplification we could detect
non-specific products in the minus-RT and water controls
(Figure 6A). Melting-curve analysis could not distinguish
between the specific and non-specific PCR products, but
cloning and sequencing of amplicons derived from
Figure 5
miRNA SYBR Green I assay
minus-RT control revealed that they were concatenated miRNA SYBR Green I assay. Real-time PCR amplification
primer sequences (data not shown). profiles of miR156, miR159 and miR167. The amounts of
RNA used for stem-loop pulsed RT were as follows: 1, 20 ng;
At 45 cycles of UPL probe assay amplification, amplifica- 2, 2 ng; 3, 200 pg; 4, 20 pg; 5, 20 ng minus-RT control; 6,
tion curves correlated with the concentration of the RNA water control.
(Figure 6B). Neither of the negative controls (minus-RT
and water) gave a detectable signal, though non-specific
amplification bands from minus-RT control and water

Page 9 of 12
(page number not for citation purposes)
Plant Methods 2007, 3:12 http://www.plantmethods.com/content/3/1/12

NOTE: The concept of stem-loop RT-PCRs has been used in

multiplex assays. We have not tested multiplexing with the UPL
probe assay.

Quantification of miRNA expression in vascular tissue and

phloem sap
Finally, we used the miRNA UPL assay to quantify miRNA
expression levels in pumpkin vascular tissue and the
phloem sap. miRNA expression data were normalized to
pumpkin phloem RNA binding protein, CmPP16, as this
mRNA species was earlier shown to be expressed both in
the vascular tissue and in the phloem sap [34].

This assay established that the phloem sap is enriched for

miR156 and miR167; phloem sap showed a 10-fold
increase in miR156 expression and a 20-fold increase in
miR167 expression compared with the surrounding vas-
culature. The abundance of miRNA159 was similar in the
phloem sap and in the surrounding vascular tissue. Only
relatively low levels of miR171 expression were detected
in the vascular tissue, but very little or no expression was
detectable in the phloem sap (greater than 10-fold below
the levels detected in the vasculature; Figure 7A). The
results were comparable to those obtained by RNA gel
blot analyses (Figure 7B) and spatial analysis using in situ
hybridization [35] that revealed high expression of several
miRNA, including miR159, but not miR167, in the vascu-

Figure 6
miRNA UPL probe assay
miRNA UPL probe assay. A. SYBR Green I assay for
miR166. Negative control reactions (minus-RT and water)
produced detectable amplicons after 40 PCR cycles. B. UPL
probe assay for miR166. No fluorescence was detected in
the negative control reactions after 45 cycles of PCR. C. UPL
probe assay amplification products for miR166 separated by
gel electrophoresis on 4% agarose showing specific and non-
specific amplification bands obtained after 45 cycles of PCR.
Arrowhead indicates the expected size of amplicons. 1, 20 ng
RNA; 2, 2 ng RNA; 3, 200 pg RNA; 4, 20 pg RNA; 5, 20 ng
RNA minus-RT control; 6, water control. Figure 7 of miRNAs in vascular tissue and phloem sap
Expression
Expression of miRNAs in vascular tissue and phloem
sap. A. Expression of miRNAs in pumpkin vascular tissue
(VT) and phloem sap (PS) detected by miRNA UPL assay.
Samples containing 10 ng total RNA isolated from pumpkin
vascular bundles and phloem sap each were subjected to
stem-loop RT reactions and subsequent UPL qPCR. The PCR
could be seen on the agarose gels (Figure 6C). Cloning was performed in three replicates and miRNA expression
and sequencing confirmed that plus-RT reaction products was normalized against CmPP16 and expressed as a ratio with
were the expected amplicons. Sequencing of the minus-RT vascular tissue miR159 expression, which was set arbitrarily
control products revealed that they were concatenated at 1. B. Expression of miRNAs detected by gel blot analyses.
primer sequences.

Page 10 of 12
(page number not for citation purposes)
Plant Methods 2007, 3:12 http://www.plantmethods.com/content/3/1/12

lar bundles of Arabidopsis thaliana and Nicotiana benthami- 10. Chen X: A microRNA as a translational repressor of
APETALA2 in Arabidopsis flower development. Science 2004,
ana. 303(5666):2022-2025.
11. Llave C, Xie Z, Kasschau KD, Carrington JC: Cleavage of Scare-
Conclusion crow-like mRNA targets directed by a class of Arabidopsis
miRNA. Science 2002, 297(5589):2053-2056.
The stem-loop pulsed RT-PCR assays described here are 12. Palatnik JF, Allen E, Wu X, Schommer C, Schwab R, Carrington JC,
rapid, sensitive, specific and convenient for screening a Weigel D: Control of leaf morphogenesis by microRNAs.
large number of miRNAs quickly and inexpensively. They Nature 2003, 425(6955):257-263.
13. Bao N, Lye KW, Barton MK: MicroRNA binding sites in Arabi-
require considerably less tissue and time compared with dopsis class III HD-ZIP mRNAs are required for methylation
standard gel-based methods. We have demonstrated their of the template chromosome. Dev Cell 2004, 7(5):653-662.
14. Llave C, Kasschau KD, Rector MA, Carrington JC: Endogenous and
reliability, sensitivity and specificity using plant tissue silencing-associated small RNAs in plants. Plant Cell 2002,
RNA and phloem sap RNA. These assays enable miRNA 14(7):1605-1619.
expression profiling from as little as 20 pg RNA and as lit- 15. Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP:
Prediction of plant microRNA targets. Cell 2002,
tle as 0.1 μl phloem sap. 110(4):513-520.
16. Sunkar R, Zhu JK: Novel and stress-regulated microRNAs and
other small RNAs from Arabidopsis. Plant Cell 2004,
It is envisaged that this approach will have application in 16(8):2001-2019.
detection and quantification of miRNAs across kingdoms, 17. Sunkar R, Kapoor A, Zhu JK: Posttranscriptional induction of
as well as for other small RNA sequences such as artificial two Cu/Zn superoxide dismutase genes in Arabidopsis is
mediated by downregulation of miR398 and important for
miRNAs and short interfering RNAs (siRNAs). oxidative stress tolerance. Plant Cell 2006, 18(8):2051-2065.
18. Achard P, Herr A, Baulcombe DC, Harberd NP: Modulation of flo-
ral development by a gibberellin-regulated microRNA.
Competing interests Development 2004, 131(14):3357-3365.
The author(s) declare that they have no competing inter- 19. Li H, Xu L, Wang H, Yuan Z, Cao X, Yang Z, Zhang D, Xu Y, Huang
ests. H: The Putative RNA-dependent RNA polymerase RDR6
acts synergistically with ASYMMETRIC LEAVES1 and 2 to
repress BREVIPEDICELLUS and MicroRNA165/166 in Ara-
Authors' contributions bidopsis leaf development. Plant Cell 2005, 17(8):2157-2171.
EV-G conceived of the project, designed the experiments, 20. Schwab R, Palatnik JF, Riester M, Schommer C, Schmid M, Weigel D:
Specific effects of microRNAs on the plant transcriptome.
conducted the gel-blot, end-point and real-time PCR anal- Dev Cell 2005, 8(4):517-527.
yses and prepared the manuscript. RW carried out the real- 21. Chen X: MicroRNA biogenesis and function in plants. FEBS Lett
time PCR, cloning and sequencing and prepared the man- 2005, 579(26):5923-5931.
22. Juarez MT, Kui JS, Thomas J, Heller BA, Timmermans MC: micro-
uscript. MW conceived of the UPL probe assay. EFW RNA-mediated repression of rolled leaf1 specifies maize leaf
acquired the funding and contributed to and edited the polarity. Nature 2004, 428(6978):84-88.
23. Kidner CA, Martienssen RA: Spatially restricted microRNA
manuscript. All authors read and approved the final man- directs leaf polarity through ARGONAUTE1. Nature 2004,
uscript. RPH has given final approval of the version to be 428(6978):81-84.
published. 24. Tang G, Reinhart BJ, Bartel DP, Zamore PD: A biochemical frame-
work for RNA silencing in plants. Genes Dev 2003, 17(1):49-63.
25. Mallory AC, Reinhart BJ, Jones-Rhoades MW, Tang G, Zamore PD,
Acknowledgements Barton MK, Bartel DP: MicroRNA control of PHABULOSA in
We thank Toshi Foster, Charles Ampomah-Dwamena, Anne Gunson and leaf development: importance of pairing to the microRNA 5'
region. Embo J 2004, 23(16):3356-3364.
Sue Muggleston for critical reading of the manuscript. 26. Yoo BC, Kragler F, Varkonyi-Gasic E, Haywood V, Archer-Evans S,
Lee YM, Lough TJ, Lucas WJ: A systemic small RNA signaling
References system in plants. Plant Cell 2004, 16(8):1979-2000.
1. Bartel DP: MicroRNAs: genomics, biogenesis, mechanism, 27. Parizotto EA, Dunoyer P, Rahm N, Himber C, Voinnet O: In vivo
and function. Cell 2004, 116(2):281-297. investigation of the transcription, processing, endonucleo-
2. Bartel B, Bartel DP: MicroRNAs: at the root of plant develop- lytic activity, and functional relevance of the spatial distribu-
ment? Plant Physiol 2003, 132(2):709-717. tion of a plant miRNA. Genes Dev 2004, 18(18):2237-2242.
3. Mallory AC, Vaucheret H: Functions of microRNAs and related 28. Alvarez JP, Pekker I, Goldshmidt A, Blum E, Amsellem Z, Eshed Y:
small RNAs in plants. Nat Genet 2006, 38(Suppl):S31-36. Endogenous and synthetic microRNAs stimulate simultane-
4. Zhang B, Wang Q, Pan X: MicroRNAs and their regulatory roles ous, efficient, and localized regulation of multiple targets in
in animals and plants. J Cell Physiol 2007, 210(2):279-289. diverse species. Plant Cell 2006, 18(5):1134-1151.
5. Axtell MJ, Snyder JA, Bartel DP: Common functions for diverse 29. Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M,
small RNAs of land plants. Plant Cell 2007, 19(6):1750-1769. Asada K, Mirochnitchenko O, Inouye M, Kato I: The expression
6. Zhang B, Pan X, Cannon CH, Cobb GP, Anderson TA: Conserva- profile of microRNAs in mouse embryos. Nucleic Acids Res
tion and divergence of plant microRNA genes. Plant J 2006, 2006, 34(6):1765-1771.
46(2):243-259. 30. Lu C, Tej SS, Luo S, Haudenschild CD, Meyers BC, Green PJ: Eluci-
7. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ: dation of the small RNA component of the transcriptome.
miRBase: microRNA sequences, targets and gene nomencla- Science 2005, 309(5740):1567-1569.
ture. Nucleic Acids Res 2006:D140-144. 31. Chen C, Ridzon DA, Broomer AJ, Zhou Z, Lee DH, Nguyen JT, Bar-
8. Jackson RJ, Standart N: How do microRNAs regulate gene bisin M, Xu NL, Mahuvakar VR, Andersen MR, Lao KQ, Livak KJ, Gue-
expression? Sci STKE 2007, 2007(367):re1. gler KJ: Real-time quantification of microRNAs by stem-loop
9. Aukerman MJ, Sakai H: Regulation of flowering time and floral RT-PCR. Nucleic Acids Res 2005, 33(20):e179.
organ identity by a MicroRNA and its APETALA2-like target 32. Tang F, Hajkova P, Barton SC, Lao K, Surani MA: MicroRNA
genes. Plant Cell 2003, 15(11):2730-2741. expression profiling of single whole embryonic stem cells.
Nucleic Acids Res 2006, 34(2):e9.

Page 11 of 12
(page number not for citation purposes)
Plant Methods 2007, 3:12 http://www.plantmethods.com/content/3/1/12

33. miRBase::Sequences [http://microrna.sanger.ac.uk/sequences/

index.shtml]
34. Xoconostle-Cazares B, Xiang Y, Ruiz-Medrano R, Wang HL, Monzer
J, Yoo BC, McFarland KC, Franceschi VR, Lucas WJ: Plant paralog
to viral movement protein that potentiates transport of
mRNA into the phloem. Science 1999, 283(5398):94-98.
35. Valoczi A, Varallyay E, Kauppinen S, Burgyan J, Havelda Z: Spatio-
temporal accumulation of microRNAs is highly coordinated
in developing plant tissues. Plant J 2006, 47(1):140-151.

Publish with Bio Med Central and every

scientist can read your work free of charge
"BioMed Central will be the most significant development for
disseminating the results of biomedical researc h in our lifetime."
Sir Paul Nurse, Cancer Research UK

Your research papers will be:

available free of charge to the entire biomedical community
peer reviewed and published immediately upon acceptance
cited in PubMed and archived on PubMed Central
yours — you keep the copyright

Submit your manuscript here: BioMedcentral

http://www.biomedcentral.com/info/publishing_adv.asp

Page 12 of 12
(page number not for citation purposes)