African Journal of Microbiology

African Journal of
Microbiology Research
Volume 8 Number 8, 19 February, 2014
ISSN 1996-0808
ABOUT AJMR
The African Journal of Microbiology Research (AJMR) (ISSN 1996-0808) is published Weekly (one volume per
year) by Academic Journals.
African Journal of Microbiology Research (AJMR) provides rapid publication (weekly) of articles in all areas of
Microbiology such as: Environmental Microbiology, Clinical Microbiology, Immunology, Virology, Bacteriology,
Phycology, Mycology and Parasitology, Protozoology, Microbial Ecology, Probiotics and Prebiotics, Molecular
Microbiology, Biotechnology, Food Microbiology, Industrial Microbiology, Cell Physiology, Environmental
Biotechnology, Genetics, Enzymology, Molecular and Cellular Biology, Plant Pathology, Entomology, Biomedical
Sciences, Botany and Plant Sciences, Soil and Environmental Sciences, Zoology, Endocrinology, Toxicology. The
Journal welcomes the submission of manuscripts that meet the general criteria of significance and scientific
excellence. Papers will be published shortly after acceptance. All articles are peer-reviewed.
Submission of Manuscript
Please read the Instructions for Authors before submitting your manuscript. The manuscript files should be given
the last name of the first author
Click here to Submit manuscripts online
If you have any difficulty using the online submission system, kindly submit via this email
[email protected].
With questions or concerns, please contact the Editorial Office at [email protected].

Editors
Prof. Dr. Stefan Schmidt, Dr. Thaddeus Ezeji
Applied and Environmental Microbiology Assistant Professor
School of Biochemistry, Genetics and Microbiology Fermentation and Biotechnology Unit
University of KwaZulu-Natal Department of Animal Sciences
Private Bag X01 The Ohio State University
Scottsville, Pietermaritzburg 3209 1680 Madison Avenue
South Africa. USA.
Prof. Fukai Bao

Department of Microbiology and Immunology Associate Editors
Kunming Medical University
Kunming 650031, Dr. Mamadou Gueye
China MIRCEN/ Laboratoire commun de microbiologie
IRD-ISRA-UCAD, BP 1386,
Dr. Jianfeng Wu DAKAR, Senegal.
Dept. of Environmental Health Sciences,
School of Public Health, Dr. Caroline Mary Knox
University of Michigan Department of Biochemistry, Microbiology and
USA Biotechnology
Rhodes University
Dr. Ahmet Yilmaz Coban Grahamstown 6140
OMU Medical School, South Africa.
Department of Medical Microbiology,
Samsun, Dr. Hesham Elsayed Mostafa
Turkey Genetic Engineering and Biotechnology Research
Institute (GEBRI)
Dr. Seyed Davar Siadat Mubarak City For Scientific Research,
Pasteur Institute of Iran, Research Area, New Borg El-Arab City,
Pasteur Square, Pasteur Avenue, Post Code 21934, Alexandria, Egypt.
Tehran,
Iran. Dr. Wael Abbas El-Naggar
Head of Microbiology Department,
Dr. J. Stefan Rokem Faculty of Pharmacy,
The Hebrew University of Jerusalem Mansoura University,
Department of Microbiology and Molecular Genetics, Mansoura 35516, Egypt.
P.O.B. 12272, IL-91120 Jerusalem,
Israel Dr. Abdel Nasser A. El-Moghazy
Microbiology, Molecular Biology, Genetics Engineering
Prof. Long-Liu Lin and Biotechnology
National Chiayi University Dept of Microbiology and Immunology
300 Syuefu Road, Faculty of Pharmacy
Chiayi, Al-Azhar University
Taiwan Nasr city,
Cairo, Egypt
N. John Tonukari, Ph.D
Department of Biochemistry
Delta State University
PMB 1
Abraka, Nigeria
Editorial Board
Dr. Barakat S.M. Mahmoud Dr. Haoyu Mao
Food Safety/Microbiology Department of Molecular Genetics and Microbiology
College of Medicine
Experimental Seafood Processing Laboratory
Costal Research and Extension Center University of Florida
Mississippi State University Florida, Gainesville
3411 Frederic Street USA.
Pascagoula, MS 39567
Dr. Rachna Chandra
USA
Environmental Impact Assessment Division
Prof. Mohamed Mahrous Amer Environmental Sciences
Poultry Disease (Viral Diseases of poultry) Sálim Ali Center for Ornithology and Natural History
Faculty of Veterinary Medicine, (SACON),
Department of Poultry Diseases Anaikatty (PO), Coimbatore-641108, India
Cairo university
Giza, Egypt Dr. Yongxu Sun
Department of Medicinal Chemistry and
Biomacromolecules
Dr. Xiaohui Zhou
Molecular Microbiology, Industrial Microbiology, Qiqihar Medical University, Qiqihar 161006
Environmental Microbiology, Pathogenesis, Antibiotic Heilongjiang Province
resistance, Microbial Ecology P.R. China
Washington State University
Bustad Hall 402 Department of Veterinary Dr. Ramesh Chand Kasana
Institute of Himalayan Bioresource Technology
Microbiology and Pathology, Pullman,
USA Palampur, Distt. Kangra (HP),
India
Dr. R. Balaji Raja
Department of Biotechnology, Dr. S. Meena Kumari
School of Bioengineering, Department of Biosciences
SRM University, Faculty of Science
University of Mauritius
Chennai
India Reduit
Dr. Aly E Abo-Amer Dr. T. Ramesh

Division of Microbiology, Botany Department, Faculty Assistant Professor
of Science, Sohag University. Marine Microbiology
Egypt. CAS in Marine Biology
Faculty of Marine Sciences
Annamalai University
Parangipettai - 608 502
Cuddalore Dist. Tamilnadu,
India
Dr. Pagano Marcela Claudia

Post doctoral fellowship at Department of Biology,
Federal University of Ceará - UFC,
Brazil.
Dr. EL-Sayed E. Habib Dr. Mohd Fuat ABD Razak
Associate Professor, Institute for Medical Research
Dept. of Microbiology, Malaysia
Faculty of Pharmacy,
Mansoura University, Dr. Davide Pacifico
Egypt. Istituto di Virologia Vegetale – CNR
Italy
Dr. Pongsak Rattanachaikunsopon
Department of Biological Science, Prof. Dr. Akrum Hamdy
Faculty of Science, Faculty of Agriculture, Minia University, Egypt
Ubon Ratchathani University, Egypt
Warin Chamrap, Ubon Ratchathani 34190,
Thailand Dr. Ntobeko A. B. Ntusi
Cardiac Clinic, Department of Medicine,
Dr. Gokul Shankar Sabesan University of Cape Town and
Microbiology Unit, Faculty of Medicine, Department of Cardiovascular Medicine,
AIMST University University of Oxford
Jalan Bedong, Semeling 08100, South Africa and
Kedah, United Kingdom
Malaysia
Prof. N. S. Alzoreky
Dr. Kwang Young Song Food Science & Nutrition Department,
Department of Biological Engineering, College of Agricultural Sciences & Food,
School of Biological and Chemical Engineering, King Faisal University,
Yanbian Universityof Science and Technology, Saudi Arabia
Yanji,
China. Dr. Chen Ding
College of Material Science and Engineering,
Dr. Kamel Belhamel Hunan University,
Faculty of Technology, China
University of Bejaia
Algeria Dr Svetlana Nikolid
Faculty of Technology and Metallurgy,
Dr. Sladjana Jevremovic University of Belgrade,
Institute for Biological Research Serbia
Sinisa Stankovic,
Belgrade, Dr. Sivakumar Swaminathan
Serbia Department of Agronomy,
College of Agriculture and Life Sciences,
Dr. Tamer Edirne Iowa State University,
Dept. of Family Medicine, Univ. of Pamukkale Ames, Iowa 50011
Turkey USA
Dr. R. Balaji Raja M.Tech (Ph.D) Dr. Alfredo J. Anceno

Assistant Professor, School of Environment, Resources and Development
Department of Biotechnology, (SERD),
School of Bioengineering, Asian Institute of Technology,
SRM University, Thailand
Chennai.
India Dr. Iqbal Ahmad
Aligarh Muslim University,
Dr. Minglei Wang Aligrah
University of Illinois at Urbana-Champaign,USA India
Dr. Josephine Nketsia-Tabiri Prof. Dong Zhichun
Ghana Atomic Energy Commission Professor, Department of Animal Sciences and
Ghana Veterinary Medicine,
Yunnan Agriculture University,
Dr. Juliane Elisa Welke China
UFRGS – Universidade Federal do Rio
Grande do Sul Dr. Mehdi Azami
Brazil Parasitology & Mycology Dept,
Baghaeei Lab.,
Dr. Mohammad Nazrul Islam Shams Abadi St.
NIMR; IPH-Bangalore & NIUM Isfahan
Bangladesh Iran
Dr. Okonko, Iheanyi Omezuruike Dr. Anderson de Souza Sant’Ana

Department of Virology, University of São Paulo.
Faculty of Basic Medical Sciences, Brazil.
College of Medicine,
University of Ibadan, Dr. Juliane Elisa Welke
University College Hospital, UFRGS – Universidade Federal do Rio Grande do Sul
Ibadan, Brazil
Nigeria
Dr. Paul Shapshak
Dr. Giuliana Noratto USF Health,
Texas A&M University Depts. Medicine (Div. Infect. Disease & Internat Med)
USA and Psychiatry & Beh Med.
USA
Dr. Phanikanth Venkata Turlapati
Washington State University Dr. Jorge Reinheimer
USA Universidad Nacional del Litoral (Santa Fe)
Argentina
Dr. Khaleel I. Z. Jawasreh
National Centre for Agricultural Research and Dr. Qin Liu
Extension, NCARE East China University of Science
Jordan and Technology
China
Dr. Babak Mostafazadeh, MD
Shaheed Beheshty University of Medical Sciences Dr. Xiao-Qing Hu
Iran State Key Lab of Food Science and Technology
Jiangnan University
Dr. S. Meena Kumari P. R. China
Department of Biosciences
Faculty of Science Prof. Branislava Kocic
University of Mauritius Specaialist of Microbiology and Parasitology
Reduit University of Nis, School of Medicine Institute
Mauritius for Public Health Nis, Bul. Z. Djindjica 50, 18000 Nis
Serbia
Dr. S. Anju
Department of Biotechnology, Dr. Rafel Socias
SRM University, Chennai-603203 CITA de Aragón,
India Spain
Dr. Mustafa Maroufpor

Iran
Prof. Kamal I. Mohamed Prof. Isidro A. T. Savillo
State University of New York at Oswego ISCOF
USA Philippines
Dr. Adriano Cruz Dr. How-Yee Lai

Faculty of Food Engineering-FEA Taylor’s University College
University of Campinas (UNICAMP) Malaysia
Brazil
Dr. Nidheesh Dadheech
Dr. Mike Agenbag (Michael Hermanus Albertus) MS. University of Baroda, Vadodara, Gujarat, India.
Manager Municipal Health Services, India
Joe Gqabi District Municipality
South Africa Dr. Omitoyin Siyanbola
Bowen University,
Dr. D. V. L. Sarada Iwo
Department of Biotechnology, Nigeria
SRM University, Chennai-603203
India. Dr. Franco Mutinelli
Istituto Zooprofilattico Sperimentale delle Venezie
Dr. Samuel K Ameyaw Italy
Civista Medical Center
United States of America Dr. Chanpen Chanchao
Department of Biology,
Prof. Huaizhi Wang Faculty of Science,
Institute of Hepatopancreatobiliary Chulalongkorn University
Surgery of PLA Southwest Hospital, Thailand
Third Military Medical University
Chongqing400038 Dr. Tsuyoshi Kasama
P. R. China Division of Rheumatology,
Showa University
Prof. Bakhiet AO Japan
College of Veterinary Medicine, Sudan
University of Science and Technology Dr. Kuender D. Yang, MD.
Sudan Chang Gung Memorial Hospital
Taiwan
Dr. Saba F. Hussain
Community, Orthodontics and Peadiatric Dentistry Dr. Liane Raluca Stan
Department University Politehnica of Bucharest,
Faculty of Dentistry Department of Organic Chemistry “C.Nenitzescu”
Universiti Teknologi MARA Romania
40450 Shah Alam, Selangor
Malaysia Dr. Muhamed Osman
Senior Lecturer of Pathology & Consultant
Prof. Dr. Zohair I.F.Rahemo Immunopathologist
State Key Lab of Food Science and Technology Department of Pathology,
Jiangnan University Faculty of Medicine,
P. R. China Universiti Teknologi MARA,
40450 Shah Alam, Selangor
Dr. Afework Kassu Malaysia
University of Gondar
Ethiopia Dr. Mohammad Feizabadi
Tehran University of medical Sciences
Iran
Prof. Ahmed H Mitwalli Dr. Adibe Maxwell Ogochukwu
State Key Lab of Food Science and Technology Department of Clinical Pharmacy and Pharmacy
Jiangnan University Management,
P. R. China University of Nigeria,
Nsukka.
Dr. Mazyar Yazdani Nigeria
Department of Biology,
University of Oslo, Dr. William M. Shafer
Blindern, Emory University School of Medicine
Oslo, USA
Norway
Dr. Michelle Bull
Dr. Ms. Jemimah Gesare Onsare CSIRO Food and Nutritional Sciences
Ministry of Higher, Education Australia
Science and Technology
Kenya Prof. Dr. Márcio Garcia Ribeiro (DVM, PhD)
School of Veterinary Medicine and Animal Science-
Dr. Babak Khalili Hadad UNESP,
Department of Biological Sciences, Dept. Veterinary Hygiene and Public Health,
Roudehen Branch, State of Sao Paulo
Islamic Azad University, Brazil
Roudehen
Iran Prof. Dr. Sheila Nathan
National University of Malaysia (UKM)
Dr. Ehsan Sari Malaysia
Department of Plan Pathology,
Iranian Research Institute of Plant Protection, Prof. Ebiamadon Andi Brisibe
Tehran, University of Calabar,
Iran. Calabar,
Nigeria
Dr. Snjezana Zidovec Lepej
University Hospital for Infectious Diseases Dr. Julie Wang
Zagreb, Burnet Institute
Croatia Australia
Dr. Dilshad Ahmad Dr. Jean-Marc Chobert

King Saud University INRA- BIA, FIPL
Saudi Arabia France
Dr. Adriano Gomes da Cruz Dr. Zhilong Yang, PhD

University of Campinas (UNICAMP) Laboratory of Viral Diseases
Brazil National Institute of Allergy and Infectious Diseases,
National Institutes of Health
Dr. Hsin-Mei Ku
Agronomy Dept. NCHU 250 Kuo Dr. Dele Raheem
Kuang Rd, Taichung, University of Helsinki
Taiwan Finland
Dr. Fereshteh Naderi Dr. Li Sun

Physical chemist, PLA Centre for the treatment of infectious diseases,
Islamic Azad University, Tangdu Hospital,
Shahre Ghods Branch Fourth Military Medical University
Iran China
Dr. Biljana Miljkovic-Selimovic Dr. Pradeep Parihar
School of Medicine, Lovely Professional University, Phagwara, Punjab.
University in Nis, India
Serbia; Referent laboratory for Campylobacter and
Helicobacter, Dr. William H Roldán
Center for Microbiology, Department of Medical Microbiology,
Institute for Public Health, Nis Faculty of Medicine,
Serbia Peru
Dr. Xinan Jiao Dr. Kanzaki, L I B

Yangzhou University Laboratory of Bioprospection. University of Brasilia
China Brazil
Dr. Endang Sri Lestari, MD. Prof. Philippe Dorchies

Department of Clinical Microbiology, Laboratory of Bioprospection. University of Brasilia
Medical Faculty, Brazil
Diponegoro University/Dr. Kariadi Teaching Hospital,
Semarang Dr. C. Ganesh Kumar
Indonesia Indian Institute of Chemical Technology,
Hyderabad
Dr. Hojin Shin India
Pusan National University Hospital
South Korea Dr. Farid Che Ghazali
Universiti Sains Malaysia (USM)
Dr. Yi Wang Malaysia
Center for Vector Biology, 180 Jones Avenue
Rutgers University, New Brunswick, NJ 08901-8536 Dr. Samira Bouhdid
USA Abdelmalek Essaadi University,
Tetouan,
Dr. Heping Zhang Morocco
The Key Laboratory of Dairy Biotechnology and
Engineering, Dr. Zainab Z. Ismail
Ministry of Education, Department of Environmental Engineering, University
Inner Mongolia Agricultural University. of Baghdad.
China Iraq
Prof. Natasha Potgieter Dr. Ary Fernandes Junior

University of Venda Universidade Estadual Paulista (UNESP)
South Africa Brasil
Dr. Alemzadeh Dr. Papaevangelou Vassiliki

Sharif University Athens University Medical School
Iran Greece
Dr. Sonia Arriaga Dr. Fangyou Yu

Instituto Potosino de Investigación Científicay The first Affiliated Hospital of Wenzhou Medical
Tecnológica/División de Ciencias Ambientales College
Mexico China
Dr. Armando Gonzalez-Sanchez Dr. Galba Maria de Campos Takaki

Universidad Autonoma Metropolitana Cuajimalpa Catholic University of Pernambuco
Mexico Brazil
Dr. Kwabena Ofori-Kwakye Dr. Hans-Jürg Monstein
Department of Pharmaceutics, Clinical Microbiology, Molecular Biology Laboratory,
Kwame Nkrumah University of Science & Technology, University Hospital, Faculty of Health Sciences, S-581
KUMASI 85 Linköping
Ghana Sweden
Prof. Dr. Liesel Brenda Gende Dr. Ajith, T. A

Arthropods Laboratory, School of Natural and Exact Associate Professor Biochemistry, Amala Institute of
Sciences, National University of Mar del Plata Medical Sciences, Amala Nagar, Thrissur, Kerala-680
Buenos Aires, 555
Argentina. India
Dr. Adeshina Gbonjubola Dr. Feng-Chia Hsieh

Ahmadu Bello University, Biopesticides Division, Taiwan Agricultural Chemicals
Zaria. and Toxic Substances Research Institute, Council of
Nigeria Agriculture
Taiwan
Prof. Dr. Stylianos Chatzipanagiotou
University of Athens – Medical School Prof. Dra. Suzan Pantaroto de Vasconcellos
Greec Universidade Federal de São Paulo
Rua Prof. Artur Riedel, 275 Jd. Eldorado, Diadema, SP
Dr. Dongqing BAI CEP 09972-270
Department of Fishery Science, Brasil
Tianjin Agricultural College,
Tianjin 300384 Dr. Maria Leonor Ribeiro Casimiro Lopes Assad
P. R. China Universidade Federal de São Carlos - Centro de
Ciências Agrárias - CCA/UFSCar
Dr. Dingqiang Lu Departamento de Recursos Naturais e Proteção
Nanjing University of Technology Ambiental
P.R. China Rodovia Anhanguera, km 174 - SP-330
Araras - São Paulo
Dr. L. B. Sukla Brasil
Scientist –G & Head, Biominerals Department,
IMMT, Bhubaneswar Dr. Pierangeli G. Vital
India Institute of Biology, College of Science, University of
the Philippines
Dr. Hakan Parlakpinar Philippines
MD. Inonu University, Medical Faculty, Department
of Pharmacology, Malatya Prof. Roland Ndip
Turkey University of Fort Hare, Alice
South Africa
Dr Pak-Lam Yu
Massey University Dr. Shawn Carraher
New Zealand University of Fort Hare, Alice
South Africa
Dr Percy Chimwamurombe
University of Namibia Dr. José Eduardo Marques Pessanha
Namibia Observatório de Saúde Urbana de Belo
Horizonte/Faculdade de Medicina da Universidade
Dr. Euclésio Simionatto Federal de Minas Gerais
State University of Mato Grosso do Sul-UEMS Brasil
Brazil
Dr. Yuanshu Qian Dr. N Saleem Basha
Department of Pharmacology, Shantou University M. Pharm (Pharmaceutical Biotechnology)
Medical College Eritrea (North East Africa)
China
Prof. Dr. João Lúcio de Azevedo
Dr. Helen Treichel Dept. Genetics-University of São Paulo-Faculty of
URI-Campus de Erechim Agriculture- Piracicaba, 13400-970
Brazil Brasil
Dr. Xiao-Qing Hu Dr. Julia Inés Fariña

State Key Lab of Food Science and Technology PROIMI-CONICET
Jiangnan University Argentina
P. R. China
Dr. Yutaka Ito
Dr. Olli H. Tuovinen Kyoto University
Ohio State University, Columbus, Ohio Japan
USA
Dr. Cheruiyot K. Ronald
Prof. Stoyan Groudev Biomedical Laboratory Technologist
University of Mining and Geology “Saint Ivan Rilski” Kenya
Sofia
Bulgaria Prof. Dr. Ata Akcil
S. D. University
Dr. G. Thirumurugan Turkey
Research lab, GIET School of Pharmacy, NH-5,
Chaitanya nagar, Rajahmundry-533294. Dr. Adhar Manna
India The University of South Dakota
USA
Dr. Charu Gomber
Thapar University Dr. Cícero Flávio Soares Aragão
India Federal University of Rio Grande do Norte
Brazil
Dr. Jan Kuever
Bremen Institute for Materials Testing, Dr. Gunnar Dahlen
Department of Microbiology, Institute of odontology, Sahlgrenska Academy at
Paul-Feller-Str. 1, 28199 Bremen University of Gothenburg
Germany Sweden
Dr. Nicola S. Flanagan Dr. Pankaj Kumar Mishra

Universidad Javeriana, Cali Vivekananda Institute of Hill Agriculture, (I.C.A.R.),
Colombia ALMORA-263601, Uttarakhand
India
Dr. André Luiz C. M. de A. Santiago
Universidade Federal Rural de Pernambuco Dr. Benjamas W. Thanomsub
Brazil Srinakharinwirot University
Thailand
Dr. Dhruva Kumar Jha
Microbial Ecology Laboratory, Dr. Maria José Borrego
Department of Botany, National Institute of Health – Department of Infectious
Gauhati University, Diseases
Guwahati 781 014, Assam Portugal
India
Dr. Catherine Carrillo Dr. Tang Ming
Health Canada, Bureau of Microbial Hazards College of Forestry, Northwest A&F University,
Canada Yangling
China
Dr. Marcotty Tanguy
Institute of Tropical Medicine Dr. Olga Gortzi
Belgium Department of Food Technology, T.E.I. of Larissa
Greece
Dr. Han-Bo Zhang
Laboratory of Conservation and Utilization for Bio- Dr. Mark Tarnopolsky
resources Mcmaster University
Key Laboratory for Microbial Resources of the Canada
Ministry of Education,
Yunnan University, Kunming 650091. Dr. Sami A. Zabin
School of Life Science, Al Baha University
Yunnan University, Kunming, Saudi Arabia
Yunnan Province 650091.
China Dr. Julia W. Pridgeon
Aquatic Animal Health Research Unit, USDA, ARS
Dr. Ali Mohammed Somily USA
King Saud University
Saudi Arabia Dr. Lim Yau Yan
Monash University Sunway Campus
Dr. Nicole Wolter Malaysia
National Institute for Communicable Diseases and
University of the Witwatersrand, Prof. Rosemeire C. L. R. Pietro
Johannesburg Faculdade de Ciências Farmacêuticas de Araraquara,
South Africa Univ Estadual Paulista, UNESP
Brazil
Dr. Marco Antonio Nogueira
Universidade Estadual de Londrina Dr. Nazime Mercan Dogan
CCB/Depto. De microbiologia PAU Faculty of Arts and Science, Denizli
Laboratório de Microbiologia Ambiental Turkey
Caixa Postal 6001
86051-980 Londrina. Dr Ian Edwin Cock
Brazil Biomolecular and Physical Sciences
Griffith University
Dr. Bruno Pavoni Australia
Department of Environmental Sciences University of
Venice Prof. N K Dubey
Italy Banaras Hindu University
India
Dr. Shih-Chieh Lee
Da-Yeh University Dr. S. Hemalatha
Taiwan Department of Pharmaceutics, Institute of
Technology,
Dr. Satoru Shimizu Banaras Hindu University, Varanasi. 221005
Horonobe Research Institute for the Subsurface India
Environment,
Northern Advancement Center for Science & Dr. J. Santos Garcia A.
Technology Universidad A. de Nuevo Leon
Japan Mexico India
Dr. Somboon Tanasupawat Dr. Mick Bosilevac
Department of Biochemistry and Microbiology, US Meat Animal Research Center
Faculty of Pharmaceutical Sciences, USA
Chulalongkorn University,
Bangkok 10330 Dr. Nora Lía Padola
Thailand Imunoquímica y Biotecnología- Fac Cs Vet-UNCPBA
Argentina
Dr. Vivekananda Mandal
Post Graduate Department of Botany, Dr. Maria Madalena Vieira-Pinto
Darjeeling Government College, Universidade de Trás-os-Montes e Alto Douro
Darjeeling – 734101. Portugal
India
Dr. Stefano Morandi
Dr. Shihua Wang CNR-Istituto di Scienze delle Produzioni Alimentari
College of Life Sciences, (ISPA), Sez. Milano
Fujian Agriculture and Forestry University Italy
China
Dr Line Thorsen
Dr. Victor Manuel Fernandes Galhano Copenhagen University, Faculty of Life Sciences
CITAB-Centre for Research and Technology of Agro- Denmark
Environment and Biological Sciences, Integrative
Biology and Quality Research Group, Dr. Ana Lucia Falavigna-Guilherme
University of Trás-os-Montes and Alto Douro, Universidade Estadual de Maringá
Apartado 1013, 5001-801 Vila Real Brazil
Portugal
Dr. Baoqiang Liao
Dr. Maria Cristina Maldonado Dept. of Chem. Eng., Lakehead University, 955 Oliver
Instituto de Biotecnologia. Universidad Nacional de Road, Thunder Bay, Ontario
Tucuman Canada
Argentina
Dr. Ouyang Jinping
Dr. Alex Soltermann Patho-Physiology department,
Institute for Surgical Pathology, Faculty of Medicine of Wuhan University
University Hospital Zürich China
Switzerland
Dr. John Sorensen
Dr. Dagmara Sirova University of Manitoba
Department of Ecosystem Biology, Faculty Of Science, Canada
University of South Bohemia,
Branisovska 37, Ceske Budejovice, 37001 Dr. Andrew Williams
Czech Republic University of Oxford
United Kingdom
Dr. E. O Igbinosa
Department of Microbiology, Dr. Chi-Chiang Yang
Ambrose Alli University, Chung Shan Medical University
Ekpoma, Edo State, Taiwan, R.O.C.
Nigeria.
Dr. Quanming Zou
Dr. Hodaka Suzuki Department of Clinical Microbiology and Immunology,
National Institute of Health Sciences College of Medical Laboratory,
Japan Third Military Medical University
China
Prof. Ashok Kumar Dr. Guanghua Wang
School of Biotechnology, Northeast Institute of Geography and Agroecology,
Banaras Hindu University, Varanasi Chinese Academy of Sciences
India China
Dr. Chung-Ming Chen Dr. Renata Vadkertiova

Department of Pediatrics, Taipei Medical University Institute of Chemistry, Slovak Academy of Science
Hospital, Taipei Slovakia
Taiwan
Dr. Charles Hocart
Dr. Jennifer Furin The Australian National University
Harvard Medical School Australia
USA
Dr. Guoqiang Zhu
Dr. Julia W. Pridgeon University of Yangzhou College of Veterinary Medicine
Aquatic Animal Health Research Unit, USDA, ARS China
USA
Dr. Guilherme Augusto Marietto Gonçalves
Dr Alireza Seidavi São Paulo State University
Islamic Azad University, Rasht Branch Brazil
Iran
Dr. Mohammad Ali Faramarzi
Dr. Thore Rohwerder Tehran University of Medical Sciences
Helmholtz Centre for Environmental Research UFZ Iran
Germany
Dr. Suppasil Maneerat
Dr. Daniela Billi Department of Industrial Biotechnology, Faculty of
University of Rome Tor Vergat Agro-Industry, Prince of Songkla University, Hat Yai
Italy 90112
Thailand
Dr. Ivana Karabegovic
Faculty of Technology, Leskovac, University of Nis Dr. Francisco Javier Las heras Vazquez
Serbia Almeria University
Spain
Dr. Flaviana Andrade Faria
IBILCE/UNESP Dr. Cheng-Hsun Chiu
Brazil Chang Gung memorial Hospital, Chang Gung
University
Prof. Margareth Linde Athayde Taiwan
Federal University of Santa Maria
Brazil Dr. Ajay Singh
DDU Gorakhpur University, Gorakhpur-273009 (U.P.)
Dr. Guadalupe Virginia Nevarez Moorillon India
Universidad Autonoma de Chihuahua
Mexico Dr. Karabo Shale
Central University of Technology, Free State
Dr. Tatiana de Sousa Fiuza South Africa
Federal University of Goias
Brazil Dr. Lourdes Zélia Zanoni
Department of Pediatrics, School of Medicine, Federal
Dr. Indrani B. Das Sarma University of Mato Grosso do Sul, Campo Grande,
Jhulelal Institute of Technology, Nagpur Mato Grosso do Sul
India Brazil
Dr. Tulin Askun Dr. Hongxiong Guo
Balikesir University STD and HIV/AIDS Control and Prevention,
Turkey Jiangsu provincial CDC,
China
Dr. Marija Stankovic
Institute of Molecular Genetics and Genetic Dr. Konstantina Tsaousi
Engineering Life and Health Sciences,
Republic of Serbia School of Biomedical Sciences,
University of Ulster
Dr. Scott Weese
University of Guelph Dr. Bhavnaben Gowan Gordhan
Dept of Pathobiology, Ontario Veterinary College, DST/NRF Centre of Excellence for Biomedical TB
University of Guelph, Research
Guelph, Ontario, N1G2W1, University of the Witwatersrand and National Health
Canada Laboratory Service
P.O. Box 1038, Johannesburg 2000,
Dr. Sabiha Essack South Africa
School of Health Sciences
South African Committee of Health Sciences Dr. Ernest Kuchar
University of KwaZulu-Natal Pediatric Infectious Diseases,
Private Bag X54001 Wroclaw Medical University,
Durban 4000 Wroclaw Teaching Hospital,
South Africa Poland
Dr. Hare Krishna Dr. Hongxiong Guo

Central Institute for Arid Horticulture, STD and HIV/AIDS Control and Prevention,
Beechwal, Bikaner-334 006, Rajasthan, Jiangsu provincial CDC,
India China
Dr. Anna Mensuali Dr. Mar Rodriguez Jovita

Dept. of Life Science, Food Hygiene and Safety, Faculty of Veterinary
Scuola Superiore Science.
Sant’Anna University of Extremadura,
Spain
Dr. Ghada Sameh Hafez Hassan
Pharmaceutical Chemistry Department, Dr. Jes Gitz Holler
Faculty of Pharmacy, Mansoura University, Hospital Pharmacy,
Egypt Aalesund. Central Norway Pharmaceutical Trust
Professor Brochs gt. 6. 7030 Trondheim,
Dr. Kátia Flávia Fernandes Norway
Biochemistry and Molecular Biology
Universidade Federal de Goiás Prof. Chengxiang FANG
Brasil College of Life Sciences,
Wuhan University
Dr. Abdel-Hady El-Gilany Wuhan 430072, P.R.China
Public Health & Community Medicine
Faculty of Medicine, Dr. Anchalee Tungtrongchitr
Mansoura University Siriraj Dust Mite Center for Services and Research
Egypt Department of Parasitology,
Faculty of Medicine Siriraj Hospital,
Mahidol University
2 Prannok Road, Bangkok Noi,
Bangkok, 10700, Thailand
Instructions for Author
Electronic submission of manuscripts is strongly Regular articles
encouraged, provided that the text, tables, and figures are
included in a single Microsoft Word file (preferably in Arial All portions of the manuscript must be typed double-
font). spaced and all pages numbered starting from the title
page.
The cover letter should include the corresponding author's
full address and telephone/fax numbers and should be in The Title should be a brief phrase describing the contents
an e-mail message sent to the Editor, with the file, whose of the paper. The Title Page should include the authors'
name should begin with the first author's surname, as an full names and affiliations, the name of the corresponding
attachment. author along with phone, fax and E-mail information.
Present addresses of authors should appear as a footnote.
Article Types
Three types of manuscripts may be submitted: The Abstract should be informative and completely self-
explanatory, briefly present the topic, state the scope of
Regular articles: These should describe new and carefully the experiments, indicate significant data, and point out
confirmed findings, and experimental procedures should major findings and conclusions. The Abstract should be
be given in sufficient detail for others to verify the work. 100 to 200 words in length.. Complete sentences, active
The length of a full paper should be the minimum required verbs, and the third person should be used, and the
to describe and interpret the work clearly. abstract should be written in the past tense. Standard
Short Communications: A Short Communication is suitable nomenclature should be used and abbreviations should
for recording the results of complete small investigations be avoided. No literature should be cited.
or giving details of new models or hypotheses, innovative Following the abstract, about 3 to 10 key words that will
methods, techniques or apparatus. The style of main provide indexing references should be listed.
sections need not conform to that of full-length papers.
Short communications are 2 to 4 printed pages (about 6 to A list of non-standard Abbreviations should be added. In
12 manuscript pages) in length. general, non-standard abbreviations should be used only
when the full term is very long and used often. Each
Reviews: Submissions of reviews and perspectives covering abbreviation should be spelled out and introduced in
topics of current interest are welcome and encouraged. parentheses the first time it is used in the text. Only
Reviews should be concise and no longer than 4-6 printed recommended SI units should be used. Authors should
pages (about 12 to 18 manuscript pages). Reviews are also use the solidus presentation (mg/ml). Standard
peer-reviewed. abbreviations (such as ATP and DNA) need not be defined.
Review Process The Introduction should provide a clear statement of the

problem, the relevant literature on the subject, and the
All manuscripts are reviewed by an editor and members of proposed approach or solution. It should be
the Editorial Board or qualified outside reviewers. Authors understandable to colleagues from a broad range of
cannot nominate reviewers. Only reviewers randomly scientific disciplines.
selected from our database with specialization in the
subject area will be contacted to evaluate the manuscripts. Materials and methods should be complete enough to
The process will be blind review. allow experiments to be reproduced. However, only truly
Decisions will be made as rapidly as possible, and the new procedures should be described in detail; previously
Journal strives to return reviewers’ comments to authors as published procedures should be cited, and important
fast as possible. The editorial board will re-review modifications of published procedures should be
manuscripts that are accepted pending revision. It is the mentioned briefly. Capitalize trade names and include the
goal of the AJMR to publish manuscripts within weeks manufacturer's name and address. Subheadings should be
after submission. used. Methods in general use need not be described in
detail.
Results should be presented with clarity and precision. 1987a,b; Tijani, 1993,1995), (Kumasi et al., 2001)
The results should be written in the past tense when References should be listed at the end of the paper in
describing findings in the authors' experiments. alphabetical order. Articles in preparation or articles
Previously published findings should be written in the submitted for publication, unpublished observations,
present tense. Results should be explained, but largely personal communications, etc. should not be included
without referring to the literature. Discussion, in the reference list but should only be mentioned in
speculation and detailed interpretation of data should the article text (e.g., A. Kingori, University of Nairobi,
not be included in the Results but should be put into the Kenya, personal communication). Journal names are
Discussion section. abbreviated according to Chemical Abstracts. Authors
are fully responsible for the accuracy of the references.
The Discussion should interpret the findings in view of
the results obtained in this and in past studies on this Examples:
topic. State the conclusions in a few sentences at the end
of the paper. The Results and Discussion sections can Chikere CB, Omoni VT and Chikere BO (2008).
include subheadings, and when appropriate, both Distribution of potential nosocomial pathogens in a
sections can be combined. hospital environment. Afr. J. Biotechnol. 7: 3535-3539.
The Acknowledgments of people, grants, funds, etc Moran GJ, Amii RN, Abrahamian FM, Talan DA (2005).
should be brief. Methicillinresistant Staphylococcus aureus in
community-acquired skin infections. Emerg. Infect. Dis.
Tables should be kept to a minimum and be designed to 11: 928-930.
be as simple as possible. Tables are to be typed double-
spaced throughout, including headings and footnotes. Pitout JDD, Church DL, Gregson DB, Chow BL,
Each table should be on a separate page, numbered McCracken M, Mulvey M, Laupland KB (2007).
consecutively in Arabic numerals and supplied with a Molecular epidemiology of CTXM-producing
heading and a legend. Tables should be self-explanatory Escherichia coli in the Calgary Health Region:
without reference to the text. The details of the methods emergence of CTX-M-15-producing isolates.
used in the experiments should preferably be described Antimicrob. Agents Chemother. 51: 1281-1286.
in the legend instead of in the text. The same data should
not be presented in both table and graph form or Pelczar JR, Harley JP, Klein DA (1993). Microbiology:
repeated in the text. Concepts and Applications. McGraw-Hill Inc., New York,
pp. 591-603.
Figure legends should be typed in numerical order on a
separate sheet. Graphics should be prepared using
applications capable of generating high resolution GIF, Short Communications
TIFF, JPEG or Powerpoint before pasting in the Microsoft
Word manuscript file. Tables should be prepared in Short Communications are limited to a maximum of
Microsoft Word. Use Arabic numerals to designate two figures and one table. They should present a
figures and upper case letters for their parts (Figure 1). complete study that is more limited in scope than is
Begin each legend with a title and include sufficient found in full-length papers. The items of manuscript
description so that the figure is understandable without preparation listed above apply to Short
reading the text of the manuscript. Information given in Communications with the following differences: (1)
legends should not be repeated in the text. Abstracts are limited to 100 words; (2) instead of a
separate Materials and Methods section, experimental
References: In the text, a reference identified by means procedures may be incorporated into Figure Legends
of an author‘s name should be followed by the date of and Table footnotes; (3) Results and Discussion should
the reference in parentheses. When there are more than be combined into a single section.
two authors, only the first author‘s name should be Proofs and Reprints: Electronic proofs will be sent (e-
mentioned, followed by ’et al‘. In the event that an mail attachment) to the corresponding author as a PDF
author cited has had two or more works published during file. Page proofs are considered to be the final version
the same year, the reference, both in the text and in the of the manuscript. With the exception of typographical
reference list, should be identified by a lower case letter or minor clerical errors, no changes will be made in the
like ’a‘ and ’b‘ after the date to distinguish the works. manuscript at the proof stage.
Examples:
Abayomi (2000), Agindotan et al. (2003), (Kelebeni,

1983), (Usman and Smith, 1992), (Chege, 1998;
Fees and Charges: Authors are required to pay a $550 handling fee. Publication of an article in the African Journal of
Microbiology Research is not contingent upon the author's ability to pay the charges. Neither is acceptance to pay
the handling fee a guarantee that the paper will be accepted for publication. Authors may still request (in
advance) that the editorial office waive some of the handling fee under special circumstances
Copyright: © 2014, Academic Journals.

All rights Reserved. In accessing this journal, you agree that you will access the contents for your own personal use
but not for any commercial use. Any use and or copies of this Journal in whole or in part must include the customary
bibliographic citation, including author attribution, date and article title.
Submission of a manuscript implies: that the work described has not been published before (except in the form of an
abstract or as part of a published lecture, or thesis) that it is not under consideration for publication elsewhere; that if
and when the manuscript is accepted for publication, the authors agree to automatic transfer of the copyright to the
publisher.
Disclaimer of Warranties
In no event shall Academic Journals be liable for any special, incidental, indirect, or consequential damages of any
kind arising out of or in connection with the use of the articles or other material derived from the AJMR, whether
or not advised of the possibility of damage, and on any theory of liability.
This publication is provided "as is" without warranty of any kind, either expressed or implied, including, but not
limited to, the implied warranties of merchantability, fitness for a particular purpose, or non-infringement.
Descriptions of, or references to, products or publications does not imply endorsement of that product or publication.
While every effort is made by Academic Journals to see that no inaccurate or misleading data, opinion or statements
appear in this publication, they wish to make it clear that the data and opinions appearing in the articles and
advertisements herein are the responsibility of the contributor or advertiser concerned. Academic Journals makes no
warranty of any kind, either express or implied, regarding the quality, accuracy, availability, or validity of the data or
information in this publication or of any other publication to which it may be linked.
African Journal of Microbiology Research
International Journal of Medicine and Medical Sciences
Table of Content: Volume 8 Number 8, February 19, 2014
ARTICLES
Morphological and molecular characterization of pathogenic isolates of
Fusarium spp. obtained from gladiolus corms and their sensitivity to Jatropha
curcas L. oil
Liliana Córdova Albores, Silvia Bautista Baños, Jorge Martínez Herrera, Laura Barrera
Necha, Mónica Hernández López and Andrés Cruz Hernández
Screening phosphate solubilizing actinobacteria isolated from the rhizosphere of

wild plants from the Eastern Cordillera of the Colombian Andes
Luis Daniel Prada Salcedo, Carolina Prieto and Marcela Franco Correa
Establishment of EvaGreen qPCR for detecting bovine rotavirus based on VP7 gene
Wei Suocheng, Che Tuanjie, Wang Jingming, Li Yukong, Zhang Taojie, Song Changjun
and Tian Fengling
Nutritional requirements for the production of antimicrobial metabolites from

Streptomyces
Mariadhas Valan Arasu, Thankappan Sarasam Rejiniemon, Naif Abdullah Al-Dhabi,
Veeramuthu Duraipandiyan, Savarimuthu Ignacimuthu, Paul Agastian, Sun-Ju Kim,
V. Aldous J. Huxley, Kyung Dong Lee, Ki Choon Choi
Incidence of Aspergillus contamination of groundnut (Arachis hypogaea L.) in

Eastern Ethiopia
Abdi Mohammed and Alemayehu Chala
Microencapsulation, survival and adherence studies of indigenous probiotics

Ammara Hassan, M. Nawaz Ch and Barbara Rasco
Screening novel diagnostic marker of Mycobacterium tuberculosis

Xin Pan, Siliang Zeng, Jialin Cai, Bin Zhang, Boju Pan, Zhonglei Pan, Ying Wu,
Ying Wang, Yi Zhou, Wei Fang, Min Chen, Wanqing Liao, XiuZhen Yu, Min Tao,
Jun Zhang and Wei Song
An outbreak of ringworm caused by Trichophyton verrucosum in a group of

calves in Vom, Nigeria
Dalis, J. S., Kazeem, H. M., Kwaga, J. K. P. and Kwanashie, C. N.
African Journal of Microbiology Research
Table of Content: Volume 8 Number 8, February 19, 2014
Characteristics of nodule bacteria from Mimosa spp grown in soils of the Brazilian
semiarid region
Ana Dolores Santiago de Freitas, Wardsson Lustrino Borges, Monaliza
Mirella de Morais Andrade, Everardo Valadares de Sá Barretto Sampaio,
Carolina Etienne de Rosália e Silva Santos, Samuel Ribeiro Passos, Gustavo Ribeiro
Xavier, Bruno Mello Mulato and Maria do Carmo Catanho Pereira de Lyra
Microbiological assessment of dentists’ hands in clinical performance

Márcia Rosental da Costa CARMO, Jorge Kleber CHAVASCO, Solange de Oliveira Braga
FRANZOLIN, Luiz Alberto BEIJO, Júlia Rosental de SOUZA CRUZ and Paulo
Henrique WECKWERTH
Evaluation of marine macro alga, Ulva fasciata against bio-luminescent causing

Vibrio harveyi during Penaeus monodon larviculture
Krishnamoorthy Sivakumar, Sudalayandi Kannappan, Masilamani Dineshkumar and
Prasanna Kumar Patil
Characterization and determination of antibiotic susceptibility pattern of bacteria

isolated from some fomites in a teaching hospital in northern Nigeria
Aminu Maryam, Usman-Sani Hadiza and Usman M. Aminu
Prevalence of different enterococcal species isolated from blood and their

susceptibility to antimicrobial drugs in Vojvodina, Serbia, 2011-2013
Mihajlović-Ukropina Mira, Medić Deana, Jelesić Zora, Gusman Vera,
Milosavljević Biljana and Radosavljević Biljana
Prevalence of anti-Anaplasma phagocytophilum antibodies among dogs from

Monterrey, Mexico
J. A. Salinas-Meléndez, R. Villavicencio-Pedraza, B. V. Tamez-Hernández,
J. J. Hernández-Escareño, R. Avalos-Ramírez, J. J. Zarate-Ramos, F. J. Picón-Rubio and
V. M. Riojas-Valdés
Novel simple diagnostic methods compared to advanced ones for the diganosis of
Chlamydia trachomatis, Ureaplasma urealyticum and Mycoplasmas hominis in
patients with complicated urinary tract infections
Hala Badawi, Aisha Abu Aitta, Maisa Omar, Ahmed Ismail, Hanem Mohamed,
Manal El Said, Doaa Gamal, Samah Saad El Dine and Mohamed Ali Saber
Vol. 8(8), pp. 724-733, 19 February, 2014
DOI: 10.5897/AJMR2013.6413
ISSN 1996-0808 ©2014 Academic Journals African Journal of Microbiology Research
http://www.academicjournals.org/AJMR
Full Length Research Paper
Morphological and molecular characterization of

pathogenic isolates of Fusarium spp. obtained from
gladiolus corms and their sensitivity to Jatropha
curcas L. oil
Liliana Córdova Albores1, Silvia Bautista Baños1, Jorge Martínez Herrera1,
Laura Barrera Necha1, Mónica Hernández López1 and Andrés Cruz Hernández2
1
Instituto Politécnico Nacional-Centro de Desarrollo de Productos Bióticos. Carr. Yautepec-Jojutla km. 6, San Isidro,
CEPROBI 8, Yautepec, Morelos, C. P. 62731, México.
2
Universidad Autónoma de Querétaro. Laboratorio de Microbiología, Facultad de Ciencias Naturales-Biología. Av. de las
Ciencias s/n, Juriquilla, Querétaro, Delegación Santa Rosa Jauregui. C.P. 76230. México.
Accepted 30 January, 2014
The State of Morelos is the third biggest gladiolus producer in Mexico. However, this ornamental is
affected by the disease named corm rot or fusarium yellows, characterized by leaf yellowing, epinasty
and wilting, and caused by fungi of the genus Fusarium. The first objective was to corroborate the
pathogenicity of the 45 isolates obtained. The second objective was to identify and characterize
morphologically and molecularly by polymerase chain reaction-internal transcribed spacer (PCR-ITS),
the highly pathogenic isolates and comparatively analyze the fungal species involved with the reference
strain Fusarium oxysporum f. sp. gladioli (Fog). The third objective was to quantify the phorbol esters in
Jatropha curcas oil and evaluate their antifungal potential on mycelial growth and conidial germination
of different Fusarium species. Eleven isolates were highly significant pathogenic (P < 0.001). Three
fungal species were identified in basal stems and damaged corms taken from field plants, namely F.
oxysporum, Fusarium solani and Fusarium proliferatum. Molecular analyzes corroborated the species
identified and their sequences were deposited in the National Center for Biotechnology Information
(NCBI) gene bank. The percentage of oil obtained was 61.5 %; the phorbol ester content in the oil was
-1
1.52 mg g of 12,13-phorbol myristate. All species identified and the reference strain was sensitive to
-1
the 5 mg mL oil concentration.
Key words: Corm rot, Fusarium, molecular analysis, phorbol esters, Fusarium development.
INTRODUCTION
The gladiolus is one of the main crops in the State of among the most important plant pathogens worldwide.
Morelos, which ranks as Mexico’s third biggest producer Fusarium species are widely distributed in soil and
of this flowering plant. Corm rot is caused by Fusarium organic substrates and are abundant in cultivated soils in
spp. and results in losses of 60-80% during storage temperate and tropical regions (Booth, 1985). Some
(SAGARPA, 2006). Members of the genus Fusarium are species of this genus produce mycotoxins in stored food
*Corresponding author. E-mail: [email protected]. Tel: 52 7353942020.

Albores et al. 725
and cause disease in animals and humans (Ortoneda et obtained and evaluate their response to J. curcas seed
al., 2003). Like many soil-borne fungi, the genus oil.
Fusarium is amply endowed with means of survival, one
of its mechanisms being the ability to rapidly change both
MATERIALS AND METHODS
its host and its morphology and behavior (Booth, 1985;
Alves-Santos et al., 1999; Katan and Di Primo, 1999; Sampled material
Ortoneda et al., 2003). Differentiation of Fusarium spp. is
based on physiological and morphological characteristics, Corms and plants (yellowing of leaves and corms with basal rot) of
such as the size and shape of macroconidia, presence or five varieties (‘White foam’, ‘Red ewe’, ‘White ewe’, ‘Yellow’ and
‘Sancerri’) were collected in the field in seven producing
absence of microconidia and chlamydospores, and municipalities in the State of Morelos. A total of 34 plants showing
colony morphology. Subtle differences in a single feature symptoms of corm rot were collected from August to October 2011
can delineate species. Characterization by molecular from commercial fields in Cuautla, Yautepec, Ayala, Tlanepantla,
techniques using polymerase chain reaction (PCR) to Temixco, Yecapixtla and Totolapan.
amplify the internal transcribed sequences (ITS) allows
identifying organisms that cannot be distinguished
Isolation of fungi
morphologically, and they can also help to understand
the mechanisms of pathogenic variation and therefore, to Soil and roots were removed from gladiolus corms by washing with
develop effective management strategies (Flores-Olivas running water and then corms were immersed in an acaricide
et al., 1997; Alves-Santos et al., 1999; Baayen, 2000; solution (AK®20) at a concentration of 15 ml l-1 for 5 min and left to
Haan et al., 2000). Management by synthetic fungicides dry. They were disinfected with a sodium hypochlorite solution at
5% for 3 min, rinsed with sterile distilled water and placed in humid
leads to resistance, environmental pollution, elimination
chambers for 24 h to promote fungal growth. From mycelium
of beneficial entomofauna and operator poisoning. developed in the corms, isolates were made on Potato Dextrose
Consequently, there are a large number of reports on the Agar (PDA) medium and incubated at room temperature for 7 days.
development of alternatives such as the use of essential Monosporic cultures were established as described by Leslie and
oils (Pauli and Knobloch, 1987; Pintore et al., 2002; Summerell (2006).
Barrera-Necha and García-Barrera, 2008; Barrera-Necha
et al., 2009; Tripathi et al., 2009); however, there are few
Pathogenicity tests
reports on the use of vegetable oils. Jatropha curcas
belongs to the family Euforbiaceae. In Mexico, the latex Forty-five isolates showed differences in the color of the colonies
of this plant is used to treat mouth infections and and initially they were selected as different species. Healthy corms
digestive problems caused by certain fungi, and to make of the variety ‘White foam’, pre-peeled and pre-treated with a
biodiesel, which gives it considerable economic contact fungicide (Captan® 2 g L-1), were planted in sterile soil
(121°C, 15 lb pressure for 3 h) under greenhouse conditions. Once
importance (Martínez-Herrera, 2006). The seeds contain
the approximately 1-cm stem emerged, 5 mL of the isolated spore
chemical compounds, among which tannins, saponins solution of each isolate to examine were added at a concentration
and phorbol esters stand out for their possible biological of 1 × 106 spores ml-1. The reference strain used was Fusarium
activity. J. curcas oil has insecticidal activity (Wink et al., oxysporum f. sp. gladioli (Fog) already molecularly identified
1997), and it has also been tested as an antimicrobial (Garduño-Pizaña et al., 2010) and it was treated in the same way
agent to treat infections, including sexually transmitted without inoculation. Plants were assessed three weeks after
inoculation.
ones, in humans (Aiyelaagbe et al. 2007). Based on this, To statistically assess pathogenicity, a damage scale was
studies have focused on fungal development in in vitro developed based on the corm rot symptoms observed in the plants,
tests demonstrating that mycelial growth of several fungi, assigning it numerical values: no symptoms (plant and corm) (1);
including Alternaria alternata, Aspergillus flavus, A. epinasty/stunting (2); yellowing (3); plant did not emerge with root
fumigans, A. niger and Fusarium chladmydosporum, is development (4); plant did not emerge (5) (Mendoza, 1977).
inhibited when grown on seed oil and crude seed extracts
at concentrations of 100 and 500 µl (Srivastava et al., Data analysis
2012). In an attempt to evaluate the fungicidal effect of
different plant organs of J. curcas, it was found that A completely randomized design with 5 replicates for each isolate
seeds followed by the fruit pulp and the whole fruit had and a control treatment (reference strain, labeled as Fog) were
significant inhibition of the mycelia of the fungus used. Analysis of variance of repeated means and a multiple
comparison against the control were performed with the Holm-Sidak
Colletrotrichum gloeosporioides isolated from papaya method (P < 0.05) using the Sigma Stat 3.5 statistical package
fruits (Rahman et al., 2011). Therefore, it is necessary to designed by STATCON© Witzenhausen, Germany.
carry out studies to evaluate the use of different
antifungal compounds to control fungal diseases such as
phorbol esters contain in seed oil. The aims of this study Morphological characterization
were to verify the pathogenicity of the isolates obtained For taxonomic identification of the isolates, the classification
from gladiolus corms in the State of Morelos, to morpho- methodology of Nelson et al. (1983) and Leslie and Summerell
logically and molecularly characterize Fusarium isolates (2006) was used. These authors suggest taking as references the
726 Afr. J. Microbiol. Res.
colony colors on PDA, and the length of the phialides, 52’ 17” North; 92° 27’ 04” West, at 26 masl. 3) Ejido la Victoria,
chlamydospores, microconidia and macroconidia. The length of the municipality of Mazatán, Chiapas, 14° 49’ 16” North; 92° 29’ 56”
structures was measured using ImageTool © software for Windows West, at 10 masl. Location altitudes were taken with a GPS lll
Version 3.0 Alpha 4 designed by the Center for Health Sciences, (Garmin, GPS lll Plus model, Ronsey, UK).
University of Texas. Morphological observations and measurements
were made with a compound microscope at 40x.
Oil extraction
Molecular characterization The extraction of the seed oil was performed according to the
Soxhlet method (NMX-F-089-S-1978), with petroleum ether and
DNA extraction from 12 monosporic isolates was performed by the hexane and 8-h reflux time. About 2 to 5 g of ground J. curcas
method described by Doyle and Doyle (1990), with modifications. seeds were weighed and placed in the extraction thimble. After
The quality of the DNA obtained was verified by electrophoresis on extraction, the solvent was gently evaporated from the flask and the
1% agarose gel stained with ethidium bromide (0.1 µg µl-1) and excess petroleum ether or hexane was removed using a BÜCHI
observed in a gel documentation system (G Box®; Syngene, model 114 rotary evaporator (BÜCHI® Labortechnik AG, Switzer-
England). DNA concentration was calculated by measuring the land) at 60°C. The calculations to determine the percentage of oil
optical density at 260 nm with the following formula: obtained was performed using the formula:
[DNA] = Oil (%) = (P-p/M) × 100

A] =
Where: P = mass in grams of the flask with the oil; p = mass in
grams of the flask; M = mass in grams of the sample.
PCR for ITS primers Phorbol esters were quantified using the high performance liquid
chromatography (HPLC) method described by Martínez-Herrera
The ITS regions were amplified with the primers ITS1 (2006). Specifically, 20 ml of methanol were added to a 2 g sample,
(TCCGTAGGTGAACCTGCGG), ITS2 which was sonicated for 2 min. The sample was centrifuged at 3600
(TCCTCCGCTTATTGATATGC) and ITS5 rpm for 10 min and the supernatant was evaporated almost to dry-
(GGAAGTAAAAGTCGTAACAAGG) (White et al., 1990; Haan et ness in a rotary evaporator (the extraction was repeated 3 times).
al., 2000; Abd-Elsalam et al., 2003; Moreno-Velázquez et al., 2005; The standard used was 12,13-phorbol myristate (Sigma Aldrich®),
Teixeira et al., 2005; González-Pérez et al., 2009), as well as the which showed a retention time of 25 min. The results were
specific primers for the genus Fusarium reported by Adb-Elsalam et expressed as mg g-1 of sample equivalent to 12,13-phorbol myristate.
al. (2003): ITS-Fu-Fwd (CGCACGATTACCACTAACGA) and ITS- This analysis was performed in the food laboratory of the Institute of
Fu-Rev (CAACTCCCAAACCCCTGTGA). The primers were synthe- Animal Production in the Tropics and Subtropics at the University of
sized by the Sigma Aldrich® Company. Each PCR reaction was Hohenheim in Stuttgart, Germany.
carried out in a final volume of 25 μl; 5.5 μl of nuclease-free water
were mixed with 2.0 μl of DNA of the fungus problem, 2.5 μl of each
ITS and 12.5 μl of Taq 2X Master Mix® (BioLabsInc, New England). Mycelial growth
The amplification reaction was carried out in a Perkin Elmer ® ther-
mocycler (GeneAmp PCR System 2400) with the following pro- Only the 11 isolates mentioned above and the reference strain
gram: initial denaturation at 95°C for 5 min; 35 cycles of dena- (Fog) were used to evaluate this parameter. A 5-mm disc of the
turation, alignment and extension at 95°C for 1 min and 72°C for 2 pathogen was placed on 60 × 15 mm Petri dishes containing PDA,
min. respectively, and a final extension at 72°C for 10 min. The Tween 20® and the oil at different concentrations (2.5, 5 and 10 mg
amplified fragments were verified by electrophoresis in 1% agarose ml-1), as well as 4 controls: PDA, petroleum ether (10 mg ml-1),
gel stained with ethidium bromide (0.1 μg μl-1). The gel was run at Tween 20® (10 mg ml-1) and Captan® (2 g L-1). They were incubated
85 V for 40 min and observed in a gel documentation system (G at 25°C in the dark. Diameter growth was measured daily for 5 days
Box®; Syngene, England). with a Vernier caliper until the control treatments reached the edge
of the Petri dish. The experimental design was completely rando-
mized and consisted of 7 treatments with 6 replicates. Analysis of
Sequencing variance (ANOVA) and Tukey’s comparison of means test (P <
0.05) were performed using the Sigma Stat 3.5 software program
The amplified PCR products were purified using the DNA Clean & designed by STATCON© Witzenhausen, Germany.
ConcentratorTM-5 Kit (Zymo Research, USA) and analyzed at the
Sequencing Laboratory of the Institute of Biotechnology, belonging
Spore germination
to the University National Autonomous of México, in Cuernavaca,
Morelos. The sequences were aligned and compared with sequen-
ces in the National Center for Biotechnology Information (NCBI) Ten milliliters of sterile distilled water were added to Petri dishes
database using the Basic Local Alignment Search Tool (BLAST) containing the growth of each isolate, then the surface was scraped
(Zhang et al., 2000). with a bent metal rod and the filtrate was passed through cotton
gauze. Of this suspension, 20 µl were placed on PDA discs of 10
mm in diameter and incubated for 6 to 10 h at room temperature
(26°C). Later, a few drops of lactophenol methylene blue were
Collection of J. curcas seeds added and the number of germinated spores was determined by
photo analysis with Image Tool© software for Windows version 2.01
Seeds were collected from J. curcas plants being used as a living Alpha 4, developed by the Center for Health Sciences at the
fence in the following locations: 1) Segunda Sección de la University of Texas. Germination was evaluated on nine PDA discs.
Cebadilla, municipality of Tapachula, Chiapas, 14° 50’ 48” North; Mean percentage germination and standard deviations were
92° 17’ 00” West, at 109 masl. 2) Villa de Mazatán, Chiapas, 14° calculated.
Albores et al. 727
1 2 3 4 5 6 7 8
Figure 1. Preliminary classification of isolates according to coloring on PDA medium.
RESULTS in isolates T9, T11, T12, T20, T24, T30, T32, T34, T35,
T39 and T40, which were collected from the munici-
Number of isolates palities of Yautepec and Cuautla (Figure 2). Isolates that
showed highly significant differences in the pathogenicity
Their morphological aspect, identified as belonging to the capacity were used for morphological and molecular
genus Fusarium, obtained a total of 45 isolates. The characterization and J. curcas oil sensitivity testing.
isolates showed different apparent morphological charac-
teristics, mainly in the color of the culture medium. Nelson
et al. (1983) performed a morphological characterization Morphological characterization
using the coloration on PDA as indicating that each spe-
cies has a specific color. Based on the coloring obtained, Some of the typical structures of the 11 isolates and the
a preliminary classification was conducted, obtaining a reference strain (Fog) are summarized in Table 1.
total of eight groups as shown in Figure 1.
Pathogenicity tests Molecular characterization
Statistical analysis showed that when compared with the The DNA had a yield of 220 to 670 µg g-1 of mycelium,
reference strain Fog (T25), isolates T1, T15, T20, T36 the band of the PCR products containing the primers
and T44 were significantly different (P < 0.01), whereas ITS2-ITS5 was 500 base pairs (bp) and the PCR product
highly significant differences (P < 0.001) were observed for the primers ITS-Fu-Fwd and ITS-Fu-Rev was from
Figure 2. Comparison of means against the reference strain Fog (T25) of the pathogenic capacity of
isolates of Fusarium spp. Significant difference *P < 0.01; **P < 0.001.
410 to 429 bp (Figure 3). For the multiple alignments, the Spore germination
total amplified portion of the 12-nucleotide sequences is
shown in Table 2, which corresponds to the complete Treatment susceptibility depended on the isolate, as no
sequence of both regions (ITS2 and ITS5). In Genbank, trend was observed for any specific treatment (Table 4).
the sequence of F. oxysporum f. sp gladioli and isolates Isolate T9 presented the lowest germination rate with J.
T30, T35 and T39 showed a similarity index of 99% with curcas oil at concentrations of 2.5 and 10 mg ml-1 with a
F. oxysporum. Another five isolates showed a similarity percentage germination of 14.40 and 14.43%, respec-
index of 99% with F. proliferatum. Isolates T20 and T34 tively, as compared to 98.44% for the PDA treatment.
showed no similarity to other sequences (Table 2). Isolate T24 also showed a low germination rate, which
was 12.62 and 17.28% for the concentrations of 2.5 and
5 mg ml-1, respectively. Isolate T24 was the most sus-
Oil extraction ceptible to the treatment with the fungicide Captan®, pre-
senting a germination of 33.79% while the PDA treatment
The oil percentage obtained for both solvents was 61.5%. had 99.77% germination.
Phorbol esters in the kernel meal and the oil extracted
with petroleum ether were 0.94 and 1.52 mg g-1, respec-
tively, while the oil extracted with hexane was 0.24 and DISCUSSION
0.67 mg g-1, respectively.
The highly pathogenic isolates were characterized morpho-
logically, identifying at least 2 species: F. oxysporum and
Mycelium growth Fusarium solani, which had different morphological fea-
tures, both gross and microscopic, and which were asso-
Comparison of means of mycelial growth on the last day ciated with the afore mentioned species. González-Pérez
of each treatment indicated that the eleven Fusarium et al. (2009) reported that these species caused rot in
isolates and the reference strain (Fog) were more gladiolus in San Martin Texmelucan, Puebla. They also
-1
sensitive to the concentration of 5 mg ml . Isolates T9, reported that these species differed in terms of colony
T11, T20, T32, T34, T35 and T40 were also sensitive to color and morphological characteristics, coinciding with
the concentration of 2.5 mg ml-1. For isolate T9, it was the results obtained in this work for descriptions of
observed that the concentration of 5 mg ml-1 showed less macro- and micro-conidia, phialides and chlamydospores.
mycelial growth than the fungicide Captan®, while for the For their part, Montiel-Gonzalez et al. (2005) described
isolate T11 incubated at the same concentration (5 mg the morphological characteristics of F. oxysporum, F.
ml-1) and the control with Tween®20 there were no solani, Fusarium lateritium, Fusarium reticulatum, Fusarium
significant differences. The isolate most susceptible to equiseti, Fusarium verticillioides, Fusarium culmorum,
the fungicide Captan® was the reference strain (Fog) Fusarium crookwellense, Fusarium proliferatum and
(Table 3). Fusarium sporotrichioides present in bean roots in five
Albores et al. 729
Table 1. Morphological characteristics of isolates of the genus Fusarium collected in gladiolus-growing areas of the state of Morelos.
Color Macroconidia
Isolate Microconidia Chlamydospore Species
Anverse Reverse Apical Basal Size (m) # septa
Oval with one septa
Fog* White Violet Hooked Distinctly notched 50.50-67.49 3 No F. oxysporum
Oval
Oval with one septa

T9 White Orange Blunt Barely notched 48.72-64.51 3-4 No F. solani
Reniform
Oval Single and paired

T11 White Brown Hooked Distinctly notched 69.63-73.19 3-4 F. oxysporum
Oval with one septa verrucose
White and Oval with one septa

T12 Brown Blunt Barely notched 55.37-82.54 3-4 No F. solani
orange Oval
Oval
T20 White Cream Papillate Barely notched 56.35-67.68 3-4 Single verrucose F. solani
Oval with one septa
Oval
Single verrucose
Pyriform
T24 Cream Cream Papillate Barely notched 54.77-87.51 3-4 Paired smooth- F. solani
Globose
walled
Oval with one septa
Single and paired
T30 White Cream Obovoid with a truncate base NO NO NO NO Fusarium spp.
verrucose
Oval Single verrucose

T32 White Cream Obovoid with a truncate base Blunt Foot shaped 57.31-69.52 3 Paired smooth- F. oxysporum
Oval with one septa walled
Oval Single verrucose Fusarium spp.

T34 White Cream NO NO NO NO
Obovoid with a truncate base Paired
Oval
T35 White Violet NO NO NO NO Single smooth Fusarium spp.
Oval with one septa
White and Globose oval Chains 2,3 and 4

T39 Cream NO NO NO NO Fusarium spp.
orange Oval with one septa verrucose
Globose
T40 Cream Yellow Oval NO NO NO NO Single verrucose Fusarium spp.
Obovoid with a truncate base
*Reference strain.
Figure 3. 1% agarose gel electrophoresis of the PCR products of the regions ITS-Fu-Fwd and ITS-Fu-Rev
of the isolates of Fusarium spp. Line: M) Molecular marker 100 bp (BioLabsInc, New England), 1) Fog, 2)
T9, 3) T11, 4) T12, 5) T20, 6) T24, 7) T30, 8) T32, 9) T34, 10) T35, 11) T39, 12) T40.
Table 2. Morphological and molecular characterization of highly pathogenic isolates from gladiolus corms.
Color Species
Isolate Morphological Molecular Molecular Similarity percentage
Anverse Reverse Accession number NCBI
characterization characterization size (bp) (%)
Fusarium Fusarium
FOG* White Violet 537 99 GU724514.1
oxysporum oxysporum
T9 White Orange Fusarium solani Fusarium solani 538 99 EU982942.1
Fusarium Fusarium
T11 White Brown 553 99 EU839366.1
oxysporum proliferatum
T12 White Brown Fusarium solani Fusarium solani 539 86 EU625405.1

T20 White Cream Fusarium solani No identified 435
T24 Cream Cream Fusarium solani Fusarium solani 456 78 GU355660.1
Fusarium
T30 White Cream Fusarium spp 526 99 GU445378.1
oxysporum
Fusarium
T32 White Cream Fusarium solani 541 99 FJ460589.1
oxysporum
T34 White Cream Fusarium spp No identified 433
Fusarium
T35 White Violet Fusarium spp 516 99 GU724514.1
oxysporum
Fusarium
T39 White Cream Fusarium spp 515 99 GU724514.1
oxysporum
T40 Cream Yellow Fusarium spp Fusarium solani 557 99 EU625405.1
states of central Mexico. The descriptions made for the due to the indiscriminate use of fungicides in the region.
species isolated in this study also agreed with those Alternatively, these unidentified isolates could be species
reported by these authors. Molecular taxonomic results not yet reported. The percentage of J. curcas seed oil
by PCR: ITS confirm the morphological identification of reported by Martínez-Herrera et al. (2010) coincides with
ten isolates, which corresponded to F. oxysporum, F. the values obtained in this research in seeds from the
solani and F. proliferatum. The two isolates that showed state of Chiapas, with a value of 60.4%. The same author
no similarity when aligning them using BLAST could be reports phorbol ester values of 2.03 mg g-1 in oil and 0.16
Fusarium species, where genetic variation has occurred mg g-1 in kernel meal. The differences in phorbol ester
Albores et al. 731
Table 3. Effect of J. curcas oil on mycelial growth of isolates of Fusarium spp.
Isolate
Treatment
Fog* T9 T11 T12 T20 T24 T30 T32 T34 T35 T39 T40
a a a a a a a a a a a a
PDA 4.08 (0.82) 4.51 (0.82) 4.95 (1.01) 4.19 (0.87) 4.76 (0.96) 3.70 (0.79) 4.26 (0.84) 4.68 (0.96) 4.16 (0.88) 4.91 (0.99) 4.23 (0.90) 4.80 (0.99)
® a bc c bc d bc ab bc abc bc b b
Tween 20 3.45 (0.61) 3.10 (0.53) 2.86 (0.47) 3.55 (0.5) 2.91 (0.48) 2.61 (0.46) 3.56 (0.89) 3.0 (0.56) 3.56 (0.70) 3.30 (0.59) 2.95 (0.54) 3.76 (0.75)
® b d d d e d d e e e d d
Captan 0.78 (0.08) 1.31 (0.17) 1.43 (0.20) 1.43 (0.19) 1.50 (0.21) 1.08 (0.13) 1.23 (0.19) 0.90 (0.09) 0.98 (0.09) 1.41 (0.23) 1.66 (0.26) 1.33 (0.20)
a bc b bc bc ab ab b bcd ab ab b
Petroleum ether 3.91 (0.75) 3.0 (0.56) 3.93 (0.76) 3.11 (0.6) 3.78 (0.74) 3.03 (0.53) 3.96 (0.81) 3.66 (0.72) 3.31 (0.66) 3.91 (0.79) 3.51 (0.74) 3.63 (0.70)
-1 a c c bc cd ab ab cd cd cd ab b
Oil 2.5 mg mL 3.61 (0.72) 2.78 (0.54) 2.81 (0.47) 3.23 (0.6) 3.55 (0.70) 3.33 (0.68) 3.60 (0.68) 2.23 (0.40) 2.76 (0.52) 2.8 (0.49) 3.55 ( 0.70) 3.51 (0.67)
-1 b d d d e cd c de d de c c
Oil 5 mg mL 1.28 (0.17) 1.26 (0.15) 1.83 (0.28) 1.92 (0.28) 2.06 (0.34) 1.95 (0.28) 2.61 (0.45) 1.23 (0.14) 2.56 (0.46) 1.98 (0.41) 2.48 (0.42) 2.33 (0.42)
-1 a ab bc ab ab ab bc b ab bc ab b
Oil 10 mg mL 3.39 (0.72) 3.70 (0.77) 3.11 (0.61) 3.67 ( 0.6) 4.50 (0.92) 3.05 (0.61) 3.38 (0.68) 3.35 (0.66) 3.78 (0.79) 3.58 (0.73) 3.68 (0.76) 3.55 (0.76)
-1
*Reference strain. Means followed by different letters in each column are significantly different by Tukey test at (α 0.05). Values in parenthesis indicate growth rate (mm day ).
Table 4. Effect of J. curcas oil on percentage conidial germination of isolates of Fusarium spp.
Treatment
Isolate ® ® J. curcas oil (mg ml-1)
PDA Tween 20 Captan Petroleum ether
2.5 5 10
Fog* 97.92 ± 3.77 97.56 ± 5.20 96.26 ± 5.15 96.05 ± 4.68 61.34 ± 18.52 90.06 ± 14.62 39.87 ± 20.86
T9 98.44 ± 1.66 68.44 ± 14.27 65.35 ± 28.05 36.44 ± 25.43 14.40 ± 9.45 44.64 ± 30.46 14.43 ± 11.44
T11 97.55 ± 3.95 95.55 ± 3.12 83.33 ± 17.37 97.11 ± 2.84 96.00 ± 3.00 96.24 ± 4.69 98.22 ± 2.90
T12 99.55 ± 0.88 44.44 ± 22.70 83.33 ± 35.35 97.17 ± 5.65 44.44 ± 22.75 90.74 ± 18.84 97.77 ± 6.66
T20 99.55 ± 0.88 93.96 ± 6.04 41.95 ± 15.71 42.15 ± 10.42 91.55 ± 7.46 52.41 ± 19.90 98.66 ± 1.73
T24 99.77 ± 0.66 86.00 ± 12.84 33.79 ± 21.46 34.25 ± 11.09 12.62 ± 15.46 17.28 ± 6.03 82.66 ± 30.53
T30 97.55 ± 3.97 92.22 ± 7.03 92.07 ± 4.77 90.00 ± 7.28 89.33 ± 5.19 91.85 ± 7.78 55.37 ± 26.10
T32 99.55 ± 0.88 44.44 ± 22.70 83.33 ± 35.35 97.17 ± 5.65 44.44 ± 22.75 90.74 ± 18.84 97.77 ± 6.66
T34 99.77 ± 0.66 97.77 ± 2.10 91.66 ± 17.67 91.31 ± 8.52 89.13 ± 7.54 64.53 ± 33.37 89.58 ± 6.40
T35 100.0 ± 0.00 98.44 ± 2.51 100.00 ± 0.00 100.00 ± 0.00 98.22 ± 3.93 97.22 ± 4.39 91.15 ± 11.99
T39 99.22 ± 1.16 92.06 ± 7.67 99.77 ± 0.66 96.92 ± 4.89 96.33 ± 4.03 60.81 ± 15.04 94.41 ± 5.29
T40 99.77 ± 0.66 98.20 ± 2.18 89.94 ± 12.53 98.97 ± 2.06 91.00 ± 16.78 70.17 ± 20.16 90.54 ± 12.54
*Reference strain. Means and SD.
-1
content for each solvent, obtained in this study, applying a higher temperature to obtain the oil rates between 0.140 and 0.462 mm day were
could be because the two solvents have a diffe- with the solvents used, the phorbol esters are de- obtained, when compared with 0.820 to 1.018 mm
rent boiling point (68.85 for hexane and 60°C for graded. The greatest effect on mycelial growth for day-1 for the PDA control. Some authors reported
petroleum ether) and because the phorbol esters the isolates evaluated was with the J. curcas oil that the effect on the mycelial growth of the com-
in the oil are thermolabile, which means that by treatment at the concentration of 5 mg ml-1. Growth pounds present in the essential oils may be due to
two factors: the first involves inhibition of extracellular Barrera-Necha L, Garduño-Pizaña C, García-Barrera LJ (2009) In vitro
antifungal activity of essential oils and their compounds on mycelia
enzyme synthesis, and the second the alteration of the growth of Fusarium oxysporum f.sp. gladioli (Massey) Snyder and
cell wall structure (Tripathi et al., 2009). Siva et al. (2008) Hansen. Plant Pathol. J. 8:17-21.
evaluated the antifungal effect of aqueous, acetone and Booth C (1985) The genus Fusarium. Ed. Commonweath Mycological
ethanol extracts of 20 medicinal plants against F. Institute. p. 237.
oxysporum f. sp. melongenae. J. curcas was one of the Donlaporn S, Suntornsuk W (2010) Antifungal Activities of Ethanolic
Extract from Jatropha curcas Seed Cake. J. Microbiol. Biotechnol.
plants evaluated and showed inhibition percentages of 20:319-324.
100% for all extracts used. Donlaporn and Suntornsuk Doyle JJ, Doyle JL (1990). A rapid total DNA preparation procedure for
(2010) evaluated the antifungal activity of ethanol ex- fresh plant tissue. Focus 12:13-15.
tracts of J. curcas seeds and the importance of phorbol Flores-Olivas A, Martínez-Soriano JP, Martínez-Espinoza AD (1997)
Use of technology new in detection and genetic analysis of
esters present in the extracts on F. oxysporum, F. phytopathogens. Phytopathology 32:96-111.
semitectum, Colletotrichum capsici, C. gloeosporioides, Garduño-Pizaña C, Barrera-Necha LL, Ríos-Gómez MY (2010).
Pythium aphanidermatum, Lasiodiplodia theobromae and Evaluation of the fungicidal activity of leaves powders and extracts of
fifteen Mexican plants against Fusarium oxysporum f. sp. gladioli
Curvularia lunata, using concentrations of 0 to 10,000 mg
-1 -1 (Massey) Snyder & Hansen. Plant Pathol. J. 9:79-87.
L . Concentrations from 6,000 mg L showed 100% González-Pérez E, Yañez-Morales MJ, Ortega-Escobar H, Velázquez-
inhibition of mycelial growth for all tested pathogens. Mendoza J (2009) Comparative Analysis among Pathogenic Fungal
These authors are the first to report that phorbol esters Species that Cause Gladiolus (Gladiolus grandiflorus Hort.) Corm Rot
are responsible for the fungicidal activity of the extracts, in Mexico. Mex. J. Phytopathol. 27:45-52.
Haan LAM, Numansen A, Roebroeck EJA, van Doorn J. (2000) PCR
as they note that by removing these compounds from the detection of Fusarium oxysporum f.sp. gladioli race 1, causal agent of
extracts there were no significant differences as com- Gladiolus yellows disease, from infected corms. Plant Pathol. 49:89-
pared to the control. As for the germination of conidia, the 100.
Katan T, Di Primo P (1999). Current status of vegetative compatibility
three concentrations used in this study were effective for
groups in Fusarium oxysporum: Supplement (1999). Phytoparasitica
only two isolates (T9 and T24) with germination between 27:1-5.
12.62 and 17.28%. Ogbebor and Adekunle (2008) assessed Leslie J, Summerell BA (2006). The Fusarium laboratory manual. Ed.
the germination of Drechslera heveae conidia on PDA Blackwell publishing. p. 388.
with J. curcas extracts, attaining a 20% germination rate Martínez-Herrera J (2006) Genetic and nutritional diversity of piñón
(Jatropha curcas L.) in México. PhD dissertation, Instituto Politécnico
with the 100% concentration. The three species identified Nacional, México.
showed symptoms of the disease in the plant, such as Martínez-Herrera J, Martínez-Ayala AL, Makkar H, Francis H, Becker K
leaf yellowing, epinasty and some-times late flowering in (2010) Agroclimatic conditions, Chemical and Nutritional
Characterization of Differents provenances of Jatropha curcas L.
the field. It is suggested that in different parts of Morelos,
from Mexico. Eur. J. Sci. Res. 39:396-407.
corm rot in gladiolus is caused by three fungal species, Mendoza-Zamora C (1997). Certificación de estudios de efectividad
which showed morphological, molecular and pathogenic biológica de plaguicidas. Ed. Cecilio Mendoza Zamora-Universidad
differences, plus different sensitivity to J. curcas oil. All Autonóma de Chapingo. Texcoco, Mexico. 279 p.
Montiel-González L, González-Flores F, Sánchez-García BM, Guzmán-
three species were capable of causing the disease. The
Rivera S, Gámez-Vázquez FP, Acosta-Gallegos JA, Rodríguez-
results of this research demonstrate the antifungal poten- Guerra R, Simpson-Williamson J, Cabral-Enciso M, Mendoza-Elos M.
tial of J. curcas oil to control fungi that cause diseases in (2005). Species of Fusarium occurring on bean (Phaseolus vulgaris
ornamental plants. L.) roots affected with rots in five states of Central México. Mex. J.
Phytopathol. 23:1-7.
Moreno-Velázquez M, Yáñez-Morales MJ, Rojas-Martínez RI, Zavaleta-
ACKNOWLEDGEMENTS Mejía E, Trinidad-Santos A, Arellano-Vazquez JL (2005). Diversity of
fungi of amaranthus (Amaranthus hypochondriacus L.) seed and their
This work was funded by the Secretary of Postgraduate molecular characterization. Mex. J. Phytopathol. 23:111-118.
and Research (Projects 20090234 and 20100783) and by Nelson P E, Toussoun T A, Marasas WFO (1983) Fusarium species: an
the Commissions of Operation and Support to Academic illustration manual for identification. University Park, Pennsylvania
State University Press, Pensylvania, USA. p. 193.
Activities from the National Polytechnic Institute. Ogbebor ON, Adekunle AT (2008). Inhibition of Drechslera heveae
(Petch) M. B. Ellis, causal organism of Bird’s eye spot disease of
REFERENCES rubber (Hevea brasiliensis Muell Arg.) using plant extracts. Afr. J.
Gen. Agric. 4:19-26.
Abd-Elsalam AK, Aly IN, Abdel-Satar MA, Khalil MS, Verreet JA (2003) Ortoneda M, Guarro J, Madrid M, Caracuel Z, Roncero MI, Mayayo E,
PCR identification of Fusarium genus based on nuclear ribosomal- Di Pietro A. (2003). Fusarium oxysporum as a Multihost Model for the
DNA sequence data. Afr. J. Biotechnol. 2:82-85. Genetic Dissection of Fungal Virulence in Plants and Mammals.
Aiyelaagbe OO, Adeniyi BA, Fatunsin OF, Arimah BD (2007) In Vitro Infect. Immun. 72:1760–1766.
antimicrobial activity and phytochemical analisis of Jatropha curcas Pauli A, Knobloch K (1987) Inhibitory effects of essential oil components
roots. Int. J. Pharmacol. 3:106-110. on growth of food-contamining fungi. Z. Leb.-Unt. und-For. 185:10-
Alves-Santos FM, Benito EP, Elsava AP, Díaz-Mínguez JM. (1999) 13.
Genetic diversity of Fusarium oxysporum strains from common bean Pintore G, Chessa M, Boatto GP, Cerri G, Usai M, Trillini B (2002)
fields in Spain. Appl. Environ. Microbiol. 65:3335-3340. Essential oil Hypericum perforatum L. var. angustifolium DC growing
Baayen RP (2000). Diagnosis and detection of host-specific forms of wild in Sardinia (Italy). J. Essential Oil Res. 17:533-535.
Fusarium oxysporum. EPPO Bull. 30:489-491. Rahman M, Ahmad SH, Mohamed MTM, Rahman MZA (2011). Extrac-
Barrera-Necha L, García-Barrera L (2008) Antifungal activity of tion of Jatropha curcas fruits for antifungal activity against
essential oils and their compounds on growth of Fusarium sp. anthracnose (Colletotrichum gloeosporioides) of papaya. Afr. J.
isolated from papaya (Carica papaya). Rev. UDO Agric. 8:33-41. Biotechnol. 10:9796-9799.
Albores et al. 733
SAGARPA (2006). Manual Técnico fitosanitario del cultivo de gladiolo. White TJ, Bruns T, Lee S, Taylor J (1990). Amplification and direct
Ed. Comité Estatal de Sanidad Vegetal del Estado de Morelos. p. 13. sequencing of fungal ribosomal RNA genes for phylogenetics.
Siva N, Ganesan S, Banumathy N, Muthuchelia (2008). Antifungal Chapter 38. PCR protocols: A guide to methods and applications. Ed.
Effect of Leaf Extract of Some Medicinal Plants Against Fusarium Academic Press Inc, pp. 315-323.
oxysporum Causing Wilt Disease of Solanum melogena L. Ethnobot. Wink M, Koshmieder C, Saverwein M, Sporer F (1997). Phorbol esters
Leaflets 12:156-163. of Jatropha curcas. In G.M. Gübitz, M. Mittelbach, & M. Trabi (Eds.),
Srivastava S, Kumar R, Sinha A. (2012). Antifungal Activity of Oil Biofuels and Industrial products from Jatropha curcas Austria, Dbv-
Against Some Seed-borne Fungi. Plant Pathol. J. 11:120-123. Verlag Univ. pp.160-166.
Teixeira M, Figueira G, Sartoratto A, Garcia V, Delarmelina C (2005). Zhang Z, Schwartz S, Wagner L, Miller W (2000) A greedy algorithm for
Anti-Candida activity of Brazilian medicinal plants. J. aligning DNA sequences. J. Comput. Biol. 7:203-14.
Ethnopharmacol. 97:305-311
Tripathi A, Sharma N, Sharma V (2009). In vitro efficacy of Hyptis
suaveolens L. (Poit.) essential oil on growth and morphogenesis of
Fusarium oxysporum f.sp. gladioli (Massey) Snyder & Hansen. World
J. Microbiol. Biotechnol. 25:503-512.
Vol. 8(8), pp. 734-742, 19 February, 2014
DOI: 10.5897/AJMR2013.5940
Screening phosphate solubilizing actinobacteria

isolated from the rhizosphere of wild plants from the
Eastern Cordillera of the Colombian Andes
Luis Daniel Prada Salcedo1*, Carolina Prieto2 and Marcela Franco Correa3
1
Luis Daniel Prada Salcedo: Unidad de investigaciones agropecuarias. Facultad de Ciencias. Pontificia Universidad
Javeriana, Department of Microbiology Carrera 7ª 43-82 Edificio Félix Restrepo, S. J. 3° Piso Bogotá - Colombia.
2
Centro de investigación de la caña de azucar, Cenicaña. Cali - Colombia.
3
Marcela Franco Correa: Grupo de Biotecnología ambiental e industrial. Facultad de Ciencias. Pontificia Universidad
Javeriana, Department of Microbiology Carrera 7ª 43-82 Edificio Félix Restrepo, S. J. 3° Piso Bogotá - Colombia.
Colombia is a tropical country with high diversity and an agricultural economy, yet their soils are
characterized by low pHs and poor phosphorus concentrations. Soil supplementation with chemical
fertilizers containing soluble phosphorus is a costly and contaminating practice and for this reason, the
aim of this study was to isolate actinobacteria that are able to release soluble phosphate from wild
plants of the Eastern Cordillera of Colombia and select strains with high phosphorus solubilizing
activity. To screen the isolates of actinobacteria, we used two qualitative assays to determine the
efficiency of solubilization by measuring the halo of hydrolysis in a Pikovskaya’s agar plate (PVK). A
second assay was performed on broth with National Botanical Research Institute's phosphate growth
(NBRIP) medium containing bromophenol blue (BPB). Finally, the released soluble phosphate by
actinobacteria was quantified using insoluble Ca3(PO4)2 or AlPO4 as sole sources of P. Only five of the
tested strains were the best solubilizing strains in the two qualitative assays. The strains T1C, T1H, T3A,
T3C, P3E, F1A, F2A and V2B solubilized significantly more phosphorus than the other strains, which
was shown for the quantitative assay. Strains T1C, T3A, T3C and F1A are candidates for future studies
and to evaluate other plant growth promoting activities.
Key words: Screening, phosphate solubilizing, actinobacteria, Colombia.
INTRODUCTION
Colombia is one of the five countries in the world with the physicochemical (sorption-desorption) and biological
largest diversity of genes, species, and ecosystems. The (immobilization-mineralization) processes. Phosphate
Colombian Andes are located in one of the world bio- anions can be immobilized by precipitation with cations
diversity hotspots and the savannahs of the Llanos are such as Ca2+, Mg2+, Fe3+ and Al3+ providing a high phos-
listed as one of the world eco-regions with rare, rich and phorus fixation capacity to soils (Oliveira et al., 2009;
biologically important habitats (Myers et al., 2000; Herzog Khan et al., 2009). In Colombia’s agricultural tradition, to
et al., 2011). Soils within these areas are characterized prepare soils by adding manure, chemical fertilizers or
by low pHs and low phosphorus concentrations (Rao et organic amendments, any of them is supplemented with
al., 2004; Fassbender and Bornemisza, 1994; Malagon et phosphate in order to compensate the phosphorus defi-
al., 2003). Soil phosphorus dynamics is characterized by ciency is a common practice (León, 1991; Guimaraeset
*Corresponding author. E-mail: [email protected]. Tel: 5701 3208320 ext: 4150 – 4069. Fax: 3208320 ext. 4047.
Salcedo et al. 735
et al., 2001). Soil supplementation with chemical (Figure 1). These habitats included the rhizospheres of wild plants
fertilizers containing soluble phosphorus is thus a costly growing in natural protected areas and forests; samples were taken
from forest species associated with Vallea, Weinmannia, Vaccinium,
and conta-minating practice, not only because of their
Drimys, Rosmarinus, plus samples from legumes grasses (Rye
way of use but because of the highly polluting mode in Grass or Bromus) and clovers (Trifolium repens and Trifoliumpratense).
which they are industrially produced, requiring the use of Soil pH, total P, available P, and organic matter were characterized
sulphuric acid at high temperatures. Furthermore, wrong (Table 1). The samples were taken at a depth of 15-30 cm and
fertilizer applications can cause problems of eutrophica- were placed in polyethylene bags, closed tightly and stored in a
tion and erosion (Whitelaw, 2000; Vassilev et al., 2006). refrigerator at 4°C. Actinobacteria were isolated by dilution plate
method using oat-meal agar. These media were supplemented with
Many studies have been done on phosphate solubilizing nistatin (0.1 % V/V). Plates were incubated at 26°C, and monitored
micro-organisms (PSM) as an alternative in the pre- daily. Subcultures led to purified bacterial colonies that’s howed an
vention of environmental and agricultural issues men- actinobacteria-like appearance. Gram staining indicated that they
tioned above (Rodriguez and Fraga, 1999; Krishnaraj and were Gram positive mycelia sporulating bacteria. A classical appro-
Goldstein, 2001; Kumar et al,. 2010; Bhattacharyya and ximation was used for the characterization like aerial mass colour,
reverse side pigments, melanoid pigments, soluble pigments. We
Jha, 2012).
did determination of micro morpho-logical characteristics of the
There are reports on studies with microorganisms spore-bearing hyphae, the number of spores at the end of mature
capable of solubilizing phosphate, especially bacteria and hyphae and the spore chain Morphology. The strains were stored in
some fungi, which have experimentally demonstrated 20% sterile glycerol at -20°C.
their capacity to improve phosphorus availability to plants
in laboratory, greenhouse and field experiments (Rudresh
Screening of phosphate-solubilizing actinobacteria
et al., 2005; Deubel et al., 2005; Pandey et al., 2008;
Hamdali et al., 2012). To a lesser extent, actinobacteria The solid plate assay was done to measure the halo zone formed
have been reported as microorganisms with the capacity surrounding the bacteria after being inoculated on agar and
to release phosphorus into the soil (Mba, 1994, 1997; incubated for 72 h at 26°C on PVK growth medium containing 5 g of
Hamdali et al., 2008, El-Tarabily et al., 2006). Actinobacteria tricalcium phosphate as sole phosphorus source and pH 7.2
have special interest because these filamentous sporula- (Pikovskaya 1948). Halo-forming colonies were recorded as posi-
tive. The solubilization index was calculated as the ratio between
ting bacteria are able to thrive in extremely different soils,
the total diameter (colony + halo) and the colony diameter (Kumar
play important ecological roles in soil nutrient cycling and and Narula, 1999). A second assay was performed on broth with
are recently being regarded as plant growth promoting NBRIP medium containing BPB following the protocol of Mehta and
rhizobacteria (Jiang et al., 2005; Pathom-Aree et al., Nautiyal (2001). In brief, 5 ml of NBRIP-BPB medium in a 30-ml test
2006; Franco-Correa et al., 2010). The selection of PSM tube was inoculated with the actinobacterial strain (50 ml inoculum
is carried out by rapid qualitative methods. The most com- with approximately 3 X 107cfu/ml), and the isolates were grown for
4 days at 26°C with continuous agitation at 120 rpm. At the end of
mon method is to determine the efficiency of solubili- the incubation period, the final OD-600 values were subtracted from
zation by measuring the halo of hydrolysis in a Pikovskaya’s the initial values. The medium pH was measured by immersing a
agar plate (1948), but results are not always consistent glass electrode into the culture broth.
and in some cases this method is insufficient to detect all
the PSM (Nautiyal 1999; Mehta and Nautiyal, 2001;
Rashid et al., 2004). Mehta and Nautiyal (2001) deve- Release soluble phosphate
loped a system that includes a broth - the National Botanical
Research Institute's phosphate growth medium (NBRIP) Solubilization of P by Actinobacteria was quantified using insoluble
5 g/L of Ca3(PO4)2 or 1 g/L of AlPO4 as sole sources of P in the
medium and a qualitative assay in liquid medium, which NBRIP broth medium. In each autoclaved flask, 2 ml of bacterial
is more accurate and reliable in the selection of PSM and suspension (approximately 3 X 107cfu/ml) were transferred to 100
therefore makes the screening process more quick, effi- ml Erlenmeyer flask containing 20 ml of NBRIP broth medium. The
cient and with low cost (Khan et al., 2009). actinobacteria cultures were placed on a rotary shaker at 120 rpm
The aim of this study was to isolate actinobacteria able for 4 days and pH was measured after incubation with a pH meter.
Suspensions were centrifuged to remove bacterial cells and other
to release soluble phosphate from wild plants of the
insoluble materials. The resulting supernatants were passed through
Eastern Cordillera of Colombia and to select strains with a 0.45 μm filter and the inorganic phosphate content of the culture
high phosphorus solubilizing activity with the purpose of filtrate was determined by the molybdenum blue method (Murphy
suggesting those microorganisms as potential bioferti- and Riley, 1962). The available phosphorous was determined using
lizers and hence help to use less chemical fertilizers in a spectrophotometer at 880 nm and calibrated with a standard
agricultural practices. KH2 PO4 curve.
MATERIALS AND METHODS Statistical analysis
Soil samples and isolation of Actinobacteria All of the experiments were performed with four replicates. The data
were analyzed with a One Way Analysis of Variance (ANOVA) and
Soil samples were collected from various localities from the Eastern a Duncan’s multiple range test to determine any significant differen-
Cordillera between 2010 and 2011. Diverse habitats at different ces between groups at p < 0.05. All the statistical analyses were
altitudes were selected for the isolation of actinobacteria strains performed using the SPSS 11.0 for Windows® software.
Figure 1. Map of Colombia with coordinates, altitude, humidity and temperature of the localities sampled.
Table 1. Characteristics of the soil from the different regions in Colombia.
Region Soil pH Total P (mg/kg) Available P (mg/kg) Organic matter %

Tota* 5.06 ± 0.3 360 ± 283.6 118.4 ± 126.5 13 ± 16.9
Paipa* 5.52 ± 1.0 614 ± 311.1 8 ± 2.6 5.96 ± 5.3
Mani* 4.8 ± 0.5 407.2 ± 408.6 17.04 ± 31.3 2.2 ± 1.3
Fusagasuga* 5.1 ± 1.4 2830.6 ± 1554.0 55.52 ± 56.8 13.52 ± 13.5
La vega* 4.06 ± 0.6 1504.4 ± 417.7 86.52 ± 171.4 4.6 ± 0.6
Villleta* 5.9 ± 1.6 949.25 ± 880.8 8.725 ± 7.6 2.95 ± 1.7
Andina 5.5 ± 0.2 922 ± 1143 83 ± 83 8 ± 3.2
Caribe 6 ± 1.1 1343 ± 1143 101 ± 123 9 ± 1.8
Pacific 4.5 ± 2.1 315 ± 456 37 ± 28 8.5 ± 5.5
Orinoquia 7 ± 2.4 541 ± 626 116 ± 84 2.8 ± 4.5
Amazonica 5 ± 0.8 815 ± 717 43 ± 86 3 ± 4.6
*Data of this work. 30 soil cores from random location. Values are Average ±standard deviation.
RESULTS localities at the highest elevations: 56% of the isolates

belong to Tota and Paipa, 40% to the towns of
Soil samples and isolation of Actinobacteria Fusagasuga, La Vega and Villeta; and the remaining 4%
of the isolates were from Mani, a locality at a lower ele-
We isolated 57 strains of actinobacteria from six different vation that is located on tropical plains. The use of oat-
sampling areas from October 2010 to July 2011. Soil meal agar allowed the recovery of large numbers of
characterization showed pH ranges from 4.0 to 5.9, total actinobacteria that showed growth and sporulation results
P from 360 to 2830 mg/kg, available P from 8.7 to 118.4 after 7 days of culture. Preliminary morphological charac-
mg/kg, and organic matter from 2.95 to 13.52% (Table 1). terization of the isolates showed typical structures, like
Figure 2 shows a greater abundance of actinobacteria in aerial and substrate mycelium, conidia chains, some
Salcedo et al. 737
Figure 2. Efficiency of solubilization of the isolates. A clear zone around a growing colony indicate phosphate
solubilization and was measured as phosphate solubilazation index.
mycelium with coccoid elements, and spore chain mor- obtained with the test, the pH present in the culture
phologies namely Rectiflexibiles, Retinaculiaperti and medium was low for the majority of the strains selected.
Spirales. In addition, other characteristics as melanoid The best solubilizing strains with low pH are from the
pigments, reverse side pigments and soluble pigments town of Tota, which was the sampling zone with highest
were observed. Macroscopically, all have a dry appearance elevation and lowest temperature in addition to a rela-
granular, powdery or velvety, characteristic of the actino- tively low moisture percentage. In this area, a large num-
bacteria. Additionally, there were several colors: white ber of actinobacteria were isolated from five samples
(T1B, T3B, P2R, L4C and M2A), heavy or light gray (T3A, collected in the surroundings of the lake, near an area
T3C, T3D, L3A, P3E, F2A), beige (F1A, F2C), blue-green known as Playa Blanca where the few remnants of wild
(V1B) and pink (V2B and V1E), and diffusible pigment forests are influenced by agriculture and tourism. The
production (F1A, F2C). Finally, we recognized the smell town Fusagasuga has strains with high activity but not a
of wet soil, representative characteristic of this group of decrease in pH; this locality has a lower humidity and
microorganisms for the production of geosmina. Some higher temperatures.
genera of actinobacteria were identified as Streptomyces,
Nocardia and Actinomadura, among unidentified isolates.
Release soluble phosphate
Screening of phosphate-solubilizing actinobacteria The results of the two qualitative assessments are not
totally consistent. Seven of the tested strains F1A, F1B,
Figures 2 and 3 show which isolates belong to strains F1C, F4C, T1A, T1D and T3A were the best solubilizing
with the best phosphorus solubilizing capacity as well as strains in both the solid and liquid evaluation media. We
two control strains deposited at the Pontificia Universidad made a quantitative assessment to find which of the
Javeriana: Streptomyces sp. MCR26 labelled as negative strains has the highest solubilizing capacity and which of
control and Streptomyces sp. MCR24 as positive control. the two methods is more reliable. Figure 4 shows that the
These control strains were characterized as Plant growth- strains T1C, T1H, T3A, T3C,P3E, F1A, F2A and V2B are
promoting rhizobacteria (PGPR) (Franco-Correa et al., as good as Streptomyces sp. MCR24 for Ca3(PO4)2 and
2010). The plate assay revealed that strains with the that these strains solubilized significantly more phos-
highest values of phosphorus solubilization are F2A, F1A, phorus than the other strains. Strains T1H, T1C, T3A,
F1B, F1C, F4C, T3F, T1A, T1D, and T3A. These strains T3C and F1A are present only in the selection obtained
have the same activity as that of the control strain with the methodology reported by Mehta and Nautiyal
Streptomyces sp. MCR24. On the other hand, the liquid (2001) suggesting that this test can choose more strains
evaluation exhibited that isolates with higher solubilizing with true solubilizing ability and for this reason, it is more
capacity are those that produce changes greater than 1.5 reliable. These strains also lowered pH at around 4 or
optical density units at 600 nm, which were F1A, F1B, less with exception of F1A. This result is supported by the
F1C, F2D, F4B, F4D, M2A, M4B, T1B, T1C, T1D, T1G, change in coloration in the medium caused by the pre-
T1H, T3A, T3B and T3C. In addition to the activity results sence of BPB pH indicator,which turns from purple to
3.0 6.5
Optical density shift at 600 nm+/- standard deviation
2.5 6.0
pH of activity in the medium

2.0 5.5
1.5 5.0
1.0 4.5
0.5 4.0
0.0 3.5
Figure 3. Change in optical density at 600 nm. The dotted line indicates the cut-off for the selection of microorganisms with high tricalcium
phosphate solubilizing capacity.
600.00
Ca3(PO4)
500.00
2
400.00
300.00
200.00
100.00
0.00
0.00 5.00 10.00 15.00 20.00 25.00

ALPO4
Figure 4. Released soluble phosphate. Activity with Ca3(PO4)2 5g·L-1 source is shown in Y and activity with
AlPO4 1g·L-1 source is shown in X.
Salcedo et al. 739
green, a fact related to the secretion of organic acids by (Leyval and Barthelin, 1989; Louw and Webley, 1959;
actinobacteria. No tests were made with aluminum phos- Gupta et al., 1994; Mehta and Nautiyal, 2001; Liu et al., 2011).
phate because Mehta and Nautiyal (2001) evaluation In our work, the advantage of the liquid assay metho-
methodology was designed for tricalcium phosphate. We dology was observed with strains Tota, Fusagasuga, La
observed that only in the quantitative assessment strains Vega and Villeta, which showed a major shift in the
T1J and T3A can solubilize phosphorus significantly from NBRIP-BPB broth decolorization and a high release of
AlPO4. In addition, the control strain Streptomyces sp. soluble phosphorus in the quantitative assessment.
MRC24 had a very low activity with this source of Figures 2, 3 and 4 show these strains are not equally dis-
phosphorus. tributed in all the six sampled localities; on the contrary,
they are found mostly in the locality of Tota. This locality
DISCUSSION is a lake of 56.2 km2 surrounded by crop fields of onions,
potatoes, beans, peas and carrots, and a few small high
Soil samples and isolation of Actinobacteria Andean forests. The constantly chemically fertilized crops
are affecting forests and causing eutrophication in water
The abundance of the isolates in the locality of Tota can bodies. The soil analysis of the Tota locality showed a
be explained by the environmental conditions of this area, 13% of organic matter, a cation-exchange capacity of 6
such as an average temperature of 18°C, sandy soils cmol/kg, a pH around 5 or less, and a total phosphorus
with low water content, and pH of 5.0 to 7.2; characteris- concentration of 360 mg/kg with only 118 mg/kg available
tics that facilitate growth and colonization of actino- phosphorus. These results suggest that only 33% of
bacteria. On the other hand, the towns of Mani and La phosphorus applied to the soil may be taken up by plants,
Vega have clay soils with low organic matter content, low on the other hand the remaining 67% is not used and can
oxygen tension and pH below 5.0 (Table 1). These soil cause environmental problems. The latter phosphorus
characteristics can decrease the abundance of actino- parameters reveal excessive chemical fertilization. Pro-
bacteria (Goodfellow and Williams, 1983; Alexander bably, excess phosphorus is adsorbed or precipitated
1977; El-Tarabily and Sivasithamparam, 2006). Actino- and organic matter is removed as the crop itself, so
bacteria occurs in a wide range of environments, but soil microorganisms are forced to use mainly inorganic forms
is the most common ecological niche because the role of of phosphorus.
these microorganisms is to recycles oil nutrients. Isolates
reflect abundant numbers and variety of morphologies in Release soluble phosphate
each of the localities sampled, but due to the isolation
methodology used, the predominant genus was Perez et al. (2007) propose that isolates causing a shift of
Streptomyces spp. (Xu et al., 1996; Ghodhbane-Gtari et > 1.5 units be selected for further studies. In order to
al., 2010). Actinobacteria isolates show that fertile soils confirm the usefulness of this cut-off point proposed by
with high concentrations of nitrogen and carbon are not Perez et al. (2007) and therefore to select the best strains,
always necessary to isolate these microorganisms. Although we implemented the quantitative assay measuring the
growth of these microorganisms is optimum with pH close release of soluble phosphorus in the NBRIP broth (Baig
to neutrality; our findings show that they can be isolated et al., 2010). Figure 4 shows that strains T1C, T1H, T3C,
from sandy soils with low pH and high aluminum concen- P3E, and V2B have a significantly higher activity to other
trations; results that are consistent with those of Shirokikh isolates, a result that was not observed in the plate assay
et al. (2002) and Norovsuren et al. (2007). possibly because one or more acids involved in the
process did not diffuse into the agar so that there was no
Screening of phosphate-solubilizing actinobacteria presence of a solubilization halo. The evaluation in
NBRIP-BPB broth revealed that isolates decolorizing the
In order to perform the screening for an adequate broth more than 1.5 units were also more efficient in the
selection of phosphorus solubilizing actinobacteria from quantitative assay. Also, the assay by Mehta and Nautiyal
Colombian native soils, the isolates were subjected to the (2001) contribute to reduce costs and efforts in the search
traditional test used by PVK and the test reported by of microorganisms with biofertilizing potential. Studies
Mehta and Nautiyal (2001). Although both qualitative based on physiology of actinobacteria in Colombia are
tests use different measurement units, there is a slight scarce, especially those focused on agriculture (Joaquín
correlation pattern between them. Figure 2 shows high et al., 2006; Cardona et al., 2009; Franco-Correa et al.,
bars for the locality of Tota and locality of Fusagasuga, 2010); in addition, there has been little research on bio-
respectively. These results are similar to those in Figure fertilizer-based clean technologies as a valuable input for
3, where the highest strain bars belong to the same agricultural development (Burbano and Silva, 2010).
localities with the greatest activity strains shown in Figure Developing native biofertilizers contributes to the mana-
2. The two methodologies are used, but the assay by gement of tropical soils with high absorption and fixation
Mehta and Nautiyal (2001) is currently more reported, of phosphorus due to their high cation concentrations,
because it reveals strains with good phosphorus-solubi- usually low pH and clay texture, characteristics that have
lizing capacity which is not detected in the plate assay traditionally been amended with an increased use of che-
mical fertilizers resulting in a negative impact on render these strains good candidates for the production
ecosystems. Strains T1C, T1H, T3A, T3C, P3E, F1A, of new bio-fertilizers with the ability of colonizing crop
F2A and V2B have phosphorus solubilizing capacities rhizospheres in tropical soils.
between 396 and 520 μg/ml with tricalcium phosphate; Strains T1C, T3A, T3C and F1A are candidates for
these results are good when compared with other bac- future studies. These strains have similar activity to the
teria from similar soils reported as phosphorus solubili- positive control strain Streptomyces sp. MCR24, which
zers,s uch as Bacillus spp., and Azotobacter spp (Narula was previously characterized by Franco-Correa et al.
et al., 2000; Chatli et al., 2008; Saharan and Nehra, (2010) who reported a broad variety PGPR activities
2011). Using similar soil isolates, Perez and co-workers besides phosphorus solubilizing capacity. Prior studies
reported an activity with tricalcium phosphate as high as have reported that strain swith good phosphorus solubi-
97 μg/ml by Burkholderia and with iron phosphate of 42 lizing capacity have also a variety of mechanisms to pro-
μg/ml by Serratia. Regarding actinobacteria, El-Tarabily mote plant growth like the strain Streptomyces sp.
(2008) reported that Micromonospora has an activity of MCR24. For this reason, further studies with these strains
218 μg/ml with phosphate rock and Gupta (2010) repor- designed to evaluate other plant growth promoting active-
ted that Streptomyces has an activity of 46 μg/ml with ties, like nitrogen fixation, degradation of complex carbo-
tricalcium phosphate. The values obtained are similar to hydrates, synergistic activities, antagonisms and produc-
the results of Chen et al. (2006) that evaluated this acti- tion of plant growth promoting hormones, can make an
vity in actinobacteria belonging to the genera Rhodococcus important contribution to agriculture.
sp. and Arthrobacter sp. which had 186 and 519 activities
μg/ml, respectively. Those activities reported show that ACKNOWLEDGEMENTS
our isolates have a great potential and an acceptable
activity. This study was partially supported by the Internal Finan-
Differences in the reported values by other authors may cial (Vicerrectoria Academica - Pontificia Universidad
be due to the measurement techniques employed or to Javeriana - Colombia). The authors would like to thank
the source of phosphorus evaluated. Occasionally, the the Dra. Sandra Constantino Chuaire for her contribution
measurements with rock phosphate may overestimate on the translation of this paper.
the values of in vitro solubilization because this source of
phosphorus is composed of several insoluble as well as
REFERENCES
soluble forms of phosphorus (Zapata and Roy, 2007).
One of the most valuable achievements of our research Alexander M (1977). Introduction to soil Microbiology.2nd edn. John
is having isolated an actinobacteria with the ability to wiley and sons. ISBN0-85226-013X. New York Baig KA, M, Zahir ZA,
Cheema MA (2010).Comparative efficacy of qualitative and
solubilize both tricalcium phosphate and aluminum phos-
quantitative methods for rock phosphate solubilization with phosphate
phate; the latter is a source difficult to solubilize because solubilizing rhizobacteria. Soil Environ. 29:82-86.
aluminum phosphate is rapidly absorbed in acid soils. Its Baig KS, Arshad M, Zahir ZA, Cheema MA (2010). Comparative
fixation rate per unit area is twice the rate in neutral or efficacy of qualitative and quantitative methods for rock phosphate
solubilization with phosphate solubilizing rhizobacteria. Soil Environ.
calcareous soils. Aluminum is also the leading cause of 29(1):82-86.
phosphorus precipitation in acid soils (Olsen and Watanabe, Bhattacharyya PN, Jha DK (2012). Plant growth-promoting rhizo-
1957; Holford, 1983). The source of phosphorus in the bacteria (PGPR): emergence in agriculture. World J. Microbiol.
AlPO4 test had a concentration of 1 g/L in NBRIP broth Biotechnol. 28:1327-1350.
because this compound is highly toxic to many micro- Burbano H, Silva F (2010). Ciencia del suelo: principios básicos.
Sociedad Colombiana de la Ciencia del suelo., Bogotá, D.C.,
organisms. The greatest in vitro resistance to aluminum Colombia. 594. Cardona G, Peña.
by actinobacteria reported in the scientific literature is of 5 Cardona G, Venegas CP, Ruiz-Garcia M (2009). Comunidades de
g/L AlPO4 (Sayed et al., 2000); therefore, several authors hongos actinomicetos en tres tipos de vegetación de la Amazonia
colombiana: abundancia, morfotipos y el gen 16s ADNr. Rev. Biol.
have been working with lower concentrations (Illmer,
Trop. 57:1119-1139.
1995; Prijambada et al., 2009). In addition, it is known Chatli A, Beri V, Sidhu B (2008). Isolation and characterisation of
that AlPO4 toxicity varies by the complexity of the soils phosphate solubilizing microorganisms from the cold desert habitat of
and that actinobacteria have good resistance to alumi- Salix alba Linn. in trans Himalayan region of Himachal Pradesh.
Indian J. Microbiol. 48:267-273.
num thus their soil colonization is facilitated in presence
Chen YP, Rekha PD, Arun AB, Shen FT, Lai WA, Young CC (2006).
of this element (Shirokikh et al., 2002; Rueda et al., Phosphate solubilizing bacteria from subtropical soil and their
2009). Strains with improved phos-phorus solubilizing tricalcium phosphate solubilizing abilities. Appl. Soil Ecol. 34:33-41.
activity lowered the pH probably due to the production of Deubel A, Merbach W, Varma A, Buscot F (2005). Influence of
organic acids, which is one of the phosphorus releasing Microorganisms on Phosphorus Bioavailability in Soils Microorganisms
in Soils: Roles in Genesis and Functions. In. Springer Berlin
mechanisms reported in scientific literature (Khan et al., Heidelberg, pp. 177-191.
2009; Saharan and Nehra 2011). Soils with these charac- El-Tarabily KA, Nassar AH, Sivasithamparam K (2008).Promotion of
teristics predominate in the Colombian tropics, hence growth of bean (Phaseolus vulgaris L.) in a calcareous soil by a
phosphate-solubilizing, rhizosphere-competent isolate of
strain T3A is important because it can release phospho- Micromonospora endolithica. Appl. Soil Ecol. 39:161-171.
rus from different sources. All the facts mentioned above, El-Tarabily KA, Sivasithamparam K (2006). Non-streptomycete actino-
Salcedo et al. 741
mycetes as biocontrol agents of soil-borne fungal plant pathogens and Fe mobilization fromminerals and plant growth. Plant Soil
and as plant growth promoters.Soil Biol. Biochem. 38:1505-1520. 117:103-110.
Fassbender H, Bornemisza E (1994). Química de suelos, con énfasis Liu H, Wu X-Q, Ren J-H, Ye J-R (2011). Isolation and Identification of
en suelos de América Latina, San José, Costa Rica. Colección de Phosphobacteria inPoplar Rhizosphere from Different Regions of
libros y materiales educativos/ IICA n 81. 420. China. Pedosphere 21:90-97.
Franco-Correa M, Quintana A, Duque C, Suarez C, Rodriguez MX, Louw HA, Webley DM (1959).A study of soil bacteria dissolving certain
Barea J-M (2010).Evaluation of actinomycete strains for key traits mineral phosphatefertilizers and related compounds.J. Appl.
related with plant growth promotion and mycorrhiza helping activities. Microbiol. 22:227-233.
Appl. Soil Ecol. 45:209-217. Malagon DC (2003). Ensayo sobre tipología de suelos colombianos.
Ghodhbane-Gtari F, Essoussi I, Chattaoui M, Chouaia B, Jaouani A, Énfasis en génesis yensayos ambientales Revista de la Academia
Daffonchio D, Boudabous A, Gtari M (2010). Isolation and Colombiana de Ciencias Exactas, Físicas y Naturales 27: 319 - 341.
characterization of non-Frankia actinobacteria from root nodules of Mba C (1994). Field studies on two rock phosphate solubilizing
Alnus glutinosa, Casuarina glauca and Elaeagnus angustifolia. actinomycete isolates asbiofertilizer sources. Environ. Manage.
Symbiosis 50:51-57. 18:263-269.
Goodfellow M, Williams S (1983).Ecology of Actinomycetes. Annu. Rev. Mba C (1997). Rock phosphate solubilizing Streptosporangium isolates
Microbiol. 37:189-216. from casts oftropical earthworms. Soil Biol. Biochem. 29:381-385.
Guimaraes ES, Rao Y, Amezquita MC, Amezquita E (2001). Sistemas Mehta S, Nautiyal CS (2001). An Efficient Method for Qualitative
agropastoriles en sabanas tropicales de América Latina.CIAT: Cali, Screening of Phosphate-Solubilizing Bacteria. Curr. Microbiol. 43:51-
Colombia and EMBRAPA: Brasilia, Brasil p. 328. 56.
Gupta N, Sahoo D, Basak U (2010). Evaluation of in vitro solubilization Murphy J, Riley JP (1962).A modified single solution method for the
potential of phosphate solubilising Streptomyces isolated from determination ofphosphate in natural waters. Anal. Chim. Acta.
phyllosphere of Heritiera fomes (mangrove). Afr. J. Microbiol. Res. 27:31-36.
4:136-142. Myers N, Mittermeier RA, Mittermeier CG, da Fonseca GA, Kent J
Gupta R, Singal R, Shankar A, Kuhad RC, Saxena RK(1994).A (2000).Biodiversityhotspots for conservation priorities. Nature 403:
modified plate assay for screening phosphate solubilizing 853-858.
microorganisms. J. Gen. Appl. Microbiol. 40:255-260. Narula N, Kumar V, Behl RK, Deubel A, Gransee A, Merbach W
Hamdali H, Bouizgarne B, Hafidi M, Lebrihi A, Virolle MJ, Ouhdouch Y (2000).Effect of PsolubilizingAzotobacter chroococcum on N, P, K
(2008). Screening for rock phosphate solubilizing Actinomycetes from uptake in P-responsive wheatgenotypes grown under greenhouse
Moroccan phosphate mines. Appl. Soil Ecol. 38:12-19. conditions.J. Plant Nutr. Soil Sci. 163:393-398.
Hamdali H, Moursalou K, Tchangbedji G, Ouhdouch Y, Hafidi M (2012). Nautiyal CS (1999).An efficient microbiological growth medium for
Isolation and characterization of rock phosphate solubilizing screening phosphatesolubilizing microorganisms.FEMS Microbiol.
actinobacteria from a Togolese phosphate mine. Afr. J. Lett.170:265-270.
Biotechnol.11: 312-320. Norovsuren Z, Zenova G, Mosina L (2007). Actinomycetes in the
Herzog SK, Martinez R, Jørgensen PM, Tiesse H (2011). Climate rhizosphere of semidesertsoils of Mongolia.Eurasian Soil Sci. 40:415-
change and biodiversity in the tropical Andes. Inter-American Institute 418.
for Global Change Research (IAI) and Scientific Committee on Oliveira CA, Alves VMC, Marriel IE, Gomes EA, Scotti MR, Carneiro
Problems of the Environment (SCOPE), 348 pp. ISBN: 978-85- NP, Guimarães CT, Schaffert RE, Sá NMH (2009). Phosphate solu-
99875-05-6. bilizing microorganisms isolated from rhizosphereof maize cultivated
Holford I (1983). Differences in the efficiency of various soil phosphate in an oxisol of the Brazilian Cerrado Biome. Soil Biol. Biochem.
tests for white clover between very acidic and more alkaline soils. 41:1782-1787.
Austr. J. Soil Res. 21:173-182. Olsen S, Watanabe F (1957). A method to determine a phosphorus
Illmer P, Barbato A, Schinner F (1995). Solubilization of hardly-soluble absorption maximum ofsoils as measured by the Langmuir isotherm.
AlPO4 with P solubilizing microorganisms.Soil Biol. Biochem. 27:265- Soil Sci. Soc. Am. J. 21:144-149.
270. Pandey A, Das N, Kumar B, Rinu K, Trivedi P (2008). Phosphate
Jiang Y, Li WJ, Xu P, Tang SK, Xu LH (2005). Study on diversity of solubilization byPenicillium spp. isolated from soil samples of Indian
Actinomycetes saltand alkaline environments. WeiShengWuXueBae. Himalayan region. World J. Microbiol. Biotechnol. 24:97-102.
46(2):191-195. Pathom-aree W, Stach J, Ward A, Horikoshi K, Bull A, Goodfellow M
Joaquín L, Benavides L, Gladys M, Quintero O, Ostos O (2006). (2006). Diversity ofactinomycetes isolated from Challenger Deep
Aislamiento eidentificación de diez cepas bacterianas desnitrificantes sediment (10,898 m) from the Mariana Trench. Extremophiles.
a partir de un suelo agrícolacontaminado con abonos nitrogenados 10:181-189.
proveniente de una finca productora decebolla en la Laguna de Tota, Pérez E, Sulbarán M, Ball MM, Yarzábal LA (2007).Isolation and
Boyacá, Colombia nova - publicación científica.4(6):50-54. characterization of mineral phosphate-solubilizing bacterianaturally
Khan A, Ajgam S, Naqvi SM, Rasheed M (2009). Phosphorus colonizing a limonitic crust in the south-eastern Venezuelan region.
solubilizing bacteria:occurrence, mechanisms and their role in crop Soil Biol. Biochem. 39(11):2905-2914.
production. J. Agric. Biol. Sci. 1:48-58. Pikovskaya R (1948). Mobilization of phosphorus in soil in connection
Krishnaraj PU, Goldstein AH (2001). Cloning of a Serratia marcescens with vital activity ofsome microbial species. Microbiol. 17: 362-370.
DNA fragment thatinduces quinoprotein glucose dehydrogenase- Prijambada I, Widada J, Kabirun S, Widianto D (2009). Secretion of
mediated gluconic acid production inEscherichia coli in the presence organic acids by phosphate solubilizing bacteria isolated from Oxisols
of stationary phase Serratia marcescens. FEMS Microbiol. Lett. J. Tanah Trop.14(3):245-251.
205:215-220. Rao IM, Barrios E, Amézquita E, Friesen DK (2004).Soil phosphorus
Kumar A, Bhargava P, Rai L (2010). Isolation and molecular character- dynamics, acquisition and cycling in crop-pasture fallow systems in
rization of phosphatesolubilizing Enterobacter and Exiguobacterium low fertility tropical soils: A review from Latin America CentroInter-
species from paddy fields of EasternUttar Pradesh. Afr. J. Biotechnol. nacional de Agricultura Tropical (CIAT), Canberra. Modelling nutrient
4:820-829. management in tropical cropping systems. ACIAR proceedings. pp.
Kumar V, Narula N (1999).Solubilization of inorganic phosphates and 126-134.
growth emergenceof wheat as affected by Azotobacter chroococcum Rashid M, Khalil S, Ayub N, Alam S, Latif F (2004).Organic acids
mutants.Biol. Fert. Soils 28:301-305. production andphosphate solubilization by phosphate solubilizing
León LA (1991). La experiencia La experiencia del centro internacional microorganisms (PSM) under invitro conditions. Pakistan J. Biol. Sci.
para el desarrollode fertilizantes en el uso de rocas fosfóricas en 7:187-196.
América Latina. Rev. Fac. Agron. 17:49-66. Rodriguez H, Fraga R (1999). Phosphate solubilizing bacteria and their
Leyval C, Berthelin J (1989). Interactions betweenLaccarialaccata, role in plant growth promotion. Biotech. Adv.17:319-339.
Agrobacteriumradiobacterand beech roots: Influence on P, K, Mg, Rudresh DL, Shivaprakash MK, Prasad RD (2005).Effect of combined
application ofRhizobium, phosphate solubilizing bacterium and Shirokikh IG, Zenova GM, Zvyagintsev DG (2002). Actinomycetes in the
Trichoderma spp. on growth, nutrient uptake and yield of chickpea Rhizosphere of Barley Grown on Acid Soddy Podzolic Soil. Microbiol.
(Cicer aritenium L.). Appl. Soil Ecol. 28:139-146. 71:455-459.
Rueda C, Aikawa M, Prada LD, Franco-Correa M, Martinez MA, Padilla Vassilev N, Vassileva M, Nikolaeva I (2006). Simultaneous P-
G (2009). Evaluación de la presencia del gen mer A implicado en la solubilizing and biocontrolactivity of microorganisms: potentials and
detoxificacion demercurio a partir de actinomicetos nativos del future trends. Appl. Microbiol. Biotechnol. 71:137-144.
humedal de La Conejera. Revista Colombiana de Biotecnología Whitelaw M (2000). Growth promotion of plants inoculated with
11:105-113. phosphate-solubilizingfungi. Adv. Agron. 69:99-151.
Saharan B, Nehra V (2011). Plant Growth Promoting Rhizobacteria: A Xu L, Li Q, Jiang C (1996). Diversity of soil actinomycetes in Yunnan,
Critical Review. Life Sci. Med. Res. 2011:LSMR-21. china. Appl. Environ. Microbiol. 62:244-248.
Sayed W, Mohaowad S, Abd El-Karim M (2000). Effect of Al, Co, and Zapata F, Roy R (2007).Utilización de rocas fosfóricas para agricultura
Pb ions on growthof Frankia spp. in a mineral medium. Folia sostenible. Boletin FAO No 13, Roma. 156.
Microbiol. 45:153-156.
Vol. 8(8), pp. 743-749, 19 February, 2014
DOI: 10.5897/AJMR2013.5953
Establishment of EvaGreen qPCR for detecting bovine

rotavirus based on VP7 gene
Wei Suocheng1*, Che Tuanjie2, Wang Jingming3, Li Yukong3, Zhang Taojie1, Song Changjun1
and Tian Fengling1
1
Life Science and Engineering College, Northwest University for Nationalities, Lanzhou 730030, China.
2
Lanzhou Baiyuan Company for Gene Technology, Lanzhou 730000, China.
3
Lanzhou Veterinary Research Institute of Chinese Academy of Agricultural Sciences, Lanzhou 730030, China.
4
Agriculture Bureau of Yuzhong County, Lanzhou 730100, China.
The aim of the present study was to establish a method of EvaGreen real time fluorescence quantitative
polymerase chain reaction (qPCR) for detecting quickly bovine rotavirus (BRV) in fecal samples from
calves with diarrhea. The specific primers were designed and synthesized according to BRV VP7 gene in
Genbank. VP7 gene was cloned into the pMD18-T vector. The bovine viral diarrhea virus, bovine
coronavirus, porcine epidemic diarrhea virus, bovine mycobacterium tuberculosis and negative control
were detected with qPCR. Plasmids in five 10-fold gradients were detected using qPCR. The results
show that a EvaGreen qPCR was established in the present study. Only BRV displayed amplification
curve; cross-reactivity between BRV and the other viruses or bacteria was not observed. The
amplification curve of pMD18-T vector plasmid (diluted in 10-1 to 103 gradient) was typical S shape. The
detection limit of qPCR was 8.0 copies/μL, namely 100 plasmid concentrations. The coefficients of
variation in both intra-assay and inter-assay was less than 2%. The established EvaGreen qPCR had a
high specificity, sensitivity and reproducibility. It can be applied to clinical diagnosis and
epidemiological surveys of BRV.
Key words: Rotavirus, VP7 gene, evagreen, real-time quantitative PCR, bovine.
INTRODUCTION
Neonatal calf diarrhea is a common disease affecting the countries (Abe et al., 2009). Even in developed countries,
newborn calf worldwide, threatening the cattle production rotavirus remains an important cause of morbidity.
along with significant morbidity and mortality and inducing Rotaviruses possess 11 segments of double-stranded
severe economic losses (Wei, 2011). Group A rotaviruses ribonucleic acid (dsRNA) and two outer capsid proteins:
(RVA) are known to be important viral diarrheal agents in VP4 (encoded by gene segment 4) and VP7 (encoded by
infants and young animals, including calves. gene segment 7, 8 or 9 depending on the strain), both of
The numbers of the rotavirus-associated mortality are which are independently responsible for virus neutrali-
estimated to be 453,000 in 2008 (Tate, 2012; 2013). The zation (Estes, 2001). RVA strains are antigenically hetero-
numbers of deaths is particularly high in developing geneous, and are classified in multiple G and P types de-
*Corresponding author. E-mail: [email protected]. Tel: +0086-931-2937773.

fined by VP7 and VP4 outer capsid proteins (Papp et al., more sensitive for the detection and quantification of
2013). The neutralization specificity related to VP7 is rotavirus (Mackay et al., 2002; Kang et al., 2004; Pang et
referred to as the G serotype (for glycoprotein), and that al., 2004). EvaGreen (EG) is a novel DNA-binding dye. It
associated with VP4 is referred to as the P serotype (for has been reported to be used for DNA quantification, DNA
protease-sensitive protein) (Anthony et al. 1999). conformation detection quantitative PCR (Ihrig et al., 2006).
Currently, group A rotavirus has been classified into at Currently, very little research of Evagreen Real-time
least 15 G serotypes (G1-G15) and 21 P genotypes Quantitative PCR (qPCR) is performed for detection of
(P1-P24) (Ram, 2004). With regard to bovine, at least BRV (Ihrig et al., 2006). Currently, very little research of
nine G serotypes (G1-4, 6-8, 10, 11) and three P Evagreen Real-time Quantitative PCR (qPCR) has been
genotypes have been found so far (Santos and Hoshino, performed for detection of bovine rotavirus (BRV) (Gouvea
2005; Papp et al., 2013). Feray et al. (2010) reported G6 et al., 1990; Mohan et al., 2006). It has not been applied in
was the predominant G-type, detected in 40/53 samples detecting bovine rotavirus in China. The aim of the pre-
(75.4%), while P[11] was the predominant P-type, detected sent study was to establish EvaGreen Real-time Quanti-
in 52/53 samples (98.1%). The most common VP7/VP4 tative PCR (qPCR) for detecting BRV VP7 gene in fecal
combinations were G6P[11] (60.3%) and G10P[11] samples.
(24.5%). A similar finding was reported by Swiatek et al.
(2010). Our study found that G6 and G10 serotypes were
29 (54.7%) and 8 (15.1%) in positive samples for VP7. MATERIALS AND METHODS
The main combinations of BRV G serotype and P Fecal samples
genotype were G6P[5] (28.3%) (Wei et al., 2013).
VP7 and VP4 proteins elicit the production of neutralizing Fecal samples were collected from 62 calves with diarrhea that were
antibodies, define the antigenic specificities, referred to as one to thirty days old and located on dairy farms in Lanzhou (26
G type and P type, respectively, and are the major samples), Qingyang cities (19 samples) and Gannan autonomous
prefecture (17 samples) of Gansu province of China, from Novem-
antigens neutralizing immune responses during rotavirus
ber 2010 to April 2011. TRIzol (a nucleic acid extraction reagent;
infections (Aminu et al., 2010). Rotavirus VP7 gene is Invitrogen, Beijing, China) was added to the collection tube in
highly conservative at both ends of open reading frame advance. All fecal specimens were stored at -20°C until further use.
(ORF), such it is feasible to detect rotavirus serotypes A 10% suspension of each fecal sample was prepared in phosphate
utilizing the rotavirus specific primers. VP7 has been shown buffered saline (PBS), pH 7.2 and centrifuged at 4,000 g for 15 min
to be involved in the early interactions with cell-surface at 4°C. The supernatants of 62 fecal samples were subjected to
ELISA for detecting the presence of RV with commercially rotavirus
molecules, during the rotavirus entry process (Lopez and
detection kits (Lanzhou Institute of Biological Products Company,
Arias, 2006; Martha et al., 2012). Moreover, PCR can be Lanzhou, China) and following the protocol of the manufacture
used to detect rotavirus VP7 not only stool specimens instructions. The results were interpreted by using the OD values
also cerebrospinal fluids and sera (Hiroshi et al., 1994). obtained at 450 nm with ELISA reader (BioTec, Dresden, Germany).
Currently many methods (including polymerase chain All positive samples from ELISA were used for the subsequent
reaction, PCR) are available for detecting rotavirus, espe- experiments. Fecal supernatants were stored at 4°C.
cially VP6 antigen (Luan et al., 2006; Gutierrez-Aguirre et al.,
2008; Zhu et al., 2011; Fan et al., 2011). Unfortunately, PCR Primers designs and synthesis
assays require sophisticated equipment, which is costly to
maintain, and must be performed in specialized labora- For qPCR, based on the deposited genome sequences of BRV VP7
tories (Xie et al., 2012). So far, little information regarding in GenBank (accession number No. GQ433985), specific primers
were designed using Primer Premier 5.0 software according to the
real-time quantitative PCR (qPCR) utilized to detect RV highly conserved regions: Forward:
VP7 antigen has been known. The real-time quantitative 5’-GTATGGTATTGAATATACCAC-3’ (nts 51-71 of GQ433985).
PCR (qPCR) methods are not only fast and accurate, and Reverse: 5’-GATCCTGTTGGCCATCC-3’ (nts 376-392 of
also can test against different target sequences. Its speci- GQ433985). The length of predicting product is 342 bp. The concen-
ficity is very high (Okada and Matsumoto, 2002; Santos and trations of primers (100, 200, 300 and 500 nM) were evaluated. The
formation of primer-dimers was assessed by melting curve analysis.
Hoshino, 2005). Quantitative PCR (qPCR), also known as
Thus, only those concentrations of primers that showed
real-time PCR, has become a powerful tool for the ampli- dimer-free reactions were used for the final analysis. Primers were
fication, identification and quantification of nucleic acids. synthesized from Takara Bio, Dalian, China.
Its ability to quantitatively and specifically detect genes
has been invaluable for both research and diagnostic
applications (Schweitzer and Kingsmore, 2001). The qPCR Cell cultures
using a simple DNA dye is a popular choice among The neonatal calf diarrhea virus (NCDV) strain (AV-51, purchased
academic laboratories for PCR experiments (Bustin, from Chinese Veterinary Drugs Supervisor Institute, Beijing, China)
2002). Compared to conventional reverse transcript PCR and ELISA positive fecal samples were inoculated to single layer
(RT-PCR), qPCR has been shown to be more rapid and MA-104 cells as described previously (Wei et al., 2010). The cells
Suocheng et al. 745
were cultured for 3-4 days at 37°C. The process ended when the (PEDV) and bovine mycobacterium tuberculosis (provided by
cytopathogenic effect (CPE) was higher than 90%. Then, the cells Lanzhou Veterinary Research Institute, Chinese Academy of
were frozen and thawed 2 to 3 times. The viral supernatant was agricultural sciences, Lanzhou, China), respectively. RNA was
collected for RNA extraction or stored at -80°C until processed. reverse transcribed. RNA templates were amplified with the
established qPCR. Meanwhile, the negative control was detected.
Meanwhile, the negative control was set.
RNA extraction and cDNA synthesis
According to the manufacturer’s instructions, total RNA was extrac- Sensitivity tests
ted from the viral supernatants of the neonatal calf diarrhea virus
(NCDV) strain (AV-51) and fecal samples using the TRIzol RNA The plasmids were diluted on the serial 10-fold dilutions (103, 102,
extraction kit (Invitrogen, Beijing, China). 101, 100 and 10-1 gradients) and detected with the established qPCR
Briefly, PCR was performed in a 25 μL volumes that included 15.5 to evaluate the sensitivity of qPCR.
μL diethylpyrocarbonate (DEPC) water, 0.5 μL (10 mM) deoxyribo-
nucleotide triphosphate (dNTPs), 2.5 μL 10×PCR buffer, 0.5 μL Tag
enzyme. 0.5 μL BRVF primer, 0.5 μL BRVR and 5 μL cDNA. The Stability
PCR products were electrophoresed on 1.5% agarose gel (Amresco,
USA) containing 1×Gel Red (BIOTIUM, Hayward, CA, U.S.A.) and For the intra-assay variability, the plasmids in 5 dilution gradients
subsequently analyzed with the software CS Analyzer Ver 3.0 (10-4, 10-3, 10-2 and 10-1) were detected using qPCR. The test was
(ATTO, Tokyo, Japan). repeated thrice. The copy numbers, mean, standard deviation and
The cDNA was synthesized from the NCDV strain and extracted variation coefficient (CV) were calculated from the standard curve
viral RNA by reverse transcription reaction and used for PCR for each dilution gradients.
amplification of the VP7 gene. The expected amplicons were 342 bp For inter-assay variability, the plasmids in 5 dilution gradients
sizes. were detected with the qPCR for three times every three days. The
copy numbers, average, standard deviation and variation coefficient
Preparation of plasmid standard template were also calculated as the methods mentioned above.
The amplified VP7 cDNA fragments were cloned into pMD18-T

Fecal sample detection
vectors. Then, pMD18-T vectors were sequenced and validated.
The positive plasmids were quantitatively measured using the
To evaluate the diagnostic efficacy of qPCR assay, cDNAs of 62
optimized reaction conditions to establish a standard curve with the
fecal samples were detected using the established qPCR. The
logarithm values of template starting copy number as the horizontal
findings were compared with that of ELISA method to verify the
axis and Ct values as the vertical axis. The positive plasmids were
coincidence rate of two methods.
used as standards (pMD-VP7), which were serially diluted 10-fold
gradient to 4.0×10-1, 4.0×100, 4.0×101, 4.0×102 and 4.0×103 (copies/μL).
RESULTS
EvaGreen Real-time Quantitative PCR (qPCR)
Screening of fecal samples by ELISA
The qPCR was performed in a 50 μL reaction systems, which
consisted of 25 μL EvaGreen qPCR Master Mix (Chaoshi The screening of 10% suspension of 62 fecal samples
biotechnology company, Shanghai, China), 1 μL BRVF Primer (10 indicated that 12 fecal samples were positive for BRV,
μM), 1 μL BRVR primers (10 μM), 5 μL cDNA and 18 μL deionized with a prevalence rate of 19.36%.
water. The experiment Detector was set to SYBR, and the Quencher
was set to None. The conditions for qPCR were as follows: initial
denaturation at 95°C for 15 min followed by 40 cycles of 94°C for 15 Amplification of BRV VP7 gene
s, 55°C for 30 s and 72°C for 40 s, and a final extension at 72°C for
10 min. The qPCR was done in ABI quantitative PCR instrument As shown in Figure 1, a predicted 342 bp band was found
(ABI PRISM 7300 type, Applied Biosystems incorporation, USA). in agarose gel electrophoresis. The result testified they
are group A BRV.
Establishment of the standard curve for qPCR
Dynamics curve and the standard curve of qPCR
The 10-fold diluted plasmid standards (4.0×10-1, 4.0×100, 4.0×101,
4.0×102 and 4.0×103 copies/μL) were detected quantitatively using
qPCR assay. Such the standard curve had been established with
The reaction conditions of qPCR were optimized. The
the logarithmic values of the starting copies as the horizontal axis (X) optimum reaction conditions were as follows: initial
and Ct values as the vertical axis (Y). denaturation for 15 min at 95°C, denaturation for 15 s at
95°C, annealing for 30 s at 55°C, elongation for 40 sat
72°C, by 40 cycles, and a final elongation of 10 min at 72°C.
Specificity tests The dynamics curve of qPCR was acquired (Figure 2).
The recombinant plasmids (pMD-VP7) in five 10-fold
To examine the analytical sensitivity, the RNA was extracted from
the viral supernatants of BRV stools, bovine viral diarrhea virus gradients from 4.0×10-1 to 4.0×103 were detected using
(BVDV), bovine coronavirus (BCV), porcine epidemic diarrhea virus the optimized qPCR reactions, respectively. Ct values were
had an excellent specificity. It can be applied to detect

diarrhea sample clinically.
Sensitivity test results
The plasmids in five dilution gradients were detected with

the established qPCR (Figure 5).
The amplification curve of pMD-VP7 plasmid (diluted in
10-1～103 gradient) was typical S shape with an excellent
appearance. Ct values were 28.55, 24.42, 2.067, 17.42 and
14.48, respectively. The corresponding copy numbers
-3 2 1 0
were 1.80×10 , 4.11×10 , 6.21×10 , 8.03×10 and
-1
9.68×10 , respectively. Therefore, the detection limit of
qPCR was 8.0 copies/μL, namely 10-0 plasmid concentration.
Stability test results

Figure 1. Amplification of BRV in agarose gel
electrophoresis. The predicted 342 bp band was
found. 1: blank control; 2 and 3: extracted total RNA
As shown in Table 1, the variation coefficients (CV) of
from fecal samples; 4: marker. intra-assay reproducibility and inter-assay reproducibility
were 1.0-1.1 and 1.7-2.0, respectively, which demonstra-
ted the qPCR assay was stable and reliable.
Detection results of fecal samples
Detection results of fecal samples showed that 10 (all of

which were positive for ELISA) out of 62 fecal samples
were found positive for BRV by qPCR. The coincidence
rate of qPCR and ELISA was 83.3%. qPCR had a higher
sensitivity and specificity.
DISCUSSION
Figure 2. The dynamics curve of qPCR.
Real-time PCR can be carried out using either probes or
DNA dyes (Higuchi et al., 1993; Wilhelm and Pingoud,
2003; Anne, 2011). SYBR Green exhibits a very strong
28.55, 24.42, 20.67, 17.42 and 14.48 respectively. Such,
fluorescent signal, but it has been shown to inhibit the
the standard curve was established (Figure 3). The slope,
2 PCR reaction and has a narrow dynamic range and lower
intercept and correlation coefficient (R ) of the standard
reproducibility than other detection chemistries (Gudnason
curve were -3.574, 31.77 and 0.997 respectively,
et al., 2007). EvaGreen is another DNA dye which is less
indicating a strong linear relationship. Gene amplification
inhibitory to PCR than SYBR Green and is marketed as
efficiency (E) equalled to (1.91-1) x100%=91%. Such, the
an alternative. EvaGreen dye performed better than
regression equation was expressed as Y=-3.574 LogX
SYBR Green in general, and high reaction efficiencies
+31.77. It can be calculated that Ct value equated to
can be achieved using the dye. In cases where template
31.77-3.574X.
sequence tends to vary, dye-based detection helps
prevent false negatives that might result from base pair
Specificity test results mismatches in a sequence-specific probe binding region
(Anderson et al., 2003; Papin et al., 2004). It has recently
As can be seen from Figure 4, the optimized rotavirus been used for quantitative real-time PCR (qPCR),
qPCR assay was tested against other viruses and post-PCR DNA melt curve analysis and several other
bacteria, which included BCoV, PEDV and MB, in order to applications (Mao et al., 2007). So far, it has not been
demonstrate the specificity of the assay. The results show reported that qPCR is utilized to detect bovine rotavirus in
only BRV displayed amplification curve, the cross- China. The present study was to develop a higher
reactivity between BRV and other viruses or bacteria was specificity and sensitivity method for detecting BRV VP7
not observed. It indicated the established qPCR assay gene in fecal samples using EvaGreen dye.
Suocheng et al. 747
Figure 3. The standard curve of qPCR. The slope, intercept and correlation coefficient (R2)
of the standard curve were -3.574, 31.77 and 0.997 respectively, indicating a strong linear
relationship.
Figure 4. Specificity of qPCR assay. BRV displayed amplification curve, the

cross-reactions between bovine rotavirus and other viruses: BVDV, bovine viral
diarrhea virus; BcoV, bovine coronavirus; PEDVPEDV, porcine epidemic diarrhea
virus or bacteria bovine; MB, mycobacterium tuberculosis and negative control were
not observed, indicating a high specificity for qPCR assay.
Figure 5. Sensitivity of qPCR assay. M, 100bp DNA Marker; 1-2, padding

and negativie control; 3-7, the 10-fold serial plasmid dilutions (103 , 102, 101,
100 and 10-1 gradients).
Table 1. Intra-assay and Inter-assay reproducibility test of qRT-PCR.
Dilution gradient of n Intra-assay reproducibility Inter-assay reproducibility

Standard plasmid*
X  SD CV(%) X  SD CV(%)
10-1 3 15.1±0.6 1.0 16.3±0.7 1.7
-2
10 3 18.4±0.7 1.0 19.4±0.9 2.0
-3
10 3 21.5±0.6 1.1 21.1±0.9 1.9
10-4 3 26.1±0.7 1.0 26.0±0.9 2.0
Note: * Copy /μL
In the present research, a 342 bp VP7 gene of BRV was 73(9): 7574-7581.
Bustin SA (2002). Quantification of mRNA using real-time reverse
amplified from fecal samples with RT-PCR. qPCR has
transcription PCR (RT-PCR): trends and problems. J. Mol. Endocrinol.
been developed for determining BRV VP7 gene. The 29(1): 23-39.
quantities of RNA in qPCR ranged between 8.03×100 and Estes MK (2001). Rotaviruses and their replication. In Fields virology
-3
1.80×10 copies per reaction. The established qPCR was Knipe DM, Howley PM eds). Lippincott-Roven Publishers,
high specificity, sensitivity and stability. However, because Philadelphia, 1747-1785.
Fan Q, Xie ZX, Lie JB, Peng YS, Deng XW, Xie ZQ, Xie LJ, Peng Y
of inadequate conditions and detection of small samples, (2011). Detection of bovine rotavirus by TaqMan based Real-time
the specificity of the experimental methods and result reverse transcription polymerase chain reaction assay. China Anim.
repetition need to be improved in the future. In addition, Husbandry Vet. Med. 38:105–108.
Feray A, Aykut O, Tuba CO, Mehmet OT, Elvin C, Vito M, Ibrahim B
BRV Kit has not been developed (Luan et al., 2006; Wei
(2010). Distribution of G (VP7) and P (VP4) genotypes of group A
et al., 2010). The human ELISA Kit was used in this study. bovine rotaviruses from Turkish calves with diarrhea, 1997–2008. Vet.
The coincidence rate of qPCR and ELISA in our findings Microbiol. 141:231–237.
needs to be investigated further. Gouvea V, Glass RI, Woods P, Taniguchi K, Clarke HF, Forrester B,
Fang ZY (1990). Polymerase chain reaction amplification and typing
It is concluded that the qPCR using EvaGreen dye is a of rotavirus nucleic acid from stool specimens. J. Clin. Microbiol.
rapid, sensitive and stable method for the detection of 28:276-282.
BRV VP7 gene. The qPCR has a low risk of contamination Gudnason H, Dufva M, Bang DD, W olff A (2007). Comparison of multiple
and is less time and manpower consuming than con- dyes for real-time PCR: effects of dye concentration and sequence
ventional RT-PCR. It could be used for clinical diagnosis composition on DNA amplification and melting temperature. Nucleic
Acids Res. 35(19): e127
and epidemiological survey of bovine rotavirus. Gutierrez-Aguirre I, Steyer A, Boben J, Gruden K, Poljsak-Prijatelj M,
Ravnikar M (2008). Sensitive detection of multiple rotavirus genotypes
with a single reverse transcriptionreal-time quantitative PCR assay. J.
ACKNOWLEDGEMENTS Clin. Microbiol. 46:2547–2554.
Higuchi R, Fockler C, Dollinger G, Watson R (1993). Kinetic PCR
The work was supported by the science and technology analysis: real-time monitoring of DNA amplification reactions. Bio.
program project in Gansu province of China in 2007 Technol. 11:1026-1030.
Hiroshi U, Keqin X, Shuichi N, Shigeru M, Toshiaki A (1994). Detection
(Grant No: 0708NKCA079 and the research and and Sequencing of Rotavirus VP7 Gene from Human Materials
application project of agricultural biotechnology in Gansu (Stools, Sera, Cerebrospinal Fluids, and Throat Swabs) by Reverse
province (Grant No: GNSW-2010-10). Transcription and PCR. J. Clin. Microbiol. 32(12): 2893-2897.
Ihrig J, Lill R, Muhlenhoff U (2006). Application of the DNA-specific dye
EvaGreen for the routine quantification of DNA in microplates. Anal.
REFERENCES Biochem. 359(2):265-267.
Kang G, Iturriza-Gomara M, Wheeler JG, Crystal P, Monica B, Ramani S,
Abe M, Ito N, Morikaw S, Takasu M, Murase T, Kawashima T, Kawai Y, Primrose B, Moses PD, Gallimore CI, Brown DW, Gray J (2004).
Kohara J, Sugiyama M (2009) Molecular epidemiology of rotaviruses Quantitation of group A rotavirus by real-time
among healthy calves in of a novel bovine rotavirus bearing new P reverse-transcription-polymerase chain reaction: correlation with
and G genotypes. Virus Res. 144: 250-257 clinical severity in children in South India. J. Med. Virol. 73, 118-122.
Aminu M, Page N A, Ahmad AA, Umoh JU, Dewar J, Steele AD (2010). Lopez S, Arias CF. (2006) Early steps in rotavirus cell entry. Curr Top
Diversity of Rotavirus VP7 and VP4 Genotypes in Northwestern Microbiol Immunol 309:39–66.
Nigeria. JID. 202 (Suppl 1): S198-S204. Luan J, Yang S, Zang W, Gao Y, Zhong J, Zhao H (2006). Rapid
Anderson TP, Werno AM, Beynon KA, Murdoch DR (2003). Failure to detection of bovine rotavirus with semi2nested RT2PCR assay.
genotype herpes simplex virus by real-time PCR assay and melting Chinese J. Zoonoses. 22(7): 671-674.
curve analysis due to sequence variation within probe binding sites. J. Mackay IM, Arden KE, Nitsche A (2002). Real-time PCR in virology.
Clin. Microbiol. 41(5): 2135-2137. Nucleic Acids Res. 30: 1292-1305.
Anne CE (2011). SYTO dyes and EvaGreen outperform SYBR Green in Mao F, Leung WY, Xin X (2007). Characterization of EvaGreen and the
real-time PCR. BMC Res. Notes. 4: 263-271. implication of its physicochemical properties for qPCR applications.
Anthony HC, Choi MB, Monica MM (1999). Antibody-Independent BMC Biotechnol. 7:76-82.
Protection against Rotavirus Infection of Mice Stimulated by Martha NC, Fanny G, Orlando A, Carlos AG (2012). Rotavirus VP4 and
Intranasal Immunization with Chimeric VP4 or VP6 Protein. J. Virol. VP7-Derived Synthetic Peptides as Potential Substrates of Protein
Suocheng et al. 749
Disulfide Isomerase Lead to Inhibition of Rotavirus Infection. Int. J. Tate JE, Steele AD, Bines JE, Zuber PL, Parashar UD (2012). Research
Pept. Res. Ther. 18:373–382 priorities regarding rotavirus vaccine and intussusception: a meeting
Mohan S, Manoharan P, Pachaikani R (2006). Genotyping of rotavirus of summary. Vaccine. 30 (Suppl 1):A179-84.doi:
neonatal calves by nested-multiplex PCR in India. Veterinarski Arhiv. 10.1097/INF.0b013e31828d639c.
76 (6): 497-505. Tate JE, Haynes A, Payne DC, Cortese MM, Lopman BA, Patel MM,
Okada N, Matsumoto Y (2002). Bovine rotavirus G and P types and Parashar UD (2013). Trends in national rotavirus activity before and
sequence analysis of the VP7 gene of two G8 bovine rotaviruses from after introduction of rotavirus vaccine into the national immunization
Japan. Vet Microbiol. 84: 297-305. program in the United States, 2000 to 2012. Pediatr Infect Dis J.
Pang XL, Lee B, Boroumand N, Leblanc B, Preiksaitis JK, Yu ICC (2004). 32(7):741-4.
Increased detection of rotavirus using a real time reverse transcription Wei Suocheng, FENG Ruofei, GONG Zhuandi, TIAN Fengling (2010).
polymerase chain reaction (RT-PCR) assay in stool specimens Researches of Isolation and Cell Cultivation of Bovine Rotavirus in
fromchildren with diarrhea. J. Med. Virol. 72: 496-501. Vero and MA-104 Cells. J. Northwest University for Nationalities.
Papin JF, Vahrson W, Dittmer D (2004). SYBR Green-based real-time 31(4):71-75.
quantitative PCR assay for detection of West Nile virus circumvents Wei S, Gong Z, Che T, Ayimu G, Tian F (2013). Genotyping of calves
false-negative results due to strain variability. J. Clin. Microbiol. rotavirus in China by reverse transcription polymerase chain reaction.
42(4):1511-1518. J. Virol. Methods 189(1):36– 40
Papp H, László B, Jakab F, Ganesh B, De Grazia S, Matthijnssens Wei Z, Jianbao D, Takeshi H, Yoshitaka G, Masuo S (2011). Rapid and
J, Ciarlet M, Martella V, Bányai K (2013). Review of group A rotavirus Sensitive Detection of Bovine Coronavirus and Group A Bovine
strains reported in swine and cattle. Vet. Microbiol. 165(3-4):190-199. Rotavirus from Fecal Samples by Using One-Step Duplex RT-PCR
Ram IG (2004). Pathogenesis of intestinal and system in rotavirus Assay. J. Vet. Med. Sci. 73(4): 531-534.
infection. J. Virol. 78:10213-10220. Xie Z, Fan Q, Liu J, Pang Y, Deng X, Xie Z, Xie L, Khan MI (2012).
Santos N, Hoshino Y (2005). Global distribution of rotavirus serotypes/ Reverse transcription loop-mediated isothermal amplification assay
genotypes and its implication for the development and implementation for rapid detection of Bovine Rotavirus. BMC Vet. Res. 8:133-137.
of an effective rotavirus vaccine. Rev. Med. Virol. 15: 29-56. Zhu W, Dong J, Haga T, Goto Y, Sueyoshi M (2011). Rapid and
Schweitzer B, Kingsmore S (2001). Combining nucleic acid amplification sensitive detection of bovine coronavirus and group a bovine rotavirus
and detection. Curr. Opin. Biotechnol. 12(1):21-27. from fecal samples by using one-step duplex RT-PCR assay. J. Vet.
Swiatek DL, Palomboc EA, Leed A, Coventryd MJ, Britza ML, Kirkwooda Med. Sci. 73:531–534.
CD (2010). Detection and analysis of bovine rotavirus strains
circulating in Australian calves during 2004 and 2005. Vet. Microbiol.
140: 56–62.
Vol. 8(8), pp. 750-758, 19 February, 2014
DOI: 10.5897/AJMR2013.6351
Nutritional requirements for the production of

antimicrobial metabolites from Streptomyces
Mariadhas Valan Arasu1,2*, Thankappan Sarasam Rejiniemon3, Naif Abdullah Al-Dhabi4,
Veeramuthu Duraipandiyan1,4, Savarimuthu Ignacimuthu1, Paul Agastian1,5, Sun-Ju Kim6,
V. Aldous J. Huxley3, Kyung Dong Lee7, Ki Choon Choi2*
1
Division of Microbiology, Entomology Research Institute, Loyola College, Chennai, India.
2
Grassland and forage division, National Institute of Animal Science, RDA, Seonghwan-Eup, Cheonan-Si, Chungnam,
330-801, Republic of Korea.
3
Department of Zoology, Thiru Vika Government Arts College, Thiruvarur - 610 003, Tamil Nadu, India.
4
Department of Botany and Microbiology, Addiriyah Chair for Environmental Studies, College of Science, King Saud
University, Riyadh, Saudi Arabia.
5
Department of Plant Biology and Biotechnology, Loyola College, Chennai, India.
6
Department of Bio-environmental Chemistry, Chungnam National University, 99 Daehak-Ro, Yuseong-Gu, Daejeon
305-764, Republic of Korea.
7
Department of Oriental Medicine Materials, Dongsin University, Naju, Korea.
The objective of this study was to optimize the nutritional and cultural conditions of Streptomyces
strain ERI-1, ERI-3 and ERI-26 for the production of antimicrobial metabolites under shake-flask
conditions. Effect of eight fermentation medium, different temperature, pH, incubation time, different
carbon and nitrogen sources and different concentration of sodium chloride on production of
antimicrobial metabolites were studied. Antimicrobial activity of the fermentation medium was
evaluated by cup plate method by measuring the zone of inhibition. Nutritional and cultural conditions
for the production of antimicrobial metabolites by Streptomyces strain ERI-1, ERI-3 and ERI-26 under
shake-flask conditions have been optimized. Modified nutrient medium was found to be good base for
fermentation. Glucose and ammonium nitrate were identified as best carbon and nitrogen sources,
respectively for growth and production of more antimicrobial compounds. Similarly, initial production
medium pH of 7.0, incubation temperature of 30°C and incubation time of 96 h was found to be optimal.
Optimization of medium and cultural conditions resulted in better antibacterial and antifungal activity.
The zone of inhibition of ERI-26 against Aspergillus niger was 25 and 20 mm for Curvularia lunata,
respectively. It is clear that novel Stretomyces strains ERI-1, ERI-3 and ERI-26 produced extra cellular
antimicrobial metabolites effective against pathogenic bacteria and fungi, moreover the medium and
cultural conditions for better antimicrobial metabolites production have been optimized.
Key words: Streptomyces, antimicrobial activity, nutritional requirements, cultural conditions, optimized media.
INTRODUCTION
Streptomycetes are potent producers of secondary al., 2000). Secondary metabolites produced by them
metabolites. Among 10000 known antibiotics, 45-55% is have a broad spectrum of biological activities such as
produced by Streptomycetes (Demain, 2006; Lazzarini et antibacterial (streptomycin, tetracycline, chloramphenicol),
*Corresponding author. E-mail: [email protected].

Arasu et al. 751
antifungal (nystatin), antiviral (tunicamycin), antiparasitic mL fermentation broth medium and incubated on a rotary shaker at
(avermectin), immunosuppressive (rapamycin), antican- 200 rpm, 30°C for 24 h. After that 10% of inoculum was transferred
to production medium containing 100 mL of fermentation medium in
cer (actinomycin, mitomycin C, anthracyclines), enzyme
500 mL Erlenmeyer flask. Different culture conditions like tempera-
inhibitors (clavulanic acid) and diabetogenic (bafilomycin, tures (20, 25, 30, 37 and 45°C), pH (6.0, 6.5, 7.0, 7.5, 8.0 and 8.5)
streptozotocin). and incubation time (24, 48, 72, 96, 120 and 144 h) were studied to
Secondary metabolite production in microbes is strongly standardize the antibiotic production. Effect of different carbon
influenced by nutritional factors and growth conditions. A source and nitrogen source for growth and antimicrobial compound
common strategy, widely applied in industrial screening production in fermentation medium were evaluated. Different con-
centrations of sugar for production of antimicrobial compound and
programs, consists of the application of several growth growth were also studied. Influence of different concentrations of
conditions (including variables such as production media, sodium chloride in production medium was studied.
incubation time and other factors) to different strains
which has been studied (Vilella et al., 2000). There is
strong evidence that this approach improves the chances Antibacterial assay
of finding the desired metabolites (Lauren and Yit-Heng, Test organism
2011; Arasu et al., 2013). Considering that any screening
program of microbial natural products can handle a limi- The following test organisms were used for antibacterial studies:
ted number of fermentations, applying many growth Staphylococcus aureus (ATCC 25923), Staphylococcus epidermidis
(MTCC 3615), Bacillus subtilis (MTCC 441), Enterococcus faecalis
conditions to each strain may critically restrict the number
(ATCC 29212), Escherichia coli (ATCC 25922), Pseudomonas
of strains and therefore the diversity of biosynthetic path- aeruginosa (ATCC 27853), Klebsiella pneumoniae (ATCC 15380),
ways included in the screening. As a compromise bet- Proteus vulgaris (MTCC 1771), Erwinia sp. MTCC (2760),
ween these two requirements, a number of conditions are Xanthomonas sp., Vibrio fischeri (MTCC 1738) and Salmonella
usually applied to each strain (Wildmans, 1997). Further- typhi (MTCC 733). All cultures were obtained from Department of
more, without prior knowledge about the preferred growth Microbiology, Christian Medical College, Vellore, Tamil Nadu, India.
Each bacterial strain was inoculated in 3 mL of Mueller Hinton broth
conditions for a given microorganism, random assign- and incubated at 37°C for 24 h. After incubation period the culture
ment of media to strains may generate an inefficient was diluted.
redundancy of metabolites or extracts lacking relevant
levels of secondary metabolites. The production of secon- Fungal strains
dary metabolites is affected by the availability of nutrients
The following fungi were used for experiments: Trichophyton
(Valanarasu et al., 2010). In fermentation experiments, rubrum (MTCC 296), Trichophyton rubrum (57/01), Trichophyton
the production of antibiotics is increased by the presence mentagrophytes (66/01), Trichophyton simii (110/02),
of a non preferred carbon source, or by other nutrients Epidermophyton floccosum (73/01), Scopulariopsis sp. (101/01)
(Mohd et al., 2012). The source and availability of nitro- Aspergillus niger (MTCC 1344), Botyritis cinerea, Curvularia lunata
gen can also influence the production of secondary meta- (46/01) and Candida albicans (MTCC 227).
bolites (Arasu et al., 2008; Arasu et al., 2009).
In our screening programme for isolation and identi- Preparation of fungal spore
fication of actinomycetes from Westen Ghats of Tamil
Nadu for antimicrobial metabolite production, we isolated The filamentous fungi were grown on Sabouraud dextrose sgar
367 actinomycetes from different parts of the forest soil (SDA) slants at 28°C for 10 days and the spores were collected
using sterile doubled distilled water and homogenized. Yeast was
samples. Actinomycetes recovered from Kanyakumari grown on Sabouraud dextrose broth at 28°C for 48 h.
showed significant activity against most of the tested bac-
teria and fungi (Arasu et al., 2013). Among the different
actinomycetes; ERI-1, ERI-3 and ERI-26 isolates from the Cup plate method
Western Ghats region of Kanyakumari District revealed
Antibacterial assays
significant activity against all the tested bacteria and fungi.
This study focused on optimizing nutrition and cultural Antibacterial activities were assayed by the agar diffusion method
conditions of Streptomyces strain ERI-1, ERI-3 and ERI- by Arasu et al. (2013). Petri plates were prepared with 20 mL of ste-
26 for the production of antimicrobial metabolites under rile Mueller Hinton Agar (MHA) (Hi-media, Mumbai). The test cul-
the shake-flask condition. tures (100 µL) of suspension containing 108 CFU/mL bacteria) were
swabbed on the top of the solidified media and allowed to dry for 10
min. 5 mm diameter well was made using sterile cork borer and
MATERIALS AND METHODS filled with 0.05 mL of supernatant of ERI-1, ERI-3 and ERI-26. The
plates were left for 30 min at room temperature for supernatant
Fermentation medium diffusion. Negative control was prepared using the respective fer-
mentation medium. The plates were incubated for 24 h at 37°C. A
Fermentations were carried out using eight different antimicrobial zone of inhibition was recorded in millimeters and the experiment
compound production medium; GEN medium (M-1), Streptomyces was repeated twice.
medium (M-2), Micromonospora medium (M-3), nutrient glucose
medium (M-4), Bennett medium (M-5), starch with a mineral salt Antifungal assays
solution medium (M-6), complex medium (M-7) and starch casein
medium (M-8). A loopful of a selected strain was inoculated into 50 Antifungal assay was done by agar diffusion method. Petri plates
Table 1. Effect of production of antimicrobial metabolites on different media.
Inhibition zones in mm
Fermentation medium
B.s S.a S.e E.f E.c P.a K.p X.sp. E.sp. S.t V.f P.v C.a
ERI-1
Medium -1 12 10 10 14 10 10 9 9 12 10 10 13 10
Medium – 2 10 12 12 12 10 10 - - - - - - -
Medium – 3 12 10 23 10 11 10 10 - - - - - -
Medium – 4 14 12 14 15 14 11 10 10 12 10 10 10 14
Medium – 5 10 12 15 - - - - - - - - - 10
Medium – 6 12 13 10 12 10 10 10 12 12 11 10 - -
Medium – 7 10 14 - - - - - - - - - - -
Medium – 8 12 12 10 10 10 10 12 11 12 10 9 9 12
ERI-3
Medium - 1 10 12 13 10 10 10 9 9 10 - - - -
Medium – 2 12 11 12 10 11 10 11 10 10 - - - -
Medium – 3 10 9 11 10 - - - - - - - - 10
Medium – 4 10 10 9 9 9 12 - - - - - - -
Medium – 5 15 12 10 - - - - - - - - - 10
Medium – 6 11 10 11 11 10 10 12 10 10 - - - -
Medium – 7 11 - - - - - - - - - - - -
Medium – 8 12 14 14 10 12 11 10 12 15 10 12 10 12
ERI-26
Medium –1 9 9 11 10 - - - - - - - - 10
Medium –2 11 13 14 10 11 9 9 10 - - - - -
Medium –3 10 11 12 10 - - - - - - - - -
Medium –4 12 14 14 12 15 10 11 12 12 10 14 10 10
Medium –5 11 12 12 10 - - - - - - - - 10
Medium –6 11 10 10 - - - - - - - - - -
Medium –7 10 - - - - - - - - - - - -
Medium –8 9 11 10 10 9 - - - - - - - 10
-: No activity, ERI: Entomology Research Institute. B.s- B. subtilis; S.a- S. aureus; S.e-S. epidermidis; E.f- E. faecalis; E.c-
E. coli; P.a- P. aeruginosa; K.p- K. pneumoniae; X.sp- Xanthomonas sp.; E.sp- Erwinia; S.t- S. typhi; V.f- V. fischeri; P.v- P.
vulgaris. Results were analyzed in triplicates.
were prepared with 20 mL of sterile SDA (Hi-media, Mumbai). The pound(s) from three actinomycetes strains ERI-1, ERI-3
test cultures (50µL of fungal spore suspension) were swabbed on and ERI-26. All the twelve tested bacteria and yeast
the top of the solidified media and allowed to dry for 10 min. Five
mm diameter well was made using sterile cork borer and filled with
growth was inhibited by strain ERI-1 grown in M-1 and M-
0.05 mL of supernatant of ERI-1, ERI-3 and ERI-26. The plates 8 medium. M-2 did not show any activity against K.
were left for 30 min at room temperature for supernatant diffusion. pneumoniae, Xanthomonas sp., Erwinia, S. typhi, V.
Negative control was prepared using the respective fermentation fischeri, P. vulgaris and C. albicans, whereas M-5 exhi-
medium. The plates were incubated for 24-48 h at 28°C. A zone of bited activity against only B. subtilis, S. aureus and S.
inhibition was recorded in millimeters and the experiment was epidermidis (Table 1). ERI-3 cultivated in M-3, M-5 and
repeated twice.
M-8 inhibited the growth of all the tested bacteria; how-
ever M-4 was ideal for ERI-26
RESULTS
Effect of pH on the production of antimicrobial
Selection of fermentation medium compounds
Eight different fermentation media named as M-1 to M-8 Optimum pH for the production of antimicrobial com-
were used as the base to determine the optimal nutri- pounds was recorded by diameter of zone of inhibition
tional conditions for the production of antimicrobial com- (Table 2). At pH 7.0, ERI-1, ERI-3 and ERI-26 exhibited
Arasu et al. 753
Table 2. Effect of pH of the medium on the growth and production of antimicrobial metabolites.
pH Strain
B.s S.a S.e E.f E.c P.a K.p X.sp E.sp S.t V.f P.v C.a
ERI-1 - - - - - - - - - - - - -
DCW 1.5g/L
6.0 ERI-3 - - - - - - - - - - - - -
DCW 0.98 g/L
ERI-26 - - - - - - - - - - - - -
DCW 1.23 g/L
ERI-1 12 9 11 10 12 - - - - - - - 10
DCW 1.74 g/L
6.5 ERI-3 9 10 10 11 9 9 9 - - - - - -
DCW 1.32g/L
ERI-26 10 11 12 10 10 9 7 - - - - - -
DCW 1.47 g/L
ERI-1 15 15 14 14 14 11 10 10 12 12 12 10 12
DCW 2.47 g/L
7.0 ERI-3 12 9 9 11 10 9 9 9 11 - - - -
DCW 2.21 g/L
ERI-26 13 13 16 16 13 10 11 12 12 11 13 10 12
DCW 2.73 g/L
ERI-1 9 10 10 9 9 10 9 10 12 10 9 9 9
DCW 2.4 g/L
ERI-3 12 13 15 10 11 11 10 12 14 10 12 10 11
7.5
DCW 2.75 g/L
ERI-26 9 10 9 9 10 8 8 12 13 14 - - 10
DCW 2.43 g/L
ERI-1 13 14 10 12 12 14 12 - - - - - -
DCW 1.41 g/L
8.0 ERI-3 9 10 11 9 9 9 - - - - - - 12
DCW 1.28 g/L
ERI-26 - - - - - - - - - - - - -
DCW 0.79 g/L
ERI-1 - - - - - - - - - - - - -
DCW 0.42 g/L
ERI-3 - - - - - - - - - - - - -
8.5
DCW 0.61 g/L
ERI-26 - - - - - - - - - - - - -
DCW 0.72 g/L
-; No activity, ERI- Entomology Research Institute, DCW- dry cell weight. B.s - B. subtilis; S.a – S. aureus ;S.e - S. epidermidis; E.f - E.
faecalis; E.c - E. coli; P.a- P. aeruginosa; K.p - K. pneumoniae; X.sp - Xanthomonas sp.; E.sp- Erwinia;S.t - S. typhi; V.f - V. fischeri;P.v - P.
vulgaris. Results were analyzed in triplicates.
good growth and antimicrobial activity against tested Optimizing the incubation time and temperature for
bacteria. Cell growth in terms of biomass was noted in production of antimicrobial compounds
strain ERI-3 as 0.98, 1.32, 2.21, 2.43, 0.79 and 0.72 g/L
for pH 6.0, 6.5, 7.0, 7.5, 8.0 and 8.5, respectively. ERI-1, ERI- 3 and ERI- 26 showed maximum antimicro-
Table 3. Effect of incubation time on growth and production of antimicrobial metabolites.
Time Strain
ERI-1 9 9 10 - - - - - - - - - -
DCW 1.27 (g/L)
ERI-3 - - - - - - - - - - - - -
24
DCW 0.7 (g/L)
ERI-26 - - - - - - - - - - - - -
DCW 0.86 (g/L)
ERI-1 10 12 10 9 11 12 13 11 12 10 12 12 10
DCW 2.8
ERI-3 9 10 12 9 10 11 10 10 12 11 10 10 10
48
DCW 2.46 (g/L)
ERI-26 10 9 11 12 9 10 11 9 11 10 10 10 9
DCW 2.1 (g/L)
ERI-1 9 10 11 10 11 12 12 10 12 11 11 10 10
DCW 3.21 (g/L)
ERI-3 12 11 12 10 11 13 10 9 12 10 12 10 10
72
DCW 4.01 (g/L)
ERI-26 10 12 11 12 13 10 11 12 12 10 13 10 10
DCW 3.9 (g/L)
ERI-1 9 10 9 9 10 9 10 10 9 10 9 10 10
DCW 3.02 (g/L)
ERI-3 12 10 11 11 10 11 9 10 10 9 11 10 10
96
DCW 3.79 (g/L)
ERI-26 10 9 11 10 10 9 11 12 9 10 10 10 9
DCW 4.0 (g/L)
-; No activity, ERI- Entomology Research Institute, DCW- dry cell weight; B.s - B. subtilis; S.a- S. aureus; S.e- S. epidermidis; E.f -
E. faecalis; E.c - E. coli; P.a- P. aeruginosa; K.p - K. pneumoniae; X.sp - Xanthomonas sp.; E.sp- Erwinia; S.t- S. typhi; V.f - V. fischeri;
P.v - P. vulgaris. Results were analyzed in triplicates.
bial activity after 24 h. At 48 and 72 h, it exhibited maxi- Effect of glucose concentration on growth and
mum cell growth as well as antibacterial activity (Tables 3 antimicrobial activity
and 4). ERI-1, ERI-3 and ERI-26 did not exhibit activity at
20 and 45°C. It was not suitable for growth also. 30°C Different concentration of glucose on growth and antibac-
was found to be optimum temperature for antimicrobial terial activity was studied (Table 6). For ERI-1, ERI-3 and
metabolite production (Table 4). ERI-26, the concentration of glucose from 6 to 12 g/L
enhanced the cell growth and the antimicrobial compound
production.
Effect of different carbon sources on growth and
antimicrobial activity
Effect of different nitrogen source on growth and
Effect of different carbon source on growth and antimicro- antimicrobial activity
bial activity was analyzed. Optimization of antibacterial
compound production was carried out in batch culture. The results of nitrogen source utilization are shown in
Strains were able to grow in all the tested carbon sources Table 7. The higher growth and antibacterial activity were
(Table 5). However, ERI-1 and ERI-3 exhibited maximum observed in ammonium nitrate as nitrogen source follo-
antimicrobial activity in medium supplemented with glu- wed by sodium nitrate and potassium nitrate in case of
cose as a sole carbon source followed by starch and fruc- ERI-1 and ERI-26. ERI-3 exhibited maximum growth and
tose. ERI-26 was able to utilize glucose for better growth antibacterial activity by using sodium nitrate followed by
and revealed maximum antibacterial activity. ammonium nitrate.
Arasu et al. 755
Table 4. Effect of incubation temperature on growth and production of antimicrobial metabolites.
Temperature Strain
ERI-1 - - - - - - - - - - - - -
20°C ERI-3 - - - - - - - - - - - - -
ERI-26 - - - - - - - - - - - - -
ERI-1 10 11 11 14 10 12 10 11 10 10 10 11 10
30°C ERI-3 11 9 11 13 10 13 11 12 10 10 10 10 12
ERI-26 9 11 12 10 9 10 10 10 11 11 11 10 11
ERI-1 10 10 9 11 9 11 10 9 9 - - - 9
37°C ERI-3 9 10 10 9 9 - - 9 9 9 10 11 10
ERI-26 9 11 10 9 9 9 10 10 10 10 10 9 9
ERI-1 10 11 - - - - - - - - - - -
45°C ERI-3 - - - - - - - - - - - - -
ERI-26 - - - - - - - - - - - - -
-: No activity, ERI- Entomology Research Institute. B.s- B. subtilis; S.a- S. aureus; S.e- S. epidermidis; E.f- E. faecalis;
E.c- E. coli; P.a- P. aeruginosa; K.p- K. pneumoniae; X.sp- Xanthomonas sp.; E.sp- Erwinia; S.t- S. typhi; V.f- V. fischeri;
P.v- P. vulgaris.Results were analyzed in triplicates.
Table 5. Effect of different carbon sources on growth and antimicrobial activity against S. epidermidis.
ERI-1 ERI-3 ERI-26

Carbon
Dry cell weight Antimicrobial activity Dry cell weight Antimicrobial activity Dry cell weight Antimicrobial activity
source
(g/L) (mm) (g/L) (mm) (g/L) (mm)
Glucose 2.9 23 3.1 20 3 23
Starch 1.7 20 1.5 18 1.7 17
Sucrose 1.8 17 1.7 15 2 16
Starch 1.5 20 1.4 15 1.8 16
Maltose 2.7 18 2.9 17 2.5 18
Fructose 2.8 20 2.7 19 2.9 19
Mannitol 0.8 15 0.4 15 0.5 16
Mannose 1.7 15 1.5 15 1.8 15
Xylose 0.6 0 0.7 13 0.4 -
Glycerol 2.4 18 2.7 16 2.9 16
Results were analyzed in triplicates.
Table 6. Effect of different glucose concentration on growth and antimicrobial activity (against S. epidermidis).
Glucose ERI-1 ERI-3 ERI-26

concentration Dry cell Antimicrobial activity Dry cell Antimicrobial activity Dry cell Antimicrobial activity
(g/L) weight (g/L) (mm) weight (g/L) (mm) weight (g/L) (mm)
2 0.72 - 0.45 - 0.91 12
4 1.25 - 0.93 - 1.43 12
6 2.37 14 1.73 16 2.30 15
8 3.11 17 2.54 17 3.10 17
10 3.73 17 3.1 19 3.80 20
12 3.68 22 3.04 19 3.90 22
14 3.24 22 2.73 18 2.40 22
16 2.43 20 2.64 18 2.34 22
18 1.40 20 1.56 14 2.10 18
20 0.91 18 1.24 14 2.03 18
Table 7. Effect of different nitrogen sources on growth and antimicrobial activity (against S. epidermidis).
ERI-1 ERI-3 ERI-26

Nitrogen source Dry cell Antimicrobial Dry cell Antimicrobial activity Dry cell Antimicrobial activity
weight (g/L) activity (mm) weight (g/L) (mm) weight (g/L) (mm)
Ammonium nitrate 2.78 21 2.42 17 2.40 17
Ammonium sulphate 0.87 14 1.27 15 1.70 15
Ammonium citrate 1.04 15 0.73 12 0.64 -
Sodium nitrate 2.45 20 2.75 22 1.92 15
Potassium nitrate 2.40 19 2.35 17 2.29 15
Table 8. Effect sodium chloride concentration on growth and antimicrobial activity (against S. epidermidis).
Sodium chloride ERI-1 ERI-3 ERI-26

concentration Dry cell weight Antimicrobial Dry cell Antimicrobial Dry cell Antimicrobial
(g/L) (g/L) activity (mm) weight (g/L) activity (mm) weight (g/L) activity (mm)
4 1.85 17 1.93 18 1.93 18
8 3.21 18 2.84 18 3.71 21
12 4.68 23 3.64 24 3.53 22
16 3.43 20 2.94 20 2.14 22
20 1.91 18 1.54 19 1.33 21
Effect of sodium chloride on growth and antimicrobial Effect of fermentation media on antifungal activity
activity
Fermentation media were also checked against fungal
Effect of different concentration of sodium chloride on pathogens. It was observed that strain ERI-26 greatly
growth and antibacterial activity was studied. Increase in suppressed the growth of all the chosen fungal strains as
concentration of sodium chloride in the medium influen- compared to strain ERI-1 and ERI-3 (Table 9). Among all
ced the growth and antimicrobial compound production the fungi, A. niger and C. lunata showed significant inhibi-
(Table 8). A concentration of 12 g/L was good for growth tion.
as well as antimicrobial activity for the strains. There was
a decline in growth and antimicrobial activity after 20 g/L. DISCUSSION
Cultivation of different complex media signalized the abi-

Optimized media on antimicrobial activity lity for secondary metabolite production and the influence
of inoculum stage conditions. Arasu et al. (2008) reported
Optimized media showed good activity as compared to that antagonistic properties are largely influenced by the
normal fermentation media. Secondary metabolites from quality of the medium. Eight different fermentation media
strain ERI-1 showed good antimicrobial activity in opti- were used for the selection of best antimicrobial meta-
mized media (M-4 media containing 12 g/L glucose, 1.2 bolite production. Medium-4 (modified nutrient glucose
g/L ammonium nitrate, 12 g/L sodium chloride, pH 7.0, agar media) was chosen as the best base for the pro-
temperature 30°C and incubation time 72 h). It was 1.5 duction and antimicrobial metabolite production for ERI-1
times more than the normal media (Table 9). ERI-3 culti- and ERI-26. ERI-3 cultured in M-8 was the best source
vated in M-8 media containing 12 g/L glucose, 1.2 g/L for antimicrobial metabolite production. Our results indi-
sodium nitrate, 12 g/L sodium chloride, pH 7.5, tempe- cated that MNGA was the good base for antimicrobial
rature 30°C and incubation time 72 h revealed good pro- metabolite production; however Augustine et al. (2005)
duction of antimicrobial metabolite in the broth. M-4 reported that starch casein medium was found to be good
media components with 12 g/L of glucose, 1.2 g/L ammo- base for antifungal metabolite production.
nium nitrate, 12 g/L sodium chloride, pH 7.0, temperature Optimizations of fermentation conditions are necessary
30°C and incubation time 72 h influenced ERI-26 for to improve secondary metabolite formation. Dissolved
better production of antimicrobial metabolites. oxygen tension was identified to influence the productivity
Arasu et al. 757
Table 9. Antimicrobial activity of optimized fermentation medium.
Antibacterial activity (Inhibition zones in mm) Anfungal activity (Inhibition zones in mm)
Strain
B.s S.a S.e E.f E.c P.a K.p X.sp E.sp S.t V.f P.v T.m E.f T.s C.l A.n B.c T.r 296 T.r 57 Scro C.a
ERI-1 22 18 18 19 15 16 23 18 15 15 15 10 - - - - - - - - - -
ERI-3 22 20 21 12 11 10 12 15 10 12 10 13 - - - - - - - - - -
ERI-26 21 23 20 15 13 12 10 11 11 11 10 11 15 15 10 20 25 10 15 18 10 18
- ; No activity, ERI- Entomology Research Institute. B.s- B. subtilis; S.a- S. aureus ; S.e- S. epidermidis; E.f- E. faecalis; E.c - E. coli; P.a- P. aeruginosa; K.p - K. pneumoniae; X.sp - Xanthomonas sp.;
E.sp- Erwinia; S.t- S. typhi; V.f- V. fischeri; P.v- P. Vulgaris; T.m- T. mentographytes; E.f- Epidermophyton floccosum; T.s- T. simii; C.l- Curvularia lunata; A.n- Aspergillus niger; B.c- Botrytis cinerea; T.r-
Trichophyton rubrum; Scro- Scropulariopsis sp.; C.a- Candida albicans. Results were analyzed in triplicates. Among the fungus, only Candida albicans was used in the initial antimicrobial screening
such as effect of different medium, different temperature, different pH and different incubation time, respectively.
of several processes concerning bioactive com- They influence the growth, as well as the potassium nitrate. Strains cultivated at 30°C were
pound (Ya-Jie et al., 2009). Possibility to enlarge antimicrobial metabolite production of the optimum for good growth and antimicrobial meta-
secondary metabolite formation with high oxygen actinomycetes strains. Nadia et al. (2004) repor- bolite production. The results also indicated an
levels is a strong dependency of oxygen with the ted that leucine was the best nitrogen source for incubation time of 96 h as optimal. Cruz et al.
enzymatic reactions of product formation. Kim et antimicrobial activity, while maximum antimicrobial (1999) reported that the production of antibiotic by
al. (2000) reported a 7-fold enhancement of activity was introduced by using the carbon sour- S. griseocarneus was increased by glucose.
kasugamycin production by pH shock in batch ces, citrate and acetate. Our results indicated that Gupte and Kulkarni reported that three indepen-
culture of Streptomyces kasugaensis. It is well more antimicrobial activity was found when the dent variables, namely concentration of carbon
known that environmental signals, including pH carbon source is glucose in combination with the source (glucose), nitrogen source (soybean meal)
shock, can stimulate and promote the biosynthe- nitrogen source ammonium nitrate. The effects of and temperature of incubation, were found to be
sis of secondary metabolites. Kim et al. (2007) nitrogen sources on streptolydigin production and the most important for the production of antimicro-
reported that when the pH was maintained at 5, distribution of secondary metabolites from bial metabolites (Gupte and Kulkarni, 2000). In
production of geldanamycin was increased from Streptomyces lydicus were investigated in shake general, Streptomyces sp. grew best in media
414 to 768 mg/L. Nadia et al. (2004) studied the flask level (Liangzhi et al., 2007). When soybean containing carbon and nitrogen sources, including
effects of temperature, pH, incubation period, meal was used as the source of nitrogen, three chitin, starch, glycerol, arginin, asparagine, casein
some media and different nitrogen and carbon analogues of streptolydigin were detected. Among and nitrate (Locci, 1989).
sources for the production of antimicrobial meta- the nitrogen sources glutamic acid was most Results of the present work indicated that the
bolite production. Temperature of 35°C and pH 8 favorable for the formation of streptolydigin selected actinomycetes possess antibacterial and
were the best for growth and antimicrobial agent (Liangzhi et al., 2007). antifungal properties in liquid broth. This explains
production and 14 to 15 days of incubation was ERI-1, ERI-3 and ERI-26 were able to grow in all that the antimicrobial metabolites are extra cellular
found to be the best for maximum growth and the tested carbon sources. However maximum in nature. Conditions such as pH, temperature and
antimicrobial activity, respectively, in the medium growth and antimicrobial activity was obtained in incubation period were optimized. Best me-dium
BG-11. medium supplemented with glucose followed by for growth and antimicrobial metabolite production
We found that medium with glucose and fruc- fructose. Fermentation medium supplemented were selected on the basis of antimicrobial activity.
tose showed maximum antimicrobial metabolite with glucose enhanced the growth and antimicro- Modified nutrient medium with glucose as a car-
production and cell growth. Ammonium nitrate and bial metabolite synthesis. The highest activity was bon source was found to be good base for fer-
sodium nitrate were found to be the best nitrogen obtained in media containing ammonium nitrate as mentation. Best nitrogen source was selected
source for the antimicrobial metabolite production. a nitrogen source, followed by sodium nitrate and based on the growth and antimicrobial activity. From
the present investigations, it was clear that ERI-1, ERI-3 Kim CJ, Chang YK, Chun GT (2000). Enhancement of kasugamycin
and ERI-26 were found to produce extra cellular antimic- production by pH shock in batch cultures of Streptomyces
kasugaensis. Biotech. Prog. 16:548-552.
robial metabolites.
Kim YJ, Song JY, Moon MH, Smith CP, Hong SK, Chang YK (2007).
pH shock induces overexpression of regulatory and biosynthetic
genes for actinorhodin production in Streptomyces coelicolor
ACKNOWLEDGEMENTS A3(2). Appl. Microbiol. Biotechnol. 76:1119-1130.
Lauren BP, Yi T, Yit-Heng C (2011). Metabolic engineering for the
We thank "Cooperative Research Program for Agriculture production of natural products. Annu. Rev. Chem. Biomol. 2:211-
236.
Science and Technology Development (Project No. Lazzarini A, Cavaletti L, Toppo G, Marinelli F (2000). Rare genera of
PJ008502)" Rural Development Administration, Republic actinomycetes as potential producers of new antibiotics. Antonie
of Korea. The authors extend gratitude to The Director, van Leeuwenhoek 78:399-405.
Entomology Research Institute, Loyola College, Chennai. Liangzhi LI, Bin Q, Yingjin Y (2007). Nitrogen sources affect strep-
Authors are thankful to Addiriyah Chair for Environmental tolydigin production and related secondary metabolites distribu-
tion of Streptomyces lydicus. Chin. J. Chem. Eng. 15:403-410.
Studies, Department of Botany and Microbiology, College
Locci R (1989). Streptomyces and related genera. In: Stanley T.
of Science, King Saud University, Saudi Arabia for finan- Williams, M. Elizabeth. Sharpe, and John Holt, editors. Bergey’s
cial assistance. manual of systematic bacteriology. Baltimore: Williams Co.
Mohd HI, Hawa ZEJ (2012). Primary, secondary metabolites, H2O2,
malondialdehyde and photosynthetic responses of Orthosiphon
REFERENCES stimaneus Benth. to different irradiance levels. Molecules
17:1159-1176.
Arasu MV, Al-Dhabi NA, Saritha V, Duraipandiyan V, Muthukumar Nadia HN, Abdel FM, Khaleafa SHZ (2004). Factors affecting anti-
C, Kim SJ (2013). Antifeedant, larvicidal and growth inhibitory microbial activity of Synechococcus leopoliensis. Microbiol. Res.
bioactivities of novel polyketide metabolite isolated from 159:395-402.
Streptomyces sp. AP-123 against Helicoverpa armigera and Valanarasu M, Kannan P, Ezhilvendan S, Ganesan G, Ignacimuthu
Spodoptera litura BMC Microbiol. 13:105. S, Agastian P (2010). Antifungal and antifeedant activities of
Arasu MV, DuraipandiyanV, Agastian P, Ignacimuthu S (2008). extracellular product of Streptomyces spp. ERI-04 isolated from
Antimicrobial activity of Streptomyces spp. ERI-26 recovered Western Ghats of Tamil Nadu. J. Med. Mycol. 20:290-297
from Western Ghats of Tamil Nadu. J. Med. Mycol. 18:147-153. Vilella D, Sánchez M, Platas G, Salazar O, Genilloud O, Royo I,
Arasu MV, Duraipandiyan V, Agastian P, Ignacimuthu S (2009). In Cascales C, Martín I, Díez T, Silverman KC, Lingham RB, Singh
vitro antimicrobial activity of Streptomyces spp. ERI-3 isolated SB, Jayasuriya H, Peláez F (2000). Inhibitors of farnesylation of
from Western Ghats rock soil (India). J. Med. Mycol. 19: 22-28. ras from a natural products screening program. J. Ind. Microbiol.
Arasu MV, Ignacimuthu S, Agastian P (2012). Actinomycetes from Biotechnol. 25:315-327.
Western Ghats of Tamil Nadu with its antimicrobial properties. Wildmans H (1997). Potential of tropical microfungi within the
Asian Pac. J. Trop. Med. S830-S837. pharmaceutical industry. In: Hyde KD, editor. Biodiversity of
Augustine SK, Bhavsar OSP, Kapadnis BP (2005). Production of a tropical microfungi. Hong Kong: Hong Kong University Press; pp.
growth dependent metabolite active against dermatophytes by 29-46.
Streptomyces rochei AK 39. Ind. J. Med. Res. 121:164-170. Ya-Jie T, Wei Z, Jian-Jiang Z (2009). Performance analyses of a
Cruz R, Arias ME, Soliveri J (1999). Nutritional requirements for the pH-shift and DOT-shift integrated fed-batch fermentation process
production of pyrazoloisoquinolinone antibiotics by Streptomyces for the production of ganoderic acid and Ganoderma polysaccha-
griseocarneus NCIMB 40447. Appl. Microbiol. Biotechnol. rides by medicinal mushroom Ganoderma lucidum. Bioresour
53:115-119. Technol 100: 1852–1859.
Demain AL (2006). From natural products discovery to commerciali-
zation: a success story. J. Ind. Microbiol. Biotechnol. 33:486-495.
Gupte MD, Kulkarni PR (2002). A study of antifungal antibiotic
production by Streptomyces chattanoogensis MTCC 3423 using
full factorial design. Lett. Appl. Microbiol. 35:220-226.
Vol. 8(8), pp. 759-765, 19 February, 2014
DOI: 10.5897/AJMR12.2078
Incidence of Aspergillus contamination of groundnut

(Arachis hypogaea L.) in Eastern Ethiopia
Abdi Mohammed1 and Alemayehu Chala2*
1
Bule Hora University, P. O. Box 144, Bule Hora, Ethiopia.
2
Hawassa University, P. O. Box 05, Hawassa, Ethiopia.
The production of groundnut is constrained by several factors, among which is Aspergillus spp. In
addition to causing quantitative losses, Aspergillus spp. produce highly toxic and carcinogenic
chemical substances known as aflatoxins. This study was conducted with the objectives to (i) identify
Aspergillus species associated with groundnuts, (ii) determine the frequency of seed contamination,
and (iii) survey agro-ecological conditions related to groundnut contamination by Aspergillus spp.
About 270 groundnut samples were collected from farmers’ storage, fields and local markets of three
districts that is, Babile, Darolabu and Gursum of Eastern Ethiopia for mycological analysis in the year
2010. Results of the mycological analysis suggested heavy infestation of groundnut samples by various
molds including Aspergillus niger, Aspergillus flavus, Aspergillus ochraceus, Aspergillus parasiticus
and Pencillium species. At the district level, the incidence of infected groundnut kernels ranged from 50
to 80%. Within the district kernel infection varied between 36.3 and 100%. The common Aspergillus
symptoms (yellowing or chlorotic leaves, wilting, drying and brown or black mass covered by yellow or
greenish spores) were also observed in groundnut fields. The current results were consistent with our
earlier report of heavy aflatoxin contamination of groundnut from the same places, suggesting the
urgent need to apply control measures against toxigenic fungi and associated mycotoxins.
Key words: Aspergillus spp., groundnut, Penicillium spp., Ethiopia.
INTRODUCTION
Groundnut (Arachis hypogaea L.) is an important food nic microorganisms like Aspergillus species. Aspergillus
and feed crop, which also serve as component of crop spp. are facultative parasites. They invade host plant
rotation in many countries (Pande et al., 2003; tissues directly or attack tissues that have been predis-
Upadhyaya et al., 2006). Groundnuts are also significant posed by environmental stresses such as dry weather or
source of cash in developing countries that contribute damages caused by insects, nematodes, natural crac-
significantly to food security and alleviate poverty (Smart king, and harvest equipment (Pettit and Taber, 1968).
et al., 1990). Developing countries account for 97% of the They are distributed worldwide, mainly in countries with
world’s groundnut area and 94% of the total production tropical climates that have extreme ranges of rainfall,
(FAOSTAT, 2010). However, groundnut yield in this part temperature and humidity (Pettit and Taber, 1968). Many
of the world and particularly in Africa is lower than the strains of this fungus are capable of producing aflatoxins
world average due to prevailing abiotic, biotic and socio- that render the seed unacceptable due to high toxicity for
economic factors (Pande et al., 2003; Upadhyaya et al., human or animal consumption (Reddy et al., 1996).
2006; Caliskan et al., 2008). Aflatoxins are highly toxic metabolites associated with
In warm climates grains are easily infected with toxige- Reye’s syndrome, Kwashiorkor and acute hepatitis
*Corresponding author E-mail: [email protected]. Tel: +251 912 163096. Fax: +251 46 2206517.
(Wild and Hall, 1999; Wild and Turner, 2002). then stored at 4°C in vials containing 2.5 ml of sterile distilled water
The Eastern lowland areas of Ethiopia have conside- for further use.
rable potential for increased oil crop production including
groundnut. Particularly areas such as Babile, Darolabu Species identification
and Gursum are the major producers of groundnuts for
local and commercial consumption (Getnet and Nugussie, Isolates were identified to a species level based on morphological
1991; Chala et al., 2012). Nevertheless, the area may (phenotypic) features as described by Cotty (1994), Egel et al.
(1994), Kurtzman et al. (1997), and Okuda et al. (2000). For this
also be very conducive for toxigenic fungi like Aspergillus
purpose: Isolates representing each pure culture were grown on
spp. owing to its warm and dry climate. Moreover, far- Czapek Dox Agar (CZDA) and PDA at 25°C for 5-7 days. Fungal
mers’ practices of production and handling of groundnut colonies that grew rapidly and produced colors of white, yellow,
at pre- and pos-harvest stages may provide favorable yellow-brown, brown to black or shades of green, mostly consisting
conditions for outbreaks of fungi and their mycotoxins. As of a dense felt of erect conidiophores were broadly classified as
Chala et al. (2012) reported, groundnut from East Ethio- Aspergillus spp. while those that produce blue spores were
considered as Pencillium spp. (Okuda et al., 2000). Isolates with
pia is heavily contaminated by aflatoxins at levels much dark green colonies and rough conidia were considered A.
more than international standards, and this might be parasiticus (Klich, 2002). The major distinction currently separating
associated with infection of the crop with Apsergillus spp., A. niger from the other species of Aspergillus is the production of
mainly A. falvus and A. parasiticus that are known produ- carbon black or very dark brown spores from biseriate phialides
cers of aflatoxins. However, up to date information on the (Raper and Fennell, 1965). Those that showed brown colony with
orange and cream reverse sides were considered A. sojae and A.
prevalence of fungi, and studies on environmental factors
oryzae, respectively (Cotty, 1994). Those, which produce conidia
and farmers’ practices that promote fungal contamination, with smooth surface on CZDA and colonies typical of A. flavus were
which could be basis for the reduction of mycotoxins are recorded as A. flavus.
limited under Ethiopian conditions. On the other hand,
such studies are of paramount importance to give valid Data analysis
recommendations for safe consumption and marketing of
groundnut. The objectives of this study were to: i) identify Data on frequencies of kernel infection by Aspergillus and
Aspergillus species associated with groundnut in East Penicillium species for samples collected from different locations of
Ethiopia, ii) determine the frequency of seed contamina- the districts were subjected to analysis of variance (ANOVA) using
the SAS computer package, version 9.11 (SAS, 2003). LSD test at
tion, and iii) survey agro-ecological conditions related to the 0.05 probability level was used for mean comparison.
contamination of groundnut by Aspergillus spp.
RESULTS AND DISCUSSION

Surveys of groundnut and sample collection Identification of Aspergillus species associated with
groundnut
Groundnut samples were collected from three districts (Babile,
Darolabu and Gursum) of Eastern Ethiopia in the year 2010. The Four different Aspergillus spp. were found to be asso-
samples were collected in three groups that is, from farmers’ stores, ciated with groundnut samples collected from Eastern
fields and from local markets of selected locations of the three dis-
tricts. Geographic description of survey locations are given in Table
Ethiopia (Figure 1). The first species isolated from the
1. In each district, five locations were chosen based on the ground- collected samples was A. niger. The major distinction
nut productions potential. Six samples were collected from each currently separating A. niger from the other species of
location and hence 30 samples were collected per district making Aspergillus is the production of carbon black or dark
the total number of samples collected from all over the three dis- brown spores of biseriate phialides (Raper and Fennell,
tricts 270 (3 districts × 5 locations per district × 6 samples per 1965). The current study also confirmed the production of
location × 3 sample groups per district). Data were also gathered on
planting and harvesting dates of the crop, the variety, soil type,
black or brown-black or black conidia by this species
previous crop, and types of cultural practices. The common (Figure 1).
methods of storage structures, drying materials and grain moistures A. flavus was the second species identified in this
were observed. study. Colonies of this fungus were characterized by
yellow to dark, yellowish-green pigments, consisting of a
Fungal isolation, species identification dense felt of conidiophores or mature vesicles bearing
phialides over their entire surface (Gourama and Bullerman,
Fungal isolation 1995). In general, A. flavus was known as a velvety,
Fifty groundnut seeds per sample were surface sterilized with 10% yellow to green or the old colony was brown mould with a
Chlorox solution for 1 min, followed by immersion in sterile distilled goldish to red-brown on the reverse. The conidiophores
water for 1 min. Surface sterilized seeds were then placed on were variable in length; walls of A. flavus conidia were
freshly prepared potato dextrose agar (PDA) plates (five seeds per smooth to finely roughened or moderately roughened,
plate) and incubated for three days at 25°C. Pure cultures of pitted and spiny. These observations were consistent
different out growing fungi were obtained by transferring fungal
colonies to new PDA plates using sterile toothpicks, and incubating
with the findings of Gourama and Bullerman (1995), who
the plates for 5-7 days at 25°C. Pure cultures of each isolate were reported A. flavus colonies as being initially
Mohammed and Chala 761
Table 1. Geographic description of locations included in the survey.
District Location Latitude Longitudes Altitude (m)

0 0
Ausharif 09 11’933” 042 13’080” 1733
0
Shekabdi 09 12”890” 042013’65” 1437
0 0
Babile Shekusman 09 12’89” 042 13’105” 1784
0
Ifa 09 17’762” 042017’161” 1500
Bishan Babile 09015’872” 042018’049” 1500
Sakina 08035’023” 040020’388” 2100

0 0
Gadulo 08 26’078” 040 15’732” 1400
Darolabu Odalaku 08035’067” 040019’842” 1760
Sororo 08035’036” 040019844” 1608
Haroadi 08034’954” 040020’280” 1788
0 0
Audal 09 37’297” 042 43’951” 1792
0 0
Ilalam 09 37’268” 042 43’758” 1838
Gursum Kassa oromiya 09037’282” 042043’610” 1650
Oda oromiya 09037’273” 042043’633” 1732
Harobate 09037’298” 042043’832” 1550
colored sclerotia, and salmon-pink mycelial turf on the

reverse side of CZDA. Colonies of this species also
produced near white to light yellow pigment and were dull
yellow to dark yellow or sometimes brown on the reverse.
A. parasiticus was the fourth species isolated from
groundnut samples tested in the current study. Colonies
A. niger A. niger A. flavus representing this species produced dark green and rough
conidia on CZDA at 25 and 37°C after 5-7 days of
incubation. Similar study by Peterson et al. (2001)
distinguished A. parasiticus from A. bombycis by its
typically dark green color on CZDA.
Groundnut plants infected by Aspergillus spp. showed
typical symptoms of infection as shown in (Figure 2).
A. ochraceus A. ochraceus A. parasiticus These include yellowing of leaves or chlorosis and
premature death and dropping of leaves, wilting, drying
Figure 1. Aspergillus spp. isolated from groundnut samples. single plant and patching or drying of localized areas
within the fields. Underground grains were rotten and
distorted, and the plants were pulled out of the ground
easily. On some dried plants, brown or black mass
covered by yellow or greenish spores were observed in
infected fields. A study by Subrahmanyam and
Ravindranath (1988) stated the presence of shriveled and
dried grains covered by yellow or green spores, when
Figure 2. Symptoms of Aspergillus infection on groundnut. groundnut plants are infected by A. flavus (Aflaroot or
yellow mold). The same study reported highly stunted
seedlings; reduced leaf size with pale to light green;
yellow, turning to yellow-green or olive green with age crown rot or collar rot, with germinating seeds covered
and appearing dark green with smooth shape and some with masses of black conidia; and rapid drying of plants
having radial wrinkles. due to infection of groundnut by Aspergillus spp.
The third species identified in the current work, A.
ochraceoroseus, produced yellow-gold conidia (Bartoli Frequency of kernel contamination
and Maggi, 1978). The A. ochraceus was characterized
particularly by its pale yellow conidial heads, orange-red Proportion of kernel contamination by Aspergillus spp.
conidiophores with coarsely roughened walls, light varied from 50% at Babile market to about 80% at farmers’
Figure 3. Proportion of groundnut kernels infected with Aspergillus spp. in East

Ethiopia (N= 150 seeds/samples).
fields in Gursum district and storage houses in the district nut samples, A. niger and A. flavus were the most preva-
of Darolabu (Figure 3). Groundnut samples collected lent mycotoxigenic fungi across the storage, field and
from storage houses in the districts of Gursum and market samples in East Ethiopia. These two species
Babile, and farmers’ fields at Babile had the second hig- were isolated at a rate of 21-48% (A. flavus) and 35-66%
hest kernel contamination (70%). (A. niger). On the other hand, A. ochraceus accounted for
When samples were analyzed at the location level 0-14%, while A. parasiticus was associated with 2-21% of
(within district), kernel contamination varied significantly kernel infection. Pencillium spp. were also isolated from
(p<0.05) from 36% at Bishan Babile market (Babile 6-13% of samples analyzed (data not shown). In another
district) to 100% in farmers’ fields of Harobate (Gursum experiment, Eshetu (2010) reported the most frequent
district) (Table 2). Samples from stores in Bishan Babile occurrence of Aspergillus spp. (A. flavus, A. niger and
and Shekabdi kebeles (Babile district), stores in Sororo other Aspergilli) in wet shelled one year stored peanut
location of Darolabu district, farmers’ field in Kasa Oromiya sample from Gursum district of Hararghe region in East
of Gursum district were infected at a proportion of 93%. Ethiopia.
In addition, groundnut samples collected from farmers’ In this study; A. flavus and A. niger were isolated at
fields in Ausharif and Shekabdi location of Babile district, higher frequencies from samples collected from farmers’
stores of Sakina and Odalaku (Darolabu district), and fields and stores than markets while A. parasiticus was
stores of Audal and Harobate in Gursum district were consistently isolated at higher frequencies from market
found to be contaminated at a rate of 90%. On the other samples. In contrast to these, isolation frequency of A.
hand, samples from markets at Shekusman location ochraceus was not consistently high or low in any of the
(Babile district), Sororo of Darolabu district and Oda sample collection sites (fields, markets and stores)
Oromiya (Gursum district) had only 43% kernel infection. across the survey districts. The current results were con-
Generally, the current results suggest heavy contamina- sistent with Chala et al. (2012), who detected 5-11,900
tion of groundnut kernels with Aspergillus spp. Groundnut µg/kg total aflatoxin from same samples suggesting
samples collected from markets had the lowest level of heavy groundnut contamination by Aspergillus spp. and
Aspergillus infection compared to samples from farmers’ associated aflatoxins in the region. Aspergillus flavus and
fields and stores across the survey districts and locations. aflatoxins contamination was also prevalent in stored
This may suggest possible sorting of kernels by farmers groundnuts in Ghana (Awuah and Kpodo, 1996). Abdela
to avoid those with visible symptoms of infection (2009) also reported contamination of groundnut samples
(discoloration) before bringing the samples to the local from Sudan by A. niger and A. flavus, which were isola-
markets. The results were in agreement with the study by ted at frequencies of 29-60% for A. niger and 4-52% for
Pitt and Hocking (2009) in which Aspergillus spp. were A. flavus. Fusarium oxysporum, A. niger, R. bataticola
more prevalent in the field and stored foods than in the and S. rolfisii were the predominant species of fungi
markets. associated with diseased plants indicating the involve-
The frequency of Aspergillus isolated from the ground- ment of these fungi in pre- and post- emergence death of
nut samples analyzed in the current study is presented in groundnut plants in Babile district (Tefera and Tana,
Table 3. Of the several species isolated from the ground- 2002).
Table 2. Proportion of groundnut seeds infected by Aspergillus spp. in different

districts of East Ethiopia.
Percent kernel infection

District Location
Store Field Market
c a bc
Ausharif 50 90 53.3
b b cd
Shekusman 70 63 43.3
a a a
Shekabdi 93.3 90 70
b b
Babile Ifa 66.7 63 56b
a b
Bishan babile 93.3 70 36.3cd
LSD (0.05) 12 11 21.8
CV (%) 14 13 20
Sakina 90a 70b 56.7ab

b b a
Gadulo 73.3 53.3 66.7
a
Odalaku 90 56.7b 66.7a
a b c
Darolabu Sororo 93 53.3 43
Haroadi 66.7b 76a
46.7bc
LSD (0.05) 12 11 11
CV (%) 12 15 17
Audal 90a 73.3b 56.7c

Ilalam 56.7c 70b 66ab
Kasa Oromiya 63.3b 93.3a 65bc
Gursum Oda Oromiya 73.3b 66.7b 43.3cd
Harobate 90a 100a 46.7cd
LSD (0.05) 13.4 11 7
CV (%) 15 11 12
Means in a column followed by the same letter are not significantly different according
to LCD at p<0.05.
Table 3. Frequency of Aspergillus species isolated from groundnut seeds collected

from three districts in East Ethiopia.
Percent kernel contamination

District Fungal specie
Store Field Market
A. flavus 20.5 29 26.25
A. niger 66 47.8 38.75
Babile
A. parasiticus 3.6 14 21.25
A. ochraceus 9.8 9.7 13.75
A. flavus 31 32.6 33.7

A. niger 56 53.6 41
Darolabu
A. parasiticus 4 2.1 10.8
A. ochraceus 9 10.5 8.7
A. flavus 48.2 41 34.5

A. niger 34.82 40.5 39
Gursum
A. parasiticus 4.46 10.74 14.3
A. ochraceus 9.82 7.43 0
Description of local groundnut varieties around Gursum districts are different from that of Darolabu
selected areas districts. Their naming was based on the morphology
standing from the ground and leaf shape, size, color and
Description of groundnut varieties in around Babile and seed size. Around Babile and Gursum districts, the common
local groundnut varieties were “Oldhale”, “Sartu”, and after optimum maturations due to lack of labor, which
“Jawsi” (Data from Agricultural and Rural Develop-ment further increases Aspergillus infection. Drought stress
Bureaus of the distritcs). Another similar study re-ported during late stages of pod development favors inva-sion of
that predominant groundnut local variety (Oldhale) was groundnut by A. flavus and subsequent aflatoxin conta-
commonly produced by farmers around Babile district mination. End of season drought was very critical as it
(Tefera and Tana, 2002). The shape and leaf size of affects grain filling and pod formation in groundnut (Hill et
these three varieties were different from each other. Two al., 1984).
groundnut varieties that is, “Basuqa”and “Qacine” are
found to grow commonly around Darolabu district. They Drying method of groundnut around the study areas
are identified based on the plant morphology and seed
size. The “Basuqa” variety has larger seeds and leaves Groundnut crops harvested in the survey districts are
than “Qacine”. It gives higer yield than “Qacine”. But it is usually sun dried on materials such as matting. Curing of
more susceptible to diseases and drought as revealed by groundnut was done for few days in the farms before
the Agricultural and Rural Development Bureau of the drying and removing of the seed from the hulms, to re-
district. move some moisture content from the kernels. In cases,
where the moisture content of threshed unshelled and
shelled pods was too high, the pods were sometimes
Factors associated with Aspergillus spp.
bagged and every day the bags were brought out from
contamination of groundnuts in the study areas
the stores and left in the open. Although such practices
Cultural practices may help reduce Aspergillus invasion, it would have been
made more effective had it been coupled with fumigation
Across the study areas, the groundnut shell is removed with burning cow dung fumes and sun drying for one day
and left in farms, on the roads or water furrows then as suggested by Gehewande et al. (1986).
irrigation water takes it to the farms and gardens. Such a
scenario generally favors over seasoning of plant patho- Traditional groundnut storage system
gens including Aspergillus for subsequent contamination
of the next crops. Besides, groundnut in the survey dis- Storage structures commonly found in the survey districts
tricts is cultivated either as a sole crop or intercropped are made from mud and animal dung. In mud house
with different crops like sorghum (Sorghum bicolor), maize there was no improved aerations in some stores and in
(Zea mays), haricot bean (Phaseolus vulgaris), and under some rain could percolate from the top and from the
the shade of chat (Khata edulis), coffee (Coffea arabica) sides. Groundnuts in such houses are usually stored in
and mango (Mangifera indica) trees. Although intercrop- sacks from the previous years, and this may also
ping is generally known to decrease disease pressure in increase the contamination of groundnuts by Aspergillus
agricultural fields, the companion crops in groundnut and aflatoxins. Dickens et al. (1973) associated moisture
fields may not be very effective against Aspergillus spp. condensation on roofs, improper application of insecticide
Mechanical damages caused during pulling and digging sprays or leaking hoses and application equipment,
out groundnuts may also have predisposed kernels to conveyance of water from flooded elevator dump pits into
infection by Aspergillus and associated aflatoxins. Seeds warehouse, and storage of peanuts on concrete floors
in split pods are frequently invaded by A. flavus and that are damp or have no vapor barriers with increased A.
subsequently become contaminated with aflatoxin as flavus growth. According to Bankole and Adebanjo
suggested by (Graham, 1982). Shriveled kernels contain (2003), traditional storage structures used for on farm
higher amounts of aflatoxin as a result of higher A. flavus storage include containers made of plant materials
infection (Hill et al., 1984). Other factors, which may aid (woods, bamboo, and thratch).
the contamination of groundnut with Aspergillus and then
aflatoxins might be exchanging of equipment or plowing Conclusion
materials and groundnut seeds between households.
Results of the current survey revealed heavy contamina-
Time of planting and harvesting of groundnuts tion of groundnuts by Aspegillus spp. Infection of kernels
were higher in farmers’ store and farmers’ fields than
Rain fall is usually unpredictable at the time of planting markets with incidence of kernel infection at district level
and harvesting around the study areas. The planting time ranging from 36% at Babile market to 100% at Gursum
of groundnut around the study areas usually lasts from field. A. niger and A. flavus were the most dominant spe-
the beginning of April to the end of May, and the har- cies infecting groundnuts in East Ethiopia.
vesting time is from the end of September to the first half In combination with our earlier report on aflatoxin
of November according to the field conditions and availa- contamination of groundnut from East Ethiopia, the cur-
bility of labor. However, pods may overstay in the field rent results should serve as a wakeup call to create aware-
ness on toxicogenic fungi and associated mycotoixns in Dickens JW, Satterwhite JB, Sneed RE (1973). Aflatoxin-contaminated
peanuts produced on North Carolina farms in 1968. J Am. Peanut
the country. As aflatoxins are associated with health
Res. Edu. Assoc. 5: 48-58.
risks, reducing their level in food stuff to a level accepted Egel DS, Cotty PJ, Elias S (1994). Relationship among isolates of
by international standard is paramount importance to Aspergillus sect. flavi that vary in aflatoxin production.
ensure the safety of these food stuff to consumers Phytopathology. 84: 906-912.
Eshetu L (2010). Aflatoxin content of peanut (Arachis hypogaea L.) in
thereby facilitate trade both within and between countries.
relation to shelling and storage practice of Ethiopian farmers. M.Sc.
Five local groundnut varieties are found to grow in the Thesis. Addis Ababa University, Ethiopia.
survey districts. These are “Sartu”, “Oldhale”, “Jawsi”, FAOSTAT (2010). Groundnut world production.
“Basuka” and “Qacine”. Although these varieties vary in http://www.faostat.fao.org.
terms of morphological features and disease resistance, Gehewande MP, Nagaraj G, Jhala R (1986). Aflatoxin production and
detoxification in groundnut. Proceedings of the national seminar on
their resistance to Aspergillus and aflatoxins under dif- plant protection in field crops. 29-31 January 1986. Central plant
fering environmental conditions is not established beyond protection training institute. Hydrabd. India. pp. 15-26.
ambiguity. Thus future work should also focus in testing Getnet A, Nugussie A (1991). Production and research on oil seeds in
Ethiopia. Proceedings of the first national oil seeds workshop in
varieties for Aspergillus resistance under different envi-
Ethiopia, 3-5 December. Institute of Agricultural Research. Addis
ronmental conditions and management practices. Ababa, Ethiopia. p.312.
This study has identified some important factors that Gourama H, Bullerman LB (1995). A. flavus and A. parasiticus:
may contribute for aflatoxin contamination of groundnuts Aflatoxigenic fungi of concern in food and feeds. J. Food Prot. 58:
1395-1404.
both pre- and post-harvest. These include: weather con- Graham J (1982). Aflatoxin in peanuts: Occurrence and control.
ditions, seed and equipment sharing, planting time; har- Queens. Agri. J. 108: 119-122.
vesting time and methods; curing, drying and storage Hill RA, Wilson DM, Burg WR, Shotwell OL (1984). Viable fungi in corn
practices. The roles of additional factors that contribute to dust. App. Environ. Microbiol. 47: 84-87.
Klich MA (2002). Identification of common Aspergillus species. Cen-
aflatoxin contamination down in the value chain need
traalbureau voor Shimmelcultures. Utrecht. The Netherlands. p.116.
further investigation. In addition, the role of none che- Kurtzman CP, Horn BW, Hesseltine CW (1997). Aspergillus nomius, a
mical seeds treatments especially essential oils and that new aflatoxin-production species related to A. flavus and A. tamari.
of biological control agents in reducing groundnut Ant. Van Lee. 53: 147-158.
Okuda T, Klich MA, Seifert KA, Ando K (2000). Integration of modern
contamination should be studied to come up with a more taxonomic methods for Penicillium and Aspergillus Classification. In:
effective and sustainable management strategy. Farmers’ Samson RA, Pitt JI Editors. Hardwood Academic Publishers:
association and extension agents should also be encou- Reading, UK. pp 83-100.
raged in creating awareness about aflatoxins and mana- Pande N, Saxena J, Pandey H (2003). Natural occurrence of
mycotoxins in some cereals. Mycoses. 33:126-128.
gement techniques. Peterson SW, Ito Y, Horn BW, Goto T (2001). Aspergillus bombycis, a
new aflatoxigenic species and genetic variation in its sibling species,
A. nomius. Mycologia. 93: 689-703.
ACKNOWLEDGEMENT
Pettit RE, Taber RA (1968). Factors influencing aflatoxin accumulation
in peanut kernels and the associated mycoflora. Appl. Microbiol. 16:
We are grateful to the Drylands Coordination Group 1230-1234.
(DCG), Norway, for financial assistance. We also thank rd
Pitt JI, Hocking AD (2009). Fungi and food spoilage (3 ed). Springer.
Drs. Dereje Gorfu, Ferdu Azerefegne and Yibrah Beyene pp. 520.
for their valuable comments. Raper KB, Fennell DI (1965). The genus Aspergillus. Williams and
Wilkins. Baltimore, Maryland. pp.686.
Reddy LJ, Nigam SN, Moss JP, Singh AK, Subrahmanyam P,
McDonald D, Reddy AGS (1996). Registration of ICGV86699 peanut
REFERENCES germplasm line with multiple disease and insect resistance. Crop
Science 36: 821.
Abdella MH (2009). Mycoflora of groundnut kernels from Sudan. Trans. SAS Institute Inc (2003). SAS/STATA guide for personal computers
Br. Mycol. Soci. 63: 353-359. version 9.1 edition. Carry: SAS Institute.
Awuah RT, Kpodo KA (1996). High incidence of A. flavus and aflatoxins Smart MG, Shotwell OL, Caldwell RW (1990). Pathogenesis in
in stored groundnuts in Ghana and the use of microbial assay to Aspergillus ear rot of maize: aflatoxin B1 levels in grains around
assess the inhibitory effects of plant extracts on aflatoxin synthesis. wound inoculation sites. Phytopatology. 80: 1283-1286.
Mycopathologia 134: 109-114. Subrahmanyam P, Ravindranath V (1988). Fungal and nematode
Bankole SA, Adebanjo OO (2003). Occurrence of aflatoxins and diseases. In: Reddy PS Editor: Groundnut. Indian Council of
fumonisins in preharvest maize from south-western Nigeria. Food Agricultural Research. New Delhi. India. pp. 453-523.
Add. Cont. 21: 251- 255. Tefera T, Tana T (2002). Agronomic performance of sorghum and
Bartoli A, Maggi O (1978). Four new species of Aspergillus from Ivory groundnut cultivars in sole and intercrop cultivation under semiarid
Coast soil. Trans. Br. Mycol. Soci. 71: 383-394. conditions. J Agron. and Crop Sci. 188: 212-218.
Caliskan S, Arslan M, Arioglu H (2008). Effects of sowing date and Upadhyaya HD, Reddy LJ, Gowda CLL, Singh S (2006). Identification of
growth duration on growth and yield of groundnut in a Mediterranean- diverse groundnut germplasm: Sources of early maturity in a core
type environment in Turkey. Field Cro. Res. 105: 131-140. collection. Field Cro. Res. 97: 261-271.
Chala A, Mohammed A, Ayalew A, Skinnes H (2012). Natural Wild CP, Hall AJ (1999). Hepatitis B virus and liver cancer: Unanswered
occurrence of aflatoxins in groundnut (Arachis hypogaea L.) from questions. Can. Surv. 33: 35-54.
eastern Ethiopia. Food Control. In press. Wild CP, Turner PC (2002). The toxicology of aflatoxins as basis for
Cotty PJ (1994). Comparison of four groups for the isolation of A. flavus public health decisions. Mutagenesis. 17: 471-481.
group fungi. Mycopathologia. 125: 157-162.
Vol. 8(8), pp. 766-775, 19 February, 2014
DOI: 10.5897/AJMR2013.6182
Microencapsulation, survival and adherence studies of

indigenous probiotics
Ammara Hassan1*, M. Nawaz Ch2 and Barbara Rasco3
1
Food and Biotechnology Research Centre, Pakistan Council of Scientific and Industrial Research, Lahore. Pakistan.
2
CEES, University of the Punjab, Lahore. Pakistan.
3
School of food Sciences, Washington State University, USA.
The aim of the study was to evaluate the adherence potential of indigenous probiotic bacteria and to
improve the gastrointestinal survival of these cultures by adopting the double microencapsulation
technique. The mean with standard deviation of triplicate experiments for the cell surface
hydrophobicity, aggregation, and Cell adhesion evaluation of indigenous probiotics revealed that there
was no significant difference in the hydrophobicity of both solvents (n- hexadecane and Xylene). A
mixed trend was observed in the estimation for hydrophobicity; the indigenous Lactobacillus
acidophilus was found with highest cell surface hydrophobicity (56.3%) and the lowest was found in
Lactobacillus reuteri (28.1%). The Ca-alginate and prebiotics amalgum was used in double treatment
and compared with control (free) and single encapsulated (Ca-alginate) cells in the stimulated gastric
juice (SGJ) and stimulated intestinal juice (SIJ). The one-way analysis of variance (ANOVA) results show
that the double microencapsulation technique has significant effects (P< 0.05) on the survival of
bacterial cells during 6 weeks storage. A negligible reduction was found on day 42 in case of double
microencapsulated cells as compared to significant adverse effects on the free cell. The loss was higher
in single microencapsulated Lactobacillus plantarum and Lactobacillus paracasei and zero loss for
Lactobacillus delbrueckii subsp. Bulgaricus. While a slight revival was observed in the free and single
encapsulated bacteria in SIJ. Thus, combination of Ca-alginate and prebiotics significantly improves the
viability and stress response of probiotics in the harsh GI conditions.
Key words: Surface-hydrophobicity, aggregation, adhesion, double- microencapsulation, stimulated gastric

Juice, stimulated intestinal juice, prebiotics, probiotics.
INTRODUCTION
Foods are no longer considered by consumers only in products led Ilya Metchnikoff towards Nobel Prize in 1908
terms of taste and immediate nutritional needs, but also (Vasiljevic and Shah, 2008). Probiotics are live micro-
in terms of their ability to provide specific health benefits organisms that benefit the health of the host, if consumed
beyond their basic nutritional value. Currently, the largest in adequate amount (Liaskovskii and Podgorskii, 2005).
segment of the functional food market is provided by the Mostly probiotic bacteria are incorporated in dairy
foods targeted towards improving the balance and activity products like milk, ice cream and yoghurt. The lactic acid
of the intestinal microflora (Saarela et al., 2002). The producing probiotics keep the gut at a low pH, maintains
nutritional effects due to the presence of probiotics in the the gut microflora and helps preserve the dairy products.

Hassan et al. 767
They also combat the growth of harmful pathogens that adhesion on the gut lining is considered as an important
cause foodborne illnesses (that is, diarrhea). The probio- requirement for delivering health based benefits and the
tics prevent the attachment of these pathogens by com- estimation of surface hydrophobicity is the best technique
peting for similar binding sites on the gut epithelium to determine this adherence and colonization potential
(Parvez et al., 2006). But to deliver the health benefits, (Kaushik et al., 2009).
the probiotic bacteria need to be viable in the gut. The In this study, two materials of particular interest used as
International Dairy Foundation (IDF) has recommended a capsules were the Ca-alginate and prebiotics amalgum
7
minimum number of 10 CFU per gram of the product (containing galactooligosaccharides (GOS), manno-
consumed (Homayouni et al., 2008). However, the loss of oligosaccharide (MOS), and fructooligosaccharides
viability can happen prior to consumption, during process- (FOS)). Alginate is a natural polysaccharide of β-D-
sing procedures such as oxygen stress, freezing and mannuronic acid (M) and α-L-guluronic acid (G), usually
drying or due to the harsh conditions in gastrointestinal extracted from algae/seaweed and is currently the most
(GI) tract such as high pH, bile salt and gastric acid widely used and studied material of microencapsulation
secretion (Chávarri et al., 2010). (Chen and Walker, 2005). while Prebiotics are a group of
Therefore, providing a physical barrier to the probiotic carbohydrates made up of functional oligosaccharides
living cells to resist adverse environmental conditions is which are non-digestible food substances that favour the
therefore an approach currently receiving considerable growth of other bacteria (Liaskovskii and Podgorskii,
interest (Kailasapathy, 2009). 2005).
The microencapsulation techniques have resulted in The main objective of this research was to evaluate the
greatly enhanced viability of these microorganisms in adherence potential and survival of indigenous probiotic
food products as well as in the gastrointestinal tract. In bacteria in gastrointestinal (GI) environment after micro-
this process, active agents are entrapped within a carrier encapsulation.
material. It is a useful tool to improve living cells into
foods, to protect (Favaro-Trindade and Grosso, 2002;
Liserre et al., 2007; Shima et al., 2009; Thantsha et al., MATERIALS AND METHODS
2009) and to extend their storage life and to convert them
into a powder form for convenient use (O'riordan et al., In vitro adherence studies of indigenous probiotic strains
2001; Lian et al., 2003; Oliveira et al., 2007). In addition,
microencapsulation can promote controlled release and Cell surface hydrophobicity
optimize delivery to the site of action, thereby potentiating
the efficacy of the respective probiotic strain. This pro- To determine the probiotics adhesion to hydrocarbons the method
cess can also prevent these microorganisms from multi- of Rosenberg et al. (Rosenberg et al. 1980) and absorbance was
plying in food that would otherwise change their sensory taken at 600 nm and surface hydrophobicity (%) was calculated in
characteristics. replicates as percent decrease (ΔAbs×100) in the absorbance of
The investigations has revealed that the probiotic cell suspension (A Initial) and after phase separations (A final) as follows:
Cell aggregation was kept at 35°C for 2 h after that 1.0 ml of the top suspension was
taken to measure the absorbance (A final), and broth was used as
The freshly grown probiotic bacterial cells in MRS broth at 35°C for reference (Del Re et al., 2000; Tomás et al., 2005). The estimation
24 h were harvested (1) and the cell pellet washed with PBS and was performed in replicate. To calculate cellular autoaggregation
resuspended in PBS. An absorbance of ~0.5 at 600 nm (A initial) was index, the difference in percentage between the initial and final
taken. Then the suspension was centrifuged and the pellet was absorbance was recorded as follows:
resuspended in equal volume of removed broth (in 1). The mixture
Caco-2 Cells Adhesion Assay Preparation of cell suspension for microencapsulation
Adhesion of probiotic isolates was estimated using method of All the previously Isolated Probiotic cultures (Hassan and
Jacobsen et al. (Jacobsen et al., 1999). with Caco-2 cells (105) and Chaudhry, 2013) were prepared, from frozen stocks stored at
the estimation was performed in replicate. −80°C, by transfering into MRS broth, then cultures were incubated,
Figure 1. Overview of adopted microencapsulation technique.
in anaerobic conditions, at 35°C for 18 h. After incubation, media 2008) by adding to 36 mL of the pancreatin- bile mixture (containing
were centrifuged for 10 min at 4°C, and cells were washed with 1 mg/mL pancreatin and 4.5 g/mL of bile salts in phosphate buffer) ,
sterile 0.1% (w/v) pepton water. and pH was adjusted to 7.4. The mixture was then incubated for 4 h
at 35°C.
Microencapsulation
Statistical analysis
For microencapsulation, firstly the cells were coated with Ca-
alginate by the emulsion method of Ortakci (Ortakci et al., 2012) The data observed in in vitro adherence studies as well as the
and stored in pepton-saline solution at 4°C until use. Later, the logarithmic reductions in free (control), single encapsulated and
alginate -encapsulated probiotic cells were coated with the mixture double encapsulated bacterial cells as a consequence of acidic
of prebiotics, containing FOS, MOS, GOS and free cells were used (SGJ-A and SGJ-B) and bile (SIJ) juices were analyzed by one-way
as control. The overall adopted technique for microencapsulation is ANOVA using SPSS 17 version. Significance was declared at P ≤
shown in Figure 1. 0.05.
Survival evaluation in simulated gastric juice (SGJ) RESULTS AND DSCUSSION
To investigate the effect of pH, same as that of Gastric juice, on the In vitro adherence studies of potential indigenous
survival of indigenous encapsulated probiotic bacteria, the cells probiotic strains
were treated (for 120 min ) with sterile stimulated Gastric Juice -A
(SGJ -A) as followed by Mainville et al. (Mainville et al., 2005)
containing 2.0 g/kg of NaCl and 0.3 g/kg of pepsin in M HCl (~pH Cell surface hydrophobicity
1.4) and sterile stimulated Gastric Juice- B (SGJ -B) containing 0.9
M H3PO4 (pH 2.0) instead of HCl. The investigations has revealed that the probiotic cell
adhesion on the gut lining is considered as an important
Survival evaluation in simulated intestinal juice (SIJ)
requirement for delivering health based benefits and the
estimation of surface hydrophobicity is the best technique
After treatment in SGJ for 60 min, the mixture was converted to to determine this adherence and colonization potential
simulated intestinal juice (Huang and Adams 2004; Annan et al. (Kaushik et al., 2009). Therefore, the indigenous probiotic
Hassan et al. 769
Table 1. Cell surface hydrophobicity, aggregation, and cell adhesion evaluation of selected
indigenous probiotic Isolates.
Hydrophobicity (%)
Isolate Aggregation (%) Adhesion ratio (%)
n- hexadecane Xylene
L. acidophilus 56.3 ± 0.10 56.1 ± 0.04 36.1 ± 0.13 7.2 ± 0.10
L. lactis 49.1 ± 0.06 49.3 ± 0.08 34.9 ± 0.14 8.3 ± 0.09
L. casei 52.7 ± 0.21 52.3 ± 0.01 31.7 ± 0.09 7 ± 0.12
L. rhamnosus 47.3 ± 0.14 47.3 ± 0.09 41.3 ± 0.98 8.1 ± 016
L. brevis 43.1 ± 0.12 43.5 ± 0.03 32.6 ± 0.01 8.5 ± 0.32
L. lactis (b) 37.5 ± 0.19 37.6 ± 0.13 40.9 ± 0.12 7.9 ± 0.63
L. rhamnosus (b) 39.1 ± 0.24 39.1 ± 0.17 51.9 ± 0.07 7.4 ± 0.42
L. acidophilus(b) 34.9 ± 0.14 34.1 ± 0.74 37.9 ± 0.07 7.1 ± 0.31
L. brevis (b) 33.4 ± 0.14 33.6 ± 0.79 56.1 ± 0.03 6.9 ± 0.17
L. casei (b) 36.7 ± 0.18 36.2 ± 0.18 48.0 ± 0.04 8.6 ± 0.78
B. bifidus 29.1 ± 0.21 29 ± 0.06 49.2 ± 0.08 8.2 ± 0.91
B. infantis 39.7 ± 0.17 39.1 ± 0.08 32.9 ± 0.06 7.9 ± 0.19
B. longum 51.3 ± 0.78 51.6 ± 0.07 32.5 ± 0.02 8.1 ± 0.17
B. dentum 46.7 ± 0.98 46.7 ± 0.17 33.3 ± 0.07 7.6 ± 0.63
B. brevis 31.5 ± 0.15 31.3 ± 0.04 31.8 ± 0.03 7.3 ± 0.71
B. adoles 38.4 ± 0.18 38.1 ± 0.09 40.7 ± 0.07 7.1 ± 0.44
L. plantum 36.6 ± 0.24 36.1 ± 0.13 49.6 ± 0.05 7.2 ± 0.19
L. reteri 28.1 ± 0.27 28.6 ± 0.19 31.9 ± 0.03 6.1 ± 0.13
L. gasseri 35.5 ± 0.17 35.5 ± 0.19 35.1 ± 0.10 6.9 ± 0.22
L. fermentum 39.6 ± 0.12 39.6 ± 0.27 31.7 ± 0.09 7.5 ± 0.26
isolates were also analysed for the adherence studies in persistence of probiotic bacteria in the host GI tract
this study. The mean with standard deviation of triplicate (Boekhorst et al., 2006b) (Boekhorst et al., 2006a). It has
experiments are presented in Table 1. It has been found also been investigated that after adherence in the gut
that there was no significant difference in the hydro- lining, the probiotic bacteria got the ability of aggregation
phobicity of both solvents used. All the recorded readings and colonization for health promoting benefits.
found in line with Kaushik et al. (Kaushik et al., 2009). In Vandevoorde et al. (1992) has also reported that the
the present estimation, the hydrophobicity was found with cellular aggregation not only facilitates the colonization
mixed trend, the indigenous Lactobacillus acidophilus but also provide a protection to the host by formatio of
was found with highest cell surface hydrophobicity biofilm (Vandevoorde et al., 1992) and this biofilm
(56.3%) and lowest was found in Lactobacillus reuteri formation is important for functioning of probiotics (Ocaña
(28.1%). Previous research has revealed that some and Nader-Macias, 2001; Kos et al., 2003; Cesena et al.,
lactobacillus strains show low cell surface hydrophobicity 2001). In the present study, the mean and standard
to 2-5% (Schillinger et al., 2005; Rijnaarts et al., 1993) deviation of percentages of triplicate experiment for cell
but neither of the isolated strain showed such a low aggregation of all indigenous isolates were recorded and
hydophobicity percentage. Kaushik et al. (2009) has presented in Table 1. The highest percentage was
clamied that hydrophobicity plays a vital role in the observed in L. rhamnosus (51.9%) followed by L. brevis
cellular interaction. This great difference in the hydo- with the percentage of 56.1 while the least was found in
phobicity percentage could be due to the difference in the two isolates L.casei and L.fermentus with the similar
cell surface protein expression that may be due to the value of 31.7%. The cell aggregation study was also
variation in environmental conditions(Tomás et al., 2005; concluded by Kaushik et al (Kaushik et al., 2009) but they
Ramiah et al., 2007). did not find such a high potential of self-aggregation in
their indigenous strain of Lactobacillus plantarum.
Cell auto-aggregation
Cell adhesion assay
The reports have highlighted the presence of four mucus-
binding proteins genome in Lactobacillus plantarum The mean and standard deviation of cell adhesion assay
inclding the longest gene, ORF lp_1643 containing six of selected indigenous isolates are given in Table 1, the
repeats. These proteins helps in the adherence and the highest percentage was observed by L. casei (8.6%)
Table 2. Probiotic bacterial count for Free, Single and Double Encapsulated bacteria during storage.
Control Single-encapsulated Double-encapsulated

Time (day)
(Mean CFU × 108/g) ±SD (Mean CFU × 108/g) ±SD (Mean CFU × 108/g) ±SD
0 2.45 ± 0.20 2.98 ± 0.21 3.16 ± 0.18
7 2.52 ± 0.14 2.92 ± 0.18 3.32 ± 0.09
14 2.68 ± 0.19 3.12 ± 0.23 3.41 ± 0.17
21 2.74 ± 0.27 3.29 ± 0.40 3.68 ± 0.23
28 2.63 ± 0.23 3.36 ± 0.23 3.73 ± 0.71
35 1.91 ± 0.20 3.29 ± 0.16 3.84 ± 0.20
42 0.71 ± 0.19 3.14 ± 0.14 3.83 ± 0.20
followed by isolate L. brevis with the percentage of 8.5% combination of Ca-alginate and prebiotics significantly
while the least was found in isolates Lactobacillus lactis improves the viability of probiotic cells in the harsh gastro-
with the value of 6.1%. The results of cell surface hydro- intestinal conditions.
phobicity, cell auto-aggregation and cell adhesion assay These microencapsulated indigenous probiotic cutlures
for the selected indigenous probiotic isolates suggests can be used in food technology and production as it provides
that these isolates have specific interaction and coloni- a solution to the low viability of probiotics incorporated in
zation potential in the gut that is also indicated by good local dairy products. Ideally these cultures, since have
adhesion ratio while using Caco-2 cell lines, as matches adherence potential, can maintain the level of the bene-
the conclusions of Kaushik on lactobacillus strains ficial probiotic bacteria at the minimum standard amount
(Kaushik et al., 2009). required (Akhiar and Aqilah, 2010).
This study showed significant effects on the survival of
free cultures in both SGJ-A and SGJ-B while the loss was
higher in single microencapsulated L. plantarum and Microencapsulation and survival studies of
Lactobacillus paracasei while negligible loss was indigenous probiotic strains
observed for double- microencapsulated cells. The zero
loss was found in the mean probiotic count (cfu/g) of
Lactobacillus delbrueckii subsp. Bulgaricus and L. The mean and standard deviation experiments conducted
paracasei. While a slight revival was observed in the free in triplicate for the free, single (Ca- alginate) and double
and single encapsulated bacteria in SIJ probably (Ca- alginate and prebiotics amagum) microencapsula-
because of resuscitation of some injured cells because of tion are shown in Table 2 and count was performed on
acidic conditions. The adherence studies reveal that seven day interval for the period of six weeks. The rate of
there is significant potential of health benefits of the reduction of probiotic bacterial count (CFU/g) was calcu-
isolated indigenous probiotic cultures and the lated by the following formula;
All the individual cultures of Lactobacillus and Bifidobac- The present investigation also endorsed the results of
terium as well as the mixed culture of both showed simi- Yeo and Liong that a significant increase in the count for
lar response as that was investigated by Sultana et al. L. acidophillus FTDC 8033 and Lactobacillus sp. FTDC
(2000), Kailasapathy et al. (2002), Vivek et al. (2013) and 2113 in soy milk when supplemented with prebiotic (FOS)
Chen et al. (2005), and proved the potential of microen- upto 7- log CFU/ml (Yeo and Liong, 2010). According to
capsulation for protecting the indigenous probiotic bacte- Ding and Shah, probiotic bacteria encapsulated in algi-
rial cells. The adopted double encapsulation technique nate, xanthan gum, and carrageenan gum survived better
has presented a significant effect (P< 0.05) on the survi- (P < 0.05) than free probiotic bacteria, in acidic environ-
val of probiotic indigenous cells during storage of six ment (Ding and Shah, 2009), which also justifies the sig-
weeks. In the case of free cells, which were used as a nificance of present study. In fact, it has been investiga-
control, the reduction in the mean count was observed on ted that prebiotics (fructooligosaccharides, iso-maltooligo-
day 28, single encapsulated on day 35 while the double saccharides and lactulose) is an emerging alternative that
encapsulated bacterial cells was decreased from 3.84 × can further enhance probiotic activity and they enhance
8 8
10 on day 35 to 3.83 × 10 on day 42. the growth of probiotics by providing carbon and nitrogen
Hassan et al. 771
Figure 2. Mean loss in Lactobacillus count (Log 10 cfu/g) for free (control), Single encapsulated and Double Encapsulated
bacteria in SGJ- A. Lactobacillus lactis AH-1 Lactobacillus reuteri AH-2 , Lactobacillus acidophilus AH-3, Lactobacillus
rhamnosus AH-4 Lactobacillus casei AH-5, Lactobacillus plantarum AH-6 and Lactobacillus brevis AH-7.
sources which can increase their colonization of the gut count for uncoated free bacterial cells while the coated
(Annan et al., 2008). bacterial cells, either single or double microencapsulated,
However, the symbiotic effects of probiotics and prebio- had a negligible reduction.
tics are strain-dependent. As Yeo Siok had reported dif- In the case of single microencapsulated probiotics, the
ferent growth behaviours for six different strains of loss was high L. plantarum AH-6 and Lactobacillus brevis
lactobacilli and bifidobacteria when supplemented with AH-7 that is, 2.29 × 102 and 3.24 × 102, respectively. The
five different prebiotics. Lactobacillus spp. FTDC 2113 bacterial loss was negligible in the case of double- micro-
grew significantly when supplemented with FOS but did encapsulated bacterial cells. The zero loss was found in
not grow with pectin (Yeo and Liong, 2010). In the pre- the mean microbiological count (cfu/g) of L. reuteri AH-2
sent study the mixture of encapsulated bacteria has and L. reuteri AH-7 after the incubation of 2 h in SGJ-A.
showed higher growth in the presence of prebiotics. The The results of bifidobacterium cultures are shown in
survival of double microencapsulated probiotics not only Figure 4 for SGJ-A.
proves the statement of Rabanel et al. that both the algi- This rapid reduction in count of free bacterial cells,
nate and prebiotics are compatible with probiotics (Rabanel when incubated for 120 min in stimulated Gastric Juice -A
et al., 2009) but also justifies the claim of Chen Kun-Nan (SGJ-A), was the function of low pH (1.4) and acidic con-
et al. (2005) that the Survival rate of the co-encapsulated ditions, which is similar to the pH of the human stomach
active probiotics increases 1000 times higher than for before ingestion of food. the main reason of rapid loss
alginates alone. was that no protection was provided to free cells in such
a harsh acidic environment. The technique of double
microencapsulation, both with Ca- alginate and prebiotics
Simulated gastric Juice (FOS and IMO) showed amazing results in the case of L.
reuteri AH-2 and Lactobacillus brevis AH-7 as compared
The stimulated Gastric Juice (SGJ-A) has shown a signi- to the negligible loss of bacterial count was observed in
ficant reduction on the free probiotic cell (Figure 2). Initial the case of other probiotic isolates. It proves the potential
mean count for free cells was 2.45 × 108 cfu/g which had in technique of double microencapsulation. Under the
3 4 2 1
lost 1.09 × 10 , 1.04 × 10 , 2.01 × 10 , 2.74 × 10 , 2.56 × double microencapsulated probiotic cells, the survival of
2 1 2
10 , 1.76×10 and 1.99 × 10 for L. lactis AH-1, L. reuteri bacteria was significantly greater than free and single-
AH-2, L. acidophilus AH-3, Lactobacillus rhamnosus AH- microencapsulated bacterial cells. This supports the notion
4, Lactobacillus casei AH-5, L. plantarum AH-6, and that it is prime to test the probiotics in the proper physio-
Lactobacillus brevis AH-7, respectively. logical conditions as bacterial survival is greatly influen-
The results of the survival evaluation of free cells, ced by variations in pH (Mainville et al., 2005; Pitino et
Single encapsulated and double encapsulated probiotics al., 2010). This agrees with the findings of Sharp (Sharp
in stimulated Gastric Juice B, shown in Figure 3. The et al., 2008) who observed a 3.8-log reduction after
results indicated that the pH 2.0 resulted in great loss in two hours of incubation in SGJ.
Figure 3. Mean loss in Lactobacillus count (Log 10 cfu/g) for free (control), Single encapsulated and Double
Encapsulated bacteria in SGJ-B. L. lactis AH-1, Lactobacillus reuteri AH-2, Lactobacillus acidophilus AH-3 ,
Lactobacillus rhamnosus AH-4 , Lactobacillus casei AH-5 , Lactobacillus plantarum AH-6 , and Lactobacillus brevis
AH-7.
Figure 4. Mean loss in bifidobacterium and two lactobacillus strains count (Log 10 cfu/g) for free (control), Single
encapsulated and Double Encapsulated bacteria in stimulated Gastric Juice B (120 min incubation).
Again the great loss of free probiotic cells was found in H3PO4 (SGJ-B) was useful to provide a buffering effect
the SGJ-B as compared to single and double - micro- when the bacteria were present in a uncoated form espe-
encapsulation. The in vitro test of gastric survival using cially. The results of SGJ-B for the bifidobacterium isolates
Hassan et al. 773
Figure 5. Mean loss in bifidobacterium and two lactobacillus strains count (Log 10 cfu/g) for free (control), Single
encapsulated and Double Encapsulated bacteria in stimulated Gastric Juice B (120 min incubation).
Figure 6. Mean loss in Lactobacillus isolates (Log 10 cfu/g) for free (control), Single encapsulated and Double
Encapsulated bacteria in SIJ. L. lactis AH-1, Lactobacillus reuteri AH-2, Lactobacillus acidophilus AH-3,
Lactobacillus rhamnosus AH-4, Lactobacillus casei AH-5, Lactobacillus plantarum AH-6 and Lactobacillus brevis
AH-7 .
are shown in Figure 5. tion of bile-pancreatin mixture. The acids of the SGJ-A
and SGJ-B both were unable to provide any significant
protective effect for the control and single micro-encap-
Simulated intestinal juice (SIJ) sulated probiotics. A slight increase may be the resus-
citation of some cells that were sublethally injured during
The Mean loss in probiotic count (Log 10 cfu/g) for the 160 min of incubation of SGJ, while the zero loss was
control, single encapsulated and double encapsulated found in the case of double microencapsulated bacterial
probiotics in stimulated Intestinal Juice (pH 7.4) are cells.
shown in Figure 6. A slight recovery of free and single Bifidobacterium breve and Bifidobacterium longum
encapsulated bacterial strains was found after the addi- were encapsulated by Picot and Lacroix, who found
Figure 7. Mean loss in bifidobacterium and two lactobacillus strains count Log 10 cfu/g) for free (control), Single
encapsulated and Double Encapsulated bacteria in SIJ.
results similar to the present study. They reported that Bifidobacterium adolescentis 15703T during exposure to
simulated gastro-intestinal conditions. Food Res. Int. 41(2):184-193.
this approach is potentially useful for delivery of viable
Boekhorst J, Helmer Q, Kleerebezem M, Siezen RJ (2006a). Compa-
probiotics to the gastrointestinal tract of humans (Picot rative analysis of proteins with a mucus-binding domain found
and Lacroix 2004). After incubation in simulated gastric exclusively in lactic acid bacteria. Microbiol. 152(1):273-280
(1 h) and intestinal juices (pH 7.4, 4 h), the number of Boekhorst J, Wels M, Kleerebezem M, Siezen RJ (2006b). The pre-
probiotic B. adolescentis the surviving cells was found dicted secretome of Lactobacillus plantarum WCFS1 sheds light on
interactions with its environment. Microbiol. 152(11):3175-3183
high (Annan et al. 2008) showing similarity with the pre- Cesena C, Morelli L, Alander M, Siljander T, Tuomola E, Salminen S,
sent study. The results of SIJ for the bifidobacterium and Mattila-Sandholm T, Vilpponen-Salmela T, Von W right A (2001). 
two lactobacillus isolates are shown in Figure 7. Lactobacillus crispatus and its Nonaggregating Mutant in Human
Colonization Trials. J. Dairy Sci. 84(5):1001-1010
This study showed significantly adverse effects on the
Chávarri M, Marañón I, Ares R, Ibáñez FC, Marzo F, Villarán MdC
survival of free cultures in both SGJ-A and SGJ-B while (2010). Microencapsulation of a probiotic and prebiotic in alginate-
the loss was higher in single microencapsulated L. chitosan capsules improves survival in simulated gastro-intestinal
plantarum AH-6 and Lactobacillus brevis AH-7 while conditions. Int. J. Food Microbiol. 142(1):185-189
Chen CC, Walker WA (2005). Probiotics and prebiotics: role in clinical
negligible for double- microencapsulated cells. The zero disease states. Adv. Pediatr. 52:77-113
loss was found in the mean microbiological count (cfu/g) Chen KN, Chen MJ, Liu JR, Lin CW, Chiu HY (2005). Optimization of
of L. reuteriAH-2 and Lactobacillus brevis AH-7. While a incorporated prebiotics as coating materials for probiotic
slight revival was observed in the free and single encap- microencapsulation. J. Food Sci. 70(5):M260-M266
sulated bacteria in SIJ probably because of resuscitation Del Re B, Sgorbati B, Miglioli M, Palenzona D (2000). Adhesion,
autoaggregation and hydrophobicity of 13 strains of Bifidobacterium
of some injured cells because of acidic conditions. The longum. Lett. Appl. Microbiol. 31(6):438-442.
findings reveal that the combination of Ca-alginate and Favaro-Trindade C, Grosso C (2002) Microencapsulation of L.
prebiotics significantly improve the viability of bacterial acidophilus (La-05) and B. lactis (Bb-12) and evaluation of their
survival at the pH values of the stomach and in bile. J. Microencaps
cells in the harsh gastrointestinal conditions and may be
19(4):485-494.
of use for the food and/or pharmaceutical industries. In Hassan A, Chaudhry MN (2013) Culture-dependent and culture-
the nutshell, the results of survival studies reveals that independent techniques to identify lactic acid bacteria in fermented
incurporation of ca- alginate and prebiotic amalgum has products. Afr. J. Microbiol. Res. 7(30):3983-3987
Homayouni AA, Ehsani A, Yarmand M, Razavi MSH (2008). Effect of
improved viability of probiotics.
microencapsulation and resistant starch on the probiotic survival and
sensory properties of symbiotic ice cream. Food Chem. 111:50-55.
Huang Y, Adams MC (2004). In vitro assessment of the upper
REFERENCES gastrointestinal tolerance of potential probiotic dairy propionibacteria.
Int. J. Food Microbiol. 91(3):253-260.
Akhiar M, Aqilah NS (2010). Enhancement of probiotics survival by Jacobsen CN, Nielsen VR, Hayford A, Møller P, Michaelsen K,
microencapsulation with alginate and prebiotics. MMG 445 Basic Paerregaard A, Sandström B, Tvede M, Jakobsen M (1999).
Biotechnol. eJ. 6 (1) Screening of probiotic activities of forty-seven strains of Lactobacillus
Annan N, Borza A, Hansen LT (2008). Encapsulation in alginate-coated spp. by in vitro techniques and evaluation of the colonization ability of
gelatin microspheres improves survival of the probiotic five selected strains in humans. Appl. Environ. Microbiol. 65(11):
Hassan et al. 775
4949-4956. Rijnaarts HH, Norde W, Bouwer EJ, Lyklema J, Zehnder AJ (1993).

Kailasapathy K (2002). Microencapsulation of probiotic bacteria: Bacterial adhesion under static and dynamic conditions. Appl.
technology and potential applications. Curr. Issues Intestinal Environ. Microbiol. 59(10):3255-3265.
Microbiol. 3(2):39-48. Rosenberg M, Gutnick D, Rosenberg E (1980). Adherence of bacteria
Kailasapathy K (2009). Encapsulation technologies for functional foods to hydrocarbons: a simple method for measuring cell‐surface
and nutraceutical product development. CAB Reviews: Perspectives hydrophobicity. FEMS Microbiol. Lett. 9(1):29-33.
in agriculture, veterinary science, nutrition and natural resources Saarela M, Lähteenmäki L, Crittenden R, Salminen S, Mattila-Sandholm
4(033):1-19. T (2002). Gut bacteria and health foods - the European perspective.
Kaushik JK, Kumar A, Duary RK, Mohanty AK, Grover S, Batish VK Int. J. Food Microbiol. 78(1):99-117.
(2009). Functional and probiotic attributes of an indigenous isolate of Schillinger U, Guigas C, Heinrich Holzapfel W (2005). In vitro
Lactobacillus plantarum. PloS one 4(12):e8099. adherence and other properties of lactobacilli used in probiotic
Kos B, Šušković J, Vuković S, Šimpraga M, Frece J, Matošić S (2003). yoghurt-like products. Int. Dairy J. 15(12):1289-1297.
Adhesion and aggregation ability of probiotic strain Lactobacillus Sharp M, McMahon DJ, Broadbent J (2008). Comparative Evaluation of
acidophilus M92. J. Appl. Microbiol. 94(6):981-987. Yogurt and Low‐Fat Cheddar Cheese as Delivery Media for Probiotic
Lian W-C, Hsiao H-C, Chou C-C (2003). Viability of microencapsulated Lactobacillus casei. J. Food Sci. 73(7):M375-M377.
bifidobacteria in simulated gastric juice and bile solution. Int. J. Food Shima M, Matsuo T, Yamashita M, Adachi S (2009). Protection of
Microbiol. 86(3):293-301. Lactobacillus acidophilus from bile salts in a model intestinal juice
Liaskovskii TM, Podgorskii VS (2005). [Assessment of probiotics by incorporation into the inner-water phase of a W/O/W emulsion.
according to the international organizations (FAO/WHO)]. Microbiol. Food Hydrocolloids 23(2):281-285.
J. 67(6):104-112. Sultana K, Godward G, Reynolds N, Arumugaswamy R, Peiris P,
Liserre AM, Ré MI, Franco BD (2007). Microencapsulation of Kailasapathy K (2000). Encapsulation of probiotic bacteria with
Bifidobacterium animalis subsp. lactis in modified alginate-chitosan alginate-starch and evaluation of survival in simulated gastrointestinal
beads and evaluation of survival in simulated gastrointestinal conditions and in yoghurt. Int. J. Food Microbiol. 62(1):47-55.
conditions. Food Biotechnol. 21(1):1-16. Thantsha MS, Cloete TE, Moolman FS, Labuschagne PW (2009).
Mainville I, Arcand Y, Farnworth E (2005). A dynamic model that Supercritical carbon dioxide interpolymer complexes improve survival
simulates the human upper gastrointestinal tract for the study of of B. longum Bb-46 in simulated gastrointestinal fluids.
probiotics. Int. J. Food Microbiol. 99(3):287-296. Int. J. Food Microbiol. 12(1):88-92.
O'riordan K, Andrews D, Buckle K, Conway P (2001). Evaluation of Tomás J, Wiese B, Nader‐Macías M (2005). Effects of culture
microencapsulation of a Bifidobacterium strain with starch as an conditions on the growth and auto‐aggregation ability of vaginal
approach to prolonging viability during storage. J. Appl. Microbiol. Lactobacillus johnsonii CRL 1294. J. Appl. Microbiol. 99(6):1383-
91(6):1059-1066. 1391.
Ocaña VS, Nader-Macias ME (2001). Vaginal lactobacilli: self-and co- Vandevoorde L, Christiaens H, Verstraete W (1992). Prevalence of
aggregating ability. Br J Biomed Sci 59 (4):183-190 coaggregation reactions among chicken lactobacilli. J. Appl.
Oliveira A, Moretti T, Boschini C, Baliero J, Freitas L, Freitas O, Favaro- Microbiol. 72(3):214-219.
Trindade C (2007). Microencapsulation of B. lactis (BI 01) and L. Vasiljevic T, Shah NP (2008). Probiotics - from Metchnikoff to
acidophilus (LAC 4) by complex coacervation followed by spouted- bioactives. Int. Dairy J. 18(7):714-728.
bed drying. Drying Technol. 25(10):1687-1693. Vivek K (2013). Use of encapsulated probiotics in dairy based foods.
Ortakci F, Broadbent J, McManus W, McMahon D (2012). Survival of Int. J. Food Agric. Vet. Sci. 3(1):188-199
microencapsulated probiotic Lactobacillus paracasei LBC-1e Yeo SK, Liong MT (2010). Effect of prebiotics on viability and growth
during manufacture of Mozzarella cheese and simulated gastric characteristics of probiotics in soymilk. J. Sci. Food Agric. 90(2):267-
digestion. J. Dairy Sci. pp. 6274-6281. 275. doi:10.1002/jsfa.3808
Parvez S, Malik K, Ah Kang S, Kim HY (2006). Probiotics and their
fermented food products are beneficial for health. J. Appl. Microbiol.
100(6):1171-1185.
Picot A, Lacroix C (2004). Encapsulation of bifidobacteria in whey
protein-based microcapsules and survival in simulated
gastrointestinal conditions and in yoghurt. Int. Dairy J. 14(6):505-515.
Pitino I, Randazzo CL, Mandalari G, Lo Curto A, Faulks RM, Le Marc Y,
Bisignano C, Caggia C, Wickham MSJ (2010). Survival of
Lactobacillus rhamnosus strains in the upper gastrointestinal
tract. Food Microbiol. 27(8):1121-1127.
Rabanel JM, Banquy X, Zouaoui H, Mokhtar M, Hildgen P (2009).
Progress technology in microencapsulation methods for cell therapy.
Biotechnol. Prog. 25(4):946-963.
Ramiah K, Van Reenen C, Dicks L (2007). Expression of the mucus
adhesion genes Mub and MapA, adhesion-like factor EF-Tu and bacteriocin gene plaA of Lactobacillus
plantarum 423, monitored with real-time PCR. Int. J. Food
Microbiol. 116(3):405-409.
Vol. 8(8), pp. 776-782, 19 February, 2014
DOI: 10.5897/AJMR2013.6576
Full Length Research paper
Screening novel diagnostic marker of Mycobacterium

tuberculosis
Xin Pan1,2*, Siliang Zeng1, Jialin Cai2, Bin Zhang3*, Boju Pan2, Zhonglei Pan2, Ying Wu2, Ying
Wang4, Yi Zhou1, Wei Fang2, Min Chen2, Wanqing Liao2, XiuZhen Yu1, Min Tao1, Jun Zhang1
and Wei Song1
1
Shanghai Junwei Fine Medical Club，58 Bao Tou Road, Shanghai 200433, China.
2
Second Military Medical University，800 Xiang Yin Road, Shanghai, 200433, China.
3
Qingpu Branch of Zhongshan Hospital, Fudan University, 1158 Gong Yuan Dong Road, Shanghai 201700, China.
4
Shanghai Jiao Tong University School of Medicine, 280 Chongqing South Road, Shanghai, 200025, China.
The aim of present study was to screen and evaluate the serodiagnostic value of the purified fusion
antigens of Mycobacterium tuberculosis (Mtb) by enzyme-linked immunosorbent assay (ELISA). A group
of vector system which was constructed by cloning Rv1908c, Rv0733, Rv0899, Rv1411c and Rv3914
gene of Mtb into the prokaryotic expression plasmid pET-32b was transformed into E. coli for induction
and expression fusion antigens to determine their potentiality in diagnostic application. Following
purification with the His-select nickel magnetic agarose beads, the expressed fusion proteins showed
purity via sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blot
technique. The ELISA plates were coated with these fusion antigens. Through ELISA, the antigen
binding with specific IgG levels between active TB patients and healthy controls was compared. The
purity and the size of the expressed fusion antigens were confirmed by the Western blot. The ELISA
results indicated that IgG levels against Rv1411c-6His, Rv3914-6His and Rv2031c-6His were significantly
higher in serum of active TB patients than in that of healthy controls. More interesting, the AUC value of
Rv3914-6His (0.7867) was higher than that of Rv2031c-6His (0.754) which was widely used in clinic. The
results implied that Rv3914-6His might be a useful candidate antigen in the diagnosis of Mtb infection,
especially for active pulmonary TB diagnosis. Its role in serodiagnosis of extra-pulmonary TB is still
needed to be validated.
Key words: Mycobacterium tuberculosis, expression and purification, antigen, serodiagnosis, tuberculosis.
INTRODUCTION
Tuberculosis (TB) is a chronic infectious disease mainly liver, spleen, kidney, spine, bone and skin which named
caused by Mycobacterium tuberculosis (Mtb). The extrapulmonary TB (EPTB) (Ireton et al., 2010). TB is
bacteria typically attack the lung parenchyma which currently the second-largest killer infectious agent after
named pulmonary TB (PTB) by the clinical manifestations human immunodeficiency virus (HIV). According to the
(Walzl et al., 2011). Mtb also can attack other part of the World Health Organization (WHO) statistics, China has
body such as lymph nodes, the central nervous system, the world's second largest tuberculosis epidemic
*Corresponding authors. E-mail: [email protected] and [email protected].

Pan et al. 777
(Wang et al., 2007). Therefore, it is very important to bacteria in intracellular nucleotide metabolism. Rv0899
develop new convenient, fast, high sensitivity and gene name is ompA，antigen name is outer membrane
specificity diagnosis methods to control the prevalence protein A, molecular mass is about 33.54 kDa, it may
and spread of tuberculosis． protect the integrity of the bacterium. Rv1411c gene
Although currently bacteriological culture is still consi- name is lprG, antigen name is conserved lipoprotein,
dered as the gold standard in clinical laboratory confirma- molecular mass is about 24.55 kDa, the function is still
tion of TB disease, the laboratory may need more time (4- unknown. Rv3914 gene name is trxC, antigen name is
6 weeks), and the rates of false-positive cultures are too thioredoxin, molecular mass is about 12.54 kDa, Thiore-
high, which are not suitable for clinical application doxin participates in various redox reactions. Enzyme-
(Kashyap et al., 2010). The newly developed GeneXpert linked immunosorbent assay (ELISA) plates were coated
MTB/RIF assay is a novel nucleic acid amplification with prokaryotic expression and purification of the five
diagnostic technique for the diagnosis of tuberculosis and antigens, respectively. An indirect ELISA was established
rapid detection of rifampicin (RIF) resistance in clinical for rapid comparison serum IgG responses to the five
specimens (Steingart et al., 2013). But this assay antigens respectively between patients with active tuber-
determined the presence or absence of Mtb or rifampicin culosis (TB group) and healthy physical examinees with
resistance, the activity of TB bacillus cannot be deter- non-tuberculosis (control group). Anti-Rv3914 IgG may
mined. The QuantiFERON®-TB gold in-tube or T-Spot TB become a potential important new serum marker for
test is an indirect test for measuring the release of active tuberculosis diagnosis.
interferon-gamma (INF-γ) from the patient's viable T
lymphocytes stimulated by a few Mtb-specific antigens
(early secreted antigenic target-6 and culture filtrate
protein-10) (Rose et al., 2012) . INF-γ release assays Plasmids and antigens
have excellent sensitivity and specificity with minimizing
subjective interpretation and operator bias. However, the The recombinant prokaryotic expressive plasmids pET-32b-Rv0733,
assays require expensive instrument, reagents and well pET-32b-Rv1411c, pET-32b-Rv1908c, pET-32b-Rv0899, pET-32b-
Rv3914 and Rv2031c-6His fusion antigen were kept in our
trained operators. These requirements restrict their use in laboratory.
China. Serodiagnosis has a long history and is charac-
terized by convenient specimens, low costs, and com-
monly used in clinical laboratories to test numerous TB Main Reagents and instruments
serum samples in a short time (Steingart et al., 2011).
Mouse monoclonal to 6×His tag antibody was purchased from
The antibody response to the 88 kDa, 65 kDa Hsp, 45 Abcam, USA. Prestained protein molecular weight marker was
kDa, 38 kDa lipoprotein (He et al., 2011), 16 kDa HSP purchased from Fermentas, Canada. IRDye 800CW goat anti-
(Senol et al., 2009), ESAT-6, CFP-10, and mouse IgG (H+L) was purchased from Licor Biosciences, USA.
lipoarabinomannan (LAM) (Ben Selma et al., 2010) Plasmid preparation kit and DNA gel extraction kit were purchased
antigens of Mtb was extensively studied by diagnostic from Axygen, USA. Isopropyl-β-D-thiogalactopyranoside (IPTG) and
His-select nickel magnetic agarose beads were purchased from
companies and used in the commercial serological tests
Sigma, USA. Alkaline phosphatase (AP)-affinipure goat anti-human
of TB infection (Flores et al., 2011). However, currently IgG (H+L) was purchased from Jackson ImmunoResearch, USA.
available commercial serodiagnostic tests provided incon- BL21 (DE3) PLySs competent cells was purchased from Takara,
sistent and imprecise findings, the WHO issued a policy Japan. Amicon ultra-2 centrifugal filter unit with ultracel-3 mem-
statement against the use of commercial serological tests brane was purchased from Millipore, USA. Odyssey infrared ima-
for the diagnosis of active PTB (WHO, 2011). Therefore, ging system was purchased from Licor Biosciences, USA. ELISA
plate reader was purchased from Corning Incorporated, USA.
accurate, rapid and inexpensive antibody-based tests for
TB diagnosis are needed urgently (Flores et al., 2011).
The Mtb immunoproteome analyses revealed sera from Prokaryotic expression and purification of His-Mtb fusion
TB mainly recognized membrane associated and extra- antigens
cellular proteins of the bacterial (Kunnath-Velayudhan et
Escherichia coli (E.coli) BL21 (DE3) PLySs was transformed with
al., 2010). In the study, the successful cloned genes of the recombinant plasmid pET-32b-Rv0733, pET-32b-Rv1411c, pET-
Mycobacterium tuberculosis envelope proteins Rv1908c, 32b-Rv1908c, pET-32b-Rv0899, pET-32b-Rv3914 and pET-32b-
Rv0733, Rv0899, Rv1411c and Rv3914 were selected for Rv2031c, respectively. Positive colonies were confirmed by DNA
expression and purification and screening serodiagnosis sequencing and performed to verify antigen expression.
antigens. Rv1908c gene name is KatG, antigen name is Two hundred (200) mL medium LB containing 50 μg/mL ampicillin
catalase-peroxidase- peroxynitritase T, molecular mass is was inoculated and incubated at 37°C with 200 rpm shaking to the
optical density (OD) value approximately 0.4～0.6 at 600 nm. IPTG
about 80.57 kDa, it may play a role in the intracellular
was added to a final concentration of 0.1 mmol/L for inducing
survival of mycobacteria within macrophages. Rv0733 expression. Shaking incubation was continued at 30°C for 6 h.
gene name is adk, antigen name is adenylate kinase, Bacterial cells were precipitated by centrifugation (7000 g for 3 min
molecular mass is about 20.09 kDa, it is essential for the at 4°C) and resuspended in 20 mL lysis buffer containing 50 mmol/L
NaH2PO4，300 mmol/L NaCl and 10mmol/L imidazole pH 8.0. The 1% gelatin in PBST for an hour at 37°C and followed by three
mixture was sonicated and centrifuged (8000 g for 30 min at 4°C). washings. Subsequently, 100 μL of diluted serum samples (1:100 in
The supernatant containing recombinant Mtb antigens named crude blocking buffer) was added. Following an incubation period of 1 h at
extracts were filtered through a 0.45 μm prefilter. His-select nickel 37°C, the wells were again washed and filled with 100 μL of a
magnetic agarose beads were uniformly suspended and added 1 1:2000 dilution of alkaline phosphatase-conjugated goat anti-human
mL to the filtrate protein. The mixture gently shaked overnight at immunoglobulin G. After incubation for 1 hr at 37°C, the plates were
4°C and the affinity gel washed with plenty of wash buffer again washed with PBST. The wells were filled with 100 μL of
containing 50 mmol/L NaH2 PO4, 300 mmol/L NaCl and 20 mmol/L substrate solution (1 mg/mL p-nitrophenylphosphate in 10% dietha-
imidazole pH 8.0. The sample was centrifuged and the supernatant nolamine buffer containing 0.5 mM MgCl2, pH 9.8). After 30 min
containing unbinding contaminating proteins was removed. The His- incubation at room temperature in darkness, the reaction was stop-
Tag-C-terminal protein was eluted from the beads with elution buffer ped by adding 50 μL /well of 2 M Na2CO3. The optical density (OD)
(50 mmol/L NaH2 PO4, 300 mmol/L NaCl, 300 mmol/L imidazole, pH of each well was measured at a wavelength of 405 nm in ELISA
8.0). Eluted fractions were transferred to Amicon Ultra-2 centrifugal plate reader. Immunogenic properties of the purified antigens identi-
filter unit with ultracel-3 membrane and centrifuged to remove the fication were done in ten-fold serial dilutions of serum samples.
imidazole and other small molecules. The ultrafiltered samples were
sterilized through 0.22 μm filter. The purified proteins were stored in
Statistical analysis
40% glycerin at -80°C.
Data were presented as means and standard errors (mean ± SD).
The cut-off value for the optical density (OD) of an ELISA was
SDS-PAGE and Western blotting determined by the mean value of healthy controls plus 3SD.
Comparisons between two groups were performed with GraphPad
The protein concentration of the crude extracts and the purified Prism 5 statistical analysis software using the Mann Whitney test,
protein was measured respectively using the Bradford method. An and the level P < 0.05 was considered statistically significant.
equal amount of total protein content was loaded on each lane and
separated by 10% sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS-PAGE), followed by staining at 37°C using RESULTS
Coomassie brilliant blue R-250. Rv3914 was used as a given
example for assessing the purity effect before and after purification. Prokaryotic expression, purification and
For Western blot analysis, five purified antigens were separated
by 12% SDS-PAGE and transferred to polyvinylidene difluoride
identification of five recombinant antigens of
(PVDF) membranes by semi-dry apparatus and nonspecific binding Mycobacterium tuberculosis
was blocked with PBS containing 3% bovine serum albumin (BSA).
The blots were probed with anti-6-His antibodies diluted 1:1000, Single colonies of BL21 (DE3) PlySs bacteria
and the immune complexes were visualized using goat anti-mouse transformed respectively by pET-32b-Rv0733, pET-32b-
IgG（H+L）IRDye 800 conjugate secondary antibody, according to Rv 1411c, pET-32b-Rv1908c, pET-32b-Rv0899 and pET-
the manufacturer’s instructions. Blots were digitally photographed 32b-Rv3914 were picked up from cultured plates and
using the Odyssey infrared imaging system. confirmed by DNA sequencing analysis. Recombinant
antigens expressed as COOH-terminally polyhistidine-
tagged fusion proteins were induced with IPTG and
Human serum collection
purified using His-select nickel magnetic agarose beads.
The research proposal was approved by the ethics committee of SDS-PAGE gels for Rv3914-6His given representative
Shanghai Junwei Fine Medical Club, China and all participants at sample visualization the level of purity required was
Shanghai pulmonary hospital, China provided written informed stained with Coomassie brilliant blue R-250. Taking the
consents. Thirty-four serum samples were collected from patients molecular weight of the 6×His tag (0.84kDa) and that of
with confirmed diagnosis active pulmonary tuberculosis and thirty-
Rv3914 antigen (12.54 kDa) into account, the size of the
five serum samples were obtained from healthy physical exami-
nees. The patients had clinical symptoms，radiological signs of TB, purified protein showed an expected size of protein band
acid-fast stain test of sputum smear, as well as positive culture for of 13.38 kDa (Figure 1).
Mycobacterium tuberculosis. Serum samples as healthy controls Based on the Western blot assay, all of the five purified
were obtained from healthy physical examinees with no apparent native fusion proteins could be recognized by His
signs of any disease and tuberculosis diagnoses ruled out. monocolonal antibodies and the expected bands were
present respectively (Figure 2). These fusion proteins
were Rv0899-6His (34.38 kDa), Rv0733-6His (20.93
Detection the relative antibody in serum by indirect enzyme-
kDa), Rv1908c-6His (81.41 kDa), Rv1411c-6His (25.39
linked immunosorbent assay
kDa) and Rv3914-6His (13.38 kDa), respectively.
Flat-bottom 96-well Costar plates were coated with 100 μL/well of
each purified antigen at a concentration of 1μg/mL in carbonate Reactivities evaluation of recombinant antigens to
buffer (15mM Na2CO3, 35mM NaHCO3, pH9.6). The positive control
was Rv2031c (16 kDa HSP) -6His antigen, the negative control was
human serum specimens
serum of healthy physical examinees and blank control was
phosphate-buffered saline (PBS). After overnight incubation at 4°C, A total of 34 serum samples were collected from 34 patients
these antigen-coated wells were washed 3 times with PBS, with a confirmed diagnosis of pulmonary tuberculosis at
containing 0.05% Tween 20 (PBST), blocked with blocking buffer of Shanghai pulmonary hospital between 2009 and 2010.
Pan et al. 779
serum specimens were interpreted based on the ELISA

assays. For ELISA the positive control antigen Rv2031c-
6His (Figure 3) and the representative antigens Rv3914-
6His (Figure 4) were used. Rv2031c, the 16 kDa heat
shock protein (HSP), one of the three well known diag-
nostic antigen (Senol et al., 2009), was shown to be
specific and sensitive for detecting antibodies against M.
tuberculosis. The antigens were coated onto 96-well mic-
roplates. A total of 7 human sera were used in this assay,
of which 6 serum specimens were from active TB
patients, whereas 1 was from healthy individual. Ten-fold
serial dilutions of the sera were examined, all reactions
were run three times. The results revealed that the puri-
fied native Rv3914-6His antigen showed substantial reac-
tivity to active-TB specimens. The OD value of active-TB
specimens was significantly increased (0.88-fold for
Rv2031c-6His, t=-15.433, P=0.0001; 0.72-fold for
Rv3914-6His, t =-8.513, P=0.0004) in microwell plate
coated with the antigens at the concentration of 1μg/mL
Figure 1. Expression and purification as compared with the concentration of 0.1 μg/mL. The
of Rv3914-6His fusion protein detected recombinant antigens concentration of 1 μg/mL for ELISA
with SDS-PAGE studies was selected as working coated concentration in
1:Protein marker; 2:Lysates of pET-
the following studies.
32b-Rv3914/BL21(DE3) PlySs with
IPTG induction; 3: Purified native
Rv3914-6His fusion protein. ELISA screening of purified recombinant antigens for
TB diagnosis
After confirming the reactivity of purified fusion antigen, a

total of 69 human serum samples were assayed by
ELISA using the five recombinant antigens, respectively.
The Rv2031c-6His (16 kDa antigen) fusion protein was
included in the assay system as a positive control for
specificity and sensitivity. Each assay was repeated three
times. These sera consisted of 34 samples from active
TB patients, and 35 samples from healthy physical exa-
minees. The profiles of IgG antibodies against of these
purified fusion Mtb antigens were estimated by indirect
ELISA in these human serum samples collected (Figure
5). The ELISA with Rv3914-6His, Rv1411c-6His and
Rv2031c-6His fusion antigens were useful to discriminate
positive and negative TB, a statistically significant dif-
Figure 2. The identification of five kinds of Mtb fusion ference in IgG level were found between healthy controls
antigens by two-color infrared fluorescence and TB patients (PRv3914c-6His=0.0001, PRv1411c-6His=0.0043
1:Protein marker; 2: Purified Rv0899c-6His fusion and PRv2031c-6His=0.0004, respectively). There was no
protein; 3: Purified Rv0733-6His fusion protein; 4:
significant difference in the levels of anti-Mycobacterium
Purified Rv1908c-6His fusion protein；5: Purified
Rv1411c-6His fusion protein; 6: Purified Rv3914-6His
tuberculosis antibody IgG from those of serum specimens
fusion protein. from healthy controls and from active TB individuals by
ELISA with Rv0899-6His, Rv0733-6His and Rv1908c-6His
fusion antigens (PRv0899-6His=0.1398, PRv0733-6His=0.3060
and PRv1908c-6His = 0.0691, respectively).
The clinical and laboratory characteristics of the TB pa- Receiver operating characteristic (ROC) curves is a
tients and healthy controls were summarized in Table 1. graph of sensitivity on the y-axis against 100-specificity
Serum samples as control group were obtained from on the x-axis. It is an excellent way to evaluate the
healthy individuals (n=35) with tuberculosis diagnoses clinical diagnostic value of given biomarker. ROC curves
ruled out. were plotted using GraphPad Prism 5. The areas under
The reactivities of recombinant antigens to human serum the summary ROC curve (AUC) of Rv3914-6His,
Table 1. Clinical and experimental parameters of research cohort.
Clinical and laboratory characteristic Active tuberculosis patients (n=34) Healthy controls (n=35)
Age (years ±SD) 45.4 ± 18.6 42.8 ± 16.2
Sex (male/female) 12/22 24/11
Duration of symptoms (months ±SD) 19.18 ± 2.61 －
Treatment (months ±SD) 2.45 ± 0.12 －
Smear positive 20 －
Sputum culture positive 25 －
Purified protein derivative (PPD) positive 16 －
Cavity positive 13 －
Concentration of Rv2031c-6His antigen (μg/mL)

Figure 3. Detection of serum IgG against with Rv2031c-6His
fusion protein by indirect ELISA. TB: tuberculosis patients;
HC: protein by indirect ELISA. TB: tuberculosis patients；HC:
Figure 5. Detection of serum IgG against with Mtb
healthy physical examinees.
antigen-6His fusion protein by indirect ELISA. TB: tuber-
culosis patients (n=34)；HC: healthy physical examinees
(n=35).
Rv1411c-6His and Rv2031c-6His ROC were 0.7867,

0.5867 and 0.754, respectively (Figure 6). An AUC of
0.75 or greater is generally considered a good biomarker.
Antibody response to the 16 kDa heat shock protein in
active TB has been used in assist diagnosis of infectious
Mtb (Senol et al., 2009). It was suggested that Rv3914
recombinant protein could be potentially used for the
diagnosis of tuberculosis and as a candidate antigen.
DISCUSSION
In recent years，due to movement of population, pro-

Concentration of Rv3914-6His antigen (μg/mL)
blems of multi-drug resistant TB and TB-HIV co-infection,
Figure 4. Detection of serum IgG against with Rv3914-6His
tuberculosis continues to be one of major public health
fusion protein by indirect ELISA. TB: tuberculosis patients; burden in China．Rapid and effective diagnosis of infec-
HC: protein by indirect ELISA. tious cases is crucial to facilitate earlier treatment initiation
Pan et al. 781
TB: tuberculosis patients (n=34)；HC: healthy physical examinees (n=35)

150 Rv1411c-6His 150 Rv2031c-6His 150 Rv3914-6His
Sensitivity%
Sensitivity%
Sensitivity%
100 100 100
50 50 50
0 0 0
0 20 40 60 80 100 0 20 40 60 80 100 0 20 40 60 80 100
100% - Specificity% 100% - Specificity% 100% - Specificity%
Figure 6. ROC curves of Mtb 6His fusion antigens in the diagnosis of TB.
and reducing disease transmission and preventing emer- plates, respectively. It has been reported previously that
gence of resistant strains (Kaushik et al., 2012). mutations in the three antigens’ gene lead to reduce
The aim of this study was to screen a specific diagnos- virulence and may cause reduced survival of Mtb in host
tic marker from five envelope protein of Mtb which identi- tissues (Pym et al., 2002; Raynaud et al., 2002;
fied by proteomic studies (de Souza et al., 2011; Forrellad Bellinzoni et al., 2006). These antigens might really begin
et al., 2013). The envelop antigens，such as Rv1908c their work when Mtb were engulfed by macrophages.
(Escalante et al., 2013), Rv0899 (Marassi (2011) and Therefore, these antigens might be helpful for screening
Rv3914 (Akif et al., 2008), may play essential roles in the intracellular antibodies of Mtb.
intracellular growth and survival of Mtb within the host.
The expression and purification system of five fusion Authors’ contributions
proteins was successfully established and recombinant
fusion proteins with high purity and high yield was XP designed the research and wrote the paper; XP, SLZ,
obtained. The recombinant antigen’s native conformation JLC, BZ, BJP, ZLP, YW, YW, YZ, WF, MC, WQL, XZY,
with antibody binding activity may be lost due to prokar- MT, JZ, WS performed research.
yotic expression system, so the ELISA plates were
coated with gradient dilution antigens, and the collected
ACKNOWLEDGMENT
serums (dilution, 1:100) were used as primary antibodies.
The result showed the representative Rv3914-6His anti- This work was supported by National Key Basic Research
gen retained antibody-binding activity. The purified fusion Program of China Grants (Contract No. 2013CB531601)
antigens were potentially used as coated antigens in and National Natural Science Foundation of China Grants
ELISA assays. (Contract No. 30972633).
Serum specimens (including 34 cases of active TB
patients and 35 healthy physical examinees) were tested REFERENCES
for the presence of IgG antibodies against these five
antigens of Mtb using a quantitative ELISA. The results of Akif M, Khare G, Tyagi AK, Mande SC, Sardesai AA (2008). Functional
studies of multiple thioredoxins from Mycobacterium tuberculosis. J.
ELISA test showed good sensitivity for purified Rv3914- Bacteriol. 190(21):7087-7095.
6His and Rv1411c-6His antigen. The levels of antibodies Bellinzoni M, Haouz A, Graña M, Munier-Lehmann H, Shepard W, Alzari
against the two antigens were significantly higher in TB PM (2006). The crystal structure of Mycobacterium tuberculosis
2+
patients than in healthy individuals (PRv3914c-6His = 0.0001, adenylate kinase in complex with two molecules of ADP and Mg
PRv1411c-6His = 0.0043), respectively. Rv3914 could be supports an associative mechanism for phosphoryl transfer. Protein
Sci. 15(6):1489-1493.
selected as an adjunct for TB serodiagnostic assay Ben Selma W, Harizi H, Marzouk M, Ben Kahla I, Ben Lazreg F, Ferjeni
according to the ROC analysis, the AUC value for A, Harrabi I, Abdelghani A, Ben Said M, Boukadida J (2010). Rapid
Rv3914-6His is 0.7867 and similar to the value for detection of immunoglobulin G against Mycobacterium tuberculosis
antigens by two commercial ELISA kits. Int. J. Tuberc. Lung. Dis.
Rv2031c (AUC Rv2031c-6His=0.754 ). It would be of interest 14(7):841-846.
to further study how the Rv3914 and Rv2031c antigens de Souza GA, Leversen NA, Malen H, Wiker HG (2011). Bacterial
perform in combination. proteins with cleaved or uncleaved signal peptides of the general
There were no statistically significant differences bet- secretory pathway. J. Proteomics 75(2):502-510.
Escalante P, McKean-Cowdin R, Ramaswamy SV, Williams-Bouyer N,
ween the optical density values obtained with sera from Teeter LD, Jones BE, Graviss EA (2013). Can mycobacterial katG
TB patients and healthy controls with Rv1908c-6His, genetic changes in isoniazid-resistant tuberculosis influence human
Rv0899-6His or Rv0733-6His antigens-coated ELISA disease features? Int. J. Tuberc. Lung Dis. 17(5):644-651.
Flores LL, Steingart KR, Dendukuri N, Schiller I, Minion J, Pai M, Raynaud C, Papavinasasundaram KG, Speight RA, Springer B, Sander
Ramsay A, Henry M, Laal S (2011). Systematic review and meta- P, Bottger EC, Colston MJ, Draper P (2002). The functions of
analysis of antigen detection tests for the diagnosis of tuberculosis. OmpATb, a pore-forming protein of Mycobacterium tuberculosis. Mol.
Clin. Vaccine Immunol. 8(10):1616-1627. Microbiol. 46(1):191-201.
Forrellad MA, Klepp LI, Gioffré A, Sabio y García J, Morbidoni HR, de la Rose MV, Kimaro G, Nissen TN, Kroidl I, Hoelscher M, Bygbjerg IC,
Paz Santangelo M, Cataldi AA, Bigi F (2013). Virulence factors of the Mfinanga SG, Ravn P (2012). QuantiFERON®-TB gold in-tube
Mycobacterium tuberculosis complex. Virulence 4(1):3-66. performance for diagnosing active tuberculosis in children and adults
He XY, Li J, Hao J, Chen HB, Zhao YZ, Huang XY, He K, Xiao L, Ye LP, in a high burden setting. PLoS. One.7(7):e37851.
Qu YM, Ge LH (2011). Assessment of five antigens from Senol G, Ecevit C, Oztürk A (2009). Humoral immune response against
Mycobacterium tuberculosis for serodiagnosis of tuberculosis. Clin. 38- and 16-kDa mycobacterial antigens in childhood tuberculosis.
Vaccine Immunol.18(4):565-570. Pediatr. Pulmonol.44(9):839-844.
Ireton GC, Greenwald R, Liang H, Esfandiari J, Lyashchenko KP, Reed Steingart KR, Flores LL, Dendukuri N, Schiller I, Laal S, Ramsay A,
SG (2010). Identification of Mycobacterium tuberculosis antigens of Hopewell PC, Pai M (2011). Commercial serological tests for the
high serodiagnostic value. Clin. Vaccine Immunol. 17(10):1539-1547. diagnosis of active pulmonary and extrapulmonary tuberculosis: an
Kashyap RS, Ramteke SS, Gaherwar HM, Deshpande PS, Purohit HJ, updated systematic review and meta-analysis. PLoS. Med. 8(8):
Taori GM, Daginawala H (2010). Evaluation of BioFM liquid medium e1001062.
for culture of cerebrospinal fluid in tuberculous meningitis to identify Steingart KR, Sohn H, Schiller I, Kloda LA, Boehme CC, Pai M,
Mycobacterium tuberculosis. Indian. J. Med. Microbiol. 28(4):366- Dendukuri N (2013). Xpert® MTB/RIF assay for pulmonary tubercu-
369. losis and rifampicin resistance in adults. Cochrane. Database. Syst.
Kaushik A, Singh UB, Porwal C, Venugopal SJ, Mohan A, Krishnan A, Rev.1:CD009593.
Goyal V, Banavaliker JN (2012). Diagnostic potential of 16 kDa Walzl G, Ronacher K, Hanekom W, Scriba TJ, Zumla A (2011). Immuno-
(HspX, α-crystalline) antigen for serodiagnosis of tuberculosis. Indian. logical biomarkers of tuberculosis. Nat. Rev. Immunol. 11(5):343-354.
J. Med. Res. 135(5):771-777. Wang L, Liu J, Chin DP (2007). Progress in tuberculosis control and the
Kunnath-Velayudhan S, Salamon H, Wang HY, Davidow AL, Molina DM, evolving public-health system in China. Lancet. 369(9562):691-696.
Huynh VT, Cirillo DM, Michel G, Talbot EA, Perkins MD, Felgner PL, World Health Organization (WHO) (2011). Policy statement: commercial
Liang XW, Gennaro ML (2010). Dynamic antibody responses to the serodiagnostic tests for diagnosis of tuberculosis.
Mycobacterium tuberculosis proteome. Proc. Natl. Acad. Sci. U. S. A. WHO/HTM/TB/2011.5.WHO, Geneva, Switzerland.
107(33):14703-14708. http://whqlibdoc.who.int/publications/2011/9789241502054_eng.pdf.
Marassi FM (2011). Mycobacterium tuberculosis Rv0899 defines a Accessed 29 July 2011.
family of membrane proteins widespread in nitrogen-fixing bacteria.
Proteins.79(10):2946-2955.
Pym AS, Saint-Joanis B, Saint-Joanis B, Cole ST (2002). Effect of katG
mutations on the virulence of Mycobacterium tuberculosis and the
implication for transmission in humans. Infect. Immun. 70(9):4955-
4960.
Vol. 8(8), pp. 783-787, 19 February, 2014
DOI: 10.5897/AJMR2013.6186
An outbreak of ringworm caused by Trichophyton

verrucosum in a group of calves in Vom, Nigeria
Dalis, J. S.1*, Kazeem, H. M.2, Kwaga, J. K. P.3 and Kwanashie, C. N.2
1
Bacterial Research Division, National Veterinary Research Institute, Vom, Plateau State, Nigeria.
2
Department of Microbiology, Faculty of Veterinary Medicine, Ahmadu Bello University, Zaria, Kaduna State, Nigeria.
3
Department of Veterinary Public Health and Preventive Medicine, Ahmadu Bello University, Zaria, Kaduna State,
Nigeria.
Accepted 5 February, 2014
An outbreak of ringworm in young calves is reported from Vom in Nigeria. Twelve out of fourteen calves
were observed to have skin lesions consistent with dermatophytosis. Lesions were seen mostly around
the eyes and neck. Skin scrapings were collected from the affected areas and processed for mycology.
Trichophyton verrucosum was isolated from all the affected calves. This study has shown that T.
verrucosum can be a problem to watch for in calves in this particular environment, both as a zoonosis
and economic importance as a result of damage to hides and skin. The need to study the prevalence of
the disease among the cattle population in the state and country with a view to instituting preventive
and control measures was emphasized.
Key words: Dermatophytosis, outbreak, calves, Nigeria.
INTRODUCTION
Ringworm (dermatophytosis) is an infection of the climates, and particularly in countries or areas having hot
superficial, keratinized structures of the skin and hair of and humid climatic conditions (Radostits et al., 1997).
man and animals. The disease is caused by a group of The typical lesion in cattle is a heavy, grayish-white
keratinophilic filamentous fungi called dermatophytes in crust that is raised perceptibly above the skin, affecting
the Genera Trichophyton, Microsporum and young calves’ more than adult cattle (Cam et al., 2007;
Epidermophyton (Gudding and Lund, 1995). Akbarmehr, 2011). Dermatophytosis had been consi-
Animals are infected by contact with arthrospores dered the most common zoonosis worldwide, affecting
(asexual spores formed in the hyphae of the parasitic more children than adults (Achterman and White, 2012).
stage) or conidia (sexual or asexual spores formed in the Studies on human skin infections revealed that dermato-
“free living” environmental stage). Transmission between phytosis and other superficial fungal infections constitute
hosts usually occurs by direct contact with a symptomatic a major public health problem in Nigeria (Adeleke et al.,
or asymptomatic host (Murray et al., 2005). It had been 2008).
reported that housing animals in close proximity to each Whereas the literature is replete with information on
other for long periods in the presence of infected debris human dermatophytoses (Ameh and Okolo, 2004;
was responsible for the high incidence of the disease in Adeleke et al., 2008; Nweze, 2010), very little informa-
winter (Al-Ani et al., 2002). However, the disease tion on animal ringworm have been documented in
appears to be more common in tropical than temperate Nigeria. While there are some information on dermato-

phytosis of goats (Chineme et al., 1980) and pet animals elements (ectothrix spores and endothrix hyphae) by
(Adekeye et al., 1989), to our knowledge, no studies on direct microscopic examination. The fungus grew slowly
ringworm infection in cattle have been published from this on Dermarsel agar producing white, cottony, heaped and
country. slightly folded colonies with some submerge growth and
This paper focuses on the outbreak of ringworm in a yellow reverse pigment (Figure 2). Microscopic examina-
group of calves in Vom, Nigeria. tion of isolates stained with lactophenol cotton blue
revealed septate hyphae with numerous clavate micro-
conidia borne laterally from the hyphae (Figure 3b), and
MATERIALS AND METHODS many clamydospores arranged in chains (chains of
pearls) characteristic of T. verrucosum (Figure 3b)
Twelve out of fourteen (85.7%) calves aged between four and eight
months were observed to have skin lesions consistent with
dermatophytosis. The calves were kept indoors and in close contact
with each other. They were fed concentrate and hay and allowed to DISCUSSION
suckle from their dams in the morning during milking. The dams
and other adult cattle in the herd were physically examined for the T. verrucosum was found to be responsible for the
presence of skin lesions. Skin samples were collected from infected ringworm seen on 12 of the 14 calves in this study. Our
animals by first disinfecting the affected area by cleaning it with
cotton wool soaked in 70% ethyl alcohol. Skin scrapings were
report is significant as it suggests that dermatophytosis
collected by scraping the margin of the lesions using sterile scalpel could be a major problem in cattle farms especially in
blade into sterile Petri dishes. Hair pullouts and crusts were also young animals. This report agrees with previous findings
collected from the margin of the lesions as described by Robert and (Cam et al., 2007; Shams-Gahfarokhi et al., 2009), that
Pihet (2008). Each sample was divided into two parts. One part was young animals are particularly susceptible to infection by
used for direct microscopic examination while the second part was
ringworm fungi. This could be as a result of the poorly
used for fungal isolation by culture.
developed immune system and the high pH of the skin in
young animals (Radostits et al., 1997).
Direct microscopic examination The diagnosis of ringworm in this study was based on
clinical signs, demonstration of fungal elements in sam-
A portion of each sample was placed on a clean glass slide ples by direct microscopic examination and the isolation
containing a drop of 10% potassium hydroxide solution and covered
of causative agent by culture. T. verrucosum had been
with a cover slip. The slides were gently heated over a flame from a
Bunsen burner and examined for the presence of arthrospores and implicated in ringworm of cattle (Swai and Sanka, 2012;
hyphae under a light microscope. Cam et al., 2007). The main clinical signs observed
among the affected calves were circular, circumscribed,
grayish-white, thick crusty lesions perceptibly raised
Fungal isolation and identification above the skin. The lesions were most frequently found
Each sample was inoculated onto Dermasel agar (OXOID) con-
on the head and neck especially around the eyes and
taining: Mycological peptone, 10.0 g/L; glucose, 20.0g/L; agar, face. These observations were in agreement with other
14.5g/L; cyclohexamide, 0.4g/L and chloramphenicol, 0.05g/L, pH reports (Cam et al., 2007; Akbarmehr, 2011). The reason
6.9, incubated at 37°C for 2-4 weeks and examined for fungal for the occurrence of more lesions around the eyes and
growth. face in young animals is not well understood. However,
Identification of fungal isolates was carried out by both
the habit of licking and grooming by calves could pre-
macroscopic and microscopic examination which included growth
rate, general topography, surface and reverse pigmentation. dispose this part of the animal to infection.
Microscopic identification of positive fungal cultures was carried out Our results showed that all the samples examined by
using the method described by Murray et al. (2005). Briefly, a drop direct microscopy were positive for fungi. Other resear-
of lactophenol cotton blue stain was placed on a clean glass slide. chers found out that direct microscopic examination could
A portion of mycelium was transferred into the lactophenol cotton provide a positive diagnosis in 60-71% of samples from
blue stain and teased with a 22 gauge nichrome needle to separate
the filaments. Cover slip was placed on the preparation and
which dermatophytes were isolated (Sparkes et al., 1993;
examined under low and high power magnification using a much Al-Ani et al., 2002). In this study, the dermatophyte was
reduced light for identification. isolated in pure culture suggesting that dermasel agar is
a suitable selective medium for the isolation of patho-
genic fungi.
RESULTS Colonies of T. verrucosum in this report were slow gro-
wing, white, cottony, heaped and slightly folded with
The skin of affected calves showed circular, circum- some submerged growth and yellow reverse pigment.
scribed, grayish-white, thick, hairless, crusty raised This observation is consistent with the findings of Forbes
lesions (Figure 1). The lesions were mostly seen on the et al. (2002). In our investigation, microscopic examina-
head, face, around the eyes, neck and dewlap. No visible tion revealed septated hyphae and microconidia that
skin lesions were observed on the dams or other animals were attached laterally to the hyphae. There were nume-
in the herd. All the 12 samples were positive for fungal rous chlamydospores mostly in chains (chains of pearls).
Dalis et al. 785
Figure 1. Ringworm lesions in a 4 month-old calf. Note thick, crusty, grayish-white lesions around the eye, face,
ear and neck (arrow).
This agrees with the report of Shams-Gahfarokhi et al. downgrading of hides and skin and decrease in meat and
(2009) who observed chains of chlamydospores as pre- milk production (Gudding and Lund, 1995). In a survey of
dominant microscopic feature of the fungus in slide bovine dermatophytoses in major dairy farms of Mashhad
culture. Adult cattle had been reported to be less suscep- City, Eastern Iran, T. verrucosum was the predominant
tible to the ringworm (Cam et al., 2007) and some of the dermatophyte isolated (Shams-Gahfarokhi et al., 2009).
dams could perhaps be carrying the infection without A large scale outbreak of the disease involving a dairy
showing clinical sign and might be a source of infection herd has recently been reported in Arusha region,
for the calves. The soil, infected installations and even Tanzania (Swai and Sanka, 2012). Several other out-
the house were the animals were kept could be other breaks of ringworm affecting cattle herds and especially
sources through which the animal could acquire infection young calves had been documented in Australia
since T. verrucosum is known to persist in the environ- (Maslem, 2000), China (Ming and Ti, 2006) and Italy
ment for 5-7 years and had been isolated from the soil (Papini et al., 2009).
(Gudding and Lund, 1995; Mahmoudabadi and Zarrin, The major problem with T. verrucosum infection in
2008; Singh and Kushwaha, 2010). We do not know the cattle farms is that, once the disease is introduced into a
actual source of infection for these animals because nei- farm, it spreads rapidly among susceptible animals. The
ther neither the healthy dams nor any of these materials organism is difficult to eradicate from the environment
were sampled and investigated in this study. because of the peculiarity in composition of its spores.
The warm and humid climate of our environment could Treatment of cattle ringworm is expensive and cumbersome
have favored the growth and development of fungal especially on a herd level (Gudding and Lund, 1995).
spores thereby predisposing the animals to infection and This concern has prompted the need for effective prophy-
hence the outbreak in this highly susceptible population. laxis against the disease as hygienic and other preven-
Cattle ringworm causes high economic losses espe- tive measures were often inadequate (Rybnikar, 1992).
cially in the livestock and leather industries due to Vaccination against bovine dermatophytosis had been
Figure 2. Colonial morphology of T. verrucosum. Note:

white, cottony, heaped and folded colony.
a b
Figure 3. Microscopic morphology of T. verrucosum showing microconidia borne laterally from the hyphae (a) and
clamydoconidia in chains referred to as “chains of pearls” (b).
considered the most effective way of controlling the 2012).

infection (Rybnikar, 1992). Immunization of calves with Ringworm is enzootic in Nigeria. However, the national
live T. verrucosum was found to protect 90% of the vac- prevalence of the disease in the cattle population in this
cinated animals against T. verrucosum infection (Mikaili country is yet to be determined.
et al., 2012). A nationwide immunization program carried This study has revealed that T. verrucosum could be an
out in Norway where all cattle including none infected important health problem in calves in this particular envi-
animals of all ages followed by vaccination of all calves ronment, both as a zoonosis and economic importance
and purchased animals reduced the prevalence of ring- as a result of esthetic and damage to hides and skin.
worm from 70% in the year the program started to 0% There is need to study and understand the disease among
eight years later (Gudding and Lund, 1995; Mikaili et al., the cattle population in this country with a view to Instituting
Dalis et al. 787
prevention and control measures. Papini R, Nardoni S, Fanelli A, Mancianti F (2009). High infection rate of
Trichophyton verrucosum in calves from Central Italy. Zoonoses Pub.
Hlth. 56(2): 59-64.
Radostits OM, Blood DC, Gay CC (1997). Veterinary Medicine, 8th Ed,
ACKNOWLEDGEMENT Bailliere Tindall, London,pp. 381-39.
Robert R, Pihet M (2008). Conventional methods for the diagnosis of
dermatophytosis. Mycopath. 166: 295-306.
We thank the Executive Director, National Veterinary
Rybnikar A (1992). Cross-immunity in calves after vaccination against
Research Institute, Vom, Nigeria for permission to publish trichophytosis. Acta Vet. Brno. 61:189-194.
this work Shams-Gahfarokhi M, Mosleh TF, Ranjbar BS, Razzaghi AM (2009). An
epidemiological survey on cattle ringworm in major dairy farms of
Mashad city, Eastern Iran. I. J, M. 1(3): 31-36
Singh I, Kushwaha RKS (2010). Dermatophyte and related keratinophlic
REFERENCES
fungi in soil of Parks and Agricultural Fields of Uttar Pradesh, India.
Indian J. Dermatol. 53(3):306-308.
Achterman RR, White TC (2012). Dermatophyte virulence factors:
Sparkes AH, Gruffy TJ, Shaw SE, Wright AI, Stokes CR (1993).
identifying and analyzing genes that may contribute to chronic or
Epidemiological and diagnostic features of canine and feline
acute infections. Int. J. Microbiol. 2012. pp. 1-8
dermatophytosis in the United Kingdom from 1956 to 1991. Vet. Rec .
Adekeye J, Ado P, Kwanashie CN, Adeyanju J, Abdullahi S (1989).
133: 57-61.
Prevalence of animal dermatophytes in Zaria. Zariya Veterinarian,
Swai ES, Sanka PN (2012). Bovine dermatophytosis caused by
4(1):84-86.
Trichophyton verrucosum: a case report. Vet. World 5(5):297-300
Adeleke SI, Usman B, Ihesiulor G (2008). Dermatophytosis among
itinerant Quranic scholars in Kano (Northwest) Nigeria. Nig. Med.
Pract. 53(3):33-35.
Akbarmehr J (2011). The prevalence of cattle ringworm in native dairy
farms of Sarab city (East Azarbayjan Province) in Iran. Afr. J.
Microbiol. Res. 5(11): 1268-1271.
Al-Ani FK, Younes FA, Al-Rawashdeh OF (2002). Ringworm Infection in
Cattle and Horses in Jordan. Acta. Vet. Brno. 71: 55-60.
Ameh IG, Okolo RU (2004). Dermatophytosis among school children:
domestic animals as predisposing factor in Sokoto, Nigeria. Pak. J.
Biol. Sci. 7(7):1109-1112.
Cam Y, Gümüssoy KS, Kibar M, Apaydin N, Atalay Ö (2007). Efficacy
of ethylenediamine dihydriodise for the treatment of ringworm in
young cattle. Vet. Rec. 160: 408-410.
Chineme CN, Adekeye JO, Bida SA (1980). Trichophyton verrucosum
in young goats. Bull. Anim. Hlth. Prod. 29: 75-78.
Forbes BA, Sahm DF Weissfeld AS (2002). Laboratory Methods in
th
Basic Mycology. In Bailey and Scott’s Diagnostic Microbiology 11
edition, Mosby Inc, 11830 West line Industrial Drive St. Louis,
Missouri 63146, U S A.
Gudding R, Lund A (1995). Immunoprophylaxis of bovine dermato-
phytosis. Can. Vet. J. 36:302-306
Mahmoudabadi AZ, Zarrin M (2008). Isolation of dermatophytes and
related kerationophilic fungi from the two Public Parks in Ahvaz.
Jundishapur J. Microbiol. 1(1):20-23.
Maslen MM (2000). Human cases of cattle ringworm due to
Trichophyton verrucosum in Victoria, Australia. Australian J.
Dermatol. 42: 1-4.
Mikaili A, Chalabi M, Ghashghaie A, Mostafaie A (2012). Immunization
against bovine dermatophytosis with live Trichophyton verrucosum.
Afr. J. Microbiol. Res. 6 (23):4950-4953.
Ming PX, Ti YL, Bulmer GS (2006). Outbreak of Trichophyton
verrucosum in China transmitted from cows to humans. Mycopath.
161: 225-228.
Murray PR, Rosenthal KS, Pfaller MA (2005). Superficial and cutaneous
th
mycosis. In: Medical Microbiology, 5 edition. Philadelphia, USA, pp.
745-751.
Nweze EI (2010). Dermatophytosis among children of Fulani/Hausa
herdsmen living in Southeastern Nigeria. Rev. Iberoam. Micol.
27(4):191-194.
Vol. 8(8), pp. 788-796, 19 February, 2014
DOI: 10.5897/AJMR2013.6518
Characteristics of nodule bacteria from Mimosa spp

grown in soils of the Brazilian semiarid region
Ana Dolores Santiago de Freitas1*, Wardsson Lustrino Borges2, Monaliza Mirella de Morais
Andrade1, Everardo Valadares de Sá Barretto Sampaio 3,Carolina Etienne de Rosália e Silva
Santos1, Samuel Ribeiro Passos4, Gustavo Ribeiro Xavier4, Bruno Mello Mulato4
and Maria do Carmo Catanho Pereira de Lyra5
1
Universidade Federal Rural de Pernambuco (UFRPE), Recife-PE, Brazil.
2
Embrapa Amapá, Macapá-AP, Brazil.
3
Universidade Federal de Pernambuco (UFPE), Recife-PE, Brazil.
4
Embrapa Agrobiologia, Seropédica-RJ, Brazil.
5
Instituto Agronômico de Pernambuco (IPA), Recife-PE, Brazil.
The Brazilian Northeastern dry forest (Caatinga) is one of the diversification centers of Mimosa species.
We determined the characteristics of native rhizobia isolates from nodules of Mimosa tenuiflora and
Mimosa paraibana grown in pots with soils collected under Caatinga vegetation and compared the
restriction ribosomal DNA profiles of the isolates with those of 16 reference strains. All plants formed
abundant indeterminate nodules and all nodule isolates formed fast growing colonies. No colony altered
the medium to an alkaline reaction and most of them produced low or medium amounts of extracellular
polysaccharides. White and creamy colonies predominated among the isolates but orange and green
colonies were present. Differences among the isolates from the Mimosa species tested are indicated by
the greater phenotypic diversity of those obtained from M. tenuiflora. The analysis of the 16S rDNA gene
suggests that the isolates from M. tenuiflora and M. paraibana are closely related and closer to -
rhizobia than to α-rhizobia. However, the similarity with all the tested -rhizobia reference strains was
relatively low suggesting that the isolates may belong to different bacteria species.
Key words: Biological nitrogen fixation, diversity, rhizobia, wild tree legumes.
INTRODUCTION
Legume species belonging to the genus Mimosa have diverse habitats, including lowland tropical rainforest,
received considerable attention in recent years because savanna, tropical and subtropical dry forest and thorn
of their potential to fix large proportions of their nitrogen scrub, mid-elevation subtropical forest, desert, grassland,
from the atmosphere (Freitas et al., 2010) and because and wetland (Simon et al., 2011).
of their preferential association with -rhizobia (Chen et One of the diversification centers of Mimosa is the
al., 2005; Barrett and Parker, 2006; Bontemps et al., Brazilian Northeastern dry forest (Simon et al., 2011),
2010; Elliott et al., 2009; Reis Jr et al., 2010; Liu et al., locally called Caatinga. The Caatinga represents the
2012). Mimosa is one of the richest Leguminosae genera, largest and most isolated of the South American dry
2
with over 500 species, mostly neotropical, occupying forests. It covers more than 850,000 km (Albuquerque et
*Corresponding author. E-mail: [email protected]. Tel: 55-81-32692660, 55-81-33206237. Fax: 55-81-33206200.

de Freitas et al. 789
al., 2012), from 02°50’S at its northern limits, to 17°20’S (2003), Souza (2010) and Pereira et al. (2003), respectively.
with a variety of different types of vegetation (Queiroz Number of species and tree heights and stem diameters are higher
in the agreste zone than in the sertão zone and in this last zone
2006). Caatinga occurs under a prevailing semi-arid
higher in Serra Talhada than in Santa Terezinha, probably reflec-
climate, with a high evapotranspiration potential (1500 to ting higher water availability.
-1
2000 mm year ) and a low precipitation (300 - 1000 mm Soil subsamples were analyzed for some chemical and physical
-1
year ) that is usually concentrated within 3 to 5 months characteristics (Table 2), following the methodology described by
(Queiroz 2006). The region is rich in legume species, with Embrapa (1997). The samples were dried, passed through a 6 mm
more than 293 speies in 77 genera, many of them ende- mesh sieve and portions of 1 kg were placed in pots maintained
under greenhouse conditions. Seeds of two Mimosa species
mic ones (Queiroz et al., 2009). Few of these species (Mimosa tenuiflora (Willd.) Poir. and Mimosa paraibana Barneby)
were studied in relation to their potential to fix nitrogen were collected from a single mother tree in Remígio caatinga. The
and to their microsymbionts (Freitas et al., 2010; Teixeira seeds were surface disinfected in etanol (70% v/v - 3 min) and
et al., 2010). sodium hypochlorite (1 % v/v - 3 min), rinsed five times with sterile
Mimosa paraibana Barneby and Mimosa tenuiflora distilled water, rolled onto YMA plates to test for surface sterility and
then were sown in the pots. Each legume species was sown in
(Willd.) Poir. are leguminous tree species with great
triplicate for each soil sample. The pots received 100 ml of nutrient
nitrogen fixation capacity mean contributions of biological solution without nitrogen (Hoagland and Arnon, 1939) every week
fixation for plant nitrogen reaching up to 50% in Caatinga until harvest, 120 days after seed germination. At harvest the root
(Freitas et al., 2010). M. tenuiflora is a species of wide nodules were separated, dehydrated in silica gel and stored.
distribution, occupying dry areas of Brazil to Mexico,
Honduras and El Savador (Queiroz et al., 2009). This
species is the main pioneer species in areas of caatinga Isolation and phenotypic characterization of rhizobia
with few years of regeneration (Souza et al., 2012). Its
Rhizobia were isolated from the nodules in yeast mannitol agar
preferred symbionts are apparently β-proteobacteria, medium (YMA, pH 6.8) (Vincent, 1970) with 25 mg kg-1 (w/v) of
belonging to the genus Burkholderia (Bontemps et al., Congo red. The typical rhizobia colonies were purified and stored at
2010; Reis Jr et al., 2010). Moreover, M. paraiba is a -20°C, in microtubes with 1 ml YM medium(YMA without agar) plus
species endemic to Northeast Brazil (Queiroz et al., 15% sterilized glycerol. Isolates colonies in YMA with 25 mg kg-1
2009) and there is no studies on bacteria capable of (w/v) bromethymol blue as pH indicator (Fred and Waksman, 1958)
forming symbiotic nodules on their roots. were observed for the following characteristics: growth period, pH
alteration of growth medium, colony morphology (shape, size,
Research on Mimosa rhizobia have been conducted in border, transparency, surface) and amount of extracellular poly-
several regions of Brazil (Chen et al., 2005; Barrett and saccharides (EPS) (Xavier et al., 1998). These characteristics were
Parker, 2006; Elliott et al., 2009; Liu et al., 2012). converted to binary data employed in a cluster analysis using the
Isolation of rhizobia populations from Caatinga soils has UPGMA (Unweighted Pair Group Method Using Arithmetic Ave-
been relatively rare (Bontemps et al., 2010; Reis Jr et al., rages) algorithmand the Jaccard similarity index.
The results of the cluster analysis were used to calculate
2010; Teixeira et al., 2010), mainly considering the diver-
richness (Taxa S and Margalef), diversity (Shannon H), dominance
sity of environmental conditions in the region, that can (Simpson 1-D) and uniformity (Equitability J) indices for the soils
affect the structure of rhizobia populations (Mishra et al., and species, where each morphological group, at 60% of the
2012). Moreover, most of this research centered on ge- similarity (Jesus et al., 2005), was considered as one operational
netic characteristics and only Teixeira et al. (2010) des- taxonomic unit. The Past (palaeontological statistics) program was
cribed cultural characteristics of the rhizobia. Therefore, used to perform cluster analysis and diversity indices calculation
(Hammer et al., 2001).
the diversity of bacteria able to nodulate Mimosa species
in the region is little known.
Considering this scarcity of information, we charac- Restriction analysis (ARDRA) and reference strains
terized Caatinga native rhizobia associated to two
Mimosa species in relation to their cultural traits and DNA isolation, 16S rDNA gene amplification and restriction analysis
compared the restriction profiles of their amplified ribo- of ribosomal DNA (ARDRA) using HinfI, MspI and DdeI endo-
somal DNA (16S rDNA-ARDRA) with those of 16 nucleases were prepared according to Teixeira et al. (2010).
reference strains. Twenty eight new strains were randomly selected (19 from M.
paraibana and 9 from M. tenuiflora) and compared with 16 strains
from Embrapa Agrobiologia bacterial diazotrophic collection: BR
7801 (Mesorhizobium loti), BR 527 (Sinorhizobium terangae), BR
7606 (Rhizobium leguminosarum bv trifoli), BR 2811
(Bradyrhizobium elkani), BR 114 (Bradyrhizobium japonicum), BR
Soil sampling and Mimosa spp. cultivation 5401 (Azospirilum doberaneae), BR5410 (Azorhizobium
caulinodans), BR 2006 (Methylobacterium nodulans), BR 3407
Composite soil samples from the 0 to 20 cm superficial layer were (Burkholderia sabiae), BR 3437 (Burkholderia nodosa), BR 3454
collected in areas of preserved Caatinga vegetation in three (Burkholderia mimosarum), BR 3467 (Burkholderia mimosarum),
municipalities, with different climate conditions (Table 1): 1) Santa BR 3471 (Cupriavidus taiwanensis), BR 3486 (Burkholderia
Terezinha, in the sertão zone of Paraíba state; 2) Remígio, in the phymatum), BR 3487 (Burkholderia tuberum) and BR 3498
agreste zone of this same state; and 3) Serra Talhada, in the sertão (Burkholderia caribensis). The restriction fragment profiles were
zone of Pernambuco state. The composition and structure of the used to perform a cluster analysis using the Jaccard index, the
vegetation in the three areas were described by Ferraz et al. UPMGA algorithm and the GelCompar II (Applied Maths) program.
Table 1. General characteristics of preserved Caatinga areas in three municipalities, in the States of Paraíba (PB)
and Pernambuco (PE), Brazil.
Municipality (state)
Characteristic
Santa Teresinha (PB) Remígio (PB) Serra Talhada (PE)
Coordinates 07º03'S and 37º29'W 6°52’S and 35°47’W 07º59'S and 38º18'W
Altitude (m) 380 596 500
Annual rainfall (mm) 824 700 768
Months with water deficit 9 - 10 4-5 6-7
Average temperature (◦C) 26 22 24
Table 2. Soil characteristics of preserved Caatinga areas in three municipalities, in the States of Paraíba (PB) and
Pernambuco (PE), Brazil.
Municipality (state)
Soil characteristic
Santa Teresinha (PB) Remígio (PB) Serra Talhada (PE)
Classification Litholic Neosol Regolithic Neosol Luvisol
pH (water) 8.8 4.4 6.8
P (mg dm -3) 7.3 8.4 4.9
N (%) 0.07 0.08 0.10
C (%) 0.73 0.96 1.09
Sand (g kg-1) 623 725 651
Silt (g kg-1) 224 122 227
Clay (g kg-1) 153 153 122
(A) (B)
Figure 1. Shape of nodules found in Mimosa paraibana (A) and M. tenuiflora (B) roots from plants grown in soils
collected under mature Caatinga vegetation.
RESULTS very fast, in less than 24 h, and formed circular colonies

in the YMA medium.
Mimosa spp. nodulation
All harvested plants, cultivated in all three soils, had Phenotypic characteristics of rhizobia isolates
nodules of indeterminate growth with dark red interior and
sizes up to 3 cm in diameter (Figure 1). Sixty one isolates No isolate changed the medium pH to an alkaline reac-
were obtained from the nodules of M. paraibana and 62 tion. Most of the isolates obtained from M. tenuiflora
from the nodules of M. tenuiflora. All isolates developed changed the medium pH to an acid reaction: 96% when
Acid Neutral A
100
90
80
70
Isolates (%)
60
50
40
30
20
10
0
MT MP MT MP MT MP
Santa Teresinha Remígio Serra Talhada
B
100 None Low Moderate Copious
90
80
70
Isolates (%)
60
50
40
30
20
10
0
MT MP MT MP MT MP
Santa Teresinha Remígio Serra Talhada
Figure 2. pH change (A) and amount of extracellular polysaccharides (EPS) production (B) in
YMA medium of bacterial nodule isolates from Mimosa tenuiflora (MT) and M. paraibana (MP)
grown in soils collected under mature Caatinga vegetation.
when grown in the soil from Santa Terezinha, 75% in the from M. tenuiflora, the highest proportion (30 to 40% in
soil from Remígio and 68% in the soil from Serra Talhada the three soils) produced colonies with moderate
(Figure 2). Most of the isolates from M. paraibana grown amounts of extracellular polysaccharides (EPS), 26%
in the soil from Serra Talhada (62%) also changed the pH were dry colonies and only in the colonies originating
to an acid reaction but the proportions were lower in the from the Santa Terezinha soil the proportion of high EPS
soils from Santa Terezinha (48%) and Remígio (35%). producers (46%) surpassed the proportion of moderate
Most of the colonies had a cream color (74% of those producers (Figure 2). Among the isolates from M.
from M. tenuiflora and 67% from M. paraibana) but there paraibana most (30 to 95%) produced low amounts of
were also white, orange and green colonies. At 48 h in EPS, except in the Santa Terezinha soil where the
YMA, the most common diameters of colonies from M. proportion of colonies with copious amounts of EPS was
tenuiflora were punctiform (29%), 3 mm (19%) and 4 mm also high (48%).
(16%) while those from M. paraibana were 2 mm (31%), The isolates from M. tenuiflora were classified into 19
punctiform (23%) and 1 mm (21%). Among the isolates phenotypic groups and those of M. paraibana into 16
Figure 3. Phenotipic similarity dendrogram among M. tenuiflora (A) and M. paraibana (B) nodule isolates froms oils of preserved Caatinga.
The letters MT and MP indicates the isolates from M. Tenuiflora and M. Paraibana respectively. The letters M P, R and S indicates isolates
native from soils of Santa Terezinha, Remígio and Serra Talhada (municipalities in the States of Paraíba (PB) and Pernambuco (PE),
Brazil.), respectively.
groups (Figure 3). Eight groups from each plant species Santa Terezinha, 23 of them clustering into four groups
were composed of a single isolate which can be con- exclusive of isolates from the soil of this area (Figure 3B).
sidered to belong to different or rare types. The isolates On the other hand, the isolates from M. tenuiflora had no
from M. paraibana had a tendency to group according to clear tendency to group according to the soil.
the soil, mainly the isolates originating from the soil of Richness, diversity and equitability were higher among
Figure 4. Taxa S, Margalef, Shannon H, Simpson 1-D and Equitability J indices for bacterial nodule
isolates from Mimosa tenuiflora (MT) and M. paraibana (MP) grown in soils collected under Mature
Caatinga vegetation.
the isolates from M. tenuiflora than from M. paraibana native populations of bacteria able to colonize the roots of
(Figure 4). For the first species, the order of isolate both plant species. Ample populations of nodulating
diversity for the soils was Santa Terezinha, Remígio and bacteria are common in the soils of the regions where the
Serra Talhada while for the second species it was the legume species are native. On the other hand, nodulation
inverse order. frequently fails when a legume species is planted outside
its original region (Bala et al., 2003; Souza et al., 2007).
M. tenuiflora has a large distribution in tropical dry
Restriction analysis (ARDRA) cluster forests, from Brazil to Mexico (Queiroz et al., 2009) and
naturally occurs in the three Caatinga fragments where
Four large groups (Figure 5) were formed in the cluster the soils were collected (Ferraz et al., 2003; Pereira et
analysis based on the restriction analysis of ribosomal al., 2003; Souza, 2010). M. paraibana has a more
DNA (ARDRA). One group was composed of 26 out of 28 restricted distribution, being endemic to the Caatinga,
of the new isolates, both from M. paraibana (17 out of 19 and spontaneously occurs only in the Caatinga fragment
total new isolates) and from M. tenuiflora (9 new of Remígio (Pereira et al., 2003). In spite of that, it also
isolates). The second group was somewhat related to the nodulated when planted in the soil of the two other areas.
first group and was composed mostly of strains typical of There is no information on the natural occurrence of
-rhizobia genera. The third group was composed of rhizobia populations able to form symbiosis with the
strains of the type typical of α-rhizobia genera. The fourth several Mimosa species growing in soils of the Brazilian
group included only two isolates from M. paraibana semiarid, but the spontaneous nodulation of M. paraibana
(MPS5 and MPS10) and had a low similarity with both the indicates that this occurrence may be quite general.
-rhizobia and the α-rhizobia groups. Two pairs of These species may also be very promiscuous, nodulating
isolates (MPS 19 and MTP 16-2; MPS 17 and MPS 12) with a large spectrum of microsymbionts, as observed for
and one groups of five isolates (MPS1, MPS6, MPS7, M. pudica (Bontemps et al., 2010).
MPS8 and MPS9) from M. paraibana had 100% The nodules of M. tenuiflora and M. paraibana were
similarity. indeterminate, as has been described for those of other
Mimosoideae legumes. Indeterminate nodules, with a
wide range of size, formats and ramifications are usually
DISCUSSION attributed to species of Mimosoideae (Sprent et al.,
2007), without influence of the microsymbionts (Lammel
Mimosa spp. nodulation et al., 2007).However, some of the nodules grew more
than usually reported (Patreze and Cordeiro, 2004),
The spontaneous nodulation of M. paraibana and M. reaching more than 20 mm in their longest axis (Figure
tenuiflora indicates the presence, in the three soils, of 1). M. paraibana is one of the endemic species of
Figure 5. Genetic similarity dendrogram among 28 bacterial nodule isolates from

Mimosa tenuiflora (MT) and M. paraibana (MP) grown in soils collected under mature
Caatinga vegetation and 16 α- and -reference rhizobia strains based on PCR-ARDRA
of the 16S rDNA gene.
caatinga that only recently was identified as capable of type of colony. Therefore, the bacteria associated with M.
fixing nitrogen (Freitas et al., 2010) and the description of paraibana and M. tenuiflora seem to differ, from a certain
its nodules is being reported for the first time. extent, from those described in native rhizobia collections
obtained from soils of the region using cowpea as a trap
culture. Mishra et al. (2012) demonstrated that different
Phenotypic characteristics of rhizobia isolates legume species can form associations with different
rhizobia populations, in spite of being cultivated in the
The growing interest on microsymbionts associated to same soils. The wide phylogenetic distance from cowpea
Mimosa spp. has resulted in a large number of articles on and Mimosa species, belonging to two distinct legume
the subject (Chen et al., 2005; Barrett and Parker, 2006; subfamilies (Papilionoidea and Mimosoidea), may explain
Bontemps et al., 2010; Elliott et al., 2009; Reis Jr et al., part of the difference in their microsymbionts.
2010; Liu et al., 2012). However, few of these articles Differences among the isolates from the two Mimosa
describe the characteristics of the culture colonies formed species tested are indicated by the greater phenotypic
by these symbionts. Recently, Teixeira et al. (2010) diversity of those obtained from M. tenuiflora (Figure 4).
observed that all the isolates obtained from nodules of M. This species may establish symbiosis with a larger array
tenuiflora grown in a soil from a Caatinga area (Petrolina, of rhizobia species, and this could be explained by its
Pernambuco State, Brazil) had a rapid development and larger spatial distribution which may determine different
acidified the medium and that most of them produced a patterns of co-evolution with the microsymbionts.
large quantity of EPS. Fast-growing acid-producing rhizobia
are the most common symbionts of several African and
Asian wild tree legumes (Wolde-Meskel et al., 2004; Analysis of the 16S rDNA gene
Shetta et al., 2011). The isolates obtained from M. The analysis of the 16S rDNA gene suggests that the
paraibana and M. tenuiflora cultivated in the soils from isolates from M. tenuiflora and M. paraibana are closely
Serra Talhada, Santa Terezinha and Remígio also had related, independently from the soil of cultivation, clus-
rapid development but, contrasting with the African tering in the first group of the dendrogram (Figure 5). All
isolates, some of them did not modify the YMA culture isolates show the same phenotypic characteristics of
medium (51% of the M. paraibana isolates and 19% of
mucus production, acid or neutral reaction and homo-
the M. tenuiflora isolates). Large production of EPS was geneous and circular colonies. Other characteristics such
only observed in 17 isolates (20% of all the M. paraibana as differences in color of colonies and amount of mucus
isolates and 8% of the M. tenuiflora isolates). Rapid generated clustering on phenotypic dendrograms that
growth is a common characteristic of native isolates from cannot be observed in the genetic analysis. They were
the Brazilian semiarid region obtained from nodules of
also closer related to -rhizobia than to α-rhizobia, corro-
several species (Teixeira et al., 2010; Medeiros et al.,
borating previous reports of prevalence of this group
2009). Usually, isolates of rapid development do not form
among species of the Mimosoideae subfamily (Chen et
dry colonies (Teixeira et al., 2010) but this was the case
al., 2005; Reis Jr et al., 2010). However, the similarity with
in 16% of the isolates from M. tenuiflora and 6% of the
all the tested -rhizobia reference strains was relatively
isolates from M. paraibana (Figure 2).
low.
White, creamy or translucent colonies are commonly
Two isolates (MPS5 and MPS10) are clustered apart
formed by bacteria associated with wild tree legumes
such as Acacia spp. (Wolde-Meskel et al., 2004), Millettia these two groups. According to their position they could
pinatta (Rasul et al., 2012) and Mimosa tenuiflora be alpha that were not well resolved by the analysis, or
another class of proteobacteria.
(Teixeira et al., 2010). White and creamy colonies also
predominated among the isolates from M. tenuiflora and
M. paraibana but orange and green colonies were also Conclusion
present. Considering that descriptions of colonies formed
by rhizobia associated to Mimosa spp. are scarce (Chen The results demonstrate that the bacteria populations
et al., 2005; Bontemps et al., 2010; Reis Jr et al., 2010; from the nodules of Mimosa spp. species native from the
Teixeira et al., 2010), it is difficult to evaluate the soils of the semiarid Brazilian region have cultural cha-
frequency of these phenotypes. racteristics different from those obtained from the same
Medeiros et al. (2009) reported that punctiform colonies soils but using other legume species as trap plants. In
are commonly formed by isolates from nodules of Vigna spite of fast growth, the isolates can form from dry colo-
unguiculata cultivated in soils from Caatinga areas. nies to colonies with large production of EPS. The isola-
Cowpea associates with a large diversity of rhizobia and tes are more related to -rhizobia than to α-rhizobia, but
due to this characteristic it is frequently used as a trap the low similarity with the strains from the Embrapa
culture (Melloni et al., 2006; Medeiros et al., 2009). collection suggests that the rhizobia isolated from the
However, only 29 and 23% of the isolates from the nodules of M. tenuiflora and M. paraibana are different
nodules of M. tenuiflora and M. paraibana formed this bacteria species.
REFERENCES Patreze CM, Cordeiro L (2004). Nitrogen-fixing and vesicular -

arbuscular mycorrhizal symbioses in some tropical legume trees of
Albuquerque UP, Araújo EL, El-Deir ACA, et al. (2012) Caatinga tribe Mimoseae. Forest Ecology and Management. 196: 275-285.
revisited: ecology and conservation of an important seasonal dry Pereira IM, Andrade LA, Sampaio EVSB, Barbosa MRV (2003). Use-
forest, The Scientific World Journal: 18 p. history effects on structure and flora of Caatinga. Biotropica. 35:154-
Bala A, Murphy PJ, Osunde AO, Giller KE (2003).Nodulation of tree 165.
legumes and the ecology of their native rhizobial populations in Queiroz LP (2006). The Brazilian Caatinga: phytogeografical patterns
tropical soils. Appl. Soil Ecol. 22:211-223. inferred from distribution data of the Leguminosae. In: Pennington T,
Barrett CF, Parker MA (2006). Coexistence of Burkholderia, Lewis GP, Ratter JA (eds) Neotropical Savannas and Seasonally Dry
Cupriavidus, and Rhizobium sp. nodule bacteria on two Mimosa spp. Forests Plant Diversity, Biogeography and Conservation, CRC
in Costa Rica. Appl. Environ. Microbiol. 77:1198-1206. Press,New York, pp 121-157.
Bontemps C, Elliott GN, Simon MF, Reis Jr FB, Gross E, Lawton RC, Queiroz LP (2009). Leguminosas da Caatinga, Universidade Estadual
Elias Neto N, Loureiro MF, Faria SM, Sprent JI, James EK, Young de Feira de Santana, Royal Botanic Gardens Kew, Associação
JPW (2010). Burkholderia species are ancient symbionts of legumes. Plantas do Nordeste, Feira de Santana.
Mol. Ecol. 19:44-52. Rasul A, Amalraj ELD, Kumar GP, Grover M, Venkateswarlu B (2012).
Chen WM, Faria SM, Straliotto R, Pitard RM, Araújo JLS, Chou JH, Characterization of rhizobial isolates nodulating Millettia pinnata in
Chou YJ, Barrios E, Prescott AR, Elliott GN, Sprent JI, Young JPW, India. FEMS Microbiol. Lett. 336:148-158.
James EK (2005). Proof that Burkholderia strains form effective Reis Jr FB, Simon MF, Gross E, Boddey RM, Elliott GN, Neto NE,
symbioses with legumes: a study of novel Mimosa-nodulating strains Loureiro MF, Queiroz LP, Scotti MR, Chen WM, Norén A, Rubio MC,
from South America. Appl. Environ. Microbiol. 71:7461-7471. Faria SM, Bontemps C, Goi SR, Young JPW, Sprent JI, James EK
Elliott GN, Chou JH, Chen WM, Bloemberg GV, Bontemps C, Martínez- (2010). Nodulation and nitrogen fixation by Mimosa spp. in the
Romero E, Velázquez E, Young JPW, Sprent JI, James EK Cerrado and Caatinga biomes of Brazil. New Phytol. 186:934-946.
(2009).Burkholderia spp. are the most competitive symbionts of Shetta ND, Al-Shaharani TS, Abdel-Aal M (2011). Identification and
Mimosa, particularly under N-limited conditions. Environ. Microbiol. characterization of Rhizobium associated with woody legume trees
11(4):762-778. grown under Saudi Arabia condition. Am. Eurasian J. Agric. Environ.
EMBRAPA - Embrapa Brasileira de Pesquisa Agropecuária (1997). Sci. 10:410-418.
Manual de métodos de análise de solos, Embrapa, Rio de Janeiro. Simon MF, Grether R, Queiroz LP, Särkinen TE, Dutra VF, Hughes CE
Ferraz EMN, Rodal MJ, Sampaio EVSB (2003).Physiognomy and (2011). The evolutionary history of Mimosa (Leguminosae): toward a
structure of vegetation along an altitudinal gradient in the semi-arid phylogeny of the sensitive plants. Am. J. Bot. 98(7):1201-1221.
region of northeastern Brazil. Phytocoenologia 33:71-92. Souza LAG, Bezerra Neto E, Santos CERS, Stamford NP (2007).
Fred EB, Waksman SA (1958) Laboratory manual of general Desenvolvimento e nodulação natural de leguminosas arbóreas em
microbiology. Mc Grow Hill, New York. solos de Pernambuco. Pesq Agropec Bras. 42(2):207-217.
Freitas ADS, Sampaio EVSB, Fernandes AR, Santos CERS (2010). Souza LQ (2010). Fitossociologia em áreas com diferentes históricos
Biological nitrogen fixation in legume trees of the Brazilian Caatinga. de uso e fixação biológica de nitrogênio em Caatinga madura na
J. Arid Environ. 74:344-349. Paraíba. M.Sc. dissertation, Universidade Federal de Pernambuco,
Hammer Ø, Harper DAT, Ryan PD (2001). Past: paleontological Brazil.
statistics software package for education and data analysis. Souza LQ, Freitas, ADS, Sampaio EVSB, Moura PM, Menezes RSC
Palaeontologia Electronica 4:1-9 (2012). How much nitrogen is fixed by biological symbiosis in tropical
Hoagland DR, Arnon DI (1939). The water culture method growing dry forests? 1. Trees and shrubs. Nutr. Cycl. Agroecosist. 94:171-
plants without soil. U Calif Agric Exp Sta, California. 179.
Jesus EC, Moreira FMS, Florentino LA, Rodrigues MID, Oliveira MS Sprent JI (2007). Evolving ideas of legume evolution and diversity: a
(2005). Diversidade de bactérias que nodulam siratro em três taxonomic perspective on the occurrence of nodulation. New Phytol.
sistemas de uso da terra da Amazônia Ocidental. Pesq. Agropecu. 174:11-25.
Bras. 40:769-776. Teixeira FCP, Borges WL, Xavier GR, Rumjanek NG (2010).
Lammel DR, Brancalion PHS, Dias CTS, Cardoso EJBN (2007). Characterization of indigenous rhizobia from caatinga. Braz J
Rhizobia and other legume nodule bacteria richness in brazilian Microbiol. 41:201-208.
Araucaria angustifolia forest. Sci. Agric. 64(4):400-408. Vincent JM (1970). A manual for the practical study of root nodule
Liu XY, Wei1 S, Wang F, James EK, Guo XY, Zagar C, Xia LG, Dong X, bacteria, Blackkwell Scientific, Oxford.
Wang YP (2012).Burkholderia and Cupriavidus spp. are the preferred Wolde-Meskel E, Berg T, Peters NK, Frostegard A (2004) Nodulation
symbionts of Mimosa spp. in Southern China. FEMS Microbiol. Ecol. status of native woody legumes and phenotypic characteristics of
80:417-426. associated rhizobia in soils of southern Ethiopia. Biol. Fertil. Soils.
Medeiros EV, Martins CM, Lima JAM, Fernandes YTD, Oliveira VR, 40:55-66.
Borges WL (2009). Diversidade morfológica de rizóbios isolados de Xavier GR, Martins LMV, Neves MCP, Rumjanek NG (1998). Edaphic
caupi cultivado em solos do Estado do Rio Grande do Norte. Acta. factors as determinants for the distribution of intrinsic antibiotic
Sci. Agron. 31(3):529-535. resistance in a cowpea rhizobia population. Biol. Fertil. Soils. 27:386-
Melloni R, Moreira FMS, Nóbrega RSA, Siqueira JO (2006). Eficiência e 392.
diversidade fenotípica de bactérias diazotróficas que nodulam caupi
(Vigna unguiculata (L.) Walp) e feijoeiro (Phaseolus vulgaris L.) em
solos de mineração de bauxita em reabilitação R. Bras. Ci. Solo.
30:235-246.
Mishra RPN, Tisseyre P, Melkonian R, Chaintreuil C, Miché L,
Klonowska A, Gonzalez S, Bena G, Laguerre G, Moulin L. (2012).
Genetic diversity of Mimosa pudica rhizobial symbionts in soils of
French Guiana: investigating the origin and diversity of Burkholderia
phymatum and other beta-rhizobia. FEMS Microbiol. Ecol. 79:487-
503.
Vol. 8(8), pp. 797-802, 19 February, 2014
DOI: 10.5897/AJMR2013.6527
Microbiological assessment of dentists’ hands in

clinical performance
Márcia Rosental da Costa CARMO1*, Jorge Kleber CHAVASCO1, Solange de Oliveira Braga
FRANZOLIN2, Luiz Alberto BEIJO1, Júlia Rosental de SOUZA CRUZ3 and
Paulo Henrique WECKWERTH2
1
Universidade Federal de Alfenas – Unifal-MG, Rua Gabriel Monteiro da Silva, 700. Centro. 37.130-000 Alfenas- MG.
Brazil.
2
Universidade Sagrado Coração – USC-Bauru, São Paulo, Brazil.
3
Acadêmica da Universidade Federal de Alfenas – Unifal-MG, Alfenas-MG, Brazil.
This study verified the presence of opportunist pathogenic bacteria in the hands of Surgeons Dentists.
Biological materials were collected from the hands of 41 professionals, randomly selected. The
professional washed his/her hands for around 30 s in a sterile plastic bag, filled with 250 mL of
physiologic serum, in three distinct times: Timing 1 (T1), hands without wearing gloves, before
attending to the patient; Timing 2 (T2), wearing gloves, right after the patient treatment, when the glove
was contaminated with the patients’ biological material; and Timing 3 (T3), collected after removing the
gloves. The material obtained was inoculated in culture mediums such as: Brain Heart Infusion Agar
(BHI), Manitol Salt Agar (MSA), Eosin Methylene Blue (EMB) and Bile Esculin Agar (BEA). There were
identified Staphylococcus aureus and not aureus strains, besides Gram-negative bacteria, suggesting
deficient hygiene of the hands. An antibiogram was made for all the Gram-positive and Gram-negative
bacteria found. The result shows a high number of strains resistant to the most common used
antibiotics. The microbiological count was higher in the T1 for all the culture mediums, suggesting that
the act of washing the hands for 30 s decreases the microbiota resident in the hands.
Key words: Antimicrobial agents, hands washing, infection control, odontology, risk due to biological agents.
INTRODUCTION
Infection control has become one of the most discussed contributing for the spread of multiresistant pathogens,
topics in odontology, being very important during the besides playing an important role in the development of
practice, so that professionals no longer question its post operatory complications. Lately, multiresistant bacte-
importance. The knowledge about occupational hazards rial strains are responsible for outbreaks all over the
has been largely developed, but unfortunately it has been world and the therapeutic arsenal has become more and
short to strengthen awareness and change behaviors, as more scarce, increasing costs and time expending on
policies of infection control are not being fully applied treatment. The Staphylococcus aureaus resistant to
(Moraes, 2008). methicillin (MRSA) is responsible for important infections
According to Lehotsky et al. (2010) the failure in hand and hands are the most common way of transmission
disinfection before surgical procedures is considered the (Custódio et al., 2009).
major cause of nasocomiais infections worldwide, According to Myers et al. (2008) Odontology profes-
*Corresponding author. E-mail: [email protected]. Tel: 55 (35)3291-1852.

sionals must be bound to principles scientifically accep- grown in BEA underwent the Gram Method and Catalase Test.
ted and based on evidences of infection control, con- Finally, the ones grown in EMB Agar underwent the Gram Method
and were identified using Bactray® Kit, for biochemical identification
sidering that hands hygiene is one of the most important
of Gram Negative bacilli with Negative or Positive Oxidase.
processes to reduce the transmission of microorganisms The antibiogram using the Agar Disc Diffusion Technique (also
between professional and patient. known as Agar Diffusion Method or Kirby- Bauer Test), according to
Thus, the ethical responsibility of health professionals CLSI (CLSI document, 2009), using antibiotics discs made by
in reducing the risks of contamination is expected. Accor- DME® Sensidisc . There were made the following antibiotics for
ding to Dejours (1995), the Health Area may be a health Gram positive bacteria: Amoxicillin/Clavulanic Ac. (AMC 30 - 20/10
µg), Azithromycin (AZI 15 - 15 µg), Ciplofloxacin (CIP 05 - 5µg),
provider or a pathogenic producer. This study aimed to Clindamycin (CLI 02 - 2 µg), Doxycycline (DOX 30 - 30 µg),
isolate and identify bacterial strains in the collected mate- Norfloxacin (NOR 10 - 10 µg), Oxacillin (OXA 01 - 1 µg),
rial extracted from hands of dentists during clinical proce- Vancomycin (VAN 30 - 30 µg), Linezolid (LNZ 30 - 30 µg), Table 4.
dures, being a helpful matter in the awareness about the For the Gram negative were used: Cephalotin (30 µg), Sulfazotrin
possibility of transmission of pathogenic microorganisms (25µg), Tobramycin (10µg), Chloramphenicol (30µg), Gentamicin
(10µg), Doxycycline (30µg), Ciprofloxacin (05µg), Azithromycin
through hands. It also intends to determinate the profile
(15µg), Norfloxacin (10µg), Table 6.
of sensibility of microorganisms to antibiotics, building up The analysis of variance was used to evaluate the factors signi-
consciousness and a reasonable use of antimicrobials. ficance and the Scott-Knott test was applied at 5% level of signi-
ficance to get the average difference.
This research was carried out after the Committee of Ethics in
MATERIALS AND METHODS Research had authorized the realization of the project on Protocol
No 216/10 in November, 25th, 2010.
The research was developed starting with a list of 120 names,
provided by the Odontology Regional Council from Minas Gerais
(CRO-MG), and intermediated by the Regional Office from Alfenas. RESULTS
Later, based on the names enrolled in the list, 41 participants were
randomly selected and invited to participate in the survey. The timing 1 (T1) which represents the first collection of
Professionals were sought after in their workplaces and they the material from professional hands, always presented
were informed about the attribute of the study. The participation the highest number of Colony-Forming Unit (CFU/ml), when
was linked to a consent form. On the research, dentists from both
genders, specialists and general clinical dentist, who perform their
compared to the others timing (T2 and T3) from the
activities in private and public offices, participated. research (Table 2). T2 presented the lowest count of
The study was developed starting with the collection of biological CFU/ml when compared to T1 and T3, with statistical signi-
material on the active hand of the dentist. On each sample an sterile ficance for the media used, according to Scott-Knott Test
bag measuring 15x32 centimeters containing 250 mL of sterile physio- (Table 1).
logic serum was used, where the professional washed their hands
41 pairs of Descarpack® sterile gloves were used,
for about 30 s, over three different times: Timing 1 (T1), bare hands
before seeing the patient; Timing 2 (T2), gloved hands right after which did not show any damage during the collection,
the patient treatment, when the glove was contaminated with the except one glove that had a perforation on the middle
patients’ biological material; and Timing 3 (T3), collected after glove finger. The glove that presented the perforation was used
removal looking forward to verify microbiota present within the glove. in a long duration surgical procedure.
Expecting to obtain standardization during the material collection, The material inoculation in the culture medium (BHI)
sterile Descarpack® latex gloves were provided to all participants
(sample) in the research. The material collection did not interfere
was used to count the total bacteria, in each one of the
with the professional routine, in other words, the dentist was told to three timing used in this research, totaling 246 samples.
act just like his/her would normally do, which means that the dentist The results show that the T1 relative to the time when
had full choice to wash hands before starting treatments and wear the professional gets ready to start the clinical procedure,
sterile gloves in the manner they judged more suitable. in other words, before wearing gloves, presented the
Right after the three collecting timings in the physiologic serum, highest count of total bacteria, reaching up to more than
the obtained material was sent to the Microbiology Laboratory at
the Universidade Federal de Alfenas, together with the glove used
double of the CFU/ml count in the three media used.
by the professional. The glove was filled with methylene blue and The colonies count in the MSA was used to isolate the
observed after 24 h in order to verify the presence of perforations. Gram positive cocci in the samples, specifically
Overall, samples were collected 123 from the hands of 41 Staphylococcus sp. The colonies counting in this media
professionals. At the laboratory, 100 microliters (µL) of physiologic followed the trend observed in BHI. In the same way,
serum withdrew from hand washing was inoculated in the culture
there was a reduction from T1 to T3, indicating that the
media: Brain Heart Infusion Agar (BHI - Himedia), Manitol Salt Agar
(MSA), Eosin Methylene Blue (EMB) and Bile Esculin Agar (BEA), act of washing hands in physiologic serum removes part
for each one of the timing (T1, T2, T3), in concentrations: undiluted of the microorganisms, thereby, reducing the number of
and 1/10, in each one of the three times, and each sample for each CFU/ml (Table 3).
one of the four culture medium, totaling 984 samples. In T2, 27 samples had zero count. So, the unfolding of
The culture media were incubated at 37°C (98.6°F) in a bacterio- the significance for all the variable T presented a statis-
logical incubator for 48 h. The colonies quantification was made
using a colony counter, and the results were obtained in CFU/mL
tical three timing used in this research.
(Colony-Forming Unit per Milliliters). The results indicate the presence of 26 samples of S.
Strains which were grown in MSA underwent the Gram Method, aureus and 44 Coagulase-negative Staphylococci (CoNS),
Catalase Test, DNase and Coagulase Test. Strains which were from analysis of the 246 samples distributed over the
Carmo et al. 799
Table 1. Colonies’ counting average in the culture media BHI, MSA and EMB in CFU/ml.
Culture media T1 (CFU/mL) T2 (CFU/mL) T3 (CFU/mL)

a c b
BHI 2624,27 701,83 1074,32
MAS 1837,93a 48,66c
807,93 b
a a a
BEM 89,27 0 20,49
T1= Bare hands before seeing the patient; T2= Gloved Hands, right after the patient treatment,
when the glove was contaminated with the patients’ biological material; T3= collected after glove
removal. BHI= Brain Heart Infusion Agar; MSA= Manitol Salt Agar; EMB= Eosin Methylene Blue
Note 1: it was not possible to calculate the statistics for the BEA medium, because only one was
collected in T1; of all the 246 made showed positive result. The values are means. The means
followed by the same lower case letter in the line do not have difference between then by Scott-
Knott test, at level 5% of significance.
Table 2. Minimum and Maximum CFU/ml counting in the 4 culture media used.
T1 (CFU/ml) T2(CFU/ml) T3 (CFU/ml)

Culture Media
Minimum Maximum Minimum Maximum Minimum Maximum
BHI 0 Countless 0 9,400 0 6,010
MAS 0 6,000 0 920 0 5,320
BEM 0 1,530 0 0 0 830
BEA 0 Countless 0 0 0 0
T1= Bare Hands before seeing the patient; T2= Gloved hands right after the patient treatment, when the
glove was contaminated with the patients’ biological material; T3= collected after glove removal. BHI=
Brain Heart Infusion Agar; MSA= Manitol Salt Agar; EMB= Eosin Methylene Blue; BEA= Bile Esculin
Agar.
Table 3. Identification of the strains of Staphylococcus aureus and CNS - Coagulase

negative Staphylococcus, obtained in T1, T2 and T3.
Timing Staphylococcus aureus CNS - Coagulase negative Staphylococcus

T1 13 19
T2 03 07
T3 10 18
Total 26 44
T1= Bare hand before seeing the patient; T2= Gloved hand right after the patient treatment,
when the glove was contaminated with the patients’ biological material; T3= collected after
glove removal.
three timings established in this research, although, with positive for two samples, and they were: 10 and 830
a higher colonies concentration in T1, for both identifica- CFU/ml. The T2 was equal to zero and for 100% of the
tions (Table 3). samples, indicating that those bacteria are not common
Both S. aureus and Coagulase-negative Staphylococci in the oral cavity (Table 2). 246 samples were analyzed in
strains isolated and identified in this study underwent an the EMB culture medium, and for the three timings used
antibiogram, being totally, sensitive to Amoxicillin/ in the research; there were no statistical significance in
Clavulanic Acid and Norfloxacin. Also, they presented a the results (Table 1).
high resistance to Azitromicin, Clindamicin and Vancomy- The presence of Escherichia coli in 8 samples was
cin, according to Table 4. verified, Citrobacter freundii in 7 samples, and one sam-
The culture medium EMB is used to differentiate and ple presented Enterobacter cloacae, totaling 16 samples
isolate Gram negative bacilli (Enterobacteriaceae and with positive results for Gram negative bacteria, for a total
others Gram negative bacilli). Following up the tenden- of 86 samples.
cies of the others culture media, T1 in EMB presented the After identification of the 16 samples positive for Gram
highest concentration of CFU/mL, resulting to positive in negative bacteria, the antibiogram was done, and the strains
six cases with minimum counting as 90 CFU/ml and the were sensitive in 100% of the cases to Cephalotin, Genta-
highest counting as 1,530 CFU/ml. In T3, results were micin and Norfloxacin. It is important to point out the
Table 4. Susceptibility profile of 26 strains of Staphylococcus aureus and 44 strains of CNS - coagulase negative
Staphylococcus, in response to 9 clinical drugs.
AMC 30 AZI 15 CIP 05 CLI 02 DOX 30 NOR 10 OXA 01 VAN 30 LNZ 30

Antibiotic/Strain
R S R S R S R S R S R S R S R S R S
S. aureus 0 26 10 16 0 26 9 17 0 26 0 26 7 19 12 14 0 26
SCNS 0 44 26 18 4 40 26 18 14 30 0 44 13 31 25 19 1 43
AMC 30µg: Amoxicilin/Clavulanic Acid; AZI 15µg: Azitromicin; CIP 05µg: Ciprofloxacin; CLI 02µg: Clindamicin; DOX 30µg: Doxycycline;
NOR 10µg: Norfloxacin; OXA 01µg: Oxacilin; VAN 30µg: Vancomycin; LNZ 30µg: Linezolid.
Table 5. Distribution of the Gram negative strains (Enterobacteriaceae)

isolated in the culture media.
Gram negative Bacilli N (%)

Escherichia coli 08 (50.0)
Citrobacter freundii 07 (43.75)
Enterobacter cloacae 01(6.25)
Total 16 (100)
elevated number of strains resistant to Chloramphenicol, associated to diarrhea and pyogenic infections (Custódio
Sulfazotrin, Azithromycin, Ciprofloxacin (Table 6). et al., 2009).
The BEA is used to isolate and used as presumptive In this study, in the MSA culture were found values that
identification of Enterococo faecalis. This bacterium was range from zero to 6,000 CFU/ml. Also isolated in the
found in only one sample in T1 (with formation of MSA, in T1 was the presence of 13 S. aureus and 19
bacterial biofilm) for a total of 246 samples. other Staphylococcus; not aureus, from a total of 26 and
44 colonies, respectively (Table 3); totaling 86 samples in
DISCUSSION the MSA. In the same way Silva et al. (2003) found a high
rate of contamination for Staphylococcus and a lower
Professional’s choice of washing or not of hands before number of Gram negative bacilli, in a study that verified
wearing gloves, was determinant to the highest CFU/ml the microbiological contamination on surfaces, including
counting found in all culture media used. It was so the operator hands’ and the places touched by him.
because T1 had the highest count of CFU/ml, when S. aureus is responsible for several types of infection in
compared to T2 and T3. And, besides, in some cases in human body, and hands are the main way of
T1, the formation of biofilm could be noticed. This topic transmission. In this way, MRSA can be transmitted from
was also studied by Agbor and Azodo (2010), when only one patient to another if hands hygiene is neglected.
63.4% of the interviewed reported the practice of hand Lately, MRSA has become an important topic, but it is not
washing. more aggressive than Staphylococcus not aureus, and
Poor hand hygiene (HH) among professionals on the the actual challenge is a shortage of antibiotics that can
health area has motivated a lot of researches. And, combat the bacterium and not its virulence (Johnston and
although this practice is a simple act, its interdependence Bryce, 2009). Due to the increasingly frequent and
with the behavior sciences makes them complex and it unnecessary use of antibiotics, infections for MRSA have
depends on a set of factors and attitudes, beliefs and become more frequent. The infections caused by S.
knowledge (Pessoa-Silva et al., 2005). For researchers, aureus are usually treated with penicillin derivates such
although professionals valorized and recognize the as Oxacilin, Cefazolin and Cefalotin; all of them were
importance of the HH, the inadequate habit results in the used in this study.
non adhesion and only the divulgation is not enough to The S. aureus strains were sensitive, in all cases to
change behavior (Larson et al., 2007). Amoxicilin and Clavulanic acid, Ciprofloxacin, Doxy-
For the culture media EMB and BEA, where T2 was cycline, Norfloxacin and Linezolid, according to Table 4,
equal to zero, no result in T3 was higher than in T1; and were resistant to Azitromicin, Clindamicin, Oxacilin
relevant fact considered is that Gram negative bacteria and Vancomycin. The occurrence of bacteria resistance
(EMB culture) and Enterococcus (BEA culture) are not to antibiotics is a critical point, affecting sharply morbid-
usually found in the oral cavity, being found, most times mortality rate and treatment costs (Oliveira et al., 2010).
in places poorly sanitized. The Gram negative bacilli are MRSA rates clinical isolated from S. aureus vary from
normally found in the environment and make part of the less than 1% in Norway and Sweden, from 5% to 10% in
intestinal flora of humans and other animals, and may be Canada, 25% to 50% in USA, reaching up to more than
Carmo et al. 801
Table 6. Sensitivity profile of the 16 strains of Enterobacteriaceae in response to 9 clinical drugs.
Antibiotic (µg) Sensitive strain Resistant strain

Cefalotin (30) 16 0
Sulfazotrin (25) 8 8
Tobramycin (10) 13 3
Chloraphenicol (30) 5 11
Gentamicin (10) 16 0
Doxycycline (30) 14 2
Ciprofloxacin (05) 10 6
Azitromicin (15) 5 11
Norfloxacin (10) 16 0
50% in Hong Kong and Singapore (Michael and Martin, This situation is unacceptable in clinical offices. This
2010). MRSA are not only resistant to all the regular Gram negative bacilli, was also found and it is the main
antibiotics, but also to a combination of them. cause of infections in the urinary tract and neonatal
In this study 44 strains of Staphylococcus coagulase meningitis, causing 80% of mortality. It can also cause
negative were found, for a total of 70 Staphylococcus sp. infections in wounded skin, peritonitis and septicemia
Until the last couple of years, the Staphylococcus coagu- (Fraser and Cunha, 2012)
lase negative, were seen as reduced risk in causing Strains of Citrobacter freundii (Gran Negative) identified
infections, due to presence in the skin of microbiota. in this study, (Table 5), usually can be found in human
However, the Negative Coagulase Staphylococcus begin and other animals feces. Fraser and Cunha (2012) had
to be identified as a pathogenic agent, being considered already isolated strains in clinical samples of urine, throat
the main cause of bacteremia in the USA; caused by the swabs, expectorations, blood and wound swabs, with
increase in the incidence of infections (Grundman et al., characteristics of opportunist pathogen. The presence of
2006). The highest concentration of this pathogen was this bacterium on the hands and in the clinical offices
collected on the professionals’ hands in T1 and T3, environment is critical, and not only increases the risk of
according to Table 3. Due to similar finding, warning on infection, but also chances of one be infected by a
how easy it is to transport the bacterium from one place resistant bacterium. Besides epidemiological vigilance,
to another, completing the circle of microbial infection this issue also needs prioritization of health programs,
should be done. effective health education, and aiming a reasonable use
The antibiogram for Coagulase Negative Staphylococcus of antibiotics (Oliveira et al., 2010).
was found in this study; 29.5% of strains were resistant to The strains of E. cloacae, also isolated in this study,
Oxacilin, 9% to Ciprofloxacin and 56.8% to Vancomycin. are enterotoxigenic, and showed resistance to antibiotics,
What makes the Staphylococcus a pathogen with the according to Table 6. Enterobacter can infect any surgical
highest resistant rate to antibiotics is shown in Table 4. wounds, and these infections are clinically indistinguisha-
The World Health Organization (2007) has made ble from infections caused by others bacteria (Fraser and
reference to the excessive using of antibiotics worldwide, Cunha, 2012).
and shows that the resistance to them is one of the three The antibiogram for Gram negative bacilli was made
biggest threats to human health. Odontology overuses (Table 6). Most of the strains were resistant to most of
antibiotics, and most of the time with no justification. This the antibiotics tested, with exception to Cefalotin,
alert must be considered, because this study found 2.27% Gentamicin and Norfloxacin.
of strains resistant to Linezolid, 56.8% to Vancomycin, Among the samples analyzed in T1, a strain of E.
29.5% to Oxacilin, 31.8% to Doxycycline, 59% to Clindamicin, faecalis was identified, commensal of human digestive
9% to Ciprofloxacin and 59% to Azitromicin. Only the tract, causing over 90% of the enterococci human infec-
Amoxicilin associated to the Clavulanic acid and the tions (Johnston and Bryce, 2009). The strain isolated was
Norfloxacin, was shown to be effective in 100% to the resistant to Clindamicin, Cefalotin, Chloraphenicol and
cases in this study (Table 4). Oxacilin, with no inhibition, and with Norfloxacin, there
Nowadays, the main concern is also applied to the was the formation of a ring of 14 mm. Although, it was
specific treatments for infections caused by Gram nega- sensitive to the others antibiotics used, including
tive bacteria and multidrug resistant to E. coli, just like the Vancomycin. A multinational study (including countries
ones that were isolated in this study, and are indicated in such as South Africa, Egypt, Saudi Arabia and Lebanon)
Table 5. These bacteria can survive for around 48 h after on nosocomial pathogens has found a similar result,
being deposited on surfaces (Rodrigues et al., 2008). because none of the Enterococcus found in the study
The presence of those bacteria in T1 and T3, in other were resistant to Vancomycin. However, 7% of the
words on dentists’ hands indicate fecal contamination. Enterococcus isolated in Germany and 16.7% of the ones
isolated in Switzerland and Greece were resistant to Larson EL, Quiros D, Lin SX (2007). Dissemination of the CDC's Hand
Hygiene Guideline and impact on infection rates. Am. J. Infect.
Vancomycin. Other studies show that environments fre- Control 35(10):666-675.
quented by patients with MRSA and Enterococcus resis- Lehotsky Á, Nagy M, Haidegger T (2010). Towards the Objective
tant to Vancomycin is often contaminated by MRSA and Evaluation of Hand Disinfection. In: 26th Southerm Biomedical
Enterococcus, just like the same contamination found on Engineering Conference. 32:92-96.
hands, coats and equipments used by service providers Michael V, Martin MBE (2010). Antimicrobials and dentistry: Are we
over prescribing? J. Marmara Univ. Dent. 1(1):15-19.
(Johnston and Bryce, 2009). Moraes MS (2008). Em ambiente de risco, conhecimento é
The scene is very critical, because in the late years the fundamental. J. Glob. Infect. Dis. Ano XX; 65:3.
pharmaceutical industry did not invest on new antibiotics. Myers R, Larson E, Cheng B, Schwartz A, Silva K, Kunzel C (2008).
Hand hygiene among general practice dentists. JADA 139(7): 948-
According to Piddock (2011), this has occurred due to
957.
merging pharmaceutical companies, small profit rates, Oliveira DGM, Souza PR, Watanabe E, Andrade D (2010). Avaliação da
high costs and regulatory barriers. Besides all these bar- higiene das mãos na perspectiva microbiológica. Rev. Panam.
riers, when the new drug has been finally approved, it is Infectol. 12(3):28-32.
Pessoa-Silva CL, Posfay-Barbe MD, Touveneau S, Perneger TV, Pittet
will not be effective in a long term, for the bacterium will D (2005). Attitudes and perceptions toward hand hygiene among
soon develop resistance mechanism. healthcare workers caring for critically ill neonates. Cienc Enferm.
26(3):305-311.
ACKNOWLEDGEMENTS Piddock LJ (2011). The crisis of no new antibiotics--what is the way
forward? Lancet Infect. Dis. 12(3):249-253.
Rodrigues MVP, Fusco-Almeida AM, Nogueira NGP, Bertoni BW,
Part of the financial resources was personal and the Torres SCZ, Pietro RCLR (2008). Evaluation of the spreading of
other part of the financial resources was donated by the isolated bacteria from dental consulting-room using RAPD technique.
Universidade Federal de Alfenas, Alfenas, Minas Gerais, Lat. Am. J. Pharm. 27(6):805-811.
Brazil. Silva FC, Antoniazzi MCC, Rosa LP, Jorge AOC (2003). Estudo da
contaminação microbiológica em equipamentos radiográficos. Rev.
Bras. Biocienc. 9(2):35-43.
Conclusion World Health Organization (2007). The selection and use of essential
medicines- Interventions for improvement of antimicrobial use.
This study found the presence of Gram negative and Geneva. (Accessed em 2012 abril 9); Avalible in:
http://whqlibdoc.who.int/trs/WHO_TRS_946_eng.pdf
Gram positive bacteria, based on the collection of
biological material on hands of Surgeons Dentists, during
clinical procedures, showing deficiency in hand hygiene
procedures. The CFU/ml count from hands of profes-
sionals before starting the procedure (Timing 1) was the
highest for all the culture media used, suggesting that
hand washing was neglected or was made improperly.
The antibiogram showed the existence of strains resistant
to most used antibiotics in the office. Thus, this press the
recommendable need for effective programs in orienting
professionals to a reasonable use of antibiotics.
REFERENCES
Agbor MA, Azodo CC (2010). Handwashing and barrier practices

among Cameroonian dental professionals. Tanzan. Dent. J. 16(2):35-
38.
CLSI (2009). Performance Standards for antimicrobial disk susceptibility
tests. Approved standard – Tenth edition. CLSI document M02-A10.
29(1):3-34.
Custódio J, Alves JF, Silva, FM, Dolinger EJO, Santos JGS; Brito DD
(2009). Avaliação microbiológica das mãos de profissionais da saúde
de um hospital particular de Itumbiara, Goiás. Rev Cien Med.
18(1):7-11.
Dejours C (1995). Com ment formuler une problématque de la santé en
ergonomie et en médicine du travail ? Trav. Hum. 58:1-16.
Fraser SL, Cunha BA (2012). Enterobacter Infections Clinical
Presentation. Medscape J Med (periódico na Internet) May 30
(acessado 2012 jul 12); Disponível em:
http://emedicine.medscape.com/article/216845-clinical.
Grundman H, Aires SM, Boyce J, Tiemersma E (2006). Emergence and
resurgence of meticilin-resistant Staphylococcus aureus as a public
health threat. Lancet Infect Dis. 368:874-885.
Johnston BL, Bryce E (2009). Hospital infection control strategies for
vancomycin-resistant Enterococcus, methicillin-resistant
Staphylococcus aureus and Clostridium difficile. CMAJ 180(6):627-
631.
Vol. 8(8), pp. 803-813, 19 February, 2014
DOI: 10.5897/AJMR2013.6233
Evaluation of marine macro alga, Ulva fasciata

against bio-luminescent causing Vibrio harveyi during
Penaeus monodon larviculture
Krishnamoorthy Sivakumar, Sudalayandi Kannappan*, Masilamani Dineshkumar and
Prasanna Kumar Patil
Genetics and Biotechnology Unit, Central Institute of Brackishwater Aquaculture (Indian Council of Agricultural
Research), 75, Santhome High Road, Raja Annamalai Puram, Chennai - 600 028, Tamilnadu, India.
Vibrio harveyi is one of the major disease causing bacterium in shrimp larviculture and grow-out
practices. V. harveyi produces many virulence cum pathogenic factors. Application of antibiotics
against luminescence causes development of antibiotic resistance among V. harveyi. Therefore, it is
obligatory to develop bio-inhibitory agents as substitute in lieu of antibiotics. Under this study, Ulva
fasciata was collected and extracted for crude compounds, 300 µg extract showed 12.3 mm of bio-
inhibition against V. harveyi through “agar well diffusion assay”. Further, U. fasciata extract at 300 µg/ml
was treated against V. harveyi in LB broth and showed reductions on phospholipase and proteolysis.
Production of bio-luminescence was reduced to 7.3, 7.7, 13.0, 17.0 counts per second (CPS) and growth
also reduced to 24.91%. Further, U. fasciata extract at 200 g/ml was tested against V. harveyi during
Penaeus monodon larviculture and showed 32.40% reduction in the cumulative percentage mortality on
postlarvae due to V. harveyi. Chemical constituents of U. fasciata was characterized by FTIR and GCMS.
GC-MS analysis, reported to contain organic compounds such as Bis(2-ethylhexyl) phthalate was
highest (88.42%), followed by 1,2- benzenedicarboxylic acid- butyl (2.47%). Therefore, it was concluded
that U. fasciata may be a better bio-inhibitory agent against V. harveyi in shrimp larviculture.
Key words: Ulva fasciata extracts, antagonism, virulence factors, Vibrio harveyi, challenging shrimp postlarvae,
cumulative mortality reduction.
INTRODUCTION
Penaeid shrimp farming have become a momentous quently reported in hatcheries (Raissy et al., 2011) and
aquaculture activity in many countries in the tropics. grow-out ponds (Zhou et al., 2012). V. harveyi has been
However, this grow-out practice is constantly under threat established as well-known bacterium to produce extra
due to the outbreak of infectious diseases. Among the cellular products indicating its virulence factors such as
infectious diseases the luminescent disease causing luminescence, proteases, phospholipases, lipases, side-
Vibrio harveyi is one of the most important bacterial rophores, chitinases and hemolysins (Soto-Rodriguez et
pathogen, capable of causing higher mortality among the al., 2012). The applications of antimicrobial chemicals,
marine invertebrates (Vezzulli et al., 2010). In the last two especially antibiotics, led to the emergence of more
decades, mass mortalities (80-100%) among Penaeid virulent as well as resistant among the bacterial
shrimps resulting from V. harveyi infections were fre- pathogens (Rahman et al., 2010). Under this condition, it
*Corresponding author. E-mail: [email protected]. Tel: +91-44-24616948 or +91-96770 39103. Fax: +91-44-24610311.
Figure 1. Marine macro alga U. fasciata.
is indispensible to develop an alternative agent in place against shrimp pathogens such as Vibrio fischeri,
of antibiotics that are commendably biodegradable and postlarvae (Selvin et al., 2011). incorporated diet was
eco-friendly too. Vibrio alginolyticus, Vibrio
Marine resources are an unmatched reservoir of The bio-potential of marine algae such as Skeletonema
biologically active natural products, many of which exhibit costatum, U. fasciata and Kappaphycus alvarezii were
structural features that has not been found in terrestrial studied against luciferase and luminescence producing V.
organism (Saritha et al., 2013). There are numerous harveyi (Sivakumar and Kannappan, 2013). However,
reports on compounds derived from macro algae with a numerous studies showed the biological activity of U.
broad range of biological activities such as the anti- fasciata against many aquatic pathogens, but not closely
microbial, antiviral, anti-tumor and anti-inflammatory as determined against luminescent disease causing V.
well as neurotoxins (Osman et al., 2013). In addition, the harveyi and its virulence factors. Thus, this study was
macro algae derived polysaccharides for example algi- under taken to discover the antagonistic effect of crude
nate, carrageenan was capable of improving the healthi- U. fasciata extract against luminescent disease causing
ness of marine candidate fish species in aquaculture, V. harveyi during P. monodon larviculture with the,
when they were added to the diets (Peso-Echarri et al., description of functional compounds by FTIR and
2012). quantification of phytochemicals by GC-MS.
Current studies reported that the solvent extracts of the
red seaweed Gracilaria fisheri prevent V. harveyi
infections in Penaeus monodon postlarvae (Kanjana et
al., 2011). The crude extract obtained from Sargassum Isolation of V. harveyi
hemiphyllum var. Chinense, show increased immunity
and resistance against Vibrio alginolyticus and white spot V. harveyi strains were isolated from the P. monodon larviculture
syndrome virus (WSSV) infection on Litopenaeus tanks. The isolates were identified using standard biochemical tests
and further confirmed by polymerase chain reaction (PCR)
vannamei (Huynh et al., 2011). Ulva fasciata is a green (Sivakumar and Kannappan, 2013). The pathogenicity of V. harveyi
marine macro alga (Chlorophyceae), which grows cells were ascertained by spotting in 3% blood agar (Hi-media,
abundantly in both intertidal and deep water regions of India). The isolates were re-confirmed by V. harveyi selective agar
sea, and documented to be the potential sources of (VHSA) (Harris et al., 1996) and then stored in Luria-Bertani (LB)
bioactive compounds (Paul and Devi, 2013). Further- broth with sterile glycerol (15% v/v) (Hi-media, India).
more, various extracts from U. reticulata and U. lactuca
were tested for antagonism against human pathogens Macro alga collection
(Kolanjinathan and Stella, 2011). Aqueous extract of U.
fasciata show inhibition against aquatic bacterial The marine macro alga U. fasciata was collected with a knife from
pathogens (Priyadharshini et al., 2012). Antimicrobial all over the substrate (rock, plant, wood, etc.) (Figure 1) from
intertidal region of Tuticorin (Latitude 8.7874°N; Longitude
efficiency of U. fasciata, Chaetomorpha antennina was 78.1983°E), Tamilnadu, India (Figure 2). The alga was washed in
studied against many pathogenic bacteria (Premalatha, permanganate solution [1% KMnO4 (w/v)] to remove the epiphytes,
2011). The efficacy of U. fasciata harveyi and sand and other extraneous matters and then shadow dried. The
Aeromonas spp. challenged with P.monodon tested dried alga was weighed, pulverised using mechanical grinder and
Sivakumar et al. 805
Figure 2. Map showing Tuticorin region (Latitude 8.7874°N; Longitude 78.1983°E), India where macro
alga U. fasciata was collected.
used for extracting crude fatty acids. Active 24 h old V. harveyi of 500 µl (1.8 OD) was inoculated into LB
broth and shaker incubated at 28°C/100 rpm/5 days. The growth
with various virulence factors such as luminescence, proteolytic,
Solvent extraction lipolytic, phospholipase, thermonuclease activities, crude
bacteriocin production, exopolysaccharide (EPS) and protease
Ethyl acetate was used for extracting the crude compounds from
produced by V. harveyi were estimated. Cell surface hydrophobicity
alga at 30°C called “cold extraction method”. The U. fasciata extract
was examined by salt aggregations test (SAT) and cell adhesion
was prepared by taking 1.0 g of shadow dried powder, and then
was examined by bacterial adhesion to hydrocarbons test (BATH)
mixed with 10.0 ml of ethyl acetate and shaker incubated at 30°C
(Soto-Rodriguez et al., 2012). Each test was performed in triplicates
for 96 h at 50 rpm. Then the extract was filtered by Whatman filter
and values were expressed in average with SD.
paper No. 1, rotary evaporated (30°C) under vacuum and stored at
4°C for additional use. The resultant extract was liquefied with 5
mg/ml of 30% (v/v) dimethyl sulfoxide (DMSO) and used for testing Fourier transform infra red spectroscopy (FTIR) analysis
antagonism against V. harveyi (Sivakumar and Kannappan, 2013).
The shadow dried U. fasciata was ground to powder by pestle and
Estimation of MIC mortar. The FTIR spectra was recorded using BRUKER IFS 66
model FTIR spectrometer in the region 4000-400 cm-1 by employing
The minimum inhibitory concentration (MIC) of U. fasciata against standard KBr pellet technique (D‟Souza et al., 2008).
V. harveyi was evaluated (Islam et al., 2008).
Gas chromatography and mass spectrometry analysis

Antibacterial assay
Gas chromatography-mass spectrometry (GC-MS) analysis was
Antibacterial activity was ascertained against V. harveyi using the performed by using Agilent GC-MS-5975C with the Triple-Axis
“agar well diffusion assay” (Sivakumar and Kannappan, 2013). Detector equipped with an auto sampler. The GC column used was
fused with silica capillary column (length 30 m × diameter 0.25 mm
× film thickness 0.25 m) with helium at 1.51 ml for 1 min as a
Effect of crude U. fasciata extract against the growth and carrier gas. The mass spectrometer was operated in the electron
virulence of V. harveyi impact (EI) mode at 70 eV in the scan range of 40-700 m/z. The
split ratio was adjusted to 1:10 and injection volume was 1 μl. The
U. fasciata extract at 300 g/ml was added in 100 ml of LB medium. injector temperature was 250°C; the oven temperature was kept at
70°C for 3 min, rose to 250°C at 14°C min-1 (total run time 34 min). The maximum reduction on bacteriocin production (OD)
The temperature of the transfer line and of the ion source was set was on 4th and 5th day (0.177 and 0.184) and minimum
to a value of 230°C and the interface temperature at 240°C, st
(0.064) observed on 1 day as compared to the control
respectively. Full mass data was recorded between 50-400 Dalton
per second and scan speed 2000. Mass start time is at 5 min and (OD 1.986 and 1.978 on 4th and 5th, and 2.082 on 1st
end time at 35 min. Peak identification of crude U. fasciata extract days). Although, reductions of crude extra cellular protein
was performed by comparison with retention times of standards and released was noticed in all the treatment days (Figure
the mass spectra obtained was compared with those available in 3b). The EPS production in the treatment was reduced to
the NIST libraries (NIST 11- Mass Spectral Library 2011 version) st
0.525, 0.556, 0.585, 0.551 and 0.507 from 1 to 5 days
th
with an acceptance criterion of a match above a critical factor of
80% (Musharraf et al., 2012).
as compared to the control (OD 2.026, 2.408, 2.242,
2.262 and 2.250) (Figure 3c). The protease level was
reduced from 0.047 and 0.051 as compared to the control
Challenge of crude U. fasciata extract against V. harveyi during (OD 0.146 and 0.171) (Figure 3d).
larviculture of P. monodon Further, the treated V. harveyi cells were subjected to
phospholipase, proteolysis, lipolysis and thermonuclease
The plastic tubs were washed with 1% KMnO4 solution. Tubs were
filled with 20 L of saline water at 20 Practical Salinity Units-PSU. activities, determined based on the hydrolysis of medium
Disease free postlarvae (PL 10) of P. monodon, procured from in the plate assay (Table 1). The activities were coded
shrimp hatchery were acclimatized at 20 PSU for 5 days under with qualitative parameters like weak, moderate, high and
laboratory conditions at 28 ± 1°C with continuous aeration. The very high. In treatment, the moderate level of
average body weight of PL ranged from 17 to 18 mg and stocked at phospholipase and proteolysis activity was noticed on 1st,
1000 numbers per each tub. The control tub was inoculated with V.
harveyi (10 ml of 1.80 OD) alone. Second tub was considered as
2nd and 3rd days. Weak activities were noticed on 4th and
treatment inoculated with V. harveyi and 200 µg (2 gm/10L) of 5th days (very high). But moderate level of lipolysis and
crude U. fasciata extract per ml. Third tub was considered as thermonuclease activities was shown on 1st to 5th day as
control where crude U. fasciata extract was added at 200 µg per ml compared to the control (very high).
alone with PL. The fourth tub was a control for PL, where neither V. Cell surface hydrophobicity was examined using SAT
harveyi nor extract was added. The aeration was given for each tub and BATH tests (Table 1). SAT test was determined as
to provide oxygen level not more than 4 ppm. The PL feed was
given twice at 15% of their body weight. The water quality
the lowest molarity of ammonium sulphate (0.05-4.0 M)
parameters such as temperature, salinity and pH were measured that caused visible agglutination of a test organism. In
once in 5 days. The mortality of PL was counted daily. No water SAT test, the control V. harveyi revealed strong hydro-
exchange was given for all the tubs till 30 days. The water samples phobic activity for 1st to 5th day whereas, the treated
were collected once in 5 days by sterile water bottles. The total showed moderate hydrophobic activity for 1st to 5th day.
heterotrophic and V. harveyi bacterial counts were enumerated
Similar way, BATH test also exhibited strong level of
using LB medium and V. harveyi selective agar medium under
spread plate method. All the experimental tubs were top covered to hydrophobic activity for control from 1st to 5th day. When
avoid any external contaminations. For each experiment, triplicates crude extract of macro alga of U. fasciata was treated
were maintained and the values are average of three with V. harveyi, the production on luminescence was
determinations (Traifalgar et al., 2009; Kannappan et al., 2013). reduced to 7.3, 7.7, 13.0 and 17.0 CPS (counts per
second) for the 4 days period (Figure 3e). The maximum
RESULTS reduction on luminescence was reported on 4thday (17.0
CPS) and minimum was observed on the 1st day (7.3
CPS) when compared with the control (39.6, 50.3, 59.3,
Minimum inhibitory concentration (MIC) of U. fasciata
63.6 CPS).
The MIC of crude extracts of U. fasciata was established
at 30 µg concentration. The zone of inhibition was 12.3 FTIR of U. fasciata
mm, established at 300 µg level of extract of U. fasciata
whereas, the 200 and 100 µg level of concentrations The FTIR spectrum of dried powder of U. fasciata is
showed 8.3 and 3.3 mm zones, respectively, against the shown in Figure 4 and functional groups identified were
growth of V. harveyi. compared from the FTIR standard library data. FTIR
spectrum showed the presence of significant functional
groups such as alcohols, phenols, esters, ethers,
Effect of crude extract of U. fasciata against the alkanes, alkenes, primary amines, nitro compounds,
changes in growth and virulence factors produced by aromatics and carboxylic acids, alkyl halides and aliphatic
V. harveyi amines, etc (Table 2).
The treatment reduced the growth of V. harveyi (1.8 OD)
st th
from 1 to 5 day. The highest growth differences was GC-MS of U. fasciata
rd st th
observed on 3 day (0.532 OD) and lowest on 1 and 5
day (0.468 OD) as compare to the control (Figure 3a). GC-MS analysis of crude ethyl acetate extract of U.
Figure 3. Crude extract of U. fasciata against the changes of growth and virulences produced
by V. harveyi in LB broth for 5 days.
fasciata was found to have mixture of volatile P. monodon postlarvae for 30 days, the reduction on
compounds. A total of 36 peaks were observed with re- cumulative percentage of mortality on postlarvae was
tention times as shown in Figure 5. Chemical constituents noticed as 32.40% as compared to the control (76.30%).
were identified using spectrum data base NIST 11 Two trails were maintained under larviculture as negative
software installed in GC-MS. controls to distinguish any influence of U. fasciata extract
The GC-MS analysis of the crude extract revealed that on PL. However, it was noticed that treatment does not
the main chemical-constituent was organic compound affect PL as compared to the control (76.30%) which
Bis(2-ethylhexyl) phthalate (tR = 23.21 min) (88.42 %) showed less reduction on cumulative percentage mortality
followed by 1,2-benzenedicarboxylic acid- butyl (tR = with extract and PL (29.56%) and with PL alone (28.39%).
18.14 min) (2.47%) (Figure 6a and b). It is possible that The weight of the PL was measured for both the control
bioactive compounds primarily consisting of Bis(2- and treatments. There was no much weight difference
ethylhexyl)phthalate (tR =23.21 min) (88.42%) may be observed both in the treatment and control. On 30th day,
involved in biological activity (Table 3) with other the average weight of the PL was 269.3 and 266.5 mg for
compounds. control and treatment, respectively (initial weight of the
PL for control was 17.7 and 18.1 mg for treatment,
Challenge of crude U. fasciata extract against V. respectively).
harveyi during P. monodon larviculture The maximum decrease on V. harveyi counts were
observed on 5th, 10th, 15th and 20th days and mean values
4 4 3
When U. fasciata extract was tested against V. harveyi in for treatment were 2.38 x 10 , 1.56 x 10 , 4.30 x 10 and
Table 1. Effect of U. fasciata extract against the changes of virulences produced by V. harveyi.
Virulence studied
Cell surface hydrophobicity
Day Proteolysis Phospholipase Lipolysis Thermonuclease
SAT (M) BATH (%)
Control Treated Control Treated Control Treated Control Treated Control Treated Control Treated
1 ++++ ++ ++++ ++ ++++ ++ ++++ ++ 0.86± 0.02 1.29± 0.04 86.78±4.11 46.33±2.13
2 ++++ ++ ++++ ++ ++++ ++ ++++ ++ 0.89± 0.03 1.35± 0.05 85.66±3.91 43.11 ±1.65
3 ++++ ++ ++++ ++ ++++ ++ ++++ ++ 0.91± 0.04 1.44± 0.06 82.33± 3.03 39.56± 1.33
4 ++++ + ++++ + ++++ ++ ++++ ++ 0.91± 0.03 1.49± 0.04 76.31±3.13 36.81± 1.29
5 ++++ + ++++ + ++++ ++ ++++ ++ 0.99± 0.04 1.55± 0.06 73.46± 2.96 36.31± 1.19
Control- V. harveyi untreated with crude extract; Treated- V. harveyi treated with crude extract of U. fasciata; Activity of V. harveyi + = weak; ++ = moderate; +++ = high; ++++ = very high; SAT test
(0.0 to 1.0 molarity (M) = strongly hydrophobic, 1.0 to 2.0 M = moderately hydrophobic; 2.0 to 4.0 M = weakly hydrophobic, and >4.0 M = n ot hydrophobic); BATH-test (>50% partitioning = strongly
hydrophobic, 20 to 50% partitioning = moderately hydrophobic; and <20 % partitioning = not hydrophobic).
-1
Transmission/wavelength (cm )
Figure 4. FTIR spectrum of shadow dried powder of U. fasciata.

Table 2. The wave number (cm-1) of dominant peak obtained from the FTIR absorption spectra
of U. fasciata.
Frequency (cm -1) Bond Functional groups

3425.4 O-H stretch, H-bonded Alcohols, phenols
O-H stretch Carboxylic acids
2926.1
C-H stretch Alkanes
-C=C- stretch Alkenes
1647.7
N-H bend Primary amines
1541.8 N-O asymmetric stretch Nitro compounds
1419.9 C-C stretch (in-ring) Aromatics
Aromatic amines
C-N stretchC-O stretch
1256.1 Alcohols, carboxylic acids, esters, ethers
C-H wag (-CH2X)
Alkyl halides
C-O stretch Alcohols, carboxylic acids, esters, ethers
1154.9 C-H wag (-CH2X) Alkyl halides
C-N stretch Aliphatic amines
1054.2 C-N stretch Aliphatic amines
=C-H bend Alkenes
897.65 C-H "oop" Aromatics
N-H wag Primary, secondary amines
=C-H bend Alkenes
848.08
C-H "oop" Aromatics
C-Cl stretch Alkyl halides
=C-H bend Alkenes
791.88
C-H "oop" Aromatics
C-Cl stretch Alkyl halides
3.40 x 103 cfu/ml as compared to control which is 3.40 x Priyadharshini et al. (2012) observed that aqueous and
105, 1.44 x 105, 1.45 x 105 and 2.49 x 104 cfu/ml, solvent based extracts of U. fasciata showed inhibition
respectively. Various water quality parameters like against fish-borne bacteria and fungal pathogens.
temperature, salinity and pH were observed in every Kolanjinathan and Stella (2011) reported that crude
sampling are presented in Table 4. There were not much extracts of U. reticulata and U. lactuca are inhibitory to
changes of water quality parameters both in the treat- human pathogenic bacteria and fungi. The dietary
ment and control. Although, in the treatment, and with administration of U. fasciata extracts controlled marine V.
extract alone, light greenish coloration was observed harveyi in shrimp grow-out system (Selvin et al., 2011).
when compared with control due to the crude nature of In a recent study, reductions on crude bacteriocin were
extract. noticed in all the days by U. fasciata extract on V. harveyi.
The moderate and weak levels of reduction on
proteolysis, phospholipase, lipolysis and thermonuclease
DISCUSSION of V. harveyi were observed treating against U. fasciata
extract. Silva et al. (2013a) has observed that U. fascita
In the present study, U. fasciata extract reduced the extract exhibited antagonism against V. parahaemolyticus.
growth of V. harveyi. The preliminary phytochemical In this study, the cell surface hydrophobicity of V. harveyi
characterization and antimicrobial efficacy of macro algae exhibit moderate hydro-phobicity by U. fasciata treatment
U. fasciata and Chaetomorpha antennina were studied when compared with the control. This was corroborated
against pathogenic bacteria (Premalatha, 2011). with the values reported by Sivakumar and Kannappan
Figure 5. GC-MS chromatogram of the crude ethyl acetate extract of U. fasciata.
Figure 6. Major compounds isolated from U. fasciata. (a) Structure of Bis(2-ethylhexyl)phthalate

(C24H38O4) extracted and detected by GC-MS from U. fasciata (b) Structure of 1,2-benzenedicarboxylic
acid, butyl 2-ethylhexyl ester (C20H30O4), extracted and detected by GC-MS from U. fasciata.
(2013) from the marine algae such as S. costatum and K. Sargassum muticum using FTIR. Though the GC-MS
alvarezii. analysis of crude extract of U. fasciata revealed many
The FTIR spectra of U. fasciata showed various components, the main chemical constituents observed in
functional groups of compounds which agreed with the high percentage were Bis(2-ethylhexyl) phthalate and
FTIR values reported for marine macro algae Laminaria 1,2-benzenedicarboxylic acid-butyl which may also be
digitata (Dittert et al., 2012). Similarly, Azizi et al. (2013) involved in antagonism against V. harveyi.
observed various functional compounds like water, Challenge against V. harveyi during P. monodon post-
protein, polysaccharide and lipids from marine algae larvae revealed that U. fasciata extract showed 32.40%
Table 3. GC-MS profile of U. fasciata.
Retention Peak area Molecular Molecular

Compound’s name
time (min) (%) formula weight
4.03 Anisole 0.80 C7H8O 108.13
5.29 1-Decene 0.09 C10H20 140.26
8.75 5-Tetradecene, (E)- 0.34 C12H28 196.37
8.88 Dodecane 0.05 C12H26 170.33
9.37 Benzothiazole 0.14 C7H5NS 135.18
11.67 1-Tetradecene 0.52 C14H28 196.37
11.77 Tetradecane 0.07 C14H30 198.38
13.15 Phenol, 2,4-bis(1,1-dimethylethyl) 0.34 C14H22O 206.32
14.21 Cetene 0.60 C16H32 224.42
14.29 Hentriacontane 0.10 C31H64 436.83
15.21 8-Heptadecene 0.23 C17H34 238.45
15.44 Heptadecane 0.06 C17H36 240.46
15.70 Phenol, 2-(1-phenylethyl)- 0.19 C14H14O 198.26
16.46 1-Octadecene 0.47 C18H36 252.48
16.53 Octadecane 0.06 C18H38 254.49
Bicyclo[3.1.1]heptanes, 2,6,6-trimethyl-
16.91 0.32 C10H18 138.24
,(1.alpha.,2.beta.,5.alpha)
16.97 2-Undecanone, 6,10-dimethyl- 0.13 C13H26O 198.34
17.18 Dibutyl phthalate 0.30 C16H22O4 278.34
17.36 Phytol, acetate 0.11 C22H42O2 338.56
17.66 Phthalic acid, butyl isohexyl ester 0.45 C18H26O4 306.39
17.84 Phthalic acid, 2-ethylhexyl pentyl ester 0.09 C21H32O4 348.47
18.14 1,2-Benzenedicarboxylic acid, butyl 2.47 C20H30O4 334.44
18.32 Phthalic acid, butyl isohexyl ester 1.12 C18H26O4 306.39
18.51 5-Eicosene, (E)- 0.66 C20H40 280.53
18.56 Dodecane, 1,1'-oxybis- 0.10 C24H50O 354.65
Silanetriamine,1-azido-N,N,N',N', N'',N''-
19.89 0.21 C6H18N6Si 202.33
hexamethyl-
20.36 Behenic alcohol 0.26 C22H46O 326.60
1,2-Benzenedicarboxylic acid, butyl 2-
20.87 0.27 C20H30O4 334.44
ethylhexyl ester
21.70 Methyl dehydroabietate 0.10 C21H30O2 314.46
22.08 Octacosanol 0.12 C28H58O 410.75
22.24 Phenol, 2,4-bis(1-phenylethyl)- 0.25 C30H29N3O3 479.56
22.37 Phenol, 2,4-bis(1-phenylethyl)- 0.49 C30H29N3O3 479.56
22.80 Bis(2-ethylhexyl) phthalate 0.45 C24H38O4 390.55
23.02 Naphthalene, 6-chloro-1-nitro- 0.13 C10H6ClNO2 207.61
23.21 Bis(2-ethylhexyl) phthalate 88.42 C24H38O4 390.55
26.89 Benzo[h]quinoline, 2,4-dimethyl- 0.22 C15H13N 207.27
reduction in the cumulative percentage of mortality as al., 2009). Marine algae are impending source for owning
compared to control; but, Saptiani et al. (2011) has repor- extensive range of polyunsaturated fatty acids (PUFA),
ted that ethyl acetate, n-butanol fractions of crude carotenoids, phycobiliproteins, polysaccharides and phy-
Acanthus ilicifolius extract controlled P. monodon post- cotoxins, etc (Chu, 2012). It was reported that lipids ob-
larvae from V. harveyi infections. The supplementation of struct microbesby distracting cellular membrane (Bergsson
Undaria pinnatifida and fucoidon incorporated diet proved et al., 2011) of bacteria, fungi and yeasts. These fatty
to enhance growth with reduced mortalities among P. acids may further distress the expression of bacterial
monodon postlarvae caused by V. harveyi (Traifalgar et virulence which was significant for establishing infections.
Table 4. Challenging of crude extracts of U. fasciata against V. harveyi during P. monodon larviculture with the cumulative percentage mortality reduction.
Treatment tubs Average weight of Water quality parameters for treatment and control
Cumulative percentage mortality Control tubs (cfu/ml)
(cfu/ml) postlarvae (mg) tubs
Day Control Treatment Tubs with Total pH in pH in
Tubs with Total plate V. Treatment Control Temperature Salinity
tubs with tubs extract extract and plate V. harveyi control treatment
PL alone count harveyi tubs tubs (°C) (PSU)
V. harveyi with V. harveyi PL alone count tubs tubs
0 0.00 0.00 0.00 0.00 1.24106 1.15106 1.18106 2.41106 17.7 ± 3 18.1±2 29.0±1.0 20±0.5 8.40±0.2 8.30±0.2
5th 13.66±0.3 06.96±0.2 2.390.1 3.230.1 2.42104 2.38104 3.18105 3.40105 60.9 ± 4 63.6±3 29.5±1.0 20±0.5 8.50±0.2 8.40±0.2
10th 26.05±0.9 14.36±0.3 6.190.2 6.030.2 2.15104 1.56104 2.94105 1.44105 121.1 ± 4 127.5±5 29.0±1.0 20±0.5 8.20±0.2 8.30±0.2
15th 35.63±1.1 21.33±0.6 12.050.5 13.330.5 7.4010 4 4.30103 1.51105 1.45105 156.3 ± 5 157.5±5 30.0±1.0 20±0.5 8.40±0.2 8.50±0.2
20th 47.33±1.5 27.81±1.1 18.130.6 17.430.5 1.2910 4 3.40103 2.66104 2.49104 201.5 ± 9 197.9±7 30.0±1.0 21±0.5 8.10±0.2 8.30±0.2
25th 62.13±2.3 36.63±1.3 24.690.9 23.861.0 9.40104 5.40103 1.80104 1.74104 236.9 ± 8 240.1±9 31.0±1.0 21±0.5 8.40±0.2 8.20±0.2
30th 76.30±2.9 43.90±1.3 29.561.0 28.391.0 8.2010 4 4.10103 1.74104 1.51104 269.3 ± 9 266.5±8 30.0±1.0 21±0.5 8.10±0.2 8.00±0.2
Values of average of three determinations with standard deviation (SD)
It has been demonstrated that fatty acids of chain the presence of various chemical constituents as sponsoring the project entitled “Development of
length more than 10 carbon atoms would induce described. Hence, macro algae U. fasciata extract inhibitors for controlling quorum sensing
lysis of bacterial protoplasts. Due to the tough will have immense applications in aquaculture. luminescence disease causing Vibrio harveyi in
environments in which many macro algae exists, shrimp larviculture system” during 2010. This work
effective defense mechanisms have been Conclusion was a component under this project
established and consequently, amusing source of (BT/PR/13383/AAQ/03/501/2009).
bioactive compounds, including polysaccharides, Results from this study proved that the crude
polyphenols, fatty acids and peptides, with extract of U. fasciata at 300 µg/ml inhibited the
REFERENCES
dissimilar structures and activities than those growth and modulated the virulences produced by
found in terrestrial plants (Tierney et al., 2010). V. harveyi. U. fasciata extract at 200 µg/ml also Al-Saif SSAL, Abdel-Raouf N, El-Wazanani HA, Aref IA (2013).
Many species of macro algae had foremost controlled the mortality caused by V. harveyi Antibacterial substances from marine algae isolated from
constituentslike tetradecanoic acid, hexadecanoic during shrimp larviculture. Based on this study, Jeddah coast of Red Sea, Saudi Arabia. Saudi J. Biological
acid, octadecanoic acid methyl esters etc the U. fasciata extract can be used as alternative Sci. (article in press).
Azizi S, Namvar F, Mahdavi M, Ahmad MB, Mohamad R
(Balamurugan et al., 2013) which may reveal bio-inhibitors for the aquaculture practices. (2013). Biosynthesis of silver nanoparticles using brown
antagonism against marine bacteria (Al-Saif et al., Application of such bio-products would moderate marine macro alga, Sargassum muticum aqueous extract.
2013). Lately, the secondary metabolites and the undesirable contamination from applying the Materials 6:5942-5950.
organic extracts obtained from U. fasciata has synthetic compounds with reduced cost and eco- Balamurugan M, Selvam GG, Thinakaran T, Sivakumar K
(2013). Biochemical Study and GC-MS Analysis of Hypnea
potential applications (Silva et al., 2013b) and the friendly nature. musciformis (Wulf) Lamouroux. American-Eurasian J. Sci.
diverse derivatives of diterpenoids extracted from Res. 8(3):117-123.
U. fasciata exhibited antagonism against Vibrio ACKNOWLEDGEMENTS Bergsson G, Hilmarsson H, Thormar H (2011). Antibacterial,
parahaemolyticus and V. harveyi (Chakraborty et antiviral and antifungal activities of lipids. In: Thormar H.
(eds), Lipids and essential oils as antimicrobial agents. John
al., 2010). Thus, in the present study, biological The authors greatly acknowledge the Department Wiley and Sons Limited, Chichester, United Kingdom. pp.
activity of U. fasciata against V. harveyi was due to of Biotechnology (DBT), Government of India for 47-80.
Chakraborty K, Lipton AP, Paulraj R, Vijayan KK (2010). Antibacterial Raissy M, Momtaz H, Moumeni M, Ansari M, Rahimi E (2011).
labdanediterpenoidsof Ulva fasciata Delile from southwestern coast Molecular detection of Vibrio spp. in lobster haemolymph. Afri. J.
of the Indian Peninsula. Food Chem. 119(4):1399-1408. Microbiol. Res. 5(13):1697-1700.
Chu WL (2012). Biotechnological applications of microalgae. IeJSME Saptiani G, Prayitno SB, Anggoro S (2011). Inhibition test of jeruju
6(1):S24-S37. (Acanthus ilicifolius) leaf extracts on the in vitro growth of the Vibrio
Dittert I M, Vilar VJP, da Silva EAB, de Souza SMAGU, de Souza AAU, harveyi. Paper. Simposium Nasional Kimia Bahan Alam XIX. Simnas
Botelho CMS, Boaventura RA (2012). Adding value to marine macro KBA. Samarinda 11-12 p October (In Indonesian).
algae Laminaria digitata through its use in the separation and Saritha K, Mani AE, Priyalaxmi M, Patterson J (2013). Antibacterial
recovery of trivalent chromium ions from aqueous solution. Chem. activity and biochemical constituents of seaweed Ulva lactuca. Global
Eng. J. 193:348-357. J. Pharmacol. 7(3):276-282.
D'Souza L, Devi P, Shridhar DM, Naik CG (2008). Use of Fourier Selvin J, Manilal A, Sujith S, Kiran GS, Lipton AP (2011). Efficacy of
Transform Infrared (FTIR) spectroscopy to study cadmium-induced marine green alga Ulva fasciata extracts on the management of
changes in Padina tetrastromatica (Hauck). Anal. Chem. Insights shrimp bacterial diseases. Lat. Am. J. Aquat. Res. 39(2):197-204.
3:135-143. Silva GC, Albuquerque-Costa R, Oliveira-Peixoto JR, Macedo-Carneiro
Harris L, Owens L, Smith S (1996). A selective and differential PBD, Fernandes-Vieira RHSD (2013a).Tropical Atlantic marine
medium for Vibrio harveyi. Appl. Enviorn. Microbiol. 62(9):3548-3550. macro algae with bioactivity against virulent and antibiotic resistant
Huynh TG, Yeh ST, Lin YC, Shyu JF, Chen LL, Chen JC (2011). Vibrio. Lat. Am. J. Aquat. Res. 41(1):183-188.
White shrimp Litopenaeus vannamei immersed Silva M, Vieira L, Almeida AP, Kijjoa A (2013b). The marine macro
in seawater containing Sargassum hemiphyllum var. Chinense algae of the genus Ulva: chemistry, biological activities and potential
powder and its extract showed increased immunity and resistance applications. Oceanography 1:101. doi:10.4172/ocn.1000101.
against Vibrio alginolyticus and white spot syndrome virus. Fish Sivakumar K, Kannappan S (2013). Inhibitory effect of marine algae
Shellfish Immunol. 31(2):286-93. collected from the East and West coast of India against luciferase
Islam MA, Alam MM, Choudhury ME, Kobayashi N, Ahmed MU (2008). and luminescence producing Vibrio harveyi. Afri. J. Biotechnol.
Determination of minimum inhibitory concentration of cloxacillin for 12(22):3493- 3502.
selected isolates of methicillin-resistant Staphylococcus aureus Soto-Rodriguez SA, Gomez-Gil B, Lozano R, del Rio-Rodriguez R,
(MRSA) with their antibiogram. Bangl. J. Vet. Med. 6(1):121-126. Dieguez AL, Romalde JL (2012). Virulence of Vibrio harveyi
Kanjana K, Radtanatip T, Asuvapongpatana S, Withyachumnarnkul B, responsible for the "Bright-red" Syndrome in the Pacific white shrimp
Wongprasert K (2011). Solvent extracts of the red seaweed Litopenaeus vannamei. J. Invertebrate Pathol. 109(3):307-317.
Gracilaria fisheri prevent V. harveyi infections in the black tiger Tierney MS, Croft AK, Hayes M (2010). A review of antihypertensive
shrimp Penaeus monodon. Fish Shellfish Immunol. 30(1):389-396. and antioxidant activities in macro algae. Botanica Marina 53(5):387-
Kannappan S, Sivakumar K, Patil PK (2013). Effect of garlic extract on 408.
the luciferase, bio-luminescence, virulence factors produced by V. Traifalgar RF, Serrano AE, Corre V, Kira H, Tung HT, Fady RM, Kader
harveyi with a challenge during Penaeus monodon larviculture. Afr. J. Md. A, Laining A, Yokoyama S, Ishikawa M, Koshio S (2009).
Microbiol. Res. 7(18):1766-1779. Evaluation of dietary fucoidan supplementation effects on growth
Kolanjinathan K, Stella D (2011). Comparative studies on antimicrobial performance and Vibriosis resistance of Peneaus monodon
activity of Ulva reticulata and Ulva lactuca against human pathogens. postlarvae. Aquaculture Sci. 57:167-174.
Int. J. Pharma. Biol. Archives 2(6):1738-1744. Vezzulli L, Previati M, Pruzzo C, Marchese A, Bourne DG, Cerrano C
Musharraf SG, Ahmed MA, Zehra N, Kabir N, Choudhary MI, Rahman (2010). Vibrio infections triggering mass mortality events in a
AU (2012). Biodiesel production from micro algal isolates of southern warming Mediterranean Sea. Environ. Microbiol. 12:2007-2019.
Pakistan and quantification of FAMEs by GC-MS/MS analysis. Chem. Zhou J, Fang W, Yang X, Zhou S, Hu L, Li X, Qi X, Su H, Xie L (2012).
Cent. J. 6(1):1-10. A non-luminescent and highly virulent V. harveyi strain is associated
Osman MEH, Aboshady AM, Elshobary ME (2013). Production and with „„bacterial white tail disease‟‟ of Litopenaeus vannamei shrimp.
characterization of antimicrobial active substance from some macro PLoS One 7(2): e29961.
algae collected from Abu- Qir bay (Alexandria) Egypt. Afr. J.
Biotechnol. 12(49):6847-6858.
Paul JJP, Devi SDKS (2013). Seasonal variability of Ulva species
(Green seaweed) in Tirunelveli region, the southeast coast of Tamil
Nadu, India. Res. J. Marine Sci. 1(1):14-17.
Peso-Echarri P, Frontela-Saseta C, Gonzalez-Bermudez CA, Ros-
Berruezo GF, Martinez-Gracia C (2012). Polysaccharides from
seaweed as ingredients in marine aquaculture feeding: alginate,
carrageenan and ulvan. Revista de Biologia Marina y
Oceanografia 47(3):373-381.
Premalatha M (2011). Phytochemical characterization and antimicrobial
efficiency of seaweed samples, Ulva fasciata and Chaetomorpha
antennina. Int. J. Pharma Bio Sci. 2(1):P288-293.
Priyadharshini S, Bragadeeswaran S, Prabhu K, Sophia Rani S (2012).
Antimicrobial and hemolytic activity of seaweed extracts Ulva fasciata
(Delile 1813) from Mandapam, Southeast coast of India. Asian Pac.
J. Trop. Biomed. S38-S39.
Rahman S, Khan SN, Naser MN, Karim MM (2010). Isolation of Vibrio
spp. from Penaeidshrimp hatcheries and coastal waters of Cox‟s
Bazar, Bangladesh. Asian J. Exp. Biol. Sci. 1(2):288-293.
Vol. 8(8), pp. 814-818, 19 February, 2014
DOI: 10.5897/AJMR2013.6512
Characterization and determination of antibiotic

susceptibility pattern of bacteria isolated from some
fomites in a teaching hospital in northern Nigeria
Aminu Maryam1*, Usman-Sani Hadiza1 and Usman M. Aminu2
1
Department of Microbiology, Faculty of Science, Ahmadu Bello University, Zaria, Kaduna State, Nigeria.
2
University Health Services, Ahmadu Bello University, Main Campus, Zaria, Kaduna State, Nigeria.
Fomites are inanimate objects that can serve as vehicles for pathogens transfer. This study was
conducted to determine the antibiogram of bacteria isolated from fomites in a teaching hospital in
Nigeria. Exactly 35 samples were used for the study. Twenty three (65.7%) isolates were obtained; the
ratio of Gram positive to Gram negative organisms was 12 to 11. The bacteria isolated were
Staphylococcus aureus (21.7%), Staphylococcus epidermidis (8.7%), Streptococcus spp. (8.7%),
Bacillus spp. (13.0%), Escherichia coli (26.1%), Pseudomonas spp. (8.7%) and Klebsiella spp. (13.0%).
The isolated bacteria showed varying susceptibility pattern to the antibiotics used and were all
susceptible to erythromycin and streptomycin.
Key words: Bacteria, fomites, antibiotics, susceptibility, teaching hospital, Nigeria.
INTRODUCTION
Fomites consist of either porous or nonporous surfaces Stethoscopes, neckties (Merlin et al., 2009; Williams
or inanimate objects that whencontaminated with patho- and Davis, 2009), skin cells, hair, food, computer
genic microorganisms can transfer them to a new host keyboards, pens, tables, artificial acrylic fingernails
thereby serving as vehicles in transmission (Greene, (McNeil et al., 2001), bedding and clothing are common
2009; Cramer, 2013). Fomites are associated particularly hospital sources of pathogens (Boyce et al., 1997;
with hospital acquired infections (HAIs) that remain a Cramer, 2013). Up to 60% of hospital staff’s uniforms are
major cause of patient morbidity and mortality (Weber et usually colonized with potentially pathogenic bacteria,
al., 2010; Nwankiti et al., 2012). An estimated 20 to 40% including drug-resistant organisms (Munoz-Price et al.,
of HAIs have been attributed to cross infection via the 2012). Intravenous fluid (IVF) tubes/stands, catheters,
hands of health care workers (HCWs), who have become water systems and life support equipment can also be
contaminated from direct contact with the patient or carriers, when the pathogens form biofilms on the
indirectly by touching contaminated hospital environmen- surfaces (Willey et al., 2011; Cramer, 2013).
tal surfaces (Kelly, 2002; Christensen et al., 2007; Identification of common fomites and associated
Mangicaro, 2012). Fomites can therefore serve as reser- pathogens in any hospital settings is important because
voir with pathogens being spread from the inanimate the most important factor in prevention of a disease is to
environment to an animate (patient) environment via the simply identify what has been transferring the disease in
hands of HCWs (Bhalla et al., 2004; Kramer et al., 2006; the first place (Cramer, 2013). Fomites are therefore an
Ikeh and Isamade, 2011; Nwankiti et al., 2012). opportunity to interrupt the spread of infection.
*Corresponding author. E-mail: [email protected]. Tel: +234 803 328 7031.

Maryam et al. 815
Table 1. Distribution of growth and organisms isolated from fomites in the A&E ward of ABUTH, Zaria-Nigeria.
Fomite Total no. of sample Number with growth (%) Organism(s) isolated
Table 5 3 (60) S. aureus, Bacillus spp.
Stethoscope 5 3 (60) S. epidermidis, E. coli Klebsiella spp.
Uniform 5 4 (80) S. aureus, E. coli, Streptococcus spp.,
Pen 5 3 (60) S. aureus, Bacillus spp, E. coli
Streptococcus spp., S. epidermidis, Klebsiella
IVF Stand 5 4 (80)
spp. Pseudomonas spp.
Door knob 5 3 (60) S. aureus, E. coli
Chair 5 3 (60) S. aureus, E. coli, Bacillus spp.
Total 35 23 (65.7)
By recognizing them, avoiding them, disinfecting them, or study in Nigeria (Ikeh and Isamade, 2011). Majority of the
cleansing the hands after touching them, the spread of isolates were Gram positives organisms (52.2%: 12/23)
many infections can be halted (Greene, 2009; Cramer, as compared to the Gram negative (47.8%: 11/23).
2013). This study was therefore conducted to isolate Staphylococci were isolated from all the fomites; S.
bacteria from fomites in the Accident and Emergency epidermidis (8.7%: 2/23) from IVF stand and stethoscope
(A&E) ward of Ahmadu Bello University Teaching and S. aureus (21.7%: 5/23) from the other fomites
Hospital, Zaria, Nigeria and to determine their antibiotic (Table 2).
susceptibility pattern. Isolation of more Gram positive organisms is consistent
with previous reports (Neely and Maley, 2000; Chikere et
al., 2008) and agree with the statement that Gram-
METHODOLOGY positive bacteria have overtaken the Gram-negative as
the predominant bacteria isolated from fomites
A total of thirty-five (35) samples were collected from fomites
(tables, chairs, stethoscopes, pens, uniforms, doorknobs and IVF
(Inweregbu et al., 2005). Gram-positive organism have
stands) after the early morning cleaning and disinfection process in earlier been noted to be causing more serious infections
the A&E ward of Ahmadu Bello University Teaching Hospital, Zaria than ever before in surgical patients, who are increasingly
between the months of July and October 2010. The samples were aged, ill and debilitated (Barie, 1998). In a more recent
collected using sterile swab sticks, transported immediately to the study, only Gram positive organisms were isolated (Ikeh
laboratory and cultured using the streak plate method on nutrient and Isamade, 2011).
agar, MacConkey agar, Eosin methylene blue, mannitol salt agar,
blood agar and centrimide agar as described by Cheesbrough
Isolation of more Gram positive organisms is probably
(2006). The plates were incubated at 37°C for 24 h; the isolates because they are members of the body flora of both
were sub-cultured, maintained on Nutrient Agar slants and asymptomatic carriers and sick persons. These
identified based on their cultural morphology, Gram and bioche- organisms can be spread by the hand, expelled from the
mical reactions (Cheesbrough, 2006). respiratory tract or transmitted by animate or inanimate
Antibiotic sensitivity testing was performed using Mueller-Hinton
objects (Chikere et al., 2008). Their main source(s) of
agar. Inoculums were prepared by standardizing using the
McFarland’s standard. Standard antibiotic discs containing colonization on the fomites might likely be nasal carriage
augmentin, ampiclox, septrin, ceftriaxone, ampicillin, ciprofloxacin, by hospital personnel (Graham et al., 2006), likely
erythromycin, lincomycin, nitrofurantoin, ofloxacin, streptomycin, facilitated by hand-to-mouth or hand-to-nose contact
tetracycline and gentamycin with concentrations of 30, 3, 250, 30, while using these fomites, and/or by poor hand-washing
15, 25, 10 m, 30, 200, 10, 10, 25, 10 mcg, respectively were used. habits (ASM, 2005).
The discs were placed on the plates which were inverted and kept
Isolation of Staphylococcus aureus from almost all the
in the refrigerator for 30 min and then incubated at 37°C for 24 h. A
clear zone of growth inhibition around a disc determined the relative fomites show their ubiquitous nature and that they can be
susceptibility of each isolate to the antibiotics. sources of infection to patients as previously noted
(Hartmann et al., 2004; Inweregbu et al., 2005; Ikeh and
Isamade, 2011). Although the strains of the isolated S.
RESULTS AND DISCUSSION aureus were not determined in this study, methicillin
resistant Staphylococcus aureus (MRSA) strains have
A total of 23 (65.7%) bacterial growths were obtained been shown to be transmissible from many fomites to
from the culture with uniforms and IVF stands showing skin (Desai et al., 2011). For example, an earlier
highest number of growth each (80%: 4/5), followed by study showed that one in three stethoscopes tested to
tables, stethoscopes, pens, door knobs and chairs each harbour Staphylococcus aureus and that 15% of all
having 60% (3/5) (Table 1). The percentage of growth stethoscopes tested were contaminated with MRSA
obtained was lower than the 99% obtained in a previous (Williams and Davis, 2009). Staphylococcus epidermidis
Table 2. Frequency of isolation of bacteria from fomites in the A&E

Ward of ABUTH, Zaria-Nigeria (N = 23).
Bacteria Isolated Frequency Percentage (%)

Staphylococcus aureus 5 21.7
Staphylococcus epidermidis 2 8.7
Streptococcus spp. 2 8.7
Bacillus spp. 3 13.0
Escherichia coli 6 26.1
Pseudomonas spp. 2 8.7
Klebsiella spp. 3 13.0
Table 3. Parentage susceptibility of bacterial isolates to common antibiotic.
Organism CN OFX CPX CRO SXT E L S APX AG COX C N PM T

S. aureus 40 40 60 60 60 100 80 100 80 20 - - - - -
S. epidermidis 50 50 100 100 50 100 50 100 100 50 - - - - -
Streptococcus spp. 50 50 100 50 100 100 100 100 50 50 - - - - -
Bacillus spp. 33.3 33.3 66.7 100 100 100 100 66.7 66.7 - - - - - -
E. coli 100 50 83.3 66.7 16.7 - - - - - 100 100 83.3 50 50
Pseudomonas spp. 100 100 50 50 50 - - - - - - 50 - - 50
Klebsiella spp. 100 33.3 - 100 10 - - - - - 66.7 100 66.7 100 66.7
CN = Gentamycin; OFX = ofloxacin; CPX = ciprofloxacin; CRO = ceftriazone; SXT = cotrimozazole; E = erythromycin; L = lincomycin; S =
streptomycin; APX = ampiclox; AG = augmentin; COX = cephalexin ; C = chloramphenicol; N = nitrifurantoin; PM = ampicillin; T= tetracyclin.
was isolated with the lowest frequency in this study. stands and tables probably due to fecal contamination as
Though these strains of staphylococci are known to be a result of improper hand washing after the use of toilet.
non-pathogenic on the body, when they harbor antimi- This is evident in its isolation from pens, stethoscopes
crobial resistance genes they constitute serious health and doorknobs which are usually held and touched by
hazard. This coagulase negative Staphylococci have hands.
been isolated from keyboards on multiple user computers As previously reported (Williams and Davis, 2009), the
(Hartmann et al., 2004) and increased virulence of this Gram negative bacteria Klebsiella spp. and
organism resulting from the acquisition of methicillin Pseudomonas spp. were isolated from stethoscopes and
resistance has been recognized (Ben-Saida et al., 2006). IVF stand in this study. Gram-negative bacteria are
Other bacteria isolated were Streptococcus spp. (8.7%: responsible for a high proportion of HAIs, particularly
2/23) from IVF stand and uniforms, Bacillus spp. (13.0%: among the critically ill and those in hospital for long
3/23) from pens, tables and chairs, Escherichia coli periods (Gould and Chamberlain, 1994).
(26.1%: 6/23) from all the fomites except table and IVF The isolated bacteria showed varying susceptibility
stand, Klebsiella spp. (13.0%: 3/23) from IVF stand and pattern to the antibiotics used (Table 3). All the S. aureus
stethoscopes and Pseudomonas spp. (8.7%: 2/23) from and S. epidermidis isolates were sensitive to erythro-
only IVF stand. mycin and streptomycin (100%). Streptococcus spp. were
Bacillus spp., the only Gram positive bacilli most sensitivity (100%) to ciprofloxacin, septrin,
encountered in this study has been isolated with the erythromycin, streptomycin and ampiclox. All the isolated
highest frequency in some studies in Nigeria: 84 E. coli were susceptible to gentamycin, cephalexin and
(Nwankiti et al., 2012) and 90% (Ikeh and Isamade, chloramphenicol while all the isolated Pseudomonas spp.
2011). This organism forms endospores, which, probably were susceptible to gentamycin and ofloxacine. Similarly,
from the air can settle on the surface of fomites in the all the Klebsiella spp. isolates were susceptible to
hospital, explaining why they were isolated mainly from gentamycin, ceftriazone, chloramphenicol and ampicillin.
tables and chairs. Susceptibility of all the organisms isolated to
Although, Gram positive organisms were more Erythromycin and Streptomycin does not necessary imply
frequently isolated in this study, the Gram negative that these antibiotics may represent therapeutic options
bacterium Escherichia coli was the most prevalent. E. coli for infections caused by these organisms. S. aureus and
were isolated from almost all the fomites except IVF S. epidermidis showed similar susceptibility pattern being
Maryam et al. 817
highly susceptible to Streptomycin and resistant to settling on them or by hand, to survive and be transmitted
Augmentin. Augmentin may therefore not be a drug of to patient or HCWs. Although surface cleaners play a role
choice for treatment of infections caused by these in reducing the spread of infections, not all disinfectants
organisms. The Gram positive isolates were resistant to work equally well at killing all pathogens (Boskey, 2011).
gentamycin and ofloxacin while the Gram negative iso- Some pathogens are more susceptible to specific
lates were resistant to Cotrimozazole, indicating that detergents than others. Therefore, the need for regular
these antibiotics might not be very effective in the treat- cleaning and effective disinfection of fomites identified to
ment of HAIs that might results from infection with these be easily contaminated with specific pathogens is very
pathogens. Similar weakness and susceptibility in activity crucial. The effective use of disinfectants constitutes an
of antibiotics against bacteria from clinical specimens important factor in preventing HAIs and improved
have been shown (Chikere et al., 2008). As more cleaning/disinfection of environmental surfaces and hand
bacteria become resistant to antibiotics, the ability to hygiene have been shown to reduce the spread of
control the spread of these bacteria with antibiotic treat- hospital acquired pathogens (Rutala and Weber, 2001;
ments decreases. Nicolle, 2002; Christensen et al., 2007; Weber et al.,
The isolation of potential pathogens such as S. aureus 2010; Boskey, 2011).
and Streptococcus spp. from IVF stands and uniforms of
HCWs in the A&E ward confirms the possibility of cross
infections from workers to patients. This implies that Conclusion and recommendation
these fomites might act as vehicles for transfer of these
pathogens hence etiologic agents for infectious The isolation of pathogenic bacteria from fomites in this
pathogens. Many studies have shown uniforms to be study indicates that they can be vehicles for disease
potential reservoirs for hospital organisms, potentially re- transmission. In the light of this, there is need therefore
infecting the hands of HCWs (Boyce et al., 1997; Snyder for thorough disinfection and conscientious contact
et al., 2008; Munoz-Price et al., 2012). Treakle et al. control procedures to minimize the spread of these
(2009) showed a large proportion of HCWs' white coats pathogens in the A&E ward where interaction between
to be contaminated with S. aureus, including MRSA and patients, HCWs and caregivers is very common and
postulated that white coats may be an important vector frequent. It is also necessary to encourage the effective
for patient-to-patient transmission of S. aureus. Potential use of disposable hand gloves between patients and to
pathogens such as S. aureus, Acinetobacter spp. and avoid touching fomites with gloved hands, which may be
enterococci have been recently isolated from hands that acting as sources of infection.
were used to touch uniforms (Munoz-Price et al., 2012).
Similarly, isolation of E. coli from door knobs simply
implies that they can be easily transmitted to anybody Limitation of study
that opened the door to the A&E ward. One can therefore
easily postulate how these fomites could become vectors Small sample size and inability to determine if the S.
for the spread of pathogenic organisms in the A&E ward aureus isolated were MRSA.
as a HCW moves from one patient to another and these
fomites contacts different patients. ACKNOWLEDGEMENTS
In the A&E Ward of ABUTH, we observed that reusable
cleaning cloths soaked in bucket of water containing We acknowledge all the personnel at the Accident and
OmoR detergent are used irregularly to clean door knobs Emergency ward of ABUTH for their cooperation during
and tables; while methylated spirit is used to clean the IV sample collection.
stands once or twice a week. Floors are cleaned with
mops dipped in diluted SalvonR every morning and even-
ing while JikR is used only when there is contamination REFERENCES
with blood. The cloths and mops used in cleaning are American Society for Microbiology (ASM) (2005). Women better at hand
however not adequately cleaned and disinfected, as most hygiene habits, hands down. ASM Press Releases: 2005. Available
often, the water containing the disinfectant is not changed from: http://www.asm.org/Media/index.asp. Cited 2013 July 9.
until the cleaning is completed. It has been shown that if Barie PS (1998). Antibiotic-resistant Gram-positive cocci: implications
water-disinfectant mixture used in cleaning is not for surgical practice. Wld. J. Surg. 22(2):118-126.
Ben-Saida N, Ferjeni A, Benhadjtaher N, Monastiri K, Boukadida J
changed regularly, the mopping procedure actually can (2006). Clonality of clinical methicillin resistant Staphylococcus
spread heavy microbial contamination throughout the epidermidis isolates in a neonatal intensive care unit. Patholo. Biol.
health-care facility (Mangicaro, 2012). 54:337-342.
Bhalla A, Pultz NJ, Gries DM, Ray AJ, Eckstein EC, Aron DC, Donskey
Irregular cleaning and effective disinfection of door
CJ (2004). Acquisition of nosocomial pathogens on hands after
knobs to the A&E ward, tables, chairs and IV stands in contact with environmental surfaces near hospitalized patients. Infect.
the ward may allow pathogens that contaminate them by Control Hosp. Epidemiol. 25:164-167.
Boskey E (2011). What is Fomite Transmission. Updated April 06, 2011. Nicolle EL (2002). Nosocomial infections. Available from:
Accessed 13
th
Nov 2013. Available from: http://www.sciencedirect.com/. Accessed 7 August 2012.
http://std.about.com/od/glossary/g/What-Is-Fomite-Transmission.htm. Nwankiti OO, Ndako JA, Nwankiti AJ, Okeke OI, Uzoechina AR, Agada
Boyce JM, Potter-Bynoe G, Chenevert C, King T (1997). Environmental GO (2012). Computer keyboard and mouse: etiologic agents for
contamination due to methicillin-resistant Staphylococcus aureus: microbial infections. Nat. Sci. 10(10):162-166.
possible infection control implications. Infect. Control Hosp. Rutala WA, Weber DJ (2001). Surface disinfection: should we do it? J.
Epidemiol. 18:622-627. Hosp. Infect. 48 Suppl A:S64-68.
Cheesbrough M (2006). District Laboratory Practice in Tropical Snyder GM, Thom KA, Furuno JP, Perencevich EN, Roghmann MC,
Countries. Part 2. Cambridge University Press, United Kingdom. Strauss SM, Netzer G, Harris AD (2008). Detection of methicillin-
Chikere, CB, Omoni VT, Chikere BO (2008). Distribution of potential resistant Staphylococcus aureus and vancomycin-resistant
nosocomial pathogens in a hospital environment. Afri J. Biotech. enterococci on the gowns and gloves of healthcare workers. Infect.
7(20):3535 -3538. Control Hosp. Epidemiol. (7):583-9.
Christensen TE, Jørgensen JS, Kolmos HJ (2007). The importance of Treakle AM, Thom KA, Furuno JP, Strauss SM, Harris AD, Perencevich
hygiene for hospital infections. Ugeskr Laeger. 169(49):4249-4251. EN (2009). Bacterial contamination of health care workers' white
Cramer L (2013). Fomites, fomite, fomite! Available from: coats. Am. J. Infect. Control 37(2):101-5.
http://www.microbiology.com//p=961. Accessed 19 Nov 2013. Weber DJ, Rutala WA, Miller MB, Huslage K, Sickbert-Bennett E
Desai R, Pannaraj PS, Agopian J, Sugar CA, Liu GY, Miller LG (2011). (2010). Role of hospital surfaces in the transmission of emerging
Survival and transmission of community-associated methicillin- health care-associated pathogens: norovirus, Clostridium difficile, and
resistant Staphylococcus aureus from fomites. Am. J. Infect. Contrl. Acinetobacter species. Am. J. Infect. Control 38(5 Suppl 1):S25-33.
39(3):219-225. Willey JM, Sherwood LM, Woolverton CJ. (2011). Epidemiology and
Gould D, Chamberlain A (1994). Gram-negative bacteria: the challenge public health microbiology: Nosocomial infections. In: Willey JM,
of preventing cross-infection in hospital wards: a review of the Sherwood LM and Woolverton CJ. edited Prescott’s Microbiology.8th
literature. J. Clin. Nurs. 3(6):339-345. Edition, New York. The McGraw Hill Companies. International
Graham P, Lin S, Larson EA (2006). US population based survey of Edition. pp. 873,884-886.
Staphylococcus aureus colonization. Ann. Internal Med. 144:318-325. Williams C, Davis DL (2009). Methicillin-resistant Staphylococcus
Greene A (2009). Fomites. Available from: aureus fomite survival. Clin. Lab. Sci. 22(1):34-38.
http://www.drgreene.com/articles/fomites/. Reviewed by Le-Bucklin
K-V, Hicks R January 12, 2009. Accessed 4 Nov 2013.
Hartmann B, Benson M, Junger A, Quinzio L, Röhrig R, Fengler B,
Färber UW, Wille B, Hempelmann G (2004). Computer keyboard and
mouse as a reservoir of pathogens in an intensive care unit. J. Clin.
Monitor Comput.18 (1):7-12.
Ikeh EI, Isamade ES (2011). Bacterial flora of fomites in a Nigerian
multi-disciplinary intensive care unit. Lab. Med. 42:411-413.
Inweregbu K, Dave J, Pittard (2005). Nosocomial infections. Contin.
Educ. Anaesth, Crit. Care Pain 5(1):4-17.
Kelly MP (2002). Fomites role in disease transmission is still up for
debate. Cited 2012 August 12. Available from:
http://www/infectioncontroltoday.com.
Kramer A, Scwebke I, Kampf G (2006). How long do nosocomial
pathogens persist on inanimate surfaces? A systematic review. BMC
Infect. Dis 6:130.
Mangicaro S (2012). Fomites: a vector for infection transmission.
Updated March 20, 2012; cited July 9 2013. Available from:
http://www.gnyhaservices.com/801/File.aspx.
McNeil SA, Foster CL, Hedderwick SA, Kauffman CA (2001). Effect of
hand cleansing with antimicrobial soap or alcohol-based gel on
microbial colonization of artificial fingernails worn by health care
workers. Clin. Infect. Dis. 32(3):367-372.
Merlin MA, Wong ML, Pryor PW, Rynn K, Marques-Baptista A, Perritt R,
Stanescu CG, Fallon T (2009). Prevalence of methicillin-resistant
Staphylococcus aureus on the stethoscopes of emergency medical
services providers. Prehosp. Emerg. Care. 13(1):71-74.
Munoz-Price LS, Arheart KL, Mills JP (2012). Associations between
bacterial contamination of health care workers' hands and
contamination of white coats and scrubs. Am. J. Infect. Contrl.
40(9):e245-8. doi: 10.1016/j.ajic.2012.03.032.
Neely AN, Maley MP (2000). Survival of enterococci and staphylococci
on hospital fabrics and plastic. J. Clin. Microbiol. 38(2):724-726.
Vol. 8(8), pp. 819-824, 19 February, 2014
DOI: 10.5897/AJMR2013.6517
Prevalence of different enterococcal species isolated

from blood and their susceptibility to antimicrobial
drugs in Vojvodina, Serbia, 2011-2013
Mihajlović-Ukropina Mira*, Medić Deana, Jelesić Zora, Gusman Vera, Milosavljević Biljana
and Radosavljević Biljana
Institute of Public Health of Vojvodina, Centre for Microbiology, University of Novi Sad, Faculty of Medicine, Serbia.
Enterococci are one of the leading causes of nosocomial infections worldwide. Enterococcus faecalis
and Enterococcus faecium are the most commonly isolated. The aim of this study was to determine
prevalence of these species isolated from blood samples of hospitalized patients and their susceptibility
to antibiotics particularly to vancomycin and high concentrations of aminoglycosides. A total of 89
enterococcal strains isolated from blood samples between January 1st 2011 and August 31st 2013 were
tested. The species identification and susceptibility to antimicrobial drugs were performed using
automated VITEK 2 system. The most common species was E. faecalis (55.05%), followed by E. faecium
(41.57%). The enterococcal isolates were multidrug resistant with E. faecium resistance to vancomycin
of 54.05%, while resistance in E. faecalis was not found. All vancomycin resistant enterococci had VanA
phenotype of resistance. Thirty three (89.18%) isolates of E. faecium were high-level gentamycin
resistant and 32 (91.4%) were resistant to high concentration of streptomycin, whereas frequency of
resistant E. faecalis was 61.2 and 63.04%, respectively. This study shows that resistance in
enterococcal species is a serious clinical problem in our hospital and suggests the need for regular
susceptibility test and species level identification of enterococcal isolates.
Key words: Enterococci, blood culture, antimicrobial resistance.
INTRODUCTION
Enterococci are part of normal flora of gastrointestinal became one of faecium) are responsible for the majority
tract of humans and animals, but they have also emerged of infections in the most frequent causes of intrahospital
as significant cause of serious infection such as endo- infections particularly because of increasing resistance to
carditis, urinary and blood stream infections, intra- a wide range of antibiotics (Schaberg et al., 1991; Low et
abdominal end intra-pelvic abscesses (Moellering, 1992; al., 2001; Chou, 2008; Hidron et al., 2008; Bereket, 2012;
Teixeira and Facklan, 2003). Among enterococci, Sievert et al., 2013).
Enterococcus faecalis (E. faecalis) and Enterococcus Enterococci have both an intrinsic and acquired
faecium (E. humans. Over the last two decades, they resistance (Murray, 1990, 2000; Leclercq, 1997). They
*Corresponding author. E-mail: [email protected]. Tel: +381638657743. Fax: +381216613989.
Abbreviations: E. faecalis, Enterococcus faecalis; E. faecium, Enterococcus faecium; ATCC, American Type Culture Collection;
PBP, penicillin binding protein; HLAR, high-level aminoglycoside resistance; VRE, vancomycin resistant enterococci; SPSS,
statistical package for the social sciences; ICU, intensive care unit.
are intrinsically resistant to penicillinase-susceptible faecalis American Type Culture Collection (ATCC) 29212 was used
penicillins (low level), penicillinase-resistant penicillins, as control.
cephalosporins, sulphonamides, clindamycin and low-
level concentrations of aminoglycosides. Acquired Statistical analysis
resistance to penicillins, chloramphenicol, tetracyclins,
aminoglycosides (high-level) and vancomycin develops The statistical differences were analyzed using x2 test. The test was
either by mutation or transfer of plasmids and trans- performed using SPSS (statistical package for the social sciences).
posons. Resistance of many beta-lactams is as a result A p-value of < 0.05 was considered significant .
of overproduction and modification of penicilin-binding-
proteins (PBPs), particularly PBP5, with low affinity for
antibiotics. RESULTS
High-level aminoglycoside resistance (HLAR) can be
mediated by single mutation within a protein of the 30S Among 89 enterococci isolated from blood samples, the
ribosome subunit or by production of amino-glycoside- most common species was E. faecalis (55.05%), followed
modifying enzymes. Acquired resistance to glycopeptides by E. faecium (41.57%). There was no significant
occurs because of synthesis of modified cell wall difference between prevalence of these two species (p
precursors with decreased affinity for these drugs. Nine value = 0.196). Prevalence of all enterococcal species
phenotypes of glycopeptide resistance (VanA, B, C, D, E, isolated from blood is given in Table 1. Susceptibility of E.
G, L, M, N) have been detected (Arthur, 1993; Perichon faecium and E. faecalis to antibiotics is shown in Table 2.
et al., 1997; Fines et al., 1999; Xu et al., 2010; Lebreton Resistance of E. faecium isolates to all antibiotic tested,
et al., 2011). The most common and clinically significant except to chloramphenicol, was higher as compared to E.
are VanA, that determine high-level resistance to both faecalis strains. A high percentage of E. facium resistant
vancomycin and teicoplanin, and VanB with variable to vancomycin (54.05%) was detected, while resistance
resistance to vancomycin only. in E. faecalis was not found. All vancomycin resistant
Resistance to wide range of antibiotics is a great enterococci (VRE) were resistant to teicoplanin also,
problem to clinicians because it has seriously affected the belonging to VanA phenotype of resistance. Thirty three
treatment of enterococcal infections leaving limited (89.18%) isolates of E. faecium were high-level
therapeutic options. gentamycin resistant and 32 (91.4%) were high-level
Keeping in mind that antimicrobial susceptibility of streptomycin, whereas the number of resistant E. faecalis
enterococci is not predictable and that it differs by was 30 (61.2%) and 29 (63.04%), respectively. The
enterococcal species and changes rapidly over time, difference in resistance to gentamycin and streptomycin
species identification and its susceptibility to antimicrobial in these two species was statistically significant (p =
drugs are important for clinicians for choosing the most 0.004 and p = 0.003, respectively). The most effective
effective drug and also useful for epidemiological antibiotics were linezolid and tigecycline against all
investigations. isolates tested. Unlike E. faecium, all isolates of E.
The aim of this study was to determine prevalence of E. faecalis were susceptible to vancomycin and teicoplanin
faecalis and E. faecium isolated from blood and their also. E. faecium isolates were susceptible to quino-
susceptibility to antibiotics particularly, vancomycin and pristin/dalfopristin. Resistance to other antibiotics range
high concentration of aminoglycosides. from 37.2% for chloramphenicol to 83.3% for
ciprofloxacin in E. faecalis isolates. In E. faecium it was
between 9.3% for chloramphenicol and 97.2% for
MATERIALS AND METHODS ampicillin. All E. faecium 89.7% isolates of E. faecalis
were resistant to three or more groups of antibiotics and
This study was conducted at the Centre for Microbiology of Institute
the most common multidrug resistant profile in E. faecium
of Public Health, Vojvodina. A total of 89 enterococcal strains that
were isolated from blood samples of hospitalized patients between was resistance to ampicillin, high-level concentrations of
January 1st 2011 and August 31st 2013 were included in the study. aminoglycosides, vancomycin, and ciprofloxacin.
All blood samples were routinely cultured in blood culture bottles Resistance to ampicillin, high-level concentrations of
(Bio Merieux, France) using semi-automated blood culture system aminoglycosides, quinipristin/ dalfopristin and
(Bact/Alert, Bio Merieux, Marcyl’ Etoile, France). The positive ciprofloxacin was the most commonly found pattern in
samples were inoculated onto blood and MacConkey agar plate
(HiMedia, India) that were incubated aerobically for 24 h at 37°C.
isolates of E. faecalis. The rates of VRE isolates from
Enteococcal genus identification was based on colony different wards are given in Table 3.
morphology, Gram staining results, catalase reaction, growth on Enterococcal species and VRE were most commonly
bile-esculin agar and tolerance to 6.5% NaCl. The species found in patients from intensive care unit (ICU), followed
identification was done using automated VITEC 2 system by those from haematology/oncology ward.
(BioMerieux). Susceptibility to ampicillin, gentamycin (high-level),
There was no significant difference between proportion
streptomycin (high-level), ciprofloxacin, vancomycin, teicoplanin,
linezolid, tigecycline, chloramphenicol and quinopristin/ dalfopristin of enterococcal isolates and VRE found in different
was determined using VITEK 2 system according to Clinical hospital wards (p value=0.068 and p value=0.894,
Laboratory Standards Institute guideline (2010, 2011, 2012). E. respectively). Demographic characteristics of patients with
Mira et al. 821
Table 1. Prevalence of enterococcal

species isolated from blood.
Species No. (%) of isolates

E. faecalis 49 (55.05%)
E. faecium 37 (41.57%)
E. gallinarum 2 (2.24%)
E. caseiflavus 1 (1.12%)
Total 89 (100%)
Table 2. Susceptibility of E. faecium and E. faecium to antibiotics.
E. faecium E. faecalis
Antibiotic No. of isolates No. (%) of resistant No. of isolates No. (%) of resistant
tested isolates tested isolates
Ampicillin 37 36 (97.2) 49 28 (57.1)
Gentamycin (hl) 37 33 (89.1) 49 30 (61.2)
Streptomycin
35 32 (91.4) 46 29 (63.0)
(hl)
Ciprofloxacin 26 25 (96.1) 36 30 (83.3)
Vancomycin 37 20 (54.05) 49 0 (0)
Teicoplanin 37 19 (53.1) 49 0 (0)
Linezolid 37 0 (0) 49 0 (0)
Tigecycline 37 0 (0) 46 0 (0)
Chloramphenicol 32 3 (9.37) 43 16 (37.2)
Quinopristin/
dalfopristin 29 0 (0) 30 30 (100)
hl- High-level.
Table 3. Distribution of E. faecium, E. faecalis and VRE within hospital ward.
Ward No. of E. faecium and E. faecalis No. (%) of VRE

Intensive care unit (ICU) 32 8(25)
Haematology/oncology 20 5(25)
Internal 17 4(23)
Other 17 3(17)
Total 86 20
positive blood cultures and VRE are showed in Table 4. a wide range of antibiotics. Until 1990s, glycopeptides
Proportion of E. faecalis and E. faecium isolates in were antibiotics of choice in treating serious infections
males (62.7%) was higher than in females (32.2%), (p = caused by enterococci, but occurrence of strains resistant
0.018). Prevalence of VRE also was higher in males to these drugs significantly decreased their efficiency.
(25.9%) than in females (18.8%), but the difference was VRE were first detected in France and United Kingdom in
not statistically significant (p = 0.619). The number of 1986, a year later similar strains were isolated in
enterococcal isolates found in patients above 60 years of hospitals in United States and since then VRE have been
age was higher than in other age groups (p = 0.004). discovered throughout the world (Uttley, 1988; Murray,
There was no significant difference in proportion of VRE 2000; Edmond et al., 1999; Treitman et al., 2005; Goossens,
between different age groups (p = 0.737). 1998). The main reason for emergence of resistant isolates
is widespread use of vancomycin. Broad spectrum
antibiotics, such as third-generation cephalosporins and
DISCUSSION fluoroquinolons, also contributed to the selection of
resistant isolates (Sood et al., 2008; Heath et al., 1996).
Enterococci are one of the leading causes of nosocomial In some European countries the outbreaks of VRE were
infections worldwide because of increasing resistance to related to the extensive use of avoparcin, as growth
Table 4. Demographic characteristics of patients.
Variable No. (%) of E. fecium and E. faecalis No. (%) of VRE

Sex
Male 54 (62.7) 14 (25.9)
Female 32 (37.2) 6 (18.8)
Age group
0-19 23 (26.7) 0 (0)
20-39 11 (12.7) 3 (27.3)
40-59 18 (20.9) 7 (38.9)
≥60 34 (39.5) 10 (29.4)
promoter in farm animals (McDonald et al., 1997; Bates, 2007), Czech Republic (Kolar et al., 2006), Poland
1997; Bager et al., 1997). Avoparcin causes bacterial cross- (Sadowy et al., 2013), Serbia (Mihajlovic-Ukropina et al.,
resistance to vancomycin and teicoplanin. 2011) and other European countries (Werner et al.,
Resistant enterococcal isolates are reported all over the 2008).
world, but prevalence of enterococcal species and their Enterococcal infections develop usually in patients with
resistance vary widely in different geographic regions. some risk factors, such as severe underlying disease,
In this study, E. faecalis (55.04%) was the most common long hospital stay, particularly in ICU, immune-suppression
enterococcal species isolated from blood samples, followed and haematological malignance. The largest number of
by E. faecium (41.57%). E. faecalis was predominant isolate vancomycin resistant E. faecium in this study was found
in studies from India (62.2% by Ajay et al. (2012), 76% by in samples of patients from ICU and haematology/oncology
Sreeja et al. (2012) and 82% by Bose et al. (2012), UK ward that is in agreement with results of other authors
(62% by Brown et al. (2008) and 63% by Fisher and (Kolar et al., 2006; Brown et al., 2008).
Phillips (2009) and Turkey (76% by Shah et al. (2012). In addition to intrinsic resistance to low-level resistance
Until the early to mid-1990s this species was the most to aminoglycosides, enterococci can acquire resistance
frequent isolated enterococci in US hospitals (Treitman et to high concentrations of aminoglycosides. Very high
al., 2005). Since then there has been an important increase percentages of HLAR in E. faecium (~90%) and E.
in the incidence of E. faecium as a cause of nosocomial faecalis (~60%) were found in this study, similar to the
infections (Hidron et al., 2008). results reported in India (Sood et al., 2008; Jain et al.,
Prevalence of vancomycin resistant E. faecium (50.05%) 2011), Iran (Talebi et al., 2007) and Turkey (Baldir et al.,
in this study was very high, much higher than that 2013). HLAR in E. faecalis was reported from all
reported in most of the other countries. Some European European counties except Iceland. The majority of
countries (Bulgaria, Cyprus, Estonia, Iceland, Malta, countries reported frequency of resistant isolates
Slovenia and Sweden) reported an absence or very low between 25 and 50%. The highest percentages were
prevalence (Denmark-1.3%, Norvey-1.8%, Netherland-1% detected in Italy (50%), Slovakia (49.5%), Hungary
and France-1.4%) of vancomycin resistance (European (48.6%) and Poland (48.4%). (European Centre for
Centre for Disease Prevention and Control, 2012). Disease Prevention and Control, 2012).
Similar results were reported from India (Sreeja et al., Combinations of aminoglycosides with beta-lactam anti-
2012) and Turkey (Shah et al., 2012). Among European biotics or glycopeptides are the treatment of choice for
countries, the highest rates of VRE were obtained from serious enterococcal infections, such as endocarditis,
Ireland (34.9%), Greece (23.1%) and Portugal (20.2%). due to their synergistic activity. Occurrence of resistance
In other parts of the world the highest frequency of to these antibiotics and loss of their synergistic
vancomycin resistant E. faecium was found in US (60% bactericidal activity significantly limited therapeutic
by Bearman et al (2005), 67% by Forrest (2008), 80% by options.
Arias et al. (2010). Newer antibiotics, such as linezolid, tygecyclin,
Resistance to vancomycin is still very rare in E. faecalis daptomycin and quinopristin/dalfopristin have been
isolates. In this study all E. faecalis were susceptible to suggested as an alternative option for treating infections
vancomycin. Bose et al. (2012), Sunilkumar and Karthika caused by multidrug resistant enterococci (Aksoy and
(2012) and Bearman and Wenzel (2005) also reported Unal, 2008; Yemisen et al., 2009, Arias et al., 2010; Tsai
low prevalence of resistant isolates (0, 1 and 2%, et al., 2012). The results obtained in this study confirmed
respectively). All E. faecium in this study had VanA good activity of linezolid and tygecyclin against both
phenotype of resistance. This type is widely distributed enterococcal species tested and quinopristin/dalfopristin
and predominant type of resistance in Iran (Talebi et al., against E. faecium only. Unfortunately, their clinical use
Mira et al. 823
may be limited by emergence of resistance that is a new type of acquired glycopeptides resistance in Enterococcus
faecalis. BM4405. Antimicrob. Agents Chemother. 42(9):2161-2164.
reported in several studies (Werner et al., 2008; Berdal Fisher K, Phillips C (2009). The ecology, epidemiology and virulence of
and Eskesen, 2008; Bonora et al., 2006; Kainer et al., Enterococcus. Microbiology 155(6):1749-1757.
2007). Forrest (2008). Enterococcal Bacteremia. Antimicrob. Agents.
In conclusion, this study shows a very high prevalence Chemother. 52(10):3558-2563.
of multi drug resistant enterococci isolated from blood Goossens H (1998). Spread of vancomycin-resistant enterococci:
Differences between the United States and Europe. Infect. Control.
samples. These results suggest that regular susceptibility Hosp. Epidemiol. 19(8):546-551.
test and species level identification of enterococcal Heath CH, Blackmore TK, Gordon DL (1996). Emerging resistance in
isolates are important in order to treat enterococcal Enterococcus spp. Med. J. Aust. 164(2):116-120.
Hidron AL, Edwards JR, Patel J, Horan TC, Sievert DM, Pollock DA,
infections effectively and implement appropriate infection
Fridkin SK (2008). NHSN annual update: antimicrobial-resistant
control measures to limit the spread in nosocomial pathogens associated with healthcare-associated infections: annual
settings. summary of data reported to the National Healthcare Safety Network
at the Centre for Disease Control and Prevention, 2006-2007. Infect.
Control Hosp. Epidemiol. 20(11):996-1011.
REFERENCES Jain S, Kumar A, Kashyap B, Kaur JR (2011). Clinico-epidemiological
profile and high-level aminoglycoside resistance in enterococcal
Ajay KO, Rajeshwari H, Nagaveni S, Kelmani CR (2012). Antimicrobial septicemia fro tertiary care hospital in Delhi. Int. J. App. Basic. Med.
susceptibility pattern of Enterococcus species isolated from clinical Res.1:80-83.
samples in South India. JRAAS. 27:5-10. Kainer MA, Devasia RA, Jones TF, Simmons BP, Melton K, Chow S,
Aksoy DY, Unal S (2008). New antimicrobial agents for the treatment of Broyler J, Moore KL, Craig AS, Schaffners W (2007). Response to
Gram-positive bacterial infections. Clin. Microbial. Infect. 14:411-420. emerging infection leading to outbreak of linezolid-resistant
Arias CA, Conreras GA, Murray BE (2010). Management of multidrug- enterococci. Emerg. Infect. Dis. J. 13(7):1024-1030.
resistant enterococcal infections. Clin. Microbiol. Infect. 16(6):555- Kolar M, Pantucek R, Vagnerova I, Sauer P, Kesselova M, Cekanova L,
562. Koukalova D, Doskar J, Ruzickova V (2006). Prevalence of
Arthur M, Courvalin P (1993). Genetics and mechanisms of vancomycin-resistant enterococci in hospitalized patients and those
glycopeptides resistance in enteroocci. Antimicrob. Agents living in the community in the Czeech Republic, New Microbiologica
Chemother. 37:1563-1571. 29:121-125.
Bager F, Madsen M, Christensen J, Aarestrup FM (1997). Avoparcin Lebreton F, Depardieu F, Bourdon N, Fines-Guyon M, Berger P,
used as a growth promoter is associated with the occurrence of Camiade S (2011). VanN-type transferable vancomycin resistance in
vancomycin-resistant Enterococcus faecium in Danish poultry and pig Enterococcus faecium. Antimicrob. Agents Chemother. 55:4606-
farms. Prev. Vet. Med. 31:95-112. 4612.
Baldir G, Engin DO, Kucukercan M, Inan A, Akcay S, Ozyuker S, Leclercq R (1997). Enterococci acquire new kinds of resistance. Clin.
Asaray S (2013). High-level resistance to aminoglycoside, Infect. Dis. 24(1):s80-84.
vancomycin and linezolid in enterococci strains. J. Microbiol. Infect. Low DE, Keller N, Barth A, Jones RN (2001). Clinical prevalence,
Dis. 3(3):100-103. antimicrobial susceptibility,and geographic resistance patterns of
Bates J (1997). Epidemiology of vancomycin-resistant enteroccoci in enterococci: Results from the SENTRY Antimicrobial Surveillence
the community and the relevance of farm animals to human jnfection. program, 1997-1999. Clin. Infect. Dis. 32:S133-145.
J. Hosp. Infect. 37:89-101. McDonald LC, Kuehnert MJ, Tenover FC, Jarvis WR (1977).
Bearman GML, Wenzel RP (2005). Bacteriemias: a leading cause of Vancomycin- resistant enteroccoci outside the health-care
death. Arch. Med. Res. 36(6):646-659. setting:prevalence,source and public health
Berdal JE, Eskesen A (2008). Short-term success, but long-term implications.Emerg.Infect.Dis.3:311-317.
treatment failure with linezolid for enterococcal endocarditis. Scand. Mihajlovic-Ukropina M, Medic D, Jelesic Z, Gusman V, Milosavljevic B
J. Infect. Dis. 40:765-766. (2011). Frequency of vancomycin-resistant enterococci isolated from
Bereket W, Hemalatha K, Getener B, Wondwossen T, Solomon A, blood cultures from 2008 to 2010, Med. Preg. 64(9-10):481-485,
Zeynudin A, Kannan S (2012). Update on bacterial nosocomial Moellering RC Jr. (1992). Emergence of Enterococcus as a significant
infections. Eur. Rev. Med. Pharmacol. Sci. 16(8):1039-1044. pathogen. Clin. Infect. Dis. 14(6):1173-1176.
Bonora MG, Solbiati M, Stepan E, Zorzi A, Luzzani A, Catania MR, Murray BE (1990). The life and times of enterococcus. Clin. Microbiol.
Fontana R (2006). Emergence of linezolid resistance in the Rev. 3:45-65.
vancomycin-resistant Enterococcus faecium multilocus sequence Murray BE (2000). Vancomycin-resistant enterococcal infections. N.
typing C1 epidemic lineage. J. Clin. Microbiol. 44(3):1153-1155. Engl. J. Med. 10:710-721.
Bose S, Ghosh AK, Barapatre R (2012). Prevalence of drug resistance Perichon B, Reynolds P, Courvalin (1997). VanD-type glycopeptides
among Enterococcus spp from a tertiary care hospital. Int. J. Med. resistant Enterococcus faecium BM4339. Antimicrob. Agents
Health. Sci. 1(3):38-44. Chemother 41(9):2016-2018.
Brown DFJ, Hope R, Livermore DM, Brick G, Broughton K, George RC, Sadowy E, Sienko A, Gawryszewska J, Bojarska A, Malinowska K,
Reynolds R (2008). Non-susceptibility trends among enterococcci Hryniewicz W (2013). High abundance and diversity of antimicrobial
and non-pneumococcal streptococci from bacteraemias in UK and resistance determinants among early vancomycin-resistant
Ireland, 2001-06. J. Antimicrob. Chemother. 62(2):ii75-ii85. Enterococcus faecalis in Poland.Eur.J. Clin. Microbiol. Infect. Dis.
Chou Y, Lin T, Lin J, Wang N, Peng M, Chang F (2008). Vancomycin- 32(9):1193-1203.
resistant enterococcal bacteremia: comparison of clinical features Schaberg DR, Culver DH, Gaynes RP (1991). Major trends in the
and outcome between Enterococcus faecium and Enterococcus microbial etiology of nosocomial infection. Am. J. Med. 91(3B):72S-
faecalis. J. Immunol. Infect. 41(2):124-129. 75S.
Edmond MB, Wallace SE, McClish DK, Pfaller MA, Jones RN, Wenzel Shah L, Mulla S, Patel KG, Rewadiwala S (2012). Prevalence of
RP (1999). Nosocomial bloodstream infections in United States enterococci with higher resistance level in a tertiary care hospital: a
hospitals: A three-year analysis. Clin. Infect. Dis. 29(2):239-244. matter of concern. Natl. J. Med. Res. 291:25-27.
European Centre for Disease Prevention and Control (2012). Sievert DM, Ricks P, Edwards JR, Schneider A, Patel J, Srinivasen A,
Antimicrobial resistance surveillance in Europe 2011. Annual Report Kallen A, Limbago B, Fridkun S (2013). Antimicrobial-resistant
of the European Antimicrobial Resistance Network (EARS-Net). pathogens associated with healthcare-associated infections:
Stockholm; ECDC:59-63. Summary of data reported to the National Healthcare Safety Network
Fines M, Perichon B, Reynolds P, Sahm DF, Courvalin P (1999). Van E, at the Centres for Disease Control and Prevention, 2009-2010, Infect.
Control Hosp. Epidemiol. 34(1):1-14. Uttley AH, Collins CH, Naidoo J, George R (1988). Vancomycin
Sood S, Malhotra M, Das BK, Kapil A (2008). Enterococcal infection resistant enteroccoci. Lancet.1:57-58.
and antimicrobial resistance. Indian J. Med. Res.128:111-121. Werner G, Coque TM, Hammerum AM, Hope R, Hryniewicz W,
Sreeja S, Babu PRS, Prathab AG (2012). The prevalence and the Johnson A, Klare I, Kristinsson KG (2008). Emergence and spread of
characterization of the enterococcus species from various clinical vancomycin resistance among enterococci in Europe.
samples in the tertiary care hospital. J. Clin. Diagn. Res. 6(9):1486- Eurosurvailance,13:8-18.
1488. Werner G, Gfrorer S, Fleige C, Witte W, Klare I (2008). Tigecyclin-
Sunilkumar J, Karthika J (2012). Prevalence of Enteroccocus species resistant Enreococcus faecium strain isolated from a German
from various clinical specimens in Shri Sathya Sai Medical College intensive care unit patient. J. Antimicrob. Chemother. 61(5):1182-
and Research Institute with special reference to speciation and their 1183.
resistance to vancomycin.Int. J. Med. Clin. Res. 3:154-160. Xu X, Lin D, Yan G, Ye X, Wu S, Guo Y, Zhu D, Hu F Zhang Y, Wang M
Talebi M, Eshraghi SS, Pourshafle MR, Pourmand MR, Eshraghian MR (2010). VanM, a new glyopeptide resistance gene cluster found in
(2007). Characterization of vancomycin resistant Enterococcus Enterococcus faecium. Antimicrob. Agents Chemother. 54:4643-
faecium. Iranian. J. Publ. Health 36(4):20-25. 4647.
Teixeira LM, Facklan RR (2003). Enterococcus In: Murray PR, Baron Yemisen M, Demirel A, Mete B, Kaygusuz A, Mert A, Tabak F, Ozturk R
EJ, Jorgensen JH,Pealler MA, Yolken RH (2003). Mannual of clinical (2009). Comparative in vitro antimicrobial activity of tigecyclin against
th
microbiology.8 ed. Washington. AMS Press č423-433. clinical isolates of vancomycin-resistant enterooccus. Indian. J. Med.
Treitman AN, Yarnold PR, Warren J, Noskin G (2005). Emerging Microbiol. 27:373-374.
incidence of Enterococcus faecium among hospital isolates 1993-
2002. J. Clin. Microbiol. 43:462-463.
Tsai HY, Liao CH, Chen YH, Lu PL, Huang CH, Lu CT, Chuang YC,
Tsao SM, Chen YS, Lui YC, Chen WY, Jang TN, Lin HC, Chen CM,
Shi ZY, Pan SC, Yang JL, Kung CE, Liu CE, Cheng YJ, Liu JW, Sun
W, Wang LS, Ko WC, Yu KW, Chiang PC, Lee MH, Lee CM, Hsu GJ,
Hsueh PR (2012). Trends in susceptibility of vancomycin-resistant
Enterococcus faecium to tigecyclin, daptomycin and linezolid and
molecular epidemiology of the isolates: results from the tigecyclin in
vitro surveillance in Taiwan study, 2006 to 2010. Antimicrob. Agents
Chemother. 56(6):3402-3405.
Vol. 8(8), pp. 825-829, 19 February, 2014
DOI: 10.5897/AJMR2013.6128
Prevalence of anti-Anaplasma phagocytophilum

antibodies among dogs from Monterrey, Mexico
J. A. Salinas-Meléndez, R. Villavicencio-Pedraza, B. V. Tamez-Hernández, J. J. Hernández-
Escareño, R. Avalos-Ramírez, J. J. Zarate-Ramos, F. J. Picón-Rubio and V. M. Riojas-Valdés*
Universidad Autónoma de Nuevo León, UANL. Facultad de Medicina Veterinaria y Zootecnia. Av. Universidad S/N,
Ciudad Universitaria, San Nicolás de los Garza, Nuevo León, CP 66451, México.
Infection with Anaplasma phagocytophilum is of importance in dogs. It is called canine

anaplasmosmosis and causes persistent clinical signs for long periods of time. Its main vector is a tick
of the genus Ixodes. Diagnosis of anaplasmosis can be achieved either by serological or molecular
methods. Presence of the disease has been reported in the U.S.A., Europe and Asia, but little is known
about its prevalence in Mexico. In the present study, the enzyme-linked immunosorbent assay (ELISA)
diagnostic method was used to determine the prevalence of antibodies against A. phagocytophilum at
the city of Monterrey, Mexico. A total of 391 dogs were tested using a commercial kit. A 3% prevalence
was found that included dogs of the breeds Doberman, French Puddle and Maltese, as well as mixed
breed.
Key words: Anaplasma phagocytophilum, dogs, Mexico.
INTRODUCTION
Anaplasma phagocytophilum produces infection in some as in Europe (Petrovec et al., 1997; Arnež et al., 2001;
animal species including man. It has been informed that Walder et al., 2003).
this disease can cause fever, anorexia, pain, neutropenia, Studies in dogs have shown seroprevalence ranging from
thrombocytopenia, as well as the formation of cytoplasmatic 17 to 50% at European countries (Barutzki et al., 2006;
inclusion bodies in granulocytic neutrophiles (Rikihisa, Liebisch et al., 2006; Jensen et al., 2007; Krupka et al.,
1991; Greig et al., 1996; Engvall et al., 1997; Engvall and 2007; Schaarschmidt-Kiener and Miller, 2007). The clinical
Engvall, 2002). The genus Anaplasma was previously disease in dogs is often associated to the acute infection.
known as the Ehrlichia phagocytophila group (Dumler et Development of clinical signs during the acute phase can
al., 2001). vary, lasting from one to several days (Engvall et al.
Infection with A. phagocytophilum was first reported in 1998). Persistent infection, either clinical or subclinical, in
canines at Minnesota and Wisconsin states in 1996 (Greig dogs experimentally inoculated with A. phagocytophilum
et al., 1996). It is a zoonotic disease transmitted by vectors has been documented for time lapses of more than six
and apparently its presence in dogs is related to its presence months (Engvall et al., 2000; Alleman et al., 2006).
in humans (Bakken et al., 1994). Confirmed clinical cases This pathogen has been reported in 8 years old dogs or
by A. phagocytophilum in humans have been informed in older, and is more common in certain breeds (Greig et
the U.S.A. (Chen et al., 1994; Demma et al., 2005), as well al,. 1996; Engvall et al., 1997; Beall et al., 2008).
*Corresponding author. E-mail: [email protected]. Tel.: 83294000, Ext. 3610.

Clinical signs more often found in dogs infected with A. for A. phagocytophilum detection and identification from
phagocytophilum are articular pain and lameness blood and skin samples, as well as from ticks. 16 SrRNA
resulting from poli-artritis; other less often observed signs gen has been used as reference for studies on the
can be gastrointestinal such as vomit and diarrhea, and phylogenetic classification of the bacteria (Blanco and
some respiratory clinical signs like coughing and disnea. Oteo, 2002).
In some cases the central nervous system can be
affected causing meningitis, leading to neurologic mani-
festations like ataxia and convulsions. Infection with A. MATERIALS AND METHODS
phagocytophilum is often unapparent, but after eight to
Blood samples were obtained from 391 dogs of different breeds in
15 days incubation period it can cause fever, generalized the city of Monterrey, using as inclusion factor only dogs with fixed
adenopathy, leucopenia, moderate anemia, moderate address, age over 6 months. It was decided to sample only one dog
hypogammaglobulinemia, hypoalbuminemia, per house in case of having more than one dog. The examination of
hypocalcaemia and specially thrombocytopenia (Engvall the dogs started with physical evaluation followed by blood
et al. 1998; Engvall et al., 2000; Alleman et al., 2006). sampling. All dogs showed no clinical signs of any disease.
The main vector for A. phagocytophilum in Europe is This study was carried out in the city of Monterrey, Nuevo Leon,
located in the northeast of Mexico, with a territorial extension of
Ixodes ricinus (Parola and Raoult, 2001, Strle, 2004). In 451.30 km2. Location coordinates are 25°40´17´´ N, 100° 18´31´´
the U.S.A. it is associated to Ixodes scapularis and W. Altitude is 530 m above sea level. The climate of the region has
Ixodes pacificus (Barlough et al., 1997a; Chang et al., an average of 21°C, but because of annual thermal oscillation of
1998). Other authors indicate that the main vector is I. 18°C, with important contrast among seasons. In summertime
scapularis in the east coast and I. pacificus in the west temperatures above 30°C are common with an average in July and
august of 34°C. In winter, cold air arrive constantly to the region,
coast (Parola et al., 2005). There are also reports about
often accompanied of humidity from the coast, making the
its detection in Ixodes spinipalis and Ixodes dentatus in temperature descend drastically, and every year at least 2 to 3 days
the U.S.A. (Zeidner et al., 2000; Goethert and Telfort, are recorded with 0°C or less. The average annual precipitation is
2003). of 600 m spread mainly in summer, with September as the rainiest
Studies in the Asian countries mention the presence of month. The city was divided in quadrants in accordance with its
A. phagocytophilum in Ixodes perseculatus and Ixodes cartographic plan.
From this map, the 15 most urbanized quadrants were chosen,
ovatus (Cao et al., 2000; Ohashi et al., 2005). In North-
since the others belonged to not well developed neighborhoods and
America it has been observed that certain rodents in little human population. Sampling was performed according the dog
particular and White-tail deer can act as natural hosts of population density and owner cooperation, sampling only one dog
A. phagocytophilum (Bunnell et al., 1998; Belongia et al., per city block and only one dog in each house. To determine the
1997). Other wild animals detected as positive for the sample size, calculations were made in basis of the population’s
disease include foxes, wild hogs (Petrovec et al., 2003), representative sample (infinite), with precision level of 5%, con-
fidence level of 95% and a power of statistical test of 80% in order
bison, donkey, moose, hare and lynx (Grzeszczuk et al., to ensure reliability of the results and that they could be translated
2004, de la Fuente et al., 2005, Jenkins et al., 2001). to the population under study using a 16% prevalence, according to
Canine anaplasmosis is often diagnosed directly by previous studies in the country. Sample size was determined using
microscopic identification of A. phagocytophilum morulae Epidat 3.1. Blood was extracted from the jugular vein with
in circulating neutrophyles an in some cases in synovial Vacutainer vacuum tubes and sterile needles, drawing close to 5 m
from each animal. No anesthetic or tranquilizer was used. The
fluid. These findings can be seen at the acute phase of
samples were carried in a container with refrigerant material to the
the disease. laboratory and kept al 4o C until they were centrifugated at 3000
Using serological tests as a diagnostic tool, the early rpm for 5 min to separate the serum, after which were processed to
phases of the disease and the dogs at terminal phase determine the presence of antibodies against Anaplasma
can show negative results; in the former because there phagocytophilum. For the in vitro detection of the mentioned
has not been enough time for the immune response and antibodies in the samples, the commercial kit “canine SNAP*4Dx”
(IDEXX labs, Inc. USA) was used, according to the manufacture’s
in the latter because it is exhausted (Weisiger et al., instructions. Before starting the procedure samples must be at room
1975; Waner et al., 2001; Cohn, 2003). In the blood temperature. The sera, either fresh or refrigerated, were utilized
serum antibodies can be detected around 7-28 days after after no more than a week from the sampling. Sensibility and
infection (Ristic et al., 1972; Buhles et al., 1974); at 20 specificity of the kit for the disease are reported with a minimum of
days almost all dogs are seropositive, reaching maximum 98.8 and 100%, respectively.
values of antibodies titers at 80 days (Buhles et al., 1974;
Maeda et al., 1987). Antibody detection is the most RESULTS
utilized way to identify the disease, including immuno-
fluoresence and ELISA techniques. However, some For the present work, 391 blood samples were taken
reports exist about false-positive results due to cross- from dogs located in the city of Monterrey, Mexico;
reactions with Ricketsias such as Ehrlichia chafensis antibodies against Anaplasma phagocytophilum were
(Blanco and Oteo, 2002). found in 12 samples, resulting in 3% prevalence.
Polymerase chain reaction is a fast and sensitive tool Regarding to sex, dogs’ samples comprised 173 males
Salinas-Meléndez et al. 827
Table 1. Seropositive dogs to Anaplasma phagocytophilum.
Breed Sex Place of stay Kind of floor Parasite treatment Vaccination Presence of ticks
2 grass
Doberman 3 Females Outside Yes Yes No
1 soil
French Poodle 2 Males Both Cement No Yes No
Maltese 2 Females Outside Cement Yes Yes No
3 Males 5 outside 4 cement 5 Yes 5 Yes 3 Yes

Mixed-breed
2 Females 1 inside 1 mixed* 1 No 1 No 3 No
*Mixed: cement and soil.
and 218 females of which five males and seven females 2007; Schaarschmidt-Kiener and Miller, 2007), which
were positive, giving a prevalence of 3.4% and 3.2% represents a higher value than the one informed in the
respectively (Table 1). present work.
Positive dogs varied in age from 21 to 132 months old. The clinical disease has often been reported in 8 year
Only 3 positive dogs presented ticks (2 females and 1 old and older dogs and with some breeds such as
male); however, the questionnaire applied to the dog’s Labrador and Golden Retriever among the most affected;
owners revealed that 11 dogs of the 13 that resulted these findings are in agreement with the results pre-
positive had ticks within a period of two months before sented in this study, since positive dogs having 11 years
the sampling. Additionally, only three owners mentioned of age were found (Greig et al., 1996; Engvall et al.,
the use of anti-tick baths and treatment against internal 1997; Beall et al., 2008).
parasites in a constant way every 3 months. Only one Recent studies report higher frequencies of A.
among the 13 positive dogs had record of anti-rabies phagocytophilum in dogs, from 14% in Poland
vaccination (Table 1). (Ryamasewka et al., 2011) to 46.9% in Germany (Kohn
Regarding the place of stay, 12 of the positive dogs et al., 2010). However, in other countries the results are
were kept outside of the owner home and only one lived closer that the ones reported in the present work, since
in the house all the time. Among the positive dogs, 8 lived absence of the bacteria was informed at Canada (Bryan
on cement floor, 2 on grass, 2 in both and one on soil. et al., 2011) and Korea (Lim et al., 2010).
With regard to breed, 6 were mixed-breed, 3 dogs were Little work on this disease has been realized in Mexico
Doberman, 2 French Poodle and 2 Maltese (Table 1). because of its relatively new presence; therefore, informa-
tion in our geographical area is scarce. This is not the
case of European countries, where many cases have been
DISCUSION documented and much more knowledge exists about this
disease of dogs.
Anaplasmosis is a disease that must be considered for On the other hand, other members of the same Rickettsia
differential diagnosis in dogs because due to its diverse family such as Ehrlichia canis, which causes monocytic
clinical manifestations, it can be confused with other canine ehrlichiosis, have been documented in the
common diseases of dogs. Currently there are not data on metropolitan area of Monterrey by serological methods
the prevalence of this disease in the area studied, as well like ELISA; this study reported a general seropositivity of
as in many states of the country. In the present study, a 44%, which is much higher than the one informed here
prevalence of 3% was found, whereas a work done at for A. phagocytophilum. The results were also in
Switzerland reported 7.5% prevalence (Pusterla et al., disagreement according to age, since E. canis was found
1998). more often in four year old dogs, whereas for A.
The disease has been reported in the following domesti- phagocytophilum was e years old. One possible reason
cated species: horse (Bjöersdorff et al., 2002; Engvall et for these discordances could be that in the present work
al., 1996, Engvall and Engvall, 2002), dog (Engvall et al., only dogs living in the urban area were sampled, whereas
1996; Engvall and Engvall, 2002; Skotarczak, 2003; it can be assume that a bigger number of ticks will be
Lester et al., 2005, Poitout et al., 2005), cat (Bjöersdorff present in the country side, outside the city.
et al., 1999), cattle (Engvall et al., 1996), sheep (Steere
et al., 1998) and lama (Barlough et al., 1997b).
At some European countries, prevalence in dogs varying Conclusion
from 17 to 50% have been found (Barutzki et al., 2006;
Liebisch et al., 2006; Jensen et al., 2007; Krupka et al., The results observed in the present study allows the
conclusion that A. phagocytophilum is being transmitted (2000). Granulocytic Ehrlichiae in Ixodes persulcatus Ticks from an
amongst the canine population at Monterrey county Area in China Where Lyme Disease is Endemic. J. Clin. Microbiol.
38:4208-4210.
through ticks, although at a frequency lower than the one Chang YF, Novosel V, Chang CF, Kim JB (1998). Detection of human
informed for other countries or other infectious agents of granulocytic ehrlichiosis agent and Borrelia burgdorferi in ticks by
the same family. New studies will be necessary to polymerase chain reaction. J. Vet. Diagn. Invest. 10:56-59.
confirm the presence of the bacteria in the ticks, as well Chen SM, Dumler JS, Bakken JS, Walker DH (1994). Identification of a
granulocytotropic Ehrlichia species as the etiologic agent of humen
as to determine its presence in humans. disease. J. Clin. Microbiol. 33:589-595.
Cohn LA (2003). Ehrlichiosis and related infections. Vet. Clin. North.
Am. Small Anim. Pract. 33:863-884
ACKNOWLEDGEMENT De La Fuente J, Torina A, Caracappa S, Tumino G (2005). Serologic
and molecular characterization of Anaplasma species infection in
farm animals and ticks from Sicily. Vet. Parasitol. 5:357-362.
We will like to thank MHICO de Mexico, S.A. de C.V., Demma L J, Holman R C, McQuiston J H, Krebs J W, Swerdlow D L
Monterrey, Nuevo Leon, for support with laboratory (2005). Epidemiology of human Ehrlichiosis and anaplasmosis in the
supplies United States, 2001- 2002. Am. J. Trop. Med. Hyg. 73:400-409.
Dumler J S, Barbet AF, Bekker CPJ, Dasch GA, Palmer GH, Ray SC,
Rikihisa Y, Rurangirwa FR (2001). Reorganization of genera in the
families Rickettsiaceae and Anaplasmataceae in the order
REFERENCES Rickettsiales: unification of some species of Ehrlichia with
Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia,
Alleman AR, Chandrashekar R, Beall M (2006). Experimental descriptions of six new species combinations and designation of
inoculation of dogs with a human isolate (Ny18) of Anaplasma Ehrlichia equi and 'HGE agent' as subjective synonyms of Ehrlichia
phagocytophilum and demonstration of persistent infection following phagocytophila. Int. J. Syst. Evol. Microbiol. 51:2145-2165.
doxycycline therapy. J. Vet. Int. Med. 20:763. Engvall A, Bjöersdorff A, Lilliehöök I (1998). Early manifestations of
Arnež M, Petrovec M, Lotric-Furlan S, Avsic Zupanc T, Strle F (2001). granulocytic ehrlichiosis in dogs inoculated experimentally with a
First European Pediatric Case of Human Granulocytic Ehrlichiosis. J. Swedish Ehrlichia species isolate. Vet. Rec. 143:412-417.
Clin. Microbiol. 39:4591-4592. Engvall A, Lilliehöök I, Bjöersdorff A (2000). Detection of granulocytic
Bakken JS, Dumler JS, Chen SM (1994). Human granulocytic Ehrlichia species DNA by PCR in persistently infected dogs. Vet.
ehrlichiosis in the upper Midwest United States. A new species Rec. 146:186-190.
emerging? J.A.M.A. 272:212-218. Engvall AE, Hedhammar AA, Bjöersdorff AI (1997). Clinical features
Barlough JE, Madigan JE, Kramer VL, Clover JR (1997a). Ehrlichia and serology of 14 dogs affected by granulocytic ehrlichiosis in
phagocytophila genogroup rickettsiae in Ixodid ticks from California Sweden. Vet. Rec. 140:222-226.
collected in 1995 and 1996. J. Clin. Microbiol. 35:2018-2021. Engvall EO, Engvall A (2002). Granulocytic ehrlichiosis in Swedish dogs
Barlough JE, Madigan JE, Turoff DR, Clover JR (1997b). An Ehrlichia and horses. Int. J. Med. Microbiol. 291:100-103.
strain from a llama (Lama glama) and Llama-associated ticks (Ixodes Engvall EO, Pettersson B, Persson M, Artursson K, Johansson KE
pacificus). J. Clin. Microbiol. 35:1005-1007. (1996). A 16S rRNA-based PCR assay for detection and identification
Barutzki D, De Nicola A, Zeziola M, Reule M (2006). Seroprävalenz der of granulocytic Ehrlichia species in dogs, horses, and cattle. J. Clin.
Anaplasma phagocytophilum-Infektion bei Hunden in Deutschland. Microbiol. 34(9):2170-2174.
Berl. Münch. Tierärztl. Wochenschr. 119:342-347. Goethert HK and Telford SR (2003). Enzootic transmission of the agent
Beall MJ, Chandrashekar R, Eberts MD, Cyr KE, Diniz PP, Mainville C, of human granulocytic ehrlichiosis among cottontail rabbits. Am. J.
Hegarty BC, Crawford JM, Breitschwerdt EB (2008). Serological and Trop. Med. Hyg. 68:633-637.
molecular prevalence of Borrelia burgdorferi, Anaplasma Greig B, Asanovich KM, Armstrong PJ, Dumler JS (1996). Geographic,
phagocytophilum, and Ehrlichia species in dogs from Minnesota. clinical, serologic, and molecular evidence of granulocytic
Vector Borne Zoonotic. Dis. 8(4):455-464. ehrlichiosis, a likely zoonotic disease, in Minnesota and Wisconsin
Belongia EA, Reed KD, Mitchell PD, Kolbert CP (1997). Prevalence of dogs. J. Clin. Microbiol. 34:44-48.
granulocytic Ehrlichia infection among white-tailed deer in Wisconsin. Grzeszczuk A, Ziarko S, Prokopowicz D, Radziwon PM (2004).
J Clin Microbiol. 35:1465-1468. Evidence of Anaplasma phagocytophilum infection in European
Bjöersdorff A, Bagert B, Massung RF (2002). Isolation and Bisons in the Bialowieza Primeral Forest, Poland. Med. Weter
characterization of two European strains of Ehrlichia phagocytophila 60:600-601.
of equine origin. Clin. Diagn. Lab. Immunol. 9:341-343. Jenkins A, Handeland K, Stuen S, Schouls L (2001). Ehrlichiosis in a
Bjöersdorff A, Svendenius L, Owens JH, Massung RF (1999). Feline moose calf in Norway. J. Wildl. Dis. 37:201-203.
granulocytic ehrlichiosis- a report of a new clinical entity and Jensen J, Simon D, Escobar H, Soller J T, Bullerdieck J, Beelitz P,
characterization of the infectious agent. J. Small. Anim. Pract. 40:20- Pfister K, Nolte I (2007). Anaplasma phagocytophilum in dogs in
24. Germany. Zoonoses Public Health 54:94-101.
Blanco JR, Oteo JA (2002). Human granulocytic ehrlichiosis in Europe. Kohn B, Silaghi C, Galke D, Arndt G, Pfister I (2010). Infection with A.
Clin. Microbiol. Infect. 8:763-772. phagocytophilum in dogs in Germany. Res. Vet. Sci. 91:71-76.
Bryan HM, Darimont CT, Paquet PC, Ellis JA, Goji N, Gouix M, Smiths Krupka I, Pantchev N, Lorentzen L, Weise M, Straubinger RK (2007).
JC (2011). Exposure to infectious agents in dogs in remote coastal Durch Zecken übertragene bakterielle Infektionen bei Hunden:
British Columbia: Possible sentinels of disease in wildlife and Seroprävalenzen von Anaplasma phagocytophilum, Borrelia
humans. Can. J. Vet. Res. 75:11-17. burgdorferi sensu lato und Ehrlichia canis in Deutschland. Der
Buhles WC Jr., Huxsoll DL, Ristic M (1974). Tropical canine praktische Tierarzt. 88:776-788.
pancytopenia: clinical, hematologic, and serologic responses of dogs Lester SJ, Breitschwerdt EB, Collis CD, Hegarty BC (2005). Anaplasma
to Ehrlichia canis infection, tetracycline therapy, and challenge phagocytophilum infection (granulocytic anaplasmosis) in a dog from
inoculation. J. Infect. Dis. 130:357-367. Vancouver Island. Can. Vet. J. 46:825-827.
Bunnell JE, Dumler JS, Childs JE, Glass GE (1998). Retrospective Liebisch G, Thiet W, Liebisch A (2006). Die canine monocytäre (CME)
serosurvey for human granulocytic ehrlichiosis agent in urban white- und die canine granulocytäre Ehrlichiose (CGE), zwei durch Zecken
footed mice from Maryland. J. Wildl. Dis. 34:179-181. übertragene Infektionskrankheiten bei Hunden in Deutschland. Der
Cao WC, Zhoa QM, Zhang PH, Dumler JS, Zhang XT, Fang L, Yang H praktische Tierarzt. 87:342-353.
Salinas-Meléndez et al. 829
Lim S, Irwin PJ, Lee S, Oh M, Ahn K, Myung B, Shin S (2010). Steere AC, Sikand VK, Meurice F, Parenti DL, Fikrig E, Schoen RT,
Comparison of selected canine vector-borne disease between urban Nowakowski J, Schmid CH, Laukamp S, Buscarino C, Krause DS
animal shelter and rural hunting dogs in Korea. Parasit. Vectors 3:32. (1998). Vaccination against Lyme disease with recombinant Borrelia
Maeda K, Markowitz N, Hawley RC, Ristic M, Cox D, McDade JE burgdorferi outer-surface lipoprotein A with adjuvant. New Engl. J.
(1987). Human infection with Ehrlichia canis a leukocytic rickettsia. N. Med. 339: 209-215
Engl. J. Med. 316:853-856. Strle F (2004). Human granulocytic ehrlichiosis in Europe. Int. J. Med.
Ohashi N, Inayoshi M, Kitamura K, Kawamori F, Kawaguchi D, Microbiol. 293 (Suppl. 37):27-35.
Nishimura Y, Naitou H, Hiroi M, Masuzawa T (2005). Anaplasma Walder G, Tiwald G, Dierich M P, Würzner R (2003). Serological
phagocytophilum-infected ticks, Japan. Emerg. Inf. Dis. 11:1780-1783. Evidence for Human Granulocytic Ehrlichiosis in Western Austria.
Parola P, Davoust B, Raoult D (2005). Tick- and flea-borne rickettsial Eur. J. Clin. Microbiol. Infect. Dis. 22:543-547.
emerging zoonoses. Vet. Res. 36:469-492. Waner T, Harrus S, Jongejan F, Bark H, Keysary A, Cornelissen AW
Parola P, Raoult D (2001). Tick-borne bacterial diseases emerging in (2001). Significance of serological testing for ehrlichial diseases in
Europe. Clin. Microbiol. Infect. 7: 80-83. dogs with special emphasis on the diagnosis of canine monocytic
Petrovec M, Lotric-Furlan S, Avsic-Zupank T, Strle F, Brouqui P, Roux ehrlichiosis caused by Ehrlichia canis. Vet. Parasitol. 95:1-15.
V, Dumler S (1997). Human Disease in Europe caused by a Weisiger RM, Ristic M, Huxsoll DL (1975). Kinetics of antibody
Granulocytic Ehrlichia Species. J. Clin. Microbiol. 35:1556-1559. response to Ehrlichia canis assayed by indirect fluorescent antibody
Petrovec M, Sixl W, Schweiger R, Mikulasek S (2003). Infections of method. Am. J. Vet. Res. 36:689-694.
wild animals with Anaplasma phagocytophila in Austria and the Zeidner NS, Burkot TR, Massung R, Nicholson WL, Dolan MC,
Czech Republic. Ann. N. Y. Acad. Sci. 990:103-106. Rutherford JS, Biggerstaff BJ, Maupin GO (2000). Transmission of
Poitout FM, Shinozaki JK, Stockwell PJ, Holland CJ (2005). Genetic the agent of human granulocytic ehrlichiosis by Ixodes spinipalpis
variants of Anaplasma phagocytophilum infecting dogs in Western ticks: evidence of an enzootic cycle of dual infection with Borrelia
Washington State. J. Clin. Microbiol. 43:796-801. burgdorferi in Northern Colorado. J. Infect. Dis. 182:616-619.
Pusterla N, Berger J, Pusterla, Deplazes P, Wolfensberger C, Müller W,
Hörauf A, Reusch C, and Lutz H (1998). Seroprevalence of Ehrlichia
canis and of canine granulocytic Ehrlichia infection in dogs in
Switzerland. J. Clin. Microbiol. 36:3460 3462.
Rikihisa Y (1991). The tribe Ehrlichieae and ehrlichial diseases. Clin.
Microbiol. Rev. 4:286-308.
Ristic M, Huxsoll DL, Weedier RM, Hildebrandt PK, Nyindo, MB (1972).
Serological diagnosis of tropical canine pancytopenia by indirect
immunofluorescence. Infect. Immun. 6:226-231.
Ryamasewka A, Adamska M (2011). Molecular evidence of vector-
borne pathogens coinfecting dogs from Poland. Acta Vet. Hung. 59:
215-229.
Schaarschmidt-Kiener D, Miller W (2007). Labordiagnostische und
klinische Aspekteder kaninen Anaplasmose. Tierärztl. Prax. 35:129-
136.
Skotarczak B (2003). Canine ehrlichiosis. Ann. Agric. Environ. Med.
100:137-141.
Vol. 8(8), pp. 830-838, 19 February, 2014
DOI: 10.5897/AJMR2013.6537
Novel simple diagnostic methods compared to

advanced ones for the diganosis of Chlamydia
trachomatis, Ureaplasma urealyticum and
Mycoplasmas hominis in patients with complicated
urinary tract infections
Hala Badawi1*, Aisha Abu Aitta1, Maisa Omar1, Ahmed Ismail2, Hanem Mohamed3, Manal El
Said1, Doaa Gamal1, Samah Saad El Dine1 and Mohamed Ali Saber3
1
Microbiology Department, Theodor Bilharz Research Institute, Giza, Egypt.
2
Urosurgery Department, Theodor Bilharz Research Institute, Giza, Egypt.
3
Biochemistry Department, Theodor Bilharz Research Institute, Giza, Egypt.
Chlamydia trachomatis is responsible for the most common sexually transmitted bacterial infection
worldwide. Infections with Ureaplasma urealyticum and genital Mycoplasma hominis have been
recognized for about a decade as common sexually transmitted infections (STIs) in developed
countries. The aim of this study was to assess the diagnostic value of novel simple diagnostic kits used
in the detection of C. trachomatis, U. urealyticum and M. hominis in urine of patients with complicated
urinary tract infections (UTIs) and to compare these simple methods to molecular and cultural ones as
gold standards. This study was conducted on two male patient’s groups; group I: 30 patients with
compilcated UTIs and Group II: 50 patients with non complicated UTIs. Twenty (20) healthy male control
subjects (Group III) were also included. The patients were chosen from those admitted to the urosurgery
department or attending the urosurgery outpatient clinic in Theodor Bilharz Research Institute (TBRI).
First voided urine (FVU) samples and mid-stream urine (MSU) were collected from patients and controls.
FVU samples were investigated for C. trachomatis plasmid DNA using polymerase chain reaction (PCR)
and for C. trachomatis antigen using Chlamyfast OIA test. MSU samples were used for inoculating of
conventional culture media and three culture kits; Mycoplasma DUO, Mycoplasma IST and Mycokit
NUM. Blood samples were investigated for the presence of C. trachomatis IgG antibodies using enzyme-
linked immunosorbent assay (ELISA) and ImmunoComb Chlamydia Kit and for mycoplasmal antibodies
using mycokit sero. C. trachomatis infection was found in 35% (28/80) of patients in both groups, 56.7%
(17/30) was detected in group I and 22% (11/50) in group II compared to none of the controls. C. trachomatis
infection was significantly higher in group I versus group II (P˂0.05). Chlamyfast OIA test was less sensitive
but more specific than serological assays. ImmunoComb assay had a higher sensitivity but lower specificity
than ELISA. A total of 34 cases (42.5%) were positive in a pathogenic level for U. urealyticum and or M.
hominis and 30% were positive for U. urealyticum only, 7.5% were positive for M. hominis only and 5% had
mixed infection with both organisms. Mycoplasmas infection in group I was found to be significantly higher
than in group II (P˂0.05). Mycoplasma IST has the highest sensitivity (100%) andin identification of U.
urealyticum while both mycoplasma ISTand mycoplasma DUO showed the highest sensitivity in identi-
fication of M.hominis. Serological evidence was detected in 16/24 (66.7%), 2/6 (33.3%) and 4/4 (100%) of
U. urealyticum, M. hominis and mixed infections respectively. The serological response to each infection is
significantly higher in group I than in group II (P value ˂0.05). Our study detects a high prevalence rate of C.
trachomatis, M. hominis and U. urealyticum in cases with complicated UTI. Commercially available kits
are simple and sensitive methods to use in laboratories which do not routinely test for these pathogens.
Key words: Chlamydia trachomatis, urinary tract infections (UTIs), non gonorrheal urethritis (NGU).
Badawi et al. 831
INTRODUCTION
Urinary tract infections (UTI) are frequent type of diseases such as urethritis, postpartum endometritis,
infectious pathology treated in primary care clinics. The chorioamnionitis, spontaneous abortion and premature
participation of microorganisms associated with sexually birth, as well as low birth weight, pneumonia, bacteremia,
transmitted infection has been reported recently as meningitis and chronic lung disease in prematurely born
possible cause of UTI (González-Pedraza et al., 2003). infants (Dhawan et al., 2012; Al-Sweih et al., 2012).
According to a World Health Organization (WHO, 2001) Mycoplasma hominis is also associated with bacterial
report, Chlamydia trachomatis is responsible for the most vaginosis, pelvic inflammatory disease, arthritis and even
common sexually transmitted bacterial infection world- neonatal meningitis (Hopfe et al., 2013).
wide, affecting more than 90 million people and has been The aim of this study was to asses diagnostic value of
known to have a significant effect on human reproduction novel simple diagnostic kits used in the detection of C.
(Paavonen and Eggert-Kruse, 1999; Al-Sweih et al., trachomatis, U. urealyticum and M. hominis in urine of
2012). The prevalence of C. trachomatis in woman under patients with complicated urinary tract infections (UTIs)
25 years of age is very high (up to 30%) hence, young and to compare these simple methods to molecular and
sexually active women are the most at risk (Mangin et al., cultural ones as gold standards.
2012). C. trachomatis is one of the causes of acute and
chronic urinary tract infections and acute or silent
salphingitis (Wanic-Kossowska et al., 2001) that if not
treated in an early stage can lead to severe compli- Patients
cations, such as pelvic inflammatory disease (PID),
ectopic pregnancy and tubal infertility (Marrazo and This study was conducted on 80 patients that were divided into two
Stamm, 1998; Gaydos et al., 2004). patient’s groups; group I: 30 male patients with clinically diagnosed
Most C. trachomatis genital tract infections in men and complicated UTIs complained of recurrent UTI that resist treatment
with conventional antibiotics (cystitis, prostatitis, epididymititis,
women are asymptomatic, so the opportunity for cancer bladder, urethral stricture,stone fomation, hydronephrosis
unchecked transmission is high even in countries with and urinary bilharziais), their Group II: 50 male patients with non
advanced public health care systems (Dean et al., 2012; complicated UTIs. Twenty male healthy control subjects (Group III)
Vicetti Miguel et al., 2013). Dysuria and increased were also included. The patients were chosen from those admitted
urinary frequency associated with presumed urinary tract to urosurgery department or attending the urosurgery outpatient
clinic in TBRI. The controls were selected from those admitted,
infection are extremely common reasons for seeking
during the same period, for Surgery Department with normal urine
treatment in primary care. About 10% of women suffer analysis. The patients diagnosis was based on complete history
from symptoms of a urinary tract infection in any year, taking including increased frequency of micturation, dysuria,
and seeking treatment provides a potential opportunity to haematuria, uretheral discharge, antischistosomal treatment,
detect both symptomatic and asymptomatic infection with instrumentation or any previous pelvic troubles. Complete clinical
C. trachomatis (Mangin et al., 2012). assessment, radiological investigation, cystoscopy and histopa-
thological examination, urine analysis and culture were also
C. trachomatis infection is easily treatable with
performed. The patients or controls did not receive antibiotics two
antibiotics, so detection and treatment of infected indivi- weeks before the study.
duals is a key element of Chlamydia control programs
(Gaydos et al., 2004; Van der Helm et al., 2013).
Although there are a variety of methods for testing for C. Sample collection
trachomatis, no single test is ideal (Mangin et al., 2012).
Early morning first voided urine (FVU) samples and mid-stream
Culture, nucleic acid hybridization tests, and nucleic acid urine (MSU) were collected from patients and controls. FVU
amplification tests (NAATs) are available for the detection samples were stored at -70°C untill investigated for C. trachomatis
of C. trachomatis. Culture and hybridization tests require antigen using enzyme immunoassay (EIA) and C. trachomatis
urethral swab specimens, whereas NAATs can be plasmid DNA using PCR. MSU samples were centrifuged and the
performed on urine specimens. The sensitivity and pellets were then used for inoculating of three culture kits;
Mycoplasma DUO, Mycoplasma IST and Mycokit NUM and
specificity of the NAATs are clearly the highest of any of
conventional culture media. Blood samples were collected and sera
the test platforms for the diagnosis of chlamydial were stored at -70°C to be investigated for the presence of C.
infections (Lee and Lee, 2013). trachomatis antibodies and mycoplasmal antibodies using ELISA
Infections with Ureaplasma urealyticum and genital and ImmunoComb Chlamydia Kit and Mycokit Sero respectively.
mycoplasmas (M. hominis and M. genitalium) have been
recognized for about a decade as a common STD in
Detection of Chlamydia trachomatis
developed countries (Yoshida et al., 2002). Genital urea-
plasmas and mycoplasmas are natural inhabitants of the PCR analysis of C. trachomatis plasmid DNA in urine specimens
male urethra, contaminating the semen during ejacu-
lation. However, U. urealyticum, are implicated in invasive Eight (8) ml of FVU samples were mixed thoroughly and centrifuged

at 3000 rpm for 30 min at room temperature. The precipitate was EIA ImmunoComb Chlamydia Kit for semi-quantitative
transferred to 1.5 ml microcentrifuge tube and centrifuged at 14000 determination of Chlamydia IgG in serum
rpm for 30 min. The pellets were stored at -20°C until DNA
extraction. DNA extraction was performed using QIA amp Viral RNA The ImmunoComb Chlamydia Bivalent IgG Kit (ImmunoComb,
Mini kit (Qiagen GmbH, Germany) because the AVL buffer used in PBS, Orgenics, France) is an EIA test intended for the semi-
this kit, inactivates the numerous unidentified PCR inhibitors found quantitative of IgG antibodies to C trachomatis in serum.
in urine. The extraction was done following the QIA amp using spin- ImmunoComb consist of a solid-phase EIA. The solid phase is a
column protocol with slight modification as follows: The urine pelet comb with 12 projections. Each tooth is sensitized at two positions;
was dissolved in 1ml PBS. 250 μl of urine solution were added to upper spot: goat antibodies to human immunoglobulin (Internal
560 μl of the buffer AVL/carrier RNA followed by vortexing and Control), lower spot: inactivated antigens of C. trachomatis. The
incubation for 15 min at room temperature. 750 μl of absolute developing plate has 6 rows (A-F) of 12 wells, each row containing
ethanol were then added and mixed by pulse-vortex for 20 s. The a reagent solution ready for use at a different step in the assay. The
mixture was then applied to the QIA amp spin column and test was performed stepwise, by moving the comb from row to row,
centrifuged at 8000 rpm for 2 min followed by washing with buffer with incubation at each step. Serum specimens were added to the
AW1 then AW2. DNA adsorbed onto the QIA amp silica gel diluent in the wells of row A of developing plate. The comb was
membrane was eluted by adding 60 μl buffer AVE followed by then inserted in the wells of row A. Anti-C. trachomatis antibodies, if
incubation for 5 min and centrifugation for 5 min at 8000 rpm. The present in the specimens, will specifically bind to the respective
elution step was repeated to increase the yield of DNA. The eluted chlamydial antigens on the lower spot of each tooth of the comb.
solution was stored in aliquots at -20oC untill performance of Simultaneously, immunoglobulins present in the specimens would
amplification. PCR amplification: performed with PCR kit (DiaSorin, be captured by the anti-human immunoglobulin on the upper spot
Italy-UAS). Primers set used : It delineated PCR amplification (Internal Control). Unbound components would be washed away in
product of 207 bp within the cryptic plasmid of C. trachomatis : PC24 row B. In row C, the human IgG captured on the teeth will react with
: 5`GGG ATT CTT GTA ACA ACA AGT CAGG 3` and PC 27 : alkaline phosphatase-labeled anti-human IgG. In the next two rows,
5`CCT CTT CCC CAG AAC AAT AAG AAC AC 3`. The 207 bp unbound components were removed by washing. In row F, the
product obtained with primers PC24 and PC27. bound alkaline phosphatase will react with chromogenic
components. The results were visible as gray-blue spots on the
Reaction mixture: The reaction volume was 100 μl containing 1 × surface of the teeth of the comb. A positive control (anti- C.
PCR buffer, 2.5 mM MgCl2, 0.2 mM each deoxynucleoside trachomatis IgG) and a negative control were included in each
triphosphate, 2.5U Taq DNA polymerase (Promega, Madison WI, assay run. Upon completion of the test, the tooth used with the
USA), 50 P mole of each primer. Ten microliters of extracted DNA positive control should show 2 gray-blue spots. The tooth used with
were added to 100 μl of the PCR mixture in the reaction tube. the negative control should show the upper spot and either no other
Enzymatic amplification was performed using a programmable spot or a faint lower spot. The upper spot should also appear on all
thermal cycler 480 version (Perkin Elmer Ceteus, Norwalk, Conn). other teeth, to confirm the addition of the specimen, proper
Amplification started with an initial denaturation step at 94°C for 5 functioning of the kit and correct performance of the test.
min followed by 35 cycles. Each cycle consisted of denaturation at
94°C for 1 min, annealing at 60°C for 1 min and primer extension at
72°C for 1 min. The reaction was stopped by cooling at 4°C.
Detection of mycoplasmas
Detection of amplification product: Fifteen microliters of the PCR
Conventional Culture for Mycoplasmas
product were electrophoresed through 2% agarose gel containing
ethidium promide (0.5 mg/ml) at constant current 100 volt for 45
Urine sediment was cultured for M.hominis by direct plating on
min. Bands were observed under UVR light and photographed.
enriched heart infusion (HN) mycoplasma agar and indirect
inoculation of HN mycoplasma broth, which were then incubated at
37°C in a candle Jar. It was also cultured for U. urealyticum on U9
Optical immunoassay (Chlamyfast OIA, International Microbio,
broth and A7 agar (Int-mycolpasma-France) and incubated
France) in urine
anaerobically according to El-Mishad et al. (1992). The plates were
then examined under a dissecting microscope for up to 10 days.
Optical immunoassay is a two-step procedure involving antigen
The results have been determined in terms of identification and
extraction and detection. The test surface is a silicon water
quantification of U. urealyticum and M. hominis. For quantification;
reflecting white light into a predominant gold color. The sample was
two different levels have been determined for both U. urealyticum
placed on the test surface. If it contains the antigen, binding would
and M. hominis: a non-pathogenic level which was determined as
occur between the antigen and the water surface and it was then
<104 colour changing units (CCUs)/ml and a pathogenic level which
recognized by the anti-LPS conjugate. After washing to remove
was determined as ≥104 CCU/ml.
unbound components, an optical enhancer was applied to the test
surface. Its precipitation leads to an increased thickness in the
molecular thin film with subsequent change in the color of the Detection and Antibiotic Susceptibility Testing of Urogenital
reflected light from gold to blue/purple. If chlamydial antigen was Mycoplasmas
not present in the sample, there would be no change in color.
The centrifuged pellets were resuspended in sterile saline and then
processed with the following 3 kits:
Enzyme-linked immunosorbent assay for detection of
Chlamydia IgG in serum Mycoplasma DUO (Sanofi, Diagnostics Pasteur, France): The
kit composed of microplates, each of 6 wells containing substrates
Enzyme-linked immunosorbent assay (ELISA) (DRG Diagnostics, and growth factors for mycoplasma to ensure optimal sensitivity,
Germany) was performed and interpreted according to manufac- besides inhibitors for polymorphic flora to ensure optimal selectivity.
turer’s instractions. IgG titer greater than 1:512 was a criterion for It was designed for identification and enumeration of mycoplasmas.
serodiagnosis of acute or current infection. Identification was based on specific metabolic properties; hydrolysis
Badawi et al. 833
of urea by U. urealyticum or arginine by M.hominis which was Table 1. Distribution of 30 patients Group I among different
indicated, after 24 or 48 h of incubation, by a change in colour of complicated clinical condition.
the well containing the relevant substrate without clouding of the
medium. Titration was based on applying successive dilutions of Complicated
the specimens to the lower three wells. The titer was expressed as No. %
Clinical Status*
the number of CCUs/ml specimen. The technique allowed titration
around the level of 103 and 104/ml which were the accepted Cystitis 8 27
pathogenicity levels Prostatitis 15 50
Epididymitis 13 43
Mycoplasma IST (bioMerieux, France): The principle and
Cancer bladder 9 30
components were similar to those of DUO with the addition of
eleven more wells for determining the susceptibility of the strain to Urethra stricture 6 20
six antibiotics including doxycycline, josamycine, ofloxacine, Stone formation 11 37
erythromycine, tetracycline and pristinamycin. Hydronephrosis 4 13
Urinary
Mycokit-NUM (PBS-Orgenics, france): Serial tenfold dilutions 16 53
Bilharzial
were made from the urine and inoculated into the transport
medium; urea broth (U9) for U. urealyticum in the first column and *One patient may have more than one clinical status
into arginine broth (M42) for M. hominis in the second column; in
presence of appropriate PH indicator. After 48 h incubation, the titer
was estimated in CCU/ml as the reciprocal of the highest dilution the controls. Serological evidence was detected in 76%
revealing a colour change.
(13/17) and in 27% (3/11) of positive cases of group I and
group II respectively. C. trachomatis infection was
Serological assessment for mycoplasmas (Mycokit-SERO, significantly higher in group I versus group II (P˂0.05).
PBS-Orgenics, France) Table 2 shows the diagnostic performance of different
tests used for the detection of C. trachomatis infection
For detection of mycoplasmal antibodies; anti-U.urealyticum and among all studied patients using PCR assay (Figure 1) as
anti-M.hominis; in sera. The principle and components of the kit
were similar to those of Mycokit-NUM, except that lyophlized
reference standard. It was noticed that Chlamyfast OIA
U.urealyticum and M.hominis were added to U9 and M42 columns test which detects chlamydial antigen in urine specimens
respectively. After incubation for 48 h at 37°C, growth of was less sensitive but more specific than serological
mycoplasma induced a pH change of the medium, turning its colour assays that detect IgG antibodies in serum.
from yellow to blue. If serum contained specific antibodies, ImmunoComb assay had a higher sensitivity but lower
inhibition of multiplication of mycoplasma would occur preventing specificity than ELISA.
the colour change (metabolic inhibition test). The antibody titer was
the least dilution showing no colour change (remained yellow). In this study, out of 80 urine specimens of infected
groups, a total of 34 cases (42.5%) were positive in a
pathogenic level for U. urealyticum and or M. hominis
Statistical analysis by at least one of the diagnostic procedures used. It was
found that 30% were positive for U. urealyticum only and
The statistical analysis was performed using SPSS version 10.0
7.5% were positive for M. hominis only and 5 % had
statistical software (SPSS Inc, Chicago, IL). Data were presented
as mean ± SD and range or as an absolute number and mixed infection with both organisms. In the control group,
percentage. Sensitivity, specificity and predective values were U. urealyticum and M. hominis were isolated from 5 and
calculated. Chi-square tests were used for the analysis of the 2.5% of normal subjects respectively in a non-pathogenic
categorical variables and Quantitative data with uneven distribution level. The distribution of different types of mycoplasma
were analyzed with the Mann-Whitney U test. P < 0.05 was among the studied groups are shown in Table 3.
considered statistically significant.
Mycoplasmas infection in group I was found to be
significantly higher than in group II (P˂0.05).
The diagnostic value of different identification proce-
RESULTS dures for U. urealyticum and M. hominis among studied
groups were shown in Table 4. It was observed that
Two groups of patients were included in the present Mycoplasma IST has the highest sensitivity (100%) and
study; Group (I): consists of 30 male patients with clinical absolute negative predictive value (NPV) in identification
diagnosis of complicated UTIs. Their ages were ranged of U. urealyticum while both Mycoplasma ISTand
from 29 to 54 years with a mean of 30 ± 9.8 years Mycoplasma DUO showed the highest sensitivity and
(average ± SD) (Table 1). Group (II): consists of 50 absolute NPV in identification of M. hominis.
patients with simple non complicated UTIs. Their ages The serologic reactivity to U. urealyticum and M.
were ranged from 32 to 59 years with a mean of 32 ± 8.7 hominis infection among positive cases was illustrated in
years (average ± SD). Using amplified PCR assay, C. Table 5. Serological evedince was detected in 16/24
trachomatis infection was found in 35% (28/80) of (66.7%), 2/6 (33.3%) and 4/4 (100%) of U. urealyticum,
patients in both groups, 56.7% (17/30) was detected in M. hominis and mixed infections respectively.
group I and 22% (11/50) in group II compared to none of Serologic reactivity to C. trachomatis, U. urealyticum,
Table 2. Diagnostic performance of recent tests used for detection of C. trachomatis among all studied patients
with UTI.
C. trachomatis PCR
Test result On urine sediment Sensitivity Specificity PNV* NPV**
Pos. (No=28) Neg. (No=52)
Chlamyfast OIA
Pos 17 9 61 83 65 80
Neg 11 43
ELISA IgG
Pos 16 11 57 79 59.5 77.4
Neg 12 41
ImmunoComb IgG
Pos 26 14 93 67 61 95
Neg 2 38
*NPV: Negative predictive value. **Positive predictive value.
Figure 1. PCR Results for FVU specimens from male patients with recurrent
urogenital infections. The 207 bp product obtained with primers PC 24 and PC27.
Lane 1: molecular weight marker, Lanes 2-5: amplification products of four
Chlamydia trachomatis positive specimens, Lane 6: a positive control and Lane
7: negative control.
M. hominis among studied groups are shown in Table 6. sexually transmitted pathogens of humans. According to
It was noted that the serological respond to each infection the Centers for Disease Control (CDC), C.
is significantly higher in group I than in group II (P value trachomatis infection is among the most prevalent of all
˂0.05). STDs, and since 1994, has comprised the largest
proportion of all STDs reported to CDC (CDC, 2010).
Since most of infected men and women are
DISCUSSION asymptomatic, this high number of unrecognized infected
individuals may provide the reservoir for spreading the
Chlamydia trachomatis is one of the most common infection to other men and women via sexual intercourse
Badawi et al. 835
Table 3. Distribution of different types of mycoplasmas among disease groups.
M. hominis U. urealyticum Mixed Total

Group isolates
No. % No. % No. % No. %
Group I (No=30) 4 13.3 18 60 2 6.7 24* 80
Group II (No=50) 2 4 6 12 2 4 10 20
Total (No=80) 6 7.5 24 30 4 5 34 42.5
*P value ˂0.05 versus group II.
Table 4. Diagnostic value of different identification for U. urealyticum and M. hominis in disease groups.
Diagnostic performance
Culture system
Sensitivity (%) Specificity (%) PPV (%) NPV (%)
Mycoplasma IST
U. urealyticum 100 89.7 78.6 100
M. hominis 100 98.6 90 100
Mycoplasma DUO
U. urealyticum 90.9 89.7 76.9 96.3
M. hominis 100 97.2 80 100
Mycokit - NUM
U. urealyticum 80 90 72.7 93.1
M. hominis 70 100 100 95.9
Table 5. Serologic Reactivity to U.urealyticum and M.hominis among positive cases using
Mycokit-NUM.
Positive Negative
Positive case
No. % No. %
U. urealyticum (No. = 24) 16 66.7 8 33.3
M. hominis (No = 6) 2 33.3 4 66.7
Mixed infection (No.= 4) 4 100 0 0
Total (No. =34) 22 64.7 12 35.3
(Nassar, 2007). not been adequately studied and the prevalence of C.

Reported rates of chlamydial infection have increased trachomatis, genital ureaplasmas and genital myco-
dramatically over the past decade, reflecting expansion of plasmas has not been determined so infections by these
chlamydial screening activities, highly sensitive nucleic pathogens may be higher than those reported (Gdoura et
acid amplification tests and improvements in information al., 2008; Ghanaat et al., 2008).
systems used for reporting rather than a true increase in In our study C. trachomatis infection was found in 35%
disease burden (Workowski and Berman 2007 ; Geisler, (28/80) of patients in both groups, 56.7% (17/30) was
2010). However, screening and treatment are focused on detected in group I and 22% (11/50) in group II compared
females, with the burden of this infection and infertility to none of the controls. These results were similar to a
sequelae considered to be a predominantly female study done by Vasic et al. (2004) who reported that
problem, although the prevalence of chlamydial infection Chlamydia infection has been determined in 35.55%
is similar in males and females (Cunningham and (128/360) of male patients with urethritis symptoms. Our
Beagley 2008; Fernández-Benítez et al., 2013). Preva- results was comparable to a previous study in Egypt by
lence of C. trachomatis varies according to geographic El Sayed et al. (2006) where C. trachomatis was detected
area, age and status of patients (Ghazvini et al., 2012; in 25 out of 50 (50%) of examined urine samples. In a
Fernández-Benítez et al., 2013). In developing countries, Japanese study, 47.7% (73/153) of FVU specimens in
infections caused by Chlamydia and Mycoplasma have men with urethritis were positive for C. trachomatis
Table 6. Serologic reactivity to C. trachomatis, U. urealyticum, M. hominis among studied groups.
Group I (No. = 30) Group II (No. = 50) Total (No. = 80)

Test result
No. % No. % No. %
C. trachomatis
Positive 18 60 9 18 27 33.8
Negative 12 40 41 82 53 66.2
U. urealyticum
Positive 17 56.7 3 6 20 25
Negative 13 43.3 47 94 60 75
M. hominis
Positive 4 13.3 2 4 6 7.5
Negative 26 86.7 48 96 74 92.5
(Maeda et al., 2004). Wiggins et al. (2006) reported that assist but cannot replace direct antigen detection or
up to 30% of urethritis cases were due to a C. isolation of the organism by the culture technique (Kamel,
trachomatis infection, compared to only 4% in healthy 2013).
control subjects. Mycoplasma pathogens have been discovered in the
C. trachomatis is a frequent pathogen associated with urogenital tract of patients suffering from PID, urethritis
upper and lower urinary tract infections (El-Sayed et al., and other urinary tract diseases (Goulet et al., 1995). M.
2006). Chlamydial infection in the male urethra can be hominis is frequently recovered from the genitourinary
complicated by urethritis, epididymitis and prostatitis tract. In addition, M. hominis causing bacterial vaginosis
(Gdoura et al., 2008), Although the role of Chlamydia in in women, has been proposed as one cause of NGU in
the development of prostatitis is controversial, it is highly men (Workowski and Berman, 2007).
suggested that Chlamydia is considered to be an etio- In our study pathogenic level for U. urealyticum and or
logical agent, with incidences of up to 39.5% reported in M. hominis was found in 42.5% of our patients; 30% were
patients with prostatitis (Cunningham and Beagley, positive for U. urealyticum only and 7.5% were positive
2008). This may explain the higher prevalence of C. for M. hominis only and 5 % had mixed infection with both
trachomatis in the group of complicated UTI, as 50% of organisms. U. urealyticum and M. hominis were isolated
our patients suffer from prostatitis, 43% suffer from in a non-pathogenic level from 5% and 2.5% of normal
epididymitis and 30% had urethral stricture. subjects respectively. Our results were comparable to
In this study, the diagnostic performance of different those in a previous study from Turkey in which U.
tests used for the detection of C. trachomatis infection urealyticum was found in 48% of patients (24/50) with
among all studied patients was compared using PCR as non-gonococcal urethritis. Thirteen (13) of these patients
a reference standard. Chlamyfast OIA test which detects had only U. urealyticum, and the rest had mixed
chlamydial antigen in urine specimens was less sensitive pathogenic organisms; 14% (7/50) U. urealyticum with M.
but more specific than ImmunoComb assay that detect hominis; 6% (3/50) U. urealyticum with C. trachomatis
IgG antibodies in serum. ImmunoComb IgG had a higher and 2% (1/50) U. urealyticum with M. hominis and C.
sensitivity but lower specificity than ELISA IgG. Vasic et trachomatis (Kılıç et al., 2004). Also Takahashi et al.
al. (2004) reported that Chlamyfast OIA test detected (2006) in Japan detected Mycoplasma and Ureaplasma
significant percentage of the Chlamydia infections in in FVU of young men at comparable rates of 4% for M.
patients, which emphasizes the diagnostic importance in hominis and 12% for U. urealyticum. Whereas in Tunisia
diagnosing STIs. Chernesky et al. (1998) concluded that genital M. huminis and genital ureaplasmas affected a
supplemental to the C. trachomatis antigen detection, the large number of infertile male patients, reaching 10.6%
easily performed ImmunoComb IgG is of great value in and 15.4% respectively (Gdoura et al., 2008).
routine diagnosis of genital chlamydial infections. How- Mycoplasma IST and Mycoplasma DUO showed high
ever, Bakardzhie et al (2011) noted a lack of specificity of sensitivity compared to culture as gold standard method
the ImmunoComb IgG compared to PCR. In an Egyptian of detection. This finding was similar to previous studies
study performed by El-Sayed et al. (2006), ELISA IgG which found no difference between Mycoplasma IST and
showed high level of specificity (100%) and low level of culture regarding isolation of Mycoplasma (Kılıç et al.,
sensitivity (40%) when compared to the cell culture 2004) and considered Mycoplasma Duo assay as a
method. As sensitivity of the ELISA test is low, this can simple and a sensitive method comparable to culture and
Badawi et al. 837
PCR for the detection of Ureaplasma spp. (Cheah et al., Serology diagnose upper genital tract Chlamydia trachomatis
infection? Studies on women with pelvic pain, with or without
2005; Ekiel et al., 2009). Biernat-Sudolska et al. (2013) chlamydial plasmid dna in endometrial biopsy tissue. Sex. Transm.
reported that the sensitivity and specificity of the Dis. 25(1):14-19.
Mycoplasma IST test when compared to the culture Clegg A, Passey M, Yoannes M, Michael A (1997). High rates of genital
method as a “gold standard” were determined as 91 and mycoplasma infection in the highlands of Papua New Guinea
96%, respectively, while the positive and negative determined both by culture and by a commercial detection kit. J. Clin.
Microbiol. 35:197-200.
predictive value of the commercial test was 27 and 99%, Cunningham KA, Beagley KW (2008). Male genital tract chlamydial
respectively for detection of M. hominis in clinical infection: Implications for pathology and infertility. Biol. Reprod.
samples. Clegg et al. (1997) demonstrated sensitivity of 79(2):180-189.
Dean D, Turingan RS, Thomann H-U, Zolotova A, Rothschild J, Joseph
93% and specificity of 87% of Mycoplasma IST kit
SJ, Read TD, Tan E, Selden RF (2012). A multiplexed microfluidic
compared to the culture of M. hominis. These findings PCR assay for sensitive and specific point-of-care detection of
make the current tests suitable for use in diagnostic Chlamydia trachomatis. PLoS ONE 7(12): e51685. doi:10.1371/
laboratories that do not currently test for Ureaplasma spp. journal.pone.0051685.
or Mycoplasma. Ekiel AM, Friedek DA, Romanik MK, Jozwiak J, Martirosian G (2009).
Occurrence of Ureaplasma parvum and Ureaplasma urealyticum in
It is interesting that 53% of our patients were suffering women with cervical dysplasia in Katowice, Poland. J. Korean Med.
from urinary bilharziasis. This coexistence between Sci. 24(6):1177-1181.
urogenital schistosomiasis and sexually transmitted El-Mishad AM, Mokhtar S, Adu Aitta AM, Ahmed A (1992). Ocurrence of
infection including Chlamydia trachomatis and U. urealyticum, M. hominis and anaerobic bacteria in urine of patients
with UTI and haematobiasis. Med. J. Cairo Univ. 60(1):167-176.
Mycoplasma genitalium has been previously reported in El-Sayed M, Badwy W, Bakr A (2006). Rapid hybridization probe assay
the area of Madagascar, where Schistosoma and PCR for detection of Chlamydia trachomatis in urinary tract
haematobium is endemic. Authors in that study sug- infections: a prospective study, Curr. Microbiol., 53(5):379-383.
Fernández-Benítez C, Mejuto-López P, Otero-Guerra L, Margolles-
gested that similar situation can be anticipated in most
Martins MJ, Suárez-Leiva P, Vazquez F, Chlamydial Primary Care
other schistosoma-endemic areas in sub-Saharan Africa Group (2013). Prevalence of genital Chlamydia trachomatis infection
presenting the two disease entities as a diagnostic among young men and women in Spain. BMC Infect. Dis. 13:388.
challenge for the local health care providers in these Gaydos CA, Theodore M, Dalesio N, Wood BJ, Quinn TC (2004).
areas (Leutscher et al., 2008). Comparison of three nucleic acid amplification tests for detection of
Chlamydia trachomatis in urine specimens. J. Clin. Microbiol.
42(7):3041-3045.
Conclusion Gdoura R, Kchaou W, Chaari C, Znazen A, Keskes L, Rebai T,
Hammami A (2008). Assessment of Chlamydia trachomatis,
Ureaplasma urealyticum, Ureaplasma parvum, Mycoplasma hominis,
Our study detects a high prevalence rate of C. and Mycoplasma genitalium in semen and first void urine specimens
trachomatis, M. hominis and U. urealyticum in cases with of asymptomatic male partners of infertile couples. J. Androl.
complicated UTI. Patients with urinary symptoms should 29(2):198-206.
Geisler WM (2010). Duration of untreated, uncomplicated Chlamydia
be evaluated for three pathogens as common causes of
trachomatis genital infection and factors associated with chlamydia
NGU. Commercially available kits are simple and resolution: a review of human studies. J. Infect. Dis. 201(2):S104-
sensitive methods to use in laboratories which do not 113.
routinely test for these pathogens. The association Ghanaat J, Afshari JT, Ghazvini K, Malvandi M (2008). Prevalence of
between STD and S. haematobium requires further genital chlamydia in Iranian males with urethritis attending clinics in
Mashhad. Eastern Mediterranean Health J. 14(6):1333-1337.
studies. Ghazvini K, Ahmadnia H, Ghanaat J (2012). Frequency of Chlamydia
trachomatis among male patients with urethritis in northeast of iran
detected by polymerase chain reaction. Saudi J. Kidney Dis. Transpl.
REFERENCES 23(2):316-320.
González-Pedraza A, Ortiz C, Mota R, Dávila R, Dickinson E (2003).
Al-Sweih NA, Al-Fadli AH, Omu AE, Rotimi VO (2012). Prevalence of Role of bacteria associated with sexually transmitted infections in the
Chlamydia trachomatis, Mycoplasma hominis, Mycoplasma etiology of lower urinary tract infection in primary care. Enferm Infecc.
genitalium, and Ureaplasma urealyticum infections and seminal Microbiol. Clin. 21(2):89-92.
quality in infertile and fertile men in Kuwait. J. Androl. 33(6):1323- Goulet M, Dular R, Tully JG, Billowes G, Kasatiya S (1995). Isolation of
1329. Mycoplasma pneumoniae from the human urogenital tract. J Clin
Bakardzhie I, Pehlivanov G, Kovachev E (2011). Correlations between Microbiol, 33(11):2823-2825.
Contemporary Methods in the Diagnosis of Chlamydia Trachomatis Hopfe M, Deenen R, Degrandi D, Ko¨hrer K, Henrich B (2013). Host
urogenital infections. J. IMAB 17(1):158-160. /DOI: Cell Responses to Persistent Mycoplasmas - Different Stages in
10.5272/jimab.2011171.158 Infection of HeLa Cells with Mycoplasma hominis. PLoS ONE 8(1):
Biernat-Sudolska M, Rojek-Zakrzewska D, Zawilińska B, Magdalena K- e54219. doi:10.1371/journal.pone. 0054219.
V (2013). The need to verify of positive Mycoplasma hominis results Kamel RM (2013). Screening for Chlamydia trachomatis infection
obtained using the Mycoplasma IST2 tests. J of Lab Diag, 49 (1):5-8. among infertile women in Saudi Arabia. Int J Women’s Health, 5:
Centers for Disease Control (CDC) (2010). Sexually transmitted 277-284.
diseases surveillance, 2010. Kılıç D, Basar MM, kaygusuz S,Yilmaz E, Basar H, Batislam E (2004).
Cheah F-C, Anderson TP, Darlow BA, Murdoch DR (2005). Comparison Prevelance and treatment of chlamydia trachomatis, Ureaplasma
of the mycoplasma duo test with PCR for detection of Ureaplasma urealyticum and Mycoplasma hominis in patients with non-
species in endotracheal aspirates from premature infants. J Clin gonococcal urethritis. Jpn. J. Infect Dis. (8):17-20.
Microbiol, 43(1):509. DOI: 10.1128/JCM.43.1.509-510.2005. Lee Y-S, Lee K-S (2013). Chlamydia and Male Lower Urinary Tract
Chernesky M, Luinstra K, Sellors J, Schachter J, Moncada J, Caul O, Diseases. Korean J. Urol. 54:73-77.
Paul I, Mikaelian L, Toye B, Paavonen J, Mahony J (1998). Can Leutscher PDC, Ramarokoto C-E, Hoffmann S, Jensen JS, Ramaniraka
V, Randrianasolo B, Raharisolo C, Migliani, R, Christensen N Van der Helm JJ, Bom RJM, Gru¨nberg AW, Bruisten SM, Schim van
(2008).Coexistence of urogenital schistosomiasis and sexually der Loeff MF, Sabajo LOA, de Vries HJC (2013). Urogenital
transmitted infection in women and men living in an area where Chlamydia trachomatis Infections among Ethnic Groups in
Schistosoma haematobium is endemic. Clin. Infect. Dis. 47(6):775. Paramaribo, Suriname; Determinants and Ethnic Sexual Mixing
Maeda S-I, Deguchi T, Ishiko H, Matsumoto T, Naito S, Kumon H, Patterns. PLoS ONE 8(7): e68698. doi:10.1371/
Tsukamoto T, Onodera S, Kamidono S (2004). Detection of journal.pone.0068698
Mycoplasma genitalium, Mycoplasma hominis, Ureaplasma parvum Vasic A, Tasic NM, Zdravkovic D, Tasic S (2004). Chlamyfast-OIA test
(biovar 1) and Ureaplasma urealyticum (biovar 2) in patients with in the genital chlamydia male infection diagnosis. Acta Medica
non-gonococcal urethritis using polymerase chain reaction-microtiter Medianae 43:33-36.
plate hybridization. Int. J. Urol. 11(9):750-754. Vicetti Miguel RD, Harvey SAK, LaFramboise WA, Reighard SD,
Mangin D, Murdoch D, Wells JE, Coughlan E, Bagshaw S, Corwin P, Matthews DB, Cherpes TL (2013). Human Female Genital Tract
Chambers S, Toop L (2012). Chlamydia trachomatis testing Infection by the Obligate. Intracellular bacterium Chlamydia
sensitivity in midstream compared with first-void urine specimens. trachomatis elicits robust type 2 immunity. PLoS ONE 8(3): e58565.
Ann. Fam. Med. 10:50-53. doi:10.1370/afm.1323. doi:10.1371/journal.pone.0058565.
Marrazo J, Stamm WE (1998). New approaches of chlamydial infection. Wanic-Kossowska M, Kozioł L, Bajew L, Czekalski S (2001). Acute and
Curr. Top Clin. Infect. Dis.18:37-59. chronic urinary tract infections caused by Chlamydia trachomatis. Int.
Nassar F (2007). Chlamydia trachomatis, Mycoplasma hominis, Urol. Nephrol. 32(3):437-438.
Mycoplasma genitalium, and Ureaplasma urealyticum in Patients with Wiggins RC, Holmes CH, Andersson M, Ibrahim F, Low N, Horner PJ
Sterile Pyuria in Gaza-Palestine. Master thesis in Microbiology, (2006). Quantifying leukocytes in first catch urine provides new
Biological Sciences, Faculty of Science, The islamic University-Gaza. insights into our understanding of symptomatic and asymptomatic
Paavonen J, Eggert-Kruse W (1999). Chlamydia trachomatis: impact on urethritis. Int. J. STD AIDS 17(5):289-295.
human reproduction. Hum. Reprod. Update 5(5):433-447. Workowski KA, Berman SM (2007). Centers for Disease Control and
Sethi S, Singh G, Samanta P, Sharma M (2012). Mycoplasma Prevention sexually transmitted diseases treatment guidelines. Clin.
genitalium: An emerging sexually transmitted pathogen. Indian J. Infect. Dis. 44 (3):S73-76.
Med. Res. 136(6):942-955. World Health Organization (WHO) (2001). Global prevalence and
Takahashi S, Takeyama K, Miyamoto S, Ichihara K, Maeda T, incidence of selected curable sexually transmitted infections.
Kunishima Y, Matsukawa M, Tsukamoto T (2006). Detection of overviews and estimates. Geneva, Switzerland: WHO.
Mycoplasma genitalium, Mycoplasma hominis, Ureaplasma Yoshida T, Maeda S, Deguchi T, Ishiko H (2002). Phylogeny-based
urealyticum, and Ureaplasma parvum DNAs in urine from rapid identification of mycoplasmas and ureaplasmas from urethritis
asymptomatic healthy young Japanese men. J. Infect. Chemother. patients. J. Clin. Microbiol. 40(1):105-110.
12(5): 269-271.
UPCOMING CONFERENCES
7th Asia-Pacific Organization for Cell Biology Congress, Biopolis, Singapore, 24

February 2014
18th Annual International Conference on Research in Computational Molecular

Biology Pittsburgh, Pennsylvania April 2-5, 2014
Conferences and Advert
February 2014
7th Asia-Pacific Organization for Cell Biology Congress, Biopolis, Singapore, 24
February 2014
March 2014
VIII International Symposium on Antimicrobial Resistance, Cartegena, Colombia,
March 5- 7, 2014
April 2014
Annual Meeting of the Association of Medical Microbiology and Infectious Disease
Canada, Victoria, Canada, April 2-5, 2014
18th Annual International Conference on Research in Computational Molecular

Biology Pittsburgh, Pennsylvania April 2-5, 2014
African Journal of
Microbiology Research
Related Journals Published by Academic Journals
African Journal of Biotechnology

African Journal of Biochemistry Research
Journal of Bacteriology Research
Journal of Evolutionary Biology Research
Journal of Yeast and Fungal Research
Journal of Brewing and Distilling

African Journal of Microbiology

Uploaded by

Copyright:

Available Formats

African Journal of Microbiology

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

African Journal of Microbiology

Uploaded by

Copyright:

Available Formats

African Journal of

Click here to Submit manuscripts online

With questions or concerns, please contact the Editorial Office at [email protected].

Prof. Fukai Bao

Dr. Aly E Abo-Amer Dr. T. Ramesh

Dr. Pagano Marcela Claudia

Dr. R. Balaji Raja M.Tech (Ph.D) Dr. Alfredo J. Anceno

Dr. Okonko, Iheanyi Omezuruike Dr. Anderson de Souza Sant’Ana

Dr. Mustafa Maroufpor

Dr. Adriano Cruz Dr. How-Yee Lai

Dr. Dilshad Ahmad Dr. Jean-Marc Chobert

Dr. Adriano Gomes da Cruz Dr. Zhilong Yang, PhD

Dr. Fereshteh Naderi Dr. Li Sun

Dr. Xinan Jiao Dr. Kanzaki, L I B

Dr. Endang Sri Lestari, MD. Prof. Philippe Dorchies

Prof. Natasha Potgieter Dr. Ary Fernandes Junior

Dr. Alemzadeh Dr. Papaevangelou Vassiliki

Dr. Sonia Arriaga Dr. Fangyou Yu

Dr. Armando Gonzalez-Sanchez Dr. Galba Maria de Campos Takaki

Prof. Dr. Liesel Brenda Gende Dr. Ajith, T. A

Dr. Adeshina Gbonjubola Dr. Feng-Chia Hsieh

Dr. Xiao-Qing Hu Dr. Julia Inés Fariña

Dr. Nicola S. Flanagan Dr. Pankaj Kumar Mishra

Dr. Chung-Ming Chen Dr. Renata Vadkertiova

Dr. Hare Krishna Dr. Hongxiong Guo

Dr. Anna Mensuali Dr. Mar Rodriguez Jovita

Review Process The Introduction should provide a clear statement of the

Abayomi (2000), Agindotan et al. (2003), (Kelebeni,

Copyright: © 2014, Academic Journals.

Table of Content: Volume 8 Number 8, February 19, 2014

Screening phosphate solubilizing actinobacteria isolated from the rhizosphere of

Nutritional requirements for the production of antimicrobial metabolites from

Incidence of Aspergillus contamination of groundnut (Arachis hypogaea L.) in

Microencapsulation, survival and adherence studies of indigenous probiotics

Screening novel diagnostic marker of Mycobacterium tuberculosis

An outbreak of ringworm caused by Trichophyton verrucosum in a group of

Table of Content: Volume 8 Number 8, February 19, 2014

Microbiological assessment of dentists’ hands in clinical performance

Evaluation of marine macro alga, Ulva fasciata against bio-luminescent causing

Characterization and determination of antibiotic susceptibility pattern of bacteria

Prevalence of different enterococcal species isolated from blood and their

Prevalence of anti-Anaplasma phagocytophilum antibodies among dogs from

Full Length Research Paper

Morphological and molecular characterization of

*Corresponding author. E-mail: [email protected]. Tel: 52 7353942020.

[DNA] = Oil (%) = (P-p/M) × 100

Pathogenicity tests Molecular characterization

Oval with one septa

Oval Single and paired

White and Oval with one septa

Oval Single verrucose

Oval Single verrucose Fusarium spp.

White and Globose oval Chains 2,3 and 4

T9 White Orange Fusarium solani Fusarium solani 538 99 EU982942.1

T12 White Brown Fusarium solani Fusarium solani 539 86 EU625405.1

T34 White Cream Fusarium spp No identified 433

T40 Cream Yellow Fusarium spp Fusarium solani 557 99 EU625405.1

Table 3. Effect of J. curcas oil on mycelial growth of isolates of Fusarium spp.

Full Length Research Paper

Screening phosphate solubilizing actinobacteria