From www.bloodjournal.org by guest on September 9, 2018. For personal use only.

NEOPLASIA

Nifuroxazide inhibits survival of multiple myeloma cells by directly

inhibiting STAT3
Erik A. Nelson,1 Sarah R. Walker,1 Alicia Kepich,1 Laurie B. Gashin,1 Teru Hideshima,1 Hiroshi Ikeda,1
Dharminder Chauhan,1 Kenneth C. Anderson,1,2 and David A. Frank1,2
1Department of Medical Oncology, Dana-Farber Cancer Institute, and 2Departments of Medicine, Harvard Medical School and Brigham and Women’s Hospital,

Boston, MA

Constitutive activation of the transcrip- STAT3 function. Nifuroxazide inhibits the come this survival advantage. Reflecting
tion factor STAT3 contributes to the patho- constitutive phosphorylation of STAT3 in the interaction of STAT3 with other cellu-
genesis of many cancers, including mul- MM cells by reducing Jak kinase auto- lar pathways, nifuroxazide shows enhanced
tiple myeloma (MM). Since STAT3 is phosphorylation, and leads to down- cytotoxicity when combined with either the
dispensable in most normal tissue, tar- regulation of the STAT3 target gene Mcl-1. histone deacetylase inhibitor depsipeptide
geted inhibition of STAT3 is an attractive Nifuroxazide causes a decrease in viabil- or the MEK inhibitor UO126. Therefore, us-
therapy for patients with these cancers. ity of primary myeloma cells and my- ing a mechanistic-based screen, we identi-
To identify STAT3 inhibitors, we devel- eloma cell lines containing STAT3 activa- fied the clinically relevant drug nifuroxazide
oped a transcriptionally based assay and tion, but not normal peripheral blood as a potent inhibitor of STAT signaling that
screened a library of compounds known mononuclear cells. Although bone mar- shows cytotoxicity against myeloma cells
to be safe in humans. We found the drug row stromal cells provide survival signals that depend on STAT3 for survival. (Blood.
nifuroxazide to be an effective inhibitor of to myeloma cells, nifuroxazide can over- 2008;112:5095-5102)

Introduction
Signal transducers and activators of transcription (STATs) are a promote the continued survival and proliferation of MM cells.6
family of transcription factors essential for the pathogenesis of Thus, the pathogenesis of MM depends on STAT3 signaling, and
many cancers.1 In normal cells, signaling initiated by cytokines and interruption of this signaling pathway may lead to the death of
growth factors leads to the transient activation of STATs by tyrosine these cancer cells.
kinases, such as members of the Janus kinase (Jak) family. To develop targeted inhibitors of STAT3 function for the
Activation involves phosphorylation of a tyrosine residue near the treatment of MM and other forms of cancer, we developed a
carboxyl terminus followed by dimerization of 2 STAT monomers. cell-based assay to measure STAT3-dependent transcriptional
These activated STATs enter the nucleus, and regulate gene activity. To accelerate the identification of agents that could be used
transcription by binding to specific DNA regulatory elements. in clinical trials, we used this system to perform a high-throughput
STATs have long been known for their ability to up-regulate genes; screen of compounds known to be bioactive, including many drugs
however, emerging evidence demonstrates that STATs can also presently in clinical use for a variety of diseases.
down-regulate key target genes.2,3 Soon after activation, STATs are
typically dephosphorylated, ending the signaling process. In can-
cer, STAT activation is often constitutive.4 This can occur through a
variety of mechanisms, such as positive signaling from mutated Methods
kinases, or by a lack of negative regulation by phosphatases or
Cell culture
other feedback inhibitors. This continuously activated state leads to
the inappropriate regulation of genes that are important for survival RPMI 8266, H929, and U266 myeloma cells were obtained from ATCC
and proliferation, and that are known to contribute to the malignant (Manassas, VA) and were grown in RPMI media containing 10% fetal calf
phenotype. serum. 293 human embryonic kidney cells (ATCC) were grown in DMEM
STAT3 in particular has been found to be a critical mediator in containing 10% fetal calf serum. The IL-6–dependent INA6 myeloma cell
line7 was obtained from Dr Renate Burger (University of Kiel, Kiel,
the pathogenesis of many tumors. STAT3 is activated by several
Germany), and was grown in RPMI media containing 10% fetal calf serum
factors including IL-6, a cytokine essential for the survival of many
supplemented with 1 ng/mL IL-6 (Peprotech, Rocky Hill, NJ). STAT1-null
cell lineages, including B lymphocytes and plasma cells. Multiple U3A cells and the parental 2FTGH cells were a gift from Dr George Stark
myeloma (MM) is a plasma cell malignancy often characterized by (Cleveland Clinic, Cleveland, OH), and were grown in DMEM containing
the constitutive activation of STAT3.5 In the bone marrow environ- 10% fetal calf serum. T47D human mammary carcinoma cells (ATCC)
ment, cytokines such as IL-6 can be secreted by stromal cells or the were grown in DMEM containing 10% fetal calf serum. Bone marrow
myeloma cells themselves, and the presence of these cytokines can mononuclear cells from patients with untreated multiple myeloma were

Submitted December 19, 2007; accepted September 7, 2008. Prepublished The publication costs of this article were defrayed in part by page charge
online as Blood First Edition paper, September 29, 2008; DOI 10.1182/blood- payment. Therefore, and solely to indicate this fact, this article is hereby
2007-12-129718. marked ‘‘advertisement’’ in accordance with 18 USC section 1734.

The online version of this article contains a data supplement. © 2008 by The American Society of Hematology

BLOOD, 15 DECEMBER 2008 䡠 VOLUME 112, NUMBER 13 5095

 From www.bloodjournal.org by guest on September 9, 2018. For personal use only.

5096 NELSON et al BLOOD, 15 DECEMBER 2008 䡠 VOLUME 112, NUMBER 13

obtained through a Dana-Farber Cancer Institute IRB-approved protocol, 4% ␤-mercaptoethanol and boiled for 5 minutes. For STAT analysis, protein
and were cultured in RPMI media containing 10% fetal calf serum. was resolved on an 8% acrylamide gel, and for Mcl-1 analysis, protein was
resolved on a 12% gel, then transferred to nitrocellulose. Membranes were
Antibodies blocked in 5% milk in TBST (USB, Cleveland, OH) for 1 hour. Blots were
washed in TBST and incubated with the appropriate horseradish peroxidase–
Antibodies recognizing STAT3 (sc-482), Jak2 (sc-278), Jak1 (sc-295), Tyk2 labeled secondary antibody. Following washing in TBST, the blots were
(sc-169), c-src (sc-18), and Mcl-1 (sc-819) were obtained from Santa Cruz developed using Western Blot Chemiluminescence Reagent Plus
Biotechnology (Santa Cruz, CA); tyrosine-phosphorylated STAT3 (9131L), (PerkinElmer, Boston, MA). For immunoprecipitations, cells were lysed on
and pan-phospho-tyrosine (9411 and 9416) were from Cell Signaling ice for 15 minutes in radioimmunoprecipitation assay (RIPA) buffer
Technology (Danvers, MA); epidermal growth factor receptor (EGFr) (150 mM NaCl, 50 mM Tris, pH 7.4, 1% NP40, 0.5% sodium deoxy-
(2232), Parp (9542), p-STAT3 (9131L), and pan-phospho-tyrosine (9411 cholate, and 0.1% SDS) supplemented with sodium vanadate and protease
and 9416), p-src (2101), p-EGFr (2234), and p-Jak1 (3331) were from Cell inhibitors. Lysates were cleared by centrifugation. The supernatant was
Signaling Technology; anti–tyrosine 4G10 platinum (05-1050x) was from incubated with the indicated antibody overnight. Protein A/G Plus beads
Millipore (Billerica, MA); tubulin was from Sigma (St Louis, MO); and (Santa Cruz Biotechnology) were added and incubated for 2 hours, after
serine-phosphorylated STAT3 was generated as described.8 which the beads were washed 4 times in RIPA buffer. The beads were
resuspended in 2⫻ sample buffer containing 10% ␤-mercaptoethanol and
Compounds boiled for 5 minutes. Quantitation of band intensity was performed using
ImageJ software (National Institutes of Health, Bethesda, MD;
The Prestwick chemical library was obtained from Prestwick Chemical
http://rsb.info.nih.gov/ij/index.html).
Company (Illkirch, France). Nifuroxazide (catalog no. 5227235) was
obtained from Chembridge (San Diego, CA), and was dissolved in DMSO
Viability assays
at a concentration of 150 mM. Jak inhibitor 1 (420099), WP1066 (573097),
and AG490 (658401) were obtained from EMD (La Jolla, CA). The final Cells (104) were plated in opaque 96-well dishes. Compound or vehicle was
concentration of DMSO in cellular experiments was 0.1%. added to yield a total volume of 100 ␮L. At the indicated times, cell
viability was assessed using the CellTiter-Glo Luminescent Cell Viability
Generation of reporter cell lines Assay (Promega).
To measure STAT3-dependent luciferase activity, the STAT-luc/U3A cell
Bone marrow stromal cell culture
line was used.9 A STAT1-responsive line (STAT-luc/2FTGH) was generated
by cotransfecting pIRES-puro with a STAT-responsive luciferase plasmid10 After IRB approval from the Dana-Farber Cancer Institute and informed
into 2FTGH cells. A STAT5-responsive line (NCAM2-luc/T47D) was consent in accordance with the Declaration of Helsinki, bone marrow
generated by cotransfecting pIRES-puro with a STAT5-responsive NCAM2- specimens were obtained from patients with MM. Mononuclear cells
luciferase construct11 into T47D cells. An NF-␬B–responsive cell line (MNCs) separated by Ficoll-Hypaque density sedimentation were used to
(NF-␬B-luc/293) was generated by cotransfecting pIRES-puro with an establish long-term bone marrow stromal cell (BMSC) cultures, as previ-
NF-␬B–responsive reporter plasmid (catalog no. 219078; Stratagene, La ously described,12 except no growth factors were added. When an adherent
Jolla, CA) into 293 cells. After selection, individual clones were isolated. To cell monolayer developed, cells were harvested in Hanks buffered saline
assess reporter gene activity, STAT-luc/U3A cells were stimulated for solution containing 0.25% trypsin and 0.02% EDTA, washed, and collected
6 hours with 10 ng/mL IL-6; STAT-luc/2FTGH cells were stimulated with by centrifugation. For coculture experiments, 5 ⫻ 105 BMSCs were seeded
500 units/mL IFN␥; NCAM2-luc/T47D cells were stimulated with 100 ng/ into a 25-cm2 flask and cultured overnight. The cells were washed 3 times
mL prolactin; NF-␬B-luc/293 cells were stimulated for 6 hours with with PBS, and U266 cells were added. The coculture was maintained for
10 ng/mL TNF␣. IL-6 and TNF␣ were obtained from Peprotech, whereas 48 hours after drug addition, after which, the U266 cells were collected for
IFN␥ and prolactin were obtained from R&D Systems (Minneapolis, MN). protein isolation.

Identification of STAT3 inhibitors Gene expression analysis

To identify STAT3 inhibitors, we screened the Prestwick Chemical Library, Cells were incubated for the indicated times with either compound or
which contains 1120 bioactive compounds. Compounds were tested for vehicle, and RNA was isolated using the RNeasy kit (QIAGEN, Valencia,
their ability to modulate STAT3 activity using the STAT-luc/U3A cells. To CA). cDNA was generated using the Taqman reverse transcription kit
eliminate compounds displaying nonspecific activity, a counter screen was (Applied Biosystems, Foster City, CA). Quantitative real-time polymerase
performed using the NF-␬B-luc/293 cells. Cells (2.5 ⫻ 103) were plated in chain reaction (PCR) was performed in triplicate using SYBR green master
triplicate in 30 ␮L media in an opaque 384-well dish. The following day, mix (Applied Biosystems) on a model 7500 real time PCR system (Applied
100 nL (2 mg/mL) of each compound from the library was transferred to the Biosystems). Data are expressed as the mean fold change plus or minus SE
cells. After one hour of incubation, cytokines were added at the indicated of 3 replicates. Each assay was repeated at least 3 times. Primers used were
concentrations. For confirmation of inhibitory activity, and for testing Mcl-1, forward, GAGACCTTACGACGGGTT and reverse, TTTGATGTC-
compounds for STAT1 and STAT5 inhibitory activity, 104 cells were plated CAGTTTCCG; HPRT, forward, GAACGTCTTGCTCGAGATGTG and
in opaque 96-well plates. The following day, drug was added for one hour, reverse, CCAGCAGGTCAGCAAAGAATT.
after which cytokines were added. Six hours later, luciferase activity was
quantitated using the Bright-Glo Luciferase Assay System from Promega Statistical analysis
(Madison, WI) and a Luminoskan Ascent luminometer from Labsystems
Analysis of the effects of combinations of agents was performed using
(Helsinki, Finland).
CalcuSyn software (Conservion, Ferguson, MO) using previously estab-
lished parameters for determining synergy.13
Western blotting and immunoprecipitation

Protein was isolated from myeloma cells by incubating cells on ice for
15 minutes in lysis buffer (50 mM Tris, pH 8.0, 250 mM NaCl, and 0.5% Results
NP40) supplemented with sodium vanadate and Complete Protease
Inhibitors (Roche, Indianapolis, IN). Lysates were cleared by centrifuga- Identification of nifuroxazide as a STAT inhibitor
tion. Protein concentration was quantitated using the Bradford Reagent
(Bio-Rad Laboratories, Hercules, CA). Lysates were mixed with 2⫻ sample To assess the ability of compounds to inhibit STAT3 function, we
buffer (0.125 M Tris, pH 6.8, 4% SDS, 20% glycerol) containing used U3A cells stably expressing a luciferase reporter gene under
 From www.bloodjournal.org by guest on September 9, 2018. For personal use only.

BLOOD, 15 DECEMBER 2008 䡠 VOLUME 112, NUMBER 13 NIFUROXAZIDE INHIBITS STAT3 IN MULTIPLE MYELOMA 5097

completely dependent upon STAT3 function. We used this cell line

to interrogate the Prestwick Library of 1120 bioactive compounds
to identify clinically relevant drugs that specifically inhibit STAT3
function. To eliminate compounds that broadly inhibit gene expres-
sion, we performed a parallel counter screen using the NF-␬B-luc/
293 cell line in which luciferase expression is driven by the
transcription factor NF-␬B. Through this approach, we identified
nifuroxazide as a potent inhibitor of STAT3 (Figure 1A). Nifuroxa-
zide inhibited STAT3-dependent luciferase activity, with an EC50 of
approximately 3 ␮M (Figure 1B). By contrast, at concentrations up
to 10 ␮M, nifuroxazide had essentially no effect on NF-␬B–
dependent luciferase expression. Thus, nifuroxazide is a potent
inhibitor of STAT3 function.
Nifuroxazide inhibits STAT3 tyrosine phosphorylation

Having shown that nifuroxazide inhibits STAT3 function, we next

examined the mechanism for this effect. Since tyrosine phosphory-
lation is a critical event for STAT3 activation, we analyzed the
effect of nifuroxazide on the constitutive STAT3 tyrosine phosphor-
ylation found in U266 myeloma cells. When U266 cells were
incubated with nifuroxazide, a significant dose-dependent decrease
Figure 1. Nifuroxazide inhibits STAT3-dependent gene expression. (A) Chemical
structure of nifuroxazide. (B) STAT3 and NF-␬B reporter cells were pretreated with
in STAT3 tyrosine phosphorylation was observed, reaching approxi-
nifuroxazide at the indicated concentrations for 1 hour, after which cells were mately 50% inhibition at a concentration of 10 ␮M (Figure 2A).
stimulated with IL-6 or TNF-␣, respectively, for 6 hours. Luciferase activity was This was comparable with the inhibition of STAT3-dependent
quantitated by luminometry.
reporter gene activity seen with this drug (Figure 1B). This
inhibition of STAT3 tyrosine phosphorylation was rapid, occurring
the control of a STAT-dependent promoter.9 Basal luciferase as early as one hour after treatment, and was sustained for at least
expression is minimal in these cells. However, when they are 24 hours (Figure 2B). STAT3 can also be phosphorylated on a
treated with IL-6, robust and reproducible luciferase expression can carboxy-terminal serine residue, serine 727, and this modification
be detected. Although STAT1 can also activate this promoter, U3A may modulate STAT3 transcriptional activity. U266 cells contain
cells lack STAT1, and thus luciferase activity in these cells is STAT3 that is constitutively phosphorylated on serine 727, but this

Figure 2. Nifuroxazide inhibits STAT3, Jak2, and

Tyk2 tyrosine phosphorylation. (A) U266 cells were
incubated with the indicated concentration of nifuroxa-
zide for 24 hours, after which whole-cell lysates were
prepared, and Western blot analysis was performed
using antibodies specific for tyrosine-phosphorylated
STAT3 (p-tyr STAT3) and total STAT3. (B) U266 cells
were incubated for the indicated times with 10 ␮M
nifuroxazide. Western blots were performed for tyrosine-
phosphorylated STAT3, serine-phosphorylated STAT3
(p-ser STAT3), and total STAT3. (C) INA6 cells were
incubated with 10 ␮M nifuroxazide or vehicle for 6 hours,
after which immunoprecipitation was performed fol-
lowed by Western blotting with the indicated antibodies.
Quantitation of bands is shown for each panel.
 From www.bloodjournal.org by guest on September 9, 2018. For personal use only.

5098 NELSON et al BLOOD, 15 DECEMBER 2008 䡠 VOLUME 112, NUMBER 13

modification is unaffected by nifuroxazide treatment (Figure 2B).

Thus, nifuroxazide inhibits STAT3 activity through the inhibition
of STAT3 tyrosine phosphorylation.
Nifuroxazide inhibits Jak kinase phosphorylation

Given these findings, we next determined whether an upstream

tyrosine kinase is affected by nifuroxazide treatment. IL-6 auto-
crine and paracrine loops play a role in the pathogenesis of many
cases of MM,14 and thus we focused on the Jak family kinases,
Jak2, Tyk2, and Jak1, which are the central mediators of the effects
of IL-6.15 To determine the effect of nifuroxazide on the activation
of these kinases, we performed immunoprecipitations to determine
their level of tyrosine phosphorylation, which reflects their kinase
activity. IL-6–dependent INA6 MM cells were treated with 10 ␮M
nifuroxazide for 6 hours, after which immunoprecipitations were
performed to Jak2, Tyk2, Jak1, or STAT3. Western blotting was
then performed using an antibody specific for phosphotyrosine to
determine the activation state of these proteins. As expected, Figure 3. Nifuroxazide reduces the expression of Mcl-1. (A) U266 cells were
nifuroxazide led to a decrease in tyrosine phosphorylation of treated with 10 ␮M nifuroxazide for 24 hours, and Mcl-1 mRNA expression was
STAT3 by almost 70% (Figure 2C). In addition, the tyrosine quantitated by quantitative reverse-transcription (RT)–PCR, using HPRT as an
invariant control. (B) U266 and INA6 cells were treated with 10 ␮M nifuroxazide for
phosphorylation of Jak2 and Tyk2 showed decreases of approxi- the indicated times, and Western blot analysis was performed using antibodies to
mately 50%, whereas the low level of Jak1 phosphorylation was Mcl-1 or ␤-actin, which served as a loading control. Quantitation of the Western blot is
little changed. This suggested that nifuroxazide decreased STAT3 shown at right.
phosphorylation in these cells through an inhibition in upstream
Jak kinases. To determine whether nifuroxazide inhibits tyrosine
kinases broadly, we examined the effect of this drug on the EGF receptor and RPMI 8226 and H929 cells that lack detectable STAT3 phosphory-
tyrosine kinase (in HCC-827 cells) and Src (in A549 cells). Neither lation.17 Treatment of U266 or INA6 cells with nifuroxazide for
showed a significant change in activity (data not shown), indicating that 48 hours resulted in a dose-dependent loss of cell viability with an EC50
nifuroxazide is relatively specific for Jak2 and Tyk2. of approximately 4.5 ␮M in both cell types (Figure 4A). Notably, the
MM cells lacking constitutive STAT3 activation showed little toxicity to
Having shown that nifuroxazide can inhibit Jak2 and Tyk2, we
nifuroxazide. Other known Jak inhibitors, including pyridone 6, AG490,
considered the possibility that nifuroxazide could inhibit the
and WP 1066, show similar effects in reducing INA6 viability (data not
activation of other STAT family members that may be activated by
shown). Importantly, peripheral blood mononuclear cells from healthy
these kinases. Using luciferase reporter systems dependent on the
donors showed essentially no toxicity to nifuroxazide treatment. These
activation of STAT1 by interferon-␥ or the activation of STAT5 in
results suggest that nifuroxazide does not show nonspecific toxicity, and
response to prolactin, we found that nifuroxazide could inhibit both of
exerts a cytotoxic effect only on myeloma cells characterized by
these reporter systems with a similar dose response as seen for STAT3
constitutive STAT3 activation.
(data not shown). Thus, nifuroxazide can inhibit the activation of several
It is notable that nifuroxazide causes a prominent decrease in
STAT family members in Jak-dependent systems.
viability of INA6 cells while causing only partial inhibition of
Nifuroxazide inhibits expression of the endogenous STAT3 STAT3 phosphorylation. To determine whether this was a character-
target gene Mcl-1 istic of other Jak kinase inhibitors, we performed detailed quantita-
tive dose-response analyses of both cellular viability and STAT3
Having shown that nifuroxazide inhibits STAT3 phosphorylation phosphorylation in INA6 cells treated with nifuroxazide or 2 other
and activation of a heterologous reporter gene, we next examined Jak inhibitors, WP1066 and Jak inhibitor 1. At concentrations of
the effect of this drug on expression of an endogenous STAT3 these drugs that caused a 90% decrease in viability, nifuroxazide
target gene. We focused on Mcl-1, as this a key STAT3 target gene caused a 50% decrease in STAT3 phosphorylation (Table S1,
that is known to be critical for the aberrant survival and malignant available on the Blood website; see the Supplemental Materials
phenotype of myeloma.16 Twenty-four–hour treatment of U266 link at the top of the online article). Similarly, WP1066 induced a
cells with 10 ␮M nifuroxazide led to a 40% decrease in Mcl-1 mRNA 60% decrease in STAT3 phosphorylation, whereas Jak inhibitor 1
expression when normalized to HPRT expression (Figure 3A). To led to a 90% decrease in STAT3 phosphorylation. Thus, even
determine whether this led to a loss of expression of Mcl-1 protein, incomplete inhibition of STAT3 phosphorylation can be associated
Western analysis was performed on U266 and INA6 cells treated with with inhibition of expression of key target genes (Figure 3) and
nifuroxazide. The level of Mcl-1 protein was reduced at both 8 hours substantial decreases in cellular viability.
and 24 hours in both cell types (Figure 3B). Thus, nifuroxazide can
Nifuroxazide leads to a loss of viability of primary
decrease expression of a bona fide endogenous STAT3 target gene.
myeloma cells
Nifuroxazide decreases viability of myeloma cells with
activated STAT3 Although nifuroxazide shows considerable efficacy in decreasing
the viability of multiple myeloma cell lines characterized by
Given the evidence that STAT3 plays an essential role in the STAT3 activation, we wished to exclude the possibility that this
pathogenesis of myeloma, we next evaluated the effect of nifuroxa- was a feature unique to myeloma cells that had been selected for
zide on the viability of MM cell lines. We used U266 and INA6 their ability to grow in vitro. We obtained bone marrow specimens
myeloma cells that contain constitutive STAT3 phosphorylation, from 6 untreated myeloma patients, and assessed the effect of
 From www.bloodjournal.org by guest on September 9, 2018. For personal use only.

BLOOD, 15 DECEMBER 2008 䡠 VOLUME 112, NUMBER 13 NIFUROXAZIDE INHIBITS STAT3 IN MULTIPLE MYELOMA 5099

Figure 4. Nifuroxazide inhibits the viability of MM

cells containing constitutive STAT3 phosphoryla-
tion. (A) MM cells containing STAT3 phosphorylation
(U266 and INA6), MM cells without STAT3 phosphory-
lation (RPMI 8226 and H929), and peripheral blood
mononuclear cells (PBMCs) from healthy donors were
treated with the indicated concentrations of nifuroxa-
zide for 48 hours. Cell viability was measured using an
ATP-dependent bioluminescence assay. (B) Bone mar-
row aspirates from MM patient samples were treated
with the indicated concentrations of nifuroxazide for
72 hours. Cell viability was measured using an ATP-
dependent bioluminescence assay. (C) U266 cells
cultured in the presence or absence of BMSCs were
treated with the indicated concentration of nifuroxazide for
6 hours, and then examined by Western blot analysis with
the indicated antibodies. (D) U266 cells were cultured in the
presence or absence of BMSCs for 48 hours with the indi-
cated concentrations of nifuroxazide. 3H thymidine incorpo-
ration was measured during the final 8 hours of incubation
to measure DNA synthesis.

nifuroxazide on the viability of these cells. When the cells were with its effect on STAT3 phosphorylation, nifuroxazide reduced the
treated with nifuroxazide for 72 hours, the viability of all of the proliferation of myeloma cells even in the presence of stroma, with
patient specimens decreased with a dose response comparable with a similar dose response as seen in monoculture. Thus, nifuroxazide
that seen with U266 or INA6 cells (Figure 4B). Thus, nifuroxazide is effective at decreasing the activation of STAT3 and reducing the
is active against primary myeloma samples. viability of myeloma cells in an environment closely resembling
that seen in vivo.
Nifuroxazide overcomes the prosurvival effects of bone
Consistent with the enhanced survival and proliferation seen when
marrow stromal cells
MM cells are cultured in the presence of BMSCs, phosphorylation of
Myeloma cells in vivo depend on survival and proliferation signals MAP kinase and Akt is also increased in U266 cells under coculture
from bone marrow stromal cells, and thus it is essential for any conditions (Figure S1). Interestingly, in contrast to the effect of
effective treatment to overcome this effect.6 To assess the effects of nifuroxazide on STAT3 phosphorylation, nifuroxazide caused a further
nifuroxazide on MM cells in this environment, we first analyzed increase in both MAP kinase and Akt phosphorylation. Thus, the effects
the effect of BMSC coculture on STAT3 activation of the myeloma of nifuroxazide in decreasing survival and proliferation of myeloma
cells. Consistent with the prosurvival effects of this environment, cells are not mediated by inhibition of these pathways, and are more
coculture of myeloma cells with BMSCs led to enhanced STAT3 likely to be secondary to inhibition of STAT3.
tyrosine phosphorylation in the myeloma cells (Figure 4C). How- The combination of nifuroxazide and the histone deacetylase
ever, nifuroxazide led to a similar decrease in STAT3 phosphoryla- inhibitor depsipeptide leads to enhanced toxicity of MM cells
tion in the presence or absence of BMSCs. Furthermore, as
expected, the presence of bone marrow stromal cells also led to There is evidence that the simultaneous inhibition of 2 signaling
increased proliferation of U266 cells (Figure 4D). However, as pathways is necessary to induce apoptosis of MM cells in the
 From www.bloodjournal.org by guest on September 9, 2018. For personal use only.

5100 NELSON et al BLOOD, 15 DECEMBER 2008 䡠 VOLUME 112, NUMBER 13

Figure 5. The combination of nifuroxazide and depsipep-

tide results in enhanced cytotoxicity of MM cells.
(A) INA6 cells were incubated with the indicated doses of
nifuroxazide and depsipeptide for 72 hours. Viability was
measured using an ATP-dependent bioluminescence assay.
(B) INA6 cells were incubated with the indicated doses of
nifuroxazide and depsipeptide for 48 hours, after which Western
analysis was performed with the indicated antibodies.

presence of bone marrow stromal cells.18 Thus we considered the determine whether inhibition of MAPK and STAT3 would result in
possibility that a STAT3 inhibitor such as nifuroxazide might show enhanced cytotoxicity, we combined the MEK inhibitor UO126
enhanced cytotoxicity in combination with an agent that targeted a with nifuroxazide and examined cellular viability. U266 cells
different mechanism. Neither doxorubicin nor bortezomib showed treated with this combination showed enhanced cytotoxicity com-
significant combinatorial effects with nifuroxazide (data not shown). pared with either treatment alone (Figure 6A). Similar results were
However, increasing evidence has suggested that histone deacety- seen with INA6 cells (data not shown). H929 cells that have no
lase (HDAC) inhibitors may show significant therapeutic effects in activated STAT3 do not show this combinatorial effect (data not
hematologic malignancies.19 We focused on depsipeptide, a natural shown). These results suggest that clinically relevant MAPK
product with extremely potent effects as an HDAC inhibitor.20 inhibitors may be useful in combination with nifuroxazide for the
When INA6 cells were treated with the combination of nifuroxa- treatment of patients with MM.
zide and picomolar concentrations of depsipeptide, nearly com- The MAPK pathway has been linked to the serine phosphoryla-
plete cytotoxicity could be induced (Figure 5A), with evidence of tion of STAT3, which can enhance its transcriptional activity.21
synergism with 3 ␮M nifuroxazide and 750 nM depsipeptide, and Since STAT3 shows constitutive phosphorylation of serine 727 in
5 ␮M nifuroxazide with either concentration of depsipeptide both U266 and INA6 cells (Figure 2 and data not shown), we
(combination index13 ⬍ 0.5). This combinatorial effect did not considered the possibility that the combinatorial effect of nifuroxa-
occur in H929 cells that lack activated STAT3 (data not shown). zide with U0126 may be due to the loss of both tyrosine and serine
Nifuroxazide combined with depsipeptide in INA6 cells resulted in an phosphorylation of STAT3. When U266 cells are treated with
enhanced reduction in STAT3 tyrosine phosphorylation, as well as an U0126, a slight reduction in serine phosphorylation of STAT3 is
increase in Parp cleavage, indicating increased apoptosis (Figure 5B). seen (Figure 6B). Nifuroxazide alone has no effect on serine
Thus, the combination of STAT3 inhibition and HDAC inhibition may phosphorylation of STAT3, and nifuroxazide does not enhance the
be a useful strategy for clinical trials for myeloma. inhibition of STAT3 phosphorylation induced by U0126. We next
The combination of nifuroxazide and MEK inhibition leads to
considered the possibility that these drugs might cooperate in
enhanced killing of MM cells
inhibiting the tyrosine phosphorylation of STAT3. Whereas U0126
alone shows a modest reduction in STAT3 tyrosine phosphoryla-
The MAP kinase pathway has been linked to survival signals for tion, the combination of nifuroxazide and UO126 leads to nearly
cancer cells, and inhibition of this pathway, together with the complete inhibition of this modification (Figure 6B). This suggests
IL-6/STAT3 signaling pathway, leads to a loss of viability of MM that the enhanced cytotoxicity of nifuroxazide combined with
cells.18 This suggested that combining a MAPK inhibitor with UO126 may be due to increased inhibition of tyrosine phosphoryla-
nifuroxazide might enhance the cytotoxicity of nifuroxazide. To tion of STAT3.
 From www.bloodjournal.org by guest on September 9, 2018. For personal use only.

BLOOD, 15 DECEMBER 2008 䡠 VOLUME 112, NUMBER 13 NIFUROXAZIDE INHIBITS STAT3 IN MULTIPLE MYELOMA 5101

Although not currently available for clinical use in the United States,
nifuroxazide is available in many countries worldwide. In randomized
double-blind control trials, nifuroxazide has shown benefit in adults with
acute diarrhea, and is extremely well tolerated.22 Since it is generally given
orally, its systemic bioavailability is unclear, and little information is
available on the parenteral administration of nifuroxazide. However, it is
chemically related to nitrofurantoin, which does show good oral absorp-
tion, and is used widely for the treatment of urinary tract infections. In
addition, several analogs of nifuroxazide have been synthesized,23,24 and
one or more of these may show STAT3 inhibitory activity as well.
Nifuroxazide appears to inhibit STAT3 phosphorylation through
inhibition of the Jak family kinases Jak2 and Tyk2. Given that the
constitutive activation of STATs in many tumors is due to aberrant
activation of Jaks,25,26 nifuroxazide may be useful for the treatment
of these other tumors as well. Nifuroxazide is not a nonspecific
tyrosine kinase inhibitor, as it showed no effects against the EGF
receptor kinase or Src. Although the full spectrum of kinases
inhibited by nifuroxazide is not yet known, increasing evidence
supports the utility of multikinase inhibitors in oncology.27 Thus,
nifuroxazide may have broader efficacy as well.
At active concentrations, nifuroxazide inhibits STAT3 tyrosine
phosphorylation by approximately 50%, and decreases STAT3-
dependent gene expression by 50%. This is consistent with findings
from other approaches to inhibit STAT3 that there is likely a
threshold effect at which STAT3-dependent gene products promote
malignant cellular behavior. For example, partial depletion of
constitutively active STAT3 leads to prominent effects on viability
in lung cancer cells.28 Similarly, in prostate cancer cells, inhibition
of STAT3 phosphorylation with low concentrations of the Jak
inhibitor AG490 (25-50 ␮M) leads to partial inhibition of STAT3
activation, but significant effects on cellular viability.29 Thus, even
partial inhibition of STAT3 is likely to confer therapeutic benefit,
although these findings can also reflect effects of these drugs on
additional targets. In this context, it is also notable that nifuroxa-
Figure 6. The combination of nifuroxazide and the MEK inhibitor UO126 results zide showed no inhibition of Akt and MAP kinase phosphorylation.
in enhanced cytotoxicity of MM cells and enhanced loss of STAT3 tyrosine This provides evidence that the effects of this drug on myeloma cell
phosphorylation. (A) U266 cells were incubated with the indicated concentrations of
nifuroxazide and UO126 for 48 hours. Viability was measured using an ATP-
survival and proliferation are more likely mediated by its inhibition
dependent bioluminescence assay. (B) U266 cells were incubated with the indicated of STAT signaling than one of these other pathways.
concentrations of nifuroxazide and UO126 for 24 hours. Western blots were Since many STAT3 target genes are prosurvival genes, it is not
performed for tyrosine-phosphorylated STAT3, serine-phosphorylated STAT3 (p-ser
surprising that STAT3 inhibition may show combinatorial effects when
STAT3), and total STAT3.
paired with other modalities of therapy. We have shown an additive
effect of nifuroxazide on the viability of myeloma cells when used in
combination with the MEK inhibitor U0126. It has been suggested that
Discussion MAP kinases can mediate the serine phosphorylation of STAT3,30 and
thus the combination of a MEK inhibitor and an inhibitor of STAT3
Although STAT3 is a critical mediator of the oncogenic phenotype of tyrosine phosphorylation might show synergy based on this mechanism.
many cancers, it is not required for the function of most normal cells.1 Inhibition of MAPK showed only a slight reduction in the constitutive
Thus, finding effective inhibitors of STAT3 may provide useful targeted serine phosphorylation of STAT3 found in myeloma cells. However, the
agents for cancer therapy. Although much effort has gone into the combination of U0126 with nifuroxazide caused a pronounced decrease
development of STAT3 inhibitors, it has been difficult to introduce these in STAT3 tyrosine phosphorylation. Although the mechanism for this is
agents into clinical trials. To circumvent this problem, we sought to unclear, this finding shows another level of cross talk between the
identify drugs known to be safe in humans that might act as effective STAT3 and MAPK pathways, and suggests that the mechanism of the
STAT3 inhibitors. Starting with a library of known bioactive agents, we combinatorial effect of nifuroxazide and U0126 is likely through their
identified the antidiarrheal agent nifuroxazide as a potent inhibitor of convergent effects on STAT3 tyrosine phosphorylation.
STAT3. Nifuroxazide reduces STAT3 tyrosine phosphorylation, and Nifuroxazide also shows enhanced cytotoxicity to multiple my-
inhibits the viability of both primary myeloma cells and myeloma cell eloma cells when combined with the HDAC inhibitor depsipeptide, a
lines containing constitutive STAT3 activation. Nifuroxazide also showed drug currently in clinical trials for the treatment of hematologic
combinatorial effects on the viability of myeloma cells when used in malignancies. The exact mechanism by which HDAC inhibitors exert
conjunction with the histone deacetylase inhibitor depsipeptide, as well as their therapeutic effect is unclear, but may involve enhanced acetylation
with the MEK inhibitor UO126. Given that nifuroxazide showed no effect of lysine residues in histones, transcription factors, and other cellular
on normal hematopoietic cells, this drug may be useful in clinical trials for proteins.31 This can lead to changes in gene expression, though
the treatment of patients with multiple myeloma. depsipeptide may also cause cell death through caspase activation.32
 From www.bloodjournal.org by guest on September 9, 2018. For personal use only.

5102 NELSON et al BLOOD, 15 DECEMBER 2008 䡠 VOLUME 112, NUMBER 13

Thus, it is possible that the decrease in prosurvival genes mediated by publication, and the Chemical Biology Platform of the Broad
STAT3 inhibition may cooperate with caspase activation mediated by Institute of Harvard and MIT (Boston, MA) for their assistance in
depsipeptide to enhance cell killing. We demonstrate that depsipeptide this work. The collection of tissue samples was supported by the
and nifuroxazide show a combinatorial effect on STAT3 activation, with Ted and Eileen Pasquarello Tissue Bank for Hematologic Malignancies
a greater reduction in STAT3 phosphorylation compared with cells (Dana-Farber Cancer Institute). We thank Roberto Bellucci for prepar-
treated with either drug alone. In addition, this drug combination results ing and providing normal primary cells.
in enhanced apoptosis as measured by Parp cleavage. Given the known This work was supported by the Multiple Myeloma Research
safety characteristics of both nifuroxazide and depsipeptide, these drugs Foundation (Norwalk, CT) and the Brent Leahey Fund (Dana-
may be useful in clinical trials for the treatment of myeloma. Farber Cancer Institute).
In conclusion, the development of a nonbiased functional screen to
identify STAT3 inhibitors in conjunction with a chemical library biased
to drugs known to be safe in humans has allowed the identification of
nifuroxazide as an effective inhibitor of STAT3. Nifuroxazide decreases
the viability of multiple myeloma cells with constitutive activation of
STAT3, while showing minimal effects on nontransformed and normal
Authorship
cells. In addition, this drug shows enhanced effects with agents that
Contribution: E.A.N. designed the research, performed experi-
target other cellular pathways. Given that STAT3 activation is a
ments, and wrote the paper; S.R.W. designed the research and
common event in a wide range of human cancers, and this drug has been
performed experiments; A.K., L.B.G., H.I., and T.H. performed
given safely to humans for many years, it is possible that clinical trials
experiments; D.C. and K.C.A. designed the research; and D.A.F.
exploiting this approach could be developed in a rapid time frame.
designed the research and wrote the paper.
Conflict-of-interest disclosure: The authors declare no compet-
Acknowledgments ing financial interests.
Correspondence: David A. Frank, Dana-Farber Cancer Institute,
We thank the National Cancer Institute and the Initiative for Department of Medical Oncology, Mayer 522B, 44 Binney Street,
Chemical Genetics (Bethesda, MD), who provided support for this Boston, MA 02115; e-mail: [email protected].

References
1. Frank DA. STAT3 as a central mediator of neoplastic Identification of human STAT5-dependent gene nifuroxazide versus placebo in the treatment of
cellular transformation. Cancer Lett. 2007;251:199- regulatory elements based on interspecies ho- acute diarrhea in adults]. Gastroenterol Clin Biol.
210. mology. J Biol Chem. 2006;281:26216-26224. 1989;13:469-472.
2. Nelson EA, Walker SR, Alvarez JV, Frank DA. 12. Uchiyama H, Barut BA, Mohrbacher AF, Chauhan D, 23. Tavares LC, Penna TC, Amaral AT. Synthesis and
Isolation of unique STAT5 targets by chromatin Anderson KC. Adhesion of human myeloma-derived biological activity of nifuroxazide and analogs.
immunoprecipitation-based gene identification. cell lines to bone marrow stromal cells stimulates Boll Chim Farm. 1997;136:244-249.
J Biol Chem. 2004;279:54724-54730. interleukin-6 secretion. Blood. 1993;82:3712-3720. 24. Masunari A, Tavares LC. A new class of nifuroxa-
3. Walker SR, Nelson EA, Frank DA. STAT5 re- 13. Chou TC. Theoretical basis, experimental design, zide analogues: synthesis of 5-nitrothiophene
presses BCL6 expression by binding to a regula- and computerized simulation of synergism and derivatives with antimicrobial activity against mul-
tory region frequently mutated in lymphomas. On- antagonism in drug combination studies. Phar- tidrug-resistant Staphylococcus aureus. Bioorg
cogene. 2007;26:224-233. macol Rev. 2006;58:621-681. Med Chem. 2007;15:4229-4236.
4. Haura EB, Turkson J, Jove R. Mechanisms of 14. Szczepek AJ, Belch AR, Pilarski LM. Expression of 25. Ihle JN, Gilliland DG. Jak2: normal function and
disease: insights into the emerging role of signal IL-6 and IL-6 receptors by circulating clonotypic B cells role in hematopoietic disorders. Curr Opin Genet
transducers and activators of transcription in can- in multiple myeloma: potential for autocrine and para- Dev. 2007;17:8-14.
cer. Nat Clin Pract Oncol. 2005;2:315-324. crine networks. Exp Hematol. 2001;29:1076-1081. 26. Verma A, Kambhampati S, Parmar S, Platanias
5. Catlett-Falcone R, Landowski TH, Oshiro MM, et 15. Imada K, Leonard WJ. The Jak-STAT pathway. LC. Jak family of kinases in cancer. Cancer Me-
al. Constitutive activation of Stat3 signaling con- Mol Immunol. 2000;37:1-11. tastasis Rev. 2003;22:423-434.
fers resistance to apoptosis in human U266 my- 16. Le Gouill S, Podar K, Harousseau JL, Anderson 27. Stein MN, Flaherty KT. CCR drug updates: sor-
eloma cells. Immunity. 1999;10:105-115. KC. Mcl-1 regulation and its role in multiple my- afenib and sunitinib in renal cell carcinoma. Clin
6. Mitsiades CS, Mitsiades NS, Munshi NC, eloma. Cell Cycle. 2004;3:1259-1262. Cancer Res. 2007;13:3765-3770.
Richardson PG, Anderson KC. The role of the bone 17. Pedranzini L, Dechow T, Berishaj M, et al. Pyri- 28. Alvarez JV, Greulich H, Sellers WR, Meyerson M,
microenvironment in the pathophysiology and thera- done 6, a pan-janus-activated kinase inhibitor, Frank DA. STAT3 is required for the oncogenic
peutic management of multiple myeloma: interplay of induces growth inhibition of multiple myeloma effects of non-small-cell lung cancer-associated
growth factors, their receptors and stromal interac- cells. Cancer Res. 2006;66:9714-9721. mutations of the EGF receptor. Cancer Res.
tions. Eur J Cancer. 2006;42:1564-1573. 18. Chatterjee M, Stuhmer T, Herrmann P, Bommert K, 2006;66:3162-3168.
7. Burger R, Guenther A, Bakker F, et al. Gp130 and Dorken B, Bargou RC. Combined disruption of both 29. Ni Z, Lou W, Leman ES, Gao AC. Inhibition of
ras mediated signaling in human plasma cell line the MEK/ERK and the IL-6R/STAT3 pathways is re- constitutively activated stat3 signaling pathway
INA-6: a cytokine-regulated tumor model for plas- quired to induce apoptosis of multiple myeloma cells suppresses growth of prostate cancer cells. Can-
macytoma. Hematol J. 2001;2:42-53. in the presence of bone marrow stromal cells. Blood. cer Res. 2000;60:1225-1228.
8. Frank DA, Mahajan S, Ritz J. B lymphocytes from 2004;104:3712-3721.
30. Jain N, Zhang T, Fong SL, Lim CP, Cao X. Re-
patients with chronic lymphocytic leukemia contain 19. Vigushin DM, Coombes RC. Histone deacetylase pression of Stat3 activity by activation of mitogen-
STAT1 and STAT3 constitutively phosphorylated on inhibitors in cancer treatment. Anticancer Drugs. activated protein kinase (MAPK). Oncogene.
serine residues. J Clin Invest. 1997;100:3140-3148. 2002;13:1-13. 1998;17:3157-3167.
9. Lynch RA, Etchin J, Battle TE, Frank DA. A small- 20. Piekarz R, Bates S. A review of depsipeptide and 31. Richon VM, O’Brien JP. Histone deacetylase inhibi-
molecule enhancer of signal transducer and activator other histone deacetylase inhibitors in clinical tri- tors: a new class of potential therapeutic agents for
of transcription 1 transcriptional activity accentuates als. Curr Pharm Des. 2004;10:2289-2298. cancer treatment. Clin Cancer Res. 2002;8:662-664.
the antiproliferative effects of IFN-gamma in human 21. Zhang X, Blenis J, Li HC, Schindler C, Chen- 32. Aron JL, Parthun MR, Marcucci G, et al. Depsipeptide
cancer cells. Cancer Res. 2007;67:1254-1261. Kiang S. Requirement of serine phosphorylation (FR901228) induces histone acetylation and inhibition
10. Wagner BJ, Hayes TE, Hoban CJ, Cochran BH. The for formation of STAT-promoter complexes. Sci- of histone deacetylase in chronic lymphocytic leuke-
SIF binding element confers sis/PDGF inducibility ence. 1995;267:1990-1994. mia cells concurrent with activation of caspase 8-me-
onto the c-fos promoter. EMBO J. 1990;9:4477-4484. 22. Bourée P, Chaput JC, Krainik F, Michel H, Trepo diated apoptosis and down-regulation of c-FLIP pro-
11. Nelson EA, Walker SR, Li W, Liu XS, Frank DA. C. [Double-blind controlled study of the efficacy of tein. Blood. 2003;102:652-658.
 From www.bloodjournal.org by guest on September 9, 2018. For personal use only.

2008 112: 5095-5102

doi:10.1182/blood-2007-12-129718 originally published
online September 29, 2008

Nifuroxazide inhibits survival of multiple myeloma cells by directly

inhibiting STAT3
Erik A. Nelson, Sarah R. Walker, Alicia Kepich, Laurie B. Gashin, Teru Hideshima, Hiroshi Ikeda,
Dharminder Chauhan, Kenneth C. Anderson and David A. Frank

Updated information and services can be found at:

http://www.bloodjournal.org/content/112/13/5095.full.html
Articles on similar topics can be found in the following Blood collections
Neoplasia (4182 articles)

Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests

Information about ordering reprints may be found online at:

http://www.bloodjournal.org/site/misc/rights.xhtml#reprints

Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml

Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society
of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.